WO2022108309A1 - 인산화된 비멘틴의 과도한 생성을 차단하여 암을 예방 또는 치료하는 방법 - Google Patents

인산화된 비멘틴의 과도한 생성을 차단하여 암을 예방 또는 치료하는 방법 Download PDF

Info

Publication number
WO2022108309A1
WO2022108309A1 PCT/KR2021/016817 KR2021016817W WO2022108309A1 WO 2022108309 A1 WO2022108309 A1 WO 2022108309A1 KR 2021016817 W KR2021016817 W KR 2021016817W WO 2022108309 A1 WO2022108309 A1 WO 2022108309A1
Authority
WO
WIPO (PCT)
Prior art keywords
vimentin
cancer
expression
cells
shrna
Prior art date
Application number
PCT/KR2021/016817
Other languages
English (en)
French (fr)
Inventor
임형신
장해란
Original Assignee
한양대학교 에리카산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020200154791A external-priority patent/KR102511660B1/ko
Priority claimed from KR1020200164854A external-priority patent/KR20220076068A/ko
Application filed by 한양대학교 에리카산학협력단 filed Critical 한양대학교 에리카산학협력단
Publication of WO2022108309A1 publication Critical patent/WO2022108309A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors

Definitions

  • the present invention confirmed the overexpression of vimentin in cancer cells, and confirmed that tumor formation and cancer metastasis were induced through vimentin phosphorylation by PLK1.
  • two methods for reducing the frequency of interaction between PLK1 and vimentin are proposed, and their applications are provided.
  • the present invention provides a method for reducing the interaction between wild-type non-mentin and PLK1 by providing a non-mentin mutant in which a region phosphorylated by PLK1 is mutated while maintaining binding to PLK1.
  • the present invention provides a method for ultimately suppressing the production of over-phosphorylated vimentin by suppressing the expression of vimentin, which is over-expressed in cancer cells, using shRNA targeting vimentin.
  • Vimentin is an intermediate filament protein mainly expressed in mesenchymal cells, and plays a role in maintaining cellular homeostasis by forming a cytoskeletal network together with microtubules and microfilaments (Goldman, R.D. et al., J Cell Biol 134 (1996) 971). -983). In particular, it is known as an important regulator of cell mobility and invasiveness in the epithelial-mesenchymal transition (EMT) process (Eckes, B. et al., J Cell Sci 111 (Pt 13) (1998) 1897-1907; Liu, C.Y. et al., Oncotarget 6 (2015) 15966-15983).
  • EMT epithelial-mesenchymal transition
  • vimentin is overexpressed in breast cancer, lung cancer, gastric cancer and many other solid cancers, and it has been reported that the higher the malignant stage of cancer, the higher the expression of vimentin (Yamashita, N. et al., J Cancer Res Clin Oncol 139). (2013) 739-746; Ye, Z. et al., PLoS One 11 (2016) e0163162; Yin, S. et al., Pathol Res Pract 214 (2016) 1376-1380).
  • vimentin is involved in cytoskeletal reorganization during epithelial mesenchymal transition, which is known to promote cancer cell mobility and invasiveness by regulating signaling related to epithelial mesenchymal transition.
  • vimentin is known as a marker for epithelial-mesenchymal transition (EMT), its role in mediating this process is not precisely known.
  • Polo-like kinase 1 has recently been studied as a target molecule that causes cancer and metastasis.
  • PLK1 structurally has an enzymatic domain with kinase activity and a polobox domain that binds to a substrate, and phosphorylation at the T210 position induces activation of PLK1.
  • the phosphorylation enzyme of PLK1 activated by binding to the polobox domain of the substrate is an enzyme that induces phosphorylation at the Ser/Thr residue of the substrate (Barr et al., Nat Rev Mol Cell Biol 5 (2004) 429-440).
  • anticancer drugs that target the regulation of the function of PLK1 phosphorylation substrates are expected to be effective in treating not only primary cancer but also metastatic cancer.
  • cancer metastasis is a phenomenon that appears as a result of cancer progression, even if the primary cancer is substantially removed or treated, if metastasis cannot be prevented, the survival rate is very low due to cancer recurrence or the like. Since metastatic cancer accounts for 90% of all cancer deaths, the risk can be assessed (Valastyan, S. and Weinberg, R.A., Cell 147 (2011) 275-292; Khan, I. and Steeg, P.S., Lab Invest 98) (2018) 198-210). It is considered that the larger the size of the cancer, the higher the rate of metastasis to the surrounding lymph nodes and other tissues. not (Valastyan, S.
  • the present invention relates to the cancer cell killing effect of a point mutated vimentin protein, and to the use of an inhibitor of the mobility and invasiveness of metastatic cancer cells. In addition, it relates to use as an apoptosis inducer using the action of sensitively inducing apoptosis in metastatic cancer cells as well as in general solid cancer.
  • the present invention can be usefully used to treat various solid cancers and metastatic cancers.
  • the technical problem to be achieved by the present invention is to provide a non-mentin mutant in which the 327 or 339 amino acid is substituted and a vector expressing the same.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer comprising the mutant or vector as an active ingredient.
  • an object of the present invention is to provide an shRNA effective for suppressing non-mentin protein expression for use in the prevention or treatment of cancer.
  • the present invention provides a non-phosphorylated point mutant comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • the non-mentin non-phosphorylated point mutant is a non-mentin protein in which threonine, the 327th amino acid, is glycine (Glycine, Gly), alanine (Alanine, Ala), valine (Valine, Val) , Leucine (Leu), isoleucine (Isoleucine, Ile), proline (Proline, Pro), phenylalanine (Phenylalanine, Phe), methionine (Methionine, Met) or tryptophan (Tryptophan, Trp) substituted with (SEQ ID NO: 1) may be, and preferably may be one substituted with alanine.
  • serine which is the 339th amino acid in the non-mentin protein
  • glycine alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine or tryptophan (SEQ ID NO: 2), preferably substituted with alanine.
  • the present invention provides a recombinant vector comprising a gene encoding the non-mentin mutant.
  • the gene encoding the non-mentin mutant may include or consist of the base sequence of SEQ ID NO: 3 or SEQ ID NO: 4.
  • the recombinant vector may be a viral vector, preferably a lentiviral vector.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer comprising the non-mentin mutant or recombinant vector.
  • the present invention provides a pharmaceutical composition for inhibiting cancer metastasis comprising the non-mentin mutant or recombinant vector.
  • the composition may inhibit cancer metastasis by reducing the mobility and invasiveness of cancer cells.
  • the present invention provides a method for preventing or treating cancer comprising administering the non-mentin mutant or recombinant vector to an individual.
  • the present invention provides the use of the non-mentin mutant or recombinant vector for the manufacture of a medicament for the prevention or treatment of cancer.
  • the present invention provides a shRNA (short hairpin RNA) for suppressing the expression of vimentin (Vimentin).
  • the shRNA for inhibiting non-mentin expression of the present invention may include or consist of any one of the nucleotide sequences of SEQ ID NOs: 11 to 13, but preferably include or consist of the nucleotide sequence of SEQ ID NO: 11.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer comprising the shRNA as an active ingredient.
  • the composition may inhibit tumorigenicity.
  • the composition can inhibit cancer metastasis by reducing the mobility and invasiveness of cancer cells. That is, the composition of the present invention may be provided for use for the prevention of metastatic cancer.
  • the composition may further include a vimentin mutant comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 described above.
  • the present invention provides a pharmaceutical composition for inhibiting cancer metastasis comprising the shRNA.
  • the present invention provides a method for preventing or treating cancer comprising administering the shRNA to a subject.
  • the present invention provides the use of the shRNA for the manufacture of a medicament for the prevention or treatment of cancer.
  • the cancer may be a solid cancer
  • the solid cancer may be a non-small cell lung cancer
  • the non-small cell lung cancer may be an adenocarcinoma
  • the subject may be a human in need of prevention or treatment of cancer, a patient who has already developed cancer and is undergoing treatment, or a patient for preventing metastasis after cancer has been cured.
  • the non-mentin mutant of the present invention is capable of inhibiting tumor formation and cancer metastasis by binding to PLK1 overexpressed competitively with wild-type vimentin in cancer cells, as the non-mentin mutant of the present invention maintains the binding ability with PLK1, and the mutant Provision of an expressing vector can inhibit the migration and invasiveness of cancer and inhibit the formation of tumors.
  • the non-phosphorylated point mutant of the present invention is safe because it does not affect the intrinsic function of non-mentin in normal cells, and is useful in treating various diseases caused by abnormal cell growth, particularly degenerative diseases such as primary and metastatic solid cancer and leukemia. can be used
  • the vimentin shRNA and/or vimentin mutant of the present invention has a strong inhibitory effect on metastatic, invasive and selective tumorigenesis of cancer cells, and various diseases caused by abnormal cell growth, especially primary and metastatic solid cancer and leukemia, etc. It is expected to be usefully used in the treatment of such degenerative diseases.
  • 1A to 1H are results of analyzing the clinical association between vimentin and active PLK1 in metastatic lung cancer cells.
  • Figure 1a It is a graph analyzing the related pathways of invasive cells expressing active PLK1 in the cancer metastasis condition of lung cancer cell A549 through KEGG 2019 pathway analysis.
  • Figure 1b A schematic diagram showing the relationship between genes expressed in invasive cells expressing active PLK1 and ECM-related genes in cancer metastasis conditions of lung cancer cell A549 through GeneMANIA database analysis.
  • 1d It is a graph analyzing the survival rate of lung cancer patients according to the lung cancer progression stage according to the PLK1 and vimentin expression through KM PLOTTER analysis.
  • Figure 1e A graph showing the expression of epithelial-mesenchymal transition markers through heatmap analysis in various types of lung cancer cells treated with TGF- ⁇ to induce cancer metastasis.
  • 1f A graph showing the mRNA expression of vimentin, active PLK1, and epithelial-mesenchymal transition markers in lung cancer cells A549 and NCI-H460 treated with TGF- ⁇ using real-time PCR.
  • Figure 1g The results of observation of the protein expression of vimentin, active PLK1 and epithelial-mesenchymal transition markers in lung cancer cells A549 and NCI-H460 treated with TGF- ⁇ by immunoblot method.
  • Figure 1h A graph showing the protein expression of vimentin and active PLK1 of G.
  • 2A to 2G are results of analysis of phosphorylation and phosphorylation sites of vimentin by PLK1 activated type.
  • FIG. 2a A549 cells were treated with 2.5 ng/ml TGF- ⁇ by immunoprecipitation using the PLK1 antibody to observe the interaction between vimentin and PLK1.
  • Figure 2b It is the result of observing the interaction between vimentin and PLK1 by immunoprecipitation using the PLK1 antibody under the condition that NCI-H460 cells were treated with 2.5 ng/ml TGF- ⁇ .
  • Figure 2c It is the result of observing that the active-type PLK1 phosphorylates vimentin by performing a phosphorylation reaction method together with active-type PLK1 (PLK1 TD) using GST-labeled vimentin.
  • Figure 2d A result of confirming a possible candidate site for phosphorylation of vimentin phosphorylated by PLK1 through liquid chromatography quality analysis.
  • Figure 2e A result of performing a phosphorylation enzyme reaction method using a non-phosphorylated point mutant protein in which the phosphorylation candidate site of vimentin is substituted with alanine using a partial-specific mutagenesis method and active PLK1.
  • Figure 2f A549 cells were treated with 2.5 ng/ml TGF- ⁇ , and then the phosphorylation of vimentin and PLK1 was observed to decrease by phosphatase (CIP) treatment.
  • CIP phosphatase
  • Figure 2g After treating NCI-H460 cells with 2.5 ng/ml TGF- ⁇ , the decrease in vimentin and PLK1 phosphorylation was observed by phosphatase (CIP) treatment.
  • CIP phosphatase
  • 3a to 3f are experiments measuring the effect of overexpression of phosphorylated and non-phosphorylated point mutants of vimentim on the mobility and invasiveness of cancer cells in lung cancer cells NCI-H460.
  • Figure 3a After expressing vimentin phosphorylated and non-phosphorylated point mutants in lung cancer cells NCI-H460, the presence or absence of vimentin protein overexpression and changes in the mesenchymal transition marker (N-cadherin) were observed by immunoblot.
  • Figure 3b After expressing vimentin phosphorylated and non-phosphorylated point mutants in lung cancer cells NCI-H460, vimentin mRNA overexpression and mesenchymal transition marker (N-cadherin) mRNA changes were observed through a chain reaction (real-time PCR). It is the result.
  • Figure 3c After expressing vimentin phosphorylated and non-phosphorylated point mutants in lung cancer cells NCI-H460, the cell proliferation degree of cells expressing each point mutant was observed over time.
  • FIG. 3d Vimentin phosphorylated and non-phosphorylated lung cancer cells expressing the non-phosphorylated point mutants NCI-H460 using an insert (migration assay) using a mobility test (migration assay) is the result of observing the cell mobility pattern under a microscope.
  • FIG. 3e It is a graph showing the pattern of cancer cell mobility using an Odyssey infrared imaging system analyzer for the intensity of crystal violet-stained cancer cells that have migrated inserts in a migration assay using inserts.
  • Figure 3f Vimentin phosphorylation and non-phosphorylation point mutant expression in lung cancer cells NCI-H460 using matrigel and insert (migration assay) using the invasiveness test (migration assay) the result of observing the invasiveness of the cells.
  • 4A to 4H are experiments measuring metastatic and tumorigenicity of cancer cells overexpressing phosphorylated and non-phosphorylated point mutants of vimentim in an animal model.
  • Figure 4a Vimentin phosphorylated and non-phosphorylated point mutants expressed lung cancer cells when intravenously injected, the results of observing the metastatic cancer-generating and inhibitory effect in the lungs of mice.
  • Figure 4b It is a graph showing the frequency of metastatic cancer generation in each experimental group numerically about the effect of intravenous injection of lung cancer cells expressing Vimentin phosphorylation and non-phosphorylation point mutants on metastatic cancer generation and inhibitory effects in mice.
  • FIG. 4c Vimentin phosphorylated and non-phosphorylated is a graph showing the survival rate of each experimental group when the lung cancer cells expressing point mutants when injected intravenously.
  • Figure 4d When lung cancer cells expressing Vimentin phosphorylated and non-phosphorylated point mutants were intravenously injected, the cancer tissue metastasized to the mouse lung was stained with H&E and Ki-67 to observe the cancer-generating and inhibitory effects of each experimental group. is a result
  • Figure 4e H&E staining of the cancer tissue produced by metastasis to the lung of the mouse to quantify the cancer-generating and inhibitory effects of each experimental group, and is a graph showing the results.
  • Figure 4f The cancer tissue produced by metastasis to the lungs of the mouse was stained with Ki-67 to quantify the cancer-generating and inhibitory effects of each experimental group and show the results in a graph.
  • Figure 4g When lung cancer cells expressing Vimentin phosphorylated and non-phosphorylated point mutants were intravenously injected, lung tissue obtained from mice was crushed to observe changes in epithelial-mesenchymal transition protein markers and immune avoidance factor proteins.
  • Figure 4h When lung cancer cells expressing Vimentin phosphorylated and non-phosphorylated point mutants were intravenously injected, lung tissue obtained from mice was crushed to quantify the change in the expression of PD-L1, an immunity factor protein, for each experimental group. It is a graph showing .
  • Figures 5a and 5b is the result of observing the vimentin expression inhibitory effect when treated with each vimentin shRNA prepared to suppress vimentin mRNA expression in lung cancer cells.
  • Figure 5a Results showing the degree of inhibition of vimentin expression by each vimentin shRNA treatment in lung cancer cells NCI-H460 as a protein expression pattern.
  • Figure 5b It is a graph showing the mRNA expression pattern of the vimentin expression inhibition by each vimentin shRNA treatment in lung cancer cells NCI-H460.
  • 6A to 6J are results of observation of changes in epithelial hepatitis transition markers and immune avoidance factors, and changes in cancer mobility and invasiveness when treated with vimentin shRNA, a substance that inhibits vimentin mRNA expression, in lung cancer cells.
  • Figure 6a Epithelial mesenchymal transition markers (N-cadherin, E-cadherin) and immune avoidance factors (PD-L1) in cancer cell metastasis environment in which vimentin expression inhibition is induced by TGF- ⁇ treatment by vimentin shRNA treatment in lung cancer cells NCI-H460 ) is a result showing the protein expression pattern of
  • Figure 6b Epithelial mesenchymal transition markers (N-cadherin, E-cadherin) and immune avoidance factors (PD-L1) in cancer cell metastasis environment induced by TGF- ⁇ treatment in which vimentin expression inhibition by vimentin shRNA treatment in lung cancer cells NCI-H460 ) is a graph showing the mRNA expression pattern.
  • Figure 6c Epithelial mesenchymal transition markers (N-cadherin, E-cadherin) and immune avoidance factor (PD-L1) in cancer cell metastasis environment in which vimentin expression inhibition is induced by TGF- ⁇ treatment by vimentin shRNA treatment in lung cancer cells
  • P-L1 immune avoidance factor
  • Figure 6d Epithelial mesenchymal transition markers (N-cadherin, E-cadherin) and immune avoidance factor (PD-L1) in cancer cell metastasis environment in which vimentin expression inhibition is induced by TGF- ⁇ treatment by vimentin shRNA treatment in lung cancer cells
  • P-L1 immune avoidance factor
  • Figure 6e When vimentin expression inhibition is induced by TGF- ⁇ treatment in lung cancer cells NCI-H460 with vimentin shRNA treatment, the control group is 0% for the relative distance of cells after 72 hours in vimentin shRNA treatment. It is a graph that converts the mobility of cancer cells into relative percentages.
  • Fig. 6f Results showing a decrease in cancer cell invasiveness induced by TGF- ⁇ treatment of vimentin expression inhibition by vimentin shRNA treatment in lung cancer cells NCI-H460.
  • 6g Results showing the tumorigenicity inhibition pattern of cancer cells induced by TGF- ⁇ treatment in which vimentin expression inhibition by vimentin shRNA treatment in lung cancer cells NCI-H460.
  • Figure 6h After suppression of vimentin expression by vimentin shRNA treatment in lung cancer cells NCI-H460, vimentin original (WT), phosphorylated (S339E) and non-phosphorylated (S339A) point mutants were overexpressed by immunoblot observation. to be.
  • Figure 6i The effect of overexpression of the original (WT), phosphorylated (S339E) and non-phosphorylated (S339A) point mutants of vimentin on the mobility of cancer cells under vimentin expression suppression conditions by vimentin shRNA treatment in lung cancer cells NCI-H460 is the result of observation.
  • Figure 6j The effect of overexpression of the original (WT), phosphorylated (S339E) and non-phosphorylated (S339A) point mutants of vimentin on the invasiveness of cancer cells under vimentin expression suppression conditions by vimentin shRNA treatment in lung cancer cells NCI-H460 is the result of observation.
  • the present inventors confirmed that phosphorylation of vimentin by PLK1 contributes to cancer metastasis while studying PLK1 (Polo-like kinase 1), and mutated it by searching the phosphorylation region of vimentin by PLK1 As a result of inducing , it was confirmed that cancer mobility and invasiveness were significantly reduced, and when vimentin expression was knocked down, it was confirmed that cancer mobility and invasiveness were significantly reduced, thereby completing the present invention.
  • PLK1 is known to be overexpressed in cancer cells as a proto-oncogene, and research on the PLK1 molecule as a target for cancer treatment is being actively conducted.
  • PLK1 is a kinase involved in various signal transduction systems such as the cell cycle, inhibition of PLK1 is difficult to rule out the possibility of other actions other than the effect of inhibiting tumor growth. There is a problem that the original function is not smoothly performed.
  • Phosphorylation of PLK1 has been reported at the serin (S) site at positions 83 and 459 of vimentin (Eriksson, J.E. et al., Cancer Res 67 (2007) 11106-11110; Keisuke Ikawa et al., Cell cycle 13 (2014) 126-137), studies on whether point mutants at these sites block metastatic, invasive, or tumorigenicity of cancer cells have not been reported.
  • the present inventors confirmed that the expression of active PLK1 and non-mentin increases as the cancer progresses in cancer cells, particularly non-small cell lung cancer, that is, as the cancer progresses to metastatic cancer through specific experiments, and non-mentin promotes cancer metastasis of PLK1 It could be predicted that it is a factor included in the signaling system (Example 1).
  • the present inventors intended to target a sub-molecule in the mechanism by which PLK1 is involved in cancer proliferation and metastasis. Specifically, in order to confirm the interaction between PLK1 and vimentin, metastatic lung cancer was induced with TGF- ⁇ followed by immunoprecipitation method. It was possible to observe increased binding of PLK1 and vimentin by performing (Example 2).
  • vimentin is a filament protein that forms a cytoskeletal network and plays a role in maintaining cell homeostasis. wanted to pursue.
  • the present inventors confirmed that PLK1 and vimentin were overexpressed as they progressed to non-small cell lung cancer, particularly metastatic cancer, and PLK1 combined with vimentin to induce phosphorylation of vimentin. That is, if it is assumed that PLK1 phosphorylation of non-mentin by PLK1 is a necessary condition for cancer metastasis, cancer metastasis can be inhibited if only phosphorylation of non-mentin by PLK1 is prevented. By searching, Thr-327, Thr-336, and Ser-339 were selected as phosphorylation candidate regions. Then, a mutant in which the amino acid was substituted at the above position was prepared, and the kinase reaction method was performed to specify the final Thr-327 and Ser-339 as phosphorylated regions by PLK1 (Example 2).
  • the present inventors expressed a mutant in which serine or threonine was substituted with alanine at position 327 or 339 and a mutant in which serine or threonine was substituted with alanine at positions 83 or 459 reported as a phosphorylation region by PLK1 in addition to the above positions.
  • a lentivirus was prepared and cancer cells were transformed using the lentivirus to confirm the mobility, invasiveness, and tumorigenicity of cancer cells. As a result, it was possible to confirm particularly low mobility, invasiveness, and tumorigenicity in cancer cells transfected with a mutation in which the 327 or 339 amino acid was substituted with alanine.
  • the 327 and 339 of vimentin As a target for blocking phosphorylation by PLK1, the 327 and 339 of vimentin It was found that the second amino acid was effective (Examples 3 to 7).
  • the present inventors conducted a cancer cell migration assay to observe metastasis of cancer cells in NCI-H460 cells expressing each of the phosphorylated and non-phosphorylated point mutant proteins of vimentin through specific experiments (Fig. 3D). -3E).
  • the experimental group expressing the phosphorylation point mutants of vimentin (S339E, T327E, S83E)
  • the mobility of cancer cells was increased more than in the case of TGF- ⁇ (2.5ng/ml) treatment, which is a positive control.
  • the mobility of cancer cells expressing the non-phosphorylated point mutant (S339A, T327A, S83A) protein was reduced (Example 5).
  • the present inventors conducted experiments on invasiveness promoting and inhibitory effects in cancer cells using phosphorylated and non-phosphorylated point mutants of vimentin through specific experiments. It was attempted to observe the invasiveness of cancer cells using Matrigel-based invasion assay (FIG. 3F).
  • FOG. 3F Matrigel-based invasion assay
  • the present invention is to investigate the involvement of PLK1 phosphorylation and non-phosphorylation point mutants of vimentin-expressing protein in cancer metastasis and tumorigenesis in animal models through specific experiments.
  • NCI-H460 cells overexpressing the protein were injected tail vein, reared for 8 weeks, and laparotized to observe metastasis and tumorigenesis of cancer cells in organs (FIG. 4).
  • FOG. 4 In the lungs of the animals injected with cells expressing the phosphorylated point mutant of Vimentin, more cancer metastases and tumorigenesis were observed compared to the control, prototype, and cells expressing the non-phosphorylated point mutant.
  • the present invention can provide the 327th and 339th amino acids of non-mentin as a target for blocking phosphorylation of non-mentin by PLK1.
  • the present invention can provide a non-mentin mutant in which S339 and/or T327 amino acids are substituted for the prevention and treatment of cancer.
  • PLK1 structurally includes an enzyme active domain having kinase activity and a polobox domain binding to a substrate, and the non-mentin mutant in which the amino acid is substituted at position 327 or 339 maintains binding affinity to PLK1 as it is. Accordingly, the mutant in which the phosphorylation region amino acid (amino acid 327 or 339) is substituted is competitively bound to PLK1 with wild-type non-mentin, and thus phosphorylation of wild-type non-mentin may be reduced in a mutant concentration-dependent manner.
  • the non-mentin mutant of the present invention may be substituted with S339 and/or T327 iglycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine or tryptophan in the wild-type non-mentin protein, and in a specific experiment, alanine The effect was confirmed using the substituted mutant.
  • nucleotide sequences of 1447-1467 (target #1), 1290-1310 (target #2), 1132-1152 (target #3) positions among vimentin mRNA (Human vimentin mRNA [NM_003380]) sequences for suppressing vimentin expression We designed three types of shRNA that each target and confirmed the inhibitory effect on vimentin expression, and treated cancer cells induced by metastasis by TGF- ⁇ to increase the expression of epithelial-mesenchymal transition-related factors, CDH1 and CDH2, and immune evasion-related factors. PD-L1 expression level was confirmed.
  • vimetnin shRNA #1 was the most effective in suppressing vimentin expression, and it was observed that CDH1, CDH2 and PD-L1 expression was significantly reduced in lung cancer cells induced by vimentin expression suppression by shRNA #1.
  • the suppression of vimentin expression by vimentin shRNA suppressed the expression of epithelial-mesenchymal transition-related factors in the cancer metastasis environment by TGF- ⁇ treatment (Example 8).
  • shRNA #1 was selected as an shRNA for reducing vimentin expression, and lung cancer cells (NCI-H460) were infected with a lentivirus expressing it, followed by a migration assay for 72 hours (FIG. 6e).
  • vimentin shRNA was expressed in lung cancer cells, the relative metastasis of the cells was reduced to about -10% or less at 72 hours.
  • metastasis of cancer cells was reduced to about -8% or less in the vimentin shRNA expression group even under the condition of inducing cancer metastasis treated with TGF- ⁇ at the same time.
  • the present invention observed the invasiveness of cancer cells using a three-dimensional transwell culture system made of matrigel in order to confirm the effect of the selected shRNA on the invasiveness of cancer cells through specific experiments.
  • the degree of invasion could be observed by directly counting the number of stained cells after crystal violet staining.
  • lung cancer cells treated with TGF- ⁇ a positive control, it was observed that the cells invaded about 15 times compared to the control group.
  • Vimentin shRNA it was observed that the invasiveness was reduced compared to the control group.
  • a colony formation assay was performed to confirm the effect of vimentin shRNA on the tumor formation inhibitory effect of lung cancer cells with a lentivirus for vimentin shRNA expression selected through a specific experiment (FIG. 6g).
  • tumors which are cancerous masses, were formed about two times more by treatment with TGF- ⁇ , a positive control, compared to the control group, and tumorigenesis was reduced compared to the control group when vimentin shRNA was expressed.
  • the tumor formation was reduced in the vimentin shRNA expression group compared to the control group or the positive control group even under the condition of inducing cancer metastasis treated with TGF- ⁇ .
  • the present invention provides a pharmaceutical composition for preventing or treating cancer comprising the shRNA and/or a vector expressing the non-mentin expression suppression.
  • the present inventors tried to confirm the effect on the mobility and invasiveness of cancer cells by simultaneously expressing the above-described shRNA and the above-mentioned non-mentin mutant in cancer cells, which can reduce the mobility and invasiveness of cancer. Meanwhile, in order to simultaneously confirm the effect of non-mentin phosphorylation on cell mobility and invasiveness under conditions of suppression of non-mentin expression by shRNA, shRNA and non-mentin phosphorylation mutants were simultaneously expressed in cancer cells to confirm mobility and invasiveness. As a result, each vimentin mutant was well expressed under conditions in which vimentin expression was suppressed by shRNA, and phosphorylated vimentin increased cell mobility and invasiveness under conditions of suppression of vimentin expression.
  • the present invention can provide shRNA and non-mentin non-phosphorylated mutant for suppressing non-mentin expression as an anticancer agent.
  • the non-mentin shRNA and the non-mentin mutant in the anticancer composition of the present invention may be provided by being included in a vector for intracellular expression, and the vector may be provided by being loaded into one or a separate vector, and as a separate vector. When provided, it can be used for the prevention or treatment of cancer by administering to a subject simultaneously or sequentially.
  • the non-mentin shRNA and non-mentin mutant of the present invention may be in a form included in a delivery system that enables efficient introduction into cells.
  • the carrier is preferably a vector, and both a viral vector and a non-viral vector may be used.
  • Virus transport mechanisms include, but are not limited to, lentiviruses, retroviruses, adenoviruses, herpes viruses, and avipox viruses, and the like.
  • Non-viral delivery mechanisms may include lipid mediated transfection, liposomes, immunoliposomes, lipofectin, cationic surface amphiphiles, and combinations thereof.
  • the lentivirus used as a viral vector for non-mentin shRNA and mutant delivery is a kind of retrovirus, and a pre-integration complex (virus") that enables active introduction into the nuclear pore or complete nuclear membrane. Due to the nucleophilicity of the "shell”), it has the characteristic of being able to infect not only dividing cells but also non-dividing cells.
  • the present invention provides a recombinant vector comprising a gene encoding the non-mentin mutation, and the vector is provided as a viral vector and can be used as a gene therapy-based anticancer agent.
  • the non-mentin shRNA of the present invention refers to an oligonucleotide having a sequence complementary to a specific target (#1 to 3) region of a non-mentin gene, and refers to an shRNA for suppressing non-mentin expression.
  • the shRNA of the present invention may be isolated or prepared using standard molecular biology techniques, for example, chemical synthesis or recombinant methods, or commercially available ones, and those prepared using genetic engineering methods may be used.
  • the mutant means that one or more amino acids constituting the non-mentin protein are substituted, and unless otherwise stated, a mutant having an anticancer effect by reducing the mobility and invasiveness and tumorigenesis of cancer cells in the present specification means that non-mentin T327 and / or S339 amino acids are substituted.
  • the term 'anticancer' refers to an action of inhibiting or killing cancer cells and inhibiting or blocking metastasis of cancer cells, and may refer to both prevention and treatment of cancer, and may be used interchangeably.
  • the term 'prevention' refers to any action that inhibits cancer formation or delays the onset of cancer by administration of the composition
  • 'treatment' refers to any action in which the symptoms of the disease are improved or beneficially changed by administration of the composition. it means action.
  • the anticancer agent of the present invention may further include other substances known to inhibit phosphorylation of vimentin or reduce its expression in addition to the above-described shRNA and mutant, for example, a compound, a natural product, a novel protein, and the like.
  • the anticancer agent of the present invention can be used for the prevention and treatment of various solid cancers such as colorectal cancer, prostate cancer, breast cancer and gastric cancer and leukemia in which vimentin expression is excessive, and also for metastatic solid cancer induced by metastasis from primary cancer It can also be used for prophylaxis and treatment.
  • various solid cancers such as colorectal cancer, prostate cancer, breast cancer and gastric cancer and leukemia in which vimentin expression is excessive, and also for metastatic solid cancer induced by metastasis from primary cancer It can also be used for prophylaxis and treatment.
  • the pharmaceutical composition for preventing or treating cancer comprising the non-mentin mutant of the present invention and a vector expressing the same may include commonly used excipients, disintegrants, sweeteners, lubricants or flavoring agents, and the like, a conventional method It can be formulated into tablets, capsules, powders, granules, suspensions, emulsions, syrups and other liquids.
  • the apoptosis activator of the present invention is for oral administration, for example, pills (troches), tablets (lozenges), aqueous or oily suspensions, powders or granules, emulsions, hard or soft capsules, syrups or elixirs. (elixirs) can be formulated.
  • binders such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose or gelatin; excipients such as dicalcium phosphate; disintegrants such as corn starch or sweet potato starch; A lubricant such as magnesium stearate, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax may be added.
  • binders such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose or gelatin
  • excipients such as dicalcium phosphate
  • disintegrants such as corn starch or sweet potato starch
  • a lubricant such as magnesium stearate, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax may be added.
  • it can be prepared by including one or more pharmaceutically acceptable carriers in addition to the above-mentioned substances.
  • saline sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, and one or more of these components may be mixed and used.
  • other conventional additives such as antioxidants, buffers and bacteriostats may be added as needed.
  • diluents, dispersing agents, surfactants, binders and lubricants may be additionally added to form injectable formulations such as aqueous solutions, suspensions and emulsions, and antibodies specific for target cells can act specifically on target cells.
  • other ligands may be used in combination with the carrier.
  • it can be preferably formulated according to each disease or component using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA).
  • composition of the present invention may be administered parenterally, and when administered parenterally, it is preferably administered by intravenous injection, intramuscular injection or intrathoracic injection.
  • the apoptosis-promoting anticancer agent may be mixed with water together with a stabilizer or buffer to prepare a solution or suspension, which may be formulated as a unit dosage form of an ampoule or vial.
  • the dosage is preferably selected according to the absorption of the active ingredient in the body, the inactivation rate and excretion rate, the age, sex and condition of the patient, and the severity of the disease to be treated. 1 to 100 mg per kg, preferably 1 to 10 mg per kg, may be administered once to several times daily.
  • Example 1 Clinical association between vimentin and active PLK1 in metastatic lung cancer cells and analysis of the expression of vimentin and active PLK1 in cancer metastasis induced by TGF- ⁇
  • the present inventors constructed a heat map by analyzing the microarray data (GSE 114761) under the condition that cancer metastasis was induced by treating lung cancer cells with TGF- ⁇ (Fig. 1e). Through heat map analysis, it was found that vimentin and PLK1 mRNA expression was high in TGF- ⁇ -treated lung cancer cells under the conditions of high levels of mesenchymal transition markers CDH2, SNAIl and SMAI2 and low levels of epithelial markers CDH1 and OCLN. .
  • TGF- ⁇ was treated in non-small cell lung cancer cell lines A549 and NCI-H460 to induce cancer metastasis, and then mRNA and protein expression levels were measured. analyzed.
  • mRNA expression levels of the mesenchymal transition markers CDH2 and SNAl1 SNAI2 increased and the mRNA expression levels of the epithelial marker CDH1 decreased.
  • an increase in mRNA expression levels of PLK1 and vimentin was observed compared to the control group (FIG. 1f).
  • vimentin, PLK1, E-cadherin, and N-cadherin protein levels were also observed with the same results as mRNA expression levels (FIG. 1g). Additionally, it was observed that the protein expression level of the activated phosphorylated PLK1 was higher in the TGF- ⁇ -treated group than in the control group (FIG. 1g-1h).
  • Example 2 Identification of phosphorylation of vimentin and novel phosphorylation sites by active PLK1 in metastatic lung cancer cells induced by TGF- ⁇
  • Immunoprecipitation was performed to explore the interaction between PLK1 and vimentin in the condition of metastasis induced by TGF- ⁇ treatment.
  • PLK1 protein was precipitated with agarose beads and PLK1 antibody and analyzed by immunoblot method. Vimentin was also bound to PLK1 in the control group, and in the experimental group in which cancer metastasis was induced by TGF- ⁇ , the binding between PLK1 and vimentin was increased (FIGS. 2a-2b).
  • a kinase reaction method was performed to analyze the interaction method between the two proteins.
  • PLK1 serine/threonine kinase
  • purified vimentin wild and active PLK1-T210D were treated with radiation-labeled r32-P-ATP, reacted and analyzed.
  • Vimentin was strongly phosphorylated by active PLK1-TD at a level similar to that of TCTP, a positive control (Fig. 2c).
  • Liquid chromatography mass spectrometry was performed to find the phosphorylation site of vimentin by PLK1.
  • Thr-327, Thr-336, and Ser-339 of vimentin were predicted to be phosphorylated by PLK1 (Fig. 2d).
  • the predicted three sites of vimentin phosphorylation and two sites reported to phosphorylate vimentin by PLK1 were prepared as dephosphorylated mutants substituted with alanine by using a partial-specific mutagenesis method.
  • the prepared mutant was produced as a GST-labeled protein and purified, followed by a kinase reaction method.
  • the alanine mutations of Thr-327 and Ser-339 significantly decreased the degree of phosphorylation compared to the original (FIG. 1e).
  • the present inventors cut vimentin original (WT) plasmid into pLVX-TRE3G-eRFP, Mlu1 and Apa1 to construct a lentivirus system for vimentin phosphorylation and non-phosphorylation gene expression, 5'-ACGGGGCCCATGTCCACCAGGTCCGTGTC-3' (forward primer) and 5'-ACGACGCGTTTATTCAAGGTCATCGTGA-3' (reverse primer), amplified by PCR, and then cut into Mlu1 and Apa1, and subcloned into vector pLVX-TRE3G-eRFP.
  • the virus culture medium was collected at 12 hour intervals up to 72 hours, and the culture medium was filtered with a 0.2 mm filter and centrifuged at 17000 rpm, 4° C. for 90 minutes. The supernatant was discarded and the collected virus was collected with TNE Buffer, stored at 4°C, and used for cancer cell infection from the next day.
  • Example 4 Evaluation of epithelial-mesenchymal transition effect after selection of cells expressing active and inactive types of vimentin using lentivirus
  • cancer cells were cultured as follows to infect lung cancer cells with a lentivirus expressed by phosphorylated and non-phosphorylated point mutants of vimentin.
  • a lung cancer cell To construct a stabilized cell line expressing vimentin prototypical and phosphorylated and non-phosphorylated point mutants in NCI-H460, a lung cancer cell, first, pLVX-Tet3G expressing lentivirus was infected, and the infected cells were treated with G418 for 5 days. was selected. The NCI-H460Tet3G cells selected in this way were infected with a lentivirus expressing the prototype and phosphorylated point mutants (S339E, T327E, S83E, S459E) and non-phosphorylated point mutants (S339A, T327A, S83A, S459A) of vimentin.
  • a stabilized cell line was constructed by treatment with puromycin for 48 hours. Constructed cells were treated with 1ug/ml doxycycline to induce expression of vimentin prototype and phosphorylated and non-phosphorylated point mutants, and then mRNA and protein expression levels were checked to see if each vimentin point mutant was well expressed. As shown in Figures 3a-3b, it was confirmed through mRNA expression level and protein expression level that the original vimentin and each point mutant type were well expressed. Except for phosphorylation site S459, it was observed that the expression of N-cadherin was higher in lung cancer cells expressing phosphorylated vimentin than in cells expressing non-phosphorylated vimentin. In addition, as a result of checking whether the expression of the phosphorylation and non-phosphorylation point mutants of vimentin affects the proliferation of cells, it was observed that there was no significant effect on the proliferation of cells (FIG. 3c).
  • the staining intensity level was increased up to 5 times compared to the control group, similar to or higher than that of the TGF- ⁇ treatment group, which is a positive control group, and relatively compared to the vimentin phosphorylation mutant. It was observed that the non-phosphorylated point mutant experimental group had a low staining intensity (FIGS. 3d-3e). However, it was observed that the S459 phosphorylation mutant of vimentin did not affect cancer cell mobility. From the above results, it was found that vimentin phosphorylation point mutant promotes the mobility of lung cancer cells, whereas the non-phosphorylation point mutant vimentin has an excellent effect in inhibiting lung cancer cell mobility.
  • the matrix was diluted with cold serum-free RPMI 1640 (4°C) to 1 mg/ml. 100 ⁇ l of this matrigel mixture (1 mg/ml) was added to an 8.0 ⁇ m, 24 well insert, and hardened in an incubator at 37° C. for 12-20 hours.
  • Lung cancer cells NCI-H460 expressing each vimentin prototype, phosphorylated and non-phosphorylated point mutant protein in the hard matrigel insert were diluted in serum free RPMI 1640 (36°C) at 1X105 cells/well and dispensed into the insert.
  • warm RPMI 1640 (10% FBS) at 36° C.
  • the absorbance value increased from 4 to 6 times that of the control group, similar to or higher than that of the TGF- ⁇ treatment group, which is a positive control group. It was observed that the relative absorbance was lower (FIG. 3f). Therefore, it was found that the vimentin non-phosphorylated point mutant was excellent in inhibiting the mobility and invasiveness of lung cancer cells.
  • Example 7 Evaluation of metastatic and tumorigenicity of cancer cells by protein containing phosphorylation site and non-phosphorylation point mutation of vimentin in animal model
  • the present inventors tried to evaluate the tumorigenic promotion and inhibitory effects of cancer cells using cancer cells expressing the phosphorylated and non-phosphorylated point genes of vimentin.
  • NCI-H460 lung cancer cells (2X10 6 cells), in which vimentin protein containing point mutations are stably expressed, were put in PBS and injected into the tail vein of the mouse, bred for 8 weeks, and then opened open to induce cancer cells in the organs. Metastasis and tumorigenicity were observed.
  • a control group (Mock; a lentivirus-treated group in which the target gene is not expressed), a group administered with the NCI-H460 lung cancer cell line expressing vimentin protein (WT), a group administered with the NCI-H460 lung cancer cell line expressing a phosphorylation point mutant vimentin protein (S339E, T327E, S83E) and NCI-H460 lung cancer cell line expressing non-phosphorylated point mutant vimentin protein (S339A, T327A, S83A) were observed for cancer cell metastasis and tumor formation.
  • An experiment was performed on 5 mice in each experimental group, and the frequency of tumor formation, which is metastatic cancer in the lung, was measured and displayed as a graph (FIG. 4).
  • vimentin phosphorylation point mutants with the greatest tumorigenicity, the highest PD-L1 protein expression was also observed in the S339E experimental group (FIG. 4h). Therefore, it is suggested that vimentin phosphorylation enhances epithelial-mesenchymal transition, metastasis, and tumorigenicity.
  • the non-phosphorylated point mutant of the present invention in particular, the S339A test group, has lower metastasis than the original vimentin test group and the effect of inhibiting the tumorigenicity of cancer cells is excellent.
  • shRNA and a lentivirus including the same were prepared.
  • Target #1 Forward 5'-CCGGGTGAAATGGAAGAGAACTTTGCTCGAGCAAAGT TCTCTTCCATTTCACTTTTTG -3' 5 Reverse 5'-AATTCAAAAAGTGAAATGGAAGAGAACTTTGCTCGAGCAAAGTTCTCTTCCATTTCAC -3 6
  • Target #2 Forward 5'-CCGGGCAGAAGAATGGTACAAATCCCTCGAGTTATTTGTACCATTCTTCTGCTTTTTG-3 7
  • Target #3 Forward 5'-CCGGTGAAGAAACTCCACGAAGAGGCTCGAGCCTCTTCGTGGAGTTTCTTCATTTTTG-3' 9
  • the prepared shRNA is shown in Table 2 below.
  • pLKO-puro.1-vimentin shRNA plasmid using pLKO-puro.1 vector was constructed. After expressing this through HEK293 cell transfection together with pHR'-CMV-VSVG and pHR'-CMV-deltaR8.2, the cell culture medium was collected to produce lentivirus. The lentivirus was concentrated using a centrifuge. In order to confirm virus expression, NCI-H460, A549 cells were cultured at 5X10 4 cells/ml, and the next day, lentivirus was added to 20 ⁇ /well of infection buffer (10 mM HEPES, 1 mg/ml polybrene).
  • vimentin shRNA-infected cells were selected.
  • the present inventors wanted to check the vimentin expression inhibitory effect of the prepared vimentin shRNA, each selected through puromycine treatment. Vimentin mRNA expression and protein expression levels were checked in cells infected with vimentin shRNA.
  • the present inventors observed changes in mRNA expression and protein expression of epithelial-mesenchymal transition markers and related factors, as well as inhibition of vimentin mRNA expression by vimentin shRNA treatment for cancer metastasis induced by TGF- ⁇ treatment.
  • vimentin mRNA expression was reduced in lung cancer cells NCI-H460 and A549 infected with vimentin shRNA (shvimentin) compared to cells infected with control shRNA (shCtrl), which inhibited vimentin expression and metastasized to cancer It was observed that the expression of vimentin was suppressed even in the condition treated with environment-inducing TGF- ⁇ (Fig. 6a, 6c).
  • the decrease in CDH1 expression, an epithelial marker, by TGF- ⁇ treatment was suppressed by the suppression of vimentin expression by shvimentin treatment, and the decrease in CDH1 expression was also inhibited by TGF- ⁇ treatment. It was observed that the increase was also suppressed by suppression of the expression of vimentin (FIGS. 6b, 6d).
  • the present inventors demonstrated the effect of suppressing the expression of vimentin by treatment with vimentin shRNA through a cell migration assay in the TGF- ⁇ -treated metastasis environment.
  • lung cancer cells NCI-H460 were infected with a control shRNA (shCtrl) or vimentin shRNA (shvimentin) virus. The next day, after treatment with 2 ⁇ g/ml puromycin for 48 hours, the cells expressing the selected vimentin shRNA were dispensed into a 6 well plate at 2x10 5 cells/ml. After 24 hours, scratches were made at regular intervals using a pipette tip. gave out In the mobility experiment, cancer metastasis was induced using 2.5 ng/ml of TGF- ⁇ . After scratching, the cell spacing and mobility were observed under a microscope at intervals of 24 hours, and the extent to which the gap was restored through cell imaging under the microscope was measured as the distance between cells. After calculating the relative movement distance when the measured value is 100% of the distance of the control group, a graph is displayed as a percentage (FIG. 6e).
  • Relative movement distance (%) Measured value in the experimental group x 100 / Measured value in the control group
  • the metastasis of lung cancer cells itself was reduced by inhibition of vimentin expression by vimentin shRNA treatment.
  • the mobility was increased by about 30% compared to the control by TGF- ⁇ treatment, and the metastasis of these lung cancer cells was reduced by about -8% by vimentin shRNA. Therefore, it can be seen that the suppression of vimentin expression by vimentin shRNA has a strong inhibitory effect on metastasis induced by TGF- ⁇ treatment as well as metastasis of cancer cells itself.
  • the present inventors demonstrated the effect of suppressing the expression of vimentin by inhibiting the invasiveness of cells through a cell invasive assay (invasion assay) in the TGF- ⁇ -treated metastasis environment.
  • the matrix was diluted with cold RPMI 1640 (4°C) without serum to 1 mg/ml. 100 ⁇ l of this mixture was dispensed in an 8.0 ⁇ m 24 insert for 24 compartments and hardened in an incubator at 37° C. for 12-20 hours.
  • Lung cancer cells NCI-H460 in which vimentin expression was suppressed by vimentin shRNA treatment on hard matrigel were diluted in serum-free medium at a cell number of 1X10 5 cells/well and dispensed.
  • warm RPMI 1640 (10% FBS) at 36°C containing serum was dispensed at 0.5 ml/well.
  • Cancer metastasis was induced by TGF- ⁇ treatment.
  • the medium was exchanged every 3 days and the degree of invasion was observed.
  • the medium was removed and washed with 1XPBS, and then the cells inside the insert were scraped off with a cotton swab, It was washed with 1XPBS to remove cells and residues of matrigel inside the insert.
  • 500 ⁇ l of 4% paraformaldehyde was dispensed on a 24-panel plate with an outer surface of the insert, and the cells invading Matrigel were incubated for 5 minutes at room temperature and washed 3 times with 1XPBS at 5 minutes, 0.05 % crystal-violet solution was stained for 5 minutes. The stained cells were observed under a microscope and the number of cells invaded was displayed as a graph.
  • vimentin shRNA not only suppressed the expression of factors involved in the epithelial-mesenchymal transition of cells, but also reduced cell mobility and invasiveness, and vimentin shRNA even in the metastasis environment by TGF- ⁇ treatment. It was demonstrated that suppression of vimentin expression by .
  • the present inventors performed colony formation assay (soft agar assay) using soft agar to confirm the effect of suppression of vimentin expression in inhibiting tumor formation of cancer cells in the metastasis environment treated with TGF- ⁇ . Specifically, at the bottom, 150 ml of 4% stock agar, 100 ml of FBS, and 750 ml of Free RPMI 1640 were mixed to make a 0.6% agar layer, and a total of 1 ml of agar medium was placed in a 12-well diameter plate and hardened for 1 hour.
  • Example 12 Evaluation of metastatic and invasiveness promoting effect by expression of vimentin phosphorylation point mutant protein after expression inhibition by Vimentin shRNA
  • the present inventors confirmed that the suppression of vimentin expression by vimentin shRNA suppressed cancer metastasis and cancer tumorigenesis through the previous experiment. Under these conditions, the effect of the protein re-expression of the phosphorylation point mutant of vimentin on cancer metastasis and invasiveness was analyzed.
  • the constructed vimentin expression-suppressing cell line was again infected with a lentivirus expressing the prototype and phosphorylated point mutant (S339E) and non-phosphorylated point mutant (S339A) of vimentin, followed by selection with puromycin and G418. After selection, 1ug/ml doxycycline treatment was used to induce expression of the original vimentin, phosphorylated and non-phosphorylated point mutants again, and the protein expression level was checked whether each vimentin point mutant was well expressed. As shown in FIG. 6h , it was confirmed that the original form and each point mutant type of vimentin were well expressed under conditions in which vimentin expression was suppressed.
  • the present inventors demonstrated the effect of re-expression of the protein of the phosphorylation point mutant of vimentin on the mobility and invasiveness of cancer cells under conditions in which the expression of vimentin is suppressed.
  • NCI-H460 cells in which vimentin prototype (WT) and phosphorylated (S339E) and non-phosphorylated (S339A) point mutants constructed in the previous experiment were re-expressed were incubated in serum-free medium. After dilution, 5 x 10 4 cells were dispensed into an insert for 8.0 ⁇ m, 24 compartments, and a medium containing 10% serum was dispensed on a 24 compartment plate, and then the insert was put.
  • the vimentin prototype (WT) was again expressed in the cells in which vimentin expression was suppressed, and the cell mobility was increased compared to the control cell (Mock), and S339E, a vimentin phosphorylation point mutant, was Cell mobility was increased in the expressed cells than in the TGF- ⁇ -treated positive control group. Therefore, it can be seen that the phosphorylation of vimentin has a strong promoting effect on cancer cell metastasis.
  • the present inventors demonstrated the effect of re-expression of the phosphorylation point mutant of vimentin on invasiveness under conditions in which the expression of vimentin is suppressed.
  • NCI-H460 cells re-expressed with vimentin prototype (WT) and phosphorylated (S339E) and non-phosphorylated (S339A) point mutants constructed in the previous experiment on solid matrigel were treated with 1X10 5 cells/well. It was diluted and dispensed in serum-free medium.
  • warm RPMI1640 (10% FBS) at 36°C containing serum was dispensed at 0.5 ml/well. After 5 days of cell seeding, the medium was removed and washed with 1XPBS, the cells inside the insert were scraped off with a cotton swab, and washed with 1XPBS to remove the cells and residues of matrigel inside the insert.
  • vimentin phosphorylation increased cell mobility and invasiveness even under conditions of suppression of vimentin expression by vimentin shRNA.
  • the non-mentin mutant and / or shRNA of the present invention is treated separately or in combination, and acts only on cancer cells, particularly metastatic cancer, without affecting normal cells, and for treatment of primary and metastatic solid cancer and leukemia caused by abnormal growth of cells It can be usefully used.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Oncology (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 암세포에서 vimentin의 과발현을 확인하고, PLK1에 의한 vimentin 인산화를 통해 종양의 형성과 암의 전이가 유도됨을 확인하여, 종양의 형성과 암의 이동성 및 침습성을 감소시켜 그 전이를 예방하기 위한 전략으로서 PLK1과 vimentin의 상호작용(interaction) 발생 빈도를 감소시키는 2가지 방법을 제안하고, 이의 응용을 제공한다.

Description

인산화된 비멘틴의 과도한 생성을 차단하여 암을 예방 또는 치료하는 방법
본 발명은 암세포에서 vimentin의 과발현을 확인하고, PLK1에 의한 vimentin 인산화를 통해 종양의 형성과 암의 전이가 유도됨을 확인하여, 종양의 형성과 암의 이동성 및 침습성을 감소시켜 그 전이를 예방하기 위한 전략으로서 PLK1과 vimentin의 상호작용(interaction) 발생 빈도를 감소시키는 2가지 방법을 제안하고, 이의 응용을 제공한다.
첫째로, 본 발명은 PLK1과 결합력은 유지하되 PLK1에 의해 인산화되는 영역이 변이된 비멘틴 돌연변이체를 제공하여 야생형 비멘틴과 PLK1의 상호작용을 감소시키는 방법을 제공한다.
둘째로, 본 발명은 vimentin을 표적으로 하는 shRNA를 이용하여 암세포에서 과도하게 발현되는 vimentin의 발현을 억제함으로써 궁극적으로 과도하게 인산화된 비멘틴의 생성을 억제하는 방법을 제공한다.
Vimentin은 중간엽 세포에서 주로 발현되는 중간 필라멘트 단백질로서 미세소관 및 미세 필라멘트와 함께 세포 골격 네트워크를 형성하여 세포 항상성을 유지하는 역할을 한다(Goldman, R.D. et al., J Cell Biol 134 (1996) 971-983). 특히, 상피간엽이행(EMT) 과정에서는 세포의 이동성과 침습성을 조절하는 중요한 조절 인자로 알려져 있다(Eckes, B. et al., J Cell Sci 111 (Pt 13) (1998) 1897-1907; Liu, C.Y. et al., Oncotarget 6 (2015) 15966-15983). 이러한 vimentin은 유방암, 폐암, 위암 빛 기타 많은 고형암에서 과발현되어 있음이 보고되었으며, 암의 악성 단계가 높을수록 vimentin의 발현이 증가됨이 보고되었다(Yamashita, N. et al., J Cancer Res Clin Oncol 139 (2013) 739-746; Ye, Z. et al., PLoS One 11 (2016) e0163162; Yin, S. et al., Pathol Res Pract 214 (2018) 1376-1380). 고형암에서 vimentin은 상피간엽이행 동안 세포 골격 재구성에 관여하는데 이는 상피간엽이행에 관련 신호전달을 조절함으로써 암세포의 이동성과 침습성을 촉진하기 때문으로 알려져 있다. 또한 vimentin이 결여된 배아세포는 세포의 이동성이 감소되며, vimentin이 결핍된 마우스의 경우 상처 부위에서 근섬유 아세포의 이동성 손상으로 상처 부위의 회복이 잘 안됨이 보고되었다(Eckes, B. et al., J Cell Sci 111 (Pt 13) (1998) 1897-1907; Eckes, B. et al., J Cell Sci 113 (Pt 13) (2000) 2455-2462). 세포의 이동성에 vimentin의 인산화가 관여되어 있는 것으로 알려져 있는데, vimentin가 인산화되면 중간 필라멘트(IF)의 결합구조를 조절하여 세포의 이동을 증가시킨다고 알려져 있다(Eriksson, J.E. et al., J Cell Sci 117 (2004) 919-932; Zhu, Q.S. et al., Oncogene 30 (2001) 457-470). 이러한 vimentin은 상피간엽이행(EMT)에 대한 마커로 알려져 있지만, 이러한 과정을 매개하는데 있어서 그 역할은 정확하게 알려져 있지 않다.
Polo-like kinase 1(PLK1)은 최근 발암의 원인 및 전이의 원인이 되는 타겟분자로 연구되고 있으며, 이를 기반으로 PLK1에 대한 억제제 개발을 통한 항암제 개발 연구가 다국적기업을 중심으로 경쟁적으로 진행되고 있다(Yim, Anti-Cancer Drugs 24(2013) 999-1006; Yim and Erikson, Mutation Research Reviews Mutation Research, 761 (2014) 31-39). PLK1은 구조적으로 인산화효소 활성을 지닌 효소활성 도메인과 기질과 결합하는 폴로박스 도메인을 지니고 있으며, T210위치에서의 인산화가 PLK1의 활성화를 유발시킨다. 기질의 폴로박스 도메인 결합에 의해 활성화된 PLK1의 인산화 효소는 기질의 Ser/Thr 잔기에 인산화를 유도하는 효소이다(Barr et al., Nat Rev Mol Cell Biol 5 (2004) 429-440). 기능적으로는 성장 및 분열하는 세포에서 발현이 증가되는데 특히 세포주기 중 세포분열기에서의 발현과 활성이 정점을 이루고 있다. 따라서 빠르게 성장하는 암세포에서 또한 그 발현율이 높은 것으로 알려져 있으며(Yim, Anti-Cancer Drugs 24(2013) 999-1006; Yim and Erikson, Mutation Research Reviews Mutation Research, 761 (2014) 31-39), 암세포의 단계별 악성화 과정에서 많은 경우 그 발현이 증가되는 것이 실험적으로 보고되었다. 특히 비소세포 폐암, 두부경부암, 후두암, 유방암, 간암, 자궁내막암, 대장암, 난소암, 췌장암, 전립선암 등에서 악성 단계가 높을수록 그 발현이 증가되어 있음이 보고되었다(Yim, Anti-Cancer Drugs 24(2013) 999-1006; Yim and Erikson, Mutation Research Reviews Mutation Research, 761 (2014) 31-39). 최근 연구보고와 본 발명자들의 연구에 의하면 활성형의 PLK1이 암의 전이성을 증가시키는 데 관여하고 있음이 관찰되었고 이에 전이성 암을 치료하기 위한 분자 타겟으로써 PLK1에 대한 가치가 최근 부각되기 시작하였다(Cai et al., Am J Transl Res 8 (2016) 4172-4183; Wu et al., eLife 5 (2016) e10734; 개인 연구결과). 따라서 PLK1의 인산화기질의 기능 조절을 타겟으로 하는 항암제의 경우 원발성 암뿐만 아니라 전이성 암의 치료에도 효과가 뛰어날 것으로 기대하고 있다.
암전이는 암의 진행의 결과로 나타나는 현상이나, 실질적으로 원발소 암을 제거 또는 치료한다고 하더라도, 전이를 막을 수 없다면 암의 재발 등에 의해서 생존률이 매우 낮아진다. 전이암은 전체 암환자 사망의 90%를 차지하고 있어 그 위험도를 가늠할 수 있다 (Valastyan, S. and Weinberg, R.A., Cell 147 (2011) 275-292; Khan, I. and Steeg, P.S., Lab Invest 98 (2018) 198-210). 암의 크기가 커질수록 주변 림프절 및 다른 조직으로 전이하는 비율이 높은 것으로 여겨지나, 암의 크기가 작음에도 불구하고 전이가 되는 경우가 있어, 아직까지 암의 전이와 증식의 관계는 여전히 명확하게 규명되어 있지 않다 (Valastyan, S. and Weinberg, R.A., Cell 147 (2011) 275-292; Shibue, T. and Weinberg, Semin Cancer Biol 21 (2011) 99-106). 암의 치료에 있어, 암 세포의 증식 억제와 전이의 억제가 항상 같이 나타나는 효과가 아니고, 암의 전이를 억제할 수 있다면 많은 암의 치료 효율을 비약적으로 개선할 수 있다는 측면에서, 전이성 암의 치료를 위한 암의 전이 및 침윤을 효과적으로 억제하는 치료 타겟 또는 치료제의 개발이 필요하다.
본 발명은 점 돌연변이된 vimentin 단백질의 암세포 사멸효과 및 전이성 암세포의 이동성과 침습성 억제제 용도에 관한 것이다. 또한 일반 고형암뿐만 아니라, 전이성 암세포에서 민감하게 세포 사멸을 유도하는 작용을 이용한 세포 사멸 유도제로서의 용도에 관한 것이다. 본 발명은 각종 고형암, 전이성 암을 치료하는데 유용하게 사용될 수 있다.
이에, 본 발명이 이루고자 하는 기술적 과제는 327 또는 339 번째 아미노산이 치환된 비멘틴 돌연변이체와 이를 발현하는 벡터를 제공하는 것이다.
또한, 본 발명은 상기 돌연변이체 또는 벡터를 유효성분으로 포함하는 암 예방 또는 치료용 약학적 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 비멘틴 단백질 발현 억제에 효과적인 shRNA를 암의 예방 또는 치료 용도에 제공하는 것을 목적으로 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당해 기술분야의 통상의 기술자에게 명확하게 이해될 수 있을 것이다.
상기 과제를 해결하기 위하여, 본 발명은 서열번호 1 또는 서열번호 2의 아미노산 서열을 포함하거나 이로 이루어진 비멘틴(Vimentin) 비인산화 점 돌연변이체를 제공한다.
본 발명의 일 구현예로서, 상기 비멘틴 비인산화 점 돌연변이체는 비멘틴 단백질에서 327번째 아미노산인 트레오닌(Threonine)이 글리신(Glycine, Gly), 알라닌(Alanine, Ala), 발린(Valine, Val), 루신(Leucine, Leu), 아이소루신(Isoleucine, Ile), 프롤린(Proline, Pro), 페닐알라닌(Phenylalanine, Phe), 메티오닌(Methionine, Met) 또는 트립토판(Tryptophan, Trp)으로 치환된 것(서열번호 1)일 수 있으며, 바람직하게는 알라닌으로 치환된 것일 수 있다.
본 발명의 다른 구현 예로서, 상기 비멘틴 비인산화 점 돌연변이체는 비멘틴 단백질에서 339번째 아미노산인 세린(Serine)이 글리신, 알라닌, 발린, 루신, 아이소루신, 프롤린, 페닐알라닌, 메티오닌 또는 트립토판으로 치환된 것(서열번호 2)일 수 있으며, 바람직하게는 알라닌으로 치환된 것일 수 있다.
또한, 본 발명은 상기 비멘틴 돌연변이체를 암호화하는 유전자를 포함하는 재조합 벡터를 제공한다.
본 발명의 일 구현예로서, 상기 비멘틴 돌연변이체를 암호화하는 유전자는 서열번호 3 또는 서열번호 4의 염기서열을 포함하거나 이로 이루어진 것일 수 있다.
본 발명의 다른 구현예로서, 상기 재조합 벡터는 바이러스 벡터(viral vector)일 수 있으며, 바람직하게는 렌티 바이러스 벡터일 수 있다.
또한, 본 발명은 상기 비멘틴 돌연변이체 또는 재조합 벡터를 포함하는 암 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 상기 비멘틴 돌연변이체 또는 재조합 벡터를 포함하는 암 전이 억제용 약학적 조성물을 제공한다.
본 발명의 일 구현예로서, 상기 조성물은 암세포의 이동성 및 침습성을 감소시켜 암의 전이(Metastasis)를 억제하는 것일 수 있다.
또한, 본 발명은 상기 비멘틴 돌연변이체 또는 재조합 벡터를 개체에 투여하는 단계를 포함하는 암의 예방 또는 치료 방법을 제공한다.
또한, 본 발명은 암의 예방 또는 치료용 약제 제조를 위한 상기 비멘틴 돌연변이체 또는 재조합 벡터의 용도를 제공한다.
또한, 본 발명은 비멘틴(Vimentin) 발현 억제용 shRNA(short hairpin RNA)를 제공한다.
본 발명의 비멘틴 발현 억제용 shRNA는 서열번호 11 내지 13 중 어느 하나의 염기서열을 포함하거나 이로 이루어진 것일 수 있으나, 바람직하게는 서열번호 11의 염기서열을 포함하거나 이로 이루어진 것일 수 있다.
또한, 본 발명은 상기 shRNA를 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 일 구현예로서, 상기 조성물은 종양형성능을 억제하는 것일 수 있다.
본 발명의 다른 구현예로서, 상기 조성물은 암세포의 이동성 및 침습성을 감소시켜 암의 전이를 억제할 수 있다. 즉, 본 발명의 조성물은 전이암의 예방을 위한 용도에 제공될 수 있다.
본 발명의 또 다른 구현예로서, 상기 조성물은 상술한 서열번호 1 또는 서열번호 2의 아미노산 서열을 포함하거나 이로 이루어진 비멘틴(Vimentin) 돌연변이체를 추가로 포함하는 것일 수 있다.
또한, 본 발명은 상기 shRNA를 포함하는 암 전이 억제용 약학적 조성물을 제공한다.
또한, 본 발명은 상기 shRNA를 개체에 투여하는 단계를 포함하는 암의 예방 또는 치료 방법을 제공한다.
또한, 본 발명은 암의 예방 또는 치료용 약제 제조를 위한 상기 shRNA의 용도를 제공한다.
한편, 본발명에서 상기 암은 고형암일 수 있고, 상기 고형암은 비소세포폐암일 수 있으며, 상기 비소세포폐암은 특히 선암일 수 있다.
또한, 본 발명에서 상기 개체는 암의 예방 또는 치료가 필요한 인간일 수 있으며, 이미 암이 발생되어 치료 중에 있는 환자, 또는 암의 완치 후 전이를 예방하기 위한 환자일 수 있다.
본 발명의 비멘틴 돌연변이체는 PLK1와의 결합력은 유지하고 있는 바 암세포에서 야생형 비멘틴과 경쟁적으로 과발현된 PLK1과 결합하여 종양의 형성 및 암의 전이를 억제할 수 있으며, 암세포 내에서 상기 돌연변이체를 발현하는 벡터의 제공은 암의 이동성 및 침습성을 억제하고 종양의 형성을 저해할 수 있다. 본 발명의 비인산화 점 돌연변이체는 정상세포에서 비멘틴의 고유 기능에는 영향을 주지 않아 안전한 바, 세포의 비정상적인 성장에 의한 각종 질환, 특히 원발성 및 전이성 고형암과 백혈병 등의 같은 퇴행성 질환 치료에 유용하게 사용될 수 있다.
또한, 본 발명의 vimentin shRNA 및/또는 vimentin 돌연변이체는 암세포의 전이성, 침습성 및 선택적 종양형성에 대한 강력한 억제 효과를 갖는 바, 세포의 비정상적인 성장에 의한 각종 질환, 특히 원발성 및 전이성 고형암과 백혈병 등의 같은 퇴행성 질환 치료에 유용하게 사용될 것으로 기대된다.
도 1a 내지 1h은 전이성 폐암세포에서 vimentin과 활성형 PLK1의 임상적 연관성을 분석한 결과이다.
도 1a : KEGG 2019 pathway 분석을 통해서 폐암세포 A549의 암전이 조건에서 활성형 PLK1이 발현되는 침습성 세포들의 관련 pathway를 분석한 그래프이다.
도 1b : GeneMANIA database 분석을 통해서 폐암세포 A549의 암전이 조건에서 활성형 PLK1이 발현되는 침습성 세포에 발현되는 유전들과 ECM 관련 유전자들의 연관성을 보여주는 모식도이다.
도 1c: KM PLOTTER 분석을 통해서 서로 다른 종의 폐암환자들의 생존율을 PLK1과 vimentin 발현에 따라 분석한 그래프이다.
도 1d: KM PLOTTER 분석을 통해서 폐암 진행단계에 따른 폐암환자들의 생존율을 PLK1과 vimentin 발현에 따라 분석한 그래프이다.
도 1e: TGF-β를 처리하여 암전이를 유도한 여러 종류의 폐암세포들에서 상피간엽이행 마커들의 발현을 heatmap 분석을 통해서 보여준 그래프이다.
도 1f: TGF-β를 처리한 폐암세포 A549와 NCI-H460에서 vimentin, 활성형 PLK1 그리고 상피간엽이행 마커들의 mRNA 발현을 실시간 중합효소 연쇄반응(Real-time PCR)을 이용하여 보여준 그래프이다.
도 1g: TGF-β를 처리한 폐암세포 A549와 NCI-H460에서 vimentin, 활성형 PLK1 그리고 상피간엽이행 마커들의 단백질 발현을 면역블롯법으로 관찰한 결과이다.
도 1h: G의 vimentin과 활성형 PLK1의 단백질 발현을 보여준 그래프이다.
도 2a 내지 2g는 PLK1 활성형에 의한 vimentin의 인산화 및 인산화 부위를 분석한 결과이다.
도 2a : A549 세포에 2.5 ng/ml TGF-β를 처리한 조건에서 PLK1 항체를 이용하여 면역침강법을 진행하여 vimentin과 PLK1이 상호작용함을 관찰한 결과이다.
도 2b : NCI-H460 세포에 2.5 ng/ml TGF-β를 처리한 조건에서 PLK1 항체를 이용하여 면역침강법을 진행하여 vimentin과 PLK1이 상호작용함을 관찰한 결과이다.
도 2c: GST가 표지된 vimentin을 이용하여 활성형 PLK1(PLK1 TD)와 함께 인산화 효소 반응법을 수행하여 활성형 PLK1이 vimentin을 인산화 시킴을 관찰한 결과이다.
도 2d: 액체크로마토그래피 질양분석법을 통해서 PLK1에 의한 인산화된 vimentin 인산화 가능 후보 부위를 확인한 결과이다.
도 2e: 부분 특이적 돌연변이 치환법을 이용하여 vimentin의 인산화 후보 부위를 알라닌으로 치환한 비인산화 점 돌연변이체 단백질과 활성형 PLK1을 이용하여 인산화 효소 반응법을 수행한 결과이다.
도 2f: A549 세포에 2.5 ng/ml TGF-β를 처리한 후 phosphatase (CIP) 처리에 의해서 vimentin과 PLK1의 인산화의 감소를 관찰한 결과이다.
도 2g: NCI-H460 세포에 2.5 ng/ml TGF-β를 처리한 후 phosphatase (CIP) 처리에 의해서 vimentin과 PLK1의 인산화의 감소를 관찰한 결과이다.
도 3a 내지 3f는 폐암세포 NCI-H460에서 vimentim의 인산화 및 비인산화 점 돌연변이체의 과발현이 암세포의 이동성과 침습성에 미치는 영향을 측정한 실험이다.
도 3a : 폐암세포 NCI-H460에 vimentin 인산화 및 비인산화 점 돌연변이체를 발현시킨 후 vimentin 단백질 과발현 유무와 중간엽이행 마커(N-cadherin) 변화를 면역블롯으로 관찰한 결과이다.
도 3b : 폐암세포 NCI-H460에 vimentin 인산화 및 비인산화 점 돌연변이체를 발현시킨 후 vimentin mRNA 과발현 유무와 중간엽이행 마커(N-cadherin) mRNA 변화를 연쇄반응(Real-time PCR)을 통해 관찰한 결과이다.
도 3c : 폐암세포 NCI-H460에 vimentin 인산화 및 비인산화 점 돌연변이체를 발현시킨 후 각각의 점 돌연변이체를 발현하는 세포의 세포증식 정도를 시간별로 관찰한 결과이다.
도 3d : Vimentin 인산화 및 비인산화 점 돌연변이체를 발현시킨 폐암세포 NCI-H460에서 인서트(inset)를 이용한 이동성 실험(migration assay)을 통해서 세포의 이동성 양상을 현미경으로 관찰한 결과이다.
도 3e : 인서트(inset)를 이용한 이동성 실험(migration assay)에서 인서트를 이동한 crystal violet 염색된 암세포의 정도(intensity)를 Odyssey infrared imaging system 분석장치를 이용하여 암세포 이동성 양상을 보여주는 그래프이다.
도 3f : Vimentin 인산화 및 비인산화 점 돌연변이체를 발현시킨 폐암세포 NCI-H460에서 matrigel과 인서트(inset)를 이용한 침습성 실험(migration assay)을 통해서 세포의 침습성 양상을 관찰한 결과이다.
도 4a 내지 4h는 동물모델에서 vimentim의 인산화 및 비인산화 점 돌연변이체를 과발현하는 암세포의 전이성과 종양 형성능을 측정한 실험이다.
도 4a : Vimentin 인산화 및 비인산화 점 돌연변이체를 발현시킨 폐암세포를 정맥주사했을 때 마우스의 폐에 전이성 암생성 및 억제효과를 관찰한 결과이다.
도 4b : Vimentin 인산화 및 비인산화 점 돌연변이체를 발현시킨 폐암세포를 정맥주사했을 때 마우스에서의 전이성 암생성 및 억제효과를 각 실험군의 전이성 암 생성 빈도를 수치로 나타낸 그래프이다.
도 4c : Vimentin 인산화 및 비인산화 점 돌연변이체를 발현시킨 폐암세포를 정맥주사했을 때 각 실험군의 생존율을 그래프로 보여준 결과이다.
도 4d : Vimentin 인산화 및 비인산화 점 돌연변이체를 발현시킨 폐암세포를 정맥주사했을 때 마우스의 폐에 전이되어 생성한 암조직을 H&E 염색과 Ki-67 염색하여 각 실험군의 암생성 및 억제효과를 관찰한 결과이다.
도 4e : 마우스의 폐에 전이되어 생성한 암조직을 H&E 염색하여 각 실험군의 암생성 및 억제효과를 수치화하여 그래프로 나타낸 결과이다.
도 4f : 마우스의 폐에 전이되어 생성한 암조직을 Ki-67 염색하여 각 실험군의 암생성 및 억제효과를 수치화하여 그래프로 나타낸 결과이다.
도 4g : Vimentin 인산화 및 비인산화 점 돌연변이체를 발현시킨 폐암세포를 정맥주사했을 때 마우스에서 얻은 폐조직을 분쇄하여 상피간엽이행 단백질 마커와 면연회피 인자 단백질의 변화를 관찰한 결과이다.
도 4h : Vimentin 인산화 및 비인산화 점 돌연변이체를 발현시킨 폐암세포를 정맥주사했을 때 마우스에서 얻은 폐조직을 분쇄하여 면연회피 인자 단백질인 PD-L1의 발현의 변화를 각 실험군별로 수치화하여 나타낸 그래프이다.
도 5a 및 5b는 폐암세포에서 vimentin mRNA 발현 억제을 위해 제작한 각각의 vimentin shRNA 처리하였을 때의 vimentin 발현억제 효과를 관찰한 결과이다.
도 5a : 폐암세포 NCI-H460에 각각의 vimentin shRNA 처리로 vimentin 발현억제 정도를 단백질 발현 양상으로 보여주는 결과이다.
도 5b : 폐암세포 NCI-H460에 각각의 vimentin shRNA 처리로 vimentin 발현억제 정도를 mRNA 발현 양상으로 보여주는 그래프이다.
도 6a 내지 6j는 폐암세포에서 vimentin mRNA 발현 억제 물질인 vimentin shRNA 처리하였을 때의 상피간염이행 마커와 면역회피 인자의 변화 및 암의 이동성, 침습성의 변화를 관찰한 결과이다.
도 6a : 폐암세포 NCI-H460에 vimentin shRNA 처리로 vimentin 발현억제가 TGF-β 처리에 의해서 유도되는 암세포 전이 환경에서 상피간엽이행 마커(N-cadherin, E-cadherin) 및 면역회피 인자(PD-L1)의 단백질 발현 양상을 보여주는 결과이다.
도 6b : 폐암세포 NCI-H460에 vimentin shRNA 처리로 vimentin 발현억제가 TGF-β 처리에 의해서 유도되는 암세포 전이 환경에서 상피간엽이행 마커(N-cadherin, E-cadherin) 및 면역회피 인자(PD-L1)의 mRNA 발현 양상을 보여주는 그래프이다.
도 6c : 폐암세포 A549에 vimentin shRNA 처리로 vimentin 발현억제가 TGF-β 처리에 의해서 유도되는 암세포 전이 환경에서 상피간엽이행 마커(N-cadherin, E-cadherin) 및 면역회피 인자(PD-L1)의 단백질 발현 양상을 보여주는 결과이다.
도 6d : 폐암세포 A549에 vimentin shRNA 처리로 vimentin 발현억제가 TGF-β 처리에 의해서 유도되는 암세포 전이 환경에서 상피간엽이행 마커(N-cadherin, E-cadherin) 및 면역회피 인자(PD-L1)의 mRNA 발현 양상을 보여주는 그래프이다.
도 6e : 폐암세포 NCI-H460에 vimentin shRNA 처리로 vimentin 발현억제가 TGF-β 처리에 의해서 유도되는 암세포 전이 환경에서 72시간 후 세포의 상대적 거리에 대해 대조군을 0%라고 할 때, vimentin shRNA 처리에 의한 암세포의 이동성을 상대적 백분율로 변환한 그래프이다.
도 6f : 폐암세포 NCI-H460에 vimentin shRNA 처리로 vimentin 발현억제가 TGF-β 처리에 의해서 유도되는 암세포 침습성이 감소되는 양상을 보여주는 결과이다.
도 6g : 폐암세포 NCI-H460에 vimentin shRNA 처리로 vimentin 발현억제가 TGF-β 처리에 의해서 유도되는 암세포의 종양형성 억제 양상을 보여주는 결과이다.
도 6h : 폐암세포 NCI-H460에 vimentin shRNA 처리로 vimentin 발현을 억제 시킨 후 다시 vimentin의 원형(WT), 인산화(S339E) 및 비인산화(S339A) 점 돌연변이체를 과발현시킨 것을 면역블롯으로 관찰한 결과이다.
도 6i: 폐암세포 NCI-H460에 vimentin shRNA 처리로 vimentin 발현을 억제 조건에서 다시 vimentin의 원형(WT), 인산화(S339E) 및 비인산화(S339A) 점 돌연변이체의 과발현이 암세포의 이동성에 미치는 영향을 관찰한 결과이다.
도 6j: 폐암세포 NCI-H460에 vimentin shRNA 처리로 vimentin 발현을 억제 조건에서 다시 vimentin의 원형(WT), 인산화(S339E) 및 비인산화(S339A) 점 돌연변이체의 과발현이 암세포의 침습성에 미치는 영향을 관찰한 결과이다.
본 발명자들은 PLK1(Polo-like kinase 1)에 관하여 연구하던 중 PLK1에 의한 비멘틴(vimentin)의 인산화가 암의 전이에 기여함을 확인하고, PLK1에 의한 비멘틴의 인산화 영역을 탐색하여 이에 돌연변이를 유도한 결과 암의 이동성과 침습성이 현저하게 감소함을 확인하였으며, 또한 비멘틴 발현을 knock down시키는 경우 암의 이동성과 침습성이 현저하게 감소함을 확인하여 본 발명을 완성하였다.
PLK1은 proto-oncogene으로서 암 세포에서 과발현이 알려져 있으며, 암의 치료를 위한 타겟으로서 PLK1 분자에 관한 연구는 활발하게 진행되고 있다. 그러나, PLK1은 세포 주기(cell cycle) 등 다양한 신호전달계에 관여하는 인산화효소로서 PLK1의 억제는 종양의 성장 등을 억제하는 효과 이외에 다른 작용의 가능성을 배제하기 어려우며, 정상세포에서의 작용에 PLK1의 원래 기능을 수행이 원활하지 못하다는 문제가 있다.
PLK1은 비멘틴의 83번, 459번 위치의 serin(S) 부위에 인산화가 보고되어 있으나(Eriksson, J.E. et al., Cancer Res 67 (2007) 11106-11110; Keisuke Ikawa et al., Cell cycle 13 (2014) 126-137), 이러한 부위의 점 돌연변이체들이 암세포의 전이성이나 침습성, 종양형성을 차단하는 지에 대한 연구내용은 보고되지 않았다.
본 발명자들은 구체적인 실험을 통해 암세포, 특히 비소세포폐암에서 암의 진행단계가 높을수록 즉, 전이성 암으로 진행될수록 활성형 PLK1과 비멘틴의 발현이 증가됨을 확인하고, 비멘틴이 PLK1의 암 전이 촉진 신호전달계에 포함된 인자임을 예측할 수 있었다(실시예 1).
본 발명자들은 PLK1이 암의 증식과 전이에 관여하는 기작에서 하위 분자를 표적으로 하고자 하였으며, 구체적으로, PLK1과 비멘틴간의 상호작용을 확인하기 위하여 TGF-β로 전이성 폐암을 유도한 후 면역침강법을 수행하여 PLK1과 비멘틴의 증가된 결합을 관찰할 수 있었다(실시예 2).
한편, 비멘틴은 세포 골격 네트워크를 형성하여 세포 항상성을 유지하는 역할을 수행하는 필라멘트 단백질로서, 본 발명자들은 정상세포에서 비멘틴의 본래 기능은 유지하되 암의 전이 단계에서 작용만을 차단할 수 있는 방법을 강구하고자 하였다. 본 발명자들은 비소세포폐암, 특히 전이성 암으로 진행될수록 PLK1과 비멘틴이 과발현되고, PLK1이 비멘틴과 결합하여 비멘틴의 인산화를 유도함을 확인하였다. 즉, 암의 전이에 PLK1에 의한 비멘틴의 인산화가 필요조건으로 가정한다면 PLK1에 의한 비멘틴의 인산화만을 방지한다면 암의 전이를 억제할 수 있으므로, 본 발명자들은 PLK1에 의한 비멘틴의 인산화 영역을 탐색하여 인산화 후보 영역으로서 Thr-327, Thr-336, 및 Ser-339을 선정하였다. 이어서, 상기 위치에 아미노산을 치환한 돌연변이체를 제작하고 인산화효소 반응법을 진행하여 최종 Thr-327 및 Ser-339을 PLK1에 의한 인산화 영역으로 특정하였다(실시예 2).
이어서, 본 발명자들은 327 또는 339 위치에 세린 또는 트레오닌을 알라닌으로 치환한 돌연변이체와 상기 위치 이외에 PLK1에 의한 인산화 영역으로 보고된 83번 또는 459번 위치에 세린을 알라닌으로 치환한 돌연변이체를 발현하는 렌티바이러스를 제작하고 상기 렌티바이러스를 이용하여 암세포를 형질전환(transformation)하여 암세포의 이동성, 침습성, 및 종양형성능을 확인하였다. 그 결과, 327 또는 339 번째 아미노산이 알라닌으로 치환된 돌연변이가 형질감염된 암세포에서 특히 낮은 이동성, 침습성, 및 종양형성능을 확인할 수 있었는 바, PLK1에 의한 인산화 차단을 위한 타겟으로서 비멘틴의 327 번째 및 339 번째 아미노산이 효과적임을 알 수 있었다(실시예 3 내지 7).
보다 구체적으로, 본 발명자들은 구체적인 실험을 통해 vimentin의 인산화 및 비인산화 점 돌연변이체 각 단백질이 발현되는 NCI-H460 세포에서 암세포의 전이성을 관찰하기 위하여 암세포 이동성 실험(migration assay)을 진행하였다(도 3D-3E). 연구결과 vimentin의 인산화 점 돌연변이체(S339E, T327E, S83E)가 발현되는 실험군에서는 양성대조군인 TGF-β(2.5ng/ml)처리에 의한 경우보다도 더 많이 암세포의 이동성이 증가되는 것을 관찰하였다. 이와 상반되게 비인산화 점 돌연변이체(S339A, T327A, S83A) 단백질을 발현하는 암세포의 이동성은 감소되었다(실시예 5).
또한, 본 발명자들은 구체적인 실험을 통해 vimentin의 인산화 점 돌연변이체와 비인산화 점 돌연변이체을 이용하여 암세포에서의 침습성 촉진 및 억제 효과에 대한 실험을 진행하였다. Matrigel을 이용한 침습성 분석(invasion assay)를 이용하여 암세포의 침습성을 관찰하고자 하였다(도 3F). 먼저, 침습능을 평가하기 위하여 matrigel insert에 각각의 vimentin의 점 돌연변이체를 발현하는 세포를 혈청이 없는 배지와 함께 분주하고 실험플레이트에 혈청이 포함된 배지를 분주하여 5일 동안 배양한다. 침습된 암세포를 crystal violet으로 염색하여 관찰하고 DMSO로 녹인 후 590nm의 파장에서 흡광도를 측정한다. 연구결과, vimentin의 인산화 점 돌연변이체 단백질을 발현하는 폐암세포군에서 대조군과 vimentin의 원형 대비 침습성이 증가됨을 관찰하였다. 특히 vimentin의 S339 인산화 점 돌연변이체에서 가장 높은 암세포의 침습성을 관찰할 수 있었다. 반면에 vimentin의 비인산화 점 돌연변이체 단백질을 발현하는 폐암세포군에서는 침습성이 감소됨을 관찰하였다. 따라서 폐암세포에서 vimentin의 인산화 점 돌연변이체에 의한 암세포에서의 침습성 촉진 효과 및 vimentin의 비인산화 점 돌연변이체에 의한 암세포의 침습성 억제 효과를 관찰할 수 있었다(실시예 6).
또한, 본 발명은 구체적인 실험을 통해 동물모델에서 PLK1에 의한 vimentin의 인산화와 비인산화 점 돌연변이체를 발현하는 단백질이 암전이와 종양형성에 관여하는 알아보고자 BALB/c nude 마우스에 각각의 vimentin 돌연변이체 단백질을 과발현하고 있는 NCI-H460 세포를 꼬리 정맥 주사하여 8주 동안 사육하고 개복하여 장기에 암세포가 전이와 종양형성을 관찰하였다(도 4). Vimentin의 인산화 점 돌연변이체를 발현하는 세포를 주입한 동물군의 폐에서 대조군, 원형, 그리고 비인산화 점 돌연변이체를 발현하는 세포에 비해 암전이 및 종양형성이 많이 관찰되었다. 반면, vimentin의 비인산화 점 돌연변이체를 발현하는 세포를 주입한 동물군의 폐에서는 종양형성 능력이 낮은 것을 확인할 수 있었다. 따라서 vimentin의 PLK1에 의한 신규 인산화부위에서의 인산화 점 돌연변이체 단백질에 의한 암세포의 종양형성을 촉진하는 효과를 관찰할 수 있었으며, vimentin의 비인산화 점 돌연변이체 단백질에 의한 암세포의 종양형성능 억제 효과를 관찰하였다(실시예 7).
따라서, 본 발명은 PLK1에 의한 비멘틴의 인산화 차단 영역으로서 비멘틴의 327 번째 및 339 번째 아미노산을 타겟으로 제공할 수 있다.
또한, 본 발명은 S339 및/또는 T327 아미노산이 치환된 비멘틴 돌연변이체를 암의 예방 및 치료 용도에 제공할 수 있다.
한편, PLK1은 구조적으로 인산화효소 활성을 지닌 효소활성 도메인과 기질과 결합하는 폴로박스 도메인을 포함하고 있는바, 327 또는 339 위치에 아미노산이 치환된 비멘틴 돌연변이체는 PLK1과 결합력은 그대로 유지한다. 따라서, 상기 인산화 영역 아미노산(327번 또는 339번 아미노산)이 치환된 돌연변이체는 야생형 비멘틴과 경쟁적으로 PLK1과 결합하게 되고, 따라서 돌연변이체 농도 의존적으로 야생형 비멘틴의 인산화가 감소할 수 있다.
본 발명의 비멘틴 돌연변이체는 야생형 비멘틴 단백질에 S339 및/또는 T327이글리신, 알라닌, 발린, 루신, 아이소루신, 프롤린, 페닐알라닌, 메티오닌 또는 트립토판으로 치환된 것일 수 있으며, 구체적인 실험으로는 알라닌으로 치환한 돌연변이체를 이용하여 그 효과를 확인하였다.
이어서, 본 발명자들은 암세포에서 과발현된 비멘틴 유전자의 단백질 수준에서 발현 증가를 억제하여 암의 치료가 가능한지 확인하고자 하였다. 이에, 비멘틴 발현 억제를 위한 vimentin mRNA(Human vimentin mRNA [NM_003380])서열 중 1447-1467(타겟 #1), 1290-1310(타겟 #2), 1132-1152(타겟 #3) 위치의 뉴클레오티드 서열을 각각 타겟으로 하는 3종 shRNA를 설계하고 비멘틴 발현 억제효과를 확인하였으며, TGF-β에 의해 전이가 유도된 암세포에 처리하여 상피간엽이행 관련 인자들인 CDH1, CDH2 발현을 및 면역회피 관련 인자인 PD-L1 발현 수준을 확인하였다. 그 결과, vimetnin shRNA #1이 가장 비멘틴 발현 억제가 효과적이었으며, 이러한 shRNA #1 의한 vimentin 발현 억제를 유도한 폐암세포에서 CDH1, CDH2 및 PD-L1 발현이 현저하게 감소됨을 관찰하였다. 또한 vimentin shRNA이 의한 vimentin 발현 억제는 TGF-β 처리에 의한 암전이 환경에서 상피간엽이행 관련 인자들의 발현을 억제하는 것을 발견하였다(실시예 8).
이에, shRNA #1을 비멘틴 발현 감소용 shRNA로 선정하고, 이를 발현하는 렌티바이러스로 폐암세포(NCI-H460)를 감염시켜 migration assay를 72시간 동안 진행하였다(도 6e). 그 결과 폐암세포에 vimentin shRNA를 발현시킨 경우 72시간에 약 -10% 이하로 세포의 상대적 전이성이 감소됨을 관찰하였다. 또한 같은 시간에 TGF-β 처리한 암전이 유도 조건에서도 vimentin shRNA 발현군에서 약 -8% 이하로 암세포의 전이성이 감소됨을 관찰하였다. Vimentin의 mRNA 발현을 억제하는 shRNA을 발현시킨 경우, 암세포 자체의 전이성과 함께 TGF-β 처리한 암전이 유도 조건에서도 현저한 암전이 억제 효과를 나타냄을 발견하였다(실시예 9)
또한, 본 발명은 구체적인 실험을 통해 상기 선정된 shRNA이 암세포의 침습성에 미치는 영향을 확인하기 위하여 matrigel로 만든 3차원 transwell 배양시스템을 이용하여 암세포의 침습성을 관찰하였다. 침습된 세포의 경우 crystal violet staining 후에 염색된 세포수를 직접 세어서 침습된 세포의 정도를 관찰할 수 있었다. 양성 대조군인 TGF-β을 처리한 폐암세포의 경우 대조군에 비해 약 15배정도의 세포가 침습함을 관찰하였다. Vimentin shRNA를 발현시킨 세포의 경우는 대조군 보다 침습성이 감소됨을 관찰하였다. 또한 TGF-β을 처리한 암전이 조건에서 vimentin shRNA를 발현시킨 세포의 경우 양성 대조군인 TGF-β을 처리한 폐암세포보다 약 30배 정도 침습성이 감소되는 것을 관찰할 수 있었다. Vimentin의 mRNA 발현을 억제하는 shRNA을 발현시킨 경우, 암세포 자체의 침습성과 함께 TGF-β 처리한 암전이 유도 조건에서도 암세포의 침습성을 효과적으로 억제함을 발견하였다(실시예 10).
또한, 본 발명은 구체적인 실험을 통해 선정된 vimentin shRNA 발현용 렌티바이러스로 폐암세포의 종양형성 억제효과에 vimentin shRNA가 미치는 영향을 확인하고자 콜로니형성 에세이(colony formation assay)를 진행하였다(도 6g). 연구 결과, 암세포 덩어리인 종양이 대조군 대비 양성 대조군인 TGF-β 처리에 의해 약 2배 더 많이 형성되었고, vimentin shRNA를 발현시킨 경우 대조군 대비 종양형성이 감소됨을 관찰하였다. 또한 TGF-β 처리한 암전이 유도 조건에서도 vimentin shRNA 발현군에서 대조군 또는 양성대조군 대비 종양형성이 감소됨을 관찰하였다. Vimentin의 mRNA 발현을 억제하는 shRNA을 발현시킨 경우, 암세포 자체의 종양형성과 함께 TGF-β 처리한 암전이 유도 조건에서도 현저한 종양형성 억제 효과를 나타냄을 발견하였다(실시예 11).
이에, 본 발명은 상기 비멘틴 발현 억제용 shRNA 및/또는 이를 발현하는 벡터를 포함하는 암의 예방 또는 치료용 약학적 조성물을 제공한다.
이어서, 본 발명자들은 암의 이동성 및 침습성을 감소시킬 수 있는 상기 shRNA와 상술한 비멘틴 돌연변이체를 동시에 암세포에서 발현시켜 암 세포의 이동성 및 침습성에 미치는 영향을 확인하고자 하였다. 한편, shRNA에 의한 비멘틴 발현 억제 조건에서 비멘틴의 인산화가 세포의 이동성 및 침습성에 미치는 영향을 동시에 확인하고자 shRNA와 비멘틴 인산화 돌연변이체를 동시에 암세포의 발현시켜 이동성과 침습성을 확인하였다. 그 결과, shRNA에 의해 vimentin 발현이 억제되는 조건에서 각각의 비멘틴 돌연변이체는 잘 발현되고, vimentin 발현 억제 조건에서 인산화 비멘틴은 세포의 이동성과 침습성을 증가시키는 바, 비멘틴의 인산화가 암세포의 침습성에 강력한 촉진 효과가 있음을 확인할 수 있었다. 따라서, 비멘틴의 발현억제가 비멘틴 돌연변이체에 의한 비멘틴 인산화 억제가 동시에 수행되는 경우 각각 독립적으로 수행되는 경우보다 현저하게 암세포의 침습성 및 이동성을 감소시켜 전이암의 발생을 예방할 수 있음을 알 수 있다(실시예 12).
이에, 본 발명은 비멘틴 발현 억제용 shRNA 및 비멘틴 비인산화 돌연변이체를 항암제로 제공할 수 있다.
본 발명의 항암용 조성물내 상기 비멘틴 shRNA와 비멘틴 돌연변이체는 세포 내 발현을 위한 벡터에 포함되어 제공될 수 있으며, 벡터는 하나의 또는 별개 벡터에 로딩되어 제공될 수 있고, 별개의 벡터로 제공되는 경우 동시에 또는 순차로 개체에 투여하여 암의 예방 또는 치료에 이용될 수 있다.
본 발명의 비멘틴 shRNA 및 비멘틴 돌연변이체는 세포 내로의 효율적인 도입을 가능하게 하는 전달체 내에 포함된 형태일 수 있다. 상기 전달체는 바람직하게는 벡터이며, 바이러스 벡터 및 비-바이러스 벡터 모두 사용 가능하다. 바이러스 운반 메카니즘은 렌티바이러스(lentivirus), 레트로바이러스(retrovirus), 아데노바이러스(adenovirus), 허피스바이러스(herpes virus) 및 아비폭스바이러스(avipox virus) 등을 포함하나, 이에 제한되는 것은 아니다. 비-바이러스성 운반 메카니즘은 지질 매개 트랜스펙션, 리포좀, 면역리포좀, 리포펙틴, 양이온성 표면 양친매물질 및 이의 조합물을 포함할 수 있다. 본 발명에서 비멘틴 shRNA 및 돌연변이체 전달을 위한 바이러스 벡터(viral vector)로서 이용한 렌티바이러스는 레트로바이러스의 일종으로 핵공(nucleopore)이나 완전한 핵막으로의 능동 도입을 가능하게 하는 사전-통합 복합체(바이러스"쉘(shell)")의 친핵성으로 인해 분열 세포뿐만 아니라 미분열 세포도 감염시킬 수 있는 특징이 있다.
이에, 본 발명은 상기 비멘틴 돌연변이를 암호화한 유전자를 포함하는 재조합 벡터를 제공하며, 상기 벡터는 바이러스 벡터로 제공되어 유전자 치료 기반의 항암제로 이용될 수 있다.
본 발명의 비멘틴 shRNA는 비멘틴 유전자의 특정 타겟(#1~3) 영역과 상보적인 서열을 갖는 올리고뉴클레오티드로서 비멘틴 발현 억제용 shRNA를 의미한다. 본 발명의 shRNA는 표준 분자 생물학 기술, 예를 들어 화학적 합성 방법 또는 재조합 방법을 이용하여 분리 또는 제조하거나 시판되는 것을 사용할 수 있으며, 유전공학적 방법을 이용하여 제조된 것을 사용할 수 있다.
본 발명에서 돌연변이체는 비멘틴 단백질을 구성하는 하나 이상의 아미노산이 치환(substitution)된 것을 의미하고, 다른 말이 없다면, 본 명세서에서 암 세포의 이동성 및 침습성과 종양형성을 감소시켜 항암 효과를 갖는 돌연변이체는 비멘틴의 T327 및/또는 S339 아미노산이 치환된 것을 의미한다.
본 명세서에서 사용되는 용어 '항암'은 암세포의 증식을 억제하거나 사멸하는 작용 및 암세포의 전이를 억제하거나 차단하는 작용을 의미하는 것으로, 암의 예방 및 치료 모두를 의미하고 이와 혼용될 수 있다. 본 명세서에서 사용되는 용어 '예방'은 조성물의 투여로 암 형성을 억제시키거나 발병을 지연시키는 모든 행위를 의미하는 것이며, '치료'란 조성물의 투여로 상기 질환의 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하는 것이다.
본 발명의 항암제는 상술한 shRNA와 돌연변이체 이외에 비멘틴의 인산화를 억제하거나 이의 발현을 감소시키는 것으로 알려진 여타의 물질, 예를 들어 화합물, 천연물, 신규 단백질 등을 추가로 포함할 수 있다.
또한, 본 발명의 항암제는 vimentin의 발현이 과다한 다양한 대장암, 전립선암, 유방암 및 위암 등의 각종 고형암 및 백혈병 등의 예방 및 치료에 이용될 수 있으며, 또한 일차암에서 전이되어 유발된 전이성 고형암의 예방 및 치료에도 이용될 수 있다.
본 발명의 비멘틴 돌연변이체 및 이를 발현하는 벡터를 포함하는 암 예방 또는 치료용 약학적 조성물은 통상적으로 사용되는 부형제, 붕해제, 감미제, 활택제 또는 향미제 등을 포함할 수 있으며, 통상적인 방법에 의해 정제, 캡슐제, 산제, 과립제, 현탁제, 유제, 시럽제 및 기타 액제로 제제화될 있다. 구체적으로, 본 발명의 세포사멸 활성화제는 경구 투여를 위해서, 예를 들면 알약(troches), 정제(lozenge), 수용성 또는 유성 현탁액, 조제분말 또는 과립, 에멀젼, 하드 또는 소프트 캡슐, 시럽 또는 엘릭시르제 (elixirs)로 제제화될 수 있다. 이때, 정제 및 캡슐로 제제화하기 위해서는 락토오스, 사카로오스, 솔비톨, 만니톨, 전분, 아밀로펙틴, 셀룰로오스 또는 젤라틴과 같은 결합제; 디칼슘 포스페이트와 같은 부형제; 옥수수 전분 또는 고구마 전분과 같은 붕해제; 스테아르산 마그네슘, 스테아르산 칼슘, 스테아릴푸마르산 나트륨 또는 폴리에틸렌글리콜 왁스와 같은 윤활유를 첨가할 수 있다. 또한, 캡슐제로 제제화할 경우, 상기에서 언급된 물질 이외에도 약제학적으로 허용가능한 담체를 1종 이상 포함하여 제조할 수 있다. 예를 들면, 약제학적으로 허용 가능한 담체로는 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올, 리포좀 및 이들 성분 중 하나의 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액 및 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한, 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액 및 유탁액 등과 같은 주사용 제형으로 제제화할 수 있으며, 표적 세포에 특이적으로 작용할 수 있도록 표적 세포에 특이적인 항체 또는 기타 리간드를 상기의 담체와 함께 결합시켜 사용할 수 있다. 덧붙여, 당해 기술분야의 적정한 방법 또는 레밍턴의 문헌(Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA)에 게재되어 있는 방법 등을 이용하여 각 질환 또는 성분에 따라 바람직하게 제제화할 수 있다.
본 발명의 조성물은 비경구로 투여할 수 있으며, 비경구로 투여할 경우, 정맥주사, 근육내 주사 또는 흉부내 주사 주입방식에 의해 투여하는 것이 바람직하다. 비경구 투여용으로 제제화하기 위해서는 상기 세포사멸 촉진 항암제를 안정제 또는 완충제와 함께 물에 혼합하여 용액 또는 현탁액으로 제조할 수 있고, 이를 앰플 또는 바이알의 단위 투여형으로 제제화할 수 있다.
투여량은 체내에서 활성성분의 흡수도, 불활성화율 및 배설속도, 환자의 연령, 성별 및 상태, 치료할 질병의 중증 정도에 따라 선택하는 것이 바람직하며, 본 발명의 암세포사멸 촉진 항암제는 성인의 체중 1㎏ 당 1 내지 100 ㎎, 바람직하게는 1 내지 10 ㎎의 투여양으로 매일 1회 내지 수회로 나누어 투여할 수 있다.
본 발명은 다양한 변환을 가할 수 있고 여러 가지 실시예를 가질 수 있는 바, 이하 특정 실시예들을 도면에 예시하고 상세한 설명에 상세하게 설명하고자 한다. 그러나, 이는 본 발명을 특정한 실시 형태에 대해 한정하려는 것이 아니며, 본 발명의 사상 및 기술 범위에 포함되는 모든 변환, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다. 본 발명을 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 본 발명의 요지를 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.
<실시예 1> 전이성 폐암세포에서 vimentin과 활성형 PLK1의 임상적 연관성 및 TGF-β에 의해 유도된 암전이 조건에서 vimentin과 활성형 PLK1의 발현 분석
최근 연구(Shin S.B. et al., Oncogene 39 (2020) 767-785)에서 비소세포폐암 세포에서 PLK1에 의해서 유도된 암전이 과정동안 ECM-adhesion 관련 유전자들의 변화를 관찰하였다(도 1a). Vimentin은 TGF-β에 의해 유도된 암전이에 관련된 주요한 ECM 조절인자이며(Liu C.U. et al., Oncotarget 6 (2015) 15966-15983; Mendez M.G. et al., FASEB J 24 (2010) 1838-1851) 암세포의 침윤과정동안 PLK1에 의해서 인산화 되는 기질 단백질이다(Rizki A. et al., Cancer Res 67 (2007) 11106-11110). 그러나 GeneMANIA 데이터베이스의 분석을 통해서 나온 결과에서는 PLK1과 vimentin의 상호작용 네트워크는 확인할 수 없었다(도1 B). 따라서 PLK1과 vimentin의 관련성을 규명하고자 연구를 진행하였다.
먼저 vimentin과 PLK1이 임상적 연관성을 확인하기 위해서 비소세포폐암 환자에서 vimentin과 PLK1의 단백질 발현량에 따른 환자의 전체 생존율을 빅데이터를 분석을 통해서 확인하였다(도 1c). 먼저 비소세포폐암 중 선암(adenocarcinoma)에서는 PLK1과 vimentin 발현이 높은 환자의 생존율은 PLK1과 vimentin의 발현이 낮은 환자의 생존율에 비해 현저히 낮은 것을 확인할 수 있었다. 하지만 편평상피세포암(Squamouse cell carcinoma)에서는 PLK1과 vimentin 발현과 환자의 생존율과는 연관성이 관찰되지 않았다. 또한 폐선암 환자 중 암진행 단계가 높을수록 즉, 전이성 암으로 진행될수록 PLK1과 vimentin 발현이 높은 환자의 생존율은 PLK1과 vimentin의 발현이 낮은 환자의 생존율에 비해 점점 현저하게 감소하는 것을 관찰할 수 있었다(도 1d). 이상의 결과로 비소세포폐암 중 선암에서 PLK1과 vimentin 발현양과 환자의 생존율의 연관성을 확인할 수 있었으며, 특히 암전이가 많이 진행된 환자에서 PLK1과 vimentin 발현양이 높으며, 그 생존율에도 큰 영향을 주는 것으로 확인할 수 있었다.
본 발명자는 전이성 폐암에서 vimentin과 PLK1의 발현을 알아보기 위해서 폐암세포에 TGF-β을 처리하여 암전이를 유도한 조건에서 microarray을 진행한 데이터(GSE 114761)를 분석하여 히트맵을 구성하였다(도 1e). 히트맵 분석을 통하여 간엽이행 마커인 CDH2, SNAIl 및 SMAI2은 높고, 상피형질 마커인 CDH1과 OCLN은 낮은 암전이 조건에서 vimentin과 PLK1 mRNA 발현이 TGF-β를 처리한 폐암세포에서 높은 것을 알 수 있었다.
폐암의 상피간엽이행 과정에서 PLK1과 vimentin의 발현 변화와 PLK1의 활성화여부를 알아보고자 비소세포폐암 세포주 A549와 NCI-H460에 TGF-β를 처리하여 암전이를 유도한 후 mRNA 발현량과 단백질 발현량을 분석하였다. 먼저 TGF-β를 처리한 군에서 간엽이행 마커인 CDH2, SNAl1 SNAI2의 mRNA 발현량 증가와 상피형질 마커인 CDH1의 mRNA 발현량이 감소하는 것을 관찰하였다. 이 조건에서 대조군에 비하여 PLK1과 vimentin의 mRNA 발현량의 증가를 관찰할 수 있었다(도 1f). 또한 vimentin, PLK1, E-cadherin과 N-cadherin의 단백질량도 mRNA 발현량과 같은 결과를 관찰하였다(도 1g). 추가적으로 활성화형인 인산화된 PLK1의 단백질 발현량이 대조군에 비해 TGF-β 처리군에서 높게 발현되는 것을 관찰할 수 있었다(도 1g-1h).
이러한 결과는 폐암에서 특히 폐선암에서 PLK1과 vimentin의 발현이 높을 뿐만 아니라 발현 패턴도 유사하며, 임상적으로도 상호연관성을 가지는 것을 시사하였다.
<실시예 2> TGF-β에 의해 유도한 전이성 폐암세포에서 활성형 PLK1에 의한 vimentin의 인산화 및 신규 인산화 부위 확인
TGF-β처리에 의해서 유도된 암전이 조건에서 PLK1과 vimentin의 상호작용을 탐구하기 위하여 면역침강법을 수행하였다. Agarose beads와 PLK1 항체로 PLK1 단백질을 침강하였으며 면역블롯법을 통해서 분석하였다. Vimentin은 대조군에서도 PLK1과 결합하였고, TGF-β에 의해 암전이를 유도한 실험군에서는 PLK1과 vimentin의 결합이 증가되었다(도 2a-2b). 상기 결과는 전이 과정에 암세포에서 PLK1과 vimentin의 상호작용이 보다 활발함을 시사한다.
다음으로 두 단백질의 상호작용 방법을 분석하기 위하여 인산화효소 반응법을 수행하였다. 세린/트레오닌 인산화효소인 PLK1이 vimentin을 기질로서 인산화 시키는지 증명하는 방법으로 정제된 vimentin 원형(wild)과 활성형 PLK1-T210D을 방사선이 표지된 r32-P-ATP을 함께 처리하여 반응시키고 분석하였다. Vimentin은 양성대조군인 TCTP과 유사한 수준으로 강하게 활성형 PLK1-TD에 의해 인산화되었다(도 2c).
PLK1에 의한 vimentin의 인산화 부위를 찾기 위하여 액체크로마토그래피 질량분석법을 진행하였다. 본 분석법으로 vimentin의 Thr-327, Thr-336, Ser-339가 PLK1에 의해 인산화되는 부분으로 예측되었다(도 2d). 예측된 vimentin의 인산화 부분 3곳과 PLK1에 의한 vimentin을 인산화 시킨다고 보고된 2곳을 부분 특이적 돌연변이 치환법을 이용하여 알라닌으로 치환된 탈인산화 돌연변이체로 제작하였다.
상기 제작된 돌연변이체를 GST가 표지된 단백질로 생산하였고 정제하여 인산화효소 반응법을 진행하였다. Vimentin의 인산화 예측 부위 3가지 중에서 Thr-327과 Ser-339의 알라닌 돌연변이가 원형과 비교했을 때 인산화 정도가 두드러지게 감소하였다(도 1e). 이러한 연구 결과는 PLK1이 vimentin Thr-327과 Ser-339의 인산화반응을 통하여 상호작용한다는 것을 알 수 있었다.
또한 TGF-β처리하여 암전이를 유도한 폐암세포주 A549와 NCI-H460에서 인산화효소(phosphatase) 처리 후 인산화된 vimentin과 PLK1의 발현량이 감소한 것을 관찰하였다(도 2f-2g). 상기 결과로부터 TGF-β처리로 유도된 암전이 동안 vimentin과 PLK1이 인산화됨을 알 수 있다.
<실시예 3> Vimentin의 인산화 및 비인산화 점 돌연변이형 발현을 위한 렌티바이러스 시스템 구축
본 발명자들은 vimentin의 인산화 및 비인산화 유전자 발현을 위한 lentivirus system 구축을 위하여 pLVX-TRE3G-eRFP 에, Mlu1과 Apa1으로 cutting후, vimentin 원형(WT) 플라스미드를 5' -ACGGGGCCCATGTCCACCAGGTCCGTGTC-3'(forward primer)와 5' -ACGACGCGTTTATTCAAGGTCATCGTGA-3'(reverse primer)의 프라이머를 이용하여 PCR로 증폭시킨 후 이를 Mlu1과 Apa1으로 cutting후, 벡터 pLVX-TRE3G-eRFP에 서브클로닝하였다. 렌티 바이러스 시스템을 구축하기 위해서 pCMV-VSV.G와 pCMV-△8.2, pLVX-TRE3G-eRFP-Target 또는 pLVX-Tet3G DNA를 HEK293 cells에서 발현시키고자 transfection 하여 렌티 바이러스를 발현시켜 바이러스를 모은 후 이를 암세포에 사용하고자 하였다. Transfection 후 바이러스 배양액은 12시간 간격으로 72시간까지 모았으며, 0.2 mm 필터로 배양액을 필터하고 17000 rpm, 4℃ 90분 동안 원심분리하였다. 상등액은 버리고 TNE Buffer로 모아진 바이러스를 모은 후 4℃에 보관하여 다음날부터 암세포 감염에 사용하였다.
<실시예 4> 렌티바이러스를 이용한 vimentin의 활성형 및 비활성형 유전자 발현 세포 선별 후 상피간엽이행 효과 평가
점 돌연변이를 포함하는 vimentin 단백질의 암세포 상피간엽이행 조절효과를 검토하기 위하여, 폐암세포에 vimentin의 인산화 및 비인산화 점 돌연변이체가 발현시키는 렌티바이러스를 감염시키고자 다음과 같이 암세포를 배양하였다.
폐암 세포인 NCI-H460에 vimentin의 원형 및 인산화와 비인산화된 점 돌연변이체를 발현시키는 안정화된 세포주를 구축하기 위해서 먼저 pLVX-Tet3G 발현성 렌티바이러스를 감염시키고 G418을 5일 동안 처리하여 감염된 세포를 선별하였다. 이렇게 선별된 NCI-H460Tet3G 세포에 vimentin의 원형 및 인산화된 점 돌연변이형(S339E, T327E, S83E, S459E)와 비인산화된 점 돌연변이형(S339A, T327A, S83A, S459A)을 발현시키는 렌티바이러스를 감염시킨 후 puromycin을 48시간동안 처리하여 안정화된 세포주를 구축하였다. 구축된 세포에 1ug/ml doxycycline 처리하여 vimentin의 원형 및 인산화와 비인산화형의 점 돌연변이형을 발현을 유도 후 각각의 vimentin의 점 돌연변이체가 잘 발현되었는지 mRNA 발현량과 단백질 발현량을 확인하였다. 도 3a-3b에서와 같이, vimentin의 원형 및 각각의 점 돌연변이형이 잘 발현되고 있는 것을 mRNA 발현량과 단백질 발현량을 통해서 확인하였다. 인산화 부위 S459를 제외하고, 인산화형의 vimentin이 발현되는 폐암세포에서 비인산화형 vimentin를 발현하고 있는 세포에서 보다 N-cadherin의 발현이 높은 것을 관찰하였다. 또한 이러한 vimentin의 인산화 및 비인산화 점 돌연변이체 발현이 세포의 증식에 영향을 주는지 확인해 본 결과, 세포의 증식에는 큰 영향을 미치지 않는 것으로 관찰되었다(도 3c).
이상의 결과로, 폐암세포에서 vimentin의 인산화가 상피간엽이행을 촉진하는 효과를 시사하였다.
<실시예 5> Vimentin의 인산화 및 비인산화 점 돌연변이를 포함하는 단백질에 의한 전이성 촉진 및 억제 효과 평가
Vimentin 원형, 인산화 및 비인산화 점 돌연변이체 단백질을 발현시키는 폐암세포 NCI-H460에서 이들 점 돌연변이체가 암세포의 이동성에 미치는 효과를 관찰하기 위해 세포이동성 실험(migration assay)을 실시하였다.
구체적으로, 각각의 vimetnin 원형, 인산화 및 비인산화 점 돌연변이체 단백질을 발현시키는 폐암세포 NCI-H460을 5 x 104 개의 세포를 8.0 μm, 24 well insert에 분주하고 24 well plate에 10% 혈청(FBS)이 포함된 배지를 분주한 뒤 inset를 넣어 주었다. 양성 대조군의 경우, 2.5 ng/ml TGF-β가 포함된 RPMI 1640(10% FBS)를 0.5 ml 분주하여 사용하였다. 세포분주 72시간 후, 4% 파라포름알데히드(paraformaldehyde) 500 ㎕를 분주하고 1XPBS로 3회 세척하여 0.05% crystal-violet 용액으로 5분간 염색하였다. 5분 후 1XPBS로 5회 세척하였고, 염색된 정도(intensity)를 Odyssey infrared imaging system을 이용하여 측정하였다. 대조군의 염색된 정도(intensity)를 1이라고 할 때 각 실험군에서의 상대적 염색된 정도를 산출하여 그래프를 표시하였다.
연구 결과, vimentin 인산화 점 돌연변이체 단백질을 발현시킨 실험군에서 양성대조군인 TGF-β 처리군과 유사하거나 더 높게 염색강도(intensity) 수치가 대조군 대비 5배까지 증가하였으며, 상대적으로 vimentin 인산화 돌연변이체에 비해 비인산화 점 돌연변이체 실험군은 염색강도가 낮은 것을 관찰할 수 있었다(도 3d-3e). 하지만 vimentin의 S459번 인산화 돌연변이체는 암세포 이동성에 영향을 주지 않는 것을 관찰할 수 있었다. 이상의 결과로 vimentin 인산화 점 돌연변이체는 폐암세포의 이동성을 촉진하며, 반면에 vimentin 비인산화 점 돌연변이체는 폐암세포의 이동성을 억제하는 효과가 뛰어남을 알 수 있었다.
<실시예 6> Vimentin의 인산화부위 및 비인산화 점 돌연변이를 포함하는 단백질에 의한 침습성 촉진 및 억제 효과 평가
Vimentin 원형, 인산화 및 비인산화 점 돌연변이체 단백질을 발현시키는 폐암세포 NCI-H460에서 이들 점 돌연변이체가 암세포의 침습성에 미치는 효과를 관찰하기 위해 matrigel을 이용한 침습성 실험(invasion assay)을 실시하였다.
구체적으로, 4℃에서 16~20시간동안 matrigel을 완전히 녹인 후 matrigel을 1 mg/ml이 되도록 차가운 serum free RPMI 1640(4℃)으로 희석하였다. 이를 8.0 μm, 24 well 인서트(insert)에 100 μl 의 matrigel mixture(1 mg/ml)를 넣고 37℃배양기에서 12-20시간 동안 굳혀주었다. 굳은 matrigel insert에 각각의 vimentin 원형, 인산화 및 비인산화 점 돌연변이체 단백질을 발현시키는 폐암세포 NCI-H460들을 1X105 cells/well의 세포수로 serum free RPMI 1640 (36℃)에 희석하여 insert에 분주하였다. 여기에 36℃의 따뜻한 RPMI 1640 (10% FBS)을 0.5 ml/well씩 분주하였다. 양성 대조군의 경우 2.5 ng/ml TGF-β가 포함된 36℃ RPMI 1640(10% FBS)를 0.5 ml 분주하여 사용하였다. 이 후 3일에 한 번씩 배지를 교환해주고 침습되는 정도를 관찰하였으며, 암세포의 침습이 충분히 일어난 것으로 관찰된 5일 차에 배지를 제거하고 1XPBS로 세척한 후, insert 안쪽의 cell들을 면봉으로 긁어 내었고, 1XPBS로 세척하여 insert 내부에 cell과 matrigel의 잔여물이 남지 않도록 제거하였다. Insert 바깥 면이 있는 24 well에 4% paraformaldehyde 500ul를 분주하고 5분간 실온에서 incubation한 후 1XPBS로 3회 세척하여, 0.05% crystal-violet 용액으로 5분간 염색하였다. 5분 후 1XPBS로 5회 세척하였고, 염색된 정도를 DMSO로 녹인 후 590nm에서 파장을 측정하였다. 대조군의 흡광도를 1이라고 할 때 각 실험군에서의 상대적 흡광도를 산출하여 그래프를 표시하였다.
연구 결과, vimentin 인산화 점 돌연변이체 단백질을 발현시킨 실험군에서 양성대조군인 TGF-β처리군과 유사하거나 더 높게 흡광도 수치가 대조군 대비 4배에서 6배까지 증가하였으며 상대적으로 vimentin 비인산화 점 돌연변이체 실험군은 상대적 흡광도가 더 낮아진 것을 관찰할 수 있었다(도 3f). 따라서 vimentin 비인산화 점 돌연변이체는 폐암세포의 이동성과 침습성을 억제하는 효과가 뛰어남을 알 수 있었다.
<실시예 7> 동물모델에서 vimentin의 인산화부위 및 비인산화 점 돌연변이를 포함하는 단백질에 의한 암세포의 전이성 및 종양형성능 평가
본 발명자들은 동물모델에서 암세포의 종양 형성능을 관찰하기 위해 vimentin의 인산화 및 비인산화 점 유전자가 발현되는 암세포를 이용하여 암세포의 종양형성 촉진 및 억제 효과를 평가하고자 하였다.
구체적으로, 점 돌연변이를 포함하는 vimentin 단백질이 안정적으로 발현되는 NCI-H460 폐암세포(2X106 세포수)를 PBS에 넣어 마우스의 꼬리 정맥에 주사하여, 8주 동안 사육하고, 개복하여 장기에 암세포가 전이 및 종양형성능을 관찰하였다. 비교를 위해 대조군(Mock; 목적유전자가 발현되지 않는 렌티바이러스 처리군), vimentin 단백질 발현되는 NCI-H460 폐암세포주 투여군(WT), 인산화 점 돌연변이체 vimentin 단백질 발현되는 NCI-H460 폐암세포주 투여군(S339E, T327E, S83E), 비인산화 점 돌연변이체 vimentin 단백질 발현되는 NCI-H460 폐암세포주 투여군(S339A, T327A, S83A)에 대해서 암세포 전이 및 종양형성 여부를 관찰하였다. 각 실험군 마다 5마리의 마우스에 대하여 실험을 실시하고, 폐에서의 전이성 암인 종양형성 빈도수를 측정하여 그래프로 표시하였다(도 4).
도 4에 나타낸 바와 같이, 대부분의 종양은 폐에 생성되었고, 따라서 본 실험도 폐를 중심으로 분석하였다. 대조군(Mock)과 vimentin 원형 대비 인산화 점 돌연변이를 포함하는 vimentin 단백질이 발현되는 NCI-H460 세포를 투여한 실험군에서는 종양형성능이 비교적 높은 것을 관찰하였다. 특히 vimentin 인산화 점 돌연변이체 중 S339E 실험군에서는 생성된 종양의 수나 크기를 관찰했을 때 가장 높은 종양형성능을 확인할 수 있었다. 반대로 비인산화 점 돌연변이를 포함하는 vimentin 단백질이 발현되는 NCI-H460 세포를 투여한 실험군에서는 종양형성능이 비교적 낮은 것을 관찰하였다(도 4a-4b). 추가적으로 각 동물실험군들의 생존율을 관찰한 결과, vimentin 비인산화 점 돌연변이체 실험군에 비해서 인산화 돌연변이체 실험군 (S339E, S83E)에서 동물의 생존율이 낮은 것을 확인할 수 있었다(도 4c). 또한, H&E(Haematoxylin and eosin)과 Ki67 염색을 통해서 vimentin 인산화 점 돌연변이체 실험군에서 암세포 증식정도가 높은 것을 알 수 있었다(도 4d-4f). 이는 동물모델에서 vimentin의 인산화 점 돌연변이체를 발현하는 암세포는 암전이성과 종양형성능을 촉진시키며, 반대로 비인산화 점 돌연변이체는 암전이성과 종양형성능을 억제하는 것을 확인할 수 있었다.
다음으로 폐의 일부를 용해하여 상피간엽이행 마커의 단백질 수준을 관찰한 결과, vimentin 인산화 점 돌연변이체의 실험군에서 중간엽 마커인 N-cadherin의 단백질 수준이 증가하였으며, E-cadherin의 수준은 감소하였다. 또한 면역회피에 관여하여 암세포의 종양형성능을 증가시킨다고 알려진 PD-L1과 PD-L2의 발현도 각 실험군에서 확인한 결과, vimentin 인산화 점 돌연변이체 실험군에서 특히 PD-L1의 발현이 높게 관찰되었다(도 4g). 종양형성능이 가장 크게 관찰되었던 vimentin 인산화 점 돌연변이체 중 S339E 실험군에서 역시 PD-L1 단백질 발현도 가장 높게 관찰되었다(도 4h). 따라서 vimentin의 인산화가 상피간엽이행과 전이성과 종양형성능을 증진시킴을 시사한다. 반면, 본 발명의 비인산화 점 돌연변이체 특히, S339A 실험군은 원형의 vimentin 실험군보다 낮은 전이성과 암세포의 종양형성능을 억제하는 효과가 뛰어남을 알 수 있다.
<실시예 8> TGF-β 처리에 의한 전이환경에서 vimentin shRNA의 상피간엽이행 억제 효과 평가
Vimentin의 mRNA 발현 억제 효과를 확인하기 위해서, shRNA 및 이를 포함하는 렌티바이러스를 제작하였다.
구체적으로 vimentin의 mRNA 발현을 억제하기 위하여 사람의 vimentin mRNA(Human vimentin mRNA [NM_003380])서열 중 1447-1467(타겟 #1), 1290-1310(타겟 #2), 1132-1152(타겟 #3) 위치의 뉴클레오티드 서열을 각각 타겟으로 하는 shRNA를 만들고자 하기 표 1의 프라이머를 제작하였다.
타겟 #no 프라이머 서열 서열번호
타겟 #1 Forword 5'- CCGGGTGAAATGGAAGAGAACTTTGCTCGAGCAAAGT TCTCTTCCATTTCACTTTTTG -3' 5
Reverse 5'-AATTCAAAAAGTGAAATGGAAGAGAACTTTGCTCGAGCAAAGTTCTCTTCCATTTCAC -3 6
타겟 #2 Forword 5'-CCGGGCAGAAGAATGGTACAAATCCCTCGAGTTATTTGTACCATTCTTCTGCTTTTTG-3 7
Reverse 5'-AATTCAAAAAGCAGAAGAATGGTACAAATCCCTCGAGTTATTTGTACCATTCTTCTGC-3 8
타겟 #3 Forword 5'-CCGGTGAAGAAACTCCACGAAGAGGCTCGAGCCTCTTCGTGGAGTTTCTTCATTTTTG-3' 9
Reverse 5'-AATTCAAAAATGAAGAAACTCCACGAAGAGGCTCGAGCCTCTTCGTGGAGTTTCTTCA-3' 10
제작된 shRNA는 하기 표 2와 같다.
shRNA #no 서열 서열번호
shRNA #1 GTGAAATGGAAGAGAACTTTG 11
shRNA #2 GCAGAAGAATGGTACAAATCC 12
shRNA #3 TGAAGAAACTCCACGAAGAGG 13
이를 기반으로 pLKO-puro.1 벡터를 이용한 pLKO-puro.1-vimentin shRNA 플라스미드를 제작하였다. 이를 pHR'-CMV-VSVG, pHR'-CMV-deltaR8.2와 함께 HEK293 세포 형질감염을 통해 발현시킨 후, 세포의 배양배지를 모아 렌티바이러스를 생산하였다. 원심분리기를 이용하여 상기 렌티바이러스를 농축시켰다. 바이러스 발현 확인을 위하여 NCI-H460, A549 세포를 5X104 개/ml으로 배양한 후, 다음 날 감염 버퍼(Infection Buffer; 10mM HEPES, 1 mg/ml 폴리브렌에 렌티바이러스를 20 μ/well로 첨가하여 암세포를 감염시켰다. 24시간이 지난 후 puromycine를 48시간 동안 처리하여 vimentin shRNA 감염된 세포를 선별하였다. 먼저 본 발명자는 제작한 vimentin shRNA에 의한 vimentin 발현억제 효과를 확인하고자 puromycine 처리를 통하여 선별된 각각의 vimentin shRNA에 감염된 세포에서 vimentin의 mRNA 발현과 단백질 발현정도를 확인하였다.
도 5에 나타낸 바와 같이 각각의 vimentin shRNA (shvimentin)에 감염된 폐암세포 NCI-H460는 대조군 shRNA(shCtrl)에 감염된 세포에 비하여 vimentin의 mRNA의 발현이 감소하였고, 이는 vimentin의 발현이 억제되었음을 관찰하였다. 특히 vimentin mRNA 서열에서 1447-1467(타겟 #1) 위치의 뉴클레오티드 서열을 타겟으로 하는 shRNA가 vimentin의 발현억제 효과가 가장 좋은 것으로 관찰되었다. 따라서 본 발명자는 하기에 vimentin 발현억제 연구 시에 vimentin mRNA 서열에서 1447-1467(타겟 #1) 위치의 뉴클레오티드 서열을 타겟하는 shRNA를 사용하였다.
본 발명자는 TGF-β를 처리에 의해 유도된 암전이가 vimentin shRNA 처리로 vimentin mRNA 발현 억제가 상피간엽이행 마커 및 관련 인자들의 mRNA 발현 및 단백질 발현 변화 관찰하였다.
구축된 vimentin를 억제하는 세포주에 2.5ng/ml TGF-β를 48시간 동안 처리하여 암전이를 유도한 조건에서 시간 중합효소 연쇄반응(Real-time PCR)과 면역화학적 분석(Immunoblot analysis)을 통해 상피간엽이행 관련 인자들인 CDH1, CDH2 발현을 및 면역회피 관련 인자인 PD-L1 발현을 관찰하였다(도 6a-6d).
도 6에 나타낸 바와 같이 vimentin shRNA (shvimentin)에 감염된 폐암세포 NCI-H460, A549는 대조군 shRNA (shCtrl)에 감염된 세포에 비하여 vimentin의 mRNA의 발현이 감소하였고, 이는 vimentin의 발현이 억제되었으며, 암전이 환경을 유도하는 TGF-β를 처리한 조건에서도 vimentin의 발현이 억제되었음을 관찰하였다(도6 a, 6c). TGF-β 처리에 의한 상피 마커인 CDH1 발현의 감소가 shvimentin 처리에 의한 vimentin의 발현 억제로 CDH1 발현의 감소가 억제되었으며, 또한 TGF-β 처리에 의한 중간엽 마커인 CDH2을 비롯한 PD-L1 발현의 증가도 vimentin의 발현 억제를 의해 억제되었음을 관찰하였다(도 6b, 6d).
<실시예 9> Vimentin shRNA의 전이성 억제 효과 평가
본 발명자는 vimentin shRNA 처리로 vimentin의 발현 억제가 TGF-β가 처리된 전이환경에서 세포 이동성 실험(migration assay)을 통해서 세포의 이동성을 억제하는 효과를 증명하였다.
구체적으로 폐암세포 NCI-H460에 대조군 shRNA (shCtrl) 또는 vimentin shRNA (shvimentin) 바이러스를 감염시켰다. 다음날, 2μg/ml 퓨로마이신(puromycin)을 48시간동안 처리 후 선별된 vimentin shRNA이 발현되는 세포를 6 well plate에 2x105 cells/ml로 분주하였으며 24시간 후 pipette tip를 사용하여 일정한 간격으로 스크래치를 내었다. 이동성 실험에서 2.5 ng/ml의 TGF-β를 사용하여 암전이를 유도하였다. 스크래치를 낸 후 24시간 간격으로 세포의 간격과 이동성을 현미경으로 관찰하고 현미경에서의 세포 촬영을 통하여 간격이 복구되는 정도를 세포사이의 거리로 측정하였다. 측정된 수치를 대조군의 거리를 100%라고 할 때 상대적 이동 거리를 산출한 후, %로 그래프를 표시하였다 (도 6e).
상대적 이동 거리 (%) = 실험군에서의 측정수치 x 100 / 대조군의 측정수치
연구결과, vimentin shRNA 처리에 의한 vimentin 발현억제로 폐암세포 자체의 전이성을 감소시켰는데 특히 72시간에는 대조군의 이동성이 0%라고 설정할 때 약 -10% 이상 이동성을 감소시켰다. 72시간에서 TGF-β 처리에 의해 대조군 대비 약 30%의 이동성이 증가되는데, 이러한 폐암세포의 전이성을 vimentin shRNA에 의해 약 -8%까지 감소시켰다. 따라서 vimentin shRNA에 의한 vimentin 발현 억제는 암세포 자체의 전이성뿐만 아니라 TGF-β 처리에 의해 유도되는 전이성에 대한 강력한 억제효과가 있음을 알 수 있었다.
<실시예 10> Vimentin shRNA의 침습성 억제 효과 평가
다음으로 본 발명자는 vimentin의 발현 억제가 TGF-β가 처리된 전이환경에서 세포 침습성 실험(invasion assay)을 통해서 세포의 침습성을 억제하는 효과를 증명하였다.
본 발명을 위하여 4℃에서 16~20시간동안 마트리겔(matrigel)을 완전히 녹인 후 마트리겔(matrigel)을 1 mg/ml이 되도록 혈청이 포함되지 않은 차가운 RPMI 1640 (4℃)으로 희석하였다. 이를 8.0 μm 24칸용 인서트(insert)에 100μl 마트리겔(matrigel) 혼합물을 분주하고 37℃배양기에서 12-20시간 동안 굳혀주었다. 굳은 마트리겔 위에 vimentin shRNA 처리로 vimentin 발현이 억제된 폐암세포 NCI-H460를 1X105 cells/well의 세포수로 혈청이 없는 배지에 희석하여 분주하였다. 여기에 혈청이 포함된 36℃의 따뜻한 RPMI 1640(10% FBS)을 0.5 ml/well씩 분주하였다. TGF-β처리에 의해서 암전이를 유도하였다. 3일에 한 번씩 배지를 교환해주고 침습되는 정도를 관찰하였으며, 암세포의 침습이 충분히 일어난 것으로 관찰된 5일 정도에 배지를 제거하고 1XPBS로 세척한 후, 인서트 안쪽의 세포들을 면봉으로 긁어 내었고, 1XPBS로 세척하여 인서트 내부에 세포와 마트리겔(matrigel)의 잔여물이 남지 않도록 제거하였다. 인서트(inset) 바깥 면이 있는 24칸 플레이트에 4% 파라포름알데히드(paraformaldehyde) 500 ㎕를 분주하고 마트리겔을 침습한 세포를 5분간 실온에서 인큐베이션한 후 5분에 1XPBS로 3회 세척하여, 0.05% crystal-violet 용액으로 5분간 염색하였다. 염색된 세포를 현미경으로 관찰하고 그 수를 세어서 침습된 세포수를 그래프로 표시하였다.
그 결과, 도 6f에 나타낸 바와 같이, vimentin shRNA을 감염시켜 vimentin의 발현을 억제한 세포는 대조군 바이러스(shCtrl)을 처리한 세포보다 세포의 침습성을 억제되었고, TGF-β 처리에 의한 전이 환경에서도 vimentin에 의한 vimentin 발현 억제가 세포의 침습성을 억제하는 것을 관찰하였다.
이상의 결과를 종합하였을 때, vimentin shRNA 의한 vimentin 발현 억제가 세포의 상피간엽이행에 관여하는 인자들의 발현을 억제시킬 뿐만 아니라 세포의 이동성과 침습성을 감소시키며, TGF-β 처리에 의한 전이 환경에서도 vimentin shRNA에 의한 vimentin 발현 억제가 상피간엽이행 관련 인자들의 발현을 억제시키며, 세포의 이동성과 침습성도 감소하는 것을 증명하였다.
<실시예 11> Vimentin shRNA의 종양형성능 억제 효과 평가
본 발명자는 vimentin의 발현 억제가 TGF-β가 처리된 전이환경에서 암세포의 종양형성을 억제하는 효과를 확인하고자 soft agar를 이용한 콜로니 형성 실험(colony formation assay, soft agar assay)를 진행하였다. 구체적으로, 하단에는 0.6%의 agar 층을 만들기 위해 4% stock agar 150 ml, FBS 100 ml, Free RPMI 1640 750 ml을 섞어 총 1 ml의 agar 배지를 지름 12 well 플레이트에 넣고 1시간 굳혔다. 상단에는 0.4%의 agar 층을 만들기 위해 4% stock agar 100 ml, FBS 100 ml 에 1X103 cells의 세포를 섞은 RPMI1640 배지 800 ml를 섞어 1시간 굳인 후 10%의 FBS를 분주하였다. 이를 5일 간격으로 배지를 바꾸어 주었으며 2주 후 현미경 상으로 종양 덩어리인 콜로니가 형성된 것을 관찰하였으며, 0.005% cryal violet-methanol 용액을 이용하여 15분 동안 염색한 후 이를 20% methanol-PBS 용액을 이용하여 세척한 후 현미경 상으로 전체 콜로니의 수를 측정하였다.
연구 결과, 양성 대조군인 2.5 ng/ml TGF-β 처리군의 경우 대조군 대비 약 2배 colony 형성이 증가되는 것을 관찰할 수 있었으며, vimentin 발현 억제군 세포는 대조군에 대비하여 colony의 수가 감소한 것을 관찰할 수 있었다. 또한 TGF-β 처리에 의해서 유도한 암전이 환경에서도 vimentin 발현 억제는 colony의 수를 감소시키는 것을 확인할 수 있었다. 따라서 vimentin shRNA에 의한 vimentin의 발현억제는 암세포의 종양 형성 (colony 형성)을 억제하는 중요한 인자임을 알 수 있었다(도 6g).
<실시예 12> Vimentin shRNA에 의한 발현억제 후 vimentin 인산화 점 돌연변이체 단백질의 발현에 의한 전이성 및 침습성 촉진 효과 평과
본 발명자는 앞선 실험을 통해서 vimentin shRNA에 의한 vimentin의 발현억제는 암전이 및 암종양형성능을 억제함을 확인할 수 있었다. 이러한 조건에서 vimentin의 인산화 점 돌연변이체의 단백질의 재발현이 암 전이성 및 침습성에 미치는 효과를 분석하였다.
구체적으로, 폐암세포 NCI-H460에 vimentin mRNA의 발현 억제를 위하여 제작한 pLKO-puro.1-vimentin을 이용하여 발현시킨 바이러스성(viral) vimentin shRNA를 20μl 취하여 감염 버퍼(Infection Buffer; 10mM HEPES, 1㎍/ml Polybrene)와 섞어 세포에 처리하였다. 24시간 후 2㎍/ml puromycin를 48시간 동안 처리하여 vimentin shRNA에 감염된 세포만 선별하여 vimentin 발현을 억제하는 세포주를 구축하였다. 구축된 vimentin 발현억제 세포주에 다시 vimentin의 원형 및 인산화된 점 돌연변이형(S339E)와 비인산화된 점 돌연변이형(S339A)을 발현시키는 렌티바이러스를 감염시킨 후 puromycin과 G418으로 선별하였다. 선별 후, 1ug/ml doxycycline 처리하여 vimentin의 원형 및 인산화와 비인산화형의 점 돌연변이형을 발현을 다시 유도하여 각각의 vimentin의 점 돌연변이체가 잘 발현되었는지 단백질 발현량을 확인하였다. 도 6h에서와 같이, vimentin 발현이 억제되는 조건에서 vimentin의 원형 및 각각의 점 돌연변이형이 잘 발현되고 있는 것을 확인하였다.
다음으로 본 발명자는 vimentin의 발현 억제된 조건에서 vimentin의 인산화 점 돌연변이체의 단백질의 재발현이 암 세포의 이동성 및 침습성에 미치는 효과를 증명하였다.
먼저 암세포의 이동성에 미치는 효과를 보기 위해서 구체적으로 앞선 실험에서 구축된 vimentin 원형(WT) 및 인산화(S339E)와 비인산화(S339A) 점 돌연변이체를 재발현 시킨 NCI-H460 세포를 혈청이 없는 배지에 희석하여 5 x 104 개의 세포를 8.0 μm, 24칸용 인서트(inset)에 분주하고 24칸 플레이트에 10% 혈청이 포함된 배지를 분주한 뒤 인서트를 넣어 주었다. 세포 분주 후 48시간 후 4% 파라포름알데히드(paraformaldehyde) 500 ㎕를 분주하여 이동한 세포를 고정시키고, 1XPBS로 3회 세척하여 0.05% crystal-violet 용액으로 5분간 염색하였다. 5분 후 1XPBS로 5회 세척하였고, 염색된 정도(intensity)를 Odyssey infrared imaging system을 이용하여 측정하였다. 대조군의 염색된 정도(intensity)를 1이라고 할 때 각 실험군에서의 상대적 염색된 정도를 산출하여 그래프를 표시하였다.
그 결과, 도 6i에 나타낸 바와 같이, vimentin 발현이 억제된 세포에 다시 vimentin 원형(WT)이 발현되어지는 세포는 대조군 세포(Mock)보다 세포의 이동성이 증가하였고, vimentin 인산화 점 돌이변이체인 S339E를 발현시킨 세포에서는 TGF-β 처리한 양성대조군보다 세포의 이동성이 증가하였다. 따라서 vimentin의 인산화는 암세포 전이성에 대한 강력한 촉진 효과가 있음을 알 수 있었다.
다음으로, 본 발명자는 vimentin의 발현 억제된 조건에서 vimentin의 인산화 점 돌연변이체의 단백질의 재발현이 침습성에 미치는 효과를 증명하였다.
본 발명을 위하여 굳은 마트리겔 위에 앞선 실험에서 구축된 vimentin 원형(WT) 및 인산화(S339E)와 비인산화(S339A) 점 돌연변이체를 재발현시킨 NCI-H460 세포를 1X105 cells/well의 세포수로 혈청이 없는 배지에 희석하여 분주하였다. 여기에 혈청이 포함된 36℃의 따뜻한 RPMI1640(10% FBS)을 0.5 ml/well씩 분주하였다. 세포분주 5일 후 배지를 제거하고 1XPBS로 세척한 후, 인서트 안쪽의 세포들을 면봉으로 긁어 내었고, 1XPBS로 세척하여 인서트 내부에 세포와 마트리겔(matrigel)의 잔여물이 남지 않도록 제거하였다. 인서트 바깥 면이 있는 24칸 플레이트에 4% 파라포름알데히드(paraformaldehyde) 500 ㎕를 분주하고 마트리겔을 침습한 세포를 5분간 실온에서 인큐베이션한 후 5분에 1XPBS로 3회 세척하여, 0.05% crystal-violet 용액으로 5분간 염색하였다. 5분 후 1XPBS로 5회 세척하였고, 염색된 정도를 590nm에서 파장을 측정하였다. 대조군의 흡광도를 1이라고 할 때 각 실험군에서의 상대적 흡광도를 산출하여 그래프를 표시하였다.
그 결과, 도 6j에 나타낸 바와 같이, vimentin shRNA을 감염시켜 vimentin의 발현을 억제한 세포는 대조군 바이러스(shCtrl)을 처리한 세포보다 세포의 침습성을 억제되었고, 이러한 조건에서 다시 vimentin 원형(WT)이 발현시킨 세포는 대조군 세포(Mock)보다 세포의 침습성이 증가하였고, vimentin 인산화 점 돌이변이체인 S339E를 발현시킨 세포에서는 TGF-β처리한 양성대조군보다 세포의 침습성이 더 크게 증가하였다. 따라서 vimentin의 인산화는 암세포 침습성에 대한 강력한 촉진 효과가 있음을 알 수 있었다.
위의 결과를 종합하였을 때, vimentin의 인산화는 vimentin shRNA에 의한 vimentin 발현 억제 조건에서도 세포의 이동성과 침습성을 증가시키는 것을 증명하였다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
본 발명의 비멘틴 돌연변이체 및/또는 shRNA는 각각 별개로 또는 병용하여 처리되어 정상세포에는 영향 없이 암세포, 특히 전이암에만 작용하여 세포의 비정상적인 성장에 의한 원발성 및 전이성 고형암과 백혈병 등의 치료를 위해 유용하게 사용될 수 있다.

Claims (19)

  1. 서열번호 1 또는 서열번호 2의 아미노산 서열을 포함하는 비멘틴(Vimentin) 돌연변이 단백질.
  2. 제1항에 있어서, 상기 단백질은 서열번호 1의 아미노산 서열을 포함하고,
    상기 서열번호 1의 327 번째 아미노산이 알라닌(Alanine)인 것을 특징으로 하는, 비멘틴 돌연변이 단백질.
  3. 제1항에 있어서,
    상기 단백질은 서열번호 2의 아미노산 서열을 포함하고,
    상기 서열번호 2의 339 번째 아미노산이 알라닌(Alanine)인 것을 특징으로 하는, 비멘틴 돌연변이 단백질.
  4. 제1항의 단백질을 암호화하는 유전자를 포함하는 재조합 벡터.
  5. 제4항에 있어서,
    상기 유전자는 서열번호 3 또는 4인 것을 특징으로 하는, 재조합 벡터.
  6. 제4항에 있어서,
    상기 벡터는 렌티 바이러스 벡터인 것을 특징으로 하는, 재조합 벡터.
  7. 제1항의 비멘틴 돌연변이 단백질 또는 제4항의 벡터를 유효성분으로 포함하는, 암 예방 또는 치료용 약학적 조성물.
  8. 제7항에 있어서,
    상기 조성물은 암세포의 이동성 및 침습성을 감소시켜 암의 전이(Metastasis)를 억제하는 것을 특징으로 하는, 암 예방 또는 치료용 약학적 조성물.
  9. 제7항에 있어서,
    상기 암은 고형암인 것을 특징으로 하는, 암의 예방 또는 치료용 약학적 조성물.
  10. 제9항에 있어서,
    상기 고형암은 비소세포폐암인 것을 특징으로 하는, 암의 예방 또는 치료용 약학적 조성물.
  11. 제10항에 있어서,
    상기 비소세포폐암은 선암인 것을 특징으로 하는, 암의 예방 또는 치료용 약학적 조성물.
  12. 비멘틴 단백질 발현 억제용 shRNA 또는 상기 shRNA를 발현하는 벡터를 포함하는 암의 예방 또는 치료용 약학적 조성물로서,
    상기 shRNA는 서열번호 11, 서열번호 12, 또는 서열번호 13의 염기서열을 포함하는 것인, 약학적 조성물.
  13. 제12항에 있어서,
    상기 shRNA는 서열번호 11의 염기서열을 포함하는 것인 약학적 조성물.
  14. 제12항에 있어서,
    상기 조성물은 암세포의 이동성 및 침습성을 감소시켜 암의 전이를 억제하는 것인, 약학적 조성물.
  15. 제12항에 있어서,
    상기 조성물은 종양형성능을 억제하는 것인, 약학적 조성물.
  16. 제12항에 있어서,
    상기 조성물은 서열번호 1 또는 서열번호 2의 아미노산 서열을 포함하는 비멘틴 돌연변이체를 추가로 포함하는 것인, 약학적 조성물.
  17. 제12항에 있어서,
    상기 조성물은 서열번호 3 또는 4의 염기서열로 이루어진 유전자를 로딩한 벡터를 추가로 포함하는 것인, 약학적 조성물.
  18. 제12항에 있어서,
    상기 암은 비소세포폐암인 것을 특징으로 하는, 약학적 조성물.
  19. 제18항에 있어서,
    상기 비소세포폐암은 선암인 것을 특징으로 하는, 약학적 조성물.
PCT/KR2021/016817 2020-11-18 2021-11-16 인산화된 비멘틴의 과도한 생성을 차단하여 암을 예방 또는 치료하는 방법 WO2022108309A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2020-0154791 2020-11-18
KR1020200154791A KR102511660B1 (ko) 2020-11-18 2020-11-18 비멘틴 돌연변이체 또는 이를 발현하는 벡터를 유효성분으로 포함하는 암 예방 또는 치료용 약학적 조성물
KR1020200164854A KR20220076068A (ko) 2020-11-30 2020-11-30 비멘틴 발현 억제용 shRNA를 유효성분으로 포함하는 암 예방 또는 치료용 약학적 조성물
KR10-2020-0164854 2020-11-30

Publications (1)

Publication Number Publication Date
WO2022108309A1 true WO2022108309A1 (ko) 2022-05-27

Family

ID=81709426

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/016817 WO2022108309A1 (ko) 2020-11-18 2021-11-16 인산화된 비멘틴의 과도한 생성을 차단하여 암을 예방 또는 치료하는 방법

Country Status (1)

Country Link
WO (1) WO2022108309A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120021974A1 (en) * 2007-07-13 2012-01-26 Ibcc Holding As Novel inhibitor of angiogenesis
US8999921B2 (en) * 2005-06-27 2015-04-07 Cypress Bioscience, Inc. Process for diagnosing rheumatic diseases
US20190211088A1 (en) * 2016-06-15 2019-07-11 Counterpoint Biomedica Llc Polypeptide targeting aptamers for characterization, capture, and clinical management of circulating tumor cells

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8999921B2 (en) * 2005-06-27 2015-04-07 Cypress Bioscience, Inc. Process for diagnosing rheumatic diseases
US20120021974A1 (en) * 2007-07-13 2012-01-26 Ibcc Holding As Novel inhibitor of angiogenesis
US20190211088A1 (en) * 2016-06-15 2019-07-11 Counterpoint Biomedica Llc Polypeptide targeting aptamers for characterization, capture, and clinical management of circulating tumor cells

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE Protein GenPept; ANONYMOUS : "vimentin variant, partial [Homo sapiens] ", XP055932369, retrieved from NCBI *
KIM TAE WON; LEE YEO SONG; YUN NAK HYEON; SHIN CHANG HOON; HONG HYE KYUNG; KIM HYEON HO; CHO YONG BEOM: "MicroRNA-17-5p regulates EMT by targeting vimentin in colorectal cancer", BRITISH JOURNAL OF CANCER, NATURE PUBLISHING GROUP UK, LONDON, vol. 123, no. 7, 17 June 2020 (2020-06-17), London, pages 1123 - 1130, XP037482920, ISSN: 0007-0920, DOI: 10.1038/s41416-020-0940-5 *

Similar Documents

Publication Publication Date Title
WO2015156649A1 (ko) 섬유증 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물
WO2015076621A1 (ko) 혈관 신생 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물
WO2011052883A2 (ko) Ｓｏｃｓ２ 유전자의 발현을 조절하여 자연 살해 세포를 활성화시키는 방법
WO2019194586A1 (en) Novel target for anti-cancer and immune-enhancing
WO2022220632A1 (ko) 세포 투과 펩티드, 항암 펩티드 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물
WO2019216675A1 (ko) 조절 t 세포 표면 항원의 에피토프 및 이에 특이적으로 결합하는 항체
WO2020141828A2 (en) Anticancer compositions comprising immune checkpoint inhibitors
WO2022108309A1 (ko) 인산화된 비멘틴의 과도한 생성을 차단하여 암을 예방 또는 치료하는 방법
WO2022216096A1 (ko) 항암 및 면역증강용 신규 타겟
WO2016027990A1 (ko) Ｄｕｓｐ５를 유효성분으로 모두 포함하는 골대사성 질환의 예방 또는 치료용 약학적 조성물
WO2024214933A1 (ko) 인산화된 igfbp5의 과도한 생성을 차단하여 암을 예방 또는 치료하는 방법
KR102511660B1 (ko) 비멘틴 돌연변이체 또는 이를 발현하는 벡터를 유효성분으로 포함하는 암 예방 또는 치료용 약학적 조성물
WO2021194186A1 (ko) Vgll1 펩타이드를 포함하는 암 치료용 조성물
WO2017061828A1 (ko) Plrg1 (pleiotropic regulator 1) 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 약학 조성물
WO2020145465A1 (ko) Runx3 유전자 또는 단백질을 유효성분으로 함유하는 K-Ras 돌연변이 폐암의 예방 또는 치료용 약학 조성물
WO2020080656A1 (ko) Fgf2 또는 api5 유래 펩타이드 및 그의 용도
WO2023163301A1 (ko) Kitenin의 이량체 형성을 저해하는 펩타이드 및 이의 용도
WO2017164486A1 (ko) Tesk1 억제제를 포함하는 항암제 내성 억제용 조성물 및 tesk1 억제제의 스크리닝 방법
WO2024205282A1 (ko) Igsf1 특이적 결합 단백질 및 이의 용도
WO2016159695A1 (ko) Ssu72를 유효성분으로 포함하는 자가면역질환의 예방 또는 치료용 조성물
WO2022139490A1 (ko) 신규한 변형 레오바이러스 및 이의 용도
WO2023096351A1 (ko) 상피세포성장인자수용체(egfr) 변이를 갖는 암 치료용 조성물
WO2024085640A1 (ko) 치료 유도 노화 세포 사멸용 조성물 및 이의 용도
KR20230082009A (ko) 비멘틴 발현 억제용 shRNA를 유효성분으로 포함하는 암 예방 또는 치료용 약학적 조성물
WO2023113461A1 (ko) 암 예방 또는 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21895077

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21895077

Country of ref document: EP

Kind code of ref document: A1