WO2022092945A1 - 다중 진단을 위한 핵산 분리 및 검출용 미세입자 프로브 - Google Patents

다중 진단을 위한 핵산 분리 및 검출용 미세입자 프로브 Download PDF

Info

Publication number
WO2022092945A1
WO2022092945A1 PCT/KR2021/015522 KR2021015522W WO2022092945A1 WO 2022092945 A1 WO2022092945 A1 WO 2022092945A1 KR 2021015522 W KR2021015522 W KR 2021015522W WO 2022092945 A1 WO2022092945 A1 WO 2022092945A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
microparticle
detection
probe
target
Prior art date
Application number
PCT/KR2021/015522
Other languages
English (en)
French (fr)
Inventor
정용균
김지영
장근혁
Original Assignee
주식회사 이지다이아텍
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 이지다이아텍 filed Critical 주식회사 이지다이아텍
Priority to EP21886939.4A priority Critical patent/EP4144865A4/en
Priority to US17/928,252 priority patent/US20230313324A1/en
Publication of WO2022092945A1 publication Critical patent/WO2022092945A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/143—Magnetism, e.g. magnetic label
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/149—Particles, e.g. beads
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a microparticle probe for nucleic acid separation and detection, and more particularly, it is capable of rapidly discriminating a disease in the field, having high specificity to accurately determine a disease, and isolating a nucleic acid capable of multiple diagnosis And it relates to a microparticle probe for detection, a kit including the same, a method for detecting a target nucleic acid, and a multiple diagnostic method.
  • IVD In vitro diagnosis
  • a health condition is diagnosed by analyzing objects such as blood, urine, and cells collected from the human body.
  • molecular diagnosis technology is a technology that uses molecular biological techniques to diagnose diseases, and its target is gradually expanding with the discovery of new genes in the fields of genetic diseases and infectious diseases.
  • the relatively recently developed gene scissors technology recognizes a specific nucleotide sequence of a gene in a cell and edits it as desired, and has been spotlighted as an innovative technology applicable to gene therapy.
  • the gene scissors technology has been continuously developed through generations (1st generation: zinc finger nucleases, 2nd generation: Tallen TALENs (Transcription Activator-Like Effector Nucleases), 3rd generation: CRISPR-cas9), and recently Efforts to develop new molecular diagnostics using technology are receiving as much attention as 'gene editing'.
  • COVID-19 is currently spreading around the world, and there are dozens of cases in Korea and it is relatively well controlled. are facing In this situation, the diagnostic results of COVID-19 indicate limitations in coping with the current situation. Specifically, in Korea, where it is relatively well controlled, diagnosis takes 1 to 2 days, and in the United States, it usually takes 4 to 7 days, making it impossible to effectively respond to the spread of the disease. In addition, in the process of performing conventional molecular diagnostics, partial or overlapping binding of markers causes amplification of nucleic acids during the reaction process, and the sequence serving as a probe becomes positive, resulting in false positives. Therefore, there is an urgent need for a new on-site diagnosis technology that can produce accurate diagnosis results within 30 to 40 minutes.
  • COVID19 since the symptoms of COVID19 are similar to those of influenza and RSV, multiple diagnostics that can diagnose three or more diseases at once are necessary to accurately distinguish them. In particular, after the development of a therapeutic agent for COVID-19, multiple diagnosis is more necessary, because the therapeutic agents for COVID-19, influenza, and RSV are different.
  • the present invention can rapidly determine whether multiple viruses such as respiratory syncytial virus (RSV), influenza, coronavirus, etc.
  • An object of the present invention is to provide a microparticle probe, a kit including the same, and a method for detecting a nucleic acid.
  • a microparticle probe for nucleic acid separation and detection for detecting a target nucleic acid comprising: microparticles; a capture probe introduced to the surface of the microparticle and comprising a sequence complementary to the target nucleic acid; and a reporter nucleic acid introduced to the surface of the microparticle and generating a signal by an external stimulus is provided.
  • a kit for detecting a target nucleic acid comprising the above-described microparticle probe for nucleic acid separation and detection, a cleavage enzyme, and a reagent for nucleic acid amplification.
  • a target comprising a microparticle, a guide RNA introduced to the surface of the microparticle and comprising a sequence complementary to the target nucleic acid, and a reporter nucleic acid introduced to the surface of the microparticle and generating a signal by an external stimulus providing a microparticle probe for nucleic acid separation and detection;
  • binding the cleavage enzyme to the guide RNA of the microparticle for detecting the target nucleic acid;
  • each nucleotide sequence of the target nucleic acid and the reporter nucleic acid is cleaved by the activation reaction of the cleaving enzyme
  • a multi-diagnostic method capable of detecting the target nucleic acid is provided.
  • the present invention which introduces microparticle probe/gene scissors technology for nucleic acid separation and detection, recognizes and operates the precise sequence of a gene, so it can increase the sensitivity and specificity compared to the existing rapid molecular diagnosis technology within one hour, and COVID-19, It is possible to diagnose multiple viruses such as influenza and RSV within 30 to 40 minutes, making it possible to make accurate multiple diagnoses at once, maximizing the therapeutic effect.
  • the microparticle probe for nucleic acid separation and detection according to the present invention uses microparticles having high magnetic properties compared to conventional magnetic particles (especially magnetic beads), so mixing or moving using a magnet is possible with high efficiency, and is inexpensive. It can be manufactured at a price. Therefore, the same diagnosis is possible at a lower price than the existing diagnostic equipment using magnetic particles.
  • biomarkers can be diagnosed at the same time. ) multi-diagnosis is possible, so a desired disease (infectious disease) can be diagnosed in a short time.
  • FIG. 1 is a view showing an embodiment of a microparticle probe for detecting nucleic acids.
  • FIGS. 2 and 3 show a process for detecting a target nucleic acid using magnetic microparticle/gene editing technology.
  • FIG. 6 shows a process for capturing and amplifying a target nucleic acid sequentially from Well 1 to Well 4;
  • RNA and DNA shows the results of nucleic acid collection and amplification processes for fragment RNA and DNA (refer to SEQ ID NO: 1), which are arbitrary nucleic acids.
  • 11 is a result of testing for the purpose of coupling a magnetic particle probe under an optimal concentration condition.
  • FIG. 13 is a diagram illustrating a change in fluorescence signal when a Covid-19 target probe-based Covid-19 target is present, and when an influenza A or influenza B virus target is present.
  • FIG. 14 is a diagram showing the amount of change in fluorescence signal when the influenza A target probe and the influenza B target probe are each influenza A or influenza B target.
  • 15 is a diagram showing the amount of change in fluorescence signal when both a Covid-19 target probe and an influenza A target probe are present in a mixed state, or a Covid-19 target or an influenza A target or a Covid-19, influenza A target.
  • FIG. 16 is a diagram showing the data of the fluorescence signal change amount analyzed mixed in FIG. 15 by separating the data into an influenza A probe group and a Covid-19 probe group.
  • a microparticle probe for nucleic acid separation and detection for detecting a target nucleic acid for nucleic acid separation and detection for detecting a target nucleic acid.
  • the microparticle probe 100 for nucleic acid separation and detection includes a microparticle 110 , a capture probe 120 , and a reporter nucleic acid 130 .
  • the microparticle 110 provides a surface area for detection of a target nucleic acid, and for this purpose, a capture probe 120 and a reporter nucleic acid 130 are introduced onto the surface.
  • the fine particles 110 may be made of a polymer such as polymethyl methacrylate (PMMA) or polystyrene (PS) or an inorganic material such as silica, or a composite thereof.
  • PMMA polymethyl methacrylate
  • PS polystyrene
  • an inorganic material such as silica, or a composite thereof.
  • the microparticle 110 may contain magnetic particles therein.
  • the fine particles 110 may have a single structure or may have a core-shell structure.
  • the microparticle 110 may have a core-shell structure of the core 112 and the protective shell 114 surrounding it.
  • the core 112 of the microparticle 110 may include a magnetic material, for example, a magnet-reactive metal, and the magnet-reactive metal may be a paramagnetic material.
  • the magnetic reaction metal may be an alloy including iron (Fe), nickel (Ni), cobalt (Co), and manganese (Mn).
  • the magnet-reactive metal may include a rare earth metal such as gadolinium (Gd), terbium (Tb), samarium (Sm), etc.
  • a transition metal such as iron, nickel, cobalt, and manganese as a main component, and other boron (B), It may include silicon (Si), carbon (C), and the like.
  • a representative example of the magnet-reactive metal may include an iron alloy or a cobalt alloy. Specific examples of the iron alloy include Fe 70 B 15 Si 10 C 5 , and examples of the cobalt alloy include Co 68 Mn 7 Si 10 B 15 .
  • the fine particles 110 have a size and specific gravity that do not float in the water so that they can be quickly collected or separated by an external magnet such as a permanent magnet or an electromagnet.
  • the core 112 may occupy 60% or more of the total volume of the fine particles 110 .
  • the core 112 may be 60 to 99% of the total volume of the microparticles 110, preferably 75 to 99%.
  • the fine particles 110 may have a size (eg, diameter or length) of several tens to several hundreds of ⁇ m, and the specific gravity is preferably 5 or more.
  • the fine particles 130 are nanoparticles having a size of less than 1 micrometer, even particles having a high specific gravity (eg, 7.876 in the case of iron) may be suspended in water.
  • the magnetic control of the microparticles is not smooth due to the low magnetic force of the microparticles when a magnetic field is applied in the bioassay process for detecting the biomaterial in the well using the microparticles 110, so separation may be difficult.
  • the magnetic rod is moved up and down in the well to promote the immune response, microparticles attach and detach. It does not fall back to the magnetic field and can continue to remain due to non-specific binding to the magnetic rod. In this case, the reproducibility of quantitative analysis may be reduced when detecting a biomaterial in the well.
  • the size is very large compared to the silica beads conventionally used in bioassays, and the conventional silica beads in which magnetic particles are usually dispersed in silica
  • the reproducibility of quantitative analysis is excellent because the magnetic reactive metal (magnetic core) occupies most of the volume of the microparticles and reacts sensitively to magnetic force.
  • the present microparticle probe 100 for nucleic acid separation and detection forms a core-shell structure by having a magnetic reactive metal in the center and a shell layer surrounding it, and the shell layer 114 is an organic material. Or it may be made of an inorganic material, preferably glass.
  • a capture probe such as an antibody or protein may be immobilized on the surface of the microparticle probe 100 for nucleic acid separation and detection.
  • functional groups such as a hydroxyl group, an amine group, and a carboxyl group may be introduced on the surface.
  • the shell layer 114 may substantially completely surround the microparticles 110, but if necessary or during the manufacturing process, the surface of the microparticles is not completely covered with the shell layer, and some regions of the microparticle surface may be exposed.
  • the thickness of the shell layer 114 may be 1 to 100 ⁇ m, preferably 1 to 50 ⁇ m, more preferably 1 to 10 ⁇ m, even more preferably 4 to 8 ⁇ m. If the thickness of the shell layer 114 is less than the above range, the surface of the shell layer 114 may be easily broken or cracks may occur, and if the thickness of the shell layer 114 is greater than the above range, problems may occur depending on laser characteristics and wavelength during glass cutting processing.
  • the core-shell structure may be formed by applying a liquid shell component to a core metal or may be formed by filling a hollow mold with a core metal component.
  • the shell layer 114 may be solidified from a liquid coating solution of an organic or inorganic material. More specifically, the shell layer 114 may be formed by making a liquid coating solution by dissolving an organic or inorganic shell component at a high temperature or making it flowable or dissolving it in a solvent and then applying it to the core metal.
  • the organic material may be mainly a polymer
  • the inorganic material may be a metal or ceramic, particularly glass.
  • a coating solution obtained by dissolving plastic in a solvent or melting glass to form the shell layer 114 may be applied to the fine particles 110 by dip coating, spray coating, or the like.
  • a glass tube as a hollow frame
  • a method in which a glass tube is drawn while metal powder is put into the glass tube and then the metal is melted at a high temperature, while drawing the glass material first There are a method in which molten metal is injected, a method in which a dispersion in which a metal powder is dispersed in an ultraviolet curable material is filled in a glass tube and then cured by irradiating ultraviolet rays.
  • the hollow frame itself can be a shell layer.
  • the fine particles 110 obtained in the above manner have very excellent surface uniformity.
  • a silica precursor such as TEOS is used to form the shell layer 114 and grown on the surface of the core particle.
  • the shell layer 114 has a very rough surface. Therefore, a lot of non-specific binding of the detection target substance may occur. This may cause unnecessary background noise.
  • the microparticles 130 according to an embodiment of the present invention have a very uniform surface because they have a coating layer derived from a liquid component as the shell layer 114 .
  • the average surface roughness (Ra) of the surface of the shell layer 114 may be 15 nm or less, preferably 10 nm or less, more preferably 5 nm or less, still more preferably 2 nm or less, particularly 1.5 nm or less.
  • R a may be, for example, 3 nm or more, 2 nm or more, or 1 nm or more.
  • the shell layer 114 of the fine particles 110 may be made of glass.
  • the glass may be a compound selected from the group consisting of soda lime, borosilicate, aluminosilicate, silica, alkali silicate, pyrex and quartz as a main component.
  • the glass may be borosilicate.
  • the fine particles 110 may have various shapes, including a regular shape such as a rod shape, a flat shape, a spherical shape, or an atypical shape. Even when the fine particles 110 have a flat plate shape, the cross-section may have various shapes such as a star shape, a polygonal shape, a circular shape, and the like, and is not particularly limited.
  • the microparticles are preferably in the form of a microrod, microdisc, or microbead for ease of manufacture and observation, and particularly preferably in the form of a microrod.
  • the fine particles 130 have the shape of a microrod, it is easy to distinguish between the fine particles by overlapping, and when they are placed in a well, it is easy to focus, and the area occupied by individual particles is small, so a large number of fine particles can be displayed on one observation screen. particles can be observed.
  • the fine particles have a shape with a complex cross-section, such as a star, cracks in the corners may occur due to collisions with each other or walls while moving inside the well. It is advantageous.
  • the microrod may have a length of 10 to 1,000 ⁇ m.
  • the ratio (aspect ratio) of the length to the diameter of the microrod may be 2 or more, 5 or more, or 10 or more.
  • the upper limit of the aspect ratio may be 20 or less, 10 or less, or 5 or less. If the aspect ratio is less than the above range, it may be similar to spherical fine particles, so it may be difficult to distinguish them from each other, and if the aspect ratio is too large, it may be warped.
  • the microparticle 110 may be a cut product of a glass-coated metal microwire. By simply cutting the glass-coated metal microwire with a laser, microparticles 110 having various lengths can be obtained.
  • the above-mentioned microparticles can be suitably used for in vitro diagnostics for detecting biomarkers in specific samples derived from living organisms.
  • the sample may be a tissue extract, cell lysate, whole blood, plasma, serum, saliva, ocular fluid, cerebrospinal fluid, sweat, urine, milk, ascites fluid, synovial fluid, peritoneal fluid, and the like.
  • pretreatment of the sample solution may be simplified or omitted in some cases.
  • the microparticles may be prepared and used as particles having different sizes, lengths, or shapes.
  • the capture probe 120 may be introduced into the microparticle 110 to capture a biomarker derived from a sample, particularly a nucleic acid-based biomarker.
  • the biomarker can be used without limitation as long as it is used in conventional scientific or medical fields such as measurement or evaluation of biological processes, processes causing pathogenicity, and pharmacological processes for treatment.
  • the biomarker may be, for example, a polypeptide, peptide, nucleic acid, protein or metabolite that can be detected in a biological fluid such as blood, saliva, urine, etc., and preferably a biomarker associated with a specific disease with high sensitivity and specificity.
  • the biomarker is a nucleic acid in the sense that it can be detected with
  • the capture probe 120 may be introduced on the shell layer 114 of the microparticle according to the embodiment of the present invention.
  • the capture probe 120 is complementary to the target nucleic acid and specifically binds to the target nucleic acid and serves to immobilize the target nucleic acid to the microparticle 110 .
  • the capture probe 120 may include any nucleotide sequence to which a gene editing technique is applied.
  • the capture probe 120 may be or include a guide RNA (gRNA).
  • the guide RNA refers to a target DNA-specific RNA (eg, RNA capable of hybridizing with a target site of DNA), and may be used as one element of the CRISPR system together with a cleaving enzyme.
  • the guide RNA includes two guide RNAs, that is, a CRISPR RNA (crRNA) having a nucleotide sequence capable of hybridizing with a target site of a gene and an additional trans-activating crRNA (trans-activating crRNA), wherein crRNA and tracrRNA are partially bound crRNA:tracrRNA complex (dual guide RNA) form, or the crRNA (part or all) and tracrRNA (part or all) are linked through a linker to form a single guide RNA (sgRNA) can be The gRNA binds to the target nucleic acid and may cleave the target nucleic acid and the reporter nucleic acid when it encounters a cleaving enzyme. Using the characteristics of the guide RNA, as will be described later, rapid detection of a biomarker is possible using information on changes in a detection signal obtained by cutting the sequence of a specific biomarker.
  • crRNA CRISPR RNA
  • trans-activating crRNA trans-activating crRNA
  • the capture probe 120 may be a 15mer to 60mer nucleic acid. In addition, it may be 20mer to 45mer, 25mer to 40mer, or 30mer to 41mer.
  • the capture probe 120 may be fixed by adsorbing or chemically connected to the surface of the microparticle 110 , and preferably may be connected to a functional group on the surface of the shell layer 114 .
  • biotin is introduced to the surface of the capture probe 114 and avidin, neutravidin, or streptavidin, which binds to biotin, is introduced into the microparticle 110 to introduce the capture probe.
  • (114) can be attached to the fine particles (110).
  • the capture probe 120 may be connected to the microparticle 110 by using a hydroxyl group, an amino group, or a carboxyl group on the surface of the microparticle 110 .
  • microparticle probe for nucleic acid separation and detection described above, a desired biological material in a sample solution can be quickly analyzed with high sensitivity.
  • the reporter nucleic acid 130 is introduced to the surface of the microparticle 110 together with the capture probe 120, and generates a signal, for example, an optical or electrical signal, by an external stimulus including chemical, mechanical, optical, and electrical energy.
  • the reporter nucleic acid 130 may be a nucleic acid labeled with a light-emitting material, and may generate a light-emitting signal such as fluorescence or chemiluminescence by external light or chemical reaction.
  • the reporter nucleic acid 130 may be DNA.
  • the reporter nucleic acid may be a 15mer to 40mer nucleic acid. In addition, it may be 18mer to 30mer, 19mer to 25mer, or 20mer to 23mer.
  • the light emitting material is connected to the detection probe to generate light by external stimuli such as ultraviolet rays, electron beams, chemical reactions, enzyme-substrate reactions, and the like, so that the presence of the target nucleic acid can be detected.
  • external stimuli such as ultraviolet rays, electron beams, chemical reactions, enzyme-substrate reactions, and the like.
  • the light-emitting material include fluorescent molecules, quantum dots, metal nanoparticles, magnetic nanoparticles, enzymes, enzyme substrates, and the like. Among them, fluorescent molecules may be selected as various light-emitting materials in terms of availability and ease of application.
  • fluorescent molecule fluorescein isothiocyanate (FITC), fluorescein, FAM (fluorescein amidite), PE (phycoerythrin), TRITC (tetramethyl-rhodamine isothiocyanate), Cy3 (Cyanine 3), Cy5 (Cyanine 5) Fluorescent molecules selected from the group consisting of , Cy7 (Cyanine 7), Alexa fluorine dye, and rhodamine may be commonly used.
  • FITC fluorescein isothiocyanate
  • FAM fluorescein amidite
  • PE phycoerythrin
  • TRITC tetramethyl-rhodamine isothiocyanate
  • Cy3 Cyanine 3
  • Cy5 Cy5
  • Fluorescent molecules selected from the group consisting of , Cy7 (Cyanine 7), Alexa fluorine dye, and rhodamine may be commonly used.
  • various fluorophores such as FITC, PE, Alexa-647 may be introduced into the 5'-position of the reporter nucleic acid 130 for labeling.
  • the microparticle probe for separation and detection of a target nucleic acid can be applied to rapid and accurate detection of a target nucleic acid by introducing a gene editing system.
  • the reporter nucleic acid 130 may be a nucleotide sequence to be cut when the microparticle probe for nucleic acid detection is used in a gene editing system.
  • Gene editing is a technology for causing mutations by inducing insertion, deletion, and substitution of DNA in a specific region of the genome using a protein complex having a DNA nuclease function.
  • Gene editing technology includes zinc finger nucleases (ZFNs, Zinc Finger Nucleases), TALENs (Transcription Activator-Like Effector Nucleases), and CRISPR-Cas systems.
  • the gene editing technology is the CRIPSR-Cas system in that it is excellent in the ability to precisely cut a desired site in a simple and fast manner from DNA.
  • CRISPR clustered regularly interspaced short palindromic repeats
  • gRNA guide RNA
  • Cas endonuclease a cleaving enzyme
  • the CRISPR-Cas system of the CRISPR-Cas system is not particularly limited as long as it is known, and may include CRISPR-Cas9, CRISPR-Cas12, CRISPR-Cas13, and the like depending on the type of cleavage enzyme.
  • the CRISPR-Cas system may be CRISPR-Cas12 in that it has high sensitivity to mismatches within the guide RNA, and more preferably CRISPR-Cas12a using Cas12a protein as a cleaving enzyme. .
  • the reporter nucleic acid 130 is attached to the surface of the microparticle 110 at a high density for reaction with a Cas endonuclease to be introduced later, which is one of the protein complexes functioning as a DNA nuclease.
  • the reporter nucleic acid 130 is, for example, 5 ⁇ 10 16 pieces/m 2 to 10 ⁇ 10 16 pieces/m 2 , preferably 6 ⁇ 10 16 pieces/m 2 to 7 ⁇ 10 on the surface of the microparticle 110 . It can be introduced at a density of 16 pieces/m 2 , and in this case, a strong signal can be generated to easily distinguish the size and shape of the fine particles 110 .
  • the reporter nucleic acid 130 may have any sequence, and may have a single-stranded or double-stranded nucleic acid sequence depending on the type of Cas endonuclease.
  • Cas endonuclease in the embodiment, the microparticle probe 100 (ie, the state in which the capture probes 120 and the reporter nucleic acids 130 are uniformly distributed on the surface of the microparticle 110) and the target nucleic acid After forming a complex with the conjugate of the capture probe 120 and the target nucleic acid, it operates as a mechanism for cleaving the reporter nucleic acid 130 distributed in the vicinity of the conjugate.
  • the gRNA of the capture probe of a specific target nucleic acid recognizing the amplified single-stranded region and A complex may be formed by complementary binding.
  • the target nucleic acid is bound to the spacer sequence of the guide RNA and the sequence cleavage function of the Cas12a protein is activated to activate the target nucleic acid and the reporter nucleic acid ( 130), a phenomenon in which the fluorescence signal is not maintained and disappears can be observed.
  • a Cas endonuclease such as Cas12a protein used in the CRISPR system
  • microparticles whose fluorescence has disappeared can be observed.
  • can be checked By applying the gene scissors system in this way, multiple diagnosis is possible using microparticles having various shapes or sizes, types of phosphors, and the like.
  • a kit for detecting a target nucleic acid is provided.
  • the kit includes a microparticle probe and a cleavage enzyme for isolating and detecting the target nucleic acid described above.
  • the microparticle probe for separation and detection of the target nucleic acid has been described in detail above.
  • the cleaving enzyme Cas endonuclease may form a complex with guide RNA and act as a component of the CRISPR-Cas system for cleaving a reporter nucleic acid, and may be, for example, a Cas9 or Cas12a protein.
  • the kit may further include one or more selected from the group consisting of magnetic microparticles for collecting target nucleic acids, reagents for nucleic acid amplification, lysis solution, and washing solution.
  • the magnetic microparticles for collecting the target nucleic acid are configured to have the characteristics of silica on the surface portion, thereby increasing the surface area and at the same time forming a salt bridge under the presence of a high concentration of chaotropic salts contained in the lysis solution. To produce a trapping effect, it may be silica magnetic beads or silica-coated magnetic microparticles.
  • the reagent for nucleic acid amplification is not particularly limited to amplify the target nucleic acid, but loop-mediated isothermal amplification (LAMP), single primer isothermal amplification, in which nucleic acid amplification is performed under isothermal conditions, SPIA), recombinant polymerase amplification (RPA), and the like, and may preferably be an RPA reagent in terms of rapid and low-temperature reaction characteristics.
  • the RT-RPA reagent may include target-specific primers for specifically amplifying RSV, influenza, and coronavirus genes.
  • the lysis solution may be a sample lysis solution based on a chaotropic salt such as a guanidinium salt.
  • the cleaning solution may be an ethanol-based solution for cleaning the sample.
  • the nucleic acid detection kit driving integrated equipment may be combined with the target nucleic acid detection kit to configure the entire nucleic acid detection system. That is, a kit for nucleic acid detection that can smoothly drive the magnetic microparticles for nucleic acid collection in the lysis sample and the microparticle probe 100 for signal detection in the lysis sample by providing a magnetic rod to separate the sample and promote the reaction. can be included in the overall system.
  • the target nucleic acid detection kit By using the target nucleic acid detection kit, regardless of the type of sample, starting with the smear of the sample taken, lysis of the sample, nucleic acid capture and amplification, capture of the amplified target nucleic acid, Cas12a activation reaction due to the captured target nucleic acid, etc. Through a fully automated process, the reaction proceeds and the presence or absence of a target substance can be quickly and accurately detected by measuring the decrease in fluorescence signal due to the recognized target nucleic acid.
  • a method for detecting a target nucleic acid there is provided a method for detecting a target nucleic acid.
  • a target nucleic acid is extracted from a sample.
  • a lysis solution containing guanidinium thiocyanate can be used to break the cell membrane of the sample and release the nucleic acids from the cell.
  • Nucleic acids in the solution may be concentrated by attaching to magnetic silica beads or silica-coated microparticles 110 of the present invention, washing with alcohol, and desorption using an elution buffer.
  • a target nucleic acid is amplified.
  • a target nucleic acid may be specifically amplified using a reverse transcription real-time polymerase chain reaction (RT-RPA) reagent.
  • RT-RPA reverse transcription real-time polymerase chain reaction
  • the microparticle probe for separation and detection of the target nucleic acid is a microparticle, a guide RNA that is introduced to the surface of the microparticle and includes a sequence complementary to the target nucleic acid, and is introduced into the surface of the microparticle and transmits a signal by an external stimulus. and a reporter nucleic acid that generates it.
  • a detailed description of each component of the present microparticle is the same as described above.
  • a guide RNA targeting only a specific virus and a reporter DNA to which a 5'-fluorophore is attached may be immobilized on the microparticle probe for separation and detection of the target nucleic acid.
  • the gRNA of a specific target magnetic particle probe recognizing the single-stranded region to be amplified can form a complex by complementary binding with the viral gene. Formation of the complex may include a reaction promotion process using an external magnetic force. For example, a well containing reactants may be heated to an appropriate temperature to promote the reaction, and by continuously moving a magnetic rod up and down inside the well, fine particles containing a magnetic material may be controlled to promote the reaction.
  • the cleavage enzyme is coupled to the guide RNA of the microparticle probe for separation and detection of the target nucleic acid.
  • a preferred example of the cleavage enzyme is a Cas endonuclease, eg, Cas9 or Cas12a.
  • the cleavage enzyme recognizes and binds to the scaffold sequence of gRNA immobilized on the microparticle probe for separation and detection of the target nucleic acid.
  • each nucleotide sequence of the target nucleic acid and the reporter nucleic acid is cleaved by the activation reaction of the cleaving enzyme.
  • the Cas protein is activated to cut each nucleotide sequence of the target nucleic acid and the reporter nucleic acid.
  • the microparticle probe after the reaction has been completed may be washed with a washing buffer, and preferably, a washing process of the microparticle probe using an external magnetic force may be included. That is, after the reaction is completed, the step of continuously washing the microparticle probes for detecting the target nucleic acid in two or more wash wells using a magnetic rod may be further included. After washing, the type and amount of the target nucleic acid can be accurately identified by detecting the luminescence signal from the microparticle probe.
  • the signal may be a light emitting signal emitted from the light emitting material in the complex.
  • the external stimulus may be ultraviolet rays, electron beams, chemical reactions, enzyme-substrate reactions, and the like.
  • all microparticle probes may be in an on-state by generating fluorescence by a fluorescent molecule bound to the reporter nucleic acid by an external stimulus such as ultraviolet light.
  • the base sequence of the reporter nucleic acid is cut together with the target nucleic acid by the Cas endonuclease, so that the fluorescence of the microparticle probe to which the target nucleic acid is attached is turned off.
  • a multi-diagnostic method for isolating and multiple detection of a target nucleic acid in a specimen by using the gene scissors for the above-described microparticle probe for nucleic acid separation and detection.
  • the multi-diagnostic method comprises the steps of: complementary binding of the target nucleic acid amplified in the sample to two or more types of microparticle probes for separation and detection of nucleic acids; and cutting the reporter nucleic acid present in the vicinity by recognizing the gene scissors introduced into the nucleic acid separation and detection microparticle probe.
  • the gene scissors may be a CRISPR-Cas system.
  • the target nucleic acid may be detected by a method of measuring a decrease in the signal by cleavage of the reporter nucleic acid.
  • the signal may be fluorescence or chemiluminescence.
  • the two or more types of microparticle probes for separation and detection of nucleic acids may be labeled to be distinguished from each other by length, diameter, thickness, shape, color, or identification code.
  • the microparticles for nucleic acid detection may have different lengths, sizes, or shapes, and may each have different capture probes.
  • the multiple detection may include reading the microparticle probes labeled in various ways.
  • a sample may include a plurality of nucleic acid biomarkers, and the microparticle probes may be configured with a plurality of types of shapes equal to the number of biomarkers.
  • the microparticle probes having different shapes are configured in a state in which a capture probe that specifically binds to each of a plurality of nucleic acid biomarkers included in the sample, each capable of capturing only a specific biomarker, is fixed, so that a plurality of biomarkers at the same time may be detectable.
  • microparticle probe when the microparticle probe is a microrod, brightfield images and fluorescence images of two or more target nucleic acids are targeted by using microrods having different lengths and using a gene editing technique such as the CRISPR-Cas system.
  • a gene editing technique such as the CRISPR-Cas system.
  • image analysis the type and amount of each biomarker can be independently obtained quickly.
  • microrods made by cutting glass-coated microwires into various lengths are used as microparticle probes, multiple detection is possible with just one fluorescent material.
  • image analysis By analyzing the microparticle probes coded with each length information through image analysis, multi-detection is possible at once, and it has the advantage of maintaining high sensitivity and accuracy.
  • nucleic acid separation and detection microparticle probes that is, if two or more types of nucleic acid separation and detection microparticle probes are used, multiple diagnostics are possible through a single detection process for various target nucleic acids.
  • 2 and 3 show a process for detecting a target nucleic acid using magnetic microparticle/gene editing technology.
  • the target nucleic acid detection process is shown in 8 wells (Well 1 to Well 8), a DNA collection step in Well 1 to Well 3, a DNA amplification and hybridization step in Well 4, and a well 5 At ⁇ Well 8, the image analysis step is performed. The procedure in each well will be described in more detail below.
  • the magnetic silica bead to which the nucleic acid is attached is transferred to well 2, and the reaction between DNA and salt is improved with 33% isopropanol, so that the DNA is strongly attached to the magnetic silica bead, and unnecessary residual materials are removed.
  • the magnetic silica beads to which nucleic acids are bound are washed with 70% ethanol. In this process, residues other than nucleic acids are additionally removed as much as possible.
  • the magnetic silica beads to which the nucleic acids are bound are transferred to well 4 containing the elution buffer to desorb the nucleic acids from the beads. Then, cDNA is synthesized and amplified with the RT-RPA reagent included in well 4.
  • the RT-RPA reagent may include target-specific primers for specifically amplifying RSV, influenza, and coronavirus genes.
  • the viral gene is amplified by RT-RPA, the gRNA of a specific target magnetic particle probe that recognizes the single-stranded region amplified in this process complementarily binds with the viral gene, resulting in a complex of magnetic microparticle probe and viral gene sequence. is formed
  • the magnetic microparticle probe which is a round-shaped magnetic particle (RSMP) that has completed the reaction in well 4, is transferred to well 5 containing Cas12a endonuclease.
  • Cas12a protein recognizes and binds to the scaffold sequence of gRNA immobilized on the magnetic particle probe.
  • the endonuclease function of the cas12a protein is activated and it is combined with the target DNA. It cuts the surrounding non-specific DNA.
  • the magnetic microparticle probe is washed with a washing buffer.
  • the magnetic microparticle probe is washed once more with a wash buffer.
  • the magnetic microparticle probe after reaction and washing is imaged. In this case, both a bright field image and a fluorescence field image are obtained.
  • the above-described microparticle probe for nucleic acid separation and detection and multiple diagnostic methods using the same may have the following advantages.
  • the present invention overcomes the molecular diagnostic limitations of the existing RT-PCR (Reverse Transcriptase-Polymerase Chain Reaction) method by using CRISPR-CAS gene editing technology for the development of a respiratory virus emergency diagnosis platform.
  • RT-PCR Reverse Transcriptase-Polymerase Chain Reaction
  • CRISPR-CAS CRISPR-CAS gene editing technology for the development of a respiratory virus emergency diagnosis platform.
  • Existing molecular diagnostic methods consist of sample collection at the site and gene extraction, amplification, and detection at a consignment institution, and the results of gene amplification are obtained using expensive equipment. Due to this process, it was not suitable for large sample inspection in the field and it took at least 6 hours or more to obtain the results.
  • the process of gene extraction, amplification, and detection is possible in the field and can be automated (by using magnetic particles, the time in the gene extraction and amplification steps can be greatly reduced has exist).
  • the present invention overcomes the non-specific amplification phenomenon seen in conventional molecular diagnosis with CRISPR-Cas gene editing technology.
  • the present invention in which microparticle probe/gene scissors technology for nucleic acid isolation and detection is introduced, recognizes and operates the precise sequence of a gene, so it can increase sensitivity and specificity compared to existing molecular diagnostic technology, and It is possible to diagnose multiple viruses within 30 to 40 minutes, and it is possible to make accurate multiple diagnoses at once, maximizing the therapeutic effect. Since it is possible to simultaneously diagnose various biomarkers as described above, the detection method according to the present invention can be usefully used for POCT (Point-Of-Care Test) multiple diagnosis.
  • POCT Point-Of-Care Test
  • the experimental steps conducted as a single process are arbitrarily divided into target factor lysis and nucleic acid capture and amplification steps, magnetic particle probe production step for signal detection purpose, signal detection step according to target factor reaction, etc., and each step is described in detail. I would like to describe
  • magnetic microparticles that can stably collect nucleic acids extracted from target factors and move them between wells.
  • magnetic particles for collecting nucleic acids having a sufficient surface area were prepared using cylindrical magnetic microparticles or commercially available magnetic microparticles with a size of 10 to 1000 ⁇ m as a raw material.
  • the prepared basic magnetic microparticles manufactured by our company, core-shell basic magnetic microparticles having no capture probe corresponding to (110) in FIG. After washing 3 times with 0.1M sodium hydroxide solution and 3 times with 100% ethanol solution, ultrasonic washing was performed for 2 seconds.
  • TEOS Tetraethylorthosilicate
  • the process of rotating the solution at 20 rpm for 20 minutes using a rotator device is one reaction, but for each reaction, 2ml of TEOS solution is added for a total of 4 times
  • the reaction was carried out to complete the manufacture of magnetic microparticles.
  • the magnetic particles obtained after the reaction were washed three times with the aqueous solution containing ammonia and three times with 100% ethanol, and then stored in the ethanol solution.
  • nucleic acid trapping ability of the magnetic microparticles prepared for nucleic acid trapping an arbitrary sample was prepared to confirm the actual nucleic acid trapping ability.
  • a hypothetical virus or harmful bacteria can be assumed as an arbitrary sample.
  • random E. coli was selected as a target and the presence or absence of nucleic acid collection was confirmed.
  • 5 shows the results of pre-confirming the nucleic acid capture potential of the magnetic particle-based target sample.
  • 5A is an existing commercial E. coli plasmid mini prep based on an E. coli sample set with an arbitrary target factor.
  • kit Booneer, AccuPrep ® Plasmid Mini Extraction Kit
  • plasmid DNA can be purified and collected under the conditions of 100 and 500 magnetic particles for nucleic acid purification.
  • Lysis buffer 1 ml incubated based on the buffer composition of Well 1 (2M guanidinium thiocyanate, 36.7 mM Tris-Cl, 16.7 mM EDTA, 2% Triton X-100, 33% isopropanol, RNase free water) After mixing the concentrated sample of E. coli with its magnetic microparticle beads, rotating and stirring for 10 minutes, lane 1, 2 - commercialized plasmid prep.
  • 5B is a plasmid prep under the same conditions as FIG. 5A. This is the result of confirming nucleic acid purification based on the kit and 500ea beads for nucleic acid purification. Referring to FIG. 5B, plasmid prep. It can be confirmed that both plasmid DNA as well as genomic DNA of E. coli can be purified and recovered through the company's magnetic particle nucleic acid purification compared to the kit.
  • FIG. 5C is a result of confirming the ability to capture its own magnetic particles by targeting plasmid DNA at a concentration of 2 ⁇ g.
  • the ability to capture arbitrary nucleic acids can be confirmed through the fact that a nucleic acid sample can be collected at a rate of about 7.3% through its own nucleic acid purification magnetic particles.
  • FIG. 6 shows the results of confirming the nucleic acid capture of the target sample and the nucleic acid amplification of the target site in the multiple diagnostic method according to an embodiment of the present invention.
  • FIG. 6 shows a process for capturing and amplifying a target nucleic acid sequentially from Well 1 to Well 4; Referring to FIG. 6, lysis/nucleic acid capture is performed in Well 1, and a solution (2M guanidinium thiocyanate, 36.7 mM Tris-Cl, 16.7 mM EDTA, Nucleic acids were extracted and collected from virus samples using 2% Triton X-100, 33% isopropanol, RNase free water).
  • the first washing process (washing-1) is performed in Well 2, which is collected using 2M guanidinium thiocyanate, 36.7 mM Tris-Cl, 16.7 mM EDTA, 2% Triton X-100, RNase free water + 66% Isopropanol.
  • the magnetic particles including the nucleic acid were washed, and the captured nucleic acids were further condensed into the magnetic particles.
  • washing-2 A second washing process (washing-2) was performed in Well 3, and residual waste attached to the magnetic particles was removed using 70% ethanol.
  • Nucleic acids were recovered and amplified in Well 4, and the detached nucleic acids were amplified after detaching the nucleic acids attached to the magnetic particles.
  • a solution based on RPA (Recombinase Polymerase Amplification) enzyme complex was used for nucleic acid amplification.
  • RNA and DNA show the results of nucleic acid collection and amplification processes for fragment RNA and DNA (refer to SEQ ID NO: 1), which are arbitrary nucleic acids.
  • the target nucleic acid detached from Well 4 was subjected to RT-RPA (Reverse Transcriptase Recombinase Polymerase Amplification) and RPA reaction at 37°C for 20 minutes under the condition that any nucleic acid fragment RNA or DNA was added.
  • the composition of the RPA reagent used at this time was reacted according to the protocol recommended by the manufacturer (TwistDx, TwistAmp Liquid Kit). Referring to FIG.
  • nucleic acids are dissociated from Well 4, and then it can be confirmed that nucleic acid amplification is normally performed by the RT-RPA and RPA enzyme complex.
  • TBE PAGE gel electrophoresis was performed for the purpose of more clearly confirming the size of the amplified nucleic acids of less than 700 base.
  • Table 1 is information of inactivated virus.
  • Tables 2 to 6 are lists of nucleotide sequences of nucleic acids used in the present Examples.
  • RNA Synthesis of artificial RNA by integrating T7 promoter GGGCGAAUUGGGUACCAACACAAGCUUUCGGCAGACGUGGUCCAGAACAAACCCAAGGAAAUUUUGGGGACCAGGAACUAAUCAGACAAGGAACUGAUUACAAACAUUGGCCGCAAAUUGCACAAUUUGCCCCCAGCGCUUCAGCGUUCUUCGGAAUGUCGCGCAUUGGCAUGGAAGUCACACCUUCGGGAACGUGGUUGACCUACACAGGUGCCAUCAAAUUGGAUGACAAAGAUCCAAAUUUCAAGCUUGAUAUCGAAUUCCUGCAGCCCGGGGGAUCCACUAGUU ( ⁇ 1)
  • DNA Securing DNA sequence through KpnI / XbaI restriction enzymes CAACACAAGCTTTCG
  • SEQ ID NOs: 3 to 5 Target sequence information of each target sample Covid-19 (GenBank: MW811435.1, SARS-CoV-2/human/USA/USA-WA1/2020, N gene) AACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTCGATGAAATTCGAACGTGGTCAAATTCGGAAACGTGTCCATGACCTACACAGGT Influenza A virus (GenBank: MG027914.1, A/California/MA_07/2009(H1N1), HA gene) CCGGGAGACAAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCTGGTATTATCATTTCAGATACACCAGTC
  • SEQ ID NOs: 6 to 11 Primer for target sequence amplification (RPA target primer) Covid-19 (GenBank: MW811435.1, SARS-CoV-2/human/USA/USA-WA1/2020, N gene) Forward 5'-AAC ACA AGC TTT CGG CAG-3' (SEQ ID NO: 6) Reverse 5'-GAA ATT TGG ATC TTT GTC ATC C-3' (SEQ ID NO: 7) Influenza A virus (GenBank: MG027914.1, A/California/MA_07/2009(H1N1), HA gene) Forward 5'-CCG GGA GAC AAA ATA ACA TTC-3' (SEQ ID NO: 8) Reverse 5'-GTA TAT TCT GAA ATG GGA GGC-3' (SEQ ID NO: 9) Influenza B virus (GenBank: CY018366.1, B/Florida/02/2006, M1 gene) Forward 5'-ATG TCG CTG TTT GGA GAC ACA
  • SEQ ID NOs: 12 to 14 Guide RNA information Covid-19 (GenBank: MW811435.1, SARS-CoV-2/human/USA/USA-WA1/2020, N gene) 5'-UAA UUU CUA CUA AGU GUA GAU CCC CCA GCG CUU CAG CGU UC-3'-NH 2 (SEQ ID NO: 12) Influenza A virus (GenBank: MG027914.1, A/California/MA_07/2009(H1N1), HA gene) 5'-UAA UUU CUA CUA AGU GUA GAU AGA UAC ACC AGU CCA CGA UU-3'-NH 2 (SEQ ID NO: 13) Influenza B virus (GenBank: CY018366.1, B/Florida/02/2006, M1 gene) 5'-UAA UUU CUA CUA AGU GUA GAU AUU GAC AGA AGA UGG AGA AG-3'-NH 2 (SEQ ID NO: 14)
  • SEQ ID NOs: 15 and 16 reporter DNA for fluorescent signal detection
  • Reporter DNA-Fluorphore 5'-Thiol-TTA TTA TT-3'-NH 2 (SEQ ID NO: 15) 3
  • Reporter DNA-TAMRA 5'-NH 2 -TTA TTA TTT T-3'-TAMRA SEQ ID NO: 16
  • FIG. 8 is a result of nucleic acid capture and amplification against a target that is an inactive virus.
  • FIG. 8 as a result of lysis and nucleic acid collection of the inactive virus having the target sequences of SEQ ID NOs: 2 and 3, it was confirmed that the target nucleic acid was amplified by the RT-RPA enzyme complex as the wells proceeded normally.
  • lanes 1 and 2 are the results of RT-RPA without samples, after the same process, and lanes 3 - 5 are RT-RPA based on the indicated cell haploinfective capacity of Covid-19, influenza A, and influenza B viruses. It is the result of performing the process.
  • TCID 50 which refers to the hemiplegic dose, indicates the amount of virus capable of infecting 50% of cells in cell culture. From this electrophoresis result data, it was confirmed that the target nucleic acid can be amplified through RT-RPA by lysing the virus even for a low TCID 50 viral target such as 2.34 / 2.3 / 2.09 TCID 50 . This means that a result of high sensitivity capable of sufficiently detecting a target nucleic acid through the magnetic particle probe can be expected.
  • the guide RNA (gRNA) and gRNA/target sequence/Cas12a complex which play a role of recognizing the target site sequence of the target factor, play a role of sequence cleavage.
  • a magnetic particle probe is prepared in a state in which single-stranded reporter DNA responsible for signal detection is mixed. Therefore, it is necessary to check whether the gRNA of the target site sequence recognition role can play the role of the gRNA when it is mixed with the reporter DNA and coupled to the magnetic particle.
  • FIG. 10 shows the results of an experiment for confirming the Cas system activity for non-target nucleic acids.
  • the Cas protein was not activated and no fluorescence signal could be observed. Based on this, it was possible to indirectly confirm the target-specific functionality of gRNA/Cas12a.
  • FIG. 11 is a result of testing for the purpose of coupling a magnetic particle probe under an optimal concentration condition.
  • the fluorescent factor-attached reporter DNA sequences were coupled to magnetic particles alone, a similar level of fluorescence signal even at a low coupling concentration of 25 pmol compared to 50 and 100 pmol coupling concentrations can be observed, the final coupling concentration conditions of gRNA / reporter DNA were confirmed. Then, under the coupling concentration conditions determined in FIG. 11, gRNA and reporter DNA were mixed and coupled to magnetic particles, A decrease in fluorescence signal according to the presence or absence of the target sequence was confirmed.
  • FIG. 12 shows that, in the presence of a target nucleic acid in a magnetic particle probe coupled with gRNA/reporter DNA, a result of reduced fluorescence signal due to Cas system activity can be obtained.
  • the fluorescence signal of the gRNA/reporter DNA mixed-coupled magnetic particle is significantly reduced depending on the presence or absence of the target sequence. This confirmed that the fluorescence signal change in the presence or absence of the target sequence was insignificant in the magnetic particles coupled only with reporter DNA, confirming that the gRNA/reporter DNA magnetic particle probe configuration according to each target sequence could detect the target factor. .
  • a Covid-19 target magnetic particle probe was configured, and the signal detection results for the Covid-19, influenza A, and influenza B virus targets were confirmed.
  • the detection value of the fluorescence signal was confirmed.
  • the fluorescence signal intensity value in the non-target group in which the target nucleic acid does not exist fluorescence value: 14680.3
  • the fluorescence signal intensity value (fluorescence value: 6267.96) was significantly lower in the target (Covid-target) group where the Covid-19 target was present. Therefore, it was possible to confirm the difference in the fluorescence signal that the target-specific magnetic particle probe detected the Covid-19 target nucleic acid.
  • the negative group relates to magnetic particle probes to which gRNA/reporter DNA is not coupled.
  • a Non-target group without any target sequence fluorescence value: 13257.3
  • IAV with influenza A target sequence Compared to the target group (fluorescence value: 15529.41) and the IBV target group (fluorescence value: 14942.13) with the influenza B target sequence
  • the CoV target group (fluorescence value: 5071.45) with the Covid-19 target sequence showed significantly higher fluorescence signal values. decreased results were observed. Therefore, it was possible to conclude that the Covid-19 target magnetic particle probe could identify the difference in fluorescence signal through Cas12a enzyme complex activity only in the presence of the Covid-19 virus, and it was confirmed that target-specific diagnosis could be made.
  • FIG. 14 It can be further confirmed in FIG. 14 that target-specific diagnosis is possible.
  • non-treated group without influenza A target sequence Fluorescence value: 5020.17
  • IAV-target group with influenza A target sequence fluorescence value: 3272.29

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Pathology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

표적 핵산을 검출하기 위한 핵산 분리 및 검출용 미세입자 프로브에 있어서, 미세입자; 상기 미세입자의 표면에 도입되며, 상기 표적 핵산에 상보적인 서열을 포함하는 포획 프로브; 및 상기 미세입자의 표면에 도입되며, 외부 자극에 의하여 신호를 발생시키는 리포터 핵산을 포함하는 것인 핵산 분리 및 검출용 미세입자 프로브, 이를 포함한 키트, 표적 핵산의 검출방법 및 다중 진단방법이 제공된다. 본 발명에 따르면, 호흡기세포융합바이러스(RSV), 인플루엔자, 코로나바이러스 등과 같은 다중 바이러스 감염 여부를 신속하게 판별할 수 있으며, 높은 감도를 가짐에 따라 정확하게 질병(감염병)을 판정할 수 있다.

Description

다중 진단을 위한 핵산 분리 및 검출용 미세입자 프로브
본 발명은 핵산 분리 및 검출용 미세입자 프로브에 관한 것으로서, 더욱 상세하게는 질병을 현장에서 신속하게 판별할 수 있고, 높은 특이성을 가짐에 따라 정확하게 질병을 판정할 수 있으며, 다중 진단이 가능한 핵산 분리 및 검출용 미세입자 프로브, 이를 포함한 키트, 표적 핵산의 검출방법 및 다중 진단방법에 관한 것이다.
체외진단(IVD)은 인체로부터 채취된 혈액, 소변, 세포 등의 대상물을 분석하여 건강 상태를 진단할 수 있게 하는 기술로서, 면역 진단 기술, 자가 혈당 측정 기술, 분자 진단 기술 등이 있다. 이 중 분자 진단 기술은 분자생물학적 기법을 질병의 진단에 이용하는 기술로, 유전성 질환 및 감염성 질환 분야에서 새로운 유전자의 발견에 따라 그 대상이 점점 확대되고 있다.
상기 분자생물학적 기법 중 비교적 최근에 개발된 유전자 가위 기술은 세포 내 유전자의 특정 염기서열을 인식하여 원하는 대로 편집하는 기술로 유전자 치료법에 적용할 수 있는 혁신 기술로 각광을 받았다. 상기 유전자 가위 기술은 세대를 거쳐(1세대: 징크핑거 뉴클레아제, 2세대: 탈렌 TALENs(Transcription Activator-Like Effector Nucleases), 3세대: 크리스퍼(CRISPR-cas9)) 꾸준히 발전해 왔으며, 최근 유전자 가위 기술을 이용하여 새로운 분자 진단 기술로 개발하려는 노력들이 '유전자 편집' 만큼이나 주목을 받고 있다.
한편 COVID19는 현재 전세계적으로 확산되고 있으며, 국내에서는 수십 건 정도로 발생하여 비교적 잘 통제되고 있으나, 해외에서는 팬더믹 상황이 되어 30~40만 정도의 확진자, 몇천명 이상의 사망자가 발생하고 있는 심각한 상황에 처해 있다. 이러한 상황속에서 COVID19의 진단결과는 현 상황을 대처하는데 한계성을 나타내고 있다. 구체적으로 비교적 잘 통제되고 있는 국내에서도 진단에 1~2일 정도가 걸리며, 미국에서는 통상 4~7일 정도가 걸려 질병 확산에 효과적인 대응이 불가능하다. 또한 기존 분자진단 수행 과정에서, 반응 과정 중, 표지자의 부분적인 결합 또는 중복 결합을 통해, 핵산의 증폭을 유발하게 되고, 프로브 역할을 하게 되는 서열이 양성화되어 위양성의 결과를 초래하기도 한다. 그러므로 30~40분 이내로 정확한 진단결과를 낼 수 있는 새로운 현장진단용 기술이 절실히 필요하다.
구체적으로 COVID19의 증상은 인플루엔자, RSV의 질병과 유사하기 때문에 이를 정확히 구별할 수 있도록 한꺼번에 3가지 이상의 질병을 진단할 수 있는 다중 진단이 필요하다. 특히, COVID19의 치료제가 개발된 이후에 다중 진단이 더욱 필요한데, 이는 COVID19, 인플루엔자, RSV 등의 치료제가 각각 다르기 때문이다.
이러한 COVID19의 진단과 관련하여, 최근 미국 버클리 캘리포니아대 제니퍼 다우나드 교수 연구진은 크리스퍼 유전자 가위 기술을 이용하여 COVID 바이러스 유무를 확인하는 진단 기술을 개발하였고, 이 유전자 가위 기술은 2020 노벨 화학상을 수상하기도 하였다. 해당 진단 기술은 기존 분자 진단 기술과 달리 바이러스의 유전자 증폭을 할 필요가 없기 때문에 검사 시간이 단축되고, 고가의 실험 장비가 요구되지 않는다는 장점이 있다. 그러나 현재까지 알려진 크리스퍼 유전자 가위 기술로 다중 진단을 수행하는 것은 보고된 바가 없다.
따라서 다양한 바이러스 감염에 따른 증상이 뚜렷하지 않아도 한 번의 검사로 다중 바이러스 감염 유무를 확인할 수 있는 다중 진단 기술이 요구되고 있는 실정이다.
본 발명은 호흡기세포융합바이러스(RSV), 인플루엔자, 코로나바이러스 등과 같은 다중 바이러스 감염 여부를 신속하게 판별할 수 있으며, 높은 감도를 가짐에 따라 정확하게 질병(감염병)을 판정할 수 있는 핵산 분리 및 검출용 미세입자 프로브, 이를 포함한 키트 및 핵산 검출방법을 제공하고자 한다.
본 발명의 일 측면에 의하면, 표적 핵산을 검출하기 위한 핵산 분리 및 검출용 미세입자 프로브에 있어서, 미세입자; 상기 미세입자의 표면에 도입되며, 상기 표적 핵산에 상보적인 서열을 포함하는 포획 프로브; 및 상기 미세입자의 표면에 도입되며, 외부 자극에 의하여 신호를 발생시키는 리포터 핵산을 포함하는 것인 핵산 분리 및 검출용 미세입자 프로브가 제공된다.
본 발명의 다른 측면에 의하면, 상술한 핵산 분리 및 검출용 미세입자 프로브, 절단 효소 및 핵산증폭용 시약을 포함하는 표적 핵산검출용 키트가 제공된다.
본 발명의 또 다른 측면에 의하면, (a) 표적 핵산을 검체로부터 추출하는 단계; (b) 상기 표적 핵산을 증폭하는 단계; (c) 미세입자, 상기 미세입자의 표면에 도입되며 상기 표적 핵산에 상보적인 서열을 포함하는 가이드 RNA, 및 상기 미세입자의 표면에 도입되며 외부 자극에 의하여 신호를 발생시키는 리포터 핵산을 포함하는 표적 핵산 분리 및 검출용 미세입자 프로브를 제공하는 단계; (d) 상기 표적 핵산 검출용 미세입자의 가이드 RNA와 상기 표적 핵산을 반응시켜 표적 핵산 분리 및 검출용 미세입자 프로브와 표적 핵산의 복합체를 형성하는 단계; (e) 절단 효소를 상기 표적 핵산 검출용 미세입자의 가이드 RNA와 결합시키는 단계; (f) 상기 절단 효소의 활성화 반응에 의해 상기 표적 핵산 및 상기 리포터 핵산의 각 염기서열이 절단되는 단계; 및 (g) 상기 외부 자극에 의해 상기 복합체로부터 방출되는 상기 신호의 온-오프를 측정하여 상기 표적 핵산을 검출하는 단계를 포함하는 표적 핵산의 검출방법이 제공된다.
본 발명의 또 다른 측면에 의하면, 상술한 핵산 분리 및 검출용 미세입자 프로브에 유전자 가위를 이용하여 검체 내의 표적 핵산을 분리 및 다중 검출하는 다중 진단방법으로서, 2종 이상의 상기 핵산 분리 및 검출용 미세입자 프로브에 상기 검체에서 증폭된 상기 표적 핵산이 상보적 결합을 하는 단계; 및 상기 핵산 분리 및 검출용 미세입자 프로브에 도입된 상기 유전자 가위가 이를 인지하여 주변에 존재하는 상기 리포터 핵산을 절단하는 단계를 포함하되, 상기 리포터 핵산의 절단에 의하여 상기 신호의 감소를 측정하는 방법으로 상기 표적 핵산을 검출할 수 있는 다중 진단방법이 제공된다.
핵산 분리 및 검출용 미세입자 프로브/유전자 가위 기술이 도입된 본 발명은 유전자의 정확한 서열을 인식하고 작동하므로 기존 1시간 이내의 신속 분자 진단 기술 대비 민감도, 특이도를 높일 수 있으며 증상이 비슷한 COVID19, 인플루엔자, RSV 등과 같은 바이러스를 30~40분 이내로 다중 진단이 가능하여 한꺼번에 정확한 다중 진단을 내릴 수 있어 치료효과를 극대화시킬 수 있다.
한편, 본 발명에 따른 핵산 분리 및 검출용 미세입자 프로브는 기존의 자성입자(특히 자성 비드)에 비하여 높은 자성을 가지는 미세입자를 사용함으로써, 높은 효율로 자석을 이용한 혼합 또는 이동이 가능하며, 저렴한 가격으로 제조 가능하다. 따라서 기존의 자성입자를 이용한 진단 장비에 비하여 저렴한 가격으로 동일한 진단이 가능하다.
또한 본 발명에 따른 핵산 분리 및 검출용 미세입자 프로브의 종류에 따라 상이한 포획 프로브를 결합시킴으로써, 다양한 바이오마커를 동시에 진단 가능하므로, 본 발명에 따른 검출방법을 사용하면 POCT(Point-Of-Care Test) 다중 진단이 가능하여 빠른 시간내에 원하는 질병(감염병)을 진단할 수 있다.
도 1은 핵산 검출용 미세 입자 프로브의 일 구현예를 나타낸 도면이다.
도 2 및 도 3은 자성 미세입자/유전자 가위 기술을 이용하여 표적 핵산을 검출하는 프로세스를 나타낸다.
도 4는 상기 프로세스에 따른 진단 결과를 가상적으로 나타낸 것이다.
도 5는 자성입자 기반 표적 샘플의 핵산 포집 가능성을 사전 확인한 결과를 나타낸 것이다.
도 6은 웰 1(Well 1)에서 웰 4(Well)까지 순차적으로 이루어지는 표적 핵산의 포집 및 증폭 프로세스를 나타낸다.
도 7은 임의의 핵산인 단편 RNA와 DNA(서열 1 참고)에 대하여 핵산 포집 및 증폭 과정을 거친 결과이다.
도 8은 불활성 바이러스인 표적에 대한 핵산 포집 및 증폭 결과이다.
도 9는 표적 핵산 존재 시, 자유 리포터 DNA, Cas 단백질이 섞여 있는 상태에서 gRNA가 각기 다른 농도로 커플링된 자성입자 프로브에 의해 농도 의존적으로 변화하는지 보기 위해 Cas 시스템 활성을 확인한 결과이다.
도 10은 비표적 핵산에 대한 Cas 시스템 활성을 확인하기 위한 실험의 결과를 나타낸다.
도 11은 자성입자 프로브를 최적의 농도 조건으로 커플링하기 위한 목적에서 테스트를 진행한 결과이다.
도 12는 gRNA / 리포터 DNA가 커플링된 자성입자 프로브에서 표적 핵산 존재 시 형광신호 데이터이다.
도 13은 Covid-19 표적 프로브 기반 Covid-19 표적이 존재할 경우와, 인플루엔자 A 또는 인플루엔자 B 바이러스 표적이 존재 시, 형광신호 변화를 나타낸 도면이다.
도 14는 인플루엔자 A 표적 프로브와 인플루엔자 B 표적 프로브가 각각의 인플루엔자 A 또는 인플루엔자 B 표적 존재 시, 형광신호 변화량을 나타낸 도면이다.
도 15는 Covid-19 표적 프로브와 인플루엔자 A 표적 프로브가 혼합된 상태에서, Covid-19 표적 또는 인플루엔자 A 표적 또는 Covid-19, 인플루엔자 A 표적 모두 존재할 경우, 형광신호 변화량을 나타낸 도면이다.
도 16은 도 15에서 혼합 분석된 형광신호 변화량 데이터를 인플루엔자 A 프로브군과 Covid-19 프로브군으로 데이터를 분리하여 나타낸 도면을 나타낸다.
본 발명의 설명 및 청구범위에서 사용된 용어나 단어는, 통상적이거나 사전적인 의미로 한정해서 해석되어서는 아니되며, 발명자는 그 자신의 발명을 가장 최선의 방법으로 설명하기 위해 용어의 개념을 적절하게 정의할 수 있다는 원칙에 입각하여, 본 발명의 기술적 사상에 부합하는 의미와 개념으로 해석되어야만 한다.
본 발명의 일 측면에 의하면, 표적 핵산을 검출하기 위한 핵산 분리 및 검출용 미세입자 프로브가 제공된다.
도 1은 핵산 분리 및 검출용 미세입자 프로브의 일 구현예를 나타낸 도면이다. 도 1을 참조하면, 핵산 분리 및 검출용 미세입자 프로브(100)는 미세입자(110), 포획 프로브(120) 및 리포터 핵산(130)을 포함한다.
미세입자(110)는 표적 핵산 검출을 위한 표면적을 제공하며 이를 위해 포획 프로브(120) 및 리포터 핵산(130)이 그 표면에 도입된다. 미세입자(110)는 폴리메틸메타크릴레이트(PMMA)나 폴리스티렌(PS)과 같은 고분자 또는 실리카와 같은 무기물로 이루어지거나 이들의 복합체일 수 있다. 검출된 표적 핵산의 수집 혹은 시약과의 반응촉진을 위해 미세입자(110)는 내부에 자성 입자들을 함유할 수 있다.
미세입자(110)는 단일 구조를 갖거나 코어-쉘 구조를 가질 수도 있다. 바람직하게는 미세입자(110)는 코어(112)와 이를 둘러싼 보호용 쉘(114)의 코어-쉘 구조를 가질 수 있다. 미세입자(110)의 코어(112)는 자성 물질, 예를 들어 자석 반응 금속을 포함할 수 있는데, 상기 자석 반응 금속은 상자성 물질일 수 있다. 구체적으로 상기 자석 반응 금속은 철(Fe), 니켈(Ni), 코발트(Co), 망간(Mn)을 포함한 합금일 수 있다. 상기 자석 반응 금속은 철, 니켈, 코발트, 망간 등과 같은 전이금속을 주성분으로 하여 가돌리늄(Gd), 터븀(Tb), 사마륨(Sm) 등과 같은 희토류 금속을 포함할 수 있고, 기타 붕소(B), 규소(Si), 탄소(C) 등을 포함할 수 있다. 상기 자석 반응 금속의 대표적인 예로서 철 합금 또는 코발트 합금을 들 수 있다. 구체적인 철 합금의 예로 Fe70B15Si10C5를 들 수 있고, 코발트 합금의 예로 Co68Mn7Si10B15를 들 수 있다.
바람직하게는 미세입자(110)는 영구자석이나 전자석과 같은 외부 자석에 의해 신속하게 수집되거나 분리될 수 있도록 수상에서 부유하지 않는 크기 및 비중을 갖는 것이 바람직하다. 코어(112)는 미세입자(110) 총 부피의 60% 이상을 차지할 수 있다. 예를 들어 코어(112)는 미세입자(110) 총 부피의 60 내지 99%, 바람직하게는 75 내지 99%일 수 있다. 또한 미세입자(110)는 그 크기(예를 들어 직경 또는 길이)가 수십 내지 수백 ㎛ 정도일 수 있으며, 비중은 5 이상인 것이 바람직하다. 미세입자(130)가 1 마이크로미터 미만의 크기를 갖는 나노입자일 경우 높은 비중을 가지는 입자(ex: 철의 경우 7.876)라 하더라도 수중에서 부유할 수 있다. 이 경우 미세입자(110)를 이용하여 웰 내의 생체물질을 검출하는 바이오 어세이 과정에서 자장 인가 시 미세입자의 낮은 자력으로 말미암아 상기 미세입자의 자성 제어가 원활하지 않아 분리에 어려움을 겪을 수 있다. 면역 반응을 촉진시키기 위해 자석봉을 웰 내에서 상하 이동할 때 미세입자들의 탈부착이 발생하는데, 자석봉이 상하 이동하는 과정에서 자석봉에 한번 부착된 미세입자들이 낮은 무게로 인하여 자기장을 제거하여도 웰 바닥으로 다시 떨어지지 않고 자석봉에 비특이적 결합으로 계속 잔존할 수 있다. 이 경우 웰 내 생체물질을 검출할 때 정량분석의 재현성이 저하될 수 있다.
본 발명의 일 구현예에 따른 핵산 분리 및 검출용 미세입자 프로브의 경우 바이오어세이에서 종래 사용되는 실리카 비드에 비해서 그 크기가 매우 크고, 통상 자성 입자들이 실리카 내부에 분산되어 있는 종래의 실리카 비드와 달리 자석 반응 금속(자성 코어)이 미세입자의 대부분의 부피를 차지하여 자력에 민감하게 반응하므로 정량분석 시 재현성이 우수하다.
한편, 본 핵산 분리 및 검출용 미세입자 프로브(100)는 중심부에 자석 반응 금속이 있고 그 주위를 둘러싼 쉘 층(shell layer)을 구비함으로써 코어-쉘 구조를 형성하는데, 쉘 층(114)은 유기물 또는 무기물로 이루어질 수 있으며, 바람직하게는 유리(glass)이다. 또한 핵산 분리 및 검출용 미세입자 프로브(100)의 표면에 항체, 단백질 등의 포획 프로브를 고정시킬 수 있다. 바람직하게는 이를 위해 상기 표면에 히드록시기, 아민기, 카르복실기와 같은 기능기가 도입된 것일 수 있다.
쉘 층(114)은 미세입자(110)를 실질적으로 완전히 둘러쌀 수도 있지만, 필요시 또는 제조 과정에서 미세입자의 표면이 쉘 층으로 완전히 덮이지 않고 미세입자 표면의 일부 영역이 노출될 수도 있다.
쉘 층(114)의 두께는 1 내지 100㎛, 바람직하게는 1 내지 50㎛, 더 바람직하게는 1 내지 10㎛, 더더욱 바람직하게는 4 내지 8㎛일 수 있다. 쉘 층(114)의 두께가 상기 범위 미만에서는 쉘 층(114)의 표면이 부서지거나 크랙이 쉽게 발생될 수 있고, 상기 범위 초과에서는 글라스 절단 가공시 레이저 특성 및 파장에 따른 문제가 발생할 수 있다.
상기 코어-쉘 구조는 코어 금속에 액상의 쉘 성분을 도포하여 형성되거나 중공형 틀에 코어 금속 성분을 충진하여 형성된 것일 수 있다.
쉘 층(114)은 유기물 또는 무기물의 액상 코팅액으로부터 고화된 것일 수 있다. 좀 더 구체적으로 쉘 층(114)은 유기물 또는 무기물 형태의 쉘 성분을 고온에서 녹이거나 흐름성이 있게 만드는 방식 또는 용매 중에 녹이는 방식을 통해 액상 코팅액을 만든 후 코어 금속에 도포하여 형성될 수 있다. 상기 유기물은 주로 고분자일 수 있고, 상기 무기물은 금속 혹은 세라믹, 특히 유리일 수 있다. 예를 들어, 쉘 층(114)을 형성하기 위해 플라스틱을 용매에 녹이거나 유리를 용융하여 얻은 코팅 액을 딥코팅, 스프레이코팅 등의 방식으로 미세입자(110)에 도포할 수도 있다.
한편, 중공형 틀로서 유리 관을 사용하는 경우를 예를 들어 설명하면, 유리 관 안에 금속 분말을 투입 후 금속을 높은 온도에서 용융시키며 유리 관을 인발시키는 방식, 먼저 유리 재료를 인발하면서 그 내부에 용융된 금속을 주입시키는 방식, 금속 분말을 자외선 경화형 물질에 분산시킨 분산액을 유리 관 내에 충진한 후 자외선을 조사하여 경화시키는 방식 등이 있다. 이러한 방식들의 경우 중공형 틀 자체가 쉘 층이 될 수 있다.
상술한 방식으로 얻어진 미세입자(110)는 표면 균일도가 매우 뛰어나다. 종래 바이오 어세이용 입자의 경우, 쉘 층(114)을 형성하기 위해 TEOS와 같은 실리카 전구체를 이용하여 코어 입자 표면 위에 성장시키는데, 이 경우 쉘 층(114)은 매우 거친 표면을 갖게 된다. 그리하여 검출대상 물질의 비특이적 결합이 많이 발생할 수 있다. 이는 불필요한 백그라운드 노이즈를 발생시키는 원인이 될 수 있다.
반면 쉘 층(114)을 형성하는 유리(glass), 예를 들어 보로실리케이트 글라스(Borosilicate glass)는 반응 시료와 화학적 반응에 의한 흡착에 의한 비특이적 반응(non-specific binding)이 거의 없다. 특히 본 발명의 일 구현예에 따른 미세입자(130)는 액상의 성분으로부터 유래된 코팅 층을 쉘 층(114)으로 가지고 있으므로 매우 균일한 표면을 갖는다. 쉘 층(114) 표면의 평균 표면 거칠기(Ra)는 15nm 이하, 바람직하게는 10nm 이하, 더 바람직하게는 5nm 이하, 더욱 바람직하게는 2nm 이하, 특히 1.5nm 이하일 수 있다. 또한 Ra는 예를 들어 3nm 이상, 2nm 이상, 1nm 이상일 수 있다. 상기 범위의 표면 거칠기를 가질 경우 쉘 층(114) 표면에 반응 시료의 비특이적 흡착이 최소화될 수 있다.
강도 및 투명도를 고려하여 미세입자(110)의 쉘 층(114)은 유리로 된 것일 수 있다. 상기 유리는 소다라임, 보로실리케이트, 알루미노실리케이트, 실리카, 알칼리 실리케이트, 파이렉스 및 석영으로 이루어진 군 중에서 선택되는 화합물이 주성분이 될 수 있다. 바람직하게는 내열성, 내산성, 내수성이 요구되는 실험용으로 상기 유리는 보로실리케이트일 수 있다.
미세입자(110)는 막대형, 평판형, 구형 등과 같은 정형적인 형태나 비정형적인 형태를 포함한 다양한 형태를 가질 수 있다. 미세입자(110)가 평판 형태를 가질 경우에도 단면은 별형, 다각형, 원형 등의 다양한 모양을 가질 수 있으며, 특별히 제한되지 않는다. 바람직하게는 상기 미세입자는 제조의 편이성과 관찰의 용이성으로 마이크로로드(microrod), 마이크로디스크(microdisc), 또는 마이크로비드(nicrobead) 형태인 것이 바람직하며, 특히 마이크로로드의 형태를 갖는 것이 바람직하다. 미세입자(130)가 마이크로로드의 형태를 가질 경우 미세입자들 간의 겹침에 의한 구분이 용이하고, 웰 내에 배치될 경우 포커싱이 쉬우며, 개별 입자가 차지하는 면적이 적어 하나의 관찰화면에 다수의 미세입자들을 관찰할 수 있다. 한편 미세입자가 별 모양과 같이 단면이 복잡한 구조를 갖는 형상을 가질 경우 웰 내부에서 움직이는 과정에서 서로 간 또는 벽과의 충돌에 의하여 모서리 부분의 깨짐이 발생할 수 있으므로 마이크로로드와 같이 단순한 형태를 갖는 것이 유리하다.
상기 마이크로로드의 길이가 10 내지 1,000㎛일 수 있다. 상기 마이크로로드의 길이가 상기 범위 미만에서는 서로 다른 길이의 입자간의 구분이 쉽지 않고, 상기 범위 초과에서는 입자들의 겹침이 발생할 수 있어 관찰이 용이하지 않을 수 있다. 또한, 상기 마이크로로드의 직경 대비 길이의 비(종횡비)는 2 이상, 5 이상 또는 10 이상일 수 있다. 상기 종횡비의 상한은 20 이하, 10 이하 또는 5 이하일 수 있다. 종횡비가 상기 범위 미만에서는 구형의 미립자와 유사하여 서로 구별하기가 어려울 수 있으며 너무 크면 휘어질 수 있다.
바람직한 일 구현예로서, 미세입자(110)는 유리가 코팅된 금속 미세와이어의 절단물일 수 있다. 유리가 코팅된 금속 미세와이어를 레이저로 단순히 절단함으로써 다양한 길이를 갖는 미세입자(110)를 얻을 수 있다.
상술한 미세입자는 생명체로부터 유래된 특정 검체 내의 바이오마커를 검출하는 체외진단용으로 적합하게 사용될 수 있다. 상기 검체는 조직 추출물, 세포 용해물, 전혈, 혈장, 혈청, 침, 안구액, 뇌척수액, 땀, 뇨, 젖, 복수액, 활액, 복막액 등일 수 있다. 신속 진단을 위해 상기 시료액의 전처리는 간소화되거나 경우에 따라서 생략될 수 있다.
생명체로부터 유래된 검체 내에 함유된 복수의 바이오마커들을 동시에 진단하기 위해 상기 미세입자들은 서로 상이한 크기, 길이 또는 형상의 입자들로 제조되어 사용될 수 있다.
포획 프로브(120)는 시료로부터 유래한 바이오마커, 특히 핵산 기반 바이오마커를 포획하기 위하여 미세입자(110)에 도입될 수 있다. 상기 바이오마커는 생물처리과정, 병원성을 일으키는 과정, 치료를 위한 약리학적 과정의 측정 또는 평가 등의 통상적인 과학 또는 의료분야에서 사용되는 것이면 제한없이 이용가능하다. 상기 바이오마커는 예를 들어 혈액, 타액, 소변 등의 생체액에서 검출할 수 있는 폴리펩티드, 펩티드, 핵산, 단백질 또는 대사물질일 수 있으며, 바람직하게는 특정 질병과 연관된 바이오마커를높은 민감도 및 특이도를 가지고 검출할 수 있다는 면에서 상기 바이오마커는 핵산이다.
검체로부터 추출된 표적 핵산을 포획하기 위해 본 발명의 일 구현예에 따른 미세입자는 쉘 층(114) 위에 포획 프로브(120)가 도입될 수 있다. 포획 프로브(120)는 상기 표적 핵산에 상보적이어서 특이적으로 결합하여 상기 표적 핵산을 미세입자(110)에 고정시키는 역할을 한다.
포획 프로브(120)는 유전자 가위 기술을 적용하기 위한 임의의 염기서열을 포함하는 것일 수 있다. 바람직하게는 포획 프로브(120)는 가이드 RNA(guide RNA, gRNA)이거나 이를 포함할 수 있다. 상기 가이드 RNA는 표적 DNA 특이적인 RNA(예를 들어, DNA의 표적 부위와 혼성화 가능한 RNA)를 의미하며, 절단 효소와 함께 크리스퍼 시스템의 일 요소로 사용될 수 있다. 상기 가이드 RNA는 두 개의 가이드 RNA, 즉, 유전자의 표적 부위와 혼성화 가능한 뉴클레오타이드 서열을 갖는 CRISPR RNA(crRNA)와 추가적인 트랜스-활성화 tracrRNA(trans-activating crRNA)를 포함하며, crRNA와 tracrRNA가 부분적으로 결합된 crRNA:tracrRNA 복합체(이중 가이드 RNA (dual guide RNA)) 형태, 또는 상기 crRNA(일부 또는 전부)와 tracrRNA(일부 또는 전부)가 링커를 통하여 연결되어 단일 가이드 RNA(single guide RNA; sgRNA)의 형태일 수 있다. 상기 gRNA는 상기 표적 핵산과 결합하며 절단 효소를 만나면 상기 표적 핵산 및 상기 리포터 핵산을 절단할 수 있다. 이러한 가이드 RNA의 특성을 이용하면 추후 설명하겠지만 특정 바이오마커의 서열을 절단함으로써 얻어지는 검출 신호의 변화 정보를 이용하여 신속한 바이오마커의 검출이 가능하다.
구체적으로, 상기 포획 프로브(120)는 15mer 내지 60mer의 핵산일 수 있다. 또한, 20mer 내지 45mer, 25mer 내지 40mer, 또는 30mer 내지 41mer일 수 있다.
포획 프로브(120)는 미세입자(110)의 표면에 흡착시키거나 화학적으로 연결시켜 고정시킬 수 있으며, 바람직하게는 쉘 층(114)의 표면의 기능기와 연결될 수 있다. 예를 들어 포획 프로브(114)의 표면에 비오틴(biotin)을 도입하고 미세입자(110)에는 비오틴과 결합하는 아비딘(avidin), 뉴트라비딘(neutravidin) 또는 스트렙타비딘(strepavidin)을 도입하여 포획 프로브(114)를 미세입자(110)에 부착시킬 수 있다. 또는 미세입자(110) 표면의 히드록시기, 아미노기 또는 카르복실기를 이용하여 포획 프로브(120)를 미세입자(110)에 연결시킬 수 있다.
상술한 핵산 분리 및 검출용 미세입자 프로브를 이용하면 시료액 중의 원하는 생체물질을 고감도로 신속하게 분석할 수 있다.
리포터 핵산(130)은 포획 프로브(120)와 함께 미세입자(110)의 표면에 도입되며, 화학적, 기계적, 광학적, 전기적 에너지를 비롯한 외부 자극에 의하여 신호, 예를 들어 광학적 또는 전기적 신호를 발생시킨다. 일 구현예에서, 리포터 핵산(130)은 발광 물질로 라벨링된 핵산일 수 있으며, 외부 광 또는 화학반응에 의해 형광 혹은 화학발광과 같은 발광 신호를 발생시킬 수 있다.
구체적으로, 상기 리포터 핵산(130)은 DNA 일 수 있다. 또한, 상기 리포터 핵산은 15mer 내지 40mer의 핵산일 수 있다. 또한, 18mer 내지 30mer, 19mer 내지 25mer, 또는 20mer 내지 23mer일 수 있다.
상기 발광 물질은 상기 검출 프로브에 연결되어 자외선, 전자선, 화학반응, 효소-기질 반응 등과 같은 외부 자극에 의해 빛을 생성함으로써 상기 표적 핵산의 존재를 검출할 수 있게 한다. 상기 발광 물질의 예로서, 형광분자, 양자점, 금속 나노입자, 자기 나노입자, 효소, 효소 기질 등을 들 수 있다. 이들 중 입수용이성 및 적용의 편이성 면에서 다양한 발광 물질로서 형광분자가 선택될 수 있다. 상기 형광분자의 예로서, FITC(fluorescein isothiocyanate), 플루오레세인(fluorescein), FAM(fluorescein amidite), PE(phycoerythrin), TRITC(tetramethyl-rhodamine isothiocyanate), Cy3(Cyanine 3), Cy5(Cyanine 5), Cy7(Cyanine 7), 알렉사(Alexa) 플루오르 염료, 및 로다민 (rhodamine)으로 이루어진 군에서 선택되는 형광분자가 흔히 사용될 수 있다.
검체 내의 다양한 바이오마커의 검출을 위해 FITC, PE, Alexa-647 등의 다양한 형광단(fluorophore)을 리포터 핵산(130)의 5'- 위치에 도입하여 라벨링할 수 있다.
본 발명의 일 구현예에 따른 표적 핵산 분리 및 검출용 미세입자 프로브의 경우, 유전자 가위 시스템을 도입함으로써 표적 핵산의 신속, 정확한 검출에 응용될 수 있다.
리포터 핵산(130)은 본 핵산검출용 미세 입자 프로브를 유전자 가위 시스템에 활용시 절단 대상 염기서열이 될 수 있다. 유전자 가위는 DNA 뉴클레아제(nuclease) 기능을 갖는 단백질 복합체를 이용하여 유전체 특정 부위에 DNA의 삽입, 결손 및 치환을 유도하여 돌연변이를 일으키는 기술이다. 유전자 가위 기술은 징크핑거 뉴클레아제(ZFNs, Zinc Finger Nucleases), 탈렌(TALENs, Transcription Activator-Like Effector Nucleases), 크리스퍼-카스(CRISPR-Cas) 시스템 등이 있다. 바람직하게는 DNA에서 간편하고 빠른 방식으로 원하는 부위를 정확하게 잘라내는 능력이 뛰어나다는 점에서 상기 유전자 가위 기술은 크리스퍼-카스(CRIPSR-Cas) 시스템이다. 크리스퍼(CRISPR, clustered regularly interspaced short palindromic repeats)는 가이드 RNA(gRNA) 역할을 해 표적 DNA를 인식하고 Cas 엔도뉴클레아제와 같은 절단 효소와 함께 복합체를 이루어 DNA 이중가닥을 잘라낸다.본 발명에서의 크리스퍼-카스 시스템은 공지된 것이라면 특별히 한정되지 않으며, 절단 효소의 종류에 따라 CRISPR-Cas9, CRISPR-Cas12, CRISPR-Cas13 등을 들 수 있다. 이중, 가이드 RNA 내에서 미스매치에 대한 높은 감도를 가진다는 점에서 바람직하게는 상기 크리스퍼-카스 시스템은 CRISPR-Cas12일 수 있으며, 더 바람직하게는 Cas12a 단백질을 절단 효소로 사용하는 CRISPR-Cas12a이다.
일 구현예에서, 리포터 핵산(130)은 DNA 뉴클레아제 기능을 하는 단백질 복합체 중 하나인 추후 도입될 Cas 엔도뉴클레아제(engineered nuclease)와의 반응을 위해 미세입자(110)의 표면에 고밀도로 부착될 수 있다. 리포터 핵산(130)은 예를 들어 미세입자(110)의 표면에 5×1016 개/m2 내지 10×1016 개/m2, 바람직하게는 6×1016 개/m2 내지 7×1016 개/m2의 밀도로 도입될 수 있으며, 이 경우 미세입자(110)의 크기와 형상을 구분하기 용이하도록 강한 신호를 발생시킬 수 있다. 리포터 핵산(130)은 임의의 서열로 이루어질 수 있으며, Cas 엔도뉴클레아제의 종류에 따라 단일 가닥 또는 이중 가닥의 핵산서열을 가질 수 있다. 이때 Cas 엔도뉴클레아제는 구현예에서, 미세입자 프로브(100)(즉, 미세입자(110) 표면에 포획 프로브들(120)과 리포터 핵산들(130)이 균일하게 분포한 상태)와 표적 핵산의 결합체와 복합체를 이룬 다음, 포획 프로브(120)와 표적 핵산의 결합체 인근에 분포한 리포터 핵산(130)을 절단하는 기작으로 작동하게 된다.
환자로부터 얻은 검체 시료를 전처리하여 얻은 표적 핵산의 증폭물을 상술한 표적 핵산 분리 및 검출용 미세입자 프로브(100)와 반응시키면, 증폭되는 단일가닥 부위를 인식하는 특정 표적 핵산의 포획 프로브의 gRNA와 상보적 결합을 하여 복합체가 형성될 수 있다. 이 복합체에 크리스퍼 시스템에 사용되는 Cas12a 단백질과 같은 Cas 엔도뉴클레아제를 적용하면, 가이드 RNA의 스페이서 서열에 표적 핵산이 결합되어 Cas12a 단백질의 서열 절단 기능이 활성화되어 표적 핵산과 주변의 리포터 핵산(130)을 절단함으로써 형광신호가 유지되지 않고 소멸되는 현상을 관찰할 수 있다.
따라서, Cas 엔도뉴클레아제 적용 전후의 명시야 이미지(bright field image)와 형광 이미지(fluorescence image)를 동시에 얻어서 비교해보면 형광이 사라진 미세입자를 관찰할 수 있으며 이에 따라 검체 내 특정 핵산의 포함여부를 확인할 수 있다. 이렇게 유전자 가위 시스템을 적용함으로써, 다양한 형상 또는 크기, 형광체의 종류 등을 구비한 미세입자를 사용하여 다중 진단이 가능하다.
본 발명의 다른 측면에 의하면, 표적 핵산 검출용 키트가 제공된다.
상기 키트는 상술한 표적 핵산 분리 및 검출용 미세입자 프로브 및 절단 효소를 포함한다. 상기 표적 핵산 분리 및 검출용 미세입자 프로브에 대해서는 위에서 자세히 설명하였다. 상기 절단 효소의 바람직한 예로서 Cas 엔도뉴클레아제는 가이드 RNA와 복합체를 이루어 리포터 핵산을 절단하는 크리스퍼-카스 시스템의 구성요소로 작용할 수 있으며, 예를 들어 Cas9 또는 Cas12a 단백질일 수 있다.
일 구현예에서, 상기 키트는 표적 핵산 포집용 자성 미세입자, 핵산증폭용 시약, 라이시스 용액 및 세정액으로 이루어진 군 중에서 선택되는 1종 이상을 더 포함할 수 있다.
상기 표적 핵산 포집용 자성 미세입자는 표면 부위에 실리카의 특성을 가지도록 구성함으로써 표면의 표면적을 늘리는 동시에 라이시스 용액에 포함된 고농도의 카오트로픽(chaotropic) 염 존재 아래 염다리를 형성하는 등 핵산을 손쉽게 포획할 수 있는 효과를 내는 것으로, 실리카 자성 비드 혹은 실리카 코팅된 자성 미세입자일 수 있다. 상기 핵산증폭용 시약은 표적 핵산을 증폭하기 위한 것으로 특별히 제한되지 않지만 등온 조건에서 핵산 증폭이 시행되는 루프-매개 등온증폭(Loop-mediated isothermal amplification, LAMP), 단일 프라이머 등온증폭(Single primer isothermal amplification, SPIA), 재조합 폴리머라제 증폭(Recombinase polymerase amplification, RPA) 등일 수 있으며, 신속성 및 저온 반응 특성면에서 바람직하게는 RPA 시약일 수 있다. 예를 들어, RT-RPA 시약에는 RSV, 인플루엔자(Influenza), 코로나바이러스(Coronavirus) 유전자를 특이적으로 증폭하기 위한 표적 특이적 프라이머들이 포함될 수 있다. 상기 라이시스 용액은 구아니디니늄 염과 같은 카오트로픽 염 기반의 샘플 라이시스(lysis) 용액일 수 있다. 상기 세정액은 샘플을 세정하기 위한 에탄올 기반의 용액일 수 있다.
한편, 이러한 표적 핵산 검출용 키트와 함께 핵산 검출용 키트 구동 통합 장비가 결합되어 전체 핵산 검출용 시스템을 구성할 수 있다. 즉 샘플의 분리 및 반응촉진을 할 수 있도록 자석봉을 구비함으로써, Lysis 샘플 내 핵산 포집용 자성 미세입자와 신호 검출용 미세입자 프로브(100)를 원활하게 구동시킬 수 있는 핵산 검출용 키트 구동 통합 장비가 전체 시스템 내에 포함될 수 있다.
상기 표적 핵산 검출용 키트를 이용함으로써, 샘플의 종류에 관계없이 채취한 시료의 도말을 시작으로 시료의 lysis, 핵산 포집 및 증폭, 증폭된 표적 핵산의 포획, 포획된 표적 핵산으로 인한 Cas12a 활성 반응 등을 완전한 자동화 과정을 통해, 반응을 진행하게 되고 인지된 표적 핵산으로 인한 형광 신호 감소를 측정하여 표적 물질의 유무를 신속, 정확하게 검출할 수 있다.
본 발명의 또 다른 측면에 의하면, 표적 핵산의 검출방법이 제공된다.
먼저 (a) 표적 핵산을 검체로부터 추출한다. 검체의 세포막을 파괴하여 세포 내 핵산을 밖으로 나오도록 구아니디니움 티오시아네이트(Guanidinium thiocyanate)를 함유한 라이시스(lysis) 용액을 사용할 수 있다. 용액 내 핵산들은 자성 실리카 비드 혹은 본 발명의 실리카 코팅된 미세입자(110)에 부착시켜서 농축시키고 알코올을 이용해 세척하는 과정, 용리 버퍼(elution buffer)를 이용해 탈리하는 과정을 거칠 수 있다.
다음 (b) 상기 표적 핵산을 증폭한다. 예를 들어 역전사 실시간 중합효소연쇄반응(RT-RPA) 시약을 이용하여 표적 핵산을 특이적으로 증폭시킬 수 있다.
이어 (c) 표적 핵산 분리 및 검출용 미세입자 프로브를 제공한다. 상기 표적 핵산 분리 및 검출용 미세입자 프로브는 미세입자, 상기 미세입자의 표면에 도입되며 상기 표적 핵산에 상보적인 서열을 포함하는 가이드 RNA, 및 상기 미세입자의 표면에 도입되며 외부 자극에 의하여 신호를 발생시키는 리포터 핵산을 포함한다. 본 미세입자의 각 구성요소들에 대한 상세한 설명은 상술한 바와 같다.
(d) 상기 표적 핵산 분리 및 검출용 미세입자 프로브의 상기 가이드 RNA와 상기 표적 핵산을 혼성화시켜 표적 핵산 분리 및 검출용 미세입자 프로브-핵산의 복합체를 형성한다.
일 구현예에서, 상기 표적 핵산 분리 및 검출용 미세입자 프로브에는 특정 바이러스만을 표적으로 하는 가이드 RNA와 5'-형광단(5'-fluorophore)이 부착되어 있는 리포터 DNA가 고정될 수 있다. 증폭되는 단일가닥 부위를 인식하는 특정 표적 자성입자 프로브의 gRNA가 바이러스 유전자와 상보적 결합을 하여 복합체를 형성할 수 있다. 상기 복합체의 형성은 외부 자력을 이용한 반응 촉진 과정을 포함할 수 있다. 예를 들어 반응 촉진을 위해 반응물들이 담긴 웰은 적절한 온도로 가열될 수 있으며, 웰 내부에 자석봉을 상하로 연속적으로 이동시킴으로써 자성 물질을 함유한 미세입자들을 제어하여 반응을 촉진시킬 수 있다.
(e) 절단 효소를 상기 표적 핵산 분리 및 검출용 미세입자 프로브의 가이드 RNA와 결합시킨다. 상기 절단 효소의 바람직한 예는 Cas 엔도뉴클레아제로서, 예를 들어 Cas9 또는 Cas12a일 수 있다.
상기 절단 효소는 상기 표적 핵산 분리 및 검출용 미세입자 프로브에 고정되어 있는 gRNA의 스캐폴드 서열(scaffold sequence)을 인식하여 바인딩하게 된다.
(f) 이후 상기 절단 효소의 활성화 반응에 의해 상기 표적 핵산 및 상기 리포터 핵산의 각 염기서열이 절단된다. 증폭된 표적 핵산이 gRNA에 결합되어 있는 상태면 Cas 단백질이 활성화되어 상기 표적 핵산 및 상기 리포터 핵산의 각 염기서열이 절단될 수 있다.
한편 반응이 완료된 미세입자 프로브는 세척 버퍼로 세척될 수 있으며, 바람직하게는 외부 자력을 이용한 미세입자 프로브의 세척 과정이 포함될 수 있다. 즉 상기 반응이 완료된 후, 상기 표적 핵산검출용 미세입자 프로브들을 자석봉을 이용하여 2개 이상의 세척 웰에서 연속적으로 세척시키는 단계가 더 포함될 수 있다. 세척 후에 상기 미세입자 프로브로부터의 발광 신호를 검출하여 상기 표적 핵산의 종류 및 양을 정확히 확인할 수 있다.
(g) 상기 외부 자극에 의해 상기 복합체로부터 방출되는 상기 신호의 온-오프를 측정하여 상기 표적 핵산을 검출한다. 상기 신호는 상기 복합체 내 발광물질로부터 방출되는 발광 신호일 수 있다. 상기 외부 자극은 자외선, 전자선, 화학반응, 효소-기질 반응 등일 수 있다. 예를 들어, Cas 엔도뉴클레아제를 처리하기 전에는 자외선과 같은 외부 자극에 의해 상기 상기 리포터 핵산에 결합된 형광분자에 의해 모든 미세입자 프로브들이 형광을 생성하여 온 상태가 될 수 있다. 이후, Cas 엔도뉴클레아제를 가이드 RNA와 결합시키면 Cas 엔도뉴클레아제에 의해 표적 핵산과 함께 상기 리포터 핵산의 염기서열이 절단됨으로써 표적 핵산이 부착된 미세입자 프로브의 형광이 오프 상태로 바뀐다. 명시야 이미지와 함께 겹쳐서 형광 이미지를 분석하면 표적 핵산과 복합체를 이룬 미세입자 프로브를 특정할 수 있어 표적 핵산을 구분할 수 있다.
본 발명의 또 다른 측면에 의하면, 상술한 핵산 분리 및 검출용 미세입자 프로브에 유전자 가위를 이용하여 검체 내의 표적 핵산을 분리 및 다중 검출하는 다중 진단방법이 제공된다.
본 다중 진단방법은 2종 이상의 상기 핵산 분리 및 검출용 미세입자 프로브에 상기 검체에서 증폭된 상기 표적 핵산이 상보적 결합을 하는 단계; 및 상기 핵산 분리 및 검출용 미세입자 프로브에 도입된 상기 유전자 가위가 이를 인지하여 주변에 존재하는 상기 리포터 핵산을 절단하는 단계를 포함한다. 상기 유전자 가위는 크리스퍼-카스 시스템일 수 있다. 이때 상기 리포터 핵산의 절단에 의하여 상기 신호의 감소를 측정하는 방법으로 상기 표적 핵산을 검출할 수 있다. 상기 신호는 형광 또는 화학발광인 것일 수 있다.
상기 2종 이상의 핵산 분리 및 검출용 미세입자 프로브들은 길이, 직경, 두께, 형상, 색상 또는 식별 코드에 의해 서로 구분되도록 표지될 수 있다. 상기 핵산 검출용 미세입자들은 서로 다른 길이, 크기 또는 형상 등을 가질 수 있으며, 각각 서로 다른 포획 프로브를 구비할 수 있다.
상기 다중 검출은 다양한 방식으로 표지된 상기 미세입자 프로브들을 판독하는 과정을 포함할 수 있다. 예를 들어, 검체에는 복수 개의 핵산 바이오마커들이 포함되어 있고 상기 미세입자 프로브들은 바이오마커의 개수와 동일한 개수의 복수개 종류의 형상들로 구성될 수 있다. 이 경우, 각기 다른 형상의 미세입자 프로브는 상기 검체에 포함된 복수 개의 핵산 바이오마커 중에서 각각 특정 바이오마커만을 포획할 수 있는 특이적으로 결합하는 포획 프로브가 고정된 상태로 구성됨으로써 동시에 복수의 바이오마커를 검출할 수 있는 것일 수 있다. 일례로 상기 미세입자 프로브가 마이크로로드일 경우, 서로 다른 길이를 갖는 마이크로로드들을 사용하고 여기에 크리스퍼-카스 시스템과 같은 유전자 가위 기술을 이용함으로써 2종 이상의 표적 핵산들을 대상으로 명시야 이미지와 형광 이미지를 분석하는 과정을 통해 신속하게 각각의 바이오마커의 종류와 양을 독립적으로 구할 수 있다. 예를 들어 유리 코팅 미세 와이어를 다양한 길이로 절단하여 만든 마이크로로드들을 미세입자 프로브들로 사용하면 단 1개의 형광 물질로도 다중검출이 가능하다. 각 길이 정보로 코드화된 미세입자 프로브들을 이미지 분석을 통해 해석함으로써 한번에 다중 탐지(multi-detection)가 가능하며, 고감도의 정확도를 유지할 수 있는 장점이 있다.
즉 2종 이상의 핵산 분리 및 검출용 미세입자 프로브를 사용하면 다양한 표적 핵산들에 대해 한번의 검출 과정을 통해 다중 진단이 가능하다.
도 2 및 도 3은 자성 미세입자/유전자 가위 기술을 이용하여 표적 핵산을 검출하는 프로세스를 나타낸다. 도 2 및 도 3을 참조하면, 8개의 웰들(Well 1~Well 8)에서 이루어지는 표적 핵산 검출 프로세스를 나타내며, Well 1~Well 3에서 DNA 포집 단계, Well 4에서 DNA 증폭 및 혼성화 단계, 및 Well 5~Well 8에서 이미지 분석 단계가 수행된다. 각 웰들에서의 절차를 좀더 상세히 설명하면 이하와 같다.
1) Well 1: 실리카 비드에 DNA 바인딩
자성 실리카 비드, 카오트로픽 염(chaotropic salt), 및 라이시스(lysis) 용액이 담겨져 있는 웰 1(well 1)에 검체를 투입하여 검체의 세포막이 파괴됨으로써, 세포 내 핵산이 밖으로 나오면 카오트로픽 염의 작용으로 핵산이 자성 실리카 비드에 부착된다.
2) Well 2: 세척 및 에탄올 침전
핵산이 부착되어 있는 자성 실리카 비드를 웰 2(well 2)로 옮겨 33% 이소프로판올로 DNA와 염의 반응을 향상시켜 DNA가 자성 실리카 비드에 강하게 부착시키고, 불필요한 잔존 물질들이 제거된다.
3) Well 3: 세척
핵산이 결합되어 있는 자성 실리카 비드를 70% 에탄올을 이용하여 세척한다. 이 과정에서 핵산 이외의 다른 잔여물이 추가적으로 최대한 제거된다.
4) Well 4: 핵산 증폭 및 혼성화
핵산이 결합되어 있는 자성 실리카 비드를 용리 버퍼(elution buffer)가 포함된 well 4로 옮겨 비드로부터 핵산을 탈리시킨다. 그 다음 well 4에 포함된 RT-RPA 시약으로 cDNA를 합성 및 증폭시킨다. RT-RPA 시약에는 RSV, 인플루엔자(Influenza), 코로나바이러스(Coronavirus) 유전자를 특이적으로 증폭하기 위한 표적 특이적 프라이머들이 포함될 수 있다.
한편 서로 다른 세 개의 길이를 갖는 3종의 자성 미세입자 프로브들을 준비한다. 각각의 특정 길이의 자성 미세입자 프로브에는 특정 바이러스만을 표적으로 하는 guide RNA와 신호검출을 위하여 5'-형광단(5'-fluorophore)이 부착되어 있는, 단일가닥 무작위 DNA의 형태의 리포터 DNA(reporter DNA)가 고정되어 있다. 바이러스 유전자가 RT-RPA에 의해 증폭됨에 따라, 이 과정에서 증폭되는 단일가닥 부위를 인식하는 특정 표적 자성입자 프로브의 gRNA가 바이러스 유전자와 상보적 결합을 하여 자성 미세입자 프로브와 바이러스 유전자 서열의 복합체가 형성된다.
5) Well 5: Cas 단백질 결합 및 리포터 DNA 서열 절단
웰 4(well 4)에서 반응이 완료된 막대모양의 자성입자(round-shaped magnetic particle, RSMP)인 자성 미세입자 프로브는 Cas12a 엔도뉴클레아제(endonuclease)가 포함되어 있는 well 5로 옮겨준다. Cas12a 단백질은 자성입자 프로브에 고정되어 있는 gRNA의 스캐폴드 서열(scaffold sequence)을 인식하여 바인딩하게 된다. gRNA-cas12a 단백질 복합체가 형성되고, 웰 4(well 4)에서 표적 DNA(target DNA)가 증폭되어 gRNA의 스페이서 서열(spacer sequence)에 결합되어 있는 상태면 cas12a 단백질의 endonuclease 기능이 활성화 되어 target DNA와 주변의 비특이적(non-specific) DNA를 절단하게 된다. 반대로 well 4에서 표적 DNA가 증폭되지 않을 경우, 웰 5(well 5)에서 gRNA-cas12a 단백질 복합체는 형성되나 guide RNA의 스페이서 서열에는 표적 DNA가 결합되어 있지 않아 cas12a 단백질의 엔도뉴클레아제 기능은 활성화 되지 않는다.
6) Well 6: 세척
반응이 완료된 자성 미세입자 프로브를 세척 버퍼(washing buffer)로 세척한다.
7) Well 7: 세척
반응이 완료된 자성 미세입자 프로브를 세척 버퍼로 한 번 더 세척한다.
8) Well 8: 이미지 분석
반응 및 세척이 완료된 자성 미세입자 프로브를 이미징한다. 이때 명시야 이미지(bright field image)와 형광 이미지(fluorescence field image) 둘다 얻는다.
상술한 핵산 분리 및 검출용 미세입자 프로브 및 이를 이용한 다중 진단 방법은 다음과 같은 장점을 가질 수 있다. 본 발명은 호흡기 바이러스 긴급진단 플랫폼 개발을 위해 크리스퍼-카스(CRISPR-CAS) 유전자 가위 기술을 이용하여 기존 RT-PCR(Reverse Transcriptase-Polymerase Chain Reaction) 방식의 분자 진단 한계를 극복하였다. 기존 분자 진단 방법은 현장에서 검체의 채취, 수탁 기관에서 유전자 추출, 증폭, 검출의 과정이 이루어지며 고가의 장비를 이용하여 유전자 증폭의 결과를 얻었다. 이러한 과정으로 인해 현장에서 대량의 샘플 검사에 적합하지 않으며 결과를 얻을 때까지 최소 6시간 이상의 시간이 소요되었다. 그러나 본 발명은 크리스퍼-카스 유전자 가위 기술의 도입으로 유전자 추출, 증폭, 검출의 과정이 현장에서 가능하며 자동화가 가능하다(자성입자의 사용에 의해 유전자 추출, 증폭 단계에서의 시간을 대폭 줄일 수 있음). 또한 본 발명은 기존 분자 진단에서 보이는 비특이적 증폭(non-specific amplification) 현상을 크리스퍼-카스 유전자 가위 기술로 극복하였다.
핵산 분리 및 검출용 미세입자 프로브/유전자 가위 기술이 도입된 본 발명은 유전자의 정확한 서열을 인식하고 작동하므로 기존 분자 진단 기술 대비 민감도, 특이도를 높일 수 있으며 증상이 비슷한 COVID19, 인플루엔자, RSV 등과 같은 바이러스를 30~40분 이내로 다중 진단이 가능하여 한꺼번에 정확한 다중 진단을 내릴 수 있어 치료효과를 극대화시킬 수 있다. 이와 같이 다양한 바이오마커를 동시에 진단 가능하므로, 본 발명에 따른 검출방법을 사용하면 POCT(Point-Of-Care Test) 다중 진단에 유용하게 사용될 수 있다.
이하, 실시예를 통하여 본 발명에 대해 보다 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 기술적 사상이 이들 실시예에 의해 제한되지 않는다는 것은 당업계에 통상의 지식을 가진 자에게 있어서 자명할 것이다.
[실시예]
본 실시예에서는 단일 process 과정으로 진행되는 실험 단계들을, 표적 인자 lysis 및 핵산 포집 증폭 단계, 신호 검출 목적의 자성입자 프로브 제작 단계, 표적 인자 반응에 따른 신호 검출 단계 등으로 임의로 나눠 각 단계들을 상세하게 기술하고자 한다.
실시예 1. 핵산 포집용 자성 미세입자의 제조
본 다중 진단 시스템에 있어서 8개의 웰(well)들이 사용되었으며 각 웰들 간의 핵산 이동을 위해서는, 표적 인자로부터 추출된 핵산을 안정적으로 포집하여 웰 간 이동을 시킬 수 있는 자성 미세입자의 사용이 필수적이다. 핵산의 안정적 포집을 위해 10 내지 1000 ㎛ 크기의 원기둥형 자성 미세입자 또는 상용화된 자성 미세입자를 원재료로 사용하여 충분한 표면적을 가진 핵산 포집용 자성입자를 제조하였다.
먼저 준비된 기본형의 자성 미세입자(자사 제조, 도 1의 (110)에 해당하는 포획 프로브가 도입되어 있지 않은 코어-쉘 형태의 기본형 자성 미세입자로서, 100 - 500 ㎛ 길이를 가진 원기둥 막대형)를 0.1M의 수산화나트륨 용액으로 3회, 100% 에탄올 용액으로 3회 수세한 후, 2초 간 초음파 세척하였다.
다음 암모니아수를 포함한 용액(100% 에탄올 20 ml, 탈이온수 3 ml, 암모니아수 1 ml 조성) 10 ml에 상기 자성 미세입자 200mg을 투입하고, 단위 자성입자 10mg 당, TEOS (Tetraethylorthosilicate) 100 ㎕ 기준으로, TEOS 용액 2 ml을 첨가하였다. 상기 용액을 로테이터(rotator) 장치(FINEPCR, Hybridization Incubator Combi-H12)를 이용하여 20분 간 20 rpm 회전시키는 과정을 1회 반응으로 하되, 각 반응 진행 시 마다, TEOS 2ml 용액을 첨가하여 총 4회 반응을 진행하여 자성 미세입자 제작을 완료하였다. 반응 후 얻어진 자성입자를 앞선 암모니아수 포함 용액으로 3회, 100% 에탄올로 3회 수세한 후, 에탄올 용액에 보관하였다.
핵산 포집용으로 제작된 자성 미세입자의 핵산 포집능을 확인하기 위한 목적으로, 임의의 샘플을 준비하여 실제 핵산 포집능을 확인하였다. 임의의 샘플로서 가상의 바이러스 또는 유해균을 상정해볼 수 있는데 여기서는 임의의 대장균을 대상으로 선정하여 핵산 포집 유무를 확인하였다.
도 5는 자성입자 기반 표적 샘플의 핵산 포집 가능성을 사전 확인한 결과를 나타낸 것이다. 도 5의 A는 임의의 표적 인자로 설정한 대장균 샘플을 바탕으로 기존 상용화 대장균 plasmid mini prep. kit (Bioneer, AccuPrep® Plasmid Mini Extraction Kit)을 기반으로 플라스미드 DNA(plasmid DNA)가 도입된 대장균으로부터 플라스미드 DNA를 정제 분리한 결과와 자사 자성 미세입자를 기반으로 제작된 핵산 포집용 자성 미세입자 beads를 통해 plasmid DNA 도입 대장균으로부터 plasmid DNA를 아가로즈 겔 기반의 전기영동법으로 정제 분리하여 비교한 결과이다.
도 5의 A를 참조하면, 자사의 핵산 정제용 자성입자가 100개, 및 500개가 있는 조건에서 plasmid DNA를 정제 포집할 수 있음을 알 수 있다.
Lysis buffer :　Well 1을 구성하는 버퍼(buffer) 조성 (2M guanidinium thiocyanate, 36.7 mM Tris-Cl, 16.7 mM EDTA, 2% Triton X-100, 33% isopropanol, RNase free water)을 바탕으로 배양된 1 ml 의 대장균 농축 샘플과 자사 자성 미세입자 비드를 섞은 후, 회전(rotating) 교반 10분 진행, lane 1, 2 - 상용화 plasmid prep. kit 정제 결과 1, 2번, lane 3 - 자사 핵산 정제용 비드(beads) 100ea 기준 정제 결과, lane 4 - 자사 핵산 정제용 beads 500ea 기준 정제 결과, lane M : 1kb DNA ladder (솔젠트, 1 Kb Plus DNA Ladder))
도 5의 B는 도 5A와 동일한 조건에서 plasmid prep. kit과 자사 핵산 정제용 beads 500ea 기준 핵산 정제를 확인한 결과이다. 도 5의 B를 참조하면, plasmid prep. kit 대비 자사 자성입자 핵산 정제를 통해 대장균의 genomic DNA를 비롯해 plasmid DNA 모두 정제 회수할 수 있음을 확인할 수 있다.
도 5의 C는 2 ㎍ 농도의 plasmid DNA를 표적으로 자사 자성입자의 포집능을 확인한 결과이다. 도 5의 C를참조하면, 자사 핵산 정제용 자성입자를 통해 7.3% 정도의 비율로 핵산 샘플을 포집할 수 있다는 점을 통해 임의의 핵산에 대한 포집능을 확인할 수 있다.
실시예 2. 표적 인자 lysis 및 핵산 포집 증폭 단계 (Well 1 - Well 4)
표적 샘플 lysis부터 자성입자 프로브를 이미징하기까지 과정을 단일 process 과정으로 진행하는 자사 자동화 장비 적용 가능성을 확인하였다. 라이시스(Lysis) 및 포집에 의해 얻어진 표적 핵산이 정상적으로 well 간 이동을 통해 순차적으로 프로세스가 진행되는지 확인하기 위한 이동성 테스트를 진행하였다.
도 6은 본 발명의 일 구현예에 따른 다중 진단방법에서 표적 샘플의 핵산 포집 및 표적 부위 핵산 증폭을 확인한 결과를 나타낸 것이다.
도 6은 웰 1(Well 1)에서 웰 4(Well)까지 순차적으로 이루어지는 표적 핵산의 포집 및 증폭 프로세스를 나타낸다. 도 6을 참조하면, 웰 1(Well 1)에서 Lysis/핵산 포집을 수행하며, 바이러스 샘플로부터의 추출 및 포집을 위해 Chaotropic salt를 포함한 용액(2M guanidinium thiocyanate, 36.7 mM Tris-Cl, 16.7 mM EDTA, 2% Triton X-100, 33% isopropanol, RNase free water)을 이용하여 바이러스 샘플로부터 핵산을 추출하고 포집하였다.
웰 2(Well 2)에서 첫번째 세정 과정(washing-1)이 이루어지는데 2M guanidinium thiocyanate, 36.7 mM Tris-Cl, 16.7 mM EDTA, 2% Triton X-100, RNase free water + 66% Isopropanol를 이용하여 포집된 핵산을 포함한 자성입자를 세정하고 포집 핵산을 좀더 자성입자에 응축시켰다.
웰 3(Well 3)에서 두번째 세정 과정(washing-2)이 이루어지며, 70% 에탄올을 이용하여 자성입자에 부착된 잔여 부산물(waste)을 제거하였다.
웰 4(Well 4)에서 핵산의 회수 및 증폭이 이루어지며, 자성입자에 부착된 핵산을 탈리시킨 후, 탈리된 핵산들을 증폭시켰다. 핵산 증폭을 위해 RPA (Recombinase Polymerase Amplification) 효소 복합체를 기반으로 구성된 용액을 이용하였다.
도 7은 임의의 핵산인 단편 RNA와 DNA(서열 1 참고)에 대하여 핵산 포집 및 증폭 과정을 거친 결과이다. Well 4에서 탈리된 표적 핵산을 임의의 핵산 단편 RNA 또는 DNA를 투입한 조건에서 RT-RPA(Reverse Transcriptase Recombinase Polymerase Amplification)와 RPA 반응을 37도 온도 조건에서 20분 진행하였다. 이 때 사용한 RPA 시약의 조성은 제조사(TwistDx, TwistAmp Liquid Kit)에서 권장하는 프로토콜을 따라 반응을 진행하였다. 도 7을 참조하면, 각 RNA 샘플과 DNA 샘플이 포집되어 Well들 사이에 이동을 거친 후에 Well 4에서 핵산 해리된 다음 RT-RPA 및 RPA 효소 복합체에 의해 핵산 증폭이 정상적으로 이뤄졌음을 확인할 수 있다. 700 base 미만의 증폭된 핵산들의 크기를 좀더 명료하게 확인하기 위한 목적에서 TBE PAGE gel 전기영동을 진행하였다.
나아가 불활성화 바이러스(inactivated virus)인 influenza A, B, Covid-19 표적에 대해서도 테스트하였다. 표 1은 불활성화 바이러스의 정보이다. 또한 표 2 내지 표 6은 본 실시예들에 사용된 핵산의 염기서열 목록이다.
Covid-19 (SARS-CoV-2/USA-WA1/2020, Culture Fluid, Heat Inactivated)
ZeptoMetrix, Cat. No. 0810587CFHI
Influenza A virus (California/07/09(H1N1), Culture Fluid, Heat Inactivated)
ZeptoMetrix, Cat. No. 0810165CFHI
Influenza B virus (Florida/02/06, Culture Fluid, Heat Inactivated)
ZeptoMetrix, Cat. No. 0810037CFHI
서열번호 1 및 2: 임의의 표적 핵산 (RNA/DNA) 정보
Covid-19 (GenBank : MW811435.1, SARS-CoV-2/human/USA/USA-WA1/2020, N gene)
RNA : T7 promoter 를 통합 인공 RNA 합성
GGGCGAAUUGGGUACCAACACAAGCUUUCGGCAGACGUGGUCCAGAACAAACCCAAGGAAAUUUUGGGGACCAGGAACUAAUCAGACAAGGAACUGAUUACAAACAUUGGCCGCAAAUUGCACAAUUUGCCCCCAGCGCUUCAGCGUUCUUCGGAAUGUCGCGCAUUGGCAUGGAAGUCACACCUUCGGGAACGUGGUUGACCUACACAGGUGCCAUCAAAUUGGAUGACAAAGAUCCAAAUUUCAAGCUUGAUAUCGAAUUCCUGCAGCCCGGGGGAUCCACUAGUU (서열번호 1)
DNA : KpnI / XbaI 제한 효소를 통한 DNA 서열 확보
CAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTCAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTT (서열번호 2)
서열번호 3 내지 5: 각 표적 샘플의 표적 서열 정보
Covid-19 (GenBank : MW811435.1, SARS-CoV-2/human/USA/USA-WA1/2020, N gene)
AACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTC (서열번호 3)
Influenza A virus (GenBank : MG027914.1, A/California/MA_07/2009(H1N1), HA gene)
CCGGGAGACAAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCTGGTATTATCATTTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAGACACCCAAGGGTGCTATAAACACCAGCCTCCCATTTCAGAATATAC (서열번호 4)
Influenza B virus (GenBank : CY018366.1, B/Florida/02/2006, M1 gene)
ATGTCGCTGTTTGGAGACACAATTGCCTACCTGCTTTCATTGACAGAAGATGGAGAAGGCAAAGCAGAACTAGCAGAAAAATTACACTGTTGGTTCGGTGGGAAAGAATTTGACCTAGACTCTGCTTTGGAATGGATAAAAAACAAAAGATGC (서열번호 5)
서열번호 6 내지 11: 표적 서열 증폭용 프라이머 (RPA 표적 primer)
Covid-19 (GenBank : MW811435.1, SARS-CoV-2/human/USA/USA-WA1/2020, N gene)
Forward 5’-AAC ACA AGC TTT CGG CAG-3’(서열번호 6)
Reverse 5’-GAA ATT TGG ATC TTT GTC ATC C-3’(서열번호 7)
Influenza A virus (GenBank : MG027914.1, A/California/MA_07/2009(H1N1), HA gene)
Forward 5’-CCG GGA GAC AAA ATA ACA TTC-3’(서열번호 8)
Reverse 5’-GTA TAT TCT GAA ATG GGA GGC-3’(서열번호 9)
Influenza B virus (GenBank : CY018366.1, B/Florida/02/2006, M1 gene)
Forward 5’-ATG TCG CTG TTT GGA GAC ACA ATT G-3’(서열번호 10)
Reverse 5’-GCA TCT TTT GTT TTT TAT CCA TTC-3’(서열번호 11)
서열번호 12 내지 14: Guide RNA 정보
Covid-19 (GenBank : MW811435.1, SARS-CoV-2/human/USA/USA-WA1/2020, N gene)
5’-UAA UUU CUA CUA AGU GUA GAU CCC CCA GCG CUU CAG CGU UC-3’-NH2 (서열번호 12)
Influenza A virus (GenBank : MG027914.1, A/California/MA_07/2009(H1N1), HA gene)
5’-UAA UUU CUA CUA AGU GUA GAU AGA UAC ACC AGU CCA CGA UU-3’-NH2 (서열번호 13)
Influenza B virus (GenBank : CY018366.1, B/Florida/02/2006, M1 gene)
5’-UAA UUU CUA CUA AGU GUA GAU AUU GAC AGA AGA UGG AGA AG-3’-NH2 (서열번호 14)
서열번호 15 및 16: 형광 신호 검출용 reporter DNA
1 Reporter DNA QC용 (quencher 부착) 5’-TAMRA-TTA TTA TT-3’-BHQ2 (서열번호 15)
2 Reporter DNA-Fluorphore 부착용 5’-Thiol-TTA TTA TT-3’-NH2 (서열번호 15)
3 Reporter DNA-TAMRA 5’-NH2-TTA TTA TTT T-3’-TAMRA (서열번호 16)
도 8은 불활성 바이러스인 표적에 대한 핵산 포집 및 증폭 결과이다. 도 8을 참조하면, 서열 2 및 서열 3의 표적 서열을 갖는 불활성 바이러스를 Lysis 및 핵산 포집한 결과, 웰들 간에 이동이 정상적으로 진행되어 RT-RPA 효소 복합체에 의해 표적 핵산이 증폭되었음을 확인할 수 있었다. 도 8에서 lane 1, 2는 샘플 없이, 동일 process 진행 후, RT-RPA 진행 결과이고, lane 3 - 5는　Covid-19, 인플루엔자 A, 인플루엔자 B 바이러스의 표기된 세포반수감염용량을 기반으로 RT-RPA 과정을 수행한 결과이다. 세포반수감염용량을 의미하는 TCID50 은 세포 배양 시, 세포의 50%를 감염시킬 수 있는 바이러스의 양을 나타낸다. 본 전기영동 결과 데이터로부터 2.34 / 2.3 / 2.09 TCID50 과 같이 낮은 TCID50 의 바이러스 표적에 대해서도 바이러스를 lysis 하여 RT-RPA를 통해 표적 핵산을 증폭할 수 있다는 점을 확인하였다. 이는 자성입자 프로브를 통해 표적 핵산을 충분히 검출할 수 있는 높은 감도의 결과를 기대할 수 있다는 점을 의미한다.
이상의 결과를 바탕으로, 증폭된 핵산을 바탕으로 한 표적 신호 검출이 가능함을 간접적으로 확인할 수 있었다.
실시예 3. 신호 검출용 자성입자 프로브 제작 및 기능성 확인 (Well 4 ~ Well 5)
신호 검출용 자성입자 프로브에 있어서, 표적 인자의 표적 부위 서열 인식 역할을 하는 guide RNA (gRNA)와 gRNA/표적 서열/Cas12a 복합체가 서열 절단 역할을 한다. 이때 신호 검출 역할을 담당하는 단일가닥의 리포터 DNA(reporter DNA)가 혼합된 상태로 자성입자 프로브가 제작된다. 그러므로 표적 부위 서열 인식 역할의 gRNA가 리포터 DNA와 혼합되어 자성입자에 커플링(coupling)되었을 경우, gRNA의 역할을 할 수 있는지 확인할 필요가 있다.
gRNA 또는 형광인자 부착 리포터 DNA의 자성입자 단독 커플링 결과를 확인하기 위한 실험을 디자인하였다. gRNA와 리포터 DNA의 서열 정보는 서열목록의 서열 4와 서열 5에서 확인할 수 있다.
도 9는 표적 핵산 존재 시, 자유 리포터 DNA, Cas 단백질이 섞여 있는 상태에서 gRNA가 각기 다른 농도로 커플링된 자성입자 프로브에 의해 농도 의존적으로 변화하는지 보기 위해 Cas 시스템 활성을 확인한 결과이다. Cas 시스템의 컨셉을 확인하기 위한 목적으로 진행한 실험으로, 자유 리포터 DNA의 구성은 한편에는 형광인자를, 다른 한편에는 형광신호를 흡수하는 퀘엔처(quencher)를 결합시켜 테스트를 진행하였다. 도 9을 참조하면, gRNA 서열이 농도별로 자성입자 표면에 커플링되었을 경우, quencher에 의해 형광인자 기능성이 가려져 있던 자유 리포터 DNA(free reporter DNA)가 gRNA의 농도에 따라 quencher 부위가 잘려져 나가 형광 신호가 검출됨을 확인할 수 있었다.
도 10은 비표적 핵산에 대한 Cas 시스템 활성을 확인하기 위한 실험의 결과를 나타낸다. 도 10을 참조하면, Covid-19을 표적화한 Covid-19 gRNA 커플링 자성입자 프로브를 바탕으로 비표적 서열인 influenza B 바이러스 서열 존재 시에는 Cas 단백질이 활성화되지 않아 형광 신호를 관찰할 수 없었던 점을 바탕으로 gRNA / Cas12a의 표적 특이적 기능성을 간접적으로도 확인할 수 있었다.
도 11은 자성입자 프로브를 최적의 농도 조건으로 커플링하기 위한 목적에서 테스트를 진행한 결과이다. 도 11을 참조하면, 형광인자 부착 리포터 DNA(reporter DNA) 서열들을 단독으로 자성입자에 커플링했을 때, 50, 100 pmol 커플링 농도와 비교할 때 25 pmol의 낮은 커플링 농도에서도 유사한 수준의 형광신호를 관찰할 수 있음을 확인함에 따라 gRNA / 리포터 DNA의 최종 커플링 농도 조건을 확정하였다.이어서 도 11에서 확정한 커플링 농도 조건 아래, gRNA, 리포터 DNA를 혼합하여 자성입자에 커플링한 후, 표적 서열 유무에 따른 형광 신호 감소를 확인하였다. 도 12는 gRNA / 리포터 DNA가 커플링된 자성입자 프로브에서 표적 핵산 존재 시, Cas 시스템 활성으로 인한 형광신호 감소 결과를 얻을 수 있음을 나타낸다. 도 12를 참조하면, gRNA/reporter DNA 혼합 커플링된 자성입자의 형광 신호가 표적 서열 유무에 따라 현저히 감소하는 것을 확인할 수 있다. 이는 reporter DNA만 커플링된 자성입자에서는 표적 서열 유무에 따른 형광신호 변화가 미미한 점을 통해, 각 표적 서열에 따른 gRNA/reporter DNA 자성입자 프로브 구성이 표적 인자를 검출할 수 있다는 점을 확인할 수 있었다.
실시예 4. 자성입자 프로브 기반 다중 진단 구현
표적 인자 검출 가능성을 확인한 앞선 실시예를 바탕으로, 단일 표적 인자와 복수 표적 인자 존재 시 이들을 구분하여 진단할 수 있는지 확인하였다.
단일 표적 인자에 대한 신호 검출 확인을 위해 Covid-19 표적 자성입자 프로브를 구성하여, Covid-19, influenza A, influenza B 바이러스 표적에 대한 신호 검출 결과를 확인하였다.
Well 1 내지 Well 8의 단일 프로세스 진행을 통해 모든 반응을 진행한 후, 형광 신호 검출값을 확인하였다. 도 13의 좌측 결과를 참조하면, Covid-19 표적 gRNA가 커플링된 자성입자 프로브를 기반으로 표적 핵산이 존재하지 않는 비표적(Non-target) 그룹에서의 형광신호 세기값(형광값: 14680.3) 대비 Covid-19 표적이 존재하는 표적(Covid-target) 그룹에서 형광 신호 세기값(형광값: 6267.96)이 현저히 낮았다. 따라서 표적 특이적으로 자성입자 프로브가 Covid-19 표적 핵산을 검출한 형광신호 차이를 확인할 수 있었다. Negative 그룹은 gRNA / 리포터 DNA가 커플링되지 않은 자성입자 프로브에 관한 것이다. 도 13의 우측 결과를 참조하면, Covid-19 표적 gRNA가 커플링된 자성입자 프로브를 기반으로 어떠한 표적 서열이 존재하지 않은 Non-target 그룹 (형광값: 13257.3), influenza A 표적 서열이 존재하는 IAV target 그룹 (형광값: 15529.41), 및 influenza B 표적 서열이 존재하는 IBV target 그룹 (형광값: 14942.13) 대비 Covid-19 표적 서열이 존재하는 CoV target 그룹 (형광값: 5071.45)에서 현저히 형광신호값이 감소하는 결과를 확인할 수 있었다. 따라서 Covid-19 표적 자성입자 프로브가 Covid-19 바이러스가 존재할 경우에만 Cas12a 효소 복합체 활성을 통해 형광 신호 차이를 확인할 수 있다고 결론을 내릴 수 있었고 표적 특이적 진단을 할 수 있다는 점을 확인하였다.
표적 특이적 진단이 가능함은 추가로 도 14에서 확인할 수 있다. 도 14의 좌측 결과를 참조하면, 200 ㎛ 길이의 자성입자를 기반으로 influenza A 표적 gRNA / 리포터 DNA를 커플링한 자성입자를 기반으로 influenza A 표적 서열이 존재하지 않는 비처리(Non-treated) 그룹 (형광값: 5020.17) 대비 influenza A 표적 서열이 존재하는 IAV-target 그룹 (형광값: 3272.29)에서 형광신호 감소를 확인할 수 있었ㄷ다. 도 14의 우측 결과를 참조하면, 300 ㎛ 길이의 자성입자를 기반으로 influenza B 표적 gRNA / 리포터 DNA를 커플링한 자성입자를 기반으로 influenza B 표적 서열이 존재하지 않는 비처리(Non-treated 그룹) (형광값: 12886.1) 대비 influenza B 표적 서열이 존재하는 IBV-target 그룹 (형광값: 6938.84)에서 형광신호 감소를 확인할 수 있었다. 이상의 결과에 따라, 표적 자성입자 프로브가 적합한 표적 서열이 존재할 경우에만 Cas12a 효소 복합체 활성을 통해 형광 신호 차이를 확인할 수 있다고 결론을 내릴 수 있었고 표적 특이적 진단을 할 수 있다는 점을 재확인하였다.
한편 본 발명의 자성입자 프로브가 복수 표적이 존재할 경우에 다중 진단을 할 수 있음을 확인하는 실험을 수행하였다. 이를 위해 400 ㎛의 Covid-19 표적 자성입자 프로브 (도 9의 주황색 막대 그래프)와 300 ㎛의 influenza A 표적 자성입자 프로브 (도 9의 파란색 막대 그래프)를 준비하여 여러 표적들에 대한 다중 탐지(multiple detection)를 수행하였다. 그 결과 각각의 표적이 존재할 경우와, 두 표적이 모두 존재할 경우 모두, 각 표적 존재를 인식하여 각각의 자성입자 프로브 역할을 할 수 있음을 도 15 및 도 16의 그래프 분석 결과에서 확인할 수 있었다.

Claims (19)

  1. 표적 핵산을 검출하기 위한 핵산 분리 및 검출용 미세입자 프로브에 있어서,
    미세입자;
    상기 미세입자의 표면에 도입되며, 상기 표적 핵산에 상보적인 서열을 포함하는 포획 프로브; 및
    상기 미세입자의 표면에 도입되며, 외부 자극에 의하여 신호를 발생시키는 리포터 핵산을 포함하는 것인 핵산 분리 및 검출용 미세입자 프로브.
  2. 청구항 1에 있어서,
    상기 미세입자는 내부에 자성 입자들이 함유된 것인 핵산 분리 및 검출용 미세입자 프로브.
  3. 청구항 1에 있어서,
    상기 미세입자는 자성 물질을 포함하는 코어와 상기 코어를 둘러싸며 균일한 두께를 갖는 쉘 층을 구비한 코어-쉘 구조를 가지는 것인 핵산 분리 및 검출용 미세입자 프로브.
  4. 제1 항에 있어서,
    상기 미세입자는 수중에서 부유하지 않는 크기 및 비중을 갖는 것인 핵산 분리 및 검출용 미세입자 프로브.
  5. 청구항 1에 있어서,
    상기 포획 프로브는 유전자 가위 기술을 적용하기 위한 임의의 염기서열을 포함하는 것인 핵산 분리 및 검출용 미세입자 프로브.
  6. 청구항 1에 있어서,
    상기 포획 프로브는 가이드 RNA를 포함하는 것인 핵산 분리 및 검출용 미세입자 프로브.
  7. 청구항 6에 있어서,
    상기 가이드 RNA는 유전자의 표적 부위와 혼성화 가능한 뉴클레오타이드 서열을 갖는 CRISPR RNA(crRNA)와 트랜스-활성화 crRNA(trans-activating crRNA, tracrRNA)를 포함하는 것인 핵산 분리 및 검출용 미세입자 프로브.
  8. 청구항 6에 있어서,
    상기 가이드 RNA는 상기 표적 핵산과 결합하며 절단 효소를 만나면 상기 표적 핵산및 상기 리포터 핵산을 절단하는 것인 핵산 분리 및 검출용 미세입자 프로브.
  9. 청구항 1에 있어서,
    상기 리포터 핵산은 발광 물질로 라벨링된 핵산인 것인 핵산 분리 및 검출용 미세입자 프로브.
  10. 청구항 1에 있어서,
    상기 리포터 핵산은 유전자 가위 시스템에 활용시 절단 대상 염기서열이 되는 것인 핵산 분리 및 검출용 미세입자 프로브.
  11. 청구항 1 내지 청구항 10 중 어느 한 항에 따른 핵산 분리 및 검출용 미세입자 프로브, 절단 효소 및 핵산증폭용 시약을 포함하는 표적 핵산검출용 키트.
  12. 상기 절단 효소는 Cas 엔도뉴클레아제인 것인 표적 핵산검출용 키트.
  13. (a) 표적 핵산을 검체로부터 추출하는 단계;
    (b) 상기 표적 핵산을 증폭하는 단계;
    (c) 미세입자, 상기 미세입자의 표면에 도입되며 상기 표적 핵산에 상보적인 서열을 포함하는 가이드 RNA, 및 상기 미세입자의 표면에 도입되며 외부 자극에 의하여 신호를 발생시키는 리포터 핵산을 포함하는 표적 핵산 분리 및 검출용 미세입자 프로브를 제공하는 단계;
    (d) 상기 표적 핵산 검출용 미세입자의 가이드 RNA와 상기 표적 핵산을 반응시켜 표적 핵산 분리 및 검출용 미세입자 프로브와 표적 핵산의 복합체를 형성하는 단계;
    (e) 절단 효소를 상기 표적 핵산 검출용 미세입자의 가이드 RNA와 결합시키는 단계;
    (f) 상기 절단 효소의 활성화 반응에 의해 상기 표적 핵산 및 상기 리포터 핵산의 각 염기서열이 절단되는 단계; 및
    (g) 상기 외부 자극에 의해 상기 복합체로부터 방출되는 상기 신호의 온-오프를 측정하여 상기 표적 핵산을 검출하는 단계를 포함하는 표적 핵산의 검출방법.
  14. 청구항 13에 있어서,
    상기 표적 핵산의 검출은 2종 이상의 핵산 분리 및 검출용 미세입자 프로브들을 사용하여 2종 이상의 표적 핵산들을 다중 검출하는 것인 표적 핵산의 검출방법.
  15. 청구항 13에 있어서,
    상기 다중 검출은 길이, 직경, 두께, 형상, 색상 또는 식별 코드에 의해 서로 구분되도록 표지된 상기 핵산 분리 및 검출용 미세입자 프로브들을 판독하는 과정을 포함하는 것인 표적 핵산의 검출방법.
  16. 청구항 13에 있어서,
    상기 핵산 분리 및 검출용 미세입자 프로브는 마이크로로드의 형태를 가지는 것인 표적 핵산의 검출방법.
  17. 청구항 1 내지 10 중 어느 한 항에 따른 핵산 분리 및 검출용 미세입자 프로브에 유전자 가위를 이용하여 검체 내의 표적 핵산을 분리 및 다중 검출하는 다중 진단방법으로서,
    2종 이상의 상기 핵산 분리 및 검출용 미세입자 프로브에 상기 검체에서 증폭된 상기 표적 핵산이 상보적 결합을 하는 단계; 및
    상기 핵산 분리 및 검출용 미세입자 프로브에 도입된 상기 유전자 가위가 이를 인지하여 주변에 존재하는 상기 리포터 핵산을 절단하는 단계를 포함하되,
    상기 리포터 핵산의 절단에 의하여 상기 신호의 감소를 측정하는 방법으로 상기 표적 핵산을 검출할 수 있는 다중 진단방법.
  18. 청구항 17 에 있어서,
    상기 유전자 가위는 크리스퍼-카스 시스템인 것인 다중 진단방법.
  19. 청구항 17 에 있어서,
    상기 신호는 형광 또는 화학발광인 것인 다중 진단방법.
PCT/KR2021/015522 2020-11-02 2021-11-01 다중 진단을 위한 핵산 분리 및 검출용 미세입자 프로브 WO2022092945A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP21886939.4A EP4144865A4 (en) 2020-11-02 2021-11-01 MICROPARTICLE PROBE FOR ISOLATION AND DETECTION OF NUCLEIC ACID FOR MULTIPLE DIAGNOSIS
US17/928,252 US20230313324A1 (en) 2020-11-02 2021-11-01 Microparticle probes for isolating and detecting nucleic acids for multiple diagnostics

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20200144300 2020-11-02
KR10-2020-0144300 2020-11-02

Publications (1)

Publication Number Publication Date
WO2022092945A1 true WO2022092945A1 (ko) 2022-05-05

Family

ID=81382995

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/015522 WO2022092945A1 (ko) 2020-11-02 2021-11-01 다중 진단을 위한 핵산 분리 및 검출용 미세입자 프로브

Country Status (4)

Country Link
US (1) US20230313324A1 (ko)
EP (1) EP4144865A4 (ko)
KR (1) KR20220059418A (ko)
WO (1) WO2022092945A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20230173052A (ko) 2022-06-16 2023-12-26 주식회사 이지다이아텍 자성입자 및 불활성화된 유전자 가위를 포함하는 진단용 미세입자 프로브, 이를 포함하는 다중진단 시스템 및 다중진단 방법

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190140918A (ko) * 2017-03-15 2019-12-20 더 브로드 인스티튜트, 인코퍼레이티드 바이러스 검출을 위한 crispr 이펙터 시스템 기반 진단
KR20200043915A (ko) * 2018-10-17 2020-04-28 주식회사 이지다이아텍 생체물질 검출용 미세 입자 및 이를 이용한 생체물질 검출방법
WO2020102610A1 (en) * 2018-11-14 2020-05-22 The Broad Institute, Inc. Crispr system based droplet diagnostic systems and methods
KR20200103638A (ko) * 2017-11-22 2020-09-02 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 Ssdna를 절단하고 표적 dna를 검출하기 위한 v형 crispr/cas 효과기 단백질
KR20200111180A (ko) * 2017-12-22 2020-09-28 더 브로드 인스티튜트, 인코퍼레이티드 Crispr 이펙터 시스템 기반 다중 진단

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111850097B (zh) * 2020-08-10 2021-04-16 苏州顶点生物医药有限公司 基于crispr技术的核酸检测的信号放大磁珠技术系统及其应用

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190140918A (ko) * 2017-03-15 2019-12-20 더 브로드 인스티튜트, 인코퍼레이티드 바이러스 검출을 위한 crispr 이펙터 시스템 기반 진단
KR20200103638A (ko) * 2017-11-22 2020-09-02 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 Ssdna를 절단하고 표적 dna를 검출하기 위한 v형 crispr/cas 효과기 단백질
KR20200111180A (ko) * 2017-12-22 2020-09-28 더 브로드 인스티튜트, 인코퍼레이티드 Crispr 이펙터 시스템 기반 다중 진단
KR20200043915A (ko) * 2018-10-17 2020-04-28 주식회사 이지다이아텍 생체물질 검출용 미세 입자 및 이를 이용한 생체물질 검출방법
WO2020102610A1 (en) * 2018-11-14 2020-05-22 The Broad Institute, Inc. Crispr system based droplet diagnostic systems and methods

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LEE, DAE HUI: "Next-generation diagnostics with CRISPR, SHERLOCK HOLMES", NICE - NEWS & INFORMATION FOR CHEMICAL ENGINEERS, vol. 37, no. 4, 1 January 2019 (2019-01-01), KR , pages 440 - 447, XP009536547, ISSN: 1229-4284 *

Also Published As

Publication number Publication date
US20230313324A1 (en) 2023-10-05
EP4144865A1 (en) 2023-03-08
EP4144865A4 (en) 2023-11-08
KR20220059418A (ko) 2022-05-10

Similar Documents

Publication Publication Date Title
Tang et al. Application of magnetic nanoparticles in nucleic acid detection
CN111850097B (zh) 基于crispr技术的核酸检测的信号放大磁珠技术系统及其应用
JP4361905B2 (ja) 磁性ガラス粒子、それらの製造方法、及びそれらの使用
ES2547052T3 (es) Identificación de secuencias de ácidos nucleicos
JP4148900B2 (ja) 増幅反応におけるシリカ物質の使用
JP5872569B2 (ja) マイクロアレイに基づくアッセイのための粒子と結合させた発光団で標識された分子
US7611837B2 (en) Kit for detecting non-pathogenic or pathogenic influenza a subtype h5 virus
US20070238096A1 (en) Hybrid energy transfer for nucleic acid detection
US20200032324A1 (en) Specific detection of ribonucleic acid sequences using novel crispr enzyme-mediated detection strategies
ES2640522T3 (es) Ácidos nucleicos de control para múltiples parámetros
KR20210028277A (ko) 신규 크리스퍼 (crispr) 효소-매개 검출 전략들을 사용한 데옥시리보핵산 서열들의 특이적 검출
JP2003517842A (ja) 核酸の検出方法
WO2022092945A1 (ko) 다중 진단을 위한 핵산 분리 및 검출용 미세입자 프로브
WO2020256378A1 (ko) 핵산 검출 방법
Liu et al. CRISPR-Cas12a coupled with universal gold nanoparticle strand-displacement probe for rapid and sensitive visual SARS-CoV-2 detection
CN113699148A (zh) 一种超灵敏抗体检测方法
US20210340635A1 (en) Materials and methods for detecting coronavirus
WO2023244069A1 (ko) 자성입자 및 불활성화된 유전자 가위를 포함하는 진단용 미세입자 프로브, 이를 포함하는 다중진단 시스템 및 다중진단 방법
WO2023204667A1 (ko) 단일 염기 다형성 분석을 위한 미세입자 프로브
CN116987770A (zh) 一种样品中目标分析物超灵敏检测的方法与体系
JP5303981B2 (ja) Ｄｎａメチル化測定方法
EP3851527A1 (en) Method for detecting and method for quantifying oligonucleotides
KR20210132375A (ko) 자성나노입자와 결합된 산화그래핀을 이용한 핵산의 분리 방법
CN107058585B (zh) 一种核酸杂交检测方法
US20190185920A1 (en) Methods and systems that detect nucleic-acid targets

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21886939

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021886939

Country of ref document: EP

Effective date: 20221128

NENP Non-entry into the national phase

Ref country code: DE