WO2022075660A1 - 알파-글루코시다아제 저해제를 생산하는 신규한 바실러스 코아귤란스 cc 균주 - Google Patents

알파-글루코시다아제 저해제를 생산하는 신규한 바실러스 코아귤란스 cc 균주 Download PDF

Info

Publication number
WO2022075660A1
WO2022075660A1 PCT/KR2021/013460 KR2021013460W WO2022075660A1 WO 2022075660 A1 WO2022075660 A1 WO 2022075660A1 KR 2021013460 W KR2021013460 W KR 2021013460W WO 2022075660 A1 WO2022075660 A1 WO 2022075660A1
Authority
WO
WIPO (PCT)
Prior art keywords
strain
bacillus coagulans
alpha
glucosidase
glucosidase inhibitor
Prior art date
Application number
PCT/KR2021/013460
Other languages
English (en)
French (fr)
Inventor
이해익
김희웅
Original Assignee
이해익
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 이해익 filed Critical 이해익
Priority to JP2023522349A priority Critical patent/JP2023547056A/ja
Priority to CN202180068802.4A priority patent/CN116209363A/zh
Publication of WO2022075660A1 publication Critical patent/WO2022075660A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
    • A23K10/18—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions of live microorganisms
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/742—Spore-forming bacteria, e.g. Bacillus coagulans, Bacillus subtilis, clostridium or Lactobacillus sporogenes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/3262—Foods, ingredients or supplements having a functional effect on health having an effect on blood cholesterol
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/328—Foods, ingredients or supplements having a functional effect on health having effect on glycaemic control and diabetes
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/332—Promoters of weight control and weight loss
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07—Bacillus

Definitions

  • the present invention relates to a new strain of Bacillus coagulans CC (KCTC14267BP) that produces a large amount of alpha-glucosidase inhibitors in the intestine and uses thereof.
  • KCTC14267BP Bacillus coagulans CC
  • carbohydrates are digested in the body, they are decomposed into disaccharides such as maltose, which are then decomposed into monosaccharides such as glucose by an enzyme called alpha-glucosidase and absorbed into blood vessels.
  • alpha-glucosidase an enzyme called alpha-glucosidase and absorbed into blood vessels.
  • the alpha-glucosidase inhibitor remarkably suppresses postprandial hyperglycemia, so it is effective in preventing or improving diabetes, obesity, and the like.
  • Alpha-glucosidase inhibitors are distributed in some plants and microorganisms.
  • alpha-glucosidase inhibitors of plant origin aza sugars contained in mulberry leaves, isoflavones and flavone glycosides contained in soybeans are known, and alpha-glucosidase of microbial origin is known.
  • 1-deoxynojirimycin (1-deoxynojirimycin) produced by microorganisms such as Actinoplanes strain origin, pseudooligosaccharide, Streptomyces or Bacillus deoxynojirimycin), tris salt, and the like are known, and as pharmaceuticals, several alpha-glucosidase inhibitors have already been marketed as antidiabetic drugs.
  • Non-Patent Document 005 Non-Patent Document 005
  • these primary processed products or extracts are mass-produced, they have a factor that reduces palatability, such as smell and color, in common, so there is a limitation in product diversification.
  • the concentration of the active ingredient is low, so that the intended purpose can be achieved only by taking a certain amount several times a day.
  • facultative anaerobes can grow in anaerobic conditions, such as in the intestine of an animal. Therefore, facultative anaerobes capable of producing alpha-glucosidase inhibitors are expected to proliferate in the intestine and continuously produce and supply alpha-glucosidase inhibitors to the intestinal environment.
  • Bacillus subtilis strains used for production of alpha-glucosidase inhibitors using microorganisms are aerobic bacteria and are difficult to proliferate in the intestine, so it is difficult to supply alpha-glucosidase inhibitors in the intestine. .
  • the inventors of the present invention carefully searched from a wide range of natural samples to select microorganisms that have strong alpha-glucosidase inhibitory activity and can grow in the intestine.
  • an alpha-glucosidase inhibitor and 1-deoxynojirimycin (1-deoxynojirimycin (1-deoxynojirimycin) deoxynojirimycin
  • KCTC14267BP 1-deoxynojirimycin
  • Bacillus coagulans CC (KCTC14267BP) strain, which is a novel strain that produces a large amount of alpha-glucosidase inhibitor.
  • the present invention provides a novel Bacillus coagulans CC strain ( Bacillus coagulans CC, accession number KCTC14267BP) with improved ability to produce alpha-glucosidase inhibitors.
  • the strain may include the base sequence of 16s rRNA of SEQ ID NO: 1, but is not limited thereto.
  • the strain may be anaerobic, but is not limited thereto.
  • the strain may be excreted within 2 to 4 weeks from the organism after the strain is administered, but is not limited thereto.
  • the strain may be one that produces an alpha-glucosidase inhibitor in the intestine, but is not limited thereto.
  • the alpha-glucosidase inhibitor produced in the intestine may be excreted within 2 to 4 weeks from the organism after the strain is administered, but is not limited thereto.
  • the alpha-glucosidase inhibitor may be 1-deoxynojirimycin, but is not limited thereto.
  • the present invention provides a food composition for preventing or improving obesity, comprising a novel Bacillus coagulans CC strain ( Bacillus coagulans CC, accession number KCTC14267BP), its culture medium, culture filtrate or fermented product as an active ingredient.
  • a novel Bacillus coagulans CC strain Bacillus coagulans CC, accession number KCTC14267BP
  • its culture medium culture filtrate or fermented product as an active ingredient.
  • the present invention provides a feed composition for preventing or improving obesity comprising a novel Bacillus coagulans CC strain ( Bacillus coagulans CC, accession number KCTC14267BP), its culture medium, culture filtrate or fermented product as an active ingredient.
  • a novel Bacillus coagulans CC strain Bacillus coagulans CC, accession number KCTC14267BP
  • its culture medium culture filtrate or fermented product as an active ingredient.
  • the present invention provides a novel Bacillus coagulans CC strain ( Bacillus coagulans CC, accession number KCTC14267BP), its culture solution, culture filtrate or a pharmaceutical composition for the prevention or treatment of obesity comprising a fermented product as an active ingredient.
  • the present invention provides a food composition for preventing and improving hyperglycemia or diabetes, comprising a novel Bacillus coagulans CC strain ( Bacillus coagulans CC, accession number KCTC14267BP), its culture medium, culture filtrate or fermented product as an active ingredient .
  • the present invention provides a feed composition for preventing and improving hyperglycemia or diabetes comprising a novel Bacillus coagulans CC strain ( Bacillus coagulans CC, accession number KCTC14267BP), its culture medium, culture filtrate or fermented product as an active ingredient .
  • Bacillus coagulans CC Bacillus coagulans CC, accession number KCTC14267BP
  • its culture medium Bacillus coagulans CC, accession number KCTC14267BP
  • culture filtrate or fermented product as an active ingredient .
  • the present invention provides a novel Bacillus coagulans CC strain ( Bacillus coagulans CC, accession number KCTC14267BP), and a pharmaceutical composition for preventing and treating hyperglycemia or diabetes comprising a culture solution, culture filtrate or fermented product thereof as an active ingredient. .
  • the present invention provides a method for preventing or treating obesity comprising administering the pharmaceutical composition for preventing or treating obesity.
  • the novel Bacillus coagulans CC (KCTC14267BP) strain according to the present invention is a new strain capable of inhabiting even in anaerobic conditions, and since it produces and supplies an alpha-glucosidase inhibitor in the intestine, alpha-glucosidase And it is possible to maximize the inhibition of monosaccharide absorption by maintaining a constant effective concentration in the small intestine where 1-deoxynojirimycin (1-deoxynojirimycin), which is its active ingredient, acts, can exhibit weight loss and blood sugar lowering effects.
  • Bacillus coagulans CC strain (KCTC14267BP) of the present invention exhibits a characteristic of temporarily inhabiting without fixing in the intestine, and the alpha-glucosidase inhibitor and its active ingredient 1-de Oxynojirimycin (1-deoxynojirimycin) can be safely used because it can be discharged after a certain period of time.
  • alpha-glucosidase inhibitor production using microorganisms production costs such as fermentation cost and purification cost are high and require a lot of labor, but when Bacillus coagulans CC strain (KCTC14267BP) is used, alpha-glucosidase inhibitor and its effectiveness As the ingredient, 1-deoxynojirimycin, is produced and supplied in the intestines, there is no need for separate fermentation and processing costs other than the spore production cost, so production costs can be reduced, and problems such as fermentation odor occur Therefore, it can be applied to various types of food, feed and pharmaceutical compositions.
  • Bacillus coagulans CC strain KCTC14267BP
  • 1 is a result of HPLC analysis of 1-deoxynojirimycin, which is a main component of an alpha-glucosidase inhibitor produced by Bacillus coagulans CC strain.
  • FIG. 2 is a graph showing the effect of administration of Bacillus coagulans CC strain spores on the body weight of mice during feeding of a high-carbohydrate diet. Each group of spore administration ( ⁇ ) is indicated.
  • mice of the standard diet group (Normal-Diet), the high-carbohydrate diet group (HC-Diet) and the high-carbohydrate diet + CC spore administration group (HC-Diet + CC Spore) at 11 weeks of FIG. It is the result of observing the distribution of fat in the chest and abdomen, respectively.
  • mice of the standard diet group (Normal-Diet), high-fat diet group (HF-Diet) and high-fat diet + CC spore administration group (HF-Diet + CC Spore) at 11 weeks of time of FIG. It is the result of observing the distribution of fat in the chest and abdomen, respectively.
  • FIG. 6 is a graph showing the inhibitory activity of alpha-glucosidase contained in 1 g of mouse feces, and shows a high-carbohydrate diet + CC spore administration group (gray) and a high-fat diet + CC spore administration group (black), respectively.
  • CC spores were administered for 7 weeks, and after that, a high-carbohydrate diet or a high-fat diet without spores was fed.
  • the arrow indicates the time point at which CC spore administration was stopped.
  • FIG. 7 is a graph showing the distribution of Bacillus coagulans CC strains excreted in the feces of mice, and shows a high-carbohydrate diet + CC spore administration group (gray) and a high-fat diet + CC spore administration group (black), respectively.
  • CC spores were administered for 7 weeks, and after that, a high-carbohydrate diet or a high-fat diet without spores was fed.
  • the arrow indicates the time point at which CC spore administration was stopped.
  • FIG. 8 is a schematic diagram showing the taxonomic position of the Bacillus coagulans CC strain.
  • the present invention provides a novel Bacillus coagulans CC strain ( Bacillus coagulans CC, accession number KCTC14267BP) with improved ability to produce alpha-glucosidase inhibitors.
  • the strain is obtained by isolating bacteria that form heat-resistant spores using hay as a sample, and selecting a strain capable of facultative anaerobic growth and high production of alpha-glucosidase inhibitors.
  • the strain may include 16s rRNA represented by the nucleotide sequence of SEQ ID NO: 1.
  • the strain can have both an anaerobic property of producing an alpha-glucosidase inhibitor in a high yield in the intestine and an aerobic property of producing an alpha-glucosidase inhibitor in vitro.
  • the strain is capable of forming spores, exhibits a property of temporarily inhabiting without being fixed in the intestine, and can be safely used because the administered strain can be discharged from the intestine as needed.
  • the strain may be excreted out of the body from 2 to 4 weeks after administration to the organism, and more preferably, may be excreted at the time of 1 week.
  • the strain can produce the alpha-glucosidase inhibitor in the intestine, so that the effective concentration of the alpha-glucosidase inhibitor can be kept constant in the intestine, and the Alpha-glucosidase inhibitors can be safely used because they are excreted.
  • the alpha-glucosidase inhibitor can be excreted outside the body from 2 to 4 weeks after the strain is administered to the organism.
  • the alpha-glucosidase inhibitor can be produced in high yield in the intestine by administration by ingesting the composition containing the strain, and can be excreted outside the living body after a certain period of time, so it can be effectively used for the purpose of weight loss and blood sugar lowering.
  • Oligocarbohydrates that are not decomposed by the action of ⁇ -glucosidase inhibitors produced in large amounts in the intestines reach the large intestine and serve as food for intestinal microbes and serve as prebiotics to relieve constipation. can be used
  • the strain may be included in the form of spores, and may be included in 10 6 to 10 14 spores per 1 g, but is not limited thereto.
  • the alpha-glucosidase inhibitor produced by the strain may be 1-deoxynojirimycin, but is not limited thereto.
  • the term 'fermented product' refers to the fermented product itself cultured in liquid/solid medium, the filtrate obtained by filtering or centrifuging the fermented product to remove the strain (centrifuged supernatant), or the fermented product itself, such as a sediment containing bacteria. It may include artifacts derived from
  • cultivation refers to growing microorganisms in an appropriately artificially controlled environmental condition.
  • the Bacillus coagulans CC strain can be grown in a conventional medium, for example, it can be cultured in a nutrient broth (Nutrient broth) medium.
  • the medium may include a nutrient material required for a culture target, that is, a microorganism to be cultured in order to culture a specific microorganism, and may be mixed with a material for a special purpose additionally added.
  • the medium is also referred to as an incubator or culture medium, and is a concept including all of natural medium, synthetic medium, or selective medium.
  • the strain can be cultured according to a conventional culture method.
  • the medium used for culture must meet the requirements of a specific strain in an appropriate manner while controlling temperature, pH, etc. in a conventional medium containing an appropriate carbon source, nitrogen source, amino acids, vitamins, and the like.
  • an appropriate carbon source nitrogen source, amino acids, vitamins, and the like.
  • glucose is used as the main carbon source, in addition to sugars and carbohydrates such as sucrose, lactose, fructose, maltose, starch and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, etc. , fatty acids such as palmitic acid, stearic acid, and linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These substances may be used individually or as a mixture.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine and glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its degradation products, defatted soybean meal or its degradation products this can be used These nitrogen sources may be used alone or in combination.
  • the medium may contain monopotassium phosphate, dipotassium phosphate and the corresponding sodium-containing salt as a phosphoric acid source.
  • Phosphoric acid sources that can be used include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salt.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used as the inorganic compound.
  • essential growth substances such as amino acids and vitamins can be used.
  • precursors suitable for the culture medium may be used.
  • the above-mentioned raw materials may be added in a batch, fed-batch or continuous manner by an appropriate method to the culture during the culturing process, but is not particularly limited thereto.
  • Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acid compounds such as phosphoric acid or sulfuric acid may be used in an appropriate manner to adjust the pH of the culture.
  • a novel Bacillus coagulans CC strain Bacillus coagulans CC (KCTC14267BP) (KCTC14267BP), its culture solution, culture filtrate or fermented product for preventing or improving obesity comprising as an active ingredient a food composition, feed composition and pharmaceutical Provides an enemy composition.
  • the food composition, feed composition and pharmaceutical composition for preventing or improving obesity includes the novel Bacillus coagulans CC (KCTC14267BP) described above, content overlapping with the above-described strain of the present invention In order to avoid excessive complexity of the present specification due to the description of duplicated content, the description thereof is omitted.
  • the food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients like a conventional food composition.
  • Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • the above-mentioned flavoring agents can advantageously use natural flavoring agents (Taumatin), stevia extract (eg rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).
  • the food composition of the present invention may be formulated in the same manner as the pharmaceutical composition and used as a functional food or added to various foods.
  • Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gums, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements. There is this.
  • the food composition includes, in addition to the active ingredient extract, various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and thickeners (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
  • the food composition of the present invention may contain natural fruit juice and pulp for the production of fruit juice beverages and vegetable beverages.
  • the functional food composition of the present invention may be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, and the like.
  • the term 'health functional food composition' refers to food manufactured and processed using raw materials or ingredients useful for the human body according to Act No. 6727 of the Health Functional Food Act, and It refers to ingestion for the purpose of obtaining useful effects for health purposes such as regulating nutrients or physiological effects.
  • the health functional food of the present invention may contain normal food additives, and unless otherwise specified, whether it is suitable as a food additive is related to the item according to the general rules and general test method of food additives approved by the Food and Drug Administration. It is judged according to the standards and standards.
  • the items listed in the 'Food Additives Code' include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, high pigment, and guar gum; Mixed preparations, such as a sodium L-glutamate preparation, a noodle-added alkali agent, a preservative preparation, and a tar color preparation, etc. are mentioned.
  • chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid
  • natural additives such as persimmon pigment, licorice extract, crystalline cellulose, high pigment, and guar gum
  • Mixed preparations such as a sodium L-glutamate preparation, a noodle-added alkali agent, a preservative preparation, and a tar color preparation, etc. are mentioned.
  • a health functional food in tablet form is granulated by a conventional method by mixing a mixture of the active ingredient of the present invention with an excipient, binder, disintegrant and other additives, followed by compression molding by putting a lubricant, etc., or The mixture may be compression molded directly.
  • the health functional food in the form of tablets may contain a corrosive agent and the like, if necessary.
  • hard capsules can be prepared by filling a mixture of the active ingredient of the present invention with additives such as excipients in a conventional hard capsule. It can be prepared by filling the mixture mixed with the capsule base such as gelatin.
  • the soft capsules may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, if necessary.
  • a health functional food in the form of a ring can be prepared by molding a mixture of the active ingredient of the present invention with an excipient, a binder, a disintegrant, etc. by a known method, Alternatively, the surface may be coated with a material such as starch or talc.
  • the health functional food in the form of granules can be prepared in granular form by a conventionally known method by mixing a mixture of the active ingredient excipients, binders, disintegrants, etc. of the present invention, and may contain flavoring agents, flavoring agents, etc. as needed can
  • the feed composition of the present invention exhibits effects such as obesity suppression and blood sugar lowering, and thus can be expected to have an effect of improving the health of the animal body.
  • the feed composition of the present invention may be prepared in the form of fermented feed, compound feed, pellet form, silage, and the like.
  • the fermented feed can be prepared by fermenting organic matter by adding Bacillus coagulans CC of the present invention, and the compounded feed is prepared by mixing various types of general feed with the spores and fermented products of the Bacillus coagulans CC strain of the present invention. can be manufactured.
  • the feed in the form of pellets can be prepared by applying heat and pressure to the blended feed, etc.
  • silage in a pellet machine, and silage can be prepared by fermenting the feed with a microorganism according to the present invention.
  • Wet fermented feed collects and transports organic matter such as food waste, mixes excipients for sterilization and moisture control in a certain ratio, and ferments it at a temperature suitable for fermentation for 24 hours or more so that the moisture content is about 70%. It can be adjusted and manufactured.
  • Fermented dry feed can be prepared by adjusting the moisture content of the wet fermented feed to 30% to 40% through an additional drying process.
  • the feed composition of the present invention may further include a component added to a conventional feed.
  • the ingredients added to such feed may include cereal powder, meat powder, and beans.
  • the grain powder may be one or more selected from rice flour, wheat flour, barley flour, and corn flour.
  • the meat powder may be a meat powder obtained by pulverizing any one or more selected from chicken, beef, pork, and ostrich meat.
  • soybeans, kidney beans, peas, and black beans may be used.
  • any one or more selected from nutrients and minerals may be added to the feed composition in addition to the above-mentioned ingredients added to conventional feed, such as grain powder, meat powder, and beans, to increase the nutritional value of the feed, and feed quality It may include at least one selected from an antifungal agent, an antioxidant, an anticoagulant, an emulsifier, and a binder in order to prevent the deterioration.
  • the pharmaceutical composition according to the present invention may be prepared in a form in which the active ingredient is incorporated into a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier includes carriers, excipients and diluents commonly used in the pharmaceutical field.
  • Pharmaceutically acceptable carriers that can be used in the pharmaceutical composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • the pharmaceutical composition of the present invention may be formulated into powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and the like according to conventional methods, respectively.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in the active ingredient, for example, starch, calcium carbonate, sucrose, lactose, gelatin. It can be prepared by mixing and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.
  • Liquid formulations for oral administration include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. can
  • the pharmaceutical composition may be formulated in various oral dosage forms.
  • Formulations for oral administration include, for example, tablets, pills, hard, soft capsules, solutions, suspensions, emulsifiers, syrups, granules, and the like. crose, mannitol, sorbitol, cellulose and/or glycine), lubricants (eg, silica, talc, stearic acid and its magnesium or calcium salts and/or polyethylene glycol).
  • the tablet may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and optionally starch, agar, alginic acid. or a disintegrant such as its sodium salt or a boiling mixture and/or absorbent, coloring, flavoring and sweetening agent.
  • the formulation may be prepared by conventional mixing, granulating or coating methods.
  • Bacillus coagulans CC Bacillus coagulans CC
  • KCTC14267BP Bacillus coagulans CC
  • a culture solution a culture filtrate or a fermented product thereof as an active ingredient for the prevention or improvement of hyperglycemia and diabetes food composition, feed composition and pharmaceutical compositions.
  • the food composition, feed composition, and pharmaceutical composition for the prevention or improvement of hyperglycemia and diabetes are the above-described novel Bacillus coagulans CC strain ( Bacillus coagulans CC) (KCTC14267BP), and overlap with the above-described strain of the present invention. In order to avoid the excessive complexity of the present specification due to the description of duplicated content, description thereof is omitted.
  • the present invention provides a method for preventing or treating obesity, comprising administering the pharmaceutical composition for preventing or treating obesity.
  • the pharmaceutical composition of the present invention may be administered in a therapeutically effective amount or a pharmaceutically effective amount.
  • the term “pharmaceutically effective amount” refers to an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level includes the subject type and severity, age, sex, drug activity, sensitivity to drugs, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs, and other factors well known in the medical field.
  • the method of administering the pharmaceutical composition is not particularly limited, and examples thereof include methods such as application to the skin, intradermal injection, and subcutaneous injection.
  • the "subject" of the present invention means a subject in need of a method for preventing, controlling or treating a disease, and more specifically, a human or non-human primate, mouse, rat, dog , means mammals such as cats, horses, and cattle. In some cases, humans may be excluded.
  • Microorganisms were isolated using about 800 hay samples collected from various places in Korea. A small amount of sterile saline is added to each sample to suspend, and the spore solution obtained by heat treatment in a constant temperature water bath at 80°C for 20 minutes is spread on a BCP Plate Count Agar plate medium containing 1.5% agar, and incubated anaerobically for 2 days in an incubator at 55°C. Thus, the cells forming the bacterial colonies were isolated. In order to investigate the production of alpha-glucosidase inhibitor, the isolated strain was inoculated into 5 ml of a medium in which 5% soy flour was suspended and cultured with shaking at 37° C. for 24 hours. The culture medium was centrifuged to measure alpha-glucosidase inhibitory activity from the supernatant.
  • Alpha-glucosidase was extracted from the small intestine of pigs and partially purified was used as an enzyme source.
  • the alpha-glucosidase enzyme solution was appropriately diluted with 0.5M phosphate buffer (pH 7.0) to 24 units/ml, and p-nitrophenyl ⁇ -D-glucopyranoside (pNPG) was used as the substrate.
  • pNPG p-nitrophenyl ⁇ -D-glucopyranoside
  • 30 ⁇ l of the culture supernatant and 50 ⁇ l of the enzyme were mixed and pre-warmed at 37° C. for 10 minutes, then 50 ⁇ l of 3mM pNPG was added and reacted at 37° C. for 20 minutes.
  • the inhibition rate was calculated according to the following Equation 1 by using water instead of the inhibitor as a control.
  • Inhibition rate (%) [(A-B)/A] ⁇ 100
  • A is the absorbance of the control
  • B is the absorbance of the sample containing the inhibitor.
  • the ⁇ -glucosidase inhibition unit was defined as the amount of the inhibitor when 1% inhibition of ⁇ -glucosidase used for activity measurement.
  • alpha-glucosidase inhibitor-producing bacteria After the first selection of about 50 types of bacteria as alpha-glucosidase inhibitor-producing bacteria by the process of Example 2, they can be grown anaerobically at 55° C. and grow in a medium containing propionic acid. By centrifuging the culture medium of the strain that could not, the alpha-glucosidase inhibitory activity was measured from the supernatant, and three types with high alpha-glucosidase inhibitory activity were secondarily selected. Among the above three strains, it is classified as Bacillus coagulans according to the taxonomic characterization method according to Bergey's Manual of Systematic Bacteriology, 2002, and has high alpha-glucosidase inhibitor productivity and spore formation. The easy DH-128 bacteria were finally selected (see Table 1).
  • nitrosoguanidine nitrosoguanidine, 100 ⁇ g/ml
  • smear 200 to 300 per sheet on BCP Plate Count Agar plate medium and Incubated for 2 days.
  • the resulting colonies were randomly inoculated in 5% soybean meal medium and cultured with shaking at 40° C. for 2 days, and then the supernatant was centrifuged to measure alpha-glucosidase inhibitory activity.
  • Five strains with increased alpha-glucosidase inhibitory activity were selected, and DH-128-46Y93 was selected in consideration of sporulation ability and alpha-glucosidase inhibitory activity.
  • Bacillus subtilis DC-15 As control strains, Bacillus subtilis DC-15, a natto strain producing an alpha-glucosidase inhibitor, and Bacillus coagulans ATCC 7050, a strain not producing an alpha-glucosidase inhibitor, were used as control strains, and mutant strains DH-128 and DH -128-46Y93 and Bacillus coagulans CC strains ( Bacillus coagulans CC) were cultured aerobically or anaerobically for 2 days at 40° C. in 5% soy flour medium, respectively.
  • the alpha-glucosidase inhibitory activity is shown in Table 2 below. indicated.
  • Bacillus coagulans CC strain with significantly increased alpha-glucosidase inhibitory activity by sequential mutagenesis breeding was bred from the selection strain DH-128.
  • the control strain, Bacillus subtilis DC-15 is an aerobic bacterium used for natto production. It produces a significant amount of alpha-glucosidase inhibitor under aerobic conditions, but does not produce at all under anaerobic conditions, and Bacillus coagulans ATCC 7050 is neither aerobic nor anaerobic, nor does it produce alpha-glucosidase inhibitors.
  • Bacillus coagulans CC strain shows the ability to produce an alpha-glucosidase inhibitor even in an anaerobic environment such as the intestine, and thus has very different characteristics from other aerobic bacteria that produce an alpha-glucosidase inhibitor.
  • the colony formed on the L-broth agar plate medium of the Bacillus coagulans CC strain bred through the above separation process was small, flat, and had a smooth round shape with a smooth surface, and had a white appearance without luster.
  • growth was good in the range of 25°C or more and 40°C or less, and growth of cells was not confirmed at 60°C or more.
  • the reducing power of nitrate was positive, and the use of citric acid and the Voges-Proskauer test were negative.
  • Bacillus coagulans CC Bacillus coagulans CC is the strain of SEQ ID NO: 1 It was confirmed that it has a 16s rRNA sequence.
  • Bacillus coagulans CC strain was inoculated in 5ml of 5% soybean meal medium and then anaerobically cultured at 37°C for 48 hours. Take 1 ml of this, add 20 ⁇ l of 0.4M potassuim borate buffer (pH 8.5), and 20 ⁇ l of 5 mM 9-flurenylmethyl chloroformate dissolved in acetonitrile, and react by blocking the light at room temperature for 30 minutes. A derivative of the standard product, 1-deoxynojirimycin was compared with 20 ⁇ l of 0.1M glycine was added to stop the reaction, and it was used as a sample for HPLC analysis.
  • the product of the Bacillus coagulans CC strain and 1-deoxynojirimycin (1-deoxynojirimycin) showed the same retention time, confirming that they were the same material.
  • the spores of the Bacillus coagulans CC strain were orally administered while breeding mice to promote intestinal proliferation of the strain. And whether or not excretion from the body, the production of alpha-glucosidase inhibitors in the intestine, changes in body weight, etc. were reviewed.
  • commercially available standard feed and water were freely fed, and male mice (3 weeks old) were pre-bred for 1 week and then used.
  • the light-dark cycle was performed from 08:00 to 20:00 as light and from 20:00 to 08:00 as memorization, and was bred under an environment in which a temperature of 22.5 ⁇ 0.5° C.
  • mice were divided into 5 groups (8 mice each), including standard diet group, high carbohydrate diet group, high carbohydrate diet + CC spore group, high fat diet group, and high fat diet + CC spore group, and were bred for 12 weeks.
  • Bacillus coagulans CC strain spores were diluted in 100 ⁇ l of physiological saline to a weight of 10 9 cells/kg for the high-carbohydrate diet + CC spore group, high-fat diet + CC spore group and administered every other day. In the group and the high-fat diet group, 100 ⁇ l of physiological saline was administered every other day instead of the spore dilution.
  • feces were collected regularly and used as a sample for measuring the alpha-glucosidase inhibitory activity and the discharged Bacillus coagulans CC strain in the feces.
  • the high-carbohydrate diet group showed a distinct weight gain compared to the standard diet group, but It was confirmed that the carbohydrate diet + CC spore administration group showed significantly reduced weight gain than the high carbohydrate diet group.
  • the distribution of fat in the body was observed by taking CT scans of mice for each group. 3 shows the result, the bright part indicated by the arrow in the photo indicates the fat layer, and it can be seen that a large amount of fat is accumulated in the chest and abdomen in the high-carbohydrate diet compared to the standard diet.
  • body fat accumulation was significantly reduced, showing a similar trend to the standard diet. shows restraint.
  • the high-fat diet group showed a distinct weight gain compared to the standard diet group, but In the same manner as in the diet + CC spore administration group, it was confirmed that the weight gain was significantly reduced compared to the high-fat diet group.
  • the distribution of fat in the body was observed by taking CT scans of mice for each group at 11 weeks of the experiment.
  • the amount of alpha-glucosidase inhibitor and Bacillus coagulans CC strain excreted in feces was measured by collecting feces regularly during the dietary experiment of the Bacillus coagulans CC strain.
  • the alpha-glucosidase inhibitor was measured for the alpha-glucosidase inhibitory activity, and the number of Bacillus coagulans CC strains was well suspended by adding sterile water to a certain amount of feces. The number of colonies appearing after culturing spontaneously was measured.
  • the inhibitory activity of alpha-glucosidase excreted in the feces of mice administered with Bacillus coagulans CC strain spores was analyzed. As shown in FIG. 7 , the Bacillus coagulans CC strain (KCTC14267BP) proliferates vigorously in the intestine to the extent that it is excreted in the feces, and it can be confirmed that the alpha-glucosidase inhibitor is produced. As shown in FIG. 6 , it was confirmed that the amount of alpha-glucosidase inhibitor discharged during the period when the amount of the Bacillus coagulans CC strain discharged from the 5th week to the 7th week was stabilized was constant. That is, since the alpha-glucosidase inhibitor is always produced in the intestine, it can be seen that the concentration in the intestine is maintained at a certain amount, the efficiency is high, and a certain amount of the produced inhibitor is discharged.
  • the Bacillus coagulans CC strain according to the present invention can continuously produce and supply the physiologically active material in the body. is showing This eliminates the need for separate fermentation and processing costs for the production of the alpha-glucosidase inhibitor, thereby reducing the production cost, and by continuously producing it in the body, the effective concentration in the small intestine, which is the point of action of the alpha-glucosidase inhibitor, is constantly maintained. It can be seen that there is an advantage that can be maintained. In addition, by using the spores of the Bacillus coagulans CC strain, problems such as fermentation odor, volume, and color do not occur in product processing, so it has the advantage of being applicable to various types of food.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Diabetes (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Mycology (AREA)
  • Biotechnology (AREA)
  • Polymers & Plastics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Obesity (AREA)
  • Molecular Biology (AREA)
  • Food Science & Technology (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Nutrition Science (AREA)
  • Epidemiology (AREA)
  • Emergency Medicine (AREA)
  • Endocrinology (AREA)
  • Physiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Animal Husbandry (AREA)
  • Virology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명에 따른 신규한 바실러스 코아귤란스 CC (Bacillus coagulans CC)(KCTC14267BP) 균주는, 혐기성 조건에서도 서식이 가능한 신균주로서, 장내에서 알파-글루코시다아제 저해제를 생산하여 공급하므로 알파-글루코시다아제 및 이의 주된 성분인 1-데옥시노지리마이신 (1-deoxynojirimycin)가 작용하는 소장내에서 유효 농도를 일정하게 유지하여 단당류의 흡수 저해를 극대화 할 수 있어 체중 감량 및 혈당 강하 효과를 나타낼 수 있다. 또한, 알파-글루코시다아제 저해제 및 이의 주된 성분인 1-데옥시노지리마이신 (1-deoxynojirimycin)을 장에서 생산하여 공급하므로 포자 생산비용 이외의 별도의 발효비용 및 가공비가 필요하지 않아 생산비용을 절감 할수 있고, 발효취 등의 문제가 발생하지 않아 다양한 형태의 식품, 사료 및 약학 조성물에 적용이 가능하다.

Description

알파-글루코시다아제 저해제를 생산하는 신규한 바실러스 코아귤란스 CC 균주
본 발명은 장내에서 알파-글루코시다아제 (α-glucosidase) 저해제를 다량 생산하는 신균주인 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC)(KCTC14267BP) 및 이의 용도에 관한 것이다.
탄수화물은 체내에서 소화가 되면서 맥아당과 같은 이당류로 분해가 되고 이어서 알파-글루코시다아제라는 효소에 의해 포도당과 같은 단당류로 분해가 되어 혈관으로 흡수가 된다. 이 과정에서 알파-글루코시다아제의 작용을 저해하면 이당류의 분해가 지연되어 당류의 흡수를 제어 할 수 있게 된다. 따라서 알파-글루코시다아제 저해제는 식후의 과혈당을 현저하게 억제하므로 당뇨병, 비만 등의 예방 또는 개선에 유효하다.
알파-글루코시다아제 저해제는 일부의 식물이나 미생물 등에 분포한다. 식물 기원의 알파-글루코시다아제 저해제로는 뽕잎에 함유된 아자당 (aza sugar)류, 콩에 함유된 이소플라본 (isoflavone) 및 플라본 배당체 (flavone glycoside) 등이 알려져 있으며, 미생물 기원의 알파-글루코시다아제 저해제로는 악티노플라네스속 (Actinoplanes) 균주 기원의 유사올리고당 (pseudooligosaccharide), 스트렙토미세스속 (Streptomyces) 또는 바실러스속 (Bacillus) 등의 미생물이 생산하는 1-데옥시노지리마이신 (1-deoxynojirimycin), 트리스 염 (tris base) 등이 알려져 있으며, 의약품으로는 수종의 알파-글루코시다아제 저해제들이 이미 당뇨병 치료제로서 시판되고 있다.
최근, 1-데옥시노지리마이신으로 대표되는 뽕잎 추출물이나 낫토 등 천연물 기원의 알파-글루코시다아제 저해제의 효능 검정을 위한 연구가 다수 진행되고 있다 (비특허문헌 005). 이와 더불어 이들의 1차 가공품 또는 추출물이 대량으로 생산이 되고 있으나 공통적으로 냄새, 색택과 같은 기호성을 떨어뜨리는 인자를 가지고 있으므로 제품의 다양화에 제한이 있다. 또한, 이들은 식물 또는 미생물이 생산한 이차대사산물을 이용하는 경우이므로 유효성분의 농도가 낮아 하루에 수회 일정량을 복용하여야 소기의 목적을 달성할 수 있는 단점이 있다.
한편, 통성 혐기성균은 동물의 장내와 같은 혐기적인 조건에서 증식할 수 있다. 따라서 알파-글루코시다아제 저해제를 생산하는 능력이 있는 통성 혐기성균은 장내에서 증식하며 끊임없이 장내 환경에 알파-글루코시다아제 저해제를 생산하여 공급할 것으로 예상된다. 미생물을 이용한 알파-글루코시다아제 제해제의 생산에 이용되는 바실러스 서브틸리스 (Bacillus subtilis)균주는 호기성 균으로 장내에서 증식하기 힘들기 때문에 알파-글루코시다아제 저해제를 장내에서 공급하기는 어려운 실정이다. 지금까지의 알파-글루코시다아제 저해제를 둘러싼 기술을 예의 주시하여 안전성이 높고 포자를 형성하여 장내에 도달능력이 높으며 장내에서 알파-글루코시다아제 저해제를 다량 생산하는 것을 목표로 연구를 거듭한 결과 장내에서 다량의 알파-글루코시다아제 저해제를 생산하는 균주를 분리하는데 성공하여 본 발명을 완성하기에 이르렀다.
본 발명의 발명자들은 알파-글루코시다아제 저해 활성이 강하고 장내에서 생육 가능한 미생물을 선발하고자 광범위한 자연계의 시료로부터 주의 깊게 탐색하였다. 그 결과, 알파-글루코시다아제 저해 활성을 나타내는 미생물들 중에서 통성 혐기성이고 포자를 형성하며 안전한 균으로서 동물의 장내에서 알파-글루코시다아제 저해제 및 이의 주된 성분인 1-데옥시노지리마이신 (1-deoxynojirimycin)를 다량으로 생산하는 신규한 바실러스 코아귤란스 CC (Bacillus coagulans CC)(KCTC14267BP) 균주를 분리 및 동정하였다. 상기 미생물의 발효물 또는 포자를 포함한 영양세포는 체중 감량, 혈당 강하, 당뇨 및 변비 해소 등의 목적으로 식품, 의약품 및 사료 등에 유용하게 사용될 수 있음을 확인하였다. 이에, 본 발명에서는 알파-글루코시다아제 저해제를 다량 생산하는 신규한 균주인 바실러스 코아귤란스 CC (Bacillus coagulans CC)(KCTC14267BP)균주에 관한 기술 내용을 제공하는 것을 그 목적으로 한다.
상기한 바와 같은 기술적 과제를 달성하기 위해서 본 발명은, 알파-글루코시다아제 저해제를 생산하는 능력이 향상된 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP)를 제공한다.
본 발명의 일 실시예에 있어서, 상기 균주는 서열번호 1의 16s rRNA의 염기서열을 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 실시예에 있어서, 상기 균주는 혐기성인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 실시예에 있어서, 상기 균주는 균주가 투여된 후 생물체로부터 2 내지 4주 이내에 배설되는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 실시예에 있어서, 상기 균주는 장내에서 알파-글루코시다아제 저해제를 생산하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 실시예에 있어서, 상기 장내에서 생산된 알파-글루코시다아제 저해제는 균주가 투여된 후 생물체로부터 2 내지 4주 이내에 배설되는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 실시예에 있어서, 상기 알파-글루코시다아제 저해제는 1-데옥시노지리마이신 (1-deoxynojirimycin)일 수 있으나, 이에 한정되는 것은 아니다.
또한, 본 발명은 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는, 비만의 예방 또는 개선용 식품 조성물을 제공한다.
또한, 본 발명은 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는 비만의 예방 또는 개선용 사료 조성물을 제공한다.
또한, 본 발명은 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는 비만의 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는 고혈당 또는 당뇨의 예방 및 개선용 식품 조성물을 제공한다.
또한, 본 발명은 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는 고혈당 또는 당뇨의 예방 및 개선용 사료 조성물을 제공한다.
또한, 본 발명은 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는 고혈당 또는 당뇨의 예방 및 치료용 약학 조성물을 제공한다.
마지막으로, 본 발명은 상기 비만 예방 또는 치료용 약학 조성물을 투여하는 단계를 포함하는 비만 예방 또는 치료 방법을 제공한다.
본 발명에 따른 신규한 바실러스 코아귤란스 CC (Bacillus coagulans CC)(KCTC14267BP)균주는, 혐기성 조건에서도 서식이 가능한 신균주로서, 장내에서 알파-글루코시다아제 저해제를 생산하여 공급하므로 알파-글루코시다아제 및 이의 유효성분인 1-데옥시노지리마이신 (1-deoxynojirimycin)이 작용하는 소장내에서 유효 농도를 일정하게 유지하여 단당류의 흡수 저해를 극대화 할 수 있어 체중 감량 및 혈당 강하 효과를 나타낼 수 있다. 본 발명의 바실러스 코아귤란스 CC 균주 (KCTC14267BP)는 장내에 고착하지 않고 일시적으로 서식하는 특성을 나타내 필요에 따라 투여된 균주 또는 균주가 생산한 알파-글루코시다아제 저해제 및 이의 유효성분인 1-데옥시노지리마이신 (1-deoxynojirimycin)는 일정 시간 후 배출이 가능하여 안전하게 사용할 수 있다.
미생물을 이용한 알파-글루코시다아제 저해제 생산의 경우 발효비용, 정제비용 등 생산비의 부담이 크고 많은 노동력을 필요로 하나 바실러스 코아귤란스 CC 균주 (KCTC14267BP)를 사용하면 알파-글루코시다아제 저해제 및 이의 유효 성분인 1-데옥시노지리마이신 (1-deoxynojirimycin)를 장에서 생산하여 공급하므로 포자 생산비용 이외의 별도의 발효비용 및 가공비가 필요하지 않아 생산비용을 절감 할수 있고, 발효취 등의 문제가 발생하지 않아 다양한 형태의 식품, 사료 및 약학 조성물에 적용이 가능하다.
도 1은 바실러스 코아귤란스 CC 균주가 생산하는 알파-글루코시다아제 저해제의 주된 성분인 1-데옥시노지리마이신을 HPLC로 분석 확인한 결과이다.
도 2는 고탄수화물 식이의 급여시 바실러스 코아귤란스 CC 균주 포자의 투여가 마우스의 체중에 미치는 영향을 보여주는 그래프이며, 표준식이군 ( ○ ), 고탄수화물식이군 ( □ ) 및 고탄수화물식이 + CC포자 투여군 ( ■ )을 각각 나타낸다.
도 3은 도 2의 11주 시점에서 표준식이군 (Normal-Diet), 고탄수화물식이군 (HC-Diet) 및 고탄수화물식이 + CC포자 투여군 (HC-Diet + CC Spore)의 마우스를 CT 촬영을 통하여 각각 흉부와 복부의 지방 분포를 관찰한 결과이다.
도 4은 고지방 식이의 급여시 바실러스 코아귤란스 CC 균주 포자의 투여가 마우스의 체중에 미치는 영향을 보여주는 그래프이며, 표준식이군 ( ○ ), 고지방식이군 ( □ ) 및 고지방식이 + CC포자 투여군 ( ■ )을 각각 나타낸다.
도 5는 도 4의 11주 시점에서 표준식이군 (Normal-Diet), 고지방식이군 (HF-Diet) 및 고지방식이 + CC포자 투여군 (HF-Diet + CC Spore)의 마우스를 CT 촬영을 통하여 각각 흉부와 복부의 지방 분포를 관찰한 결과이다.
도 6는 마우스의 분변 1g에 포함된 알파-글루코시다아제의 저해 활성을 보여주는 그래프이며, 고탄수화물식이 + CC포자투여군 (gray) 및 고지방식이 + CC포자투여군 (black)을 각각 나타낸다. CC포자는 7주간 투여하였으며 이후는 포자가 없는 고탄수화물식이 또는 고지방식이를 급여하였다. 화살표는 CC포자 투여를 중지한 시점이다.
도 7은 마우스의 분변으로 배설되는 바실러스 코아귤란스 CC 균주의 분포를 보여주는 그래프이며, 고탄수화물식이 + CC포자투여군 (gray) 및 고지방식이 + CC포자투여군 (black)을 각각 나타낸다. CC포자는 7주간 투여하였으며 이후는 포자가 없는 고탄수화물식이 또는 고지방식이를 급여하였다. 화살표는 CC포자 투여를 중지한 시점이다.
도 8은 바실러스 코아귤란스 CC 균주의 분류학상 위치를 나타낸 개략도이다.
본 발명은, 알파-글루코시다아제 저해제를 생산하는 능력이 향상된 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP)를 제공한다.
본 발명의 일 실시예에 있어서, 상기 균주는 건초를 시료로 하여 내열성 포자를 형성하는 균을 분리하고, 통성 혐기적으로 생육이 가능하며 알파-글루코시다아제 저해제를 고생산하는 균주를 선별함으로써 얻을 수 있다.
본 발명의 일 실시예에 있어서, 상기 균주는 서열번호 1의 염기서열로 표시되는 16s rRNA를 포함할 수 있다.
본 발명의 일 실시예에 있어서, 상기 균주는 알파-글루코시다아제 저해제를 장내에서 고수율로 생산하는 혐기성 특성과 생체외에서도 알파-글루코시다아제 저해제를 생산하는 호기적 특성을 동시에 가질 수 있다.
본 발명의 일 실시예에 있어서, 상기 균주는 포자를 형성할 수 있으며, 장내에 고착하지 않고 일시적으로 서식하는 특성을 나타내, 필요에 따라 투여된 균주를 장내로부터 배출이 가능해 안전하게 사용할 수 있다. 바람직하게는 상기 균주는 생물체에 투여된 후, 2주 내지 4주 경과하는 시점부터 생물의 체외 (體外)로 배설될 수 있고, 보다 바람직하게는 1주를 경과하는 시점에 배설될 수 있다.
본 발명의 일 실시예에 있어서, 상기한 균주는 장내에서 상기 알파-글루코시다아제 저해제를 생산할 수 있어, 알파-글루코시다아제 저해제의 유효 농도를 장내에서 일정하게 유지할 수 있으며, 장내에서 생산한 상기 알파-글루코시다아제 저해제는 배설이 가능해 안전하게 사용할 수 있다. 바람직하게는 상기 알파-글루코시다아제 저해제는 균주가 생물체에 투여된 후, 2주 내지 4주 경과하는 시점부터 생물의 체외 (體外)로 배설될 수 있다.
이에 따라, 상기 균주를 포함하는 조성물을 섭취하는 방법에 의해 투여하여 장내에서 알파-글루코시다아제 저해제를 고수율로 생산할 수 있고 일정기간 후 생물체외로 배출이 가능해 체중 감량과 혈당강하의 목적으로 효과적으로 사용할 수 있다. 장내에서 다량으로 생산된 α-글루코시다아제 저해제의 작용에 의해 분해되지 않은 올리고 탄수화물은 대장까지 도달하여 장내 미생물의 먹이가 되어 프리바이오틱스로서의 역할을 하여 변비를 해소 할 수 있어 변비 완화의 목적으로 사용할 수 있다.
본 발명의 일 실시예에 있어서, 상기 균주가 포자의 형태로 포함될 수 있고, 1 g 당 106 내지 1014 개의 포자로 포함될 수 있으며, 이에 제한되지 않는다.
본 발명의 일 실시예에 있어서, 상기 균주가 생성하는 알파-글루코시다아제 저해제는 1-데옥시노지리마이신 (1-deoxynojirimycin)일 수 있으며, 이에 제한되지 않는다.
본 명세서의 용어 '발효물'은 액체/고체 배지에서 배양한 발효물 자체, 상기 발효물을 여과 또는 원심분리 하여 균주를 제거한 여액 (원심분리한 상등액) 또는 균을 함유한 침전물 등의 발효물 자체로부터 파생되는 가공물을 포함할 수 있다.
본 명세서에서의 용어 "배양"은 미생물을 적당히 인공적으로 조절한 환경조건에서 생육시키는 것을 의미한다.
상기 바실러스 코아귤란스 CC 균주는 통상의 배지에서 생육 가능하며, 일 예로 뉴트리엔트 브로스 (Nutrient broth) 배지에서 배양할 수 있다. 상기 배지는 특정 미생물을 배양하기 위하여 배양대상 즉 배양체가 되는 미생물이 필요로 하는 영양물질을 포함하는 것으로 특수한 목적을 위한 물질이 추가로 첨가되어 혼합된 것일 수 있다. 상기 배지는 배양기 또는 배양액이라고도 하며, 천연배지, 합성배지 또는 선택배지를 모두 포함하는 개념이다. 상기 균주는 통상의 배양방법에 따라 배양할 수 있다.
배양에 사용되는 배지는 적당한 탄소원, 질소원, 아미노산, 비타민 등을 함유한 통상의 배지 내에서 온도, pH 등을 조절하면서 적절한 방식으로 특정 균주의 요건을 충족해야 한다. 사용될 수 있는 탄소원으로는 포도당을 주 탄소원으로 사용하며 이외에 수크로즈, 락토즈, 프락토즈, 말토즈, 전분, 셀룰로즈와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있다. 사용될 수 있는 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 및 질산암모늄과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민과 같은 아미노산 및 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두박(분) 또는 그의 분해생성물 등 유기질소원이 사용될 수 있다. 이들 질소원은 단독 또는 조합되어 사용될 수 있다. 상기 배지에는 인산원으로서 인산 제1칼륨, 인산 제2칼륨 및 대응되는 소듐-함유 염이 포함될 수 있다. 사용될 수 있는 인산원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함된다. 또한, 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간 및 탄산칼슘 등이 사용될 수 있다. 마지막으로, 상기 물질에 더하여 아미노산 및 비타민과 같은 필수 성장 물질이 사용될 수 있다.
또한, 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기된 원료들은 배양과정에서 배양물에 적절한 방식에 의해 회분식, 유가식 또는 연속식으로 첨가될 수 있으나, 특별히 이에 제한되지는 않는다. 수산화나트륨, 수산화칼륨, 암모니아와 같은 기초 화합물 또는 인산 또는 황산과 같은 산 화합물을 적절한 방식으로 사용하여 배양물의 pH를 조절할 수 있다.
또한, 본 발명은, 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC)(KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는 비만의 예방 또는 개선용 식품 조성물, 사료 조성물 및 약학적 조성물을 제공한다.
상기 비만의 예방 또는 개선용 식품 조성물, 사료 조성물 및 약학적 조성물은 상술한 신규한 바실러스 코아귤란스 CC 균주(Bacillus coagulans CC)(KCTC14267BP)를 포함하기 때문에, 상술한 본 발명의 균주와 중복된 내용은 중복된 내용의 기재에 의한 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명의 식품 조성물은 유효성분을 함유하는 것 외에 통상의 식품 조성물과 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다.
상술한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨,소르비톨, 에리트리톨 등의 당알콜이다. 상술한 향미제는 천연 향미제 (타우마틴), 스테비아 추출물 (예를 들어 레바우디오시드 A, 글리시르히진 등) 및 합성 향미제 (사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 본 발명의 식품 조성물은 상기 약학적 조성물과 동일한 방식으로 제제화되어 기능성 식품으로 이용하거나, 각종 식품에 첨가할 수 있다. 본 발명의 조성물을 첨가할 수 있는 식품으로는 예를 들어, 음료류, 육류, 초코렛, 식품류, 과자류, 피자, 라면, 기타 면류, 껌류, 사탕류, 아이스크림류, 알코올 음료류, 비타민 복합제 및 건강보조식품류 등이 있다.
또한 상기 식품 조성물은 유효성분인 추출물 외에 여러 가지 영양제, 비타민, 광물 (전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제 (치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 그밖에 본 발명의 식품 조성물은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다.
본 발명의 기능성 식품 조성물은, 정제, 캅셀, 분말, 과립, 액상, 환 등의 형태로 제조 및 가공될 수 있다. 본 발명에서 '건강기능성 식품 조성물'이라 함은 건강기능식품에 관한 법률 제6727호에 따른 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 말하며, 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻을 목적으로 섭취하는 것을 의미한다. 본 발명의 건강기능식품은 통상의 식품 첨가물을 포함할 수 있으며, 식품 첨가물로서의 적합 여부는 다른 규정이 없는 한, 식품의약품안전청에 승인된 식품 첨가물 공전의 총칙 및 일반시험법 등에 따라 해당 품목에 관한 규격 및 기준에 의하여 판정한다. 상기 '식품 첨가물 공전'에 수재된 품목으로는 예를 들어, 케톤류, 글리신, 구연산칼슘, 니코틴산, 계피산 등의 화학적 합성물; 감색소, 감초추출물, 결정셀룰로오스, 고량색소, 구아검 등의 천연첨가물; L-글루타민산나트륨 제제, 면류첨가알칼리제, 보존료 제제, 타르색소제제 등의 혼합제제류 등을 들 수 있다. 예를 들어, 정제 형태의 건강기능식품은 본 발명의 유효성분을 부형제, 결합제, 붕해제 및 다른 첨가제와 혼합한 혼합물을 통상의 방법으로 과립화한 다음, 활택제 등을 넣어 압축성형하거나, 상기 혼합물을 직접 압축 성형할 수 있다. 또한 상기 정제 형태의 건강기능식품은 필요에 따라 교미제 등을 함유할 수도 있다. 캅셀 형태의 건강기능식품 중 경질 캅셀제는 통상의 경질 캅셀에 본 발명의 유효성분을 부형제 등의 첨가제와 혼합한 혼합물을 충진하여 제조할 수 있으며, 연질 캅셀제는 본 발명의 유효성분을 부형제 등의 첨가제와 혼합한 혼합물을 젤라틴과 같은 캅셀기제에 충진하여 제조할 수 있다. 상기 연질 캅셀제는 필요에 따라 글리세린 또는 소르비톨 등의 가소제, 착색제, 보존제 등을 함유할 수 있다. 환 형태의 건강기능식품은 본 발명의 유효성분과 부형제, 결합제, 붕해제 등을 혼합한 혼합물을 기존에 공지된 방법으로 성형하여 조제할 수 있으며, 필요에 따라 백당이나 다른 제피제로 제피할 수 있으며, 또는 전분, 탈크와 같은 물질로 표면을 코팅할 수도 있다. 과립 형태의 건강기능식품은 본 발명의 유효성분의 부형제, 결합제, 붕해제 등을 혼합한 혼합물을 기존에 공지된 방법으로 입상으로 제조할 수 있으며, 필요에 따라 착향제, 교미제 등을 함유할 수 있다.
본 발명의 사료 조성물은 비만 억제, 혈당 강하 등의 효과를 나타내는 바, 동물체의 건강상태를 양호하게 하는 효과를 기대할 수 있다. 본 발명의 사료 조성물은 발효사료, 배합사료, 펠렛 형태 및 사일레지 등의 형태로 제조될 수 있다. 상기 발효사료는 본 발명의 바실러스 코아귤란스 CC를 첨가함으로서 유기물을 발효시켜 제조할 수 있으며, 배합사료는 여러 종류의 일반사료와 본 발명의 바실러스 코아귤란스 CC 균주의 포자 및 발효물을 혼합하여 제조할 수 있다. 펠렛 형태의 사료는 상기 배합사료 등을 펠렛기에서 열과 압력을 가하여 제조할 수 있으며, 사일레지는 청예 사료를 본 발명에 따른 미생물로 발효시킴으로써 제조할 수 있다. 습식발효사료는 음식물 쓰레기 등과 같은 유기물을 수집 및 운반하여 살균과정과 수분조절을 위한 부형제를 일정비율로 혼합한 후, 발효에 적당한 온도에서 24시간 이상 발효하여, 수분함량이 약 70%으로 포함되도록 조절하여 제조할 수 있다. 발효건조사료는 습식 발효 사료를 건조과정을 추가로 거쳐 수분함량이 30% 내지 40% 정도 함유되도록 조절하여 제조할 수 있다.
본 발명의 사료 조성물은 종래 사료에 첨가되는 성분을 더 포함할 수 있다. 이러한 사료에 첨가되는 성분의 일예로서 곡류분말, 고기분말, 및 두류 등을 포함할 수 있다. 상기에서 곡류분말은 쌀가루, 밀가루, 보리가루, 및 옥수수가루 중에서 선택된 1종 이상을 사용할 수 있다. 상기에서 고기분말은 닭고기, 소고기, 돼지고기, 및 타조고기 중에서 선택된 어느 하나 이상을 분말화한 고기분말을 사용할 수 있다. 상기에서 두류는 대두, 강낭콩, 완두콩, 및 검정콩 중에서 선택된 1종 이상을 사용할 수 있다.
본 발명의 사료 조성물은 상기에서 언급한 종래 사료에 첨가되는 성분인 곡류분말, 고기분말, 및 두류 이외에도 사료의 영양성을 증대시키기 위해 영양제, 및 무기물 중에서 선택된 어느 하나 이상을 첨가할 수 있으며, 사료 품질의 저하를 막기 위해 항곰팡이제, 항산화제, 항응고제, 유화제, 및 결착제 중에서 선택된 1종 이상을 포함할 수 있다.
본 발명에 따른 약학 조성물은 유효성분을 약학적으로 허용된 담체에 혼입시킨 형태로 제조될 수 있다. 여기서, 약학적으로 허용된 담체는 제약 분야에서 통상 사용되는 담체, 부형제 및 희석제를 포함한다. 본 발명의 약학 조성물에 이용할 수 있는 약학적으로 허용된 담체는 이들로 제한되는 것은 아니지만, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로스, 메틸 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
본 발명의 약학 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀전, 시럽, 에어로졸 등으로 제형화하여 사용될 수 있다.
제제화할 경우에는 통상 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 그러한 고형 제제는 유효성분에 적어도 하나 이상의 부형제, 예를 들면 전분, 칼슘 카르보네이트, 수크로스, 락토오스, 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있다. 경구투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데, 일반적으로 사용되는 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
상기 약학 조성물은 다양한 경구 투여 형태로 제형화될 수 있다.
경구 투여용 제형으로는 예를 들면 정제, 환제, 경질, 연질 캅셀제, 액제, 현탁제, 유화제, 시럽제, 과립제 등이 있는데, 이들 제형은 유효성분 이외에 희석제 (예: 락토즈, 덱스트로즈, 수크로즈, 만니톨, 솔비톨, 셀룰로즈 및/또는 글리신), 활택제 (예: 실리카, 탈크, 스테아르산 및 그의 마그네슘 또는 칼슘염 및/ 또는 폴리에틸렌 글리콜)를 추가로 포함할 수 있다. 또한, 상기 정제는 마그네슘 알루미늄 실리케이트, 전분 페이스트, 젤라틴, 트라가칸스, 메틸셀룰로즈, 나트륨 카복시메틸셀룰로즈 및/또는 폴리비닐피롤리딘과 같은 결합제를 함유할 수 있으며, 경우에 따라 전분, 한천, 알긴산 또는 그의 나트륨 염과 같은 붕해제 또는 비등 혼합물 및/또는 흡수제, 착색제, 향미제 및 감미제를 함유할 수 있다. 상기 제형은 통상적인 혼합, 과립화 또는 코팅 방법에 의해 제조될 수 있다.
또한, 본 발명은, 신규한 바실러스 코아귤란스 CC 균주(Bacillus coagulans CC)(KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는 고혈당 및 당뇨의 예방 또는 개선용 식품 조성물, 사료 조성물 및 약학적 조성물을 제공한다.
상기 고혈당 및 당뇨의 예방 또는 개선용 식품 조성물, 사료 조성물 및 약학적 조성물은 상술한 신규한 바실러스 코아귤란스 CC 균주(Bacillus coagulans CC)(KCTC14267BP)를 포함하기 때문에, 상술한 본 발명의 균주와 중복된 내용은 중복된 내용의 기재에 의한 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명은 상기 비만 예방 또는 치료용 약학 조성물을 투여하는 단계를 포함하는 비만 예방 또는 치료 방법을 제공한다.
본 발명의 약학적 조성물은 치료적 유효량 또는 약학적으로 유효한 양으로 투여할 수 있다.
본 발명에서 사용되는 용어 “약학적으로 유효한 양”은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경료 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
또한, 상기 약학적 조성물의 투여 방법은 특별히 한정되지 않으며, 예를 들면 피부에 도포, 피내주사, 피하주사 등의 방법을 들 수 있다.
또한, 본 발명의 "개체"는 질병의 예방, 조절 또는 치료방법을 필요로 하는 대상을 의미하고, 보다 구체적으로는, 인간 또는 비-인간인 영장류, 생쥐 (mouse), 쥐 (rat), 개, 고양이, 말, 소 등의 포유류를 의미한다. 때에 따라 인간을 제외할 수 있다.
이하, 본 발명을 실시예를 통하여 더욱 상세히 설명하기로 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
<실시예 1> 균주의 탐색
한국내 각지에서 수집한 약 800여점의 건초를 시료로 하여 미생물을 분리하였다. 각 시료에 멸균 식염수를 소량 가하여 현탁시킨 다음 80℃ 항온 수조에서 20분간 열처리하여 얻은 포자액을 1.5% 한천을 함유하는 BCP Plate Count Agar 평판배지에 도말하고, 55℃ 배양기에서 2일간 혐기적으로 배양하여 균 집락을 형성하는 균체를 분리하였다. 알파-글루코시다아제 저해제의 생산량을 조사하기 위하여, 분리된 균주는 5% 콩가루를 현탁한 배지 5ml에 접종하고 37℃에서 24시간 동안 진탕 배양하였다. 상기 배양액을 원심분리하여 상등액으로부터 알파-글루코시다아제 저해 활성을 측정하였다.
<실시예 2> 알파-글루코시다아제 저해 활성 측정
알파-글루코시다아제는 돼지의 소장으로부터 추출하여 부분 정제한 것을 효소원으로 사용하였다. 알파-글루코시다아제 효소액은 24unit/ml가 되게 0.5M 인산염 완충용액 (pH 7.0)으로 적당히 희석하여 사용하였으며, 기질은 p-nitrophenyl α-D-glucopyranoside (pNPG)를 이용하였다. 시험관에 배양 상등액 30μl와 효소 50μl를 섞어 37℃에서 10분간 예비 보온을 한 후, 3mM pNPG 50μl를 첨가하고 37℃에서 20분간 반응시켰다. 반응액에 0.1M Na2CO3를 가하여 반응을 정지하고, 분광광도계로 405nm에서 흡광도를 측정함으로써 알파-글루코시다아제 저해활성을 측정하였다. 이때 저해제 대신 물을 넣은 것을 대조구로 하여 하기 수학식 1에 따라 저해율을 계산하였다.
[수학식 1]
저해율(%) = [(A-B)/A] × 100
상기 식에서, A는 대조구의 흡광도이고, B는 저해제를 넣은 시료의 흡광도이다.
이때, 알파-글루코시다아제 저해단위 (α-glucosidase inhibition unit, AGI unit)는 활성 측정에 사용된 α-glucosidase를 1% 저해할 때의 저해제의 양으로 정의하였다.
<실시예 3> 균주의 선발
상기의 실시예 2의 과정으로 약 50종의 세균을 알파-글루코시다아제 저해제 생산균으로 1차 선발한 후, 55℃에서 혐기적으로 생육이 가능하고 프로피온산 (propionic acid)이 함유된 배지에서 생육하지 못하는 균주의 배양액을 원심분리하여 상등액으로부터 알파-글루코시다아제 저해 활성을 측정하여 알파-글루코시다아제 저해 활성이 높은 3종을 2차 선발하였다. 상기한 3종의 균주중 버지스 매뉴얼 (Bergey's Manual of Systematic Bacteriology, 2002)에 의한 분류학적 특성 분석 방법에 따라 바실러스 코아귤란스 (Bacillus coagulans)로 분류되고 알파-글루코시다아제 저해제 생산성이 높고 포자 형성이 수월한 DH-128 균을 최종 선발하였다 (표 1 참조).
[표 1]
Figure PCTKR2021013460-appb-img-000001
<실시예 4> DH-128 균주의 돌연변이 유발
<4.1> 신규한 바실러스 코아귤란스 CC 선발 및 특징 확인
DH-128 균주를 니트로소구아니딘 (nitrosoguanidine, 100μg/ml)으로 사멸율이 99.9%가 되게 처리하여 돌연변이를 유발한 후 BCP Plate Count Agar 평판배지에 1장당 200~300마리가 되게 도말하고 40℃에서 2일간 배양하였다. 생성된 콜로니는 무작위하게 5% 콩가루 배지에 접종하고 40℃에서 2일간 진탕 배양한 후 상등액을 원심분리하여 알파-글루코시다아제 저해 활성을 측정하였다. 알파-글루코시다아제 저해 활성이 상승한 5 균주를 선발하여 포자형성 능력과 알파-글루코시다아제 저해 활성을 고려하여 DH-128-46Y93을 선발하였다. DH-128-46Y93균주는 상기와 같은 방법으로 돌연변이를 반복하여 알파-글루코시다아제 저해 활성이 높고 포자 형성능력이 좋은 균주를 선발하여 바실러스 코아귤란스 CC 균주(Bacillus coagulans CC)로 명명하고 한국생명공학 연구원 생물자원센터 (KCTC)에 2020.08.06. 일자로 기탁하였다 (수탁번호 KCTC14267BP).
대조 균주로서 알파-글루코시다아제 제해제 생산 낫토 균주인 바실러스 서브틸리스 DC-15와 알파-글루코시다아제 제해제 무생산 균주인 바실러스 코아귤란스 ATCC 7050를 사용하였으며 돌연변이 균주인 DH-128, DH-128-46Y93 및 바실러스 코아귤란스 CC 균주(Bacillus coagulans CC)를 5% 콩가루 배지에서 각각 40℃에서 2일간 호기적 또는 혐기적으로 배양하여 생성된 알파-글루코시다아제 저해 활성을 하기 표 2에 나타내었다.
[표 2]
Figure PCTKR2021013460-appb-img-000002
상기 표 2에 나타난 바와 같이, 선발 균주인 DH-128로부터 순차적인 돌연변이 육종에 의해 알파-글루코시다아제 저해 활성이 대폭적으로 증가한 바실러스 코아귤란스 CC 균주가 육종되었다. 대조 균주인 바실러스 서브틸리스 DC-15는 낫토 생산에 사용되는 호기성균으로 호기적인 조건에서는 상당량의 알파-글루코시다아제 제해제를 생산하나 혐기적인 조건에서는 전혀 생산을 하지 못하고 있으며 바실러스 코아귤란스 ATCC 7050은 호기적이거나 혐기적이거나 알파-글루코시다아제 제해제를 생산하지 않는다. 따라서 바실러스 코아귤란스 CC 균주는 장내와 같은 혐기적 환경에서도 알파-글루코시다아제 제해제를 생산하는 능력을 보여줌으로서 알파-글루코시다아제 제해제를 생산하는 기타 호기성 균과는 매우 다른 특징이 있다.
<4.2> 분리된 바실러스 코아귤란스 CC 균주의 형태학적 및 생화학적 특성 규명
상기의 분리과정을 거쳐 육종된 바실러스 코아귤란스 CC 균주의 L-broth 한천 평판배지에서 형성된 균 집락은 작고 평평하며 가장자리는 매끈한 둥근 형태이고 표면은 광택이 없는 흰색의 외형을 나타내었다. 균의 성장에 미치는 온도의 영향은 25℃ 이상 40℃ 이하의 범위에서 성장이 양호하였으며, 60℃ 이상에서는 균체의 성장이 확인되지 않았다. 질산염의 환원력은 양성이며, 구연산 이용, Voges-Proskauer 시험은 음성이었다. 또한, 카제인, 젤라틴, 전분을 분해하며, 포도당으로부터 산을 생성하며 아라비노스, 자일로스, 만니톨로부터는 산을 생성하지 않으며 카탈라아제 양성이며, 호기적 조건 및 혐기적 조건에서 성장한다. L-broth 액체배지를 이용한 균체 성장의 대수기에서 현미경 관찰한 결과, 짧은 막대모양의 외형으로서 비교 균주인 바실러스 코아귤란스와 유사하였으며 그람 양성이었다.
또한 API50CHB 키트 (BioMerieux사, France)를 사용하여, 분리된 균주의 생화학적 특성 등을 조사한 결과, 하기 표 3에 나타낸 바와 같은 생화학적 특성 (API test 결과)을 가짐을 확인할 수 있었다.
[표 3]
Figure PCTKR2021013460-appb-img-000003
버지스 매뉴얼 (Bergey's Manual of Systematic Bacteriology, 2002)에 의한 바실러스 속 균주의 분류학적 특성 분석을 한 결과는 하기 표 4에 요약하였으며 바실러스 코아귤란스 CC (Bacillus coagulans CC)는상기 균주가 하기 서열번호 1의 16s rRNA서열을 갖는 다는 것을 확인하였다.
[표 4]
Figure PCTKR2021013460-appb-img-000004
[서열번호 1]
CTCACCAAGGCAACGATGCGTAGCCGACCCGAGAAGGGGAGCGGCCACATTGGGACTGAGACACGGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCCACCGCCGCGTGAGTGAAGAAGGCCTTCGGGGCGTAAAAACTCCGTTGCCGGGGGAAGAACAAGGGCCGTTCCAACAGGGCGGGGCCTTTGGCGGTACCGGGCCAAAAAGGCCCGGGTCACCTCCTGTCCCCACAAGCCGCGCGTAATACTGAGGGGGGAAAGGGTTTCTCGCGAAAATTTGGGGGTGAAAAAGCGGCCCCGCGGCGGGGTTTTTAAATATGTGTGGGTTAAAATTTTTGGCGCCCCCCCCCGGCGGGCGTTTTTTAAAACGGGGGGGGGCTGTGTGGAAAAAAGAGAAAGGGTATAAATCTCCCGTATTGTTGTGGAAAAAGTATATAAAATGTGGGAAAAACACAAGGGCGGAGGGGGCCTCGGTGGAAA
<실시예 5> 바실러스 코아귤란스 CC 균주가 생산하는 1-데옥시노지리마이신(1-deoxynojirimycin) 분석
바실러스 코아귤란스 CC 균주를 5% 콩가루 배지에서 37℃, 48시간 배양한 배양액을 원심분리하고 상등액을 TLC로 전개한 후 0.5cm 간격으로 긁어낸 후 물로 추출하여 알파-글루코시다아제 제해 활성을 측정하였다. 알파-글루코시다아제 제해 저해 활성은 1-데옥시노지리마이신과 같은 위치 한 곳에서 나타나 잠정적으로 알파-글루코시다아제 제해제의 주된 성분은 1-데옥시노지리마이신 (1-deoxynojirimycin)으로 판정하였다. 1-데옥시노지리마이신 (1-deoxynojirimycin)의 추가적인 확인을 위해 HPLC로 분석하였다. 바실러스 코아귤란스 CC 균주를 5ml의 5% 콩가루 배지에 접종한 후 37℃에서 48시간 혐기적으로 배양하였다. 이중 1ml를 취하여 0.4M potassuim borate buffer (pH 8.5) 20μl, acetonitrile에 용해한 5mM 9-flurenylmethyl chloroformate 20μl를 가하고 실온에서 30분간 차광하여 반응하여 표준품인 1-데옥시노지리마이신 (1-deoxynojirimycin)의 유도체와 비교하였다. 0.1M glycine 20μl를 가하여 반응 정지하여 HPLC 분석 시료로 하였다. HPLC 분석을 위한 컬럼은 Agilent TC-C18 column (250 x 4.60 mm, 5μm)를 사용하였으며 mobile phase는 acetonitrile : 0.1% acetic acid = 35 : 65이고 flow rate는 1.2ml/min, 컬럼 oven 온도는 40℃, 254nm에서 검출하였다. 도 1에서 보여 지듯이 바실러스 코아귤란스 CC 균주의 생성물과 1-데옥시노지리마이신 (1-deoxynojirimycin)은 동일한 retention time을 보여 같은 물질임을 확인하였다.
<실시예 6> 바실러스 코아귤란스 CC 균주의 식이 실험
바실러스 코아귤란스 CC 균주가 동물의 장관내에서 알파-글루코시다아제 제해제를 효율적으로 생산하는지 여부를 확인하기 위해, 마우스를 사육하면서 바실러스 코아귤란스 CC 균주의 포자를 경구투여하여 균주의 장내 증식 및 체외 배출 여부, 장내에서의 알파-글루코시다아제 저해제의 생산 여부, 체중변화 등을 검토하였다. 이를 위해, 시판되는 표준사료와 물을 자유로 급여하며 수컷 마우스 (3주령)를 1주일간 예비 사육한 후 사용하였다. 명암 사이클은 08:00시에서 20:00시를 명기, 20:00시에서 08:00시를 암기로 하였으며, 22.5±0.5℃의 온도 및 50 내지 60%의 습도가 유지되는 환경하에서 사육하였다. 식이는 하기 표 5의 조성으로 각각 조제하였다. 마우스는 표준식이군, 고탄수화물 식이군, 고탄수화물 식이 + CC 포자군, 고지방 식이군, 고지방 식이 + CC 포자군 등 5개의 군 (각 8마리)으로 나누어 12주간 사육하였다. 바실러스 코아귤란스 CC 균주 포자는 고탄수화물 식이 + CC 포자군, 고지방 식이 + CC 포자군에 대하여 109cell/kg 체중이 되도록 생리 식염수 100μl에 희석하여 격일로 투여 하였으며 나머지 표준식이군, 고탄수화물 식이군, 고지방 식이군은 포자 희석액 대신 생리 식염수를 100μl를 격일로 투여하였다. 사육을 진행하며 분변을 정기적으로 채집하여 분변 중의 알파-글루코시다아제 제해 활성과 배출되는 바실러스 코아귤란스 CC 균주를 측정하기 위한 시료로 하였다.
[표 5]
Figure PCTKR2021013460-appb-img-000005
<6.1> 고탄수화물식이의 급여 시 바실러스 코아귤란스 CC 균주 포자의 투여가 마우스의 체중에 미치는 영향 분석
고탄수화물식이가 급여된 마우스의 체중에 바실러스 코아귤란스 CC 균주 포자의 투여가 미치는 영향을 분석한 결과, 도 2에 나타난 바와 같이, 고탄수화물식이군은 표준식이군에 비하여 뚜렷한 체중 증가를 보이나 고탄수화물식이 + CC포자 투여군에서는 고탄수화물식이군 보다 현저히 감소된 체중 증가 양상을 보이는 것을 확인할 수 있었다. 이 실험의 11주에서 각 군별로 마우스의 CT를 촬영하여 체내의 지방 분포를 관찰하였다. 도 3은 그 결과로서 사진에서 화살표로 표시한 밝은 부분은 지방층을 나타내는 것으로 표준식이에 비하여 고탄수화물식이에서는 흉부 및 복부에 많은 량의 지방이 축적되어 있음을 알 수 있다. 반면 바실러스 코아귤란스 CC 균주 포자를 투여한 고탄수화물식이군에서는 체내 지방 축적이 현저하게 감소하여 표준식이에 비슷한 경향을 보여 바실러스 코아귤란스 CC 균주 포자의 투여에 의해 체중 증가 및 체지방 축적을 효율적으로 억제함을 보여주고 있다.
<6.2> 고지방 식이의 급여시 바실러스 코아귤란스 CC 균주 포자의 투여가 마우스의 체중에 미치는 영향
고지방식이가 급여된 마우스의 체중에 바실러스 코아귤란스 CC 균주 포자의 투여가 미치는 영향을 분석한 결과, 도 4에 나타난 바와 같이, 고지방식이군은 표준식이군에 비하여 뚜렷한 체중 증가를 보이나 고탄수화물식이 + CC포자 투여군에서와 같은 양상으로 고지방식이군 보다 현저히 감소된 체중 증가 양상을 보이는 것을 확인할 수 있었다. 고지방식이군 역시 실험의 11주에서 각 군별로 마우스의 CT를 촬영하여 체내의 지방 분포를 관찰하였다. 도 5는 그 결과로서 고탄수화물식이보다는 지방 축적이 덜하나 표준식이에 비하여 고지방식이에서 흉부 및 복부에 많은 량의 지방이 축적되어 있으나 바실러스 코아귤란스 CC 균주 포자의 투여에 의해 체중 증가 및 체지방 축적을 효율적으로 억제함을 보여주고 있다.
<실시예 7> 분변의 분석
상기 바실러스 코아귤란스 CC 균주의 식이 실험을 진행하면서 정기적으로 분변을 채집하여 분변으로 배설되는 알파-글루코시다아제 저해제와 바실러스 코아귤란스 CC 균주의 양을 측정하였다. 알파-글루코시다아제 저해제는 알파-글루코시다아제 저해 활성을 측정하였으며 바실러스 코아귤란스 CC 균주 균수는 분변 일정량에 멸균수를 가하여 잘 현탁하여 상등액을 BCP 평판 배지에 도말 한 후 55℃에서 2일간 혐기적으로 배양한 후 나타나는 콜로니의 수를 측정하였다.
<7.1> 분변으로 배설되는 바실러스 코아귤란스 CC 균주의 변화
바실러스 코아귤란스 CC 균주 포자가 투여된 마우스의 변에 포함된 포자수를 측정하여 변으로 배설되는 균주의 변화를 분석한 결과 도 6에 나타난 바와 같이 5주 까지는 배설되는 균의 양이 꾸준히 증가하여 그 이후에는 분변 1g 당 107개를 유지하므로 투여된 바실러스 코아귤란스 CC 균주은 장내에서 증식하여 그 일부가 체외로 배출되는 것으로 판단 할 수 있다. 한편 균의 투여를 중지한 시점인 8주부터 완만히 감소하므로 바실러스 코아귤란스 CC 균주가 장내에서 고착되지 않고 체류하는 시간이 그다지 길지 않음을 보여준다. 따라서, 본 균주의 투여를 중단하면 장내 균총의 변화가 예상되므로 필요에 따라 장내에서 본 균주의 제거도 가능한 장점이 있음을 확인할 수 있었다. 표준식이를 급여한 마우스의 분변에서는 콜로니의 생성이 관찰 되지 않으므로 나타난 콜로니는 바실러스 코아귤란스 CC 균주임을 특정 할 수 있다.
<7.2> 분변으로 배설되는 알파-글루코시다아제 저해 활성의 변화
바실러스 코아귤란스 CC 균주 포자가 투여된 마우스의 변으로 배설되는 알파-글루코시다아제의 저해 활성을 분석하였다. 도 7에 나타난 바와 같이 바실러스 코아귤란스 CC 균주 (KCTC14267BP)는 변으로 배출될 정도로 장내에서 왕성하게 증식하며 알파-글루코시다아제 저해제를 생산하는 것을 확인할 수 있다. 도 6에 나타나듯이 5주차 부터 7주까지는 배출되는 바실러스 코아귤란스 CC 균주의 양이 안정화되는 시기로 배출되는 알파-글루코시다아제 저해제의 양도 일정한 것을 확인할 수 있었다. 즉, 알파-글루코시다아제 저해제는 항상 장내에서 생산되므로 장내에서의 농도가 일정량 유지되며 효율이 높게 작용하는 장점을 가지며 생산된 저해제의 일정량이 배출되는 것임을 알 수 있다.
상기의 결과를 보면 공업적 과정으로 발효하여 생성된 생리활성물질을 체내로 투여하는 방식이 아니라 본 발명에 따른 바실러스 코아귤란스 CC 균주가 체내에서 생리활성물질을 연속적으로 만들어 공급하는 것이 가능하다는 것을 보여주고 있다. 이는 알파-글루코시다아제 저해제의 생성을 위한 별도의 발효비용 및 가공비가 필요하지 않아 생산비용을 절감할 수 있으며 체내에서 연속적으로 생산하므로서 알파-글루코시다아제 저해제의 작용점인 소장에서 유효한 농도를 일정하게 유지할 수 있는 장점이 있음을 확인할 수 있다. 또한 바실러스 코아귤란스 CC 균주의 포자를 이용함으로써 제품가공에서 발효취, 부피 및 색택 등의 문제가 발생하지 않으므로 다양한 형태의 식품에 적용할 수 있는 장점이 있다.
[수탁번호]
기탁기관명 : 한국생명공학연구원
수탁번호 : KCTC14267BP
수탁일자 : 20200806
Figure PCTKR2021013460-appb-img-000006

Claims (14)

  1. 알파-글루코시다아제 저해제를 생산하는 능력이 향상된 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP).
  2. 제1항에 있어서,
    상기 균주는 서열번호 1의 16s rRNA의 염기서열을 포함하는 것을 특징으로 하는, 바실러스 코아귤란스 CC 균주.
  3. 제1항에 있어서,
    상기 균주는 혐기성인 것을 특징으로 하는, 바실러스 코아귤란스 CC 균주.
  4. 제1항에 있어서,
    상기 균주는 균주가 투여된 후 생물체로부터 2 내지 4주 이내에 배설되는 것을 특징으로 하는, 바실러스 코아귤란스 CC 균주.
  5. 제1항에 있어서,
    상기 균주는 장내에서 알파-글루코시다아제 저해제를 생산하는 것을 특징으로 하는, 바실러스 코아귤란스 CC 균주.
  6. 제5항에 있어서,
    상기 장내에서 생산된 알파-글루코시다아제 저해제는 균주가 투여된 후 생물체로부터 2 내지 4주 이내에 배설되는 것을 특징으로 하는, 바실러스 코아귤란스 CC 균주.
  7. 제1항에 있어서,
    상기 알파-글루코시다아제 저해제는 1-데옥시노지리마이신 (1-deoxynojirimycin)인 것을 특징으로 하는, 바실러스 코아귤란스 CC 균주.
  8. 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는, 비만의 예방 또는 개선용 식품 조성물.
  9. 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는 비만의 예방 또는 개선용 사료 조성물.
  10. 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는 비만의 예방 또는 치료용 약학 조성물.
  11. 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는 고혈당 또는 당뇨의 예방 및 개선용 식품 조성물.
  12. 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는 고혈당 또는 당뇨의 예방 및 개선용 사료 조성물.
  13. 신규한 바실러스 코아귤란스 CC 균주 (Bacillus coagulans CC, 수탁번호 KCTC14267BP), 이의 배양액, 배양여액 또는 발효물을 유효성분으로 포함하는 고혈당 또는 당뇨의 예방 및 치료용 약학 조성물
  14. 제10항의 약학 조성물을 투여하는 단계를 포함하는, 비만 예방 또는 치료 방법.
PCT/KR2021/013460 2020-10-06 2021-09-30 알파-글루코시다아제 저해제를 생산하는 신규한 바실러스 코아귤란스 cc 균주 WO2022075660A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2023522349A JP2023547056A (ja) 2020-10-06 2021-09-30 α－グルコシターゼ阻害剤を生産する新規なバチルス・コアギュランスＣＣ株
CN202180068802.4A CN116209363A (zh) 2020-10-06 2021-09-30 生成α-葡萄糖苷酶抑制剂的新型凝结芽孢杆菌CC菌株

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200128609A KR102387028B1 (ko) 2020-10-06 2020-10-06 알파-글루코시다아제 저해제를 생산하는 신규한 바실러스 코아귤란스 cc 균주
KR10-2020-0128609 2020-10-06

Publications (1)

Publication Number Publication Date
WO2022075660A1 true WO2022075660A1 (ko) 2022-04-14

Family

ID=81125868

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/013460 WO2022075660A1 (ko) 2020-10-06 2021-09-30 알파-글루코시다아제 저해제를 생산하는 신규한 바실러스 코아귤란스 cc 균주

Country Status (4)

Country Link
JP (1) JP2023547056A (ko)
KR (1) KR102387028B1 (ko)
CN (1) CN116209363A (ko)
WO (1) WO2022075660A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024037588A1 (zh) * 2022-08-19 2024-02-22 华南农业大学 一株能够抑制α-葡萄糖苷酶和/或α-淀粉酶活性的凝结魏兹曼杆菌及其应用
GB2621976A (en) * 2022-08-19 2024-03-06 De Faire Medical Ab Compositions for use in treating and/or preventing type 2 diabetes, pre-diabetes, and/or a symptom thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240010582A (ko) * 2022-07-13 2024-01-24 이해익 폴리아민 고생산 바실러스 코아귤란스 균주

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4282320A (en) * 1979-02-23 1981-08-04 Bayer Aktiengesellschaft Production of 1-desoxynojirimicin
US4307194A (en) * 1976-12-23 1981-12-22 Bayer Aktiengesellschaft Inhibitors, obtained from bacilli, for glycoside hydrolases
KR20150116262A (ko) * 2014-04-07 2015-10-15 강원대학교산학협력단 발효취가 경미한 알파-글루코시다제 저해제 생산을 위한 배양 방법

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100708286B1 (ko) 2005-09-08 2007-04-16 강원대학교산학협력단 알파 글루코시다아제 저해제를 다량 생산하는 균주 및 그제조방법
KR101302652B1 (ko) 2011-03-21 2013-09-03 (주)바이오토피아 알파-글루코시다아제 저해물질 및 맥주효모를 포함하는 당뇨병의 예방 또는 치료용 약학 조성물
JP2017046652A (ja) * 2015-09-03 2017-03-09 株式会社ニューバイオエンタープライズ α−グルコシダーゼ阻害剤生産のための微生物培養方法
CA3014287A1 (en) * 2016-02-12 2017-08-17 Anheuser-Busch Inbev S.A. Sectorized cooling arrangement for refrigerators
KR101854705B1 (ko) 2016-06-20 2018-05-04 강원대학교산학협력단 알파글루코시다아제 저해제를 다량 생산하는 바실러스 리케니포르미스 ny1505 균주
JP7249006B2 (ja) 2018-10-29 2023-03-30 株式会社東洋新薬 α－グルコシダーゼ阻害剤及び血糖値上昇抑制剤

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4307194A (en) * 1976-12-23 1981-12-22 Bayer Aktiengesellschaft Inhibitors, obtained from bacilli, for glycoside hydrolases
US4282320A (en) * 1979-02-23 1981-08-04 Bayer Aktiengesellschaft Production of 1-desoxynojirimicin
KR20150116262A (ko) * 2014-04-07 2015-10-15 강원대학교산학협력단 발효취가 경미한 알파-글루코시다제 저해제 생산을 위한 배양 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GenBank NCBI; . . : "Bacillus coagulans gene for 16S rRNA, partial sequence, strain: NRIC 1530", XP055920048 *
KIM, HYUN-SU;LEE, JAE-YEON;HWANG, KYO-YEOL;CHO, YONG-SEOK;PARK, YOUNG-SHIK;KANG, KYUNG-DON;SEONG, SU-IL;: "Isolation and Identification of a Bacillus sp. producing <TEX>${\alpha}$</TEX>-glucosidase Inhibitor 1-deoxynojirimycin", HAN'GUG MI'SAENGMUL SAENGMYEONG GONG HAGHOEJI; KOREAN JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY, HAN'GUG MI'SAENGMUL SAENGMYEONG GONG HAGHOE; KOREAN SOCIETY FOR MICROBIOLOGY AND BIOTECHNOLOGY, KR, vol. 39, no. 1, 28 March 2011 (2011-03-28), KR , pages 49 - 55, XP053030533, ISSN: 1598-642X *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024037588A1 (zh) * 2022-08-19 2024-02-22 华南农业大学 一株能够抑制α-葡萄糖苷酶和/或α-淀粉酶活性的凝结魏兹曼杆菌及其应用
GB2621976A (en) * 2022-08-19 2024-03-06 De Faire Medical Ab Compositions for use in treating and/or preventing type 2 diabetes, pre-diabetes, and/or a symptom thereof

Also Published As

Publication number Publication date
JP2023547056A (ja) 2023-11-09
CN116209363A (zh) 2023-06-02
KR20220045692A (ko) 2022-04-13
KR102387028B1 (ko) 2022-04-14

Similar Documents

Publication Publication Date Title
WO2022075660A1 (ko) 알파-글루코시다아제 저해제를 생산하는 신규한 바실러스 코아귤란스 cc 균주
WO2013151361A1 (ko) 신규 바실러스 서브틸리스
WO2012105805A2 (en) Probiotics for biological control against vibrio sp.
US20190256934A1 (en) Bifidobacterium longum cbt bg7 strain for promotion of growth and nutraceutical composition for promotion of growth containing the same
US20190298784A1 (en) Bifidobacterium breve cbt br3 strain for promotion of growth and nutraceutical composition for promotion of growth containing the same
WO2019112217A1 (ko) 글리세롤로부터 루테린을 고생산하는 락토바실러스 루테리 oh0335 균주 및 이의 용도
US20070009503A1 (en) Antibiotic, Compositions Containing the Antibiotic, and Methods for Administering the Antibiotic and/or Said Compositions to Livestock
WO2019027073A1 (ko) 바실러스 서브틸리스 및 바실러스 리체니포미스를 포함하는 사료 첨가제, 상기 첨가제를 포함하는 사료 조성물 및 상기 사료첨가제의 제조 방법
JP6663977B2 (ja) バチルスサブチリスとバチルスリケニフォルミスを含む飼料添加剤、前記添加剤を含む飼料組成物及び前記飼料添加剤の製造方法
WO2018030730A1 (ko) 락토바실러스 살리바리우스 cjls1511, 상기 균 또는 이의 사균체를 포함하는 동물 사료 첨가제 조성물, 및 상기 사균체의 제조 방법
KR102130646B1 (ko) 신규한 락토바실러스 살리바리우스 및 이를 유효성분으로 포함하는 양식 어류 및 갑각류용 사료첨가제
WO2017026635A1 (ko) 신규한 락토바실러스 속 미생물 및 이를 포함하는 동물 사료용 조성물
EP1862080A1 (en) Protease-resistant bacteriocins produced by lactic acid bacteria and their use in livestock
WO2013151364A1 (ko) 신규 분리한 바실러스 리체니포미스 및 이를 이용한 프로바이오틱스
KR101854705B1 (ko) 알파글루코시다아제 저해제를 다량 생산하는 바실러스 리케니포르미스 ny1505 균주
US4307194A (en) Inhibitors, obtained from bacilli, for glycoside hydrolases
KR20010107661A (ko) α-아밀라아제 저해제를 사용한 반추위 산증의 치료
KR102003822B1 (ko) 반려동물의 모질을 개선하는 효능을 갖는 유산균과 이를 포함하는 생균제 조성물을 유효성분으로 함유하는 모질 개선을 위한 동물 사료용 첨가제 및 동물 사료 조성물
WO2012067341A1 (ko) 신규 바실러스속 프로바이오틱스 균주
KR100803532B1 (ko) 내산성, 내담즙성의 적응력이 강하고, 병원성 미생물의 생육을 억제하고, 알파-갈락토시데이지 효소를 생산하는 락토바실러스 살리바리우스 에스피 살리바리우스 df20(kctc10942bp) 미생물
EP0071970B1 (en) Novel antibiotic 76-11, process for the production thereof, anticoccidiosis agent and domestic animals growth accelerator comprising the same as an effective ingredient
WO2019209086A1 (ko) 류코노스톡 메젠테로이드 균주 및 이의 용도
WO2013151363A1 (ko) 신규 분리한 바실러스 리체니포미스 및 이를 이용한 프로바이오틱스
WO2023140565A1 (ko) 유산균을 이용한 알파-글루코사이드 활성 저해능을 가지는 혈당강하용 조성물, 건강기능식품 및 약학적 조성물
KR102157959B1 (ko) 신규 락토바실러스 브레비스 균주 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21877912

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023522349

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21877912

Country of ref document: EP

Kind code of ref document: A1