WO2022071638A1 - L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-시트룰린의 생산 방법 - Google Patents

L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-시트룰린의 생산 방법 Download PDF

Info

Publication number
WO2022071638A1
WO2022071638A1 PCT/KR2021/003602 KR2021003602W WO2022071638A1 WO 2022071638 A1 WO2022071638 A1 WO 2022071638A1 KR 2021003602 W KR2021003602 W KR 2021003602W WO 2022071638 A1 WO2022071638 A1 WO 2022071638A1
Authority
WO
WIPO (PCT)
Prior art keywords
citrulline
corynebacterium
strain
corynebacterium glutamicum
medium
Prior art date
Application number
PCT/KR2021/003602
Other languages
English (en)
French (fr)
Inventor
이동석
최민진
김문정
박석현
한재춘
Original Assignee
대상 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대상 주식회사 filed Critical 대상 주식회사
Priority to JP2023514999A priority Critical patent/JP2023540330A/ja
Priority to US18/025,056 priority patent/US20230332192A1/en
Priority to CN202180061834.1A priority patent/CN116171327A/zh
Priority to EP21875913.2A priority patent/EP4223880A1/en
Publication of WO2022071638A1 publication Critical patent/WO2022071638A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/10—Citrulline; Arginine; Ornithine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Definitions

  • the present invention relates to a Corynebacterium glutamicum mutant having improved L-citrulline production ability and a method for producing L-citrulline using the same.
  • L-citrulline is one of the non-essential amino acids, and it is known that citrulline has useful effects such as promoting ammonia metabolism or improving blood flow by dilating blood vessels, lowering blood pressure, neurotransmission, enhancing immunity, and scavenging free radicals.
  • Citrulline is synthesized as an intermediate product during the biosynthesis of arginine. The biosynthesis of arginine in microorganisms is accomplished through eight enzymatic steps from L-glutamate through two different pathways, linear and cyclic.
  • L-arginine is converted from L-glutamate to N-acetylglutamate, N-acetylornithine, ornithine, citrulline, and argininosuccinate. (argininosuccinate) is synthesized.
  • L-citrulline production is generally produced by fermentation using microorganisms such as bacteria or yeast, and wild-type strains obtained in the natural state or mutants modified to improve L-citrulline-producing ability thereof can be used.
  • microorganisms such as bacteria or yeast
  • wild-type strains obtained in the natural state or mutants modified to improve L-citrulline-producing ability thereof can be used.
  • genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are often used for the production of L-amino acids and other useful substances, having excellent L-citrulline production ability.
  • Various recombinant strains or mutants and L-citrulline production methods using the same are being developed. According to Korean Patent Registration Nos.
  • L-citrulline production ability was improved by enhancing or weakening the activity or expression of proteins such as enzymes and transcription factors related to L-citrulline production. Therefore, it can be expected that the production of L-citrulline can also be controlled by regulating the activity or expression of various proteins acting on the L-citrulline production pathway.
  • An object of the present invention is to provide a mutant of Corynebacterium glutamicum having improved L-citrulline production ability.
  • Another object of the present invention is to provide a method for producing L-citrulline using the mutant.
  • the present inventors studied to develop a new mutant with improved L-citrulline production ability using a Corynebacterium glutamicum strain.
  • NCgl2816 encoding a transporter or transport protein acting on the L-citrulline production pathway
  • the present invention was completed by confirming that L-citrulline production increased when the gene was removed.
  • One aspect of the present invention provides a Corynebacterium glutamicum mutant with improved L-citrulline-producing ability, in which the activity of the protein expressed by the NCgl2816 gene is weakened or inactivated.
  • NCgl2816 gene used in the present invention is a putative endogenous among various transport proteins involved in the secondary transporter that overcomes the concentration difference between the outside and inside of the cell and selectively absorbs or excretes nutrients when substances move in the cell membrane. It refers to a gene encoding a putative integral membrane transport protein.
  • the NCgl2816 gene may be derived from a genus strain of Corynebacterium .
  • the Corynebacterium sp. strain is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ( Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium Callunae ( Corynebacterium callunae ), Corynebacterium suranareeae ), Corynebacterium rubricantis ( Corynebacterium lubricantis ), Corynebacterium doosanense ( Corynebacterium doosanense ), Corynebacterium ipish Ens ( Corynebacterium efficiens ), Corynebacterium utereki ( Corynebacterium uterequi ), Coryne
  • the NCgl2816 gene may consist of the nucleotide sequence of SEQ ID NO: 1. Also, according to one embodiment of the present invention, the NCgl2816 gene may be encoded by the amino acid sequence of SEQ ID NO: 2.
  • the protein expressed by the NCgl2816 gene is a transport protein involved in the L-citrulline production pathway, and the effect of this transport protein on the production of L-citrulline has been known or studied. There was no bar. However, the present inventors found that when the NCgl2816 gene encoding the transport protein is deleted, the membrane stability is improved and the release of L-citrulline is increased, as well as the intermediate 6-acetylornithine (6), which is additionally detected in the case of excessive production of L-citrulline. -acetylornithine), it was confirmed that L-citrulline could be produced in high yield and high concentration.
  • weakened activity means that the expression level of the gene as an object is reduced than the original expression level.
  • the weakening of this activity is when the activity of the protein itself is reduced compared to the activity of the protein possessed by the original microorganism through nucleotide substitution, insertion, deletion, or a combination thereof, and inhibition of expression or translation inhibition of the gene encoding it When the overall degree of enzymatic activity in the cell is low compared to the native strain, the wild type strain or the strain before modification, combinations thereof are also included.
  • “Inactivation” as used in the present invention refers to a case in which the expression of a gene encoding a protein such as an enzyme, a transcription factor, a transport protein, etc. is not expressed at all compared to the native strain, the wild type strain, or the strain before modification, or even if it is expressed, its activity This means that there is no
  • the present invention by deleting the NCgl2816 gene of the Corynebacterium glutamicum strain, the wild-type Corynebacterium glutamicum strain or the previously developed Corynebacterium glutamicum mutant to produce an excess of citrulline. Compared to that, a Corynebacterium glutamicum mutant with improved L-citrulline production ability was obtained.
  • the parent strain means a wild-type or mutant strain to be mutated, and includes a target to be directly mutated or transformed with a recombinant vector.
  • the parent strain may be a wild-type Corynebacterium glutamicum strain or a strain mutated from the wild-type.
  • it may be a Corynebacterium glutamicum mutant in which the activities of ornithine carbamoyltransferase and carbamoyl phosphate synthase are enhanced so that citrulline is produced in excess (refer to Korean Patent Application No. 10-2019-0151321) .
  • the Corynebacterium glutamicum mutant with improved L-citrulline production ability shows increased L-citrulline production ability compared to the parent strain, and in particular, L-citrulline concentration is 0.5 compared to the parent strain % or more, specifically, may be increased by 0.5% to 5%, and in this case, 6-acetyl ornithine produced as a by-product may be decreased by 20% or more, specifically, by 20 to 50%.
  • Corynebacterium glutamicum mutant according to an embodiment of the present invention can be implemented through a recombinant vector that deletes the NCgl2816 gene in the parent strain.
  • vector refers to any medium for cloning and/or transfer of a base to a host cell.
  • the vector may be a replicator capable of binding other DNA fragments to bring about replication of the bound fragment.
  • Replication unit refers to any genetic unit (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as a self-unit of DNA replication in vivo, that is, is capable of replicating under its own regulation.
  • the vector is not particularly limited as long as it can replicate in a host, and any vector known in the art may be used.
  • the vector used for the construction of the recombinant vector may be a plasmid, a cosmid, a virus, or a bacteriophage in a natural state or a recombinant state.
  • pWE15, M13, ⁇ EMBL3, ⁇ EMBL4, ⁇ FIXII, ⁇ DASHII, ⁇ ZAPII, ⁇ gt10, ⁇ gt11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors
  • pDZ vectors, pBR systems, and pUC systems may be used as plasmid vectors.
  • pBluescript II-based, pGEM-based, pTZ-based, pCL-based, pET-based and the like may be used, but the present invention is not limited thereto.
  • transformation refers to introducing a gene into a host cell so that it can be expressed in the host cell, and if the transformed gene can be expressed in the host cell, it is inserted into the host cell's chromosome or other than the chromosome. It may be included without limitation whatever is located.
  • the transformation method includes any method of introducing a nucleic acid into a cell, and can be performed by selecting a suitable standard technique as known in the art depending on the host cell.
  • a suitable standard technique as known in the art depending on the host cell.
  • electroporation calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate -DMSO method and the like may be used, but is not limited thereto.
  • an electroporation method (van der Rest et al., Appl. Microbiol. Biotechnol., 52, 541-545, 1999) may be used as a transformation method.
  • the host cells include cells transfected, transformed, or infected with the recombinant vector or polynucleotide of the present invention in vivo or in vitro.
  • a host cell comprising the recombinant vector of the present invention is a recombinant host cell, a recombinant cell or a recombinant microorganism.
  • the recombinant vector according to the present invention may include a selection marker
  • the selection marker is for selecting transformants (host cells) transformed with the vector, in the medium treated with the selection marker. Since only cells expressing the selection marker are viable, selection of transformed cells is possible.
  • Representative examples of the selection marker include, but are not limited to, kanamycin, streptomycin, and chloramphenicol.
  • Genes inserted into the recombinant vector for transformation of the present invention can be substituted into host cells such as microorganisms such as Corynebacterium spp. and Escherichia coli due to homologous recombination crossover.
  • another aspect of the present invention comprises the steps of: a) culturing the Corynebacterium glutamicum mutant in a medium; and b) recovering L-citrulline from the mutant or mutant culture medium.
  • the culture may be made according to an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use.
  • the medium may be a liquid medium, but is not limited thereto.
  • the culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination culture thereof, but is not limited thereto.
  • the medium should meet the requirements of a specific strain in an appropriate manner, and may be appropriately modified by a person skilled in the art.
  • the culture medium for the Corynebacterium sp. strain may refer to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981), but is not limited thereto.
  • the medium may include various carbon sources, nitrogen sources and trace element components.
  • Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto.
  • Nitrogen sources that can be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate.
  • the nitrogen source may also be used individually or as a mixture, but is not limited thereto.
  • Sources of phosphorus that may be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salt.
  • the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate necessary for growth, but is not limited thereto.
  • essential growth substances such as amino acids and vitamins may be included.
  • precursors suitable for the culture medium may be used. The medium or individual components may be added batchwise or continuously by an appropriate method to the culture medium during the culturing process, but is not limited thereto.
  • the pH of the culture medium by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the microorganism culture medium in an appropriate manner during culture.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid
  • an antifoaming agent such as fatty acid polyglycol ester during culture.
  • oxygen or oxygen-containing gas eg, air
  • the temperature of the culture medium may be usually 20 °C to 45 °C, for example, 25 °C to 40 °C.
  • the incubation period may be continued until a useful substance is obtained in a desired amount, for example, it may be 10 to 160 hours.
  • the step of recovering the cultured mutant and L-citrulline from the cultured medium is L-citrulline produced from the medium using a suitable method known in the art according to the culture method.
  • a suitable method known in the art according to the culture method.
  • the culture medium in the step of recovering L-citrulline, may be centrifuged at low speed to remove biomass, and the obtained supernatant may be separated through ion exchange chromatography.
  • the step of recovering L-cittrulline may include a step of purifying L-cittrulline.
  • the Corynebacterium glutamicum mutant according to the present invention can produce L-citrulline in high yield and high concentration by weakening or inactivating the activity of the transport protein expressed by the NCgl2816 gene.
  • a Corynebacterium glutamicum mutant with enhanced activity of ornithine carbamoyltransferase and carbamoyl phosphate synthase to produce excessive citrulline (refer to Korean Patent Application No. 10-2019-0151321, hereinafter referred to as 'CT4' Ham) and wild-type Corynebacterium glutamicum strain (ATCC13032) were inoculated into citrulline seed medium, respectively, and cultured at 30° C. for 10 hours, and then 250 mL of the culture solution was inoculated into a 5L incubator medium. When all the sugars contained in the initial medium were exhausted, an additional medium was added. Cells were collected at 13, 28, 35, and 68 hours of culture after inoculation and used to prepare transcript analysis samples. The composition of the medium used in this experiment is shown in Table 1 below.
  • composition (/L) Citrulline seed medium Glucose 2.67%, YPA 3.14%, KH 2 PO 4 0.1%, K 2 HPO 4 0.1%, MNSO 4 10 ppm, FeSO 4 10 ppm, Biotin 100 ug/L, Thiamin-HCl 200 ug/L 5L incubator medium Glucose 8%, MgSO 4 0.08%, FeSO 4 16 ppm, MnSO 4 8 ppm, CuSO 4 1.6 ppm, ZnSO 4 1.6 ppm, CaCl 2 32 ppm, Biotin 160 ppb, Thiamine-HCl 8 ppm, HVP 0.4%, NaCl 0.08 %, KH 2 PO 4 0.22%, (NH 4 ) 2 SO 4 2.4% additional badges Glucose 52%, MgSO 4 0.1%, CaCl 2 120 ppm, Biotin 160 ppb, Thiamine-HCl 16 ppm, NH 4 H 2 PO 4 0.08%, (NH
  • the RPKM value of permease and transporter exceeds 1000 and rapidly increases in the latter half of fermentation or wild-type 40 candidate genes having a three-fold or higher expression level compared to the strain were first selected.
  • the wild-type Corynebacterium glutamicum strain (ATCC13032) is known to have little citrulline-producing ability.
  • a Corynebacterium glutamicum strain having each of the 40 genes was inoculated into a flask titer medium (see Table 2 below) and cultured at 30° C., 200 rpm, for 30 hours. After completion of the culture, the culture solution was diluted 100 times with distilled water, filtered through a 0.45 um filter, and then high-performance liquid chromatography (HPLC) equipped with a column (DionexIonPac TM CS12A) and a UV detector (195 mm) was used in the culture solution produced in the strain. The concentrations of L-citrulline and the by-product 6-acetylornithine were measured.
  • composition (/L) flask titer medium Glucose 105.3 g (95%), MgSO 4 1 g, YPA 4 g, KH 2 PO 4 0.8 g, Na 2 HPO 4 1.2 g, (NH 4 ) 2 SO 4 30 g, Fe SO 4 20 mg, MnSO 4 20 mg, ZnSO 4 10 mg, Arginine 100 mg, Biotin 100 ug, Thiamine 200 ug
  • the production of L-citrulline was highest and the production of 6-acetylornithine was the lowest, and the NCgl2816 gene was selected as a deletion gene to improve the production of L-citrulline in the strain.
  • a wild-type Corynebacterium glutamicum strain (ATCC13032) was used to prepare a Corynebacterium glutamicum mutant.
  • chromosomal DNA was extracted from the wild-type strain using the Wizard Genomic DNA Purification Kit (Promega, USA), and then PCR was performed with a combination of primers 1 and 2 and primers 3 and 4 using this as a template, respectively.
  • the PCR product thus obtained was again amplified by crossover PCR using a combination of primers 1 and 4, and then inserted into the site of restriction enzymes HindIII and XbaI of the recombinant vector pK19mobSacB. This was named vector pK19ms/ ⁇ NCgl2816.
  • the primers in Table 4 below were used to construct the vector.
  • primer sequence (5' ⁇ 3') SEQ ID NO: Primer 1 tgatttacgccaagctccttatccg 3 Primer 2 ggaggggtttacttagattggtgacctcttctctgaaac 4 Primer 3 gtttcagagaagaggtcaccaatctaagtaaacccctcc 5 Primer 4 ccggggatcctctagcgac 6
  • PCR was performed under the following conditions using the above primers.
  • a Thermocycler TP600, TAKARA BIO Inc., Japan
  • each deoxynucleotide triphosphate dATP, dCTP, dGTP, dTTP
  • oligonucleotide 1 pM Corynebacterium glutamicum ( C. glutamicum )
  • 10 ng of chromosomal DNA of ATCC13032 as a template, 25 to 30 cycles were performed in the presence of 1 unit of PrimeSTAR Max DNA Polymerase (Takara, Japan).
  • PCR performance conditions were (i) denaturation step: 94°C for 30 seconds, (ii) annealing step: 58°C for 30 seconds, and (iii) extension step: 1-2 at 72°C It was carried out under the conditions of minutes (providing a polymerization time of 2 minutes per 1 kb).
  • the gene fragment thus prepared was cloned into the pK19mobSacB vector using self-assembly cloning.
  • the vector was transformed into E. coli DH5a, spread on an LB-agar plate containing 50 ⁇ g/ml kanamycin, and cultured at 37° C. for 24 hours. After confirming that the finally formed colony is accurately present in the vector by isolating the colony, this vector was isolated and used for recombination of the Corynebacterium glutamicum strain.
  • the amplification of the corresponding genes is amplified from Corynebacterium glutamicum ATCC13032 genomic DNA by PCR, and then inserted into the pK19mobSacB vector by self-assembled cloning according to the strategy and selected from E. coli DH5a. did.
  • a DNA ligation kit (Takara, Japan) and restriction enzymes HindIII, XbaI (NEB, UK) were used according to the supplied buffer and protocol.
  • a Corynebacterium glutamicum mutant was prepared by introducing the pK19ms/ ⁇ NCgl2816 vector prepared in 2-1 above into the mutant CT4 as the parent strain.
  • the parent strain was first cultured in 100 ml of RG medium (containing Beef extract 10 g/L, BHI 40 g/L and sorbitol 30 g/L), and 2.5 g/L glycine, 400 mg/L in the same medium A medium was prepared in which L isoniazid and 0.1 ml/L Tween80 were added. Then, the seed culture solution was inoculated so that the OD 610 value was 0.3, and then cultured at 30° C. and 180 rpm for 3 to 5 hours so that the OD 610 value was 1.6 to 1.8. After standing on ice for 30 minutes, centrifugation was performed at 4°C and 3500 rpm for 15 minutes.
  • RG medium containing Beef extract 10 g/L, BHI 40 g/L and sorbitol 30 g/L
  • a medium was prepared in which L isoniazid and 0.1 ml/L Tween80 were added. Then, the seed culture solution was inoculated so that
  • a regeneration medium (containing 18.5 g/l of Brain Heart infusion and 0.5 M of sorbitol) was added and heat-treated at 46° C. for 6 minutes. After cooling at room temperature, transfer to a 15 ml cap tube, incubate at 30° C. for 2 hours, and a solid medium containing 30 ⁇ g/ml of kanamycine (Brainheart infusion 40 g/L, D-sorbitol 30 g/L, Beef 10 g/L of extract and 20 g/L of Agar) were smeared. Colonies were obtained by culturing at 30° C. for 2 days.
  • colonies induced by the primary homologous recombination using primers 1 and 4 in Table 4, colonies confirmed for amplification by PCR under the same conditions as in 2-1 above were selected as the primary recombinant strain, and 2YT liquid medium (Tryptone 16 g/ After 12 hours of incubation in L, yeast extract 10 g/L and NaCl 5 g/L), 2YT-10% sucrose solid medium (Tryptone 16 g/L, yeast extract 10 g/L, NaCl 5 g/L and sucrose 100) g/L) to induce secondary homologous recombination to remove antibiotic markers.
  • 2YT liquid medium Teryptone 16 g/ After 12 hours of incubation in L, yeast extract 10 g/L and NaCl 5 g/L
  • 2YT-10% sucrose solid medium to induce secondary homologous recombination to remove antibiotic markers.
  • Colonies cultured in 2YT-10% sucrose solid medium were added to 2YT-Km medium (Tryptone 16 g/L, Yeast extract 10 g/L, NaCl 5 g/L and kanamycin 30 ⁇ g/ml containing) and 2YT-10% sucrose. By patching, there was no resistance to kanamycin, and finally, strains capable of growth in 10% sucrose medium were selected. Then, PCR was performed under the same conditions as in 2-1 using primers 1 and 4 of Table 4 to confirm that the NCgl2816 gene was removed, and the strain in which the NCgl2816 gene was deleted was named CT5.
  • Each strain was inoculated into a citrulline seed medium and cultured at 30° C. for 10 hours, and then 250 mL of the culture solution was inoculated into a 5L incubator medium. When all the sugars contained in the initial medium were exhausted, an additional medium was added.
  • the composition of the medium used in this experiment is shown in Table 1 above.
  • the culture solution was diluted 100 times with distilled water, filtered through a 0.45 um filter, and then high-performance liquid chromatography (HPLC) equipped with a column (DionexIonPac TM CS12A) and a UV detector (195 mm) was used in the culture solution produced in the strain. The concentrations of L-citrulline and the by-product 6-acetylornithine were measured, and the results are shown in Table 5 below.
  • the Corynebacterium glutamicum mutant CT5 in which the NCgl2816 gene is deleted increased the productivity of L-citrulline by about 2% compared to the previously developed mutant CT4, whereas the by-product, 6-acetyl ornithine, It was confirmed that production decreased by about 44%.

Abstract

본 발명은 L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 L-시트룰린의 생산 방법에 관한 것으로, 상기 코리네박테리움 글루타미쿰 변이주는 NCgl2816 유전자에 의해 발현되는 수송 단백질의 활성이 약화 또는 불활성화됨으로써 L-시트룰린을 고수율 및 고농도로 생산할 수 있다.

Description

L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 L-시트룰린의 생산 방법
본 발명은 L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 L-시트룰린의 생산 방법에 관한 것이다.
L-시트룰린(citrulline)은 비필수 아미노산 중의 하나로, 시트룰린에는 암모니아 대사 촉진이나 혈관 확장에 의한 혈류 개선, 혈압 저하, 신경 전달, 면역력 증진, 활성 산소 소거 등의 유용한 작용이 있다는 점이 알려져 있다. 이러한 시트룰린은 아르기닌의 생합성 과정에서 중간 생산물로 합성된다. 미생물에서 아르기닌의 생합성은 선형 단계와 고리형 단계의 서로 다른 두 경로를 통해, L-글루타메이트(L-glutamate)로부터 8번의 효소 단계를 거쳐서 이루어진다. 선형 단계에서, L-아르기닌은 L-글루타메이트에서 N-아세틸글루타메이트(N-acetylglutamate), N-아세틸오르니틴(N-acetylornithine), 오르니틴(ornithine), 시트룰린(citrulline), 그리고 아르기니노숙시네이트(argininosuccinate)를 거쳐서 합성된다.
L-시트룰린 생산은 일반적으로 세균이나 효모와 같은 미생물을 이용한 발효에 의해 생산되며, 자연상태에서 수득된 야생형 균주나 이의 L-시트룰린 생산능이 향상되도록 변형된 변이주를 이용할 수 있다. 최근에는 L-시트룰린의 생산 효율을 개선시키기 위하여 L-아미노산 및 기타 유용물질 생산에 많이 이용되는 대장균, 코리네박테리움 등의 미생물을 대상으로 유전자 재조합 기술을 적용하여 우수한 L-시트룰린 생산능을 갖는 다양한 재조합 균주 또는 변이주 및 이를 이용한 L-시트룰린 생산 방법이 개발되고 있다. 한국등록특허 제10-1102263호 및 제10-1053429호에 따르면, L-시트룰린 생산에 관련된 효소, 전사 인자 등 단백질의 활성 또는 발현을 강화하거나 약화함으로써 L-시트룰린 생산능이 향상됨을 확인하였다. 따라서 L-시트룰린의 생산 경로에 작용하는 다양한 단백질의 활성 또는 발현 조절을 통해 L-시트룰린의 생산량 또한 조절할 수 있을 것으로 기대할 수 있다.
[선행기술문헌]
[특허문헌]
한국등록특허 제10-1102263호
한국등록특허 제10-1053429호
본 발명은 L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰( Corynebacterium glutamicum) 변이주를 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 변이주를 이용한 L-시트룰린의 생산 방법을 제공하는 것을 목적으로 한다.
본 발명자들은 코리네박테리움 글루타미쿰 균주를 이용하여 L-시트룰린 생산능이 향상된 새로운 변이주를 개발하기 위해 연구한 결과, L-시트룰린 생산 경로에 작용하는 수송 단백질(transporter 또는 transport protein)을 암호화하는 NCgl2816 유전자를 제거할 경우 L-시트룰린 생산량이 증가하는 것을 확인함으로써 본 발명을 완성하였다.
본 발명의 일 양상은 NCgl2816 유전자에 의해 발현되는 단백질의 활성이 약화 또는 불활성화된, L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주를 제공한다.
본 발명에서 사용된 “NCgl2816 유전자”는 세포막에서 물질이 이동할 때 세포의 밖과 안의 농도 차이를 이기고 영양을 선택적으로 흡수하거나 배출하는 능동수송(secondary transporter)에 관여하는 다양한 수송 단백질들 중 추정 내재성 막 수송 단백질(putative integral membrane transport protein)을 암호화하는 유전자를 의미한다.
본 발명의 일 구체예에 따르면, 상기 NCgl2816 유전자는 코리네박테리움( Corynebacterium) 속 균주에서 유래된 것일 수 있다. 구체적으로, 상기 코리네박테리움속 균주는 코리네박테리움 글루타미쿰( Corynebacterium glutamicum), 코리네박테리움 크루디락티스( Corynebacterium crudilactis), 코리네박테리움 데저티( Corynebacterium deserti), 코리네박테리움 칼루나에( Corynebacterium callunae), 코리네박테리움 수라나래에( Corynebacterium suranareeae), 코리네박테리움 루브리칸티스( Corynebacterium lubricantis), 코리네박테리움 두사넨세( Corynebacterium doosanense), 코리네박테리움 이피시엔스( Corynebacterium efficiens), 코리네박테리움 우테레키( Corynebacterium uterequi), 코리네박테리움 스테셔니스( Corynebacterium stationis), 코리네박테리움 파캔세( Corynebacterium pacaense), 코리네박테리움 싱굴라레( Corynebacterium singulare), 코리네박테리움 휴미레듀센스( Corynebacterium humireducens), 코리네박테리움 마리눔( Corynebacterium marinum), 코리네박테리움 할로톨레란스( Corynebacterium halotolerans), 코리네박테리움 스페니스코룸( Corynebacterium spheniscorum), 코리네박테리움 프레이부르겐세( Corynebacterium freiburgense), 코리네박테리움 스트리아툼( Corynebacterium striatum), 코리네박테리움 카니스( Corynebacterium canis), 코리네박테리움 암모니아게네스( Corynebacterium ammoniagenes), 코리네박테리움 레날레( Corynebacterium renale), 코리네박테리움 폴루티솔리( Corynebacterium pollutisoli), 코리네박테리움 이미탄스( Corynebacterium imitans), 코리네박테리움 카스피움( Corynebacterium caspium), 코리네박테리움 테스투디노리스( Corynebacterium testudinoris), 코리네박테리움 슈도펠라지( Corynebacaterium pseudopelargi) 또는 코리네박테리움 플라베스센스( Corynebacterium flavescens)일 수 있으며, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 상기 NCgl2816 유전자는 서열번호 1의 염기서열로 이루어진 것일 수 있다. 또한, 본 발명의 일 구체예에 따르면, 상기 NCgl2816 유전자는 서열번호 2의 아미노산 서열로 암호화된 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 NCgl2816 유전자에 의해 발현되는 단백질은 L-시트룰린 생산 경로에 관여하는 수송 단백질인 것으로, 이러한 수송 단백질이 L-시트룰린의 생산에 미치는 영향에 관해서는 알려지거나 연구된 바가 없었다. 그러나, 본 발명자들은 수송 단백질을 암호화하는 NCgl2816 유전자를 결실시킬 경우 막 안정성이 향상되고 L-시트룰린의 배출이 증가할 뿐만 아니라 L-시트룰린 과량 생산 시 부가적으로 검출되는 중간체 6-아세틸오르니틴(6-acetylornithine)의 배출을 억제하여 L-시트룰린을 고수율 및 고농도로 생산할 수 있음을 확인하였다.
본 발명에서 사용된 “활성이 약화”는 객체인 유전자의 발현량이 본래의 발현량보다 감소되는 것을 의미한다. 이러한 활성의 약화는 유전자를 암호화하는 뉴클레오티드 치환, 삽입, 결실 또는 이들의 조합을 통하여 단백질 자체의 활성이 본래 미생물이 가지고 있는 단백질의 활성에 비해 감소한 경우와, 이를 암호화하는 유전자의 발현 저해 또는 번역 저해 등으로 세포 내에서 전체적인 효소 활성 정도가 천연형 균주, 야생형 균주 또는 변형 전의 균주에 비하여 낮은 경우, 이들의 조합 역시 포함한다.
본 발명에서 사용된 "불활성화"는 효소, 전사 인자, 수송 단백질 등 단백질을 암호화하는 유전자의 발현이 천연형 균주, 야생형 균주 또는 변형 전의 균주에 비하여 전혀 발현이 되지 않는 경우이거나 발현이 되더라도 그 활성이 없는 경우를 의미한다.
본 발명의 일 실시예에 따르면, 코리네박테리움 글루타미쿰 균주의 NCgl2816 유전자를 결실시켜 야생형 코리네박테리움 글루타미쿰 균주 또는 시트룰린이 과량 생산되도록 기 개발된 코리네박테리움 글루타미쿰 변이주에 비해 L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주를 획득하였다.
본 발명에서 사용된 “생산능이 향상된”은 모균주에 비해 L-시트룰린의 생산성이 증가된 것을 의미한다. 상기 모균주는 변이의 대상이 되는 야생형 또는 변이주를 의미하며, 직접 변이의 대상이 되거나 재조합된 벡터 등으로 형질전환되는 대상을 포함한다. 본 발명에 있어서, 모균주는 야생형 코리네박테리움 글루타미쿰 균주 또는 야생형으로부터 변이된 균주일 수 있다. 예를 들면, 시트룰린이 과량 생산되도록 오르니틴 카바모일트랜스퍼라제 및 카바모일 인산 합성효소의 활성이 강화된 코리네박테리움 글루타미쿰 변이주 (한국특허출원 제10-2019-0151321호 참조)일 수 있다.
본 발명의 일 실시예에 따르면, 상기 L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주는 모균주에 비해 증가된 L-시트룰린 생산능을 나타내며, 특히 모균주에 비해 L-시트룰린 농도가 0.5% 이상, 구체적으로는 0.5% 내지 5% 증가된 것일 수 있으며, 이때 부산물로 생산되는 6-아세틸 오르니틴이 20% 이상, 구체적으로는 20 내지 50% 감소된 것일 수 있다.
본 발명의 일 구체예에 따른 코리네박테리움 글루타미쿰 변이주는 모균주에서 NCgl2816 유전자를 결실하는 재조합 벡터를 통해 구현될 수 있다.
본 발명에서 사용된 “벡터”는 숙주세포로 염기의 클로닝 및/또는 전이를 위한 임의의 매개물을 말한다. 벡터는 다른 DNA 단편이 결합하여 결합된 단편의 복제를 가져올 수 있는 복제단위(replicon)일 수 있다. "복제단위"란 생체 내에서 DNA 복제의 자가 유닛으로서 기능하는, 즉, 스스로의 조절에 의해 복제 가능한, 임의의 유전적 단위 (예를 들면, 플라스미드, 파지, 코스미드, 염색체, 바이러스)를 말한다. 본 발명에 있어서 벡터는 숙주 중에서 복제 가능한 것이면 특별히 한정되지 않으며 당업계에 알려진 임의의 벡터를 이용할 수 있다. 상기 재조합 벡터의 제작에 사용된 벡터는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지일 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, λEMBL3, λEMBL4, λFIXII, λDASHII, λZAPII, λgt10, λgt11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ 벡터, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에서 사용된 "형질전환"은 유전자를 숙주세포 내에 도입하여 숙주세포 내에서 발현시킬 수 있도록 하는 것이며, 형질전환된 유전자는 숙주세포 내에서 발현될 수 있으면 숙주세포의 염색체 내 삽입 또는 염색체 외에 위치하고 있는 것이든 제한하지 않고 포함될 수 있다.
본 발명의 일 구체예에 따르면, 형질전환시키는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법(electroporation), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌글리콜(PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 사용될 수 있으나, 이에 한정되지 않는다.
본 발명의 일 실시예에 따르면, 형질전환 방법으로 전기 천공 방법 (van der Rest et al., Appl. Microbiol. Biotechnol., 52, 541-545, 1999)을 사용할 수 있다.
상기 숙주세포는 생체내 또는 시험관내에서 본 발명의 재조합 벡터 또는 폴리뉴클레오티드로 형질감염, 형질전환, 또는 감염된 세포를 포함한다. 본 발명의 재조합 벡터를 포함하는 숙주 세포는 재조합 숙주 세포, 재조합 세포 또는 재조합 미생물이다.
또한, 본 발명에 의한 재조합 벡터는 선택 마커(selection marker)를 포함할 수 있는데, 상기 선택 마커는 벡터로 형질전환된 형질전환체 (숙주세포)를 선별하기 위한 것으로서 상기 선택 마커가 처리된 배지에서 선택 마커를 발현하는 세포만 생존할 수 있기 때문에, 형질전환 된 세포의 선별이 가능하다. 상기 선택 마커는 대표적인 예로 카나마이신, 스트렙토마이신, 클로람페니콜 등이 있으나, 이에 한정되는 것은 아니다.
본 발명의 형질전환용 재조합 벡터 내에 삽입된 유전자들은 상동성 재조합 교차로 인하여 코리네박테리움 속 균주, 대장균 등의 미생물과 같은 숙주세포 내로 치환될 수 있다.
또한, 본 발명의 다른 일 양상은 a) 상기 코리네박테리움 글루타미쿰 변이주를 배지에서 배양하는 단계; 및 b) 상기 변이주 또는 변이주가 배양된 배지로부터 L-시트룰린을 회수하는 단계를 포함하는 L-시트룰린의 생산 방법을 제공한다.
상기 배양은 당업계에 알려진 적절한 배지와 배양 조건에 따라 이루어질 수 있으며, 통상의 기술자라면 배지 및 배양 조건을 용이하게 조정하여 사용할 수 있다. 구체적으로, 상기 배지는 액체 배지일 수 있으나, 이에 한정되는 것은 아니다. 배양 방법은 예를 들면, 회분식 배양(batch culture), 연속식 배양(continuous culture), 유가식 배양(fed-batch culture) 또는 이들의 조합 배양을 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 상기 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 하며, 통상의 기술자에 의해 적절하게 변형될 수 있다. 코리네박테리움 속 균주에 대한 배양 배지는 공지된 문헌 (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981)을 참조할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 배지에 다양한 탄소원, 질소원 및 미량원소 성분을 포함할 수 있다. 사용될 수 있는 탄소원으로는 글루코스, 수크로스, 락토스, 프락토스, 말토스, 전분, 셀룰로스와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있으나, 이에 한정되는 것은 아니다. 사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산 암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함될 수 있다. 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있으나 이에 한정되는 것은 아니다. 사용될 수 있는 인의 공급원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함될 수 있으며, 이에 한정되는 것은 아니다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있으며, 이에 한정되는 것은 아니다. 그 외에, 아미노산 및 비타민과 같은 필수 성장 물질이 포함될 수 있다. 또한 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기 배지 또는 개별 성분은 배양과정에서 배양액에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 미생물 배양액에 적절한 방식으로 첨가하여 배양액의 pH를 조정할 수 있다. 또한, 배양 중에 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 추가적으로, 배양액의 호기 상태를 유지하기 위하여, 배양액 내로 산소 또는 산소-함유 기체 (예, 공기)를 주입할 수 있다. 배양액의 온도는 통상 20℃ 내지 45℃, 예를 들면 25℃ 내지 40℃일 수 있다. 배양기간은 유용물질이 원하는 생산량으로 수득될 때까지 계속될 수 있으며, 예를 들면 10 내지 160 시간일 수 있다.
본 발명의 일 구체예에 따르면, 상기 배양된 변이주 및 변이주가 배양된 배지에서 L-시트룰린을 회수하는 단계는 배양 방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배지로부터 생산된 L-시트룰린을 수집 또는 회수할 수 있다. 예를 들면 원심분리, 여과, 추출, 분무, 건조, 증발, 침전, 결정화, 전기영동, 분별용해 (예를 들면, 암모늄 설페이트 침전), 크로마토그래피 (예를 들면, 이온 교환, 친화성, 소수성 및 크기배제) 등의 방법을 사용할 수 있으나, 이에 한정되는 것은 않는다.
본 발명의 일 구체예에 따르면, L-시트룰린을 회수하는 단계는 배양 배지를 저속 원심분리하여 바이오매스를 제거하고 얻어진 상등액을 이온교환 크로마토그래피를 통하여 분리할 수 있다.
본 발명의 일 구체예에 따르면, 상기 L-시틀룰린을 회수하는 단계는 L-시트룰린을 정제하는 공정을 포함할 수 있다.
본 발명에 따른 코리네박테리움 글루타미쿰 변이주는 NCgl2816 유전자에 의해 발현되는 수송 단백질의 활성이 약화 또는 불활성화됨으로써 L-시트룰린을 고수율 및 고농도로 생산할 수 있다.
이하, 본 발명을 보다 상세하게 설명한다. 그러나, 이러한 설명은 본 발명의 이해를 돕기 위하여 예시적으로 제시된 것일 뿐, 본 발명의 범위가 이러한 예시적인 설명에 의하여 제한되는 것은 아니다.
실시예 1. 시트룰린 생산 균주의 전사체량 변화 분석
1-1. 균체 채집
시트룰린 생산 균주의 전사체량 변화를 분석하기 위하여, 균주 성장단계의 변화 시점에서 균체 채집을 수행하였다.
먼저, 시트룰린이 과량 생산되도록 오르니틴 카바모일트랜스퍼라제 및 카바모일 인산 합성효소의 활성이 강화된 코리네박테리움 글루타미쿰 변이주 (한국특허출원 제10-2019-0151321호 참조, 이하 'CT4'라 함)와 야생형 코리네박테리움 글루타미쿰 균주 (ATCC13032)를 각각 시트룰린 종배지에 접종하여 30℃에서 10시간 배양 후 배양액 250 mL을 5L 배양기 배지에 접종하였다. 초기 배지에 포함된 당이 모두 소진되면, 추가 배지를 투입하였다. 접종 후 배양 13, 28, 35, 68시간 시점에서 균체를 채집하여 전사체 분석 샘플의 제조에 사용하였다. 본 실험에서 사용된 배지의 조성은 하기 표 1과 같다.
조성 (/L)
시트룰린종배지 포도당 2.67%, YPA 3.14%, KH 2PO 4 0.1%, K 2HPO 4 0.1%, MNSO 4 10 ppm, FeSO 4 10 ppm, Biotin 100 ug/L, Thiamin-HCl 200 ug/L
5L 배양기배지 포도당 8%, MgSO 4 0.08%, FeSO 4 16 ppm, MnSO 4 8 ppm, CuSO 4 1.6 ppm, ZnSO 4 1.6 ppm, CaCl 2 32 ppm, Biotin 160 ppb, Thiamine-HCl 8 ppm, HVP 0.4%, NaCl 0.08%, KH 2PO 4 0.22%, (NH 4) 2SO 4 2.4%
추가 배지 포도당 52%, MgSO 4 0.1%, CaCl 2 120 ppm, Biotin 160 ppb, Thiamine-HCl 16 ppm, NH 4H 2PO 4 0.08%, (NH 4) 2SO 4 4.4%
1-2. 전사체 분석 샘플 제조
상기 1-1에서 균체 채집 후 배양 종료액을 동일한 농도로 집적하여 Rneasy Mini Kit (QIAGEN, 독일)을 이용하여 사용 매뉴얼에 따라 RNA를 추출하였다. 추출된 RNA는 액체질소에 보관한 상태로 ㈜마크로젠에 전달하여 전체 유전자 전사체 분석을 의뢰하였다.
1-3. 유효 유전자 후보 선별
상기 1-2에서 분석된 코리네박테리움 글루타미쿰의 전체 유전자 전사체 분석 결과를 바탕으로, 투과효소(permease) 및 수송단백질(transpoter) 중 RPKM 값이 1000을 넘고 발효 후반에 급격히 증가하거나 야생형 균주 대비 3배 이상 발현량이 높은 후보 유전자를 40개를 1차 선별하였다. 참고로, 야생형 코리네박테리움 글루타미쿰 균주 (ATCC13032)는 시트룰린 생산능이 거의 없는 것으로 알려져 있다.
40개의 유전자를 각각 결손한 코리네박테리움 글루타미쿰 균주를 플라스크 역가배지 (하기 표 2 참조)에 접종하여 30℃, 200 rpm, 30시간 동안 배양하였다. 배양 종료 후 배양액을 증류수로 100배 희석하고 0.45 um 필터로 여과한 다음 컬럼 (DionexIonPac TM CS12A)과 자외선 검출기 (195 mm)가 장착된 고성능 액체크로마토그래피(HPLC)를 이용하여 균주에서 생산된 배양액 내 L-시트룰린과 부산물인 6-아세틸오르니틴(6-acetylornithine)의 농도를 측정하였다. 후보 유전자 40개 중에서 6-아세틸오르니틴의 농도가 낮은 5개의 후보군을 2차 선별하였고, 야생형 균주 및 선별된 5개의 후보군의 L-시트룰린 및 6-아세틸오르니틴(6-acetylornithine)의 농도를 하기 표 3에 나타내었다.
조성 (/L)
플라스크역가배지 Glucose 105.3 g (95%), MgSO 4 1 g, YPA 4 g, KH 2PO 4 0.8 g, Na 2HPO 4 1.2 g, (NH 4) 2SO 4 30 g, Fe SO 4 20 mg, MnSO 4 20 mg, ZnSO 4 10 mg, Arginine 100 mg, Biotin 100 ug, Thiamine 200 ug
균주 L-시트룰린(%) 6-아세틸 오르니틴 (%)
CT4 균주 2.10 0.36
NCgl2816 결손 균주 2.12 0.10
NCgl205 결손 균주 1.98 0.32
NCgl0397 결손 균주 0.80 0.08
NCgl0258 결손 균주 2.11 0.36
NCgl1095 결손 균주 2.00 0.35
그 결과, NCgl2816 유전자를 결손한 균주에서 L-시트룰린의 생산량이 가장 높으면서 6-아세틸오르니틴의 생산량이 가장 낮은 것으로 나타나, 균주의 L-시트룰린 생산량을 향상시키기 위한 결실 유전자로서 NCgl2816 유전자를 선택하였다.
실시예 2. NCgl2816 유전자가 결실된 변이주의 제조
2-1. 벡터 제작
코리네박테리움 글루타미쿰 변이주를 제조하기 위해 야생형 코리네박테리움 글루타미쿰 균주 (ATCC13032)를 사용하였다.
먼저, Wizard Genomic DNA Purification Kit (Promega, 미국)을 이용하여 야생형 균주로부터 염색체 DNA를 추출한 후 이를 주형으로 하여 프라이머 1 및 2와 프라이머 3 및 4의 조합으로 각각 PCR을 수행하였다. 이를 통해 얻은 PCR 산물을 다시 프라이머 1 및 4의 조합을 이용하여 크로스오버(crossover) PCR로 증폭한 후 재조합 벡터 pK19mobSacB의 제한효소 HindIII, XbaI 위치에 삽입하였다. 이를 벡터 pK19ms/△NCgl2816로 명명하였다. 상기 벡터를 제작하는데 하기 표 4의 프라이머를 사용하였다.
프라이머 서열 (5'→3') 서열번호
프라이머 1 tgatttacgccaagctccttatccg 3
프라이머 2 ggaggggttttacttagattggtgacctcttctctgaaac 4
프라이머 3 gtttcagagaagaggtcaccaatctaagtaaaacccctcc 5
프라이머 4 ccggggatcctctagcgac 6
이상의 프라이머를 이용하여 아래의 조건 하에 PCR을 수행하였다. Thermocycler (TP600, TAKARA BIO Inc., 일본)를 이용하여 각각의 데옥시뉴클레오타이드 트리포스페이트 (dATP, dCTP, dGTP, dTTP) 100 μM가 첨가된 반응액에 올리고뉴클레오타이드 1 pM, 코리네박테리움 글루타미쿰( C. glutamicum) ATCC13032의 염색체 DNA 10 ng을 주형(template)으로 이용하여, PrimeSTAR Max DNA Polymerase (Takara, 일본) 1 유닛의 존재 하에서 25 ~ 30 주기(cycle)를 수행하였다. PCR 수행 조건은 (i) 변성(denaturation) 단계: 94℃에서 30초, (ii) 결합(annealing) 단계: 58℃에서 30초, 및 (iii) 확장(extension) 단계: 72℃에서 1 ~ 2분 (1 kb 당 2분의 중합시간 부여)의 조건에서 실시하였다.
이와 같이 제조된 유전자 단편을 self-assembly cloning을 이용하여, pK19mobSacB 벡터에 클로닝하였다. 상기 벡터를 대장균( E. coli) DH5a에 형질전환시키고, 50 ㎍/㎖의 카나마이신(kanamycin)을 함유하는 LB-한천 플레이트 상에 도말하여, 37℃에서 24시간 배양하였다. 최종 형성되는 콜로니를 분리하여 삽입물(insert)이 정확히 벡터에 존재하는지 확인한 후, 이 벡터를 분리하여 코리네박테리움 글루타미쿰 균주의 재조합에 사용하였다.
상기 방법에서 공통적으로 진행된 과정으로서, 해당 유전자들의 증폭은 코리네박테리움 글루타미쿰 ATCC13032 genomic DNA로부터 PCR 방법으로 증폭하여 전략에 따라 self-assembled cloning 방법으로 pK19mobSacB 벡터에 삽입하여 E. coli DH5a에서 선별하였다. 이때 증폭된 유전자를 pK19mobSacB 벡터에 삽입하기 위해 DNA ligation kit (Takara, 일본) 및 제한효소 HindIII, XbaI (NEB, 영국)를 공급된 버퍼 및 프로토콜에 따라 사용하였다.
2-2. 변이주의 제조
모균주로서 변이주 CT4에 상기 2-1에서 제작된 pK19ms/ΔNCgl2816 벡터를 도입하여 코리네박테리움 글루타미쿰 변이주를 제조하였다.
구체적으로, RG 배지 (Beef extract 10 g/L, BHI 40 g/L 및 소비톨 30 g/L 함유) 100 ㎖에서 모균주를 1차 배양하고, 동일 배지에 2.5 g/L glycine, 400 mg/L isoniazid 및 0.1 ㎖/L Tween80을 첨가한 배지를 제조하였다. 그 다음, OD 610 값이 0.3이 되도록 종배양액을 접종한 후, 30℃, 180 rpm으로 3 내지 5시간 배양하여 OD 610 값이 1.6 내지 1.8가 되도록 하였다. 얼음에서 30분간 방치한 후, 4℃, 3500 rpm으로 15분간 원심분리하였다. 그 후 상등액을 버리고 침전된 모균주를 10% 글리세롤 용액으로 4회 세척하고, 최종적으로 10% 글리세롤 용액 0.5 ㎖에 재현탁하였다. 전기충격요법(Electroporation)은 바이오-라드(Bio-Rad) 일렉트로포레이터(electroporator)를 사용하여 수행하였다. 일렉트로포레이션 큐벳 (0.2 mm)에 상기 방법으로 제조한 컴피턴트 셀(competent cell)을 넣고 pK19ms/ΔNCgl2816 벡터를 첨가한 후 2.5 kV, 200 Ω 및 12.5 ㎌의 조건으로 전기충격을 가하였다. 전기충격이 끝난 즉시 재생(Regeneration) 배지 (Brain Heart infusion 18.5 g/l 및 소비톨 0.5 M 함유) 1 ㎖을 첨가하고 46℃에서 6분간 열처리하였다. 그 후 실온에서 식힌 뒤 15㎖ 캡 튜브로 옮겨 30℃에서 2시간 배양하고 카나마이신(kanamycine) 30 ㎍/㎖이 포함된 고체배지 (Brainheart infusion 40 g/L, D-소비톨 30 g/L, Beef extract 10 g/L 및 Agar 20 g/L 함유)에 도말하였다. 30℃에서 2일간 배양하여 콜로니를 얻었다. 1차 상동재조합이 유도된 콜로니 중 상기 표 4의 프라이머 1 및 4를 사용하여 상기 2-1과 동일한 조건으로 PCR로 증폭이 확인된 콜로니를 1차 재조합주로 선별하고 2YT 액체배지 (Tryptone 16 g/L, Yeast extract 10 g/L 및 NaCl 5 g/L 함유)에서 12시간 배양 후 2YT-10% sucrose 고체배지 (Tryptone 16 g/L, Yeast extract 10 g/L, NaCl 5 g/L 및 sucrose 100 g/L 함유)에 도말하여 2차 상동재조합을 유도하여 항생제 마커를 제거하였다. 2YT-10% sucrose 고체배지에서 배양된 콜로니를 2YT-Km 배지 (Tryptone 16 g/L, Yeast extract 10 g/L, NaCl 5 g/L 및 카나마이신 30 ㎍/㎖ 함유)와 2YT-10% sucrose에 패칭(patching)하여 카나마이신에 저항성이 없으며, 10% sucrose 배지에서 생육이 가능한 균주를 최종적으로 선별하였다. 그리고 상기 표 4의 프라이머 1 및 4를 사용하여 상기 2-1과 동일한 조건으로 PCR을 수행하여 NCgl2816 유전자가 제거되었는지 최종 확인하였고, NCgl2816 유전자가 결실된 균주를 CT5로 명명하였다.
실시예 3. NCgl2816 유전자가 결실된 변이주의 L-시트룰린 생산성 확인
모균주로 사용된 시트룰린을 과량 생산하는 코리네박테리움 글루타미쿰 변이주 (CT4) 및 실시예 2에서 제조된 NCgl2816 유전자가 결실된 균주 (CT5)의 L-시트룰린 생산성을 비교하였다.
각 균주를 시트룰린 종배지에 접종하여 30℃에서 10시간 배양 후 배양액 250 mL을 5L 배양기 배지에 접종하였다. 초기 배지에 포함된 당이 모두 소진되면, 추가 배지를 투입하였다. 본 실험에서 사용된 배지의 조성은 상기 표 1과 같다. 배양 종료 후 배양액을 증류수로 100배 희석하고 0.45 um 필터로 여과한 다음 컬럼 (DionexIonPac TM CS12A)과 자외선 검출기 (195 mm)가 장착된 고성능 액체크로마토그래피(HPLC)를 이용하여 균주에서 생산된 배양액 내 L-시트룰린과 부산물인 6-아세틸오르니틴(6-acetylornithine)의 농도를 측정하였고, 그 결과를 하기 표 5에 나타내었다.
균주 L-시트룰린(%) 6-아세틸 오르니틴 (%)
CT4 8.56 1.6
CT5 8.73 0.7
상기 표 5에 나타낸 바와 같이, NCgl2816 유전자가 결실된 코리네박테리움 글루타미쿰 변이주 CT5는 기 개발된 변이주 CT4에 비해 L-시트룰린의 생산성이 약 2% 증가한 반면, 부산물인 6-아세틸 오르니틴의 생산이 약 44% 감소한 것으로 확인되었다. 이러한 결과를 통해, NCgl2816 유전자에 의해 발현되는 단백질의 활성이 약화 또는 불활성화됨으로써 균주의 L-시트룰린 생산능이 향상될 뿐만 아니라 부산물의 생성이 감소하여 L-시트룰린을 고순도로 생산할 수 있다는 것을 알 수 있었다.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.

Claims (4)

  1. NCgl2816 유전자에 의해 발현되는 단백질의 활성이 약화 또는 불활성화된, L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰( Corynebacterium glutamicum) 변이주.
  2. 청구항 1에 있어서,
    상기 NCgl2816 유전자는 서열번호 1의 염기서열로 이루어진 것인 코리네박테리움 글루타미쿰 변이주.
  3. 청구항 1에 있어서,
    상기 변이주는 NCgl2816 유전자의 전부 또는 일부가 삽입, 치환 또는 결실된 것인 코리네박테리움 글루타미쿰 변이주.
  4. a) 청구항 1의 변이주를 배지에서 배양하는 단계; 및
    b) 상기 변이주 또는 변이주가 배양된 배지로부터 L-시트룰린을 회수하는 단계를 포함하는 L-시트룰린의 생산 방법.
PCT/KR2021/003602 2020-09-29 2021-03-23 L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-시트룰린의 생산 방법 WO2022071638A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2023514999A JP2023540330A (ja) 2020-09-29 2021-03-23 Ｌ－シトルリン生産能が向上したコリネバクテリウムグルタミクム変異株およびこれを用いたｌ－シトルリンの生産方法
US18/025,056 US20230332192A1 (en) 2020-09-29 2021-03-23 Corynebacterium glutamicum variant having enhanced l-citrulline production capacity, and method for producing l-citrulline using same
CN202180061834.1A CN116171327A (zh) 2020-09-29 2021-03-23 具有增强的l-瓜氨酸生产能力的谷氨酸棒状杆菌变体，以及用于使用其产生l-瓜氨酸的方法
EP21875913.2A EP4223880A1 (en) 2020-09-29 2021-03-23 Corynebacterium glutamicum variant having enhanced l-citrulline production capacity, and method for producing l-citrulline using same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0127021 2020-09-29
KR1020200127021A KR102433234B1 (ko) 2020-09-29 2020-09-29 L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-시트룰린의 생산 방법

Publications (1)

Publication Number Publication Date
WO2022071638A1 true WO2022071638A1 (ko) 2022-04-07

Family

ID=80950734

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/003602 WO2022071638A1 (ko) 2020-09-29 2021-03-23 L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-시트룰린의 생산 방법

Country Status (6)

Country Link
US (1) US20230332192A1 (ko)
EP (1) EP4223880A1 (ko)
JP (1) JP2023540330A (ko)
KR (1) KR102433234B1 (ko)
CN (1) CN116171327A (ko)
WO (1) WO2022071638A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102251946B1 (ko) * 2019-10-31 2021-05-17 대상 주식회사 yeeO 유전자 불활성에 의해 방향족 아미노산 생산능력이 향상된 균주

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090123980A1 (en) * 2004-09-28 2009-05-14 Kyowa Hakko Kogyo Co., Ltd. Process for producing l-arginine, l-ornithine or l-citrulline
KR101053429B1 (ko) 2006-03-30 2011-08-03 아지노모토 가부시키가이샤 Ｌ-아미노산의 생산 방법
KR101102263B1 (ko) 2005-09-27 2012-01-03 아지노모토 가부시키가이샤 Ｌ-아미노산 생산 세균 및 ｌ-아미노산 생산 방법
US20180148749A1 (en) * 2015-10-28 2018-05-31 Jiangnan University Method for Producing L-Citrulline by Using a Recombinant Corynebacterium crenatum Strain

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090123980A1 (en) * 2004-09-28 2009-05-14 Kyowa Hakko Kogyo Co., Ltd. Process for producing l-arginine, l-ornithine or l-citrulline
KR101102263B1 (ko) 2005-09-27 2012-01-03 아지노모토 가부시키가이샤 Ｌ-아미노산 생산 세균 및 ｌ-아미노산 생산 방법
KR101053429B1 (ko) 2006-03-30 2011-08-03 아지노모토 가부시키가이샤 Ｌ-아미노산의 생산 방법
US20180148749A1 (en) * 2015-10-28 2018-05-31 Jiangnan University Method for Producing L-Citrulline by Using a Recombinant Corynebacterium crenatum Strain

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
"Manual of Methods for General Bacteriology", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
EBERHARDT DORIT, JENSEN JAIDE V K, WENDISCH VOLKER F: "L-citrulline production by metabolically engineered Corynebacterium glutamicum from glucose and alternative carbon sources", AMB EXPRESS, vol. 4, no. 1, 10 December 2014 (2014-12-10), pages 1 - 9, XP055917361, DOI: 10.1186/s13568-014-0085-0 *
HAO N.; MU JR.; HU N.; XU S.; YAN M.; LI Y.; GUO K.; XU L.: "Improvement ofl-citrulline production inCorynebacterium glutamicumby ornithine acetyltransferase", JOURNAL OF INDUSTRIAL MICROBIOLOGY & BIOTECHNOLOGY, vol. 42, no. 2, 10 December 2014 (2014-12-10), GB , pages 307 - 313, XP035426865, ISSN: 1367-5435, DOI: 10.1007/s10295-014-1561-x *
STANSEN CORINNA, UY DAVIN, DELAUNAY STEPHANE, EGGELING LOTHAR, GOERGEN JEAN-LOUIS, WENDISCH VOLKER F.: "Characterization of a Corynebacterium glutamicum Lactate Utilization Operon Induced during Temperature-Triggered Glutamate Production", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 71, no. 10, 1 October 2005 (2005-10-01), US , pages 5920 - 5928, XP055917357, ISSN: 0099-2240, DOI: 10.1128/AEM.71.10.5920-5928.2005 *
VAN DER REST ET AL., APPL. MICROBIOL. BIOTECHNOL., vol. 52, 1999, pages 541 - 545

Also Published As

Publication number Publication date
KR20220043522A (ko) 2022-04-05
US20230332192A1 (en) 2023-10-19
KR102433234B1 (ko) 2022-08-18
EP4223880A1 (en) 2023-08-09
JP2023540330A (ja) 2023-09-22
CN116171327A (zh) 2023-05-26

Similar Documents

Publication Publication Date Title
WO2021162189A1 (ko) L-글루탐산 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-글루탐산의 생산 방법
KR100830289B1 (ko) Ｌ－아르기닌 생산 변이주 및 이의 제조방법
WO2022124671A1 (ko) 쉬와넬라 오네이덴시스 유래 단백질을 발현하는 미생물, 및 이를 이용한 l-아미노산 생산 방법
WO2022071638A1 (ko) L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-시트룰린의 생산 방법
WO2022191357A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022050527A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2024019215A1 (ko) L-아르기닌 또는 l-시트룰린 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 또는 l-시트룰린의 생산 방법
WO2024019216A1 (ko) L-아르기닌 또는 l-시트룰린 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 또는 l-시트룰린의 생산 방법
WO2022191358A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2023106543A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022231049A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022196919A1 (ko) L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-시트룰린의 생산 방법
WO2022231054A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2023136421A1 (ko) L-히스티딘 생산능이 향상된 에스케리치아 속 변이주 및 이를 이용한 l-히스티딘의 생산 방법
WO2023063547A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022050524A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2017065457A1 (ko) L-쓰레오닌 생산능을 가지는 미생물 및 그를 이용하여 l-쓰레오닌을 생산하는 방법
WO2023136422A1 (ko) L-히스티딘 생산능이 향상된 에스케리치아 속 변이주 및 이를 이용한 l-히스티딘의 생산 방법
WO2022231056A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
CN114008206B (zh) 具有增强的细胞色素c活性的l-氨基酸生产微生物及使用其的l-氨基酸生产方法
WO2022231055A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2023158174A9 (ko) 시그마 38 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법
WO2022124670A1 (ko) 쉬와넬라 아틀란티카 유래 단백질을 발현하는 미생물, 및 이를 이용한 l-아미노산 생산 방법
KR20220126610A (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
KR20220148694A (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21875913

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2023514999

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021875913

Country of ref document: EP

Effective date: 20230502