WO2022124671A1 - 쉬와넬라 오네이덴시스 유래 단백질을 발현하는 미생물, 및 이를 이용한 l-아미노산 생산 방법 - Google Patents

쉬와넬라 오네이덴시스 유래 단백질을 발현하는 미생물, 및 이를 이용한 l-아미노산 생산 방법 Download PDF

Info

Publication number
WO2022124671A1
WO2022124671A1 PCT/KR2021/017794 KR2021017794W WO2022124671A1 WO 2022124671 A1 WO2022124671 A1 WO 2022124671A1 KR 2021017794 W KR2021017794 W KR 2021017794W WO 2022124671 A1 WO2022124671 A1 WO 2022124671A1
Authority
WO
WIPO (PCT)
Prior art keywords
microorganism
amino acid
protein
amino acids
lysine
Prior art date
Application number
PCT/KR2021/017794
Other languages
English (en)
French (fr)
Inventor
배현원
정무영
김상준
박상민
변효정
신용욱
이한형
임보람
장재원
최윤정
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to JP2023530306A priority Critical patent/JP2023550754A/ja
Priority to AU2021398436A priority patent/AU2021398436A1/en
Priority to MX2023006846A priority patent/MX2023006846A/es
Priority to CN202180083053.2A priority patent/CN116547297A/zh
Priority to EP21903717.3A priority patent/EP4261287A1/en
Publication of WO2022124671A1 publication Critical patent/WO2022124671A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/10—Citrulline; Arginine; Ornithine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/24—Proline; Hydroxyproline; Histidine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Definitions

  • microorganism expressing a foreign protein and a method for producing L-amino acids using the same.
  • the microorganism expressing the foreign protein may have improved L-amino acid excretion and/or production ability compared to the wild type.
  • the microorganism of the genus Corynebacterium is a gram-positive microorganism that is widely used for the production of L-amino acids.
  • L-amino acids are used in animal feed, human pharmaceutical and cosmetic industries, and are produced by fermentation using Corynebacterium strains.
  • the foreign protein is a protein derived from the microorganism and heterogeneous microorganism, and may be a protein whose lysine excretion function is newly discovered in the present specification.
  • the microorganism expressing the foreign protein may have improved ability to excrete and/or produce L-amino acids compared to the same microorganism that does not express the foreign protein.
  • Another example provides a composition for producing L-amino acids, including microorganisms expressing the foreign protein.
  • Another example provides a method for producing L-amino acids, comprising culturing a microorganism expressing the foreign protein.
  • the microorganism may be a microorganism of the genus Corynebacterium.
  • L-lysine excretion protein is a membrane protein that discharges lysine produced through biosynthesis, and improvement of this protein is important for increasing lysine yield and productivity.
  • the present specification provides a recombinant strain having improved L-amino acid excretion and/or production ability by searching for a new foreign L-amino acid excreting protein with high L-amino acid excretion activity, and introducing it into a lysine-producing strain.
  • the foreign protein is a protein derived from the microorganism and heterogeneous microorganism, and may be a protein whose lysine excretion function is newly discovered in the present specification.
  • the microorganism expressing the foreign protein is L-amino acids, such as L-lysine, L-arginine, and L-histidine, compared to the same microorganism that does not express the exogenous protein, the excretion of one or more amino acids selected from the group consisting of Performance and/or productivity may be improved.
  • Another example provides a composition for the production of L-amino acids comprising a microorganism expressing the foreign protein.
  • Another example provides a method for producing L-amino acids, comprising culturing a microorganism expressing the foreign protein.
  • the microorganism may be a microorganism of the genus Corynebacterium.
  • the L-amino acid may include at least one amino acid selected from the group consisting of L-lysine, L-arginine, and L-histidine.
  • the foreign protein may be a protein derived from a microorganism belonging to a different genus or a different species than the parent strain (microbe before mutation), for example, a membrane protein derived from a microorganism other than a microorganism belonging to the genus Corynebacterium.
  • it may be a protein having the ability to excrete one or more amino acids selected from the group consisting of L-amino acids, such as L-lysine, L-arginine, and L-histidine, newly discovered herein.
  • the foreign protein is a membrane protein derived from a microorganism of the genus Shewanella, such as Shewanella oneidensis (eg, represented by the amino acid sequence of SEQ ID NO: 1); 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more with the above protein , 97% or more, 98% or more, 99% or more, 99.5% or more, or a protein having sequence identity or homology of 99.9% or more (eg, a membrane protein).
  • Shewanella oneidensis eg, represented by the amino acid sequence of SEQ ID NO: 1
  • the microorganism may include or express one or more of the foreign protein.
  • the microorganism expressing the foreign protein may be a recombinant microorganism into which the above-described polynucleotide encoding the foreign protein is introduced.
  • the polynucleotide encoding the protein of SEQ ID NO: 1 is 60% or more, 70% or more, 75% or more, 80% or more, 85% or more of the nucleic acid sequence of SEQ ID NO: 2 or the nucleic acid sequence of SEQ ID NO: 2, At least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity Or it may be expressed as a sequence having homology.
  • the microorganism expressing the foreign protein may be an L-amino acid producing microorganism having L-amino acid excretion and/or production ability.
  • L-amino acid producing microorganism refers to a microorganism having an L-amino acid excretion and/or production ability is mutated to express a foreign protein as described above, whereby the microorganism has increased L-amino acid excretion ability and When / or having a production ability, and / or a microorganism that does not have the ability to excrete and / or produce L-amino acids is mutated to express the foreign protein, whereby the microorganism has the ability to excrete and / or produce L-amino acids. It can be used to mean a case.
  • microorganism encompasses single-celled bacteria, and may be used interchangeably with “cell”. In the present specification, in order to distinguish a microorganism before being mutated to express the foreign protein from the mutated microorganism, it may be expressed as a “parent microorganism or host cell”.
  • the L-amino acid may be one or more amino acids selected from the group consisting of L-lysine, L-arginine, and L-histidine, for example, L-lysine.
  • the microorganism may be selected from all microorganisms having L-amino acid excretion and/or production ability.
  • the microorganism for example, the parent strain before mutation, (1) a microorganism having the ability to naturally excrete and/or produce L-amino acids, or (2) the ability to naturally excrete and/or produce L-amino acids Microorganisms having the ability to excrete and/or to produce L-amino acids or to have L-amino acids excretion and/or production ability or to have improved L-amino acid excretion and/or production capacity by introducing a mutation into a strain having no or significantly less L-amino acid excretion and/or production ability can
  • the microorganism is (1) a microorganism naturally having the ability to excrete and/or produce L-amino acids, or (2) a microorganism or L- that naturally has the ability to excrete and/or produce L-amino acids All Corynebacterium genus (the genus Corynebacterium ) It may be at least one selected from the group consisting of microorganisms and the like.
  • the Corynebacterium genus microorganism is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Brevibacterium lactofermentum ( Brevibacterium lactofermentum ), Brevibacterium flabum ( Brevibacterium flavum ), Corynebacterium thermoaminogenes ( Corynebacterium thermoaminogenes ), Corynebacterium efficiens ( Corynebacterium efficiens ) and the like may include, but are not necessarily limited thereto. More specifically, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum .
  • the microorganism expressing the foreign protein may be a microorganism into which a mutation to express the foreign protein is introduced.
  • the microorganism mutated to express the foreign protein may have an increased ability to excrete and/or produce L-amino acids, as compared to an unmodified microorganism of the same kind.
  • the unmodified microorganism is a microorganism that does not express the foreign protein, and may refer to a microorganism of the same species in which a mutation to express the foreign protein is not introduced or a microorganism before the mutation is introduced.
  • mutant to express a foreign protein may refer to any manipulation to express the foreign protein described above in the parent strain.
  • the mutation to express the foreign protein may be introducing a polynucleotide encoding the foreign protein or a recombinant vector comprising the same into the parent strain.
  • microorganism introduced with a mutation to express a foreign protein or "a microorganism mutated to express a foreign protein” may be a microorganism into which a polynucleotide encoding the foreign protein or a recombinant vector comprising the same has been introduced, Compared to the modified microorganism, L-amino acid excretion and/or production ability may be imparted or increased.
  • the parent strain is wild-type, or is mutated to increase the excretion and/or production capacity of L-amino acids, for example, the protein activity involved in the biosynthesis or metabolism of L-amino acids is regulated (increased) compared to the wild-type. (promoted) or reduced (inhibited)), but is not limited thereto.
  • the L-amino acid-producing microorganism in which the foreign protein is expressed may be one with accession number KCCM_12827P.
  • a polynucleotide which may be used interchangeably with “gene” or a polypeptide (which may be used interchangeably with “protein”) means “comprises a specific nucleic acid sequence or amino acid sequence, consists of a specific nucleic acid sequence or amino acid sequence, Or expressed by a specific nucleic acid sequence or amino acid sequence” is an equivalent and interchangeable expression, which may mean that the polynucleotide or polypeptide essentially includes the specific nucleic acid sequence or amino acid sequence, and the polynucleotide or Including "substantially equivalent sequences" in which mutations (deletions, substitutions, modifications, and/or additions) are made to the specific nucleic acid sequence or amino acid sequence to the extent that the original function and/or desired function of the polypeptide is maintained (or not excluding the above mutation).
  • nucleic acid sequences or amino acid sequences provided herein can be prepared by conventional mutagenesis methods such as direct evolution and/or site-specification to the extent that they retain their original or desired functions. It may include those modified by site-directed mutagenesis or the like.
  • a polynucleotide or polypeptide “comprises or consists of a specific nucleic acid sequence or amino acid sequence” means that the polynucleotide or polypeptide is (i) the specific nucleic acid sequence or or (ii) at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91% of the specific nucleic acid sequence or amino acid sequence; At least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% homology.
  • the original function may be a lysine excretion protein function (in the case of an amino acid sequence), or a function encoding a protein having the lysine excretion protein function (in the case of a nucleic acid sequence), and the desired function is a microorganism of L-amino acids (eg, L-lysine, L-arginine, L-histidine, or a combination thereof) may mean a function of increasing or imparting excretion and/or production capacity.
  • L-amino acids eg, L-lysine, L-arginine, L-histidine, or a combination thereof
  • the term 'homology' or 'identity' refers to a degree related to two given amino acid sequences or nucleotide sequences and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used.
  • Substantially, homologous or identical sequences generally have moderate or high stringency conditions along at least about 50%, 60%, 70%, 80% or 90% of the entire or full-length sequence. It can hybridize under stringent conditions. It is obvious that hybridization also includes polynucleotides containing common codons in polynucleotides or codons taking codon degeneracy into account.
  • a GAP program can be defined as the total number of symbols in the shorter of two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • nucleic acid sequence described herein is the amino acid sequence and / or function of the protein expressed from the coding region, taking into consideration the codon preferred in the microorganism to express the protein (lysine excretion protein) due to the degeneracy of the codon.
  • Various modifications may be made to the coding region within a range that does not change .
  • a polynucleotide comprising a specific nucleic acid sequence comprises a polynucleotide fragment comprising a nucleic acid sequence complementary to the specific nucleic acid sequence or a nucleic acid sequence substantially equivalent thereto, as well as the specific nucleic acid sequence.
  • the polynucleotide having the complementarity can be hybridized at a Tm value that can be appropriately adjusted by a person skilled in the art according to the purpose, for example, a Tm value of 55 °C, 60 °C, 63 °C or 65 °C, and analyzed under the conditions described below. : These conditions are specifically described in known literature.
  • Hybridization requires that two nucleotides have complementary sequences, or mismatches between bases may be allowed depending on the stringency of hybridization.
  • the term “complementary” may be used to describe a relationship between nucleotide bases capable of hybridizing to each other. For example, in the case of DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.
  • the appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotide and the degree of complementarity, which is well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
  • the term "transformation” refers to introducing a polynucleotide encoding a target protein (foreign protein) or a vector including the same into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. it means.
  • the transformed polynucleotide may include both, whether inserted into or extrachromosomally located in the chromosome of the host cell, as long as it can be expressed in the host cell.
  • the polynucleotide includes DNA and/or RNA encoding a target protein.
  • the form in which it is introduced is not limited.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
  • the expression cassette may include expression control elements such as a promoter, a transcription termination signal, a ribosome binding site and/or a translation termination signal, which are operably linked to the polynucleotide in general.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell.
  • operably linked means an expression control element (eg, a promoter) and a poly It may mean that the nucleotides are functionally linked. Operable ligation may be performed using genetic recombination techniques known in the art, for example, may be performed by conventional site-specific DNA cleavage and ligation, but is not limited thereto.
  • the method of transforming the polynucleotide into a host cell can be performed by any method of introducing a nucleic acid into a cell (microorganism), and can be performed by appropriately selecting a transformation technique known in the art according to the host cell.
  • the known transformation methods include electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol-mediated uptake. ), DEAE-dextran method, cationic liposome method, lipofection, lithium acetate-DMSO method and the like may be exemplified, but is not limited thereto.
  • RNA-guided endonuclease system RNA-guided endonuclease system or CRISPR system
  • RNA-guided endonuclease system or CRISPR system
  • an RNA-guided endonuclease eg, Cas9 protein, etc.
  • its coding gene or a vector comprising the gene
  • a guide RNA eg, single guide RNA (sgRNA), etc.
  • sgRNA single guide RNA
  • a mixture eg, a mixture of an RNA-guided endonuclease protein and a guide RNA, etc.
  • a complex eg, a ribonucleic acid fusion protein (RNP), a recombinant vector (eg, , an RNA-guided endonuclease-encoding gene and a vector including a guide RNA-encoding DNA, etc.)
  • RNP ribonucleic acid fusion protein
  • recombinant vector
  • the term "vector” refers to a DNA preparation containing the nucleotide sequence of a polynucleotide encoding the target protein operably linked to a suitable regulatory sequence so that the target protein can be expressed in a suitable host.
  • the regulatory sequence may include a promoter capable of initiating transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and/or a sequence regulating the termination of transcription and/or translation. have.
  • the vector After transformation into an appropriate host cell, the vector may be expressed independently of the genome (genome) of the host cell, or may be integrated into the genome of the host cell.
  • the vector usable herein is not particularly limited as long as it is capable of replication in a host cell, and may be selected from all commonly used vectors.
  • commonly used vectors include natural or recombinant plasmids, cosmids, viruses, bacteriophages, and the like.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as a phage vector or a cosmid vector, and pBR-based, pUC as a plasmid vector system, pBluescript II system, pGEM system, pTZ system, pCL system, pET system, etc.
  • pDZ pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector and the like may be exemplified, but is not limited thereto.
  • the vector usable herein may be a known expression vector and/or a vector for inserting a polynucleotide into a host cell chromosome.
  • the insertion of the polynucleotide into the host cell chromosome may be achieved by any method known in the art, for example, homologous recombination or a CRISPR system, but is not limited thereto.
  • the vector may further include a selection marker for confirming whether or not it is inserted into the chromosome.
  • the selection marker is used to select cells transformed with the vector, that is, to determine whether the polynucleotide is inserted, and selectable phenotypes such as drug resistance, auxotrophicity, resistance to cytotoxic agents, or surface protein expression It can be selected from among the genes that confer In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.
  • Another example is a method of increasing the L-amino acid excretion and / or production capacity of the microorganism, comprising introducing (transformation) into the microorganism the foreign protein, its encoding polynucleotide, or a recombinant vector containing the polynucleotide Or it provides a method for imparting L- amino acid excretion and / or production ability to the microorganism.
  • the foreign protein, polynucleotide, and microorganism are as described above.
  • Another example provides a method for producing L-amino acids, comprising culturing the above-described L-amino acid-producing microorganisms in a medium.
  • the method after the step of culturing, may further comprise the step of recovering L-amino acids from the cultured microorganism, the medium, or both.
  • the step of culturing the microorganism is not particularly limited thereto, but may be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, and the like.
  • the culture conditions are not particularly limited thereto, but use a basic compound (eg, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid) to an appropriate pH (eg, pH 5 to 9, specifically can control pH 6-8, most specifically pH 6.8), and introduce oxygen or oxygen-containing gas mixture into the culture to maintain aerobic conditions.
  • a basic compound eg, sodium hydroxide, potassium hydroxide or ammonia
  • an acidic compound eg, phosphoric acid or sulfuric acid
  • the culture temperature may be maintained at 20 to 45 °C, or 25 to 40 °C, and may be cultured for about 10 to 160 hours, but is not limited thereto.
  • the L-amino acids produced by the culture may be secreted into the medium or remain in the cells.
  • the medium usable for the culture includes sugars and carbohydrates (eg, glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), oils and fats (eg, soybean oil, sunflower oil, Peanut oil and coconut oil), fatty acids (eg palmitic acid, stearic acid and linoleic acid), alcohols (eg glycerol and ethanol), organic acids (eg acetic acid), etc. are individually used or Alternatively, two or more types may be mixed and used, but the present invention is not limited thereto.
  • Nitrogen sources include nitrogen-containing organic compounds (e.g.
  • peptone, yeast extract, broth, malt extract, corn steep liquor, soy flour and urea), inorganic compounds (e.g. ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and nitric acid) ammonium), etc., may be used individually or in mixture of two or more selected from the group consisting of, but is not limited thereto.
  • a phosphorus source at least one selected from the group consisting of potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and a corresponding sodium-containing salt may be used individually or in combination of two or more, but is not limited thereto.
  • the medium may contain essential growth-promoting substances such as other metal salts (eg, magnesium sulfate or iron sulfate), amino acids, and/or vitamins.
  • the step of recovering the L-amino acid may be collecting the desired amino acid from the medium, the culture medium, or the microorganism using a suitable method known in the art depending on the culture method.
  • the recovering may be performed by one or more methods selected from centrifugation, filtration, anion exchange chromatography, crystallization, HPLC, and the like.
  • the method for recovering the L-amino acid may further include a purification step before, simultaneously with, or after that.
  • Example 1 L-lysine excretion gene search and selection
  • RPS-BLAST search using NCBI CDD (Common Domain Database) and RPS-BLAST search to search for emitters with high L-lysine release activity compared to L-lysine emitters (lysE, Ncgl1214) inherently possessed by microorganisms of the genus Corynebacterium BLAST search using KEGG Protein Database was performed.
  • Candidate proteins considered as membrane proteins capable of releasing L-lysine were selected.
  • the membrane protein derived from Shewanella oneidensis , Son selected in Example 1 has the amino acid sequence of SEQ ID NO: 1.
  • Information on the gene encoding the membrane protein and the surrounding nucleic acid sequence was obtained from the US National Institutes of Health (NIH GenBank). DNA synthesis was performed based on the corresponding gene sequence (Cosmo genetech, Korea). In order to amplify the gene, PCR (SolgTM Pfu-X DNA polymerase) was performed using the synthesized DNA as a template and primers (Table 2) of SEQ ID NOs: 3 and 4 (Table 3). As a result, a 651 bp gene fragment including the 621 bp gene (SEQ ID NO: 2) was obtained.
  • PCR was performed with primers of SEQ ID NOs: 7 and 8 (Table 2) to select colonies transformed with the vector in which the desired gene and pDZTn were linked.
  • a plasmid was obtained from the selected colony using a commonly known plasmid extraction method, and this plasmid was named pDZTn-PgapA-Son.
  • the Corynebacterium glutamicum KCCM11016P strain (Korean Patent No. 10-0159812) producing L-lysine was electroporated (Appl. Microbiol. Biotechnol. (1999)) 52:541-545), a strain in which PgapA-Son is inserted between the transposon genes was obtained through a secondary crossover process. PCR and sequencing were performed using primers (Table 4) of SEQ ID NO: 9 and SEQ ID NO: 10 capable of amplifying adjacent regions including the position at which the gene was inserted, and the corresponding genetic manipulation was confirmed. The strain thus obtained was named Corynebacterium glutamicum KCCM11016P::PgapA-Son.
  • Example 4 Comparison of L-amino acid production capacity in KCCM11016P strain introduced with foreign membrane protein
  • the KCCM11016P::PgapA-Son strain and the control KCCM11016P were cultured in the following manner, and the cell mass, glucose consumption, and amino acid production capacity were compared.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm.
  • a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and incubated at 37° C. for 42 hours at 200 rpm with shaking. After completion of the culture, the production of L-amino acids was measured by HPLC.
  • Glucose 45 g (NH 4 ) 2 SO 4 15 g, soy protein 10 g, molasses 10 g, KH 2 PO 4 0.55 g, MgSO 4 7H 2 O 0.6 g, biotin 0.9 mg, thiamine hydrochloride 4.5 mg, calcium- Pantothenic acid 4.5 mg, nicotinamide 30 mg, MnSO 4 9 mg, FeSO 4 9 mg, ZnSO 4 0.45 mg, CuSO 4 0.45 mg, CaCO 3 30 g (based on 1 liter of distilled water).
  • the KCCM11016P::PgapA-Son strain showed increased amino acid production capacity compared to the control strain KCCM11016P.
  • the KCCM11016P::PgapA-Son strain ( Coryneacterium glutamicum CA03-1359) was released in October 2020. On the 29th, it was internationally deposited with the Korea Center for Microorganisms Conservation (KCCM), an international depository under the Budapest Treaty, and was given a deposit number as KCCM 12827P.
  • Example 5 Comparison of L-amino acid production capacity in KCCM10770P strain introduced with foreign membrane protein
  • Example 3 Using the method described in Example 3 above, a strain in which the PgapA-Son gene was inserted into the transposon position on the genome of the Corynebacterium glutamicum KCCM10770P (Korean Patent No. 10-0924065) strain was obtained.
  • the strain thus obtained was named Corynebacterium glutamicum KCCM10770P::PgapA-Son.
  • KCCM10770P Comparison of L-amino acid production capacity (KCCM10770P) strain OD 562 Consumed sugar (g/L) Lysine production (g/L) Arginine Concentration (mg/L) histidine concentration (mg/L) KCCM10770P 67.1 50 8.1 17.9 0 KCCM10770P::PgapA-Son 57.4 50 11.4 402.3 12.8
  • the KCCM10770P::PgapA-Son strain showed increased amino acid production capacity compared to the control strain, KCCM10770P.
  • Corynebacterium glutamicum CJ3P (US 9556463 B2) strain having L-lysine-producing ability by introducing three types of mutations [pyc(P458S), hom(V59A), lysC(T311I)] into wild strains
  • a strain in which the PgapA-Son gene was inserted was obtained using the method described in Example 3 above at the position of the phase transposon.
  • the strain thus obtained was named Corynebacterium glutamicum CJ3P::PgapA-Son.
  • the CJ3P::PgapA-Son strain and control CJ3P were cultured to compare cell mass, glucose consumption, and amino acid production (see Example 4). The experiment was repeated 3 times, and the culture results (average values) are shown in Table 7.
  • CJ3P L-amino acid production capacity
  • strain OD 562 Consumed sugar
  • g/L Lysine production
  • Arginine Concentration mg/L
  • histidine concentration mg/L

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

외래 단백질을 발현하는 미생물 및 이를 이용한 L-아미노산 생산 방법이 제공된다. 상기 외래 단백질을 발현하는 미생물은, 야생형과 비교하여, L-아미노산의 배출능 및/또는 생산능이 향상된 것일 수 있다.

Description

쉬와넬라 오네이덴시스 유래 단백질을 발현하는 미생물, 및 이를 이용한 L-아미노산 생산 방법
외래 단백질을 발현하는 미생물 및 이를 이용한 L-아미노산 생산 방법이 제공된다. 상기 외래 단백질을 발현하는 미생물은, 야생형과 비교하여, L-아미노산 배출능 및/또는 생산능이 향상된 것일 수 있다.
코리네박테리움 (Corynebacterium) 속 미생물은 L-아미노산 생산에 많이 이용되고 있는 그람 양성의 미생물이다. L-아미노산은 동물사료, 사람의 의약품 및 화장품 산업에 사용되고 있으며 코리네박테리움 균주를 이용한 발효에 의해 생성되고 있다.
코리네박테리움 균주를 이용한 L-아미노산의 제조방법을 개선하기 위하여 많은 시도가 행해지고 있다. 그 중에서 재조합 DNA 기술을 이용하여 특정유전자를 파괴시키거나, 감쇠 발현시킴으로써 L-아미노산을 생산하는 코리네박테리움 균주를 개량하려는 연구가 있었다. 또한, 각각의 L-아미노산 생합성에 관련된 유전자를 증폭시켜 L-아미노산 생성에 미치는 효과를 연구하고 L-아미노산 생산 코리네박테리움 균주를 개량하려는 연구가 많이 있어 왔다. 그럼에도, 여전히 L-아미노산의 생산능이 향상된 균주 개발이 요구되고 있다.
일 예는 외래 단백질을 발현하는 미생물을 제공한다. 상기 외래 단백질은 상기 미생물과 이종 미생물 유래의 단백질로서, 본 명세서에서 새롭게 라이신 배출 기능이 밝혀진 단백질일 수 있다. 상기 외래 단백질을 발현하는 미생물은 상기 외래 단백질을 발현하지 않는 동종 미생물과 비교하여, L-아미노산의 배출능 및/또는 생산능이 향상된 것일 수 있다.
다른 예는 상기 외래 단백질을 발현하는 미생물을 포함하는 L-아미노산 생산용 조성물을 제공한다.
다른 예는 상기 외래 단백질을 발현하는 미생물을 배양하는 단계를 포함하는, L-아미노산의 생산 방법을 제공한다.
상기 미생물은 코리네박테리움 속 미생물일 수 있다.
본 명세서에서는 코리네박테리움 속 미생물의 L-아미노산 생산능 증가를 목적으로 L-아미노산의 신규한 배출 단백질을 탐색하고, 도입함으로써 균주를 개량하고자 하였다. L-라이신을 대표적인 예로서 설명하면, 일반적으로 라이신 생산능 증가를 위해서는 균주가 가지는 L-라이신 수율을 향상시키거나, 시간당 L-라이신 생산량 (생산성)을 증가시키는 방법이 있다. L-라이신 배출 단백질은 생합성을 거쳐 생성된 라이신을 배출하는 막 단백질이며, 이 단백질의 개량은 라이신 수율과 생산성 증가에 중요하다. 하지만 코리네박테리움 속 미생물이 보유하고 있는 L-라이신 배출 단백질 (lysE, Ncgl1214)의 발현량 증가는 L-라이신 생산능을 향상시키는데 한계가 있다.
이에, 본 명세서에서는 L-아미노산 배출 활성이 높은 새로운 외래 L-아미노산 배출 단백질을 탐색하고, 이를 라이신 생산 균주에 도입시킴으로써, L-아미노산 배출능 및/또는 생산능이 향상된, 재조합 균주를 제공한다.
본 명세서에서, 새로운 외래 L-아미노산 배출 단백질의 대표적인 예로서 쉬와넬라 오네이덴시스 (Shewanella oneidensis) 유래 신규 L-아미노산 배출 단백질 및 이를 암호화하는 유전자를 발굴하였으며, 이를 L-아미노산을 생산하는 미생물에 발현시킨 결과, 상기 유전자가 발현되지 않은 미생물과 비교하여 L-아미노산의 배출능/생산능이 현저히 향상됨을 확인하였다.
일 예는 외래 단백질을 발현하는 미생물을 제공한다. 상기 외래 단백질은 상기 미생물과 이종 미생물 유래의 단백질로서, 본 명세서에서 새롭게 라이신 배출 기능이 밝혀진 단백질일 수 있다. 상기 외래 단백질을 발현하는 미생물은 상기 외래 단백질을 발현하지 않는 동종 미생물과 비교하여, L-아미노산, 예컨대, L-라이신, L-아르기닌, 및 L-히스티딘으로 이루어진 군에서 선택된 1종 이상의 아미노산의 배출능 및/또는 생산능이 향상된 것일 수 있다.
다른 예는 상기 외래 단백질을 발현하는 미생물을 포함하는 L-아미노산의 생산용 조성물을 제공한다.
다른 예는 상기 외래 단백질을 발현하는 미생물을 배양하는 단계를 포함하는, L-아미노산의 생산 방법을 제공한다.
상기 미생물은 코리네박테리움 속 미생물일 수 있다.
상기 L-아미노산은 L-라이신, L-아르기닌, 및 L-히스티딘으로 이루어진 군에서 선택된 1종 이상의 아미노산을 포함할 수 있다.
이하, 보다 상세히 설명한다.
본 명세서에서, 상기 외래 단백질은 모균주(변이 전 미생물)와 다른 속에 속하는 미생물 또는 다른 종의 미생물로부터 유래하는 단백질일 수 있으며, 예컨대, 코리네박테리움 속에 속하는 미생물 이외의 미생물로부터 유래하는 막단백질로서, 본 명세서에서 새롭게 밝혀진 L-아미노산, 예컨대, L-라이신, L-아르기닌, 및 L-히스티딘으로 이루어진 군에서 선택된 1종 이상의 아미노산의 배출능을 가지는 단백질일 수 있다. 일 예에서, 상기 외래 단백질은 쉬와넬라 속 미생물, 예컨대 쉬와넬라 오네이덴시스 (Shewanella oneidensis) 유래의 막단백질 (예컨대, 서열번호 1의 아미노산 서열로 표현됨); 상기 단백질과 60% 이상, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 99.5% 이상, 또는 99.9% 이상의 서열 동일성 또는 상동성을 가지는 단백질(e.g., 막단백질)일 수 있다.
상기 미생물은 1종 이상의 상기 외래 단백질을 포함하거나 발현하는 것일 수 있다. 상기 외래 단백질을 발현하는 미생물은 앞서 설명한 외래 단백질을 암호화하는 폴리뉴클레오타이드가 도입된 재조합 미생물일 수 있다. 일 예에서, 상기 서열번호 1의 단백질을 암호화하는 폴리뉴클레오타이드는 서열번호 2의 핵산 서열 또는 서열번호 2의 핵산 서열과 60% 이상, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 99.5% 이상, 또는 99.9% 이상의 서열 동일성 또는 상동성을 가지는 서열로 표현될 수 있다.
상기 외래 단백질을 발현하는 미생물은 L-아미노산 배출능 및/또는 생산능을 갖는 L-아미노산 생산 미생물일 수 있다.
본 명세서에서, 용어 "L-아미노산 생산 미생물"은 L-아미노산 배출능 및/또는 생산능을 갖는 미생물이 앞서 설명된 바와 같은 외래 단백질을 발현하도록 변이됨으로써 상기 미생물이 증가된 L-아미노산 배출능 및/또는 생산능을 갖는 경우, 및/또는 L-아미노산 배출능 및/또는 생산능을 갖지 않는 미생물이 상기 외래 단백질을 발현하도록 변이됨으로써 상기 미생물이 L-아미노산 배출능 및/또는 생산능을 갖게 되는 경우를 의미하기 위하여 사용될 수 있다. 본 명세서에서 "미생물"은 단세포 박테리아를 포괄하는 것으로, "세포"와 혼용될 수 있다. 본 명세서에서, 상기 외래 단백질을 발현하도록 변이되기 전의 미생물을 상기 변이된 미생물과 구별하기 위하여, "모균주 (parent microorganism or parent strain) 또는 숙주 세포 (host cell)"로 표현될 수 있다.
상기 L-아미노산은 L-라이신, L-아르기닌, 및 L-히스티딘으로 이루어진 군에서 선택된 1종 이상의 아미노산, 예컨대, L-라이신일 수 있다.
일 예에서, 상기 미생물은 L-아미노산 배출능 및/또는 생산능을 갖는 모든 미생물에서 선택된 것일 수 있다. 일 예에서, 상기 미생물, 예컨대, 변이 전의 모균주는, (1) 자연적으로 L-아미노산 배출능 및/또는 생산능을 가지는 미생물, 또는 (2) 상기 자연적으로 L-아미노산 배출능 및/또는 생산능을 가지는 미생물 또는 L-아미노산 배출능 및/또는 생산능이 없거나 현저히 적은 균주에 변이가 도입되어 L-아미노산 배출능 및/또는 생산능을 가지거나 L-아미노산 배출능 및/또는 생산능이 향상된 미생물일 수 있다.
일 구체예에서, 상기 미생물은 (1) 자연적으로 L-아미노산 배출능 및/또는 생산능을 가지는 미생물, 또는 (2) 상기 자연적으로 L-아미노산 배출능 및/또는 생산능을 가지는 미생물 또는 L-아미노산 배출능 및/또는 생산능이 없거나 현저히 적은 모균주에 변이가 도입되어 L-아미노산 배출능 및/또는 생산능을 가지거나 L-아미노산 배출능 및/또는 생산능이 향상된 모든 코리네박테리움 속 (the genus　Corynebacterium) 미생물 등으로 이루어진 군에서 선택된 1종 이상일 수 있다. 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰 (Corynebacterium　glutamicum), 코리네박테리움 암모니아게네스 (Corynebacterium ammoniagenes), 브레비박테리움 락토퍼멘텀 (Brevibacterium lactofermentum), 브레비박테리움 플라범 (Brevibacterium flavum), 코리네박테리움 써모아미노게네스 (Corynebacterium　thermoaminogenes), 코리네박테리움 에피션스 (Corynebacterium　efficiens) 등을 포함할 수 있으나, 반드시 이에 한정되는 것은 아니다. 보다 더욱 구체적으로는, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰 (Corynebacterium　glutamicum)일 수 있다.
일 예에서, 상기 외래 단백질을 발현하는 미생물은 상기 외래 단백질을 발현하도록 하는 변이가 도입된 미생물일 수 있다. 이와 같이, 외래 단백질을 발현하도록 변이된 미생물은, 동종의 비변형 미생물과 비교하여, L-아미노산 배출능 및/또는 생산능이 증가된 것일 수 있다. 상기 비변형 미생물은 상기 외래 단백질을 발현하지 않는 미생물로서, 상기 외래 단백질을 발현하도록 하는 변이가 도입되지 않은 동종의 미생물 또는 상기 변이가 도입되기 전의 미생물을 의미할 수 있다.
본 명세서에서, "외래 단백질을 발현하도록 하는 변이"는 모균주에 앞서 설명한 외래 단백질을 발현하도록 하는 모든 조작을 의미할 수 있다. 일 예에서, 외래 단백질을 발현하도록 하는 변이는 상기 외래 단백질을 암호화하는 폴리뉴클레오타이드, 또는 이를 포함하는 재조합 벡터를 모균주에 도입하는 것일 수 있다.
상기 "외래 단백질을 발현하도록 하는 변이가 도입된 미생물" 또는 "외래 단백질을 발현하도록 변이된 미생물"은 상기 외래 단백질을 암호화하는 폴리뉴클레오타이드, 또는 이를 포함하는 재조합 벡터가 도입된 미생물일 수 있으며, 비변형 미생물과 비교하여, L-아미노산 배출능 및/또는 생산능이 부여되거나 증가된 것일 수 있다.
일 예에서, 상기 모균주는 야생형이거나, L-아미노산의 배출능 및/또는 생산능이 증가되도록 변이된 것, 예컨대, 야생형과 비교하여 L-아미노산의 생합성 또는 대사에 관여하는 단백질 활성이 조절 (증가(촉진) 또는 감소(억제))된 것일 수 있으나, 이에 제한되는 것은 아니다.
일 구체예에서, 상기 외래 단백질이 발현된 L-아미노산 생산 미생물은 기탁번호 KCCM_12827P인 것일 수 있다.
본 명세서에서, 폴리뉴클레오타이드("유전자"와 혼용될 수 있음) 또는 폴리펩타이드("단백질"과 혼용될 수 있음)가 "특정 핵산 서열 또는 아미노산 서열을 포함한다, 특정 핵산 서열 또는 아미노산 서열로 이루어진다, 또는 특정 핵산 서열 또는 아미노산 서열로 표현된다" 함은 동등한 의미로 호환 가능한 표현으로, 상기 폴리뉴클레오타이드 또는 폴리펩타이드가 상기 특정 핵산 서열 또는 아미노산 서열을 필수적으로 포함하는 것을 의미할 수 있으며, 상기 폴리뉴클레오타이드 또는 폴리펩타이드의 본래의 기능 및/또는 목적하는 기능을 유지하는 범위에서 상기 특정 핵산 서열 또는 아미노산 서열에 변이(결실, 치환, 변형, 및/또는 부가)가 가해진 "실질적으로 동등한 서열"을 포함하는 것(또는 상기 변이를 배제하지 않는 것)으로 해석될 수 있다.
일 예에서, 본 명세서에서 제공되는 핵산 서열 또는 아미노산 서열은 이들의 본래의 기능 또는 목적하는 기능을 유지하는 범위에서 통상적인 돌연변이 유발법, 예를 들면 방향성 진화법(direct evolution) 및/또는 부위특이적 돌연변이법(site-directed mutagenesis) 등에 의하여 변형된 것을 포함할 수 있다. 본 명세서에 있어서, 다르게 기재되지 않는 한, 폴리뉴클레오타이드 또는 폴리펩타이드가 "특정 핵산 서열 또는 아미노산 서열을 포함한다 또는 상기 서열로 이루어진다" 함은 상기 폴리뉴클레오타이드 또는 폴리펩타이드가 (i) 상기 특정 핵산 서열 또는 아미노산 서열을 필수적으로 포함하거나, 또는 (ii) 상기 특정 핵산 서열 또는 아미노산 서열과 60% 이상, 65% 이상, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 99.5% 이상, 또는 99.9% 이상의 상동성을 갖는 아미노산 서열로 이루어지거나 이를 필수적으로 포함하고 본래의 기능 및/또는 목적하는 기능을 유지하는 것을 의미할 수 있다. 본 명세서에서, 상기 본래의 기능은, 라이신 배출 단백질 기능 (아미노산 서열의 경우), 또는 상기 라이신 배출 단백질 기능을 갖는 단백질을 암호화하는 기능 (핵산 서열의 경우)일 수 있고, 상기 목적하는 기능은 미생물의 L-아미노산 (예컨대, L-라이신, L-아르기닌, L-히스티딘, 또는 이들의 조합) 배출능 및/또는 생산능을 증가시키거나 부여하는 기능을 의미할 수 있다.
본 출원에서 용어, ‘상동성 (homology)’ 또는 ‘동일성 (identity)’은 두 개의 주어진 아미노산 서열 또는 염기 서열과 관련된 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90%를 따라 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
또한, 임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)으로 결정될 수 있다.
본 명세서에 기재된 핵산 서열은 코돈의 축퇴성(degeneracy)으로 인하여 상기 단백질(라이신 배출 단백질)을 발현시키고자 하는 미생물에서 선호되는 코돈을 고려하여, 코딩영역으로부터 발현되는 단백질의 아미노산 서열 및/또는 기능을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있다.
일 예에서, 본 명세서에 제공되는 특정 핵산 서열을 포함하는 폴리뉴클레오타이드는 상기 특정 핵산 서열 또는 이와 실질적으로 동등한 핵산 서열뿐만 아니라, 상기 특정 핵산 서열에 상보적인 핵산 서열을 포함하는 폴리뉴클레오타이드 단편을 포함하는 것으로 해석될 수 있다. 구체적으로, 상기 상보성을 가지는 폴리뉴클레오타이드는 목적에 따라 당업자에 의해 적절히 조절 가능한 Tm 값, 예컨대, 55℃, 60℃, 63℃ 또는 65℃의 Tm 값에서 혼성화하고, 후술하는 조건에서 분석할 수 있다: 이러한 조건은 공지의 문헌에 구체적으로 기재되어 있다. 예를 들어, 60% 이상, 65% 이상, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 98% 이상, 99.5% 이상, 또는 99.9% 이상의 높은 상보성을 갖는 유전자끼리 혼성화하고, 그보다 낮은 상보성을 갖는 유전자끼리는 혼성화하지 않는 조건, 또는 통상의 써던 하이브리드화의 세척 조건인 60℃, 1x SSC(saline-sodium citrate buffer), 및 0.1%(w/v) SDS (Sodium Dodecyl Sulfate); 60℃, 0.1x SSC, 및 0.1% SDS; 또는 68℃, 0.1x SSC, 및 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세척하는 조건을 등을 열거할 수 있으나, 이에 제한되는 것은 아니다. 혼성화에는 두 개의 뉴클레오타이드가 상보적 서열을 가질 것을 요구되거나, 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 허용될 수 있다. 상기 용어 "상보적"은 서로 혼성화가 가능한 뉴클레오타이드 염기 간의 관계를 기술하기 위하여 사용될 수 있다. 예를 들면, DNA의 경우, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 폴리뉴클레오타이드를 혼성화하는 적절한 엄격도는 폴리뉴클레오타이드의 길이 및 상보성 정도에 의존하고, 이는 관련 기술분야에 잘 알려져 있다 (Sambrook et al., supra,9.50-9.51, 11.7-11.8 참조).
상기 폴리뉴클레오타이드 또는 벡터의 도입은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있다. 본 명세서에서, 용어 "형질전환"은 표적 단백질(외래 단백질)을 암호화하는 폴리뉴클레오타이드나 이를 포함하는 벡터를 숙주 세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오타이드가 암호화하는 단백질이 발현될 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오타이드는 숙주 세포 내에서 발현될 수 있기만 한다면, 숙주 세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오타이드는 표적 단백질을 코딩하는 DNA 및/또는 RNA를 포함한다. 상기 폴리뉴클레오타이드는 숙주 세포 내로 도입되어 발현될 수 있는 것이면, 그 도입되는 형태는 제한이 없다. 예를 들면, 상기 폴리뉴클레오타이드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트 (expression cassette)의 형태로 숙주 세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오타이드에 작동 가능하게 연결되어 있는 프로모터 (promoter), 전사 종결신호, 리보좀 결합부위 및/또는 번역 종결신호 등의 발현 조절 요소를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오타이드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있다. 상기에서 용어 "작동 가능하게 연결"된 것이란 발현조절 요소가 목적 단백질(외래 단백질)을 암호화하는 폴리뉴클레오타이드의 전사 조절 (예, 전사 개시)를 수행할 수 있도록 발현조절 요소 (예, 프로모터)와 폴리뉴클레오타이드가 기능적으로 연결되어 있는 것을 의미할 수 있다. 작동 가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 수행할 수 있으며, 예컨대, 통상적인 부위-특이적 DNA 절단 및 연결에 의하여 수행될 수 있으나, 이에 제한되지 않는다.
상기 폴리뉴클레오타이드를 숙주 세포에 형질전환 하는 방법은 핵산을 세포(미생물) 내로 도입하는 어떠한 방법으로도 수행 가능하며, 숙주 세포에 따라 당 분야에서 공지된 형질전환 기술을 적절히 선택하여 수행할 수 있다. 상기 공지된 형질전환 방법으로 전기천공법 (electroporation), 인산칼슘 (CaPO4) 침전법, 염화칼슘 (CaCl2) 침전법, 미세주입법 (microinjection), 폴리에틸렌글리콜 (PEG) 침전법(polyethylene glycol-mediated uptake), DEAE-덱스트란법, 양이온 리포좀법, 리포펙션(lipofection), 초산 리튬-DMSO법 등이 예시될 수 있으나, 이에 제한되는 것은 아니다.
상기 폴리뉴클레오타이드의 숙주 세포 유전체 (염색체) 내 도입 (삽입)은 공지된 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 예컨대, RNA-가이드 엔도뉴클레아제 시스템 (RNA-guided endonuclease system 또는 CRISPR system; 예컨대, (a) RNA-가이드 엔도뉴클레아제(예, Cas9 단백질 등), 이의 암호화 유전자, 또는 상기 유전자를 포함하는 벡터; 및 (b) 가이드 RNA (예, single guide RNA (sgRNA) 등), 이의 암호화 DNA, 또는 상기 DNA를 포함하는 벡터를 포함하는 혼합물(예컨대, RNA-가이드 엔도뉴클레아제 단백질과 가이드 RNA의 혼합물 등), 복합체 (예컨대, 리보핵산 융합단백질 (RNP), 재조합 벡터 (예컨대, RNA-가이드 엔도뉴클레아제 암호화 유전자 및 가이드 RNA 암호화 DNA를 포함하는 함께 포함하는 벡터 등) 등으로 이루어진 군에서 선택된 하나 이상)을 사용하여 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 명세서에서, 용어 "벡터"는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 암호화하는 폴리뉴클레오타이드의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 암호화하는 서열, 및/또는 전사 및/또는 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주 세포 내로 형질전환된 후, 숙주 세포의 게놈(유전체)과 무관하게 발현되거나, 숙주 세포의 게놈 내에 통합될 수 있다.
본 명세서에서 사용가능한 벡터는 숙주 세포 내에서 복제 가능한 것이면 특별히 한정되지 않으며, 통상 사용되는 모든 벡터들 중에서 선택될 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스, 박테리오파지 등을 들 수 있다. 예를 들어, 상기 벡터로서, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는　pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 예시할 수 있으나, 이에 제한되지 않는다.
본 명세서에서 사용 가능한 벡터는 공지된 발현 벡터 및/또는 폴리뉴클레오타이드의 숙주 세포 염색체 내 삽입용 벡터일 수 있다. 상기 폴리뉴클레오타이드의 숙주 세포 염색체 내 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합 또는 CRISPR 시스템에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 벡터는 상기 염색체 내 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉, 상기 폴리뉴클레오타이드의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 유전자들 중에서 선택되어 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
다른 예는 상기한 외래 단백질, 이의 암호화 폴리뉴클레오타이드 또는 상기 폴리뉴클레오타이드를 포함하는 재조합 벡터를 미생물에 도입(형질전환)시키는 단계를 포함하는, 상기 미생물의 L-아미노산 배출능 및/또는 생산능 증가 방법 또는 상기 미생물에 L-아미노산 배출능 및/또는 생산능 부여 방법을 제공한다.
상기 외래 단백질, 폴리뉴클레오타이드, 및 미생물은 앞서 설명한 바와 같다.
다른 예는 상기한 L-아미노산 생산 미생물을 배지에서 배양하는 단계를 포함하는, L-아미노산의 생산 방법을 제공한다. 상기 방법은, 상기 배양하는 단계 이후에, 상기 배양된 미생물, 배지, 또는 이들 모두로부터 L-아미노산을 회수하는 단계를 추가로 포함할 수 있다.
　상기 방법에 있어서, 상기 미생물을 배양하는 단계는, 특별히 이에 제한되지 않으나, 공지된 회분식 배양방법, 연속식 배양방법, 유가식 배양방법 등에 의해 수행될 수 있다. 이때, 배양조건은, 특별히 이에 제한되지 않으나, 염기성 화합물 (예: 수산화나트륨, 수산화칼륨 또는 암모니아) 또는 산성 화합물 (예: 인산 또는 황산)을 사용하여 적정 pH (예컨대, pH 5 내지 9, 구체적으로는 pH 6 내지 8, 가장 구체적으로는 pH 6.8)를 조절할 수 있고, 산소 또는 산소-함유 가스 혼합물을 배양물에 도입시켜 호기성 조건을 유지할 수 있다. 배양온도는 20 내지 45℃, 또는 25 내지 40℃를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 제한되는 것은 아니다. 상기 배양에 의하여 생산된 L-아미노산은　배지　중으로 분비되거나 세포 내에 잔류할 수 있다.
상기 배양에 사용 가능한 배지는 탄소 공급원으로 당 및 탄수화물 (예: 글루코오스, 슈크로오스, 락토오스, 프럭토오스, 말토오스, 몰라세, 전분 및 셀룰로오스), 유지 및 지방 (예: 대두유, 해바라기씨유, 땅콩유 및 코코넛유), 지방산 (예: 팔미트산, 스테아르산 및 리놀레산), 알코올 (예: 글리세롤 및 에탄올), 유기산 (예: 아세트산) 등으로 이루어진 군에서 선택된 1종 이상을 개별적으로 사용하거나 또는 2종 이상을 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 질소 공급원으로는 질소-함유 유기 화합물 (예: 펩톤, 효모 추출액, 육즙, 맥아 추출액, 옥수수 침지액, 대두 박분 및 우레아), 무기 화합물 (예: 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄) 등으로 이루어진 군에서 선택된 1종 이상을 개별적으로 사용하거나 또는 2종 이상을 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 인 공급원으로 인산이수소칼륨, 인산수소이칼륨, 이에 상응하는 나트륨 함유 염 등으로 이루어진 군에서 선택된 1종 이상을 개별적으로 사용하거나 또는 2종 이상을 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 또한,　상기 배지는 기타 금속염 (예: 황산마그네슘 또는 황산철), 아미노산, 및/또는 비타민 등과 같은 필수성장-촉진 물질을 포함할 수 있다.
상기 L-아미노산을 회수하는 단계는 배양방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배지, 배양액, 또는 미생물로부터 목적하는 아미노산을 수집하는 것일 수 있다. 예를 들어, 상기 회수하는 단계는 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화, HPLC 등에서 선택된 하나 이상의 방법으로 수행될 수 있다. 상기 L-아미노산을 회수하는 방법은, 그 이전, 동시, 또는 그 이후에, 정제단계를 추가적으로 포함할 수 있다.
본 명세서에서는 미생물의 L-아미노산의 배출능 및/또는 생산능을 증가시키는 기술이 제공되며, 이를 위하여, 새롭게 L-아미노산의 배출능이 밝혀진 외래 단백질, 및 상기 외래 단백질을 미생물에 도입함으로써, 모균주 대비 L-아미노산의 생산성을 향상시킬 수 있는 기술이 제공된다.
이하에서는 실시예를 들어 본 발명을 더욱 구체적으로 설명하고자 하나, 이는 예시적인 것에 불과할 뿐이며, 본 발명의 범위를 제한하고자 함이 아니다. 아래 기재된 실시예들은 발명의 본질적인 요지를 벗어나지 않는 범위에서 변형될 수 있음은 당 업자들에게 있어 자명하다.
실시예 1: L-라이신 배출 유전자 탐색 및 선별
코리네박테리움 속 미생물이 내재적으로 보유하는 L-라이신 배출자(lysE, Ncgl1214)와 비교하여 L-라이신 배출 활성이 높은 배출자를 탐색하기 위해, NCBI CDD(Common Domain Database)를 이용한 RPS-BLAST 탐색과 KEGG Protein Database를 이용한 BLAST 탐색을 수행하였다. L-라이신을 배출할 수 있는 막단백질로 고려되는 후보 단백질을 선정하였다.
L-라이신 배출 막단백질 후보군
No. 균 주 단백질 등록 번호 게놈 등록 번호
1 Shewanella oneidensis MR-1 WP_011072781.1 NC_004347.2
2 Corynebacterium glutamicum ATCC13032 WP_003854734.1 NC_003450.3
3 Aeromonas allosaccharophila WP_042063605.1 NZ_CDCB01000123
4 Bacillus pseudofirmus OF4 WP_012958260.1 NC_013791.2
5 Bacillus halodurans C-125 WP_010899078.1 NC_002570.2
6 Natrialba aegyptia WP_006666837.1 NZ_AOIP01000039.1
7 Haloquadratum walsbyi WP_011571763.1 NC_008212.1
8 Thermotoga maritima MSB8 WP_004083139.1 NC_000853.1
9 Pyrodictium delaneyi WP_055407773.1 NZ_CP013011.1
10 Bacteroides coprophilus WP_008140089.1 NZ_EQ973631.1
11 Shewanella atlantica HAW-EB5 WP_126504868.1 NZ_RXNV01000002.1
실시예 2: 외래 막단백질 유전자 도입 벡터 제작
상기 실시예 1에서 선정된 쉬와넬라 오네이덴시스(Shewanella oneidensis, Son) 유래의 막 단백질은 서열번호 1의 아미노산 서열을 가진다. 미국 국립보건원 진뱅크(NIH GenBank)로부터 상기 막단백질을 코딩하는 유전자 및 주변 핵산서열에 대한 정보(등록번호 NC_004347.2)를 획득하였다. 해당 유전자 서열을 기반으로 DNA 합성을 수행하였다(Cosmo genetech, Korea). 유전자를 증폭시키기 위하여, 합성된 DNA를 주형으로 하고 서열번호 3와 4의 프라이머(표 2)를 이용하여 PCR(SolgTM Pfu-X DNA polymerase)을 수행하였다(표 3). 그 결과 621 bp의 유전자(서열번호 2)를 포함한 651 bp의 유전자 단편을 수득하였다.
프라이머 서열
No. 명칭 DNA 서열 (5'→3')
서열번호 3 Son-F TAGAGGAGACACAACATGCAAACGGCGTTTATTCA
서열번호 4 Son-R TAGATGTCGGGCCCATTAAATTGCGGCAAGGTATGG
서열번호 5 PgapA-F AATGAGTTCCTCGAGAAACGACCGAGCCTATTGGG
서열번호 6 PgapA-R ACGCCGTTTGCATGTTGTGTCTCCTCTAAAGATTG
서열번호 7 pDZTn-1 ACGACGCTGGTATTTCTCCC
서열번호 8 pDZTn-2 TGATTGTCGATATGACCGGG
PCR 수행 조건
단계 온도 시간
Initialization 95 ℃ 2분
Denaturation 95 ℃ 20초
Annealing 62 ℃ 40초
Elongation 72 ℃ 0.5~1분
Post Elongation 72 ℃ 5분
코리네박테리움 글루타미쿰 유래의 gapA 프로모터를 확보하기 위하여, 코리네박테리움 글루타미쿰 ATCC 13032의 게놈 DNA를 주형으로 하고 서열번호 5와 6의 프라이머(표 2)를 이용하여 PCR(SolgTM Pfu-X DNA polymerase)을 수행하였다(표 3). 증폭된 gapA 프로모터 부위와 상기 수득된 쉬와넬라 오네이덴시스 유래 유전자 단편 및 NdeI 제한효소로 절단된 벡터 pDZTn (한국 등록특허 제10-1126041호)를 깁슨 어셈블리 (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) 방법을 이용하여 연결한 후, 대장균 DH5α에 형질전환하고 카나마이신 (25 mg/l)이 포함된 LB 고체배지에 도말하였다. 목적한 유전자와 pDZTn이 연결된 벡터로 형질전환된 콜로니를 선별하기 위하여 서열번호 7과 8(표 2)의 프라이머로 PCR을 수행하였다. 선별된 콜로니로부터 통상적으로 알려진 플라스미드 추출법을 이용하여 플라스미드를 획득하였고, 이 플라스미드를 pDZTn-PgapA-Son으로 명명하였다.
실시예 3: 외래 막단백질 도입 균주 제작
제작된 pDZTn-PgapA-Son 벡터를 이용하여 L-라이신을 생산하는 코리네박테리움 글루타미쿰 KCCM11016P 균주 (대한민국 등록특허 제10-0159812호)를 전기천공법 (Appl. Microbiol.Biotechnol. (1999) 52:541-545) 으로 형질 전환한 후, 2차 교차 과정을 거쳐 트랜스포존 유전자의 사이에 PgapA-Son 이 삽입된 균주를 획득하였다. 해당 유전자가 삽입된 위치를 포함한 인접 부위를 증폭할 수 있는 서열번호 9와 서열번호 10의 프라이머(표4)를 이용하여 PCR 및 염기서열 분석을 수행하였고, 해당 유전적 조작을 확인하였다. 이렇게 수득한 균주를 코리네박테리움 글루타미쿰 KCCM11016P::PgapA-Son 로 명명하였다.
프라이머 서열
No. 명칭 DNA 서열
서열번호 9 Tn-1 TAAGGCACCGCAGAATGTAG
서열번호 10 Tn-2 TAGGACTCACCATCACCGGC
실시예 4: 외래 막단백질이 도입된 KCCM11016P 균주에서 L-아미노산 생산능 비교
KCCM11016P::PgapA-Son 균주와 대조구 KCCM11016P를 아래와 같은 방법으로 배양하여, 균체량, 당소모능, 아미노산 생산능을 비교하였다.
먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주를 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 37℃에서 42 시간 동안, 200 rpm에서 진탕 배양하였다. 배양 종료 후 HPLC에 의해 L-아미노산의 생산량을 측정하였다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 22 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 45 g, (NH4)2SO4 15 g, 대두 단백질 10 g, 당밀 10 g, KH2PO4 0.55 g, MgSO4·7H2O 0.6 g, 바이오틴 0.9 mg, 티아민 염산염 4.5 mg, 칼슘-판토텐산 4.5 mg, 니코틴아미드 30 mg, MnSO4 9 mg, FeSO4 9 mg, ZnSO4 0.45 mg, CuSO4 0.45 mg, CaCO3 30 g (증류수 1리터 기준).
상기 실험은 3번 반복되었으며, 배양 결과(평균값)는 표 5에 나타내었다.
L-아미노산 생산능 비교 (KCCM11016P)
균 주 OD562 소모당 (g/L) 라이신 농도 (g/L) 아르기닌 농도
(mg/L)		 히스티딘 농도
(mg/L)
KCCM11016P 33.6 50.0 12.1 24.5 0
KCCM11016P::PgapA-Son 28.3 50.0 14.4 317.0 20.4
표 5에 나타난 바와 같이, KCCM11016P::PgapA-Son 균주는 대조균주인 KCCM11016P와 비교하여 증가된 아미노산 생산능을 보였다.상기 KCCM11016P::PgapA-Son 균주(Coryneacterium glutamicum CA03-1359)는 2020년 10월 29일자로 부다페스트 조약하의 국제기탁기관인 한국미생물보존센터(KCCM)에 국제기탁하여 KCCM 12827P로 기탁번호를 부여받았다.
실시예 5: 외래 막단백질이 도입된 KCCM10770P 균주에서 L-아미노산 생산능 비교
상기 실시예 3에 기술한 방법을 이용하여 코리네박테리움 글루타미쿰 KCCM10770P (대한민국등록특허 제10-0924065호) 균주의 게놈상 트랜스포존 위치에 PgapA-Son 유전자가 삽입된 균주를 획득하였다. 이렇게 수득한 균주를 코리네박테리움 글루타미쿰 KCCM10770P::PgapA-Son 로 명명하였다.
KCCM10770P::PgapA-Son 균주와 대조구 KCCM10770P를 배양하여, 균체량, 당소모능, 아미노산 생산능을 비교하였다 (실시예 4 참조). 상기 실험은 3번 반복되었으며, 배양 결과(평균값)는 표 6에 나타내었다.
L-아미노산 생산능 비교 (KCCM10770P)
균 주 OD562 소모당 (g/L) 라이신 생산량 (g/L) 아르기닌 농도
(mg/L)		 히스티딘 농도
(mg/L)
KCCM10770P 67.1 50 8.1 17.9 0
KCCM10770P::PgapA-Son 57.4 50 11.4 402.3 12.8
표 6에 나타난 바와 같이, KCCM10770P::PgapA-Son 균주는 대조균주인 KCCM10770P와 비교하여 증가된 아미노산 생산능을 보였다.
실시예 6: 외래 막단백질이 도입된 CJ3P 균주에서 L-아미노산 생산능 비교
야생주에 3종의 변이[pyc(P458S), hom(V59A), lysC(T311I)]를 도입하여 L-라이신 생산능을 갖게 된 코리네박테리움 글루타미쿰 CJ3P(US 9556463 B2) 균주의 게놈상 트랜스포존 위치에 상기 실시예 3에 기술한 방법을 이용하여 PgapA-Son 유전자가 삽입된 균주를 획득하였다. 이렇게 수득한 균주를 코리네박테리움 글루타미쿰 CJ3P::PgapA-Son 로 명명하였다.
CJ3P::PgapA-Son 균주와 대조구 CJ3P 를 배양하여, 균체량, 당소모능, 아미노산 생산능을 비교하였다 (실시예 4 참조). 상기 실험은 3번 반복되었으며, 배양 결과(평균값)는 표 7에 나타내었다.
L-아미노산 생산능 비교 (CJ3P)
균 주 OD562 소모당 (g/L) 라이신 생산량 (g/L) 아르기닌 농도
(mg/L)		 히스티딘 농도
(mg/L)
CJ3P 75.5 50 3.4 53.4 12.4
CJ3P::PgapA-Son 69.7 50 4.5 560.1 70.3
표 7에 나타난 바와 같이, CJ3P::PgapA-Son 균주는 대조균주인 CJ3P 와 비교하여 증가된 아미노산 생산능을 보였다.이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
[수탁번호]
기탁기관명: 한국미생물보존센터(국외)
수탁번호: KCCM12827
수탁일자: 20201029
Figure PCTKR2021017794-appb-img-000001

Claims (10)

  1. 서열번호 1의 쉬와넬라 오네이덴시스 (Shewanella oneidensis) 유래 막단백질 또는 이와 75% 이상의 서열 상동성을 갖는 막단백질을 발현하는, 코리네박테리움 속 미생물.
  2. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 상기 막단백질을 암호화하는 폴리뉴클레오타이드가 도입된 것인, 코리네박테리움 속 미생물.
  3. 제2항에 있어서, 상기 폴리뉴클레오타이드는 서열번호 2 또는 이와 75% 이상의 서열 상동성을 갖는 핵산 서열로 표현되는 것인, 코리네박테리움 속 미생물.
  4. 제1항 내지 제3항 중 어느 한 항에 있어서, 상기 막단백질을 발현하지 않는 코리네박테리움 속 미생물과 비교하여, L-아미노산의 생상능이 증가된, 코리네박테리움 속 미생물.
  5. 제4항에 있어서, 상기 L-아미노산은 L-라이신, L-아르기닌, 및 L-히스티딘으로 이루어진 군에서 선택된 1종 이상인, 미생물.
  6. 제1항 내지 제3항 중 어느 한 항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰인, 코리네박테리움 속 미생물.
  7. 제1항 내지 제3항 중 어느 한 항의 코리네박테리움 속 미생물을 포함하는, L-아미노산 생산용 조성물.
  8. 제7항에 있어서, 상기 L-아미노산은 L-라이신, L-아르기닌, 및 L-히스티딘으로 이루어진 군에서 선택된 1종 이상인, 조성물.
  9. 제1항 내지 제3항 중 어느 한 항의 코리네박테리움 속 미생물을 배지에서 배양하는 단계, 및
    상기 배양된 미생물, 배지, 또는 이들 모두로부터 L-아미노산을 회수하는 단계
    를 포함하는, L-아미노산의 생산 방법.
  10. 제9항에 있어서, 상기 L-아미노산은 L-라이신, L-아르기닌, 및 L-히스티딘으로 이루어진 군에서 선택된 1종 이상인, 방법.
PCT/KR2021/017794 2020-12-09 2021-11-29 쉬와넬라 오네이덴시스 유래 단백질을 발현하는 미생물, 및 이를 이용한 l-아미노산 생산 방법 WO2022124671A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP2023530306A JP2023550754A (ja) 2020-12-09 2021-11-29 シュワネラ・オネイデンシス由来蛋白質を発現する微生物、およびこれを利用したｌ－アミノ酸の生産方法
AU2021398436A AU2021398436A1 (en) 2020-12-09 2021-11-29 Shewanella oneidensis-derived protein expressing microorganism and l-amino acid producing method using same
MX2023006846A MX2023006846A (es) 2020-12-09 2021-11-29 Microorganismo que expresa una proteina derivada de shewanella oneidensis y metodo para producir l-aminoacido usando el mismo.
CN202180083053.2A CN116547297A (zh) 2020-12-09 2021-11-29 表达奥奈达湖希瓦氏菌衍生蛋白的微生物和使用其生产l-氨基酸的方法
EP21903717.3A EP4261287A1 (en) 2020-12-09 2021-11-29 Shewanella oneidensis-derived protein expressing microorganism and l-amino acid producing method using same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0171738 2020-12-09
KR1020200171738A KR102617168B1 (ko) 2020-12-09 2020-12-09 쉬와넬라 오네이덴시스 유래 단백질을 발현하는 미생물, 및 이를 이용한 l-아미노산 생산 방법

Publications (1)

Publication Number Publication Date
WO2022124671A1 true WO2022124671A1 (ko) 2022-06-16

Family

ID=81973757

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/017794 WO2022124671A1 (ko) 2020-12-09 2021-11-29 쉬와넬라 오네이덴시스 유래 단백질을 발현하는 미생물, 및 이를 이용한 l-아미노산 생산 방법

Country Status (8)

Country Link
EP (1) EP4261287A1 (ko)
JP (1) JP2023550754A (ko)
KR (1) KR102617168B1 (ko)
CN (1) CN116547297A (ko)
AR (1) AR126030A1 (ko)
AU (1) AU2021398436A1 (ko)
MX (1) MX2023006846A (ko)
WO (1) WO2022124671A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240000168A (ko) * 2022-06-23 2024-01-02 씨제이제일제당 (주) L-히스티딘 배출 단백질 및 이를 이용한 l-히스티딘 생산 방법
KR20240000169A (ko) * 2022-06-23 2024-01-02 씨제이제일제당 (주) L-히스티딘 배출 단백질 및 이를 이용한 l-히스티딘 생산 방법

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR0159812B1 (ko) 1995-12-20 1998-11-16 손경식 코리네박테리움 글루타미컴 씨에이치 77 및 이 균주를 이용한 l-라이신의 제조 방법
KR19990076708A (ko) * 1995-12-22 1999-10-15 아달베르트 베. 플라텐타이히, 하 엑스포트 캐리어의 활성 증대를 통한 미생물사용 아미노산 제조방법
JP2000189180A (ja) * 1998-12-30 2000-07-11 Ajinomoto Co Inc Ｌ―アミノ酸の製造法
JP2005253459A (ja) * 2004-03-10 2005-09-22 Centre For Dna Fingerprinting & Diagnostics 微生物を用いたアルギニン産生の方法
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
KR101126041B1 (ko) 2008-04-10 2012-03-19 씨제이제일제당 (주) 트랜스포존을 이용한 형질전환용 벡터, 상기 벡터로형질전환된 미생물 및 이를 이용한 ｌ-라이신 생산방법
US9556463B2 (en) 2013-10-15 2017-01-31 Cj Cheiljedang Corporation Genes encoding biofilm formation inhibitory proteins and a method for producing L-lysine using a bacterial strain with the inactivated genes
KR20200080163A (ko) * 2018-12-26 2020-07-06 대상 주식회사 L-아미노산을 생산하는 대장균 변이주 또는 코리네박테리움 글루타미컴 변이주 및 이를 이용한 l-아미노산의 생산 방법

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR0159812B1 (ko) 1995-12-20 1998-11-16 손경식 코리네박테리움 글루타미컴 씨에이치 77 및 이 균주를 이용한 l-라이신의 제조 방법
KR19990076708A (ko) * 1995-12-22 1999-10-15 아달베르트 베. 플라텐타이히, 하 엑스포트 캐리어의 활성 증대를 통한 미생물사용 아미노산 제조방법
JP2000189180A (ja) * 1998-12-30 2000-07-11 Ajinomoto Co Inc Ｌ―アミノ酸の製造法
JP2005253459A (ja) * 2004-03-10 2005-09-22 Centre For Dna Fingerprinting & Diagnostics 微生物を用いたアルギニン産生の方法
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
KR101126041B1 (ko) 2008-04-10 2012-03-19 씨제이제일제당 (주) 트랜스포존을 이용한 형질전환용 벡터, 상기 벡터로형질전환된 미생물 및 이를 이용한 ｌ-라이신 생산방법
US9556463B2 (en) 2013-10-15 2017-01-31 Cj Cheiljedang Corporation Genes encoding biofilm formation inhibitory proteins and a method for producing L-lysine using a bacterial strain with the inactivated genes
KR20200080163A (ko) * 2018-12-26 2020-07-06 대상 주식회사 L-아미노산을 생산하는 대장균 변이주 또는 코리네박테리움 글루타미컴 변이주 및 이를 이용한 l-아미노산의 생산 방법

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence And Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
APPL. MICROBIOL.BIOTECHNOL., vol. 52, 1999, pages 541 - 545
ATSCHUL, [S.] [F., J MOLEC BIOL, vol. 215, 1990, pages 403
CARILLO: "SIAM J Applied Math", vol. 48, 1988, pages: 1073
DATABASE Nucleotide ANONYMOUS : "Shewanella oneidensis MR-1, complete genome - Nucleotide - NCBI", XP055950477, retrieved from NCBI Database accession no. AE014299.2 *
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
DG GIBSON ET AL., NATURE METHODS, vol. 6, no. 5, May 2009 (2009-05-01)
GRIBSKOV ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 6745
J. SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET, vol. 16, 2000, pages 276 - 277, XP004200114, DOI: 10.1016/S0168-9525(00)02024-2
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482

Also Published As

Publication number Publication date
AU2021398436A1 (en) 2023-06-01
KR102617168B1 (ko) 2023-12-21
MX2023006846A (es) 2023-06-22
EP4261287A1 (en) 2023-10-18
KR20220081824A (ko) 2022-06-16
CN116547297A (zh) 2023-08-04
JP2023550754A (ja) 2023-12-05
AR126030A1 (es) 2023-09-06

Similar Documents

Publication Publication Date Title
WO2021162459A1 (ko) 변이형 LysE를 포함하는 미생물, 및 이를 이용한 L-아미노산 생산 방법
WO2009096689A2 (ko) 개량된 프로모터 및 이를 이용한 ｌ-라이신의 생산 방법
WO2019027267A2 (ko) Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
WO2009096690A2 (ko) 개량된 프로모터 및 이를 이용한 ｌ-라이신의 생산 방법
WO2011108808A2 (en) Enhanced promoter and method for producing l-lysine using the same
WO2022124671A1 (ko) 쉬와넬라 오네이덴시스 유래 단백질을 발현하는 미생물, 및 이를 이용한 l-아미노산 생산 방법
WO2014208981A1 (ko) Ｌ-라이신 생산능이 향상된 미생물 및 그를 이용하여 ｌ-라이신을 생산하는 방법
WO2017034165A1 (ko) L-라이신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
WO2016171392A1 (ko) 글루코네이트 리프레서 변이체, 이를 포함하는 l-라이신을 생산하는 미생물 및 이를 이용한 ｌ－라이신 생산방법
WO2017034164A1 (ko) L-라이신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
WO2015174655A1 (ko) L-라이신을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신의 생산방법
WO2015122569A1 (ko) L-쓰레오닌 생산능을 가지는 재조합 에스케리키아 속 미생물 및 이를 이용한 l-쓰레오닌의 생산방법
WO2011083933A2 (ko) Ｌ-오르니틴 또는 ｌ-아르기닌 생산 변이주 및 이의 제조방법
WO2022124670A1 (ko) 쉬와넬라 아틀란티카 유래 단백질을 발현하는 미생물, 및 이를 이용한 l-아미노산 생산 방법
WO2022191357A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022225320A1 (ko) 신규한 포스포글리세린산 디하이드로게나제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022225319A1 (ko) 신규한 l-세린 암모니아 분해 효소 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022149865A2 (ko) GlxR 단백질 변이체 또는 이를 이용한 쓰레오닌 생산방법
WO2016159536A1 (ko) 신규 프로모터 및 이의 용도
WO2022071638A1 (ko) L-시트룰린 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-시트룰린의 생산 방법
WO2022215800A1 (ko) 신규한 분지쇄아미노산 투과효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022191358A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2021133030A1 (ko) 사이토크롬 c 활성이 강화된 l-아미노산 생산 미생물 및 이를 이용한 l-아미노산 생산방법
WO2022231049A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2024019215A1 (ko) L-아르기닌 또는 l-시트룰린 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 또는 l-시트룰린의 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21903717

Country of ref document: EP

Kind code of ref document: A1

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023008128

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2023530306

Country of ref document: JP

ENP Entry into the national phase

Ref document number: 2021398436

Country of ref document: AU

Date of ref document: 20211129

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2023/006846

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 202180083053.2

Country of ref document: CN

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112023008128

Country of ref document: BR

Free format text: APRESENTAR PROCURACAO REGULAR, UMA VEZ QUE A PROCURACAO APRESENTADA NA PETICAO NO 870230035536 DE 27/04/2023 NAO POSSUI ASSINATURA DO OUTORGANTE.

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021903717

Country of ref document: EP

Effective date: 20230710

ENP Entry into the national phase

Ref document number: 112023008128

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230427