WO2023158174A9 - 시그마 38 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법 - Google Patents

시그마 38 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법 Download PDF

Info

Publication number
WO2023158174A9
WO2023158174A9 PCT/KR2023/002095 KR2023002095W WO2023158174A9 WO 2023158174 A9 WO2023158174 A9 WO 2023158174A9 KR 2023002095 W KR2023002095 W KR 2023002095W WO 2023158174 A9 WO2023158174 A9 WO 2023158174A9
Authority
WO
WIPO (PCT)
Prior art keywords
sigma
amino acid
aromatic amino
primer
variant
Prior art date
Application number
PCT/KR2023/002095
Other languages
English (en)
French (fr)
Other versions
WO2023158174A1 (ko
Inventor
김현영
양철민
한종윤
조영일
Original Assignee
대상 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대상 주식회사 filed Critical 대상 주식회사
Priority to CN202380008905.0A priority Critical patent/CN116940591A/zh
Publication of WO2023158174A1 publication Critical patent/WO2023158174A1/ko
Publication of WO2023158174A9 publication Critical patent/WO2023158174A9/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine

Definitions

  • the present invention relates to a new variant of Sigma 38 and a method for producing L-aromatic amino acids using the same.
  • Aromatic amino acids include phenylalanine, tyrosine, and tryptophan. Phenylalanine and tryptophan are essential amino acids that cannot be synthesized in the living body, and are a high value-added industry with a global market worth $300 billion annually.
  • the present invention aims to provide novel Sigma 38 variants.
  • the present invention provides polynucleotides encoding the variants.
  • the present invention provides a transformant containing the above variant or polynucleotide.
  • the present invention aims to provide a method for producing L-aromatic amino acids using the above transformant.
  • One aspect of the present invention provides a Sigma 38 variant consisting of the amino acid sequence of SEQ ID NO: 1, in which glutamine at position 37 in the amino acid sequence of SEQ ID NO: 3 is replaced with leucine.
  • “Sigma 38” used in the present invention is a type of sigma factor, a protein that binds to RNA polymerase, and plays a role in initiating transcription by recognizing and binding to the promoter of a gene.
  • the sigma 38 may be a gene encoding sigma 38 or a sequence substantially identical thereto.
  • “substantial identity” means that when each gene sequence, that is, a base sequence or nucleotide sequence, and any other nucleotide sequence are aligned and analyzed to match as much as possible, the other nucleotide sequence is at least 70%, 80% identical to each nucleotide sequence. It means having sequence homology of more than 90% or more than 98%.
  • Sigma 38 in the present invention is encoded by the rpoS gene and includes the amino acid sequence of SEQ ID NO: 3.
  • the amino acid sequence of SEQ ID NO: 3 may be derived from wild-type E. coli.
  • variant refers to the mutation of the variant by conservative substitution and/or modification of one or more amino acids at the N-terminus, C-terminus, and/or inside the amino acid sequence of a specific gene. It refers to a polypeptide that is different from the entire amino acid sequence but maintains functions or properties.
  • conservative substitution means replacing one amino acid with another amino acid with similar structural and/or chemical properties, and may have little or no effect on the activity of the protein or polypeptide.
  • variants include those in which one or more portions, such as the N-terminal leader sequence or transmembrane domain, are removed, or portions are removed from the N- and/or C-terminus of the mature protein. . These variants may have their abilities increased, unchanged, or decreased compared to the polypeptide before the mutation. In the present invention, variant may be used interchangeably with variant type, modification, variant polypeptide, mutated protein, mutation, etc.
  • the variant in the present invention is a Sigma 38 variant in which glutamine, the 37th amino acid in the amino acid sequence of SEQ ID NO: 3, is replaced with leucine, and may be composed of the amino acid sequence of SEQ ID NO: 1.
  • Another aspect of the invention provides a polynucleotide encoding the sigma 38 variant.
  • Polynucleotide used in the present invention is a strand of DNA or RNA of a certain length or more, which is a polymer of nucleotides in which nucleotide monomers are connected in a long chain by covalent bonds, and more specifically, the variant. refers to a polynucleotide fragment encoding .
  • the polynucleotide may include a base sequence encoding the amino acid sequence of SEQ ID NO: 1.
  • the polynucleotide may include the base sequence represented by SEQ ID NO: 2.
  • Another aspect of the present invention provides a vector containing a polynucleotide encoding the sigma 38 variant.
  • Another aspect of the present invention provides a transformant containing the Sigma 38 variant or polynucleotide.
  • vector refers to any type of nucleic acid sequence delivery structure used as a means to deliver and express a gene of interest in a host cell. Unless otherwise specified, the vector may refer to inserting and expressing the carried nucleic acid sequence into the host cell genome and/or allowing it to be expressed independently. These vectors contain essential regulatory elements that are operably linked so that the gene insert can be expressed, and “operably linked” means that the target gene and its regulatory sequences are functionally linked to each other to enable gene expression.
  • regulatory elements include promoters for performing transcription, optional operator sequences for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences regulating termination of transcription and translation.
  • the vector used in the present invention is not particularly limited as long as it can replicate within the host cell, and any vector known in the art can be used.
  • the vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state.
  • phage vectors or cosmid vectors include pWE15, M13, ⁇ MBL3, ⁇ MBL4, ⁇ IXII, ⁇ ASHII, ⁇ APII, ⁇ t10, ⁇ t11, Charon4A, Charon21A, etc.
  • plasmid vectors include pBR series, pUC series, pBluescriptII series, These include, but are not limited to, pGEM-based, pTZ-based, pCL-based and pET-based.
  • the vector can typically be constructed as a vector for cloning or as a vector for expression.
  • Vectors for expression can be those commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed through various methods known in the art.
  • Recombinant vectors can be constructed using prokaryotic cells or eukaryotic cells as hosts.
  • a strong promoter capable of advancing transcription e.g., pL ⁇ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter
  • It typically includes a ribosome binding site for initiation of translation and a transcription/translation termination sequence.
  • the origin of replication operating in the eukaryotic cell included in the vector includes the f1 origin of replication, SV40 origin of replication, pMB1 origin of replication, adeno origin of replication, AAV origin of replication, and BBV origin of replication. It is not limited.
  • promoters derived from the genome of mammalian cells e.g., metallothionine promoter
  • promoters derived from mammalian viruses e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter
  • adenovirus late promoter e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter
  • SV40 promoter e.g., cytomegalovirus promoter
  • the recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector and expresses the selection marker in the medium treated with the selection marker. Because only cells are viable, selection of transformed cells is possible.
  • Representative examples of the selection marker include kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.
  • a transformant can be created by inserting a recombinant vector into a host cell, and the transformant may be obtained by introducing a recombinant vector into an appropriate host cell.
  • the host cell is a cell capable of stably and continuously cloning or expressing the expression vector, and any host cell known in the art can be used.
  • E. coli JM109 When transforming prokaryotic cells to produce recombinant microorganisms, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli coli W3110, E. coli XL1-Blue, Bacillus subtilis, Bacillus thuringiensis, Salmonella Typhimurium, Serratia marcescens, and Pseudomonas species. It may be used, but is not limited to this.
  • yeast e.g., Saccharomyces cerevisiae
  • insect cells plant cells
  • animal cells such as Sp2/0, CHO K1
  • host cells e.g., CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc.
  • CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc. can be used, but are not limited thereto.
  • transformation refers to a phenomenon that artificially causes genetic changes by introducing foreign DNA into a host cell
  • transformat refers to a phenomenon in which foreign DNA is introduced into a target gene. It refers to a host cell that stably maintains expression.
  • an appropriate vector introduction technology is selected depending on the host cell to express the target gene or a recombinant vector containing the same within the host cell.
  • vector introduction can be performed using electroporation, heat-shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE- It may be performed by the dextran method, the cationic liposome method, the lithium acetate-DMSO method, or a combination thereof, but is not limited thereto.
  • the transformed gene can be expressed within the host cell, it can be included without limitation, whether it is inserted into the chromosome of the host cell or located outside the chromosome.
  • the transformant includes cells transfected, transformed, or infected with the recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.
  • the transformant may be a strain of the genus Escherichia .
  • the Escherichia genus strains include Escherichia coli , Escherichia albertii , Escherichia blattae , Escherichia fergusonii , and Escherichia hermann. Escherichia hermannii , Escherichia vulneris , etc., but are not limited thereto.
  • the transformant in the present invention is a strain containing the above-described Sigma 38 variant or a polynucleotide encoding the same, or a vector containing the same, a strain expressing the Sigma 38 variant or polynucleotide, or the Sigma 38 variant. It may be a strain that has activity against, but is not limited to this.
  • the transformant may have the ability to produce L-aromatic amino acids.
  • the transformant may naturally have the ability to produce L-aromatic amino acids, or may be artificially endowed with the ability to produce L-aromatic amino acids.
  • the transformant may have improved L-aromatic amino acid production ability due to a change in the activity of Sigma 38.
  • “Improved production capacity” as used in the present invention means increased productivity of L-aromatic amino acids compared to the parent strain.
  • the parent strain refers to a wild type or mutant strain that is subject to mutation, and includes a subject that is directly subject to mutation or transformed with a recombinant vector, etc.
  • the parent strain may be a wild-type Escherichia genus strain or an Escherichia genus strain mutated from the wild type.
  • the transformant according to the present invention exhibits increased L-aromatic amino acid production ability compared to the parent strain by changing the activity of Sigma 38 by introducing the Sigma 38 variant.
  • the L-aromatic amino acid production is more than 10% compared to the parent strain.
  • Another aspect of the present invention includes culturing the transformant in a medium; and recovering the L-aromatic amino acid from the transformant or the medium in which the transformant was cultured.
  • the culture can be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust the medium and culture conditions.
  • the medium may be a liquid medium, but is not limited thereto.
  • Cultivation methods may include, for example, batch culture, continuous culture, fed-batch culture, or combinations thereof, but are not limited thereto.
  • the medium must meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art.
  • Culture media for Escherichia strains may refer to known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981), but are not limited thereto.
  • the medium may contain various carbon sources, nitrogen sources, and trace element components.
  • Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, It includes fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These substances may be used individually or in mixtures, but are not limited thereto.
  • Nitrogen sources that may be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources can also be used individually or in a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but is not limited thereto. In addition, essential growth substances such as amino acids and vitamins may be included. Additionally, precursors appropriate for the culture medium may be used. The medium or individual components may be added to the culture medium in an appropriate manner in a batch or continuous manner during the culture process, but are not limited thereto.
  • the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, foam generation can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during culture. Additionally, in order to maintain the aerobic state of the culture medium, oxygen or oxygen-containing gas (e.g., air) can be injected into the culture medium.
  • the temperature of the culture medium may typically be 20°C to 45°C, for example, 25°C to 40°C. The culturing period may continue until the desired yield of useful material is obtained, for example, 10 to 160 hours.
  • the step of recovering L-aromatic amino acids from the cultured transformant or the medium in which the transformant was cultured is produced from the medium using a suitable method known in the art according to the culture method.
  • L-aromatic amino acids can be collected or recovered. Examples include centrifugation, filtration, extraction, nebulization, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g. ammonium sulfate precipitation), chromatography (e.g. ion exchange, affinity, hydrophobic and Methods such as size exclusion) can be used, but are not limited to this.
  • the step of recovering the L-aromatic amino acid may be performed by centrifuging the culture medium at low speed to remove biomass and separating the obtained supernatant through ion exchange chromatography.
  • the step of recovering the L-aromatic amino acid may include a process of purifying the L-aromatic amino acid.
  • the L-aromatic amino acid may be one or more selected from the group consisting of L-tryptophan, L-phenylalanine, and L-tyrosine.
  • the Sigma 38 variant according to the present invention changes protein activity by substituting one or more amino acids in the amino acid sequence constituting Sigma 38, so that a recombinant microorganism containing it can efficiently produce L-aromatic amino acids.
  • Figure 1 shows the structure of plasmid pDSG according to an embodiment of the present invention.
  • Figure 2 shows the structure of plasmid pDS9 according to an embodiment of the present invention.
  • the plasmid pDSG has an origin of replication that operates only in E. coli and has an ampicillin resistance gene and guide RNA (gRNA) expression mechanism.
  • Plasmid pDS9 has an origin of replication that functions only in Escherichia coli and has an expression mechanism for kanamycin resistance genes, ⁇ Red genes (exo, bet, and gam), and CAS9 from Streptococcus pyogenes .
  • each upstream and downstream fragment included a sequence that changes glutamine (Gln), the 37th amino acid residue of the rpoS gene, to leucine (Leu).
  • Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and the PCR amplification conditions were denaturation at 95°C for 10 seconds, annealing at 57°C for 15 seconds, and polymerization at 72°C for 10 seconds, repeated 30 times.
  • each gene fragment included a gRNA sequence targeting Gln of the rpoS gene.
  • gRNA was selected as the 20 mer in front of NGG of the sequence to induce mutation.
  • Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and the PCR amplification conditions were denaturation at 95°C for 10 seconds, annealing at 57°C for 15 seconds, and polymerization at 72°C for 15 seconds, repeated 30 times.
  • E. coli KCCM13013P and KCCM10016 were used as parent strains.
  • KCCM13013P strain or KCCM10016 strain was first transformed with plasmid pDS9, cultured on LB-Km solid medium (containing 25 g/L LB liquid medium and 50 mg/L kanamycin), and then colonies with kanamycin resistance were selected. Secondary transformation of pDSG-rpoS(Gln37Leu) plasmid into selected colonies was performed and cultured on LB-Amp&Km (LB liquid medium 25 g/L, containing 100 mg/L ampicillin and 50 mg/L kanamycin) solid medium, followed by ampicillin and kanamycin. After selecting resistant colonies, gene fragments were obtained through PCR using primer pairs of primer 17 and primer 18.
  • Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and PCR amplification conditions were denaturation at 95°C for 10 seconds, annealing at 57°C for 10 seconds, and polymerization at 72°C for 15 seconds, repeated 30 times. Macrogen was commissioned to confirm the sequence of the obtained gene fragment using the primer pair of primer 17 and primer 18.
  • the selected secondary transformants were subcultured seven times in LB liquid medium and colonies were selected on LB solid medium. Each colony was selectively cultured on LB, LB-Amp, and LB-Km solid media. Colonies that grew on LB solid media but did not grow on LB-Amp and LB-Km solid media were selected.
  • the strains produced in this way were named KCCM13013P_rpoS (Gln37Leu) and KCCM10016_rpoS (Gln37Leu), respectively.
  • Primer name sequence number Primer sequence (5'-3') primer 1 5 CAATTTTATTATAGTAATTGACTATTATAC primer 2 6 GGAACCCAGTCAATTTTATTATAGTAATTGACTATTATAC primer 3 7 ACTGGGTTCCTGTTCTACTAGTTTTAGAGGCTAGAAATAGC primer 4 8 TGTTCTACTAGTTTTAGAGGCTAGAATAGC primer 5 9 GAGCCTGTCGGCCTACCTGCT primer 6 10 CGGCCGGCATGAGCCTGTCG primer 7 11 ATGCCGGCCGGGTCCGGGAACAACAAGAAG primer 8 12 GGTCCGGGAACAACAAGAAG primer 9 13 GCCTTTTCGTCAAAAACCTC primer 10 14 TTCTACTAAGGCCTTTTTCGTCAAAAACCTC primer 11 15 CTTAGTAGAATTGGAACCCAGTGATAACGA primer 12 16 TTGGAACCCAGTGATAACGA Primer 13 17 CGGATCAGCCAGGTTGCC primer 14 18 CTCTACCGCGCGGATCAGCC primer 15 19 CGCGGTAGAGGAGCTCCTGAAA
  • the mutant strains KCCM13013P_rpoS (Gln37Leu) and KCCM10016_rpoS (Gln37Leu) into which the sigma 38 variant was introduced showed an improvement in both L-tryptophan and L-phenylalanine production by about 24% compared to the parent strains KCCM13013P and KCCM10016. Confirmed.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 시그마 38 신규 변이체 및 이를 이용한 L-방향족 아미노산 생산 방법에 관한 것으로, 상기 시그마 38 변이체는 시그마 38을 구성하는 아미노산 서열 중 하나 이상의 아미노산이 치환됨으로써 단백질 활성이 변화되어, 이를 포함하는 재조합 미생물은 L-방향족 아미노산을 효율적으로 생산할 수 있다.

Description

시그마 38 신규 변이체 및 이를 이용한 L-방향족 아미노산 생산 방법
본 발명은 시그마 38 신규 변이체 및 이를 이용한 L-방향족 아미노산 생산 방법에 관한 것이다.
아미노산은 곁사슬의 성질에 따라 소수성, 친수성, 염기성 및 산성 아미노산으로 구분되며, 이들 중 벤젠 고리를 갖는 아미노산을 방향족 아미노산이라 한다. 방향족 아미노산에는 페닐알라닌, 티로신 및 트립토판이 있으며, 페닐알라닌과 트립토판은 생체 내에서 합성되지 않는 필수 아미노산으로 전세계적으로 연간 3000억 달러 규모의 시장을 형성하고 있는 고부가가치 산업에 해당한다.
방향족 아미노산의 생산은 자연상태에서 수득된 야생형 균주나 이의 아미노산 생산능이 향상되도록 변형된 변이주를 이용할 수 있다. 최근에는 방향족 아미노산의 생산 효율을 개선시키기 위해 L-아미노산과 같은 유용물질 생산에 많이 이용되는 대장균, 코리네박테리움 등의 미생물을 대상으로 유전자 재조합 기술을 적용하여 우수한 L-방향족 아미노산 생산능을 갖는 다양한 재조합 균주 또는 변이주 및 이를 이용한 L-방향족 아미노산 생산 방법이 개발되고 있다. 특히 L-방향족 아미노산의 생합성 경로에 관여하는 효소, 전사인자, 수송 단백질 등의 유전자를 대상으로 하거나, 또는 이들의 발현을 조절하는 프로모터에 변이를 유도하여 해당 아미노산의 생산량을 증대시키려는 시도가 있었다. 그러나 L-방향족 아미노산 생산에 직간접적으로 연관된 효소, 전사인자, 수송 단백질 등 단백질의 종류가 수십여 종에 이르기 때문에 이러한 단백질의 활성 변화에 따른 L-방향족 아미노산 생산능 증가 여부에 관해 여전히 많은 연구가 필요한 실정이다.
[선행기술문헌]
[특허문헌]
한국 등록특허 제10-1830002호
본 발명은 신규한 시그마 38 변이체를 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 변이체를 암호화하는 폴리뉴클레오티드를 제공한다.
또한, 본 발명은 상기 변이체 또는 폴리뉴클레오티드를 포함하는 형질전환체를 제공한다.
또한, 본 발명은 상기 형질전환체를 이용한 L-방향족 아미노산의 생산 방법을 제공하는 것을 목적으로 한다.
본 발명의 일 양상은 서열번호 3의 아미노산 서열에서 37번째 글루타민이 류신으로 치환된, 서열번호 1의 아미노산 서열로 이루어진 시그마 38 변이체를 제공한다.
본 발명에서 사용된 “시그마 38”은 RNA 중합효소에 결합하는 단백질인 시그마 인자(sigma factor)의 일종으로, 유전자의 프로모터를 인지하고 결합하여 전사를 개시하는 역할을 한다. 상기 시그마 38은 시그마 38을 암호화하는 유전자 또는 이와 실질적 동일성을 가지는 서열일 수 있다. 여기서 “실질적 동일성”이란 각각의 유전자 서열, 즉 염기서열 또는 뉴클레오티드 서열과 임의의 다른 뉴클레오티드 서열을 최대한 대응되도록 정렬하여 분석하였을 때 상기 임의의 다른 뉴클레오티드 서열이 각각의 뉴클레오티드 서열과 70% 이상, 80% 이상, 90% 이상 또는 98% 이상의 서열 상동성을 가지는 것을 의미한다.
본 발명에서의 시그마 38은 rpoS 유전자에 의해 암호화된 것으로, 서열번호 3의 아미노산 서열을 포함한다.
본 발명의 일 구체예에 따르면, 상기 서열번호 3의 아미노산 서열은 야생형 대장균에서 유래한 것일 수 있다.
본 발명에서 사용된 “변이체”는 특정 유전자의 아미노산 서열 중 N-말단, C-말단 및/또는 내부에서 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)되어 상기 변이체의 변이 전 아미노산 서열과 상이하나 기능(functions) 또는 특성(properties)이 유지되는 폴리펩티드를 의미한다. 여기서 “보존적 치환”이란 하나의 아미노산을 구조적 및/또는 화학적 성질이 유사한 다른 아미노산으로 치환시키는 것을 의미하며, 단백질 또는 폴리펩티드의 활성에 거의 영향을 미치지 않거나, 또는 전혀 영향을 미치지 않을 수 있다. 또한, 변이체는 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거되거나, 또는 성숙 단백질(mature protein)의 N- 및/또는 C-말단으로부터 일부분이 제거된 것을 포함한다. 이러한 변이체는 그 능력이 변이 전 폴리펩티드에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다. 본 발명에서는 변이체가 변이형, 변형, 변이형 폴리펩티드, 변이된 단백질, 변이 등과 혼용될 수 있다.
본 발명에서의 변이체는 서열번호 3의 아미노산 서열에서 37번째 위치한 아미노산인 글루타민이 류신으로 치환된 시그마 38 변이체로, 서열번호 1의 아미노산 서열로 이루어진 것일 수 있다.
본 발명의 다른 양상은 상기 시그마 38 변이체를 암호화하는 폴리뉴클레오티드를 제공한다.
본 발명에서 사용된 “폴리뉴클레오티드(polynucleotide)”는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이체를 암호화하는 폴리뉴클레오티드 단편을 의미한다.
상기 폴리뉴클레오티드는 서열번호 1의 아미노산 서열을 암호화하는 염기서열을 포함할 수 있다.
본 발명의 일 구체예에 따르면, 상기 폴리뉴클레오티드는 서열번호 2로 표시되는 염기서열을 포함하는 것일 수 있다.
본 발명의 다른 양상은 상기 시그마 38 변이체를 암호화하는 폴리뉴클레오티드를 포함하는 벡터를 제공한다.
또한, 본 발명의 다른 양상은 상기 시그마 38 변이체 또는 폴리뉴클레오티드를 포함하는 형질전환체를 제공한다.
본 발명에서 사용된 “벡터(vector)”는 숙주세포에 목적 유전자를 전달하여 발현시키기 위한 수단으로 사용되는 모든 유형의 핵산 서열 운반 구조체를 의미한다. 상기 벡터는 특별한 언급이 없는 한, 담지된 핵산 서열이 숙주세포 유전체 내 삽입되어 발현되도록 하는 것 및/또는 독자적으로 발현되도록 하는 것을 의미할 수 있다. 이러한 벡터는 유전자 삽입물이 발현되도록 작동가능하게 연결된 필수적인 조절요소를 포함하며, “작동가능하게 연결된(operably linked)”이란 목적 유전자와 이의 조절 서열이 서로 기능적으로 결합되어 유전자 발현을 가능케 하는 방식으로 연결된 것을 의미하고, “조절요소”는 전사를 수행하기 위한 프로모터, 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 암호화하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함한다.
본 발명에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이라면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 상기 벡터의 일례로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들면, 파지 벡터 또는 코스미드 벡터로는 pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A 등이 있으며, 플라스미드 벡터로는 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등이 있으나, 이에 한정되는 것은 않는다.
상기 벡터는 전형적으로 클로닝을 위한 벡터 또는 발현을 위한 벡터로서 구축될 수 있다. 발현을 위한 벡터는 당업계에서 식물, 동물 또는 미생물에서 외래의 유전자 또는 단백질을 발현하는데 사용되는 통상의 것을 사용할 수 있으며, 당업계에 공지된 다양한 방법을 통해 구축될 수 있다.
재조합 벡터는 원핵세포 또는 진핵세포를 숙주로 하여 구축될 수 있다. 예를 들어, 사용되는 벡터가 발현 벡터이고 원핵세포를 숙주로 하는 경우에는, 전사를 진행시킬 수 있는 강력한 프로모터 (예컨대, pLλ프로모터, CMV 프로모터, trp 프로모터, lac 프로모터, tac 프로모터, T7 프로모터), 해독의 개시를 위한 라이보좀 결합 자리 및 전사/해독 종결 서열을 포함하는 것이 일반적이다. 진핵세포를 숙주로 하는 경우에는, 벡터에 포함되는 진핵세포에서 작동하는 복제원점은 f1 복제원점, SV40 복제원점, pMB1 복제원점, 아데노 복제원점, AAV 복제원점 및 BBV 복제원점 등을 포함하나, 이에 한정되는 것은 아니다. 또한, 포유동물 세포의 게놈으로부터 유래된 프로모터 (예컨대, 메탈로 티오닌 프로모터) 또는 포유동물 바이러스로부터 유래된 프로모터 (예컨대, 아데노 바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, 사이토 메갈로 바이러스 프로모터, HSV의 tk 프로모터)가 이용될 수 있으며, 전사 종결 서열로서 폴리아데닐화 서열을 일반적으로 가진다.
상기 재조합 벡터는 선택 마커(selection marker)를 포함할 수 있는데, 상기 선택 마커는 벡터로 형질전환된 형질전환체 (숙주세포)를 선별하기 위한 것으로 상기 선택 마커가 처리된 배지에서 선택 마커를 발현하는 세포만 생존할 수 있기 때문에, 형질전환된 세포의 선별이 가능하다. 상기 선택 마커는 대표적인 예로 카나마이신, 스트렙토마이신, 클로람페니콜 등이 있으나, 이에 한정되는 것은 아니다.
재조합 벡터를 숙주세포에 삽입함으로써 형질전환체를 만들 수 있으며, 상기 형질전환체는 재조합 벡터를 적절한 숙주세포에 도입시킴으로써 얻어진 것일 수 있다. 숙주세포는 상기 발현벡터를 안정되면서 연속적으로 클로닝 또는 발현시킬 수 있는 세포로서 당업계에 공지된 어떠한 숙주세포도 이용할 수 있다.
재조합 미생물을 제작하기 위하여 원핵세포에 형질전환시키는 경우에는 숙주세포로서 E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, E. coli XL1-Blue와 같은 대장균 속 균주, 바실러스 서브틸리스, 바실러스 츄린겐시스와 같은 바실러스 속 균주, 살모넬라 티피무리움, 세라티아 마르세슨스 및 슈도모나스 종과 같은 다양한 장내균과 균주 등이 이용되는 것일 수 있으나, 이에 한정되는 것은 아니다.
재조합 미생물을 제작하기 위하여 진핵세포에 형질전환을 하는 경우에는 숙주세포로서 효모 (예컨대, 사카로마이세스 세레비지에), 곤충 세포, 식물 세포 및 동물 세포, 예를 들어, Sp2/0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK 세포주 등이 이용될 수 있으나, 이에 한정되는 것은 아니다.
본 발명에서 사용된 “형질전환(transformation)”은 외부 DNA를 숙주세포 내로 도입하여 인위적으로 유전적인 변화를 일으키는 현상을 의미하며, “형질전환체(transformat)”는 외부 DNA가 도입되어 목적 유전자의 발현을 안정적으로 유지하는 숙주세포를 의미한다.
상기 형질전환은 숙주세포에 따라 적합한 벡터 도입 기술이 선택되어 목적 유전자 또는 이를 포함하는 재조합 벡터를 숙주세포 내에서 발현시킬 수 있다. 예를 들면, 벡터 도입은 전기천공법(electroporation), 열 충격(heat-shock), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌글리콜(PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 초산 리튬-DMSO법, 또는 이들의 조합에 의해 수행될 수 있으나, 이에 한정되는 것은 아니다. 형질전환된 유전자는 숙주세포 내에서 발현될 수 있으면 숙주세포의 염색체 내 삽입 또는 염색체 외에 위치하고 있는 것이든 제한하지 않고 포함될 수 있다.
상기 형질전환체는 생체내 또는 시험관내에서 본 발명에 따른 재조합 벡터로 형질감염, 형질전환, 또는 감염된 세포를 포함하며, 재조합 숙주세포, 재조합 세포 또는 재조합 미생물과 동일한 용어로 사용될 수 있다.
본 발명의 일 구체예에 따르면, 상기 형질전환체는 에스케리치아(Escherichia) 속 균주인 것일 수 있다.
상기 에스케리치아 속 균주로는 에스케리치아 콜라이(Escherichia coli), 에스케리치아 알베르티(Escherichia albertii), 에스케리치아 블라태(Escherichia blattae), 에스케리치아 퍼구소니(Escherichia fergusonii), 에스케리치아 헤르만니(Escherichia hermannii), 에스케리치아 불네리스(Escherichia vulneris) 등이 있으나, 이에 한정되는 것은 아니다.
본 발명에서의 형질전환체는 전술한 시그마 38 변이체 또는 이를 암호화하는 폴리뉴클레오티드를 포함하거나, 또는 이를 포함하는 벡터를 포함하는 균주, 상기 시그마 38 변이체 또는 폴리뉴클레오티드를 발현하는 균주, 또는 상기 시그마 38 변이체에 대한 활성을 가지는 균주일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 상기 형질전환체는 L-방향족 아미노산 생산능을 가지는 것일 수 있다.
상기 형질전환체는 자연적으로 L-방향족 아미노산 생산능을 가지고 있거나, 또는 인위적으로 L-방향족 아미노산 생산능이 부여된 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 형질전환체는 시그마 38의 활성이 변화되어 L-방향족 아미노산 생산능이 향상된 것일 수 있다.
본 발명에서 사용된 “생산능이 향상된”은 모균주에 비해 L-방향족 아미노산의 생산성이 증가된 것을 의미한다. 상기 모균주는 변이의 대상이 되는 야생형 또는 변이주를 의미하며, 직접 변이의 대상이 되거나 재조합된 벡터 등으로 형질전환되는 대상을 포함한다. 본 발명에 있어서, 모균주는 야생형 에스케리치아 속 균주 또는 야생형으로부터 변이된 에스케리치아 속 균주일 수 있다.
본 발명에 따른 형질전환체는 시그마 38 변이체가 도입됨으로써 시그마 38의 활성이 변화하여 모균주에 비해 증가된 L-방향족 아미노산 생산능을 나타내며, 특히 모균주에 비해 L-방향족 아미노산 생산량이 10% 이상, 구체적으로는 10 내지 80% (바람직하게는 20 내지 60%) 증가되어 균주 배양액 1 ℓ 당 3 ~ 20 g의 L-방향족 아미노산을 생산할 수 있다.
본 발명의 다른 양상은 상기 형질전환체를 배지에서 배양하는 단계; 및 상기 형질전환체 또는 형질전환체가 배양된 배지로부터 L-방향족 아미노산을 회수하는 단계를 포함하는 L-방향족 아미노산의 생산 방법을 제공한다.
상기 배양은 당업계에 알려진 적절한 배지와 배양 조건에 따라 이루어질 수 있으며, 통상의 기술자라면 배지 및 배양 조건을 용이하게 조정하여 사용할 수 있다. 구체적으로, 상기 배지는 액체 배지일 수 있으나, 이에 한정되는 것은 아니다. 배양 방법은 예를 들면, 회분식 배양(batch culture), 연속식 배양(continuous culture), 유가식 배양(fed-batch culture) 또는 이들의 조합 배양을 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 상기 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 하며, 통상의 기술자에 의해 적절하게 변형될 수 있다. 에스케리치아 속 균주에 대한 배양 배지는 공지된 문헌 (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981)을 참조할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 배지에 다양한 탄소원, 질소원 및 미량원소 성분을 포함할 수 있다. 사용될 수 있는 탄소원으로는 글루코스, 수크로스, 락토스, 프락토스, 말토스, 전분, 셀룰로스와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있으나, 이에 한정되는 것은 아니다. 사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산 암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함될 수 있다. 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있으나 이에 한정되는 것은 아니다. 사용될 수 있는 인의 공급원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함될 수 있으며, 이에 한정되는 것은 아니다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있으며, 이에 한정되는 것은 아니다. 그 외에, 아미노산 및 비타민과 같은 필수 성장 물질이 포함될 수 있다. 또한 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기 배지 또는 개별 성분은 배양과정에서 배양액에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 미생물 배양액에 적절한 방식으로 첨가하여 배양액의 pH를 조정할 수 있다. 또한, 배양 중에 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 추가적으로, 배양액의 호기 상태를 유지하기 위하여, 배양액 내로 산소 또는 산소-함유 기체 (예, 공기)를 주입할 수 있다. 배양액의 온도는 통상 20℃ 내지 45℃, 예를 들면 25℃ 내지 40℃일 수 있다. 배양기간은 유용물질이 원하는 생산량으로 수득될 때까지 계속될 수 있으며, 예를 들면 10 내지 160 시간일 수 있다.
본 발명의 일 구체예에 따르면, 상기 배양된 형질전환체 또는 형질전환체가 배양된 배지에서 L-방향족 아미노산을 회수하는 단계는 배양 방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배지로부터 생산된 L-방향족 아미노산을 수집 또는 회수할 수 있다. 예를 들면 원심분리, 여과, 추출, 분무, 건조, 증발, 침전, 결정화, 전기영동, 분별용해 (예를 들면, 암모늄 설페이트 침전), 크로마토그래피 (예를 들면, 이온 교환, 친화성, 소수성 및 크기배제) 등의 방법을 사용할 수 있으나, 이에 한정되는 것은 않는다.
본 발명의 일 구체예에 따르면, 상기 L-방향족 아미노산을 회수하는 단계는 배양 배지를 저속 원심분리하여 바이오매스를 제거하고 얻어진 상등액을 이온교환 크로마토그래피를 통하여 분리할 수 있다.
본 발명의 일 구체예에 따르면, 상기 L-방향족 아미노산을 회수하는 단계는 L-방향족 아미노산을 정제하는 공정을 포함할 수 있다.
본 발명의 일 구체예에 따르면, 상기 L-방향족 아미노산은 L-트립토판, L-페닐알라닌 및 L-티로신으로 이루어진 군에서 선택된 1종 이상인 것일 수 있다.
본 발명에 따른 시그마 38 변이체는 시그마 38을 구성하는 아미노산 서열 중 하나 이상의 아미노산이 치환됨으로써 단백질 활성이 변화되어, 이를 포함하는 재조합 미생물은 L-방향족 아미노산을 효율적으로 생산할 수 있다.
도 1은 본 발명의 일 실시예에 따른 플라스미드 pDSG의 구조를 나타낸 것이다.
도 2는 본 발명의 일 실시예에 따른 플라스미드 pDS9의 구조를 나타낸 것이다.
이하, 본 발명을 보다 상세하게 설명한다. 그러나, 이러한 설명은 본 발명의 이해를 돕기 위하여 예시적으로 제시된 것일 뿐, 본 발명의 범위가 이러한 예시적인 설명에 의하여 제한되는 것은 아니다.
실시예 1. 시그마 38 변이체를 발현하는 균주 제작
시그마 38의 아미노산 서열 (서열번호 3) 중 37번째 위치한 글루타민이 류신으로 치환된 변이체가 L-방향족 아미노산의 생산에 미치는 영향을 확인하기 위해 상기 시그마 38 변이체를 발현하는 벡터 및 상기 벡터가 도입된 균주를 제작하였다. 균주 내 시그마 38 변이체의 유전자 삽입을 위해 플라스미드 pDSG 및 pDS9를 사용하여 다음과 같이 제작하였다.
여기서 플라스미드 pDSG는 대장균에서만 작용하는 복제원점을 가지며, 암피실린 내성 유전자 및 가이드 RNA(gRNA) 발현 기전을 가진다. 플라스미드 pDS9는 대장균에서만 작용하는 복제원점을 가지며, 카나마이신 내성 유전자, λ Red 유전자 (exo, bet 및 gam) 및 Streptococcus pyogenes 유래 CAS9 발현 기전을 가진다.
1-1. 형질전환용 벡터 pDSG-rpoS(Gln37Leu) 제작
대장균(Escherichia coli) MG1655 (KCTC14419BP) gDNA를 주형으로 프라이머 7 및 프라이머 9의 프라이머 쌍과 프라이머 8 및 프라이머 10의 프라이머 쌍을 이용하여 시그마 38을 암호화하는 대장균 rpoS 유전자의 37번 아미노산 변이의 upstream 단편과, 프라이머 11 및 프라이머 13의 프라이머 쌍과 프라이머 12 및 프라이머 14의 프라이머 쌍을 이용하여 대장균 rpoS 유전자의 37번 아미노산 변이의 downstream 단편을 각각 PCR 수행을 통해 수득하였다. 이때 각 upstream과 downstream 단편에는 rpoS 유전자의 37번째 아미노산 잔기인 글루타민(Gln)을 류신(Leu)으로 변경하는 서열을 포함시켰다. 여기서 중합효소는 Takara PrimeSTAR Max DNA polymerase를 사용하였으며, PCR 증폭 조건은 95℃에서 10초 변성, 57℃ 15초 어닐링 및 72℃ 10초 중합을 30회 반복하여 수행하였다.
플라스미드 pDSG를 주형으로 프라이머 3 및 프라이머 5의 프라이머 쌍, 프라이머 4 및 프라이머 6의 프라이머 쌍, 프라이머 15 및 프라이머 1, 및 프라이머 16 및 프라이머 2의 프라이머 쌍을 각각 이용하여 4개의 pDSG 유전자 단편을 PCR 수행을 통해 수득하였다. 이때 각 유전자 단편에는 rpoS 유전자의 Gln를 타겟하는 gRNA 서열을 포함시켰다. gRNA는 변이를 유발하고자 하는 서열의 NGG 앞 20 mer로 선택하였다. 여기서 중합효소는 Takara PrimeSTAR Max DNA polymerase를 사용하였으며, PCR 증폭 조건은 95℃에서 10초 변성, 57℃ 15초 어닐링 및 72℃ 15초 중합을 30회 반복하여 수행하였다.
수득된 rpoS 유전자의 37번 아미노산의 upstream과 downstream, 그리고 4개의 pDSG 유전자 단편들을 self-assembly cloning 방법 (BioTechniques 51:55-56 (July 2011))을 이용하여 클로닝하여 재조합 플라스미드를 획득하였으며, 이를 pDSG-rpoS(Gln37Leu)로 명명하였다.
1-2. 시그마 38 변이체 rpoS(Gln37Leu)가 도입된 L-트립토판 또는 L-페닐알라닌 생산 균주 제작
L-트립토판 생산 균주 및 L-페닐알라닌 생산 균주를 제작하기 위해 모균주로서 대장균 KCCM13013P 및 KCCM10016을 이용하였다.
KCCM13013P 균주 또는 KCCM10016 균주에 플라스미드 pDS9을 1차 형질전환하여 LB-Km (LB 액체배지 25 g/L 및 카나마이신 50 mg/L 함유) 고체배지에서 배양한 후 카나마이신 내성을 가지는 콜로니를 선별하였다. 선별된 콜로니에 pDSG-rpoS(Gln37Leu) 플라스미드를 2차 형질전환하여 LB-Amp&Km (LB 액체배지 25 g/L, 암피실린 100 mg/L 및 카나마이신 50 mg/L 함유) 고체배지에서 배양하여 암피실린 및 카나마이신 내성을 가지는 콜로니를 선별한 후 프라이머 17 및 프라이머 18의 프라이머 쌍을 이용하여 PCR 수행을 통해 유전자 단편을 수득하였다. 중합효소는 Takara PrimeSTAR Max DNA polymerase를 사용하였으며, PCR 증폭 조건은 95℃에서 10초 변성, 57℃ 10초 어닐링 및 72℃ 15초 중합을 30회 반복하여 수행하였다. 마크로젠에 위탁하여 프라이머 17 및 프라이머 18의 프라이머 쌍을 이용하여 수득된 유전자 단편의 서열을 확인하였다.
선별된 2차 형질전환체는 LB 액체배지에서 7번 계대배양하여 LB 고체배지에서 콜로니를 선별하였다. 각 콜로니를 LB, LB-Amp 및 LB-Km 고체배지에서 각각 선별적으로 배양하였다. LB 고체배지에서 생장하면서 LB-Amp 및 LB-Km 고체배지에서 생육하지 않는 콜로니를 선별하였다. 이와 같은 방법으로 제작된 균주를 각각 KCCM13013P_rpoS(Gln37Leu) 및 KCCM10016_rpoS(Gln37Leu)로 명명하였다
실시예 1에서 사용된 프라이머 서열은 하기 표 1과 같다.
프라이머 명칭 서열번호 프라이머 서열 (5'-3')
프라이머 1 5 CAATTTTATTATAGTAATTGACTATTATAC
프라이머 2 6 GGAACCCAGTCAATTTTATTATAGTAATTGACTATTATAC
프라이머 3 7 ACTGGGTTCCTGTTCTACTAGTTTTAGAGCTAGAAATAGC
프라이머 4 8 TGTTCTACTAGTTTTAGAGCTAGAAATAGC
프라이머 5 9 GAGCCTGTCGGCCTACCTGCT
프라이머 6 10 CGGCCGGCATGAGCCTGTCG
프라이머 7 11 ATGCCGGCCGGGTCCGGGAACAACAAGAAG
프라이머 8 12 GGTCCGGGAACAACAAGAAG
프라이머 9 13 GCCTTTTCGTCAAAAACCTC
프라이머 10 14 TTCTACTAAGGCCTTTTCGTCAAAAACCTC
프라이머 11 15 CTTAGTAGAATTGGAACCCAGTGATAACGA
프라이머 12 16 TTGGAACCCAGTGATAACGA
프라이머 13 17 CGGATCAGCCCCAGGTTGCC
프라이머 14 18 CTCTACCGCGCGGATCAGCC
프라이머 15 19 CGCGGTAGAGGAGCTCCTGAAAATCTCGATAAC
프라이머 16 20 GAGCTCCTGAAAATCTCGATAAC
프라이머 17 21 GGCCGCGTTGTTTATGCTGG
프라이머 18 22 CTGGTGCGTATGGGCGGTAA
실험예 1. 시그마 38 변이체가 도입된 변이주의 L-방향족 아미노산 생산능 평가
모균주 (KCCM13013P 및 KCCM10016)와 시그마 38 변이체가 도입된 변이주 (KCCM13013P_rpoS(Gln37Leu) 및 KCCM10016_rpoS(Gln37Leu))의 L-트립토판 또는 L-페닐알라닌 생산능을 비교하였다.
하기 표 2의 트립토판 생산용 배지 또는 페닐알라닌 생산용 배지 10 mL가 담긴 100 mL 플라스크에 각 균주 (모균주 또는 변이주)를 부피 기준으로 1%씩 접종하여 37℃, 200 rpm의 조건으로 72시간 진탕 배양하였다. 배양 종료 후 HPLC (Agilent)를 사용하여 배지 내 L-트립토판 또는 L-페닐알라닌의 농도를 측정하였고, 그 결과를 각각 하기 표 3 및 4에 나타내었다.
트립토판 생산용 배지 페닐알라닌 생산용 배지
성분 함량 성분 함량
Glucose 80.0 g/L Glucose 80.0 g/L
(NH4)2SO4 20.0 g/L (NH4)2SO4 20.0 g/L
K2HPO4 0.8 g/L K2HPO4 1.0 g/L
K2SO4 0.4 g/L KH2PO4 1.0 g/L
MgCl2 0.8 g/L K2SO4 0.4 g/L
Fumaric acid 1.0 g/L MgCl2 1.0 g/L
Yeast extract 1.0 g/L Fumaric acid 0.5 g/L
(NH4)6Mo7O24 0.12 ppm Yeast extract 1.0 g/L
H3BO3 0.01 ppm Glutamic acid 0.5 g/L
CuSO4 0.01 ppm CaCl2 5.00 ppm
MnCl2 2.00 ppm MnCl2 2.00 ppm
ZnSO4 0.01 ppm ZnSO4 1.00 ppm
CoCl2 0.10 ppm CoCl2 0.10 ppm
FeCl2 10.00 ppm FeCl2 10.00 ppm
Thiamine_HCl 20.00 ppm Thiamine_HCl 20.00 ppm
L-Tyrosine 200.00 ppm L-Tyrosine 200.00 ppm
L-phenylalanine 300.00 ppm CaCO3 3%
CaCO3 3% - -
pH 7.0 with NaOH (33%) pH 7.0 with NaOH (33%)
균주 L-트립토판 농도
(g/L)		 L-트립토판 농도 증가율
(%)
KCCM13013P 4.02 -
KCCM13013P_rpoS(Gln37Leu) 5.00 24.3
균주 L-페닐알라닌 농도
(g/L)		 L- 페닐알라닌 농도 증가율
(%)
KCCM10016 3.01 -
KCCM10016_rpoS(Gln37Leu) 3.74 24.2
상기 표 3 및 4에 나타낸 바와 같이, 시그마 38 변이체가 도입된 변이주 KCCM13013P_rpoS(Gln37Leu) 및 KCCM10016_rpoS(Gln37Leu)는 모균주 KCCM13013P 및 KCCM10016에 비해 L-트립토판 및 L-페닐알라닌 생산량이 모두 약 24%씩 향상된 것으로 확인되었다.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.
Figure PCTKR2023002095-appb-img-000001
Figure PCTKR2023002095-appb-img-000002
[규칙 제91조에 의한 정정 16.08.2023]
Figure WO-DOC-FIGURE-87

Claims (7)

  1. 서열번호 3의 아미노산 서열에서 37번째 글루타민이 류신으로 치환된, 서열번호 1의 아미노산 서열로 이루어진 시그마 38 변이체.
  2. 청구항 1의 변이체를 암호화하는 폴리뉴클레오티드.
  3. 청구항 1의 변이체 또는 청구항 2의 폴리뉴클레오티드를 포함하는 형질전환체.
  4. 청구항 3에 있어서,
    상기 형질전환체는 에스케리치아(Escherichia) 속 균주인 것인 형질전환체.
  5. 청구항 3에 있어서,
    상기 형질전환체는 L-방향족 아미노산 생산능을 가지는 것인 형질전환체.
  6. 청구항 3의 형질전환체를 배지에서 배양하는 단계; 및
    상기 형질전환체 또는 형질전환체가 배양된 배지로부터 L-방향족 아미노산을 회수하는 단계를 포함하는 L-방향족 아미노산의 생산 방법.
  7. 청구항 6에 있어서,
    상기 L-방향족 아미노산은 L-트립토판, L-페닐알라닌 및 L-티로신으로 이루어진 군에서 선택된 1종 이상인 것인 방법.
PCT/KR2023/002095 2022-02-16 2023-02-14 시그마 38 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법 WO2023158174A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202380008905.0A CN116940591A (zh) 2022-02-16 2023-02-14 西格玛38新型变体及利用其的l-芳香族氨基酸的生产方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0020011 2022-02-16
KR1020220020011A KR20230123543A (ko) 2022-02-16 2022-02-16 시그마 38 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법

Publications (2)

Publication Number Publication Date
WO2023158174A1 WO2023158174A1 (ko) 2023-08-24
WO2023158174A9 true WO2023158174A9 (ko) 2023-09-28

Family

ID=87578511

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/002095 WO2023158174A1 (ko) 2022-02-16 2023-02-14 시그마 38 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법

Country Status (3)

Country Link
KR (2) KR20230123543A (ko)
CN (1) CN116940591A (ko)
WO (1) WO2023158174A1 (ko)

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7319026B2 (en) * 2002-03-07 2008-01-15 Degussa Ag Amino acid-producing bacteria and a process for preparing L-amino acids
DE102004003411A1 (de) * 2004-01-23 2005-09-01 Degussa Ag Verfahren zur Herstellung von L-Aminosäuren unter Verwendung von Stämmen der Familie Enterobacteriaceae
EP2700715B1 (de) * 2012-08-20 2018-07-25 Evonik Degussa GmbH Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung von verbesserten Stämmen der Familie Enterobacteriaceae
KR101830002B1 (ko) 2016-10-11 2018-02-19 대상 주식회사 부기질의 공급 강화를 통한 l-트립토판이 과발현되는 균주 및 이를 이용하는 l-트립토판의 제조 방법
KR102284730B1 (ko) * 2021-04-28 2021-08-02 씨제이제일제당 주식회사 신규한 수용성 피리딘 뉴클레오티드 트랜스수소효소 변이체 및 이를 이용한 l-트립토판 생산 방법

Also Published As

Publication number Publication date
KR20230127949A (ko) 2023-09-01
WO2023158174A1 (ko) 2023-08-24
KR20230123543A (ko) 2023-08-24
CN116940591A (zh) 2023-10-24

Similar Documents

Publication Publication Date Title
WO2023158029A1 (ko) Atp 신타아제 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법
WO2023158175A9 (ko) 수송단백질 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법
WO2021162189A1 (ko) L-글루탐산 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-글루탐산의 생산 방법
WO2023158174A9 (ko) 시그마 38 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법
WO2023158176A9 (ko) 스트레스 단백질 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법
WO2023158030A1 (ko) 징크 바인딩 디하이드로게나제 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법
WO2022191357A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2024090885A1 (ko) Dna-결합 전사 제어인자 malt 신규 변이체 및 이를 이용한 l-방향족 아미노산의 생산 방법
WO2024090883A1 (ko) 피루베이트 인산화효소 2 신규 변이체 및 이를 이용한 l-방향족 아미노산의 생산 방법
WO2024090884A1 (ko) 페닐알라닌:h+ 동시수송체 phep 신규 변이체 및 이를 이용한 l-방향족 아미노산의 생산 방법
WO2021201489A1 (ko) 글루타민 생산능을 향상시키는 형질전환용 재조합 벡터 및 이를 도입한 균주
WO2022050527A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2024096219A1 (ko) L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법
WO2024096218A1 (ko) L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법
WO2024014696A1 (ko) L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법
WO2024014698A1 (ko) L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법
WO2024014699A1 (ko) L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법
WO2024096217A1 (ko) L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법
WO2024014697A1 (ko) L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법
WO2024014700A1 (ko) L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법
WO2022231049A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022231054A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
WO2022191358A1 (ko) L-라이신 생산능이 향상된 코리네박테리움 글루타미쿰 변이주 및 이를 이용한 l-라이신의 생산 방법
KR102614733B1 (ko) 포스포에놀피루베이트 카르복실라아제 신규 변이체 및 이를 이용한 5’-이노신산 생산 방법
WO2024019216A1 (ko) L-아르기닌 또는 l-시트룰린 생산능이 향상된 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 또는 l-시트룰린의 생산 방법

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 202380008905.0

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23721822

Country of ref document: EP

Kind code of ref document: A1