WO2022046944A2 - Methods and compositions relating to glp1r variants - Google Patents

Methods and compositions relating to glp1r variants Download PDF

Info

Publication number
WO2022046944A2
WO2022046944A2 PCT/US2021/047616 US2021047616W WO2022046944A2 WO 2022046944 A2 WO2022046944 A2 WO 2022046944A2 US 2021047616 W US2021047616 W US 2021047616W WO 2022046944 A2 WO2022046944 A2 WO 2022046944A2
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
instances
seq
nos
glp1r
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/047616
Other languages
English (en)
French (fr)
Other versions
WO2022046944A3 (en
Inventor
Aaron Sato
Pankaj Garg
Qiang Liu
Fumiko Axelrod
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Twist Bioscience Corp
Original Assignee
Twist Bioscience Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Twist Bioscience Corp filed Critical Twist Bioscience Corp
Priority to EP21862681.0A priority Critical patent/EP4204460A4/en
Priority to CA3190667A priority patent/CA3190667A1/en
Priority to JP2023513296A priority patent/JP7836295B2/ja
Priority to CN202180073480.2A priority patent/CN116829946A/zh
Priority to AU2021331088A priority patent/AU2021331088A1/en
Priority to KR1020237010070A priority patent/KR20230074151A/ko
Publication of WO2022046944A2 publication Critical patent/WO2022046944A2/en
Publication of WO2022046944A3 publication Critical patent/WO2022046944A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2869Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against hormone receptors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/005Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies constructed by phage libraries
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/06Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/64Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising a combination of variable region and constant region components
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/75Agonist effect on antigen
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/94Stability, e.g. half-life, pH, temperature or enzyme-resistance
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2318/00Antibody mimetics or scaffolds
    • C07K2318/10Immunoglobulin or domain(s) thereof as scaffolds for inserted non-Ig peptide sequences, e.g. for vaccination purposes

Definitions

  • G protein-coupled receptors are implicated in a wide variety of diseases. Raising antibodies to GPCRs has been difficult due to problems in obtaining suitable antigens because GPCRs are often expressed at low levels in cells and are very unstable when purified. Thus, there is a need for improved agents for therapeutic intervention which target GPCRs.
  • antibodies or antibody fragments that binds GLP1R comprising an immunoglobulin heavy chain and an immunoglobulin light chain: (a) wherein the immunoglobulin heavy chain comprises an amino acid sequence at least about 90% identical to that set forth in Table 9; and (b) wherein the immunoglobulin light chain comprises an amino acid sequence at least about 90% identical to that set forth in Table 10.
  • antibodies or antibody fragments wherein the antibody is a monoclonal antibody, a polyclonal antibody, a bi- specific antibody, a multispecific antibody, a grafted antibody, a human antibody, a humanized antibody, a synthetic antibody, a chimeric antibody, a camelized antibody, a single-chain Fvs (scFv), a single chain antibody, a Fab fragment, a F(ab')2 fragment, a Fd fragment, a Fv fragment, a single-domain antibody, an isolated complementarity determining region (CDR), a diabody, a fragment comprised of only a single monomeric variable domain, disulfide-linked Fvs (sdFv), an intrabody, an anti -idiotypic (anti-Id) antibody, or ab antigen-binding fragments thereof.
  • scFv single chain antibody
  • Fab fragment a F(ab')2 fragment
  • Fd fragment fragment
  • a single-domain antibody an isolated complementarity
  • antibodies or antibody fragments wherein the antibody or antibody fragment thereof is chimeric or humanized. Further provided herein are antibodies or antibody fragments, wherein the antibody or antibody fragment has an EC50 less than about 25 nanomolar in a cAMP assay. Further provided herein are antibodies or antibody fragments, wherein the antibody or antibody fragment has an EC50 less than about 20 nanomolar in a cAMP assay. Further provided herein are antibodies or antibody fragments, wherein the antibody or antibody fragment has an EC50 less than about 10 nanomolar in a cAMP assay. Further provided herein are antibodies or antibody fragments, wherein the antibody or antibody fragment is an agonist of GLP1R.
  • antibodies or antibody fragments wherein the antibody or antibody fragment is an antagonist of GLP1R. Further provided herein are antibodies or antibody fragments, wherein the antibody or antibody fragment is an allosteric modulator of GLP1R. Further provided herein are antibodies or antibody fragments, wherein the allosteric modulator of GLP1R is a negative allosteric modulator.
  • the antibody is a monoclonal antibody, a polyclonal antibody, a bi-specific antibody, a multispecific antibody, a grafted antibody, a human antibody, a humanized antibody, a synthetic antibody, a chimeric antibody, a camelized antibody, a single-chain Fvs (scFv), a single chain antibody, a Fab fragment, a F(ab')2 fragment, a Fd fragment, a Fv fragment, a single-domain antibody, an isolated complementarity determining region (CDR), a diabody, a fragment comprised of only a single monomeric variable domain, disulfide-linked Fvs (sdFv), an intrabody, an anti- idiotypic (anti-Id) antibody,
  • the antibody or antibody fragment thereof is chimeric or humanized. Further provided herein are methods, wherein the antibody or antibody fragment has an EC50 less than about 25 nanomolar in a cAMP assay. Further provided herein are methods, wherein the antibody or antibody fragment has an EC50 less than about 20 nanomolar in a cAMP assay. Further provided herein are methods, wherein the antibody or antibody fragment has an EC50 less than about 10 nanomolar in a cAMP assay. Further provided herein are methods, wherein the antibody or antibody fragment is an agonist of GLP1R. Further provided herein are methods, wherein the antibody or antibody fragment is an antagonist of GLP1R.
  • the antibody or antibody fragment is an allosteric modulator of GLP1R. Further provided herein are methods, wherein the allosteric modulator of GLP1R is a negative allosteric modulator. Further provided herein are methods, wherein the antibody or antibody fragment is an allosteric modulator. Further provided herein are methods, wherein the antibody or antibody fragment is a negative allosteric modulator. Further provided herein are methods, wherein the metabolic disease or disorder is Type II diabetes or obesity.
  • antibodies or antibody fragments comprising a variable domain, heavy chain region (VH) and a variable domain, light chain region (VL), wherein VH comprises complementarity determining regions CDRH1, CDRH2, and CDRH3, wherein VL comprises complementarity determining regions CDRL1, CDRL2, and CDRL3, and wherein (a) an amino acid sequence of CDRH1 is as set forth in any one of SEQ ID NOs: 441-619; (b) an amino acid sequence of CDRH2 is as set forth in any one of SEQ ID NOs: 620-798; (c) an amino acid sequence of CDRH3 is as set forth in any one of SEQ ID NOs: 799-977; (d) an amino acid sequence of CDRL1 is as set forth in any one of SEQ ID NOs: 978-1156; (e) an amino acid sequence of CDRL2 is as set forth in any one of SEQ ID NOs: 1157-1168; and (f) an amino acid sequence of CDRL3 is as
  • antibodies or antibody fragments wherein the antibody is a monoclonal antibody, a polyclonal antibody, a bi-specific antibody, a multispecific antibody, a grafted antibody, a human antibody, a humanized antibody, a synthetic antibody, a chimeric antibody, a camelized antibody, a singlechain Fvs (scFv), a single chain antibody, a Fab fragment, a F(ab')2 fragment, a Fd fragment, a Fv fragment, a single-domain antibody, an isolated complementarity determining region (CDR), a diabody, a fragment comprised of only a single monomeric variable domain, disulfide-linked Fvs (sdFv), an intrabody, an anti -idiotypic (anti-Id) antibody, or ab antigen-binding fragments thereof.
  • scFv singlechain Fvs
  • CDR complementarity determining region
  • antibodies or antibody fragments wherein the antibody or antibody fragment thereof is chimeric or humanized. Further provided herein are antibodies or antibody fragments, wherein the antibody or antibody fragment has an EC50 less than about 25 nanomolar in a cAMP assay. Further provided herein are antibodies or antibody fragments, wherein the antibody or antibody fragment has an EC50 less than about 20 nanomolar in a cAMP assay. Further provided herein are antibodies or antibody fragments, wherein the antibody or antibody fragment has an EC50 less than about 10 nanomolar in a cAMP assay. Further provided herein are antibodies or antibody fragments, wherein the antibody or antibody fragment is an agonist of GLP1R. Further provided herein are antibodies or antibody fragments, wherein the antibody or antibody fragment is an antagonist of GLP1R. Further provided herein are antibodies or antibody fragments, wherein the antibody or antibody fragment is an allosteric modulator of GLP1R.
  • antibodies or antibody fragments wherein the allosteric modulator of GLP1R is a negative allosteric modulator.
  • the VH comprises a sequence at least about 90% identical to any one of SEQ ID NOs: 58-77.
  • antibodies or antibody fragments wherein the VH comprises a sequence of any one of SEQ ID NOs: 58-77.
  • the VL comprises a sequence at least about 90% identical to any one of SEQ ID NOs: 92-111.
  • antibodies or antibody fragments, wherein the VL comprises a sequence of any one of SEQ ID NOs: 92-111.
  • a metabolic disease or disorder comprising administering an antibody or antibody fragment that binds GLP1R comprising a variable domain, heavy chain region (VH) and a variable domain, light chain region (VL), wherein VH comprises complementarity determining regions CDRH1, CDRH2, and CDRH3, wherein VL comprises complementarity determining regions CDRL1, CDRL2, and CDRL3, and wherein (a) an amino acid sequence of CDRH1 is as set forth in any one of SEQ ID NOs: 441-619; (b) an amino acid sequence of CDRH2 is as set forth in any one of SEQ ID NOs: 620-798; (c) an amino acid sequence of CDRH3 is as set forth in any one of SEQ ID NOs: 799-977; (d) an amino acid sequence of CDRL1 is as set forth in any one of SEQ ID NOs: 978-1156; (e) an amino acid sequence of CDRL2 is as set forth in any one of SEQ ID NO
  • the antibody is a monoclonal antibody, a polyclonal antibody, a bi-specific antibody, a multispecific antibody, a grafted antibody, a human antibody, a humanized antibody, a synthetic antibody, a chimeric antibody, a camelized antibody, a single-chain Fvs (scFv), a single chain antibody, a Fab fragment, a F(ab')2 fragment, a Fd fragment, a Fv fragment, a single-domain antibody, an isolated complementarity determining region (CDR), a diabody, a fragment comprised of only a single monomeric variable domain, disulfide-linked Fvs (sdFv), an intrabody, an anti- idiotypic (anti-Id) antibody, or ab antigen-binding fragments thereof.
  • scFv single chain antibody
  • Fab fragment a F(ab')2 fragment
  • Fd fragment fragment
  • a single-domain antibody an isolated complementarity determining region (CDR)
  • the antibody or antibody fragment thereof is chimeric or humanized. Further provided herein are methods, wherein the antibody or antibody fragment has an EC50 less than about 25 nanomolar in a cAMP assay. Further provided herein are methods, wherein the antibody or antibody fragment has an EC50 less than about 20 nanomolar in a cAMP assay. Further provided herein are methods, wherein the antibody or antibody fragment has an EC50 less than about 10 nanomolar in a cAMP assay. Further provided herein are methods, wherein the antibody or antibody fragment is an agonist of GLP1R. Further provided herein are methods, wherein the antibody or antibody fragment is an antagonist of GLP1R.
  • the antibody or antibody fragment is an allosteric modulator of GLP1R. Further provided herein are methods, wherein the allosteric modulator of GLP1R is a negative allosteric modulator. Further provided herein are methods, wherein the antibody or antibody fragment is an allosteric modulator. Further provided herein are methods, wherein the antibody or antibody fragment is a negative allosteric modulator. Further provided herein are methods, wherein the VH comprises a sequence at least about 90% identical to any one of SEQ ID NOs: 58-77. Further provided herein are methods, wherein the VH comprises a sequence of any one of SEQ ID NOs: 58-77.
  • VL comprises a sequence at least about 90% identical to any one of SEQ ID NOs: 92-111. Further provided herein are methods, wherein the VL comprises a sequence of any one of SEQ ID NOs: 92-111. Further provided herein are methods, wherein the metabolic disease or disorder is Type II diabetes or obesity.
  • nucleic acid compositions comprising: a) a first nucleic acid encoding a variable domain, heavy chain region (VH) comprising complementarity determining regions CDRH1, CDRH2, and CDRH3, and wherein (i) an amino acid sequence of CDRH1 is as set forth in any one of SEQ ID NOs: 441-619; (ii) an amino acid sequence of CDRH2 is as set forth in any one of SEQ ID NOs: 620-798; (iii) an amino acid sequence of CDRH3 is as set forth in any one of SEQ ID NOs: 799-977; b) a second nucleic acid encoding a variable domain, light chain region (VL) comprising complementarity determining regions CDRL1, CDRL2, and CDRL3, and wherein (i) an amino acid sequence of CDRL1 is as set forth in any one of SEQ ID NOs: 978-1156;
  • an amino acid sequence of CDRL2 is as set forth in any one of SEQ ID NOs: 1157-1168;
  • an amino acid sequence of CDRL3 is as set forth in any one of SEQ ID NOs: 1169-1347.
  • nucleic acid compositions comprising: a) a first nucleic acid encoding a variable domain, heavy chain region (VH) comprising an amino acid sequence at least about 90% identical to a sequence as set forth in any one of SEQ ID NOs: 58-77; b) a second nucleic acid encoding a variable domain, light chain region (VL) comprising at least about 90% identical to a sequence as set forth in any one of SEQ ID NOs: 92-111; and an excipient.
  • VH variable domain, heavy chain region
  • VL variable domain, light chain region
  • nucleic acid compositions wherein the VL comprises an amino acid sequence as set forth in any one of SEQ ID NOs: 92-111.
  • nucleic acid compositions wherein the VH comprises an amino acid sequence as set forth in any one of SEQ ID NOs: 58-77, and wherein the VL comprises an amino acid sequence as set forth in any one of SEQ ID NOs: 92-111.
  • Figure 1A depicts a first schematic of an immunoglobulin.
  • Figure IB depicts a second schematic of an immunoglobulin.
  • Figure 2 depicts a schematic of a motif for placement in an immunoglobulin.
  • Figure 3 presents a diagram of steps demonstrating an exemplary process workflow for gene synthesis as disclosed herein.
  • Figure 4 illustrates an example of a computer system.
  • Figure 5 is a block diagram illustrating an architecture of a computer system.
  • Figure 6 is a diagram demonstrating a network configured to incorporate a plurality of computer systems, a plurality of cell phones and personal data assistants, and Network Attached Storage (NAS).
  • NAS Network Attached Storage
  • Figure 7 is a block diagram of a multiprocessor computer system using a shared virtual address memory space.
  • Figure 8A depicts a schematic of an immunoglobulin comprising a VH domain attached to a VL domain using a linker.
  • Figure 8B depicts a schematic of a full-domain architecture of an immunoglobulin comprising a VH domain attached to a VL domain using a linker, a leader sequence, and pill sequence.
  • Figure 8C depicts a schematic of four framework elements (FW1, FW2, FW3, FW4) and the variable 3 CDR (LI, L2, L3) elements for a VL or VH domain.
  • Figure 9A depicts a structure of Glucagon-like peptide 1 (GLP-1, cyan) in complex with GLP-1 receptor (GLP-1R, grey), PDB entry 5VAI.
  • Figure 9B depicts a crystal structure of CXCR4 chemokine receptor (grey) in complex with a cyclic peptide antagonist CVX15 (blue), PDB entry 3OR0.
  • Figure 9C depicts a crystal structure of human smoothened receptor with the transmembrane domain in grey and extracellular domain (ECD) in orange, PDB entry 5L7D.
  • ECD transmembrane domain in grey and extracellular domain
  • PDB entry 5L7D extracellular domain
  • the ECD contacts the TMD through extracellular loop 3 (ECL3).
  • Figure 9D depicts a structure of GLP-1R (grey) in complex with a Fab (magenta), PDB entry 6LN2.
  • Figure 9E depicts a crystal structure of CXCR4 (grey) in complex with a viral chemokine antagonist Viral macrophage inflammatory protein 2 (vMIP-II, green), PDB entry 4RWS.
  • Figure 10 depicts a schema of the GPCR focused library design. Two germline heavy chain VH1-69 and VH3-30; 4 germline light chain IGKV1-39 and IGKV3-15, and IGLV1-51 and IGLV2-14.
  • Figure 11 depicts a graph of HCDR3 length distribution in the GPCR-focused library compared to the HCDR3 length distribution in B-cell populations from three healthy adult donors. In total, 2,444,718 unique VH sequences from the GPCR library and 2,481,511 unique VH sequences from human B-cell repertoire were analyzed to generate the length distribution plot.
  • Figure 12A depicts the design of the over-expressing GLP-1R CHO cells for the phage antibody library selection. GLP-1R expression was confirmed by the gating of double detection of GFP green fluorescence and the surface expression of Flag tag on the cell surface.
  • Figure 12B depicts a cell-based panning process.
  • Figure 13 depicts a graph of percent unique HCDR3 in the output pools of the five GLP-1R panning rounds.
  • Figure 14 depicts a graph of binding plots of the 13 unique GLP-1R Hits, compared to the parental CHO cell binding.
  • Figure 15 depicts HCDR3 loop sequences of the 13 unique GLP1R binders. Six of the clones have a GLP-1 motif, four of the clones have a GLP-2 motif, and three clones do not have a GLP-1 or GLP-2 motif. For the clones that have the GLP-1 or GLP-2 motif, residues that are similar to the GLP-1 sequence or the GLP-2 sequence are colored in black and the residues that are different are colored red. Functional antagonists in the cAMP assay are highlighted in yellow.
  • Figure 16A depicts a graph of orthosteric inhibition of GLP1R-3 binding in the absence and presence of GLP-1 (7-36).
  • Figure 16B depicts a graph of effects of GLP1R-3 on GLP-1 activation in the cAMP assay.
  • Figure 16C depicts a graph of effects of GLP1R-3 on GLP-1 induced P-arrestin recruitment.
  • Figure 17 depicts a design of GLP1R-59-2.
  • the GLP1 (7-36) peptide was linked to the N-terminal of light chain of the functionally inactive GLP-1R binding antibody GLP1R-2.
  • Figure 18A depicts a graph of GLP1R-59-2 binding specifically to the GLP-1R with an EC50 of 15.5 nM.
  • Figure 18B depicts a graph of GLP1R-59-2 in the cAMP assay with a similar EC50 as the GLP-1 7-36 peptide.
  • Figure 18C depicts a graph of GLP1R-59-2 on inducing the P-arrestin recruitment in GLP-1R expression cells.
  • FIGs 19A-19B depict in vivo pharmacokinetic (PK) and pharmacodynamic (PD) effects of GLP1R-3 and GLP1R-59-2.
  • PK pharmacokinetic
  • PD pharmacodynamic
  • Figure 20A depicts a graph of GLP1R-59-2 on glucose after glucose challenge.
  • Figure 20B depicts a graph of Area Under the Curve (AUC) in a glucose tolerance test
  • FIG. 21A depicts a graph of GLP1R-3 and GLP-1 peptide Exendin 9-39 treatment, 19+2 hour dosing regimen
  • Figure 21B depicts a graph of Area Under the Curve (AUC) in an insulin tolerance test (ITT).
  • Figure 22A depicts a graph of GLP1R-3 treatment, single 6 hour dosing regimen after insulin challenge, as compared to GLP-1 peptide Exendin 9-39 (1.0 or 0.23 mg/kg dose) or control.
  • Figure 22B depicts a graph of Area Under the Curve (AUC) of GLP1R-3 (20mg/kg) treatment at 6 hours in an ITT.
  • AUC Area Under the Curve
  • Figure 23A depicts a graph of GLP1R-3 treatment, single 6 hour dosing regimen after insulin challenge, as compared to GLP1R-226-1, GLP1R-226-2, or control.
  • Figure 23B depicts a graph Area Under the Curve (AUC) of GLP1R-3 treatment, single 6 hour dosing regimen after insulin challenge, as compared to GLP1R-226-1, GLP1R-226-2, or control.
  • AUC Area Under the Curve
  • Figures 24A-24B are schemas of panning strategy for GLP1R-221 and GLP1R-222 variants.
  • Figures 25A-25B are graphs of competition data for GLP1R-221 and GLP1R-222 variants.
  • Figure 26 is a graph of GLP1R-221 and GLP1R-222 variants in a cAMP assay.
  • nucleic acid encompasses double- or triple-stranded nucleic acids, as well as single-stranded molecules.
  • nucleic acid strands need not be coextensive (i.e., a double-stranded nucleic acid need not be double-stranded along the entire length of both strands).
  • Nucleic acid sequences, when provided, are listed in the 5’ to 3’ direction, unless stated otherwise. Methods described herein provide for the generation of isolated nucleic acids. Methods described herein additionally provide for the generation of isolated and purified nucleic acids.
  • a “nucleic acid” as referred to herein can comprise at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, or more bases in length.
  • polypeptide-segments encoding nucleotide sequences, including sequences encoding non-ribosomal peptides (NRPs), sequences encoding non-ribosomal peptidesynthetase (NRPS) modules and synthetic variants, polypeptide segments of other modular proteins, such as antibodies, polypeptide segments from other protein families, including noncoding DNA or RNA, such as regulatory sequences e.g. promoters, transcription factors, enhancers, siRNA, shRNA, RNAi, miRNA, small nucleolar RNA derived from microRNA, or any functional or structural DNA or RNA unit of interest.
  • NRPs non-ribosomal peptides
  • NRPS non-ribosomal peptidesynthetase
  • synthetic variants polypeptide segments of other modular proteins, such as antibodies, polypeptide segments from other protein families, including noncoding DNA or RNA, such as regulatory sequences e.g. promoters, transcription factors, enhancers,
  • polynucleotides coding or non-coding regions of a gene or gene fragment, intergenic DNA, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), small nucleolar RNA, ribozymes, complementary DNA (cDNA), which is a DNA representation of mRNA, usually obtained by reverse transcription of messenger RNA (mRNA) or by amplification; DNA molecules produced synthetically or by amplification, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
  • cDNA encoding for a gene or gene fragment referred herein may comprise at least one region encoding for exon sequences
  • GPCR G protein-coupled receptor
  • GLP1R glucagon-like peptide-1 receptor
  • Immunoglobulins as described herein can stably support a GPCR binding domain.
  • the GPCR binding domain may be designed based on surface interactions of a GLP1R ligand and GLP1R.
  • Libraries as described herein may be further variegated to provide for variant libraries comprising nucleic acids each encoding for a predetermined variant of at least one predetermined reference nucleic acid sequence. Further described herein are protein libraries that may be generated when the nucleic acid libraries are translated.
  • nucleic acid libraries as described herein are transferred into cells to generate a cell library.
  • downstream applications for the libraries synthesized using methods described herein include identification of variant nucleic acids or protein sequences with enhanced biologically relevant functions, e.g., improved stability, affinity, binding, functional activity, and for the treatment or prevention of a disease state associated with GPCR signaling.
  • the immunoglobulin is an antibody.
  • the term antibody will be understood to include proteins having the characteristic two-armed, Y-shape of a typical antibody molecule as well as one or more fragments of an antibody that retain the ability to specifically bind to an antigen.
  • Exemplary antibodies include, but are not limited to, a monoclonal antibody, a polyclonal antibody, a bi-specific antibody, a multispecific antibody, a grafted antibody, a human antibody, a humanized antibody, a synthetic antibody, a chimeric antibody, a camelized antibody, a single-chain Fvs (scFv) (including fragments in which the VL and VH are joined using recombinant methods by a synthetic or natural linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules, including single chain Fab and scFab), a single chain antibody, a Fab fragment (including monovalent fragments comprising the VL, VH, CL, and CHI domains), a F(ab')2 fragment (including bivalent fragments comprising two Fab fragments linked by a disulfide bridge at the hinge region), a Fd fragment (including fragments comprising the VH and CHI fragment), a Fv
  • the libraries disclosed herein comprise nucleic acids encoding for an immunoglobulin, wherein the immunoglobulin is a Fv antibody, including Fv antibodies comprised of the minimum antibody fragment which contains a complete antigen-recognition and antigen-binding site.
  • the Fv antibody consists of a dimer of one heavy chain and one light chain variable domain in tight, non-covalent association, and the three hypervariable regions of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer.
  • the six hypervariable regions confer antigen-binding specificity to the antibody.
  • a single variable domain (or half of an Fv comprising only three hypervariable regions specific for an antigen, including single domain antibodies isolated from camelid animals comprising one heavy chain variable domain such as VHH antibodies or nanobodies) has the ability to recognize and bind antigen.
  • the libraries disclosed herein comprise nucleic acids encoding for an immunoglobulin, wherein the immunoglobulin is a single-chain Fv or scFv, including antibody fragments comprising a VH, a VL, or both a VH and VL domain, wherein both domains are present in a single polypeptide chain.
  • the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains allowing the scFv to form the desired structure for antigen binding.
  • a scFv is linked to the Fc fragment or a VHH is linked to the Fc fragment (including minibodies).
  • the antibody comprises immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, e.g., molecules that contain an antigen binding site.
  • Immunoglobulin molecules are of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG 1, IgG 2, IgG 3, IgG 4, IgA 1 and IgA 2), or subclass.
  • type e.g., IgG, IgE, IgM, IgD, IgA and IgY
  • class e.g., IgG 1, IgG 2, IgG 3, IgG 4, IgA 1 and IgA 2
  • subclass e.g., IgG 1, IgG 2, IgG 3, IgG 4, IgA 1 and IgA 2
  • libraries comprise immunoglobulins that are adapted to the species of an intended therapeutic target.
  • these methods include “mammalization” and comprise methods for transferring donor antigen-binding information to a less immunogenic mammal antibody acceptor to generate useful therapeutic treatments.
  • the mammal is mouse, rat, equine, sheep, cow, primate (e.g., chimpanzee, baboon, gorilla, orangutan, monkey), dog, cat, pig, donkey, rabbit, or human.
  • primate e.g., chimpanzee, baboon, gorilla, orangutan, monkey
  • dog cat
  • pig donkey, rabbit, or human.
  • provided herein are libraries and methods for felinization and caninization of antibodies.
  • “Humanized” forms of non-human antibodies can be chimeric antibodies that contain minimal sequence derived from the non-human antibody.
  • a humanized antibody is generally a human antibody (recipient antibody) in which residues from one or more CDRs are replaced by residues from one or more CDRs of a non-human antibody (donor antibody).
  • the donor antibody can be any suitable non-human antibody, such as a mouse, rat, rabbit, chicken, or non-human primate antibody having a desired specificity, affinity, or biological effect.
  • selected framework region residues of the recipient antibody are replaced by the corresponding framework region residues from the donor antibody.
  • Humanized antibodies may also comprise residues that are not found in either the recipient antibody or the donor antibody. In some instances, these modifications are made to further refine antibody performance.
  • Caninization can comprise a method for transferring non-canine antigen-binding information from a donor antibody to a less immunogenic canine antibody acceptor to generate treatments useful as therapeutics in dogs.
  • caninized forms of non-canine antibodies provided herein are chimeric antibodies that contain minimal sequence derived from non-canine antibodies.
  • caninized antibodies are canine antibody sequences (“acceptor” or “recipient” antibody) in which hypervariable region residues of the recipient are replaced by hypervariable region residues from a non-canine species (“donor” antibody) such as mouse, rat, rabbit, cat, dogs, goat, chicken, bovine, horse, llama, camel, dromedaries, sharks, non- human primates, human, humanized, recombinant sequence, or an engineered sequence having the desired properties.
  • donor antibody such as mouse, rat, rabbit, cat, dogs, goat, chicken, bovine, horse, llama, camel, dromedaries, sharks, non- human primates, human, humanized, recombinant sequence, or an engineered sequence having the desired properties.
  • donor antibody such as mouse, rat, rabbit, cat, dogs, goat, chicken, bovine, horse, llama, camel, dromedaries, sharks, non- human primates, human, humanized, recombinant sequence
  • the caninized antibody may also comprise at least a portion of an immunoglobulin constant region (Fc) of a canine antibody.
  • Fc immunoglobulin constant region
  • felinization can comprise a method for transferring non-feline antigen-binding information from a donor antibody to a less immunogenic feline antibody acceptor to generate treatments useful as therapeutics in cats.
  • felinized forms of non-feline antibodies provided herein are chimeric antibodies that contain minimal sequence derived from non-feline antibodies.
  • felinized antibodies are feline antibody sequences (“acceptor” or “recipient” antibody) in which hypervariable region residues of the recipient are replaced by hypervariable region residues from a non-feline species (“donor” antibody) such as mouse, rat, rabbit, cat, dogs, goat, chicken, bovine, horse, llama, camel, dromedaries, sharks, nonhuman primates, human, humanized, recombinant sequence, or an engineered sequence having the desired properties.
  • donor antibody such as mouse, rat, rabbit, cat, dogs, goat, chicken, bovine, horse, llama, camel, dromedaries, sharks, nonhuman primates, human, humanized, recombinant sequence, or an engineered sequence having the desired properties.
  • donor antibody such as mouse, rat, rabbit, cat, dogs, goat, chicken, bovine, horse, llama, camel, dromedaries, sharks, nonhuman primates, human, humanized, recombinant sequence, or an
  • the felinized antibody may also comprise at least a portion of an immunoglobulin constant region (Fc) of a felinize antibody.
  • Fc immunoglobulin constant region
  • libraries comprising nucleic acids encoding for a nonimmunoglobulin.
  • the non-immunoglobulin is an antibody mimetic.
  • Exemplary antibody mimetics include, but are not limited to, anticalins, affilins, affibody molecules, affimers, affitins, alphabodies, avimers, atrimers, DARPins, fynomers, Kunitz domain-based proteins, monobodies, anticalins, knottins, armadillo repeat protein-based proteins, and bicyclic peptides.
  • Libraries described herein comprising nucleic acids encoding for an immunoglobulin comprising variations in at least one region of the immunoglobulin.
  • Exemplary regions of the antibody for variation include, but are not limited to, a complementarity-determining region (CDR), a variable domain, or a constant domain.
  • CDR complementarity-determining region
  • the CDR is CDR1, CDR2, or CDR3.
  • the CDR is a heavy domain including, but not limited to, CDRH1, CDRH2, and CDRH3.
  • the CDR is a light domain including, but not limited to, CDRL1, CDRL2, and CDRL3.
  • the variable domain is variable domain, light chain (VL) or variable domain, heavy chain (VH).
  • the VL domain comprises kappa or lambda chains.
  • the constant domain is constant domain, light chain (CL) or constant domain, heavy chain (CH).
  • Methods described herein provide for synthesis of libraries comprising nucleic acids encoding for an immunoglobulin, wherein each nucleic acid encodes for a predetermined variant of at least one predetermined reference nucleic acid sequence.
  • the predetermined reference sequence is a nucleic acid sequence encoding for a protein
  • the variant library comprises sequences encoding for variation of at least a single codon such that a plurality of different variants of a single residue in the subsequent protein encoded by the synthesized nucleic acid are generated by standard translation processes.
  • the variant library comprises varied nucleic acids collectively encoding variations at multiple positions.
  • the variant library comprises sequences encoding for variation of at least a single codon of a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domain. In some instances, the variant library comprises sequences encoding for variation of multiple codons of a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domain. In some instances, the variant library comprises sequences encoding for variation of multiple codons of framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4).
  • An exemplary number of codons for variation include, but are not limited to, at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.
  • the at least one region of the immunoglobulin for variation is from heavy chain V-gene family, heavy chain D-gene family, heavy chain J-gene family, light chain V- gene family, or light chain J-gene family.
  • the light chain V-gene family comprises immunoglobulin kappa (IGK) gene or immunoglobulin lambda (IGL).
  • Exemplary genes include, but are not limited to, IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3- 30/33m, IGHV3-28, IGHV1-69, IGHV3-74, IGHV4-39, IGHV4-59/61, IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, and IGLV3-1.
  • the gene is IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8. In some instances, the gene is IGHV1-69 and IGHV3-30. In some instances, the gene is IGHJ3, IGHJ6, IGHJ, IGHJ4, IGHJ5, IGHJ2, or IGH1. In some instances, the gene is IGHJ3, IGHJ6, IGHJ, or IGHJ4.
  • the fragments comprise the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domain.
  • the fragments comprise framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4).
  • the immunoglobulin libraries are synthesized with at least or about 2 fragments, 3 fragments, 4 fragments, 5 fragments, or more than 5 fragments.
  • each of the nucleic acid fragments or average length of the nucleic acids synthesized may be at least or about 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, or more than 600 base pairs. In some instances, the length is about 50 to 600, 75 to 575, 100 to 550, 125 to 525, 150 to 500, 175 to 475, 200 to 450, 225 to 425, 250 to 400, 275 to 375, or 300 to 350 base pairs.
  • Libraries comprising nucleic acids encoding for immunoglobulins as described herein comprise various lengths of amino acids when translated.
  • the length of each of the amino acid fragments or average length of the amino acid synthesized may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids.
  • the length of the amino acid is about 15 to 150, 20 to 145, 25 to 140, 30 to 135, 35 to 130, 40 to 125, 45 to 120, 50 to 115, 55 to 110, 60 to 110, 65 to 105, 70 to 100, or 75 to 95 amino acids. In some instances, the length of the amino acid is about 22 amino acids to about 75 amino acids. In some instances, the immunoglobulins comprise at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than 5000 amino acids.
  • a number of variant sequences for the at least one region of the immunoglobulin for variation are de novo synthesized using methods as described herein. In some instances, a number of variant sequences is de novo synthesized for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof. In some instances, a number of variant sequences is de novo synthesized for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4).
  • the number of variant sequences may be at least or about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500 sequences.
  • the number of variant sequences is at least or about 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, or more than 8000 sequences.
  • the number of variant sequences is about 10 to 500, 25 to 475, 50 to 450, 75 to 425, 100 to 400, 125 to 375, 150 to 350, 175 to 325, 200 to 300, 225 to 375, 250 to 350, or 275 to 325 sequences.
  • Variant sequences for the at least one region of the immunoglobulin vary in length or sequence.
  • the at least one region that is de novo synthesized is for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof.
  • the at least one region that is de novo synthesized is for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4).
  • the variant sequence comprises at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more than 50 variant nucleotides or amino acids as compared to wildtype.
  • the variant sequence comprises at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 additional nucleotides or amino acids as compared to wild-type. In some instances, the variant sequence comprises at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 less nucleotides or amino acids as compared to wild-type. In some instances, the libraries comprise at least or about 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , or more than 10 10 variants.
  • libraries may be used for screening and analysis.
  • libraries are assayed for library displayability and panning.
  • displayability is assayed using a selectable tag.
  • tags include, but are not limited to, a radioactive label, a fluorescent label, an enzyme, a chemiluminescent tag, a colorimetric tag, an affinity tag or other labels or tags that are known in the art.
  • the tag is histidine, polyhistidine, myc, hemagglutinin (HA), or FLAG.
  • libraries are assayed by sequencing using various methods including, but not limited to, single-molecule real-time (SMRT) sequencing, Polony sequencing, sequencing by ligation, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electronic sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or sequencing by synthesis.
  • SMRT single-molecule real-time
  • the libraries are assayed for functional activity, structural stability (e.g., thermal stable or pH stable), expression, specificity, or a combination thereof.
  • the libraries are assayed for immunoglobulin (e.g., an antibody) capable of folding.
  • a region of the antibody is assayed for functional activity, structural stability, expression, specificity, folding, or a combination thereof.
  • a VH region or VL region is assayed for functional activity, structural stability, expression, specificity, folding, or a combination thereof.
  • GLP1R binding libraries comprising nucleic acids encoding for immunoglobulins (e.g., antibodies) that bind to GLP1R.
  • immunoglobulins e.g., antibodies
  • the immunoglobulin sequences for GLP1R binding domains are determined by interactions between the GLP1R binding domains and the GLP1R.
  • libraries comprising nucleic acids encoding immunoglobulins comprising GLP1R binding domains, wherein the GLP1R binding domains are designed based on surface interactions on GLP1R.
  • the GLP1R comprises a sequence as defined by SEQ ID NO: 1.
  • the GLP1R binding domains interact with the amino- or carboxy-terminus of the GLP1R.
  • the GLP1R binding domains interact with at least one transmembrane domain including, but not limited to, transmembrane domain 1 (TM1), transmembrane domain 2 (TM2), transmembrane domain 3 (TM3), transmembrane domain 4 (TM4), transmembrane domain 5 (TM5), transmembrane domain 6 (TM6), and transmembrane domain 7 (TM7).
  • the GLP1R binding domains interact with an intracellular surface of the GLP1R.
  • the GLP1R binding domains interact with at least one intracellular loop including, but not limited to, intracellular loop 1 (ICL1), intracellular loop 2 (ICL2), and intracellular loop 3 (ICL3).
  • the GLP1R binding domains interact with an extracellular surface of the GLP1R.
  • the GLP1R binding domains interact with at least one extracellular domain (ECD) or extracellular loop (ECL) of the GLP1R.
  • ECD extracellular domain
  • ECL extracellular loop
  • the extracellular loops include, but are not limited to, extracellular loop 1 (ECL1), extracellular loop 2 (ECL2), and extracellular loop 3 (ECL3).
  • GLP1R binding domains wherein the GLP1R binding domains are designed based on surface interactions between a GLP1R ligand and the GLP1R.
  • the ligand is a peptide.
  • the ligand is glucagon, glucagon-like peptide 1 -(7-36) amide, glucagon-like peptide l-(7-37), liraglutide, exendin-4, lixisenatide, T-0632, GLP1R0017, or BETP.
  • the ligand is a GLP1R agonist.
  • the ligand is a GLP1R antagonist.
  • the ligand is a GLP1R allosteric modulator. In some instances, the allosteric modulator is a negative allosteric modulator. In some instances, the allosteric modulator is a positive allosteric modulator.
  • Sequences of GLP1R binding domains based on surface interactions between a GLP1R ligand and the GLP1R are analyzed using various methods. For example, multispecies computational analysis is performed. In some instances, a structure analysis is performed. In some instances, a sequence analysis is performed. Sequence analysis can be performed using a database known in the art.
  • Non-limiting examples of databases include, but are not limited to, NCBI BLAST (blast.ncbi.nlm.nih.gov/Blast.cgi), UCSC Genome Browser (genome.ucsc.edu/), UniProt (www.uniprot.org/), and IUPHAR/BPS Guide to PHARMACOLOGY (guidetopharmacology.org/).
  • NCBI BLAST blast.ncbi.nlm.nih.gov/Blast.cgi
  • UCSC Genome Browser genome.ucsc.edu/
  • UniProt www.uniprot.org/
  • IUPHAR/BPS Guide to PHARMACOLOGY guidetopharmacology.org/.
  • Exemplary organisms include, but are not limited to, mouse, rat, equine, sheep, cow, primate (e.g., chimpanzee, baboon, gorilla, orangutan, monkey), dog, cat, pig, donkey, rabbit, fish, fly, and human.
  • primate e.g., chimpanzee, baboon, gorilla, orangutan, monkey
  • dog cat
  • pig donkey
  • rabbit fish, fly, and human.
  • libraries comprising nucleic acids encoding for the GLP1R binding domains may be generated.
  • libraries of GLP1R binding domains comprise sequences of GLP1R binding domains designed based on conformational ligand interactions, peptide ligand interactions, small molecule ligand interactions, extracellular domains of GLP1R, or antibodies that target GLP1R.
  • libraries of GLP1R binding domains comprise sequences of GLP1R binding domains designed based on peptide ligand interactions.
  • Libraries of GLP1R binding domains may be translated to generate protein libraries.
  • libraries of GLP1R binding domains are translated to generate peptide libraries, immunoglobulin libraries, derivatives thereof, or combinations thereof. In some instances, libraries of GLP1R binding domains are translated to generate protein libraries that are further modified to generate peptidomimetic libraries. In some instances, libraries of GLP1R binding domains are translated to generate protein libraries that are used to generate small molecules.
  • Methods described herein provide for synthesis of libraries of GLP1R binding domains comprising nucleic acids each encoding for a predetermined variant of at least one predetermined reference nucleic acid sequence.
  • the predetermined reference sequence is a nucleic acid sequence encoding for a protein
  • the variant library comprises sequences encoding for variation of at least a single codon such that a plurality of different variants of a single residue in the subsequent protein encoded by the synthesized nucleic acid are generated by standard translation processes.
  • the libraries of GLP1R binding domains comprise varied nucleic acids collectively encoding variations at multiple positions.
  • the variant library comprises sequences encoding for variation of at least a single codon in a GLP1R binding domain. In some instances, the variant library comprises sequences encoding for variation of multiple codons in a GLP1R binding domain.
  • An exemplary number of codons for variation include, but are not limited to, at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.
  • Methods described herein provide for synthesis of libraries comprising nucleic acids encoding for the GLP1R binding domains, wherein the libraries comprise sequences encoding for variation of length of the GLP1R binding domains.
  • the library comprises sequences encoding for variation of length of at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons less as compared to a predetermined reference sequence.
  • the library comprises sequences encoding for variation of length of at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, or more than 300 codons more as compared to a predetermined reference sequence.
  • the GLP1R binding domains may be placed in immunoglobulins as described herein. In some instances, the GLP1R binding domains are placed in the CDRH3 region. GPCR binding domains that may be placed in immunoglobulins can also be referred to as a motif. Immunoglobulins comprising GLP1R binding domains may be designed based on binding, specificity, stability, expression, folding, or downstream activity. In some instances, the immunoglobulins comprising GLP1R binding domains enable contact with the GLP1R. In some instances, the immunoglobulins comprising GLP1R binding domains enables high affinity binding with the GLP1R. An exemplary amino acid sequence of GLP1R binding domain is described in Table 1. Table 1. GLP1R amino acid sequences
  • immunoglobulins comprising GLP1R binding domains, wherein the sequences of the GLP1R binding domains support interaction with GLP1R.
  • the sequence may be homologous or identical to a sequence of a GLP1R ligand.
  • the GLP1R binding domain sequence comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 1.
  • the GLP1R binding domain sequence comprises at least or about 95% homology to SEQ ID NO: 1.
  • the GLP1R binding domain sequence comprises at least or about 97% homology to SEQ ID NO: 1.
  • the GLP1R binding domain sequence comprises at least or about 99% homology to SEQ ID NO: 1. In some instances, the GLP1R binding domain sequence comprises at least or about 100% homology to SEQ ID NO: 1. In some instances, the GLP1R binding domain sequence comprises at least a portion having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, or more than 400 amino acids of SEQ ID NO: 1.
  • sequence identity means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison.
  • percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as EMBOSS MATCHER, EMBOSS WATER, EMBOSS STRETCHER, EMBOSS NEEDLE, EMBOSS LALIGN, BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.
  • publicly available computer software such as EMBOSS MATCHER, EMBOSS WATER, EMBOSS STRETCHER, EMBOSS NEEDLE, EMBOSS LALIGN, BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.
  • Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
  • the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows: 100 times the fraction X/Y, where X is the number of amino acid residues scored as identical matches by the sequence alignment program ALIGN-2 in that program's alignment of A and B, and where Y is the total number of amino acid residues in B.
  • the term “homology” or “similarity” between two proteins is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one protein sequence to the second protein sequence. Similarity may be determined by procedures which are well-known in the art, for example, a BLAST program (Basic Local Alignment Search Tool at the National Center for Biological Information).
  • CDR complementarity determining region
  • HVR hypervariable region
  • FR-H1, FR-H2, FR-H3, and FR-H4 there are four FRs in each full-length heavy chain variable region (FR-H1, FR-H2, FR-H3, and FR-H4), and four FRs in each full-length light chain variable region (FR-L1, FR-L2, FR-L3, and FR-L4).
  • FR-H1, FR-H2, FR-H3, and FR-H4 four FRs in each full-length heavy chain variable region
  • FR-L1, FR-L2, FR-L3, and FR-L4 four FRs in each full-length light chain variable region.
  • the precise amino acid sequence boundaries of a given CDR or FR can be readily determined using any of a number of well-known schemes, including those described by Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed.
  • IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains
  • Dev Comp Immunol 2003 Jan;27(l):55-77
  • IMGT numbering scheme
  • Honegger A and Pliickthun A “Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool,” J Mol Biol, 2001 Jun 8;309(3):657-70, (“Aho” numbering scheme); and Whitelegg NR and Rees AR, “WAM: an improved algorithm for modelling antibodies on the WEB,” Protein Eng. 2000 Dec;13(12):819-24
  • AbM numbering scheme.
  • the CDRs of the antibodies described herein can be defined by a method selected from Kabat, Chothia, IMGT, Aho, AbM, or combinations thereof.
  • the boundaries of a given CDR or FR may vary depending on the scheme used for identification.
  • the Kabat scheme is based on structural alignments
  • the Chothia scheme is based on structural information. Numbering for both the Kabat and Chothia schemes is based upon the most common antibody region sequence lengths, with insertions accommodated by insertion letters, for example, “30a,” and deletions appearing in some antibodies. The two schemes place certain insertions and deletions (“indels”) at different positions, resulting in differential numbering.
  • the Contact scheme is based on analysis of complex crystal structures and is similar in many respects to the Chothia numbering scheme.
  • GLP1R binding libraries comprising nucleic acids encoding for immunoglobulins comprising GLP1R binding domains comprise variation in domain type, domain length, or residue variation.
  • the domain is a region in the immunoglobulin comprising the GLP1R binding domains.
  • the region is the VH, CDRH3, or VL domain.
  • the domain is the GLP1R binding domain.
  • Methods described herein provide for synthesis of a GLP1R binding library of nucleic acids each encoding for a predetermined variant of at least one predetermined reference nucleic acid sequence.
  • the predetermined reference sequence is a nucleic acid sequence encoding for a protein
  • the variant library comprises sequences encoding for variation of at least a single codon such that a plurality of different variants of a single residue in the subsequent protein encoded by the synthesized nucleic acid are generated by standard translation processes.
  • the GLP1R binding library comprises varied nucleic acids collectively encoding variations at multiple positions.
  • the variant library comprises sequences encoding for variation of at least a single codon of a VH, CDRH3, or VL domain. In some instances, the variant library comprises sequences encoding for variation of at least a single codon in a GLP1R binding domain. For example, at least one single codon of a GLP1R binding domain as listed in Table 1 is varied. In some instances, the variant library comprises sequences encoding for variation of multiple codons of a VH, CDRH3, or VL domain. In some instances, the variant library comprises sequences encoding for variation of multiple codons in a GLP1R binding domain.
  • An exemplary number of codons for variation include, but are not limited to, at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.
  • Methods described herein provide for synthesis of a GLP1R binding library of nucleic acids each encoding for a predetermined variant of at least one predetermined reference nucleic acid sequence, wherein the GLP1R binding library comprises sequences encoding for variation of length of a domain.
  • the domain is VH, CDRH3, or VL domain.
  • the domain is the GLP1R binding domain.
  • the library comprises sequences encoding for variation of length of at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons less as compared to a predetermined reference sequence.
  • the library comprises sequences encoding for variation of length of at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, or more than 300 codons more as compared to a predetermined reference sequence.
  • GLP1R binding libraries comprising nucleic acids encoding for immunoglobulins comprising GLP1R binding domains, wherein the GLP1R binding libraries are synthesized with various numbers of fragments.
  • the fragments comprise the VH, CDRH3, or VL domain.
  • the GLP1R binding libraries are synthesized with at least or about 2 fragments, 3 fragments, 4 fragments, 5 fragments, or more than 5 fragments.
  • each of the nucleic acid fragments or average length of the nucleic acids synthesized may be at least or about 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, or more than 600 base pairs. In some instances, the length is about 50 to 600, 75 to 575, 100 to 550, 125 to 525, 150 to 500, 175 to 475, 200 to 450, 225 to 425, 250 to 400, 275 to 375, or 300 to 350 base pairs.
  • GLP1R binding libraries comprising nucleic acids encoding for immunoglobulins comprising GLP1R binding domains as described herein comprise various lengths of amino acids when translated.
  • the length of each of the amino acid fragments or average length of the amino acid synthesized may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids.
  • the length of the amino acid is about 15 to 150, 20 to 145, 25 to 140, 30 to 135, 35 to 130, 40 to 125, 45 to 120, 50 to 115, 55 to 110, 60 to 110, 65 to 105, 70 to
  • the length of the amino acid is about 22 to about 75 amino acids.
  • GLP1R binding libraries comprising de novo synthesized variant sequences encoding for immunoglobulins comprising GLP1R binding domains comprise a number of variant sequences.
  • a number of variant sequences is de novo synthesized for a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or a combination thereof.
  • a number of variant sequences is de novo synthesized for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4).
  • a number of variant sequences is de novo synthesized for a GPCR binding domain.
  • the number of variant sequences is about 1 to about 10 sequences for the VH domain, about 10 8 sequences for the GLP1R binding domain, and about 1 to about 44 sequences for the VK domain.
  • the number of variant sequences may be at least or about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500 sequences.
  • the number of variant sequences is about 10 to 300, 25 to 275, 50 to 250, 75 to 225, 100 to 200, or 125 to 150 sequences.
  • the antibody or antibody fragment thereof comprises a sequence as set forth in Tables 7-13. In some embodiments, the antibody or antibody fragment thereof comprises a sequence that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence as set forth in Tables 7-13.
  • an antibody or antibody fragment described herein comprises a CDRH1 sequence of any one of SEQ ID NOs: 441-619. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 80% identical to a CDRH1 sequence of any one of SEQ ID NOs: 441-619. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 85% identical to a CDRH1 sequence of any one of SEQ ID NOs: 441-619. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 90% identical to a CDRH1 sequence of any one of SEQ ID NOs: 441-619.
  • an antibody or antibody fragment described herein comprises a sequence that is at least 95% identical to a CDRH1 sequence of any one of SEQ ID NOs: 441-619. In some instances, an antibody or antibody fragment described herein comprises a CDRH2 sequence of any one of SEQ ID NOs: 620-798. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 80% identical to a CDRH2 sequence of any one of SEQ ID NOs: 620-798. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 85% identical to a CDRH2 sequence of any one of SEQ ID NOs: 620-798.
  • an antibody or antibody fragment described herein comprises a sequence that is at least 90% identical to a CDRH2 sequence of any one of SEQ ID NOs: 620-798. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 95% identical to a CDRH2 sequence of any one of SEQ ID NOs: 620-798. In some instances, an antibody or antibody fragment described herein comprises a CDRH3 sequence of any one of SEQ ID NOs: 799-977. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 80% identical to a CDRH3 sequence of any one of SEQ ID NOs: 799-977.
  • an antibody or antibody fragment described herein comprises a sequence that is at least 85% identical to a CDRH3 sequence of any one of SEQ ID NOs: 799-977. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 90% identical to a CDRH3 sequence of any one of SEQ ID NOs: 799-977. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 95% identical to a CDRH3 sequence of any one of SEQ ID NOs: 799-977.
  • an antibody or antibody fragment described herein comprises a CDRL1 sequence of any one of SEQ ID NOs: 978-1156. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 80% identical to a CDRL1 sequence of any one of SEQ ID NOs: 978-1156. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 85% identical to a CDRL1 sequence of any one of SEQ ID NOs: 978-1156. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 90% identical to a CDRL1 sequence of any one of SEQ ID NOs: 978-1156.
  • an antibody or antibody fragment described herein comprises a sequence that is at least 95% identical to a CDRL1 sequence of any one of SEQ ID NOs: 978-1156. In some instances, an antibody or antibody fragment described herein comprises a CDRL2 sequence of any one of SEQ ID NOs: 1157-1168. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 80% identical to a CDRL2 sequence of any one of SEQ ID NOs: 1157-1168. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 85% identical to a CDRL2 sequence of any one of SEQ ID NOs: 1157-1168.
  • an antibody or antibody fragment described herein comprises a sequence that is at least 90% identical to a CDRL2 sequence of any one of SEQ ID NOs: 1157-1168. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 95% identical to a CDRL2 sequence of any one of SEQ ID NOs: 1157-1168. In some instances, an antibody or antibody fragment described herein comprises a CDRL3 sequence of any one of SEQ ID NOs: 1169-1347. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 80% identical to a CDRL3 sequence of any one of SEQ ID NOs: 1169-1347.
  • an antibody or antibody fragment described herein comprises a sequence that is at least 85% identical to a CDRL3 sequence of any one of SEQ ID NOs: 1169-1347. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 90% identical to a CDRL3 sequence of any one of SEQ ID NOs: 1169-1347. In some instances, an antibody or antibody fragment described herein comprises a sequence that is at least 95% identical to a CDRL3 sequence of any one of SEQ ID NOs: 1169-1347.
  • the antibody or antibody fragment comprising a variable domain, heavy chain region (VH) and a variable domain, light chain region (VL), wherein VH comprises complementarity determining regions CDRH1, CDRH2, and CDRH3, wherein VL comprises complementarity determining regions CDRL1, CDRL2, and CDRL3, and wherein (a) an amino acid sequence of CDRH1 is as set forth in any one of SEQ ID NOs: 441-619; (b) an amino acid sequence of CDRH2 is as set forth in any one of SEQ ID NOs: 620-798; (c) an amino acid sequence of CDRH3 is as set forth in any one of SEQ ID NOs: 799-977; (d) an amino acid sequence of CDRL1 is as set forth in any one of SEQ ID NOs: 978-1156; (e) an amino acid sequence of CDRL2 is as set forth in any one of SEQ ID NOs: 1157-1168; and (f) an amino acid sequence of CDRL3 is as
  • the antibody or antibody fragment comprising a variable domain, heavy chain region (VH) and a variable domain, light chain region (VL), wherein VH comprises complementarity determining regions CDRH1, CDRH2, and CDRH3, wherein VL comprises complementarity determining regions CDRL1, CDRL2, and CDRL3, and wherein (a) an amino acid sequence of CDRH1 is at least or about 80%, 85%, 90%, or 95% identical to any one of SEQ ID NOs: 441-619; (b) an amino acid sequence of CDRH2 is at least or about 80%, 85%, 90%, or 95% identical to any one of SEQ ID NOs: 620-798; (c) an amino acid sequence of CDRH3 is at least or about 80%, 85%, 90%, or 95% identical to any one of SEQ ID NOs: 799-977; (d) an amino acid sequence of CDRL1 is at least or about 80%, 85%, 90%, or 95% identical to any one of SEQ ID NOs:
  • antibodies or antibody fragments comprising a variable domain, heavy chain region (VH) and a variable domain, light chain region (VL), wherein the VH comprises an amino acid sequence at least about 90% identical to a sequence as set forth in any one of SEQ ID NOs: 58-77, and wherein the VL comprises an amino acid sequence at least about 90% identical to a sequence as set forth in any one of SEQ ID NOs: 92-111.
  • the antibodies or antibody fragments comprise VH comprising at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 58-77, and VL comprising at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 92-111.
  • sequence identity means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison.
  • percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • sequence identity typically includes comparing two nucleotide or amino acid sequences and the determining their percent identity. Sequence comparisons, such as for the purpose of assessing identities, may be performed by any suitable alignment algorithm, including but not limited to the Needleman-Wunsch algorithm (see, e.g., the EMBOSS Needle aligner available at www.ebi.ac.uk/Tools/psa/emboss_needle/, optionally with default settings), the BLAST algorithm (see, e.g., the BLAST alignment tool available at blast.ncbi.nlm.nih.gov/Blast.cgi, optionally with default settings), and the Smith-Waterman algorithm (see, e.g., the EMBOSS Water aligner available at www.ebi.ac.uk/Tools/psa/emboss_water/, optionally with default settings).
  • the Needleman-Wunsch algorithm see, e.g., the EMBOSS Needle aligner available at
  • Optimal alignment may be assessed using any suitable parameters of a chosen algorithm, including default parameters.
  • the “percent identity”, also referred to as “percent homology”, between two sequences may be calculated as the number of exact matches between two optimally aligned sequences divided by the length of the reference sequence and multiplied by 100. Percent identity may also be determined, for example, by comparing sequence information using the advanced BLAST computer program, including version 2.2.9, available from the National Institutes of Health. The BLAST program is based on the alignment method of Karlin and Altschul, Proc. Natl. Acad. Sci. USA 87:2264-2268 (1990) and as discussed in Altschul, et al., J. Mol. Biol.
  • the BLAST program defines identity as the number of identical aligned symbols (i.e., nucleotides or amino acids), divided by the total number of symbols in the shorter of the two sequences. The program may be used to determine percent identity over the entire length of the sequences being compared. Default parameters are provided to optimize searches with short query sequences, for example, with the blastp program.
  • the program also allows use of an SEG filter to mask-off segments of the query sequences as determined by the SEG program of Wootton and Federhen, Computers and Chemistry 17: 149-163 (1993).
  • High sequence identity generally includes ranges of sequence identity of approximately 80% to 100% and integer values there between.
  • GLP1R binding libraries comprising de novo synthesized variant sequences encoding for immunoglobulins comprising GLP1R binding domains comprise improved diversity.
  • variants are generated by placing GLP1R binding domain variants in immunoglobulins comprising N-terminal CDRH3 variations and C-terminal CDRH3 variations.
  • variants include affinity maturation variants.
  • variants include variants in other regions of the immunoglobulin including, but not limited to, CDRH1, CDRH2, CDRL1, CDRL2, and CDRL3.
  • the number of variants of the GLP1R binding libraries is at least or about 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or more than 10 20 non-identical sequences.
  • a library comprising about 10 variant sequences for a VH region, about 237 variant sequences for a CDRH3 region, and about 43 variant sequences for a VL and CDRL3 region comprises 10 5 non-identical sequences (10 x 237 x 43).
  • the at least one region of the antibody for variation is from heavy chain V-gene family, heavy chain D-gene family, heavy chain J-gene family, light chain V-gene family, or light chain J-gene family.
  • the light chain V-gene family comprises immunoglobulin kappa (IGK) gene or immunoglobulin lambda (IGL).
  • Exemplary regions of the antibody for variation include, but are not limited to, IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30/33m, IGHV3-28, IGHV1-69, IGHV3-74, IGHV4-39, IGHV4-59/61, IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, and IGLV3-1.
  • the gene is IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8. In some instances, the gene is IGHV1-69 and IGHV3-30. In some instances, the region of the antibody for variation is IGHJ3, IGHJ6, IGHJ, IGHJ4, IGHJ5, IGHJ2, or IGH1. In some instances, the region of the antibody for variation is IGHJ3, IGHJ6, IGHJ, or IGHJ4. In some instances, the at least one region of the antibody for variation is IGHV1-69, IGHV3-23, IGKV3-20, IGKV1-39, or combinations thereof.
  • the at least one region of the antibody for variation is IGHV1-69 and IGKV3-20, In some instances, the at least one region of the antibody for variation is IGHV1-69 and IGKV1-39. In some instances, the at least one region of the antibody for variation is IGHV3-23 and IGKV3-20. In some instances, the at least one region of the antibody for variation is IGHV3-23 and IGKV1-39. [00104] Provided herein are libraries comprising nucleic acids encoding for a GLP1R antibody comprising variation in at least one region of the antibody, wherein the region is the CDR region. In some instances, the GLP1R antibody is a single domain antibody comprising one heavy chain variable domain such as a VHH antibody.
  • the VHH antibody comprises variation in one or more CDR regions.
  • libraries described herein comprise at least or about 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of a CDR1, CDR2, or CDR3.
  • libraries described herein comprise at least or about 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10°, 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or more than 10 20 sequences of a CDR1, CDR2, or CDR3.
  • the libraries comprise at least 2000 sequences of a CDR1, at least 1200 sequences for CDR2, and at least 1600 sequences for CDR3. In some instances, each sequence is non-identical.
  • the CDR1, CDR2, or CDR3 is of a variable domain, light chain (VL).
  • CDR1, CDR2, or CDR3 of a variable domain, light chain (VL) can be referred to as CDRL1, CDRL2, or CDRL3, respectively.
  • libraries described herein comprise at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of a CDR1, CDR2, or CDR3 of the VL.
  • libraries described herein comprise at least or about 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or more than 10 20 sequences of a CDR1, CDR2, or CDR3 of the VL.
  • the libraries comprise at least 20 sequences of a CDR1 of the VL, at least 4 sequences of a CDR2 of the VL, and at least 140 sequences of a CDR3 of the VL.
  • the libraries comprise at least 2 sequences of a CDR1 of the VL, at least 1 sequence of CDR2 of the VL, and at least 3000 sequences of a CDR3 of the VL.
  • the VL is IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, or IGLV3-1.
  • the VL is IGKV2-28.
  • the VL is IGLV1-51.
  • the CDR1, CDR2, or CDR3 is of a variable domain, heavy chain (VH).
  • CDR1, CDR2, or CDR3 of a variable domain, heavy chain (VH) can be referred to as CDRH1, CDRH2, or CDRH3, respectively.
  • libraries described herein comprise at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of a CDR1, CDR2, or CDR3 of the VH.
  • libraries described herein comprise at least or about 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or more than 10 20 sequences of a CDR1, CDR2, or CDR3 of the VH.
  • the libraries comprise at least 30 sequences of a CDR1 of the VH, at least 570 sequences of a CDR2 of the VH, and at least 10 8 sequences of a CDR3 of the VH.
  • the libraries comprise at least 30 sequences of a CDR1 of the VH, at least 860 sequences of a CDR2 of the VH, and at least 10 7 sequences of a CDR3 of the VH.
  • the VH is IGHV1-18, IGHV1-69, IGHV1-8 IGHV3-21, IGHV3-23, IGHV3-30/33rn, IGHV3-28, IGHV3-74, IGHV4-39, or IGHV4-59/61.
  • the VH is IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8.
  • the VH is IGHV1-69 or IGHV3- 30.
  • the VH is IGHV3-23.
  • Libraries as described herein comprise varying lengths of a CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3.
  • the length of the CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 comprises at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or more than 90 amino acids in length.
  • the CDRH3 comprises at least or about 12, 15, 16, 17, 20, 21, or 23 amino acids in length.
  • the CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 comprises a range of about 1 to about 10, about 5 to about 15, about 10 to about 20, or about 15 to about 30 amino acids in length.
  • Libraries comprising nucleic acids encoding for antibodies having variant CDR sequences as described herein comprise various lengths of amino acids when translated.
  • the length of each of the amino acid fragments or average length of the amino acid synthesized may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids.
  • the length of the amino acid is about 15 to 150, 20 to 145, 25 to 140, 30 to 135, 35 to 130, 40 to 125, 45 to 120, 50 to 115, 55 to 110, 60 to 110, 65 to 105, 70 to 100, or 75 to 95 amino acids. In some instances, the length of the amino acid is about 22 amino acids to about 75 amino acids. In some instances, the antibodies comprise at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than 5000 amino acids.
  • Ratios of the lengths of a CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 may vary in libraries described herein.
  • a CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 comprising at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or more than 90 amino acids in length comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more than 90% of the library.
  • a CDRH3 comprising about 23 amino acids in length is present in the library at 40%, a CDRH3 comprising about 21 amino acids in length is present in the library at 30%, a CDRH3 comprising about 17 amino acids in length is present in the library at 20%, and a CDRH3 comprising about 12 amino acids in length is present in the library at 10%.
  • a CDRH3 comprising about 20 amino acids in length is present in the library at 40%, a CDRH3 comprising about 16 amino acids in length is present in the library at 30%, a CDRH3 comprising about 15 amino acids in length is present in the library at 20%, and a CDRH3 comprising about 12 amino acids in length is present in the library at 10%.
  • Libraries as described herein encoding for a VHH antibody comprise variant CDR sequences that are shuffled to generate a library with a theoretical diversity of at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or more than 10 20 sequences.
  • the library has a final library diversity of at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or more than 10 20 sequences.
  • GLP1R binding libraries encoding for an immunoglobulin.
  • the GLP1R immunoglobulin is an antibody.
  • the GLP1R immunoglobulin is a VHH antibody.
  • the GLP1R immunoglobulin comprises a binding affinity (e.g., kD) to GLP1R of less than 1 nM, less than 1.2 nM, less than 2 nM, less than 5 nM, less than 10 nM, less than 11 nm, less than 13.5 nM, less than 15 nM, less than 20 nM, less than 25 nM, or less than 30 nM.
  • the GLP1R immunoglobulin comprises a kD of less than 1 nM. In some instances, the GLP1R immunoglobulin comprises a kD of less than 1.2 nM. In some instances, the GLP1R immunoglobulin comprises a kD of less than 2 nM. In some instances, the GLP1R immunoglobulin comprises a kD of less than 5 nM. In some instances, the GLP1R immunoglobulin comprises a kD of less than 10 nM. In some instances, the GLP1R immunoglobulin comprises a kD of less than 13.5 nM. In some instances, the GLP1R immunoglobulin comprises a kD of less than 15 nM.
  • the GLP1R immunoglobulin comprises a kD of less than 20 nM. In some instances, the GLP1R immunoglobulin comprises a kD of less than 25 nM. In some instances, the GLP1R immunoglobulin comprises a kD of less than 30 nM.
  • the GLP1R immunoglobulin is a GLP1R agonist. In some instances, the GLP1R immunoglobulin is a GLP1R antagonist. In some instances, the GLP1R immunoglobulin is a GLP1R allosteric modulator. In some instances, the allosteric modulator is a negative allosteric modulator. In some instances, the allosteric modulator is a positive allosteric modulator.
  • the GLP1R immunoglobulin results in agonistic, antagonistic, or allosteric effects at a concentration of at least or about 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, 120 nM, 140 nM, 160 nM, 180 nM, 200 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 900 nM, 1000 nM, or more than 1000 nM.
  • the GLP1R immunoglobulin is a negative allosteric modulator. In some instances, the GLP1R immunoglobulin is a negative allosteric modulator at a concentration of at least or about 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, or more than 100 nM.
  • the GLP1R immunoglobulin is a negative allosteric modulator at a concentration in a range of about 0.001 to about 100, 0.01 to about 90, about 0.1 to about 80, 1 to about 50, about 10 to about 40 nM, or about 1 to about 10 nM.
  • the GLP1R immunoglobulin comprises an EC50 or IC50 of at least or about 0.001, 0.0025, 0.005, 0.01, 0.025, 0.05, 0.06, 0.07, 0.08, 0.9, 0.1, 0.5, 1, 2, 3, 4, 5, 6, or more than 6 nM.
  • the GLP1R immunoglobulin comprises an EC50 or IC50 of at least or about 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, or more than 100 nM.
  • GLP1R binding libraries encoding for an immunoglobulin, wherein the immunoglobulin comprises a long half-life.
  • the half-life of the GLP1R immunoglobulin is at least or about 12 hours, 24 hours 36 hours, 48 hours, 60 hours, 72 hours, 84 hours, 96 hours, 108 hours, 120 hours, 140 hours, 160 hours, 180 hours, 200 hours, or more than 200 hours.
  • the half-life of the GLP1R immunoglobulin is in a range of about 12 hours to about 300 hours, about 20 hours to about 280 hours, about 40 hours to about 240 hours, or about 60 hours to about 200 hours.
  • GLP1R immunoglobulins as described herein may comprise improved properties.
  • the GLP1R immunoglobulins are monomeric.
  • the GLP1R immunoglobulins are not prone to aggregation.
  • at least or about 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the GLP1R immunoglobulins are monomeric.
  • the GLP1R immunoglobulins are thermostable.
  • the GLP1R immunoglobulins result in reduced non-specific binding.
  • libraries may be used for screening and analysis. For example, libraries are assayed for library di splay ability and panning. In some instances, displayability is assayed using a selectable tag.
  • Exemplary tags include, but are not limited to, a radioactive label, a fluorescent label, an enzyme, a chemiluminescent tag, a colorimetric tag, an affinity tag or other labels or tags that are known in the art. In some instances, the tag is histidine, polyhistidine, myc, hemagglutinin (HA), or FLAG.
  • the GLP1R binding libraries comprises nucleic acids encoding immunoglobulins comprising GPCR binding domains with multiple tags such as GFP, FLAG, and Lucy as well as a DNA barcode.
  • libraries are assayed by sequencing using various methods including, but not limited to, single-molecule real-time (SMRT) sequencing, Polony sequencing, sequencing by ligation, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electronic sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or sequencing by synthesis.
  • SMRT single-molecule real-time
  • libraries comprising nucleic acids encoding for immunoglobulins comprising GLP1R binding domains, wherein the libraries have improved specificity, stability, expression, folding, or downstream activity.
  • libraries described herein are used for screening and analysis.
  • libraries comprising nucleic acids encoding for immunoglobulins comprising GLP1R binding domains, wherein the nucleic acid libraries are used for screening and analysis.
  • screening and analysis comprise in vitro, in vivo, or ex vivo assays.
  • Cells for screening include primary cells taken from living subjects or cell lines. Cells may be from prokaryotes (e.g., bacteria and fungi) or eukaryotes (e.g., animals and plants). Exemplary animal cells include, without limitation, those from a mouse, rabbit, primate, and insect.
  • cells for screening include a cell line including, but not limited to, Chinese Hamster Ovary (CHO) cell line, human embryonic kidney (HEK) cell line, or baby hamster kidney (BHK) cell line.
  • CHO Chinese Hamster Ovary
  • HEK human embryonic kidney
  • BHK baby hamster kidney
  • nucleic acid libraries described herein may also be delivered to a multicellular organism.
  • Exemplary multicellular organisms include, without limitation, a plant, a mouse, rabbit, primate, and insect.
  • Nucleic acid libraries or protein libraries encoded thereof described herein may be screened for various pharmacological or pharmacokinetic properties.
  • the libraries are screened using in vitro assays, in vivo assays, or ex vivo assays.
  • in vitro pharmacological or pharmacokinetic properties that are screened include, but are not limited to, binding affinity, binding specificity, and binding avidity.
  • Exemplary in vivo pharmacological or pharmacokinetic properties of libraries described herein that are screened include, but are not limited to, therapeutic efficacy, activity, preclinical toxicity properties, clinical efficacy properties, clinical toxicity properties, immunogenicity, potency, and clinical safety properties.
  • Pharmacological or pharmacokinetic properties that may be screened include, but are not limited to, cell binding affinity and cell activity.
  • cell binding affinity assays or cell activity assays are performed to determine agonistic, antagonistic, or allosteric effects of libraries described herein.
  • the cell activity assay is a cAMP assay.
  • libraries as described herein are compared to cell binding or cell activity of ligands of GLP1R.
  • Libraries as described herein may be screened in cell-based assays or in non-cell-based assays.
  • non-cell-based assays include, but are not limited to, using viral particles, using in vitro translation proteins, and using protealiposomes with GLP1R.
  • Nucleic acid libraries as described herein may be screened by sequencing.
  • next generation sequence is used to determine sequence enrichment of GLP1R binding variants.
  • V gene distribution, J gene distribution, V gene family, CDR3 counts per length, or a combination thereof is determined.
  • clonal frequency, clonal accumulation, lineage accumulation, or a combination thereof is determined.
  • number of sequences, sequences with VH clones, clones, clones greater than 1, clonotypes, clonotypes greater than 1, lineages, simpsons, or a combination thereof is determined.
  • a percentage of non-identical CDR3s is determined. For example, the percentage of nonidentical CDR3s is calculated as the number of non-identical CDR3s in a sample divided by the total number of sequences that had a CDR3 in the sample.
  • nucleic acid libraries wherein the nucleic acid libraries may be expressed in a vector.
  • Expression vectors for inserting nucleic acid libraries disclosed herein may comprise eukaryotic or prokaryotic expression vectors.
  • Exemplary expression vectors include, without limitation, mammalian expression vectors: pSF-CMV-NEO-NH2-PPT-3XFLAG, pSF- CMV-NEO-COOH-3XFLAG, pSF-CMV-PURO-NH2-GST-TEV, pSF-OXB20-COOH-TEV- FLAG(R)-6His, pCEP4 pDEST27, pSF-CMV-Ub-KrYFP, pSF-CMV-FMDV-daGFP, pEFla- mCherry-Nl Vector, pEFla-tdTomato Vector, pSF-CMV-FMDV-Hygro, pSF-CMV-PGK-Puro, pMC
  • nucleic acid libraries that are expressed in a vector to generate a construct comprising an immunoglobulin comprising sequences of GLP1R binding domains.
  • a size of the construct varies.
  • the construct comprises at least or about 500, 600, 700, 800, 900, 1000, 1100, 1300, 1400, 1500, 1600, 1700, 1800, 2000, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200,4400, 4600, 4800, 5000, 6000, 7000, 8000, 9000, 10000, or more than 10000 bases.
  • a the construct comprises a range of about 300 to 1,000, 300 to 2,000, 300 to 3,000, 300 to 4,000, 300 to 5,000, 300 to 6,000, 300 to 7,000, 300 to 8,000, 300 to 9,000, 300 to 10,000, 1,000 to 2,000, 1,000 to 3,000, 1,000 to 4,000, 1,000 to 5,000, 1,000 to 6,000, 1,000 to 7,000, 1,000 to 8,000, 1,000 to 9,000, 1,000 to 10,000, 2,000 to
  • libraries comprising nucleic acids encoding for immunoglobulins comprising GPCR binding domains, wherein the nucleic acid libraries are expressed in a cell.
  • the libraries are synthesized to express a reporter gene.
  • Exemplary reporter genes include, but are not limited to, acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucoronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), cerulean fluorescent protein, citrine fluorescent protein, orange fluorescent protein , cherry fluorescent protein, turquoise fluorescent protein, blue fluorescent protein, horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), luciferase, and derivatives thereof.
  • AHAS acetohydroxyacid synthase
  • AP alkaline phosphatase
  • LacZ beta galactosidase
  • GUS beta glucoronidase
  • CAT chloramphenicol
  • Methods to determine modulation of a reporter gene include, but are not limited to, fluorometric methods (e.g. fluorescence spectroscopy, Fluorescence Activated Cell Sorting (FACS), fluorescence microscopy), and antibiotic resistance determination.
  • fluorometric methods e.g. fluorescence spectroscopy, Fluorescence Activated Cell Sorting (FACS), fluorescence microscopy
  • antibiotic resistance determination e.g. antibiotic resistance determination.
  • GLP1R binding libraries comprising nucleic acids encoding for immunoglobulins (e.g., antibodies) comprising GLP1R binding domains that may have therapeutic effects.
  • the GLP1R binding libraries result in protein when translated that is used to treat a disease or disorder.
  • the protein is an immunoglobulin.
  • the protein is a peptidomimetic.
  • GLP1R libraries as described herein may comprise modulators of GLP1R.
  • the modulator of GLP1R is an inhibitor.
  • the modulator of GLP1R is an activator.
  • the GLP1R inhibitor is a GLP1R antagonist.
  • the GLP1R antagonist is GLP1R-3. Modulators of GLP1R, in some instances, are used for treating various diseases or disorders.
  • Exemplary diseases include, but are not limited to, cancer, inflammatory diseases or disorders, a metabolic disease or disorder, a cardiovascular disease or disorder, a respiratory disease or disorder, pain, a digestive disease or disorder, a reproductive disease or disorder, an endocrine disease or disorder, or a neurological disease or disorder.
  • the cancer is a solid cancer or a hematologic cancer.
  • a modulator of GLP1R as described herein is used for treatment of weight gain (or for inducing weight loss), treatment of obesity, or treatment of Type II diabetes.
  • the GLP1R modulator is used for treating hypoglycemia.
  • the GLP1R modulator is used for treating post-bariatric hypoglycemia.
  • the GLP1R modulator is used for treating severe hypoglycemia. In some instances, the GLP1R modulator is used for treating hyperinsulinism. In some instances, the GLP1R modulator is used for treating congenital hyperinsulinism.
  • the subject is a mammal. In some instances, the subject is a mouse, rabbit, dog, or human. Subjects treated by methods described herein may be infants, adults, or children. Pharmaceutical compositions comprising antibodies or antibody fragments as described herein may be administered intravenously or subcutaneously.
  • compositions comprising antibodies or antibody fragment thereof that binds GLP1R.
  • the antibody or antibody fragment thereof comprises a sequence as set forth in Tables 7-13.
  • the antibody or antibody fragment thereof comprises a sequence that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence as set forth in Tables 7-13.
  • a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a CDRH1 sequence of any one of SEQ ID NOs: 441-619. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 80% identical to a CDRH1 sequence of any one of SEQ ID NOs: 441-619. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 85% identical to a CDRH1 sequence of any one of SEQ ID NOs: 441-619.
  • a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 90% identical to a CDRH1 sequence of any one of SEQ ID NOs: 441-619. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 95% identical to a CDRH1 sequence of any one of SEQ ID NOs: 441-619. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a CDRH2 sequence of any one of SEQ ID NOs: 620-798.
  • a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 80% identical to a CDRH2 sequence of any one of SEQ ID NOs: 620-798. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 85% identical to a CDRH2 sequence of any one of SEQ ID NOs: 620-798. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 90% identical to a CDRH2 sequence of any one of SEQ ID NOs: 620-798.
  • a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 95% identical to a CDRH2 sequence of any one of SEQ ID NOs: 620-798. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a CDRH3 sequence of any one of SEQ ID NOs: 799-977. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 80% identical to a CDRH3 sequence of any one of SEQ ID NOs: 799-977.
  • a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 85% identical to a CDRH3 sequence of any one of SEQ ID NOs: 799-977. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 90% identical to a CDRH3 sequence of any one of SEQ ID NOs: 799-977. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 95% identical to a CDRH3 sequence of any one of SEQ ID NOs: 799-977.
  • a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a CDRL1 sequence of any one of SEQ ID NOs: 978-1156. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 80% identical to a CDRL1 sequence of any one of SEQ ID NOs: 978-1156. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 85% identical to a CDRL1 sequence of any one of SEQ ID NOs: 978-1156.
  • a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 90% identical to a CDRL1 sequence of any one of SEQ ID NOs: 978-1156. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 95% identical to a CDRL1 sequence of any one of SEQ ID NOs: 978-1156. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a CDRL2 sequence of any one of SEQ ID NOs: 1157-1168. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 80% identical to a CDRL2 sequence of any one of SEQ ID NOs: 1157-1168.
  • a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 85% identical to a CDRL2 sequence of any one of SEQ ID NOs: 1157-1168. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 90% identical to a CDRL2 sequence of any one of SEQ ID NOs: 1157-1168. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 95% identical to a CDRL2 sequence of any one of SEQ ID NOs: 1157-1168. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a CDRL3 sequence of any one of SEQ ID NOs: 1169-1347.
  • a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 80% identical to a CDRL3 sequence of any one of SEQ ID NOs: 1169-1347. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 85% identical to a CDRL3 sequence of any one of SEQ ID NOs: 1169-1347. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 90% identical to a CDRL3 sequence of any one of SEQ ID NOs: 1169-1347. In some instances, a pharmaceutical composition comprises an antibody or antibody fragment described herein comprising a sequence that is at least 95% identical to a CDRL3 sequence of any one of SEQ ID NOs: 1169-1347.
  • the antibody or antibody fragment comprising a variable domain, heavy chain region (VH) and a variable domain, light chain region (VL), wherein VH comprises complementarity determining regions CDRH1, CDRH2, and CDRH3, wherein VL comprises complementarity determining regions CDRL1, CDRL2, and CDRL3, and wherein (a) an amino acid sequence of CDRH1 is as set forth in any one of SEQ ID NOs: 441-619; (b) an amino acid sequence of CDRH2 is as set forth in any one of SEQ ID NOs: 620-798; (c) an amino acid sequence of CDRH3 is as set forth in any one of SEQ ID NOs: 799-977; (d) an amino acid sequence of CDRL1 is as set forth in any one of SEQ ID NOs: 978-1156; (e) an amino acid sequence of CDRL2 is as set forth in any one of SEQ ID NOs: 1157-1168; and (f) an amino acid sequence of CDRL3 is as
  • the antibody or antibody fragment comprising a variable domain, heavy chain region (VH) and a variable domain, light chain region (VL), wherein VH comprises complementarity determining regions CDRH1, CDRH2, and CDRH3, wherein VL comprises complementarity determining regions CDRL1, CDRL2, and CDRL3, and wherein (a) an amino acid sequence of CDRH1 is at least or about 80%, 85%, 90%, or 95% identical to any one of SEQ ID NOs: 441-619; (b) an amino acid sequence of CDRH2 is at least or about 80%, 85%, 90%, or 95% identical to any one of SEQ ID NOs: 620-798; (c) an amino acid sequence of CDRH3 is at least or about 80%, 85%, 90%, or 95% identical to any one of SEQ ID NOs: 799-977; (d) an amino acid sequence of CDRL1 is at least or about 80%, 85%, 90%, or 95% identical to any one of SEQ ID NOs:
  • antibodies or antibody fragments comprising a variable domain, heavy chain region (VH) and a variable domain, light chain region (VL), wherein the VH comprises an amino acid sequence at least about 90% identical to a sequence as set forth in any one of SEQ ID NOs: 58-77, and wherein the VL comprises an amino acid sequence at least about 90% identical to a sequence as set forth in any one of SEQ ID NOs: 92-111.
  • the antibodies or antibody fragments comprise VH comprising at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 58-77, and VL comprising at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 92-111.
  • compositions comprising antibodies or antibody fragment thereof that binds GLP1R that comprise various dosages of the antibodies or antibody fragment.
  • the dosage is ranging from about 1 to 80 mg/kg, from about 1 to about 100 mg/kg, from about 5 to about 100 mg/kg, from about 5 to about 80 mg/kg, from about 5 to about 60 mg/kg, from about 5 to about 50 mg/kg or from about 5 to about 500 mg/kg which can be administered in single or multiple doses.
  • the dosage is administered in an amount of about 0.01 mg/kg, about 0.05 mg/kg, about 0.10 mg/kg, about 0.25 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 5 mg/kg, about 10 mg/kg, about 15 mg/kg, about 20 mg/kg, about 25 mg/kg, about 30 mg/kg, about 35 mg/kg, about 40 mg/kg, about 45 mg/kg, about 50 mg/kg, about 55 mg/kg, about 60 mg/kg, about 65 mg/kg, about 70 mg/kg, about 75 mg/kg, about 80 mg/kg, about 85 mg/kg, about 90 mg/kg, about 95 mg/kg, about 100 mg/kg, about 105 mg/kg, about 110 mg/kg, about 115 mg/kg, about 120, about 125, about 130, about 135, about 140, about 145, about 150, about 155, about 160, about 165, about 170, about 175, about 180, about 185, about 190, about
  • Variant nucleic acid libraries described herein may comprise a plurality of nucleic acids, wherein each nucleic acid encodes for a variant codon sequence compared to a reference nucleic acid sequence.
  • each nucleic acid of a first nucleic acid population contains a variant at a single variant site.
  • the first nucleic acid population contains a plurality of variants at a single variant site such that the first nucleic acid population contains more than one variant at the same variant site.
  • the first nucleic acid population may comprise nucleic acids collectively encoding multiple codon variants at the same variant site.
  • the first nucleic acid population may comprise nucleic acids collectively encoding up to 19 or more codons at the same position.
  • the first nucleic acid population may comprise nucleic acids collectively encoding up to 60 variant triplets at the same position, or the first nucleic acid population may comprise nucleic acids collectively encoding up to 61 different triplets of codons at the same position.
  • Each variant may encode for a codon that results in a different amino acid during translation.
  • Table 2 provides a listing of each codon possible (and the representative amino acid) for a variant site.
  • a nucleic acid population may comprise varied nucleic acids collectively encoding up to 20 codon variations at multiple positions.
  • each nucleic acid in the population comprises variation for codons at more than one position in the same nucleic acid.
  • each nucleic acid in the population comprises variation for codons at 1, 2, 3, 4, 5, 6, 7, 8,
  • each variant long nucleic acid comprises variation for codons at 1, 2, 3, 4, 5, 6, 7, 8, 9,
  • the variant nucleic acid population comprises variation for codons at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more codons in a single nucleic acid. In some instances, the variant nucleic acid population comprises variation for codons in at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more codons in a single long nucleic acid.
  • a platform approach utilizing miniaturization, parallelization, and vertical integration of the end-to-end process from polynucleotide synthesis to gene assembly within nanowells on silicon to create a revolutionary synthesis platform.
  • Devices described herein provide, with the same footprint as a 96-well plate, a silicon synthesis platform capable of increasing throughput by a factor of up to 1,000 or more compared to traditional synthesis methods, with production of up to approximately 1,000,000 or more polynucleotides, or 10,000 or more genes in a single highly-parallelized run.
  • Genomic information encoded in the DNA is transcribed into a message that is then translated into the protein that is the active product within a given biological pathway.
  • a drug itself can be optimized using methods described herein.
  • a variant polynucleotide library encoding for a portion of the antibody is designed and synthesized.
  • a variant nucleic acid library for the antibody can then be generated by processes described herein (e.g., PCR mutagenesis followed by insertion into a vector).
  • the antibody is then expressed in a production cell line and screened for enhanced activity.
  • Example screens include examining modulation in binding affinity to an antigen, stability, or effector function (e.g., ADCC, complement, or apoptosis).
  • Exemplary regions to optimize the antibody include, without limitation, the Fc region, Fab region, variable region of the Fab region, constant region of the Fab region, variable domain of the heavy chain or light chain (VH or VL), and specific complementarity-determining regions (CDRs) of VH or VL.
  • Nucleic acid libraries synthesized by methods described herein may be expressed in various cells associated with a disease state.
  • Cells associated with a disease state include cell lines, tissue samples, primary cells from a subject, cultured cells expanded from a subject, or cells in a model system.
  • Exemplary model systems include, without limitation, plant and animal models of a disease state.
  • a variant nucleic acid library described herein is expressed in a cell associated with a disease state, or one in which a cell a disease state can be induced.
  • an agent is used to induce a disease state in cells.
  • Exemplary tools for disease state induction include, without limitation, a Cre/Lox recombination system, LPS inflammation induction, and streptozotocin to induce hypoglycemia.
  • the cells associated with a disease state may be cells from a model system or cultured cells, as well as cells from a subject having a particular disease condition.
  • Exemplary disease conditions include a bacterial, fungal, viral, autoimmune, or proliferative disorder (e.g., cancer).
  • the variant nucleic acid library is expressed in the model system, cell line, or primary cells derived from a subject, and screened for changes in at least one cellular activity.
  • Exemplary cellular activities include, without limitation, proliferation, cycle progression, cell death, adhesion, migration, reproduction, cell signaling, energy production, oxygen utilization, metabolic activity, and aging, response to free radical damage, or any combination thereof.
  • Devices used as a surface for polynucleotide synthesis may be in the form of substrates which include, without limitation, homogenous array surfaces, patterned array surfaces, channels, beads, gels, and the like.
  • substrates comprising a plurality of clusters, wherein each cluster comprises a plurality of loci that support the attachment and synthesis of polynucleotides.
  • substrates comprise a homogenous array surface.
  • the homogenous array surface is a homogenous plate.
  • locus refers to a discrete region on a structure which provides support for polynucleotides encoding for a single predetermined sequence to extend from the surface.
  • a locus is on a two- dimensional surface, e.g., a substantially planar surface. In some instances, a locus is on a three- dimensional surface, e.g., a well, microwell, channel, or post. In some instances, a surface of a locus comprises a material that is actively functionalized to attach to at least one nucleotide for polynucleotide synthesis, or preferably, a population of identical nucleotides for synthesis of a population of polynucleotides. In some instances, polynucleotide refers to a population of polynucleotides encoding for the same nucleic acid sequence.
  • a surface of a substrate is inclusive of one or a plurality of surfaces of a substrate.
  • the average error rates for polynucleotides synthesized within a library described here using the systems and methods provided are often less than 1 in 1000, less than about 1 in 2000, less than about 1 in 3000 or less often without error correction.
  • a substrate provides support for the synthesis of more than 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000; 5,000; 10,000; 20,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000;
  • the surfaces provide support for the synthesis of more than 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000; 5,000; 10,000; 20,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more polynucleotides encoding for distinct sequences.
  • the substrate provides a surface environment for the growth of polynucleotides having at least 80, 90, 100, 120, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 bases or more.
  • each locus supports the synthesis of a population of polynucleotides.
  • each locus supports the synthesis of a population of polynucleotides having a different sequence than a population of polynucleotides grown on another locus.
  • each polynucleotide sequence is synthesized with 1, 2, 3, 4, 5, 6, 7, 8, 9 or more redundancy across different loci within the same cluster of loci on a surface for polynucleotide synthesis.
  • the loci of a substrate are located within a plurality of clusters.
  • a substrate comprises at least 10, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000 or more clusters.
  • a substrate comprises more than 2,000; 5,000; 10,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,100,000; 1,200,000; 1,300,000; 1,400,000; 1,500,000; 1,600,000; 1,700,000; 1,800,000; 1,900,000; 2,000,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; or 10,000,000 or more distinct loci.
  • a substrate comprises about 10,000 distinct loci.
  • each cluster includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 300, 400, 500 or more loci. In some instances, each cluster includes about 50-500 loci. In some instances, each cluster includes about 100-200 loci. In some instances, each cluster includes about 100-150 loci. In some instances, each cluster includes about 109, 121, 130 or 137 loci. In some instances, each cluster includes about 19, 20, 61, 64 or more loci. Alternatively or in combination, polynucleotide synthesis occurs on a homogenous array surface.
  • the number of distinct polynucleotides synthesized on a substrate is dependent on the number of distinct loci available in the substrate.
  • the density of loci within a cluster or surface of a substrate is at least or about 1, 10, 25, 50, 65, 75, 100, 130, 150, 175, 200, 300, 400, 500, 1,000 or more loci per mm 2 .
  • a substrate comprises 10- 500, 25-400, 50-500, 100-500, 150-500, 10-250, 50-250, 10-200, or 50-200 mm 2 .
  • the distance between the centers of two adjacent loci within a cluster or surface is from about 10-500, from about 10-200, or from about 10-100 um.
  • the distance between two centers of adjacent loci is greater than about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 um. In some instances, the distance between the centers of two adjacent loci is less than about 200, 150, 100, 80, 70, 60, 50, 40, 30, 20 or 10 um. In some instances, each locus has a width of about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 um. In some cases, each locus has a width of about 0.5-100, 0.5-50, 10-75, or 0.5-50 um.
  • the density of clusters within a substrate is at least or about 1 cluster per 100 mm 2 , 1 cluster per 10 mm 2 , 1 cluster per 5 mm 2 , 1 cluster per 4 mm 2 , 1 cluster per 3 mm 2 , 1 cluster per 2 mm 2 , 1 cluster per 1 mm 2 , 2 clusters per 1 mm 2 , 3 clusters per 1 mm 2 , 4 clusters per 1 mm 2 , 5 clusters per 1 mm 2 , 10 clusters per 1 mm 2 , 50 clusters per 1 mm 2 or more.
  • a substrate comprises from about 1 cluster per 10 mm 2 to about 10 clusters per 1 mm 2 .
  • the distance between the centers of two adjacent clusters is at least or about 50, 100, 200, 500, 1000, 2000, or 5000 um. In some cases, the distance between the centers of two adjacent clusters is between about 50-100, 50-200, 50-300, 50-500, and 100-2000 um. In some cases, the distance between the centers of two adjacent clusters is between about 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm. In some cases, each cluster has a cross section of about 0.5 to about 2, about 0.5 to about 1, or about 1 to about 2 mm.
  • each cluster has a cross section of about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 mm. In some cases, each cluster has an interior cross section of about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.15, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 mm.
  • a substrate is about the size of a standard 96 well plate, for example between about 100 and about 200 mm by between about 50 and about 150 mm.
  • a substrate has a diameter less than or equal to about 1000, 500, 450, 400, 300, 250, 200, 150, 100 or 50 mm.
  • the diameter of a substrate is between about 25-1000, 25-800, 25- 600, 25-500, 25-400, 25-300, or 25-200 mm.
  • a substrate has a planar surface area of at least about 100; 200; 500; 1,000; 2,000; 5,000; 10,000; 12,000; 15,000; 20,000; 30,000; 40,000; 50,000 mm 2 or more.
  • the thickness of a substrate is between about 50- 2000, 50- 1000, 100-1000, 200-1000, or 250-1000 mm.
  • Substrates, devices, and reactors provided herein are fabricated from any variety of materials suitable for the methods, compositions, and systems described herein.
  • substrate materials are fabricated to exhibit a low level of nucleotide binding.
  • substrate materials are modified to generate distinct surfaces that exhibit a high level of nucleotide binding.
  • substrate materials are transparent to visible and/or UV light.
  • substrate materials are sufficiently conductive, e.g., are able to form uniform electric fields across all or a portion of a substrate.
  • conductive materials are connected to an electric ground.
  • the substrate is heat conductive or insulated.
  • a substrate comprises flexible materials.
  • materials can include, without limitation: nylon, both modified and unmodified, nitrocellulose, polypropylene, and the like.
  • a substrate comprises rigid materials.
  • materials can include, without limitation: glass; fuse silica; silicon, plastics (for example polytetraflouroethylene, polypropylene, polystyrene, polycarbonate, and blends thereof, and the like); and metals (for example, gold, platinum, and the like).
  • the substrate, solid support or reactors can be fabricated from a material selected from the group consisting of silicon, polystyrene, agarose, dextran, cellulosic polymers, polyacrylamides, polydimethylsiloxane (PDMS), and glass.
  • the substrates/solid supports or the microstructures/reactors therein may be manufactured with a combination of materials listed herein or any other suitable material known in the art.
  • a substrate for the methods, compositions, and systems described herein, wherein the substrates have a surface architecture suitable for the methods, compositions, and systems described herein.
  • a substrate comprises raised and/or lowered features.
  • One benefit of having such features is an increase in surface area to support polynucleotide synthesis.
  • a substrate having raised and/or lowered features is referred to as a three-dimensional substrate.
  • a three-dimensional substrate comprises one or more channels.
  • one or more loci comprise a channel.
  • the channels are accessible to reagent deposition via a deposition device such as a material deposition device.
  • reagents and/or fluids collect in a larger well in fluid communication one or more channels.
  • a substrate comprises a plurality of channels corresponding to a plurality of loci with a cluster, and the plurality of channels are in fluid communication with one well of the cluster.
  • a library of polynucleotides is synthesized in a plurality of loci of a cluster.
  • substrates for the methods, compositions, and systems described herein wherein the substrates are configured for polynucleotide synthesis.
  • the structure is configured to allow for controlled flow and mass transfer paths for polynucleotide synthesis on a surface.
  • the configuration of a substrate allows for the controlled and even distribution of mass transfer paths, chemical exposure times, and/or wash efficacy during polynucleotide synthesis.
  • the configuration of a substrate allows for increased sweep efficiency, for example by providing sufficient volume for a growing polynucleotide such that the excluded volume by the growing polynucleotide does not take up more than 50, 45, 40, 35, 30, 25, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1%, or less of the initially available volume that is available or suitable for growing the polynucleotide.
  • a three-dimensional structure allows for managed flow of fluid to allow for the rapid exchange of chemical exposure.
  • segregation is achieved by differential functionalization of the surface generating active and passive regions for polynucleotide synthesis.
  • differential functionalization is achieved by alternating the hydrophobicity across the substrate surface, thereby creating water contact angle effects that cause beading or wetting of the deposited reagents.
  • Employing larger structures can decrease splashing and cross-contamination of distinct polynucleotide synthesis locations with reagents of the neighboring spots.
  • a device such as a material deposition device, is used to deposit reagents to distinct polynucleotide synthesis locations.
  • Substrates having three-dimensional features are configured in a manner that allows for the synthesis of a large number of polynucleotides (e.g., more than about 10,000) with a low error rate (e.g., less than about 1 :500, 1 : 1000, 1 : 1500, 1 :2,000, 1 :3,000, 1 :5,000, or 1 : 10,000).
  • a substrate comprises features with a density of about or greater than about 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400 or 500 features 2 per mm .
  • a well of a substrate may have the same or different width, height, and/or volume as another well of the substrate.
  • a channel of a substrate may have the same or different width, height, and/or volume as another channel of the substrate.
  • the diameter of a cluster or the diameter of a well comprising a cluster, or both is between about 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.05-1, 0.05-0.5, 0.05-0.1, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm.
  • the diameter of a cluster or well or both is less than or about 5, 4, 3, 2, 1, 0.5, 0.1, 0.09, 0.08, 0.07, 0.06, or 0.05 mm. In some instances, the diameter of a cluster or well or both is between about 1.0 and 1.3 mm. In some instances, the diameter of a cluster or well, or both is about 1.150 mm. In some instances, the diameter of a cluster or well, or both is about 0.08 mm.
  • the diameter of a cluster refers to clusters within a two-dimensional or three-dimensional substrate.
  • the height of a well is from about 20-1000, 50-1000, 100- 1000, 200- 1000, 300-1000, 400-1000, or 500-1000 um. In some cases, the height of a well is less than about 1000, 900, 800, 700, or 600 um.
  • a substrate comprises a plurality of channels corresponding to a plurality of loci within a cluster, wherein the height or depth of a channel is 5-500, 5-400, 5-300, 5- 200, 5-100, 5-50, or 10-50 um. In some cases, the height of a channel is less than 100, 80, 60, 40, or 20 um.
  • the diameter of a channel, locus (e.g., in a substantially planar substrate) or both channel and locus (e.g, in a three-dimensional substrate wherein a locus corresponds to a channel) is from about 1-1000, 1-500, 1-200, 1-100, 5-100, or 10-100 um, for example, to about 90, 80, 70, 60, 50, 40, 30, 20 or 10 um. In some instances, the diameter of a channel, locus, or both channel and locus is less than about 100, 90, 80, 70, 60, 50, 40, 30, 20 or 10 um. In some instances, the distance between the center of two adjacent channels, loci, or channels and loci is from about 1-500, 1-200, 1-100, 5-200, 5-100, 5-50, or 5-30, for example, to about 20 um.
  • the surface comprises various surface modifications.
  • the surface modifications are employed for the chemical and/or physical alteration of a surface by an additive or subtractive process to change one or more chemical and/or physical properties of a substrate surface or a selected site or region of a substrate surface.
  • surface modifications include, without limitation, (1) changing the wetting properties of a surface, (2) functionalizing a surface, i.e., providing, modifying or substituting surface functional groups, (3) defunctionalizing a surface, i.e., removing surface functional groups, (4) otherwise altering the chemical composition of a surface, e.g., through etching, (5) increasing or decreasing surface roughness, (6) providing a coating on a surface, e.g., a coating that exhibits wetting properties that are different from the wetting properties of the surface, and/or (7) depositing particulates on a surface.
  • adhesion promoter facilitates structured patterning of loci on a surface of a substrate.
  • exemplary surfaces for application of adhesion promotion include, without limitation, glass, silicon, silicon dioxide and silicon nitride.
  • the adhesion promoter is a chemical with a high surface energy.
  • a second chemical layer is deposited on a surface of a substrate.
  • the second chemical layer has a low surface energy.
  • surface energy of a chemical layer coated on a surface supports localization of droplets on the surface. Depending on the patterning arrangement selected, the proximity of loci and/or area of fluid contact at the loci are alterable.
  • a substrate surface, or resolved loci, onto which nucleic acids or other moi eties are deposited, e.g., for polynucleotide synthesis are smooth or substantially planar (e.g., two-dimensional) or have irregularities, such as raised or lowered features (e.g., three- dimensional features).
  • a substrate surface is modified with one or more different layers of compounds. Such modification layers of interest include, without limitation, inorganic and organic layers such as metals, metal oxides, polymers, small organic molecules, and the like.
  • resolved loci of a substrate are functionalized with one or more moieties that increase and/or decrease surface energy.
  • a moiety is chemically inert. In some cases, a moiety is configured to support a desired chemical reaction, for example, one or more processes in a polynucleotide synthesis reaction.
  • the surface energy, or hydrophobicity, of a surface is a factor for determining the affinity of a nucleotide to attach onto the surface.
  • a method for substrate functionalization comprises: (a) providing a substrate having a surface that comprises silicon dioxide; and (b) silanizing the surface using a suitable silanizing agent described herein or otherwise known in the art, for example, an organofunctional alkoxysilane molecule. Methods and functionalizing agents are described in U.S. Patent No. 5474796, which is herein incorporated by reference in its entirety.
  • a substrate surface is functionalized by contact with a derivatizing composition that contains a mixture of silanes, under reaction conditions effective to couple the silanes to the substrate surface, typically via reactive hydrophilic moieties present on the substrate surface.
  • Silanization generally covers a surface through self-assembly with organofunctional alkoxysilane molecules.
  • a variety of siloxane functionalizing reagents can further be used as currently known in the art, e.g., for lowering or increasing surface energy.
  • the organofunctional alkoxysilanes are classified according to their organic functions.
  • Methods of the current disclosure for polynucleotide synthesis may include processes involving phosphoramidite chemistry.
  • polynucleotide synthesis comprises coupling a base with phosphoramidite.
  • Polynucleotide synthesis may comprise coupling a base by deposition of phosphoramidite under coupling conditions, wherein the same base is optionally deposited with phosphoramidite more than once, i.e., double coupling.
  • Polynucleotide synthesis may comprise capping of unreacted sites. In some instances, capping is optional.
  • Polynucleotide synthesis may also comprise oxidation or an oxidation step or oxidation steps.
  • Polynucleotide synthesis may comprise deblocking, detrityl ati on, and sulfurization. In some instances, polynucleotide synthesis comprises either oxidation or sulfurization. In some instances, between one or each step during a polynucleotide synthesis reaction, the device is washed, for example, using tetrazole or acetonitrile. Time frames for any one step in a phosphoramidite synthesis method may be less than about 2 min, 1 min, 50 sec, 40 sec, 30 sec, 20 sec and 10 sec.
  • Polynucleotide synthesis using a phosphoramidite method may comprise a subsequent addition of a phosphoramidite building block (e.g., nucleoside phosphoramidite) to a growing polynucleotide chain for the formation of a phosphite triester linkage.
  • Phosphoramidite polynucleotide synthesis proceeds in the 3’ to 5’ direction.
  • Phosphoramidite polynucleotide synthesis allows for the controlled addition of one nucleotide to a growing nucleic acid chain per synthesis cycle. In some instances, each synthesis cycle comprises a coupling step.
  • Phosphoramidite coupling involves the formation of a phosphite triester linkage between an activated nucleoside phosphoramidite and a nucleoside bound to the substrate, for example, via a linker.
  • the nucleoside phosphoramidite is provided to the device activated.
  • the nucleoside phosphoramidite is provided to the device with an activator.
  • nucleoside phosphoramidites are provided to the device in a 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100-fold excess or more over the substrate-bound nucleosides.
  • nucleoside phosphoramidite is performed in an anhydrous environment, for example, in anhydrous acetonitrile.
  • the device is optionally washed.
  • the coupling step is repeated one or more additional times, optionally with a wash step between nucleoside phosphoramidite additions to the substrate.
  • a polynucleotide synthesis method used herein comprises 1, 2, 3 or more sequential coupling steps.
  • the nucleoside bound to the device is de-protected by removal of a protecting group, where the protecting group functions to prevent polymerization.
  • a common protecting group is 4,4'-dimethoxytrityl (DMT).
  • phosphoramidite polynucleotide synthesis methods optionally comprise a capping step.
  • a capping step the growing polynucleotide is treated with a capping agent.
  • a capping step is useful to block unreacted substrate-bound 5'-OH groups after coupling from further chain elongation, preventing the formation of polynucleotides with internal base deletions.
  • phosphoramidites activated with IH-tetrazole may react, to a small extent, with the 06 position of guanosine. Without being bound by theory, upon oxidation with I2 /water, this side product, possibly via O6-N7 migration, may undergo depurination.
  • the apurinic sites may end up being cleaved in the course of the final deprotection of the polynucleotide thus reducing the yield of the full-length product.
  • the 06 modifications may be removed by treatment with the capping reagent prior to oxidation with F/water.
  • inclusion of a capping step during polynucleotide synthesis decreases the error rate as compared to synthesis without capping.
  • the capping step comprises treating the substrate-bound polynucleotide with a mixture of acetic anhydride and 1 -methylimidazole. Following a capping step, the device is optionally washed.
  • the device bound growing nucleic acid is oxidized.
  • the oxidation step comprises a phosphite triester which is oxidized into a tetracoordinated phosphate triester, a protected precursor of the naturally occurring phosphate diester internucleoside linkage.
  • oxidation of the growing polynucleotide is achieved by treatment with iodine and water, optionally in the presence of a weak base (e.g., pyridine, lutidine, collidine). Oxidation may be carried out under anhydrous conditions using, e.g.
  • a capping step is performed following oxidation.
  • a second capping step allows for device drying, as residual water from oxidation that may persist can inhibit subsequent coupling.
  • the device and growing polynucleotide are optionally washed.
  • the step of oxidation is substituted with a sulfurization step to obtain polynucleotide phosphorothioates, wherein any capping steps can be performed after the sulfurization.
  • reagents are capable of the efficient sulfur transfer, including but not limited to 3-(Dimethylaminomethylidene)amino)-3H-l,2,4-dithiazole-3-thione, DDTT, 3H-l,2-benzodithiol-3-one 1,1-dioxide, also known as Beaucage reagent, and N,N,N'N'- Tetraethylthiuram disulfide (TETD).
  • DDTT 3-(Dimethylaminomethylidene)amino)-3H-l,2,4-dithiazole-3-thione
  • DDTT 3H-l,2-benzodithiol-3-one 1,1-dioxide
  • Beaucage reagent also known as Beaucage reagent
  • TETD N,N,N'N'- Tetraethylthiuram disulfide
  • the protected 5' end of the device bound growing polynucleotide is removed so that the primary hydroxyl group is reactive with a next nucleoside phosphoramidite.
  • the protecting group is DMT and deblocking occurs with trichloroacetic acid in dichloromethane. Conducting detritylation for an extended time or with stronger than recommended solutions of acids may lead to increased depurination of solid support-bound polynucleotide and thus reduces the yield of the desired full-length product.
  • Methods and compositions of the disclosure described herein provide for controlled deblocking conditions limiting undesired depurination reactions.
  • the device bound polynucleotide is washed after deblocking. In some instances, efficient washing after deblocking contributes to synthesized polynucleotides having a low error rate.
  • Methods for the synthesis of polynucleotides typically involve an iterating sequence of the following steps: application of a protected monomer to an actively functionalized surface (e.g., locus) to link with either the activated surface, a linker or with a previously deprotected monomer; deprotection of the applied monomer so that it is reactive with a subsequently applied protected monomer; and application of another protected monomer for linking.
  • One or more intermediate steps include oxidation or sulfurization.
  • one or more wash steps precede or follow one or all of the steps.
  • Methods for phosphoramidite-based polynucleotide synthesis comprise a series of chemical steps.
  • one or more steps of a synthesis method involve reagent cycling, where one or more steps of the method comprise application to the device of a reagent useful for the step.
  • reagents are cycled by a series of liquid deposition and vacuum drying steps.
  • substrates comprising three-dimensional features such as wells, microwells, channels and the like, reagents are optionally passed through one or more regions of the device via the wells and/or channels.
  • Methods and systems described herein relate to polynucleotide synthesis devices for the synthesis of polynucleotides. The synthesis may be in parallel.
  • the total number polynucleotides that may be synthesized in parallel may be from 2-100000, 3-50000, 4- 10000, 5-1000, 6-900, 7-850, 8-800, 9-750, 10-700, 11-650, 12-600, 13-550, 14-500, 15-450, 16- 400, 17-350, 18-300, 19-250, 20-200, 21-150,22-100, 23-50, 24-45, 25-40, 30-35.
  • the total number of polynucleotides synthesized in parallel may fall within any range bound by any of these values, for example 25-100.
  • the total number of polynucleotides synthesized in parallel may fall within any range defined by any of the values serving as endpoints of the range.
  • Total molar mass of polynucleotides synthesized within the device or the molar mass of each of the polynucleotides may be at least or at least about 10, 20, 30, 40, 50, 100, 250, 500, 750, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 25000, 50000, 75000, 100000 picomoles, or more.
  • the length of each of the polynucleotides or average length of the polynucleotides within the device may be at least or about at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500 nucleotides, or more.
  • the length of each of the polynucleotides or average length of the polynucleotides within the device may be at most or about at most 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 nucleotides, or less.
  • the length of each of the polynucleotides or average length of the polynucleotides within the device may fall from 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, 19-25.
  • each of the polynucleotides or average length of the polynucleotides within the device may fall within any range bound by any of these values, for example 100-300.
  • the length of each of the polynucleotides or average length of the polynucleotides within the device may fall within any range defined by any of the values serving as endpoints of the range.
  • Methods for polynucleotide synthesis on a surface allow for synthesis at a fast rate.
  • at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200 nucleotides per hour, or more are synthesized.
  • Nucleotides include adenine, guanine, thymine, cytosine, uridine building blocks, or analogs/modified versions thereof.
  • libraries of polynucleotides are synthesized in parallel on substrate.
  • a device comprising about or at least about 100; 1,000; 10,000; 30,000; 75,000; 100,000; 1,000,000; 2,000,000; 3,000,000; 4,000,000; or 5,000,000 resolved loci is able to support the synthesis of at least the same number of distinct polynucleotides, wherein polynucleotide encoding a distinct sequence is synthesized on a resolved locus.
  • a library of polynucleotides is synthesized on a device with low error rates described herein in less than about three months, two months, one month, three weeks, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, 24 hours, or less.
  • nucleic acids assembled from a polynucleotide library synthesized with low error rate using the substrates and methods described herein are prepared in less than about three months, two months, one month, three weeks, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, 24 hours, or less.
  • methods described herein provide for generation of a library of nucleic acids comprising variant nucleic acids differing at a plurality of codon sites.
  • a nucleic acid may have 1 site, 2 sites, 3 sites, 4 sites, 5 sites, 6 sites, 7 sites, 8 sites, 9 sites, 10 sites, 11 sites, 12 sites, 13 sites, 14 sites, 15 sites, 16 sites, 17 sites 18 sites, 19 sites, 20 sites, 30 sites, 40 sites, 50 sites, or more of variant codon sites.
  • the one or more sites of variant codon sites may be adjacent. In some instances, the one or more sites of variant codon sites may not be adjacent but are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more codons.
  • a nucleic acid may comprise multiple sites of variant codon sites, wherein all the variant codon sites are adjacent to one another, forming a stretch of variant codon sites. In some instances, a nucleic acid may comprise multiple sites of variant codon sites, wherein none the variant codon sites are adjacent to one another. In some instances, a nucleic acid may comprise multiple sites of variant codon sites, wherein some the variant codon sites are adjacent to one another, forming a stretch of variant codon sites, and some of the variant codon sites are not adjacent to one another.
  • FIG. 3 illustrates an exemplary process workflow for synthesis of nucleic acids (e.g., genes) from shorter nucleic acids.
  • the workflow is divided generally into phases: (1) de novo synthesis of a single stranded nucleic acid library, (2) joining nucleic acids to form larger fragments, (3) error correction, (4) quality control, and (5) shipment.
  • an intended nucleic acid sequence or group of nucleic acid sequences is preselected. For example, a group of genes is preselected for generation.
  • a predetermined library of nucleic acids is designed for de novo synthesis.
  • Various suitable methods are known for generating high density polynucleotide arrays.
  • a device surface layer is provided.
  • chemistry of the surface is altered in order to improve the polynucleotide synthesis process. Areas of low surface energy are generated to repel liquid while areas of high surface energy are generated to attract liquids.
  • the surface itself may be in the form of a planar surface or contain variations in shape, such as protrusions or microwells which increase surface area.
  • high surface energy molecules selected serve a dual function of supporting DNA chemistry, as disclosed in International Patent Application Publication WO/2015/021080, which is herein incorporated by reference in its entirety.
  • a deposition device such as a material deposition device, is designed to release reagents in a step-wise fashion such that multiple polynucleotides extend, in parallel, one residue at a time to generate oligomers with a predetermined nucleic acid sequence 302.
  • polynucleotides are cleaved from the surface at this stage.
  • Cleavage includes gas cleavage, e.g., with ammonia or methylamine.
  • the generated polynucleotide libraries are placed in a reaction chamber.
  • the reaction chamber also referred to as “nanoreactor” is a silicon coated well, containing PCR reagents and lowered onto the polynucleotide library 303.
  • a reagent is added to release the polynucleotides from the substrate.
  • the polynucleotides are released subsequent to sealing of the nanoreactor 305. Once released, fragments of single stranded polynucleotides hybridize in order to span an entire long-range sequence of DNA. Partial hybridization 305 is possible because each synthesized polynucleotide is designed to have a small portion overlapping with at least one other polynucleotide in the pool.
  • a PCA reaction is commenced.
  • the polynucleotides anneal to complementary fragments and gaps are filled in by a polymerase.
  • Each cycle increases the length of various fragments randomly depending on which polynucleotides find each other. Complementarity amongst the fragments allows for formation of a complete large span of double stranded DNA 306.
  • the nanoreactor is separated from the device 307 and positioned for interaction with a device having primers for PCR 308. After sealing, the nanoreactor is subject to PCR 309 and the larger nucleic acids are amplified. After PCR 310, the nanochamber is opened 311, error correction reagents are added 312, the chamber is sealed 313 and an error correction reaction occurs to remove mismatched base pairs and/or strands with poor complementarity from the double stranded PCR amplification products 314. The nanoreactor is opened and separated 315. Error corrected product is next subject to additional processing steps, such as PCR and molecular bar coding, and then packaged 322 for shipment 323.
  • additional processing steps such as PCR and molecular bar coding
  • quality control measures are taken. After error correction, quality control steps include for example interaction with a wafer having sequencing primers for amplification of the error corrected product 316, sealing the wafer to a chamber containing error corrected amplification product 317, and performing an additional round of amplification 318. The nanoreactor is opened 319 and the products are pooled 320 and sequenced 321. After an acceptable quality control determination is made, the packaged product 322 is approved for shipment 323.
  • a nucleic acid generated by a workflow such as that in FIG. 3 is subject to mutagenesis using overlapping primers disclosed herein.
  • a library of primers is generated by in situ preparation on a solid support and utilize single nucleotide extension process to extend multiple oligomers in parallel.
  • a deposition device such as a material deposition device, is designed to release reagents in a step wise fashion such that multiple polynucleotides extend, in parallel, one residue at a time to generate oligomers with a predetermined nucleic acid sequence 302.
  • any of the systems described herein may be operably linked to a computer and may be automated through a computer either locally or remotely.
  • the methods and systems of the disclosure may further comprise software programs on computer systems and use thereof.
  • computerized control for the synchronization of the dispense/vacuum/refill functions such as orchestrating and synchronizing the material deposition device movement, dispense action and vacuum actuation are within the bounds of the disclosure.
  • the computer systems may be programmed to interface between the user specified base sequence and the position of a material deposition device to deliver the correct reagents to specified regions of the substrate.
  • the system such as shown in FIG. 4 can include a CPU 401, disk drives 403, optional input devices such as keyboard 415 and/or mouse 416 and optional monitor 407.
  • Data communication can be achieved through the indicated communication medium to a server at a local or a remote location.
  • the communication medium can include any means of transmitting and/or receiving data.
  • the communication medium can be a network connection, a wireless connection or an internet connection. Such a connection can provide for communication over the World Wide Web. It is envisioned that data relating to the present disclosure can be transmitted over such networks or connections for reception and/or review by a party 422 as illustrated in FIG. 4.
  • FIG. 5 is a block diagram illustrating a first example architecture of a computer system 500 that can be used in connection with example instances of the present disclosure.
  • the example computer system can include a processor 502 for processing instructions.
  • processors include: Intel XeonTM processor, AMD OpteronTM processor, Samsung 32-bit RISC ARM 1176JZ(F)-S vl.OTM processor, ARM Cortex-A8 Samsung S5PC100TM processor, ARM Cortex-A8 Apple A4TM processor, Marvell PXA 930TM processor, or a functionally-equivalent processor. Multiple threads of execution can be used for parallel processing.
  • a high-speed cache 504 can be connected to, or incorporated in, the processor 502 to provide a high speed memory for instructions or data that have been recently, or are frequently, used by the processor 502.
  • the processor 502 is connected to a north bridge 506 by a processor bus 508.
  • the north bridge 506 is connected to random access memory (RAM) 510 by a memory bus 512 and manages access to the RAM 510 by the processor 502.
  • RAM random access memory
  • the north bridge 506 is also connected to a south bridge 514 by a chipset bus 516.
  • the south bridge 514 is, in turn, connected to a peripheral bus 518.
  • the peripheral bus can be, for example, PCI, PCI-X, PCI Express, or other peripheral bus.
  • the north bridge and south bridge are often referred to as a processor chipset and manage data transfer between the processor, RAM, and peripheral components on the peripheral bus 518.
  • the functionality of the north bridge can be incorporated into the processor instead of using a separate north bridge chip.
  • system 500 can include an accelerator card 522 attached to the peripheral bus 518.
  • the accelerator can include field programmable gate arrays (FPGAs) or other hardware for accelerating certain processing.
  • FPGAs field programmable gate arrays
  • an accelerator can be used for adaptive data restructuring or to evaluate algebraic expressions used in extended set processing.
  • the system 500 includes an operating system for managing system resources; non-limiting examples of operating systems include: Linux, WindowsTM, MACOSTM, BlackBerry OSTM, iOSTM, and other functionally-equivalent operating systems, as well as application software running on top of the operating system for managing data storage and optimization in accordance with example instances of the present disclosure.
  • system 500 also includes network interface cards (NICs) 520 and 521 connected to the peripheral bus for providing network interfaces to external storage, such as Network Attached Storage (NAS) and other computer systems that can be used for distributed parallel processing.
  • NICs network interface cards
  • FIG. 6 is a diagram showing a network 600 with a plurality of computer systems 602a, and 602b, a plurality of cell phones and personal data assistants 602c, and Network Attached Storage (NAS) 604a, and 604b.
  • systems 602a, 602b, and 602c can manage data storage and optimize data access for data stored in Network Attached Storage (NAS) 604a and 604b.
  • a mathematical model can be used for the data and be evaluated using distributed parallel processing across computer systems 602a, and 602b, and cell phone and personal data assistant systems 602c.
  • Computer systems 602a, and 602b, and cell phone and personal data assistant systems 602c can also provide parallel processing for adaptive data restructuring of the data stored in Network Attached Storage (NAS) 604a and 604b.
  • FIG. 6 illustrates an example only, and a wide variety of other computer architectures and systems can be used in conjunction with the various instances of the present disclosure.
  • a blade server can be used to provide parallel processing.
  • Processor blades can be connected through a back plane to provide parallel processing.
  • Storage can also be connected to the back plane or as Network Attached Storage (NAS) through a separate network interface.
  • processors can maintain separate memory spaces and transmit data through network interfaces, back plane or other connectors for parallel processing by other processors.
  • some or all of the processors can use a shared virtual address memory space.
  • FIG. 7 is a block diagram of a multiprocessor computer system 700 using a shared virtual address memory space in accordance with an example instance.
  • the system includes a plurality of processors 702a-f that can access a shared memory subsystem 704.
  • the system incorporates a plurality of programmable hardware memory algorithm processors (MAPs) 706a-f in the memory subsystem 704.
  • MAPs programmable hardware memory algorithm processors
  • Each MAP 706a-f can comprise a memory 708a-f and one or more field programmable gate arrays (FPGAs) 710a-f.
  • the MAP provides a configurable functional unit and particular algorithms or portions of algorithms can be provided to the FPGAs 710a-f for processing in close coordination with a respective processor.
  • the MAPs can be used to evaluate algebraic expressions regarding the data model and to perform adaptive data restructuring in example instances.
  • each MAP is globally accessible by all of the processors for these purposes.
  • each MAP can use Direct Memory Access (DMA) to access an associated memory 708a-f, allowing it to execute tasks independently of, and asynchronously from the respective microprocessor 702a-f.
  • DMA Direct Memory Access
  • a MAP can feed results directly to another MAP for pipelining and parallel execution of algorithms.
  • the above computer architectures and systems are examples only, and a wide variety of other computer, cell phone, and personal data assistant architectures and systems can be used in connection with example instances, including systems using any combination of general processors, co-processors, FPGAs and other programmable logic devices, system on chips (SOCs), application specific integrated circuits (ASICs), and other processing and logic elements.
  • SOCs system on chips
  • ASICs application specific integrated circuits
  • all or part of the computer system can be implemented in software or hardware.
  • Any variety of data storage media can be used in connection with example instances, including random access memory, hard drives, flash memory, tape drives, disk arrays, Network Attached Storage (NAS) and other local or distributed data storage devices and systems.
  • NAS Network Attached Storage
  • the computer system can be implemented using software modules executing on any of the above or other computer architectures and systems.
  • the functions of the system can be implemented partially or completely in firmware, programmable logic devices such as field programmable gate arrays (FPGAs) as referenced in FIG. 5, system on chips (SOCs), application specific integrated circuits (ASICs), or other processing and logic elements.
  • FPGAs field programmable gate arrays
  • SOCs system on chips
  • ASICs application specific integrated circuits
  • the Set Processor and Optimizer can be implemented with hardware acceleration through the use of a hardware accelerator card, such as accelerator card 522 illustrated in FIG. 5
  • Example 1 Functionalization of a device surface
  • a device was functionalized to support the attachment and synthesis of a library of polynucleotides.
  • the device surface was first wet cleaned using a piranha solution comprising 90% H2SO4 and 10% H2O2 for 20 minutes.
  • the device was rinsed in several beakers with DI water, held under a DI water gooseneck faucet for 5 min, and dried with N2.
  • the device was subsequently soaked in NH4OH (1 : 100; 3 mL:300 mL) for 5 min, rinsed with DI water using a handgun, soaked in three successive beakers with DI water for 1 min each, and then rinsed again with DI water using the handgun.
  • the device was then plasma cleaned by exposing the device surface to O2.
  • a SAMCO PC-300 instrument was used to plasma etch O2 at 250 watts for 1 min in downstream mode.
  • the cleaned device surface was actively functionalized with a solution comprising N-(3- tri ethoxy silylpropyl)-4-hydroxybutyramide using a YES-1224P vapor deposition oven system with the following parameters: 0.5 to 1 torr, 60 min, 70 °C, 135 °C vaporizer.
  • the device surface was resist coated using a Brewer Science 200X spin coater. SPRTM 3612 photoresist was spin coated on the device at 2500 rpm for 40 sec. The device was pre-baked for 30 min at 90 °C on a Brewer hot plate.
  • the device was subjected to photolithography using a Karl Suss MA6 mask aligner instrument.
  • the device was exposed for 2.2 sec and developed for 1 min in MSF 26A. Remaining developer was rinsed with the handgun and the device soaked in water for 5 min. The device was baked for 30 min at 100 °C in the oven, followed by visual inspection for lithography defects using a Nikon L200. A descum process was used to remove residual resist using the SAMCO PC-300 instrument to O2 plasma etch at 250 watts for 1 min.
  • the device surface was passively functionalized with a 100 pL solution of perfluorooctyltrichlorosilane mixed with 10 pL light mineral oil.
  • the device was placed in a chamber, pumped for 10 min, and then the valve was closed to the pump and left to stand for 10 min. The chamber was vented to air.
  • the device was resist stripped by performing two soaks for 5 min in 500 mL NMP at 70 °C with ultrasonication at maximum power (9 on Crest system). The device was then soaked for 5 min in 500 mL isopropanol at room temperature with ultrasonication at maximum power.
  • the device was dipped in 300 mL of 200 proof ethanol and blown dry with N2.
  • the functionalized surface was activated to serve as a support for polynucleotide synthesis.
  • Example 2 Synthesis of a 50-mer sequence on an oligonucleotide synthesis device
  • a two-dimensional oligonucleotide synthesis device was assembled into a flowcell, which was connected to a flowcell (Applied Biosystems (AB 1394 DNA Synthesizer").
  • the two- dimensional oligonucleotide synthesis device was uniformly functionalized with N-(3- TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE (Gelest) which was used to synthesize an exemplary polynucleotide of 50 bp ("50-mer polynucleotide”) using polynucleotide synthesis methods described herein.
  • sequence of the 50-mer was as described in SEQ ID NO: 1348.
  • TTT3 1 (SEQ ID NO.: 1348), where # denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable linker enabling the release of oligos from the surface during deprotection.
  • the flow restrictor was removed from the ABI 394 synthesizer to enable faster flow. Without flow restrictor, flow rates for amidites (0. IM in ACN), Activator, (0.25M Benzoylthiotetrazole ("BTT"; 30-3070-xx from GlenResearch) in ACN), and Ox (0.02M 12 in 20% pyridine, 10% water, and 70% THF) were roughly ⁇ 100uL/sec, for acetonitrile (“ACN”) and capping reagents (1 : 1 mix of CapA and CapB, wherein CapA is acetic anhydride in THF/Pyridine and CapB is 16% 1-methylimidizole in THF), roughly ⁇ 200uL/sec, and for Deblock (3% di chloroacetic acid in toluene), roughly ⁇ 300uL/sec (compared to ⁇ 50uL/sec for all reagents with flow restrictor).
  • ACN acetonitrile
  • Deblock 3% di chloroacetic acid in
  • Example 3 Synthesis of a 100-mer sequence on an oligonucleotide synthesis device
  • 100-mer polynucleotide (“100-mer polynucleotide”; 5' CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGTCATG CTAGCCATACCATGATGATGATGATGATGAGAACCCCGCAT##TTTTTTTT3', where # denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP -2244 from ChemGenes); SEQ ID NO.: 1349) on two different silicon chips, the first one uniformly functionalized with N-(3- TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE and the second one functionalized with 5/95 mix of 11 -acetoxyund
  • Table 5 summarizes error characteristics for the sequences obtained from the polynucleotide samples from spots 1-10.
  • Example 4 Functional GLP-1R Antibodies Identified from a Synthetic GPCR- focused Library Demonstrate Potent Blood Glucose Control [00221] This example describes the identification of antagonistic and agonistic GLP-1R antibodies with in vitro and in vivo functional activity.
  • the full length human GLP-1R gene (UniProt - P43220) with an N-terminal FLAG tag and C-terminal GFP tag cloned into pCDNA3.1(+) vector (ThermoFisher) was transfected into suspension Chinese Hamster Ovary (CHO) cells to generate the stable cell line expressing GLP-1R. Target expression was confirmed by FACS. Cells expressing > 80% of GLP-1R by GFP were then directly used for cell-based selections.
  • Germline heavy chain IGHV1-69, IGHV3-30 and germline light chain IGKV1-39, IGKV3-15, IGLV1-51, IGLV2-14 framework combinations were used in the GPCR-focused phage-displayed library, and all six CDR diversities were encoded by oligo pools synthesized similar to Examples 1-3 above. The CDRs were also screened to ensure they did not contain manufacturability liabilities, cryptic splice sites, or commonly used nucleotide restriction sites.
  • the heavy chain variable region (VH) and light chain variable region (VL) were linked by (G4S)3 linker.
  • the resulting scFv (VH-linker-VL) gene library was cloned into a pADL 22-2c (Antibody Design Labs) phage display vector by Notl restriction digestion and electroporated into TGI electro-competent A. coli cells. (Lucigen).
  • the final library has a diversity of 1.1 x 10 10 size, which was verified by NGS.
  • phage particles were blocked with 5% BSA/PBS and depleted for non-specific binders on CHO parent cells.
  • the input phage aliquot was rotated at 14 rpm/min with 1 xlO 8 CHO parent cells for 1 hour at room temperature (RT).
  • the cells were then pelleted by centrifuging at 1,200 rpm for 10 mins in a tabletop Eppendorf centrifuge 5920RS/4xl000 rotor to deplete the non-specific CHO cell binders.
  • the phage supernatant and GLP-1R expressing CHO cells were rotated at 14 rpm/min for 1 hour at RT to select for GLP-1R binders. After incubation, the cells were washed several times with lx PBS/0.5% Tween to remove non-binding clones.
  • trypsin in PBS buffer for 30 minutes at 37°C. The cells were pelleted by centrifuging at 1,200 rpm for 10 mins.
  • the output supernatant enriched in GLP-1R binding clones was amplified in TGI E.coli cells to use as input phage for the next round of selection. This selection strategy was repeated for five rounds. Every round was depleted against the CHO parent background. Amplified output phage from a round was used as the input phage for the subsequent round, and the stringency of washes were increased in each subsequent round of selections with more washes. After five rounds of selection, 500 clones from each of round 4 and round 5 were Sanger sequenced to identify unique clones.
  • the phagemid DNA was miniprepped from the output bacterial stocks of all panning rounds.
  • the variable heavy chain (VH) was PCR amplified from the phagemid DNA using the Forward Primer ACAGAATTCATTAAAGAGGAGAAATTAACC and reverse primer TGAACCGCCTCCACCGCTAG.
  • the PCR product was directly used for library preparation using the KAPA HyperPlus Library Preparation Kit (Kapa Biosystems, product # KK8514). To add diversity in the library, the samples were spiked with 15% PhiX Control purchased from Illumina, Inc. (product # FC- 110-3001).
  • the library was then loaded onto Illumina’s 600 cycle MiSeq Reagent Kit v3 (Illumina, product # MS-102-3003) and run on the MiSeq instrument.
  • Expi293 cells were transfected using Expifectamine (ThermoFisher, A14524) with the heavy chain and light chain DNA at a 2: 1 ratio and supernatants were harvested 4 days posttransfection before cell viability dropped below 80%. Purifications were undertaken using either King Fisher (ThermoFisher) with protein A magnetic beads or Phynexus protein A column tips (Hamilton). For large scale production of IgG clones that were evaluated in in vivo mouse studies, an Akta HPLC purification system (GE) was used.
  • IgG characterization and quality control The purified IgGs for the positive GLP-1R binders (hits) were subjected to characterization for their purity by LabChip GXII Touch HT Protein Express high-sensitivity assay. Dithiothreitol (DTT) was used to reduce the IgG into VH and VL. IgG concentrations were measured using Lunatic (UnChain). IgG for in vivo mouse studies were further characterized by HPLC and tested for endotoxin levels (Endosafe® nexgen- PTSTM Endotoxin Testing, Charles River), with less than 5 EU per kg dosing.
  • DTT Dithiothreitol
  • GLP-1R IgG clones were tested in a binding assay coupled to flow cytometry analysis as follows: FLAG-GLP-1R-GFP expressing CHO cells (CHO-GLP-1R) and CHO-parent cells were incubated with 100 nM IgG for 1 h on ice, washed three times and incubated with Alexa 647 conjugated goat-anti-human antibody (1 :200) (Jackson ImmunoResearch Laboratories, 109-605- 044) for 30 min on ice, followed by three washes, centrifuging to pellet the cells between each washing step. All incubations and washes were in buffer containing PBS+1% BSA.
  • IgG was serially diluted 1 :3 starting from 100 nM down to 0.046 nM.
  • Cells were analyzed by flow cytometry and hits (a hit is an IgG that specifically binds to CHO-GLP-1R) were identified by measuring the GFP signal against the Alexa 647 signal.
  • Flow cytometry data of binding assays with 100 nM IgG are presented as dot plots.
  • Analyses of binding assays with IgG titrations are presented as binding curves plotting IgG concentrations against MFI (mean fluorescence intensity).
  • cAMP assays GLP-1R IgG clones were tested for their potential effects on GLP-1R signaling by performing cAMP assays obtained from Eurofins DiscoverX. The technology involved in detecting cAMP levels is a no wash gain-of-signal competitive immunoassay based on Enzyme Fragment Complementation technology. Experiments were designed to test for either agonist or antagonist activity of the IgG clones.
  • Beta arrestin recruitment assy P-arrestin recruitment assay was obtained from Eurofins DiscoverX (Cat #93-0300E2) that utilized untagged GLP-1R overexpressing CHO-K1 cells. The experiment is to test if GLP1R-3 has an effect on GLP-1 7-36 agonist induced P-arrestin recruitment upon GLP-1R activation. Expanded cells were seeded into 96 well plates at 5,000 cells/well, and the experiment was performed 48 hours after plating cells. 100 nM IgG was preincubated for 1 hour at RT with plated cells in 50 ul volume, and then 5 ul of ligand GLP-1 7-36 was added for a further incubation for 30 min at 37 °C.
  • mice Animals. All animal procedures were approved by Institutional Animal Care and Use Committee (IACUC) at the University of California San Francisco and were conducted in accordance with the National Institutes of Health Guide for the Care and Use of laboratory Animals. C57BL/6NHsd (Envigo RMS, LLC) male littermates at 8-10 weeks of age, weighing -20-28 grams, were used in all the studies described. The mice were housed in a room that was temperature (22-25C) and light controlled (12-h: 12-h light/dark cycle starting at 7AM. The mice were fed with chow diet with 9% fat (PicoLab mouse Diet 20 (#5058), Lab Supply, Fortworth Texas, USA) for the duration of housing at the UCSF animal care facility.
  • IACUC Institutional Animal Care and Use Committee
  • GTT Glucose Tolerance Test
  • ITT Insulin Tolerance test
  • mAb administered as a double dose 15 hours prior to GTT and 21 hours prior to ITT plus a second mAb dose 2 hours prior to GTT and ITT. 3. mAb single dose 2 hours prior to GTT and ITT. 4. mAb single dose 6 hours prior to ITT only.
  • Antagonist GLP1R-3 mAb was dosed at 20 mg/kg at four different administration regimen groups. 1. mAb administered as a single dose, 15 hours prior to GTT and 21 hours prior to ITT. 2. mAb administered as a double dose, 15 hours prior to GTT and 21 hours prior to ITT plus a second mAb dose 2 hours prior to GTT and ITT. 3. mAb as a single dose 6 hours prior to GTT and ITT. 4. mAb single dose 2 hours prior to GTT and ITT.
  • Extendin 9-39 Peptide (MedChemExpress, Cat. No.: HY-P0264) were dosed at 1.0 or 0.23 mg/kg at three different administration regimen groups. 1. Extendin administered as a single dose, 21 hours prior to ITT. 2. Extendin administered as a double dose, 21 hours prior to ITT plus a second Extendin dose 2 hours prior to ITT. 3. mAb as a single dose 6 hours prior to ITT.
  • a Glucose Tolerance Test was used to assess two different anti-GLPl mAbs (Agonist and Antagonist) effect on glucose tolerance following an acute glucose administration.
  • Intraperitoneal Glucose Tolerance Test IP-GTT was conducted in 8 or 10-week old male mice to assess glucose disposal after a glucose injection and measuring blood glucose level after mice were fasted overnight (14-16 hours). To avoid circadian variations in mouse blood glucose levels this testing was performed at fixed times. Mice were weighed after the overnight fast and baseline blood glucose levels (pre-glucose injection; Time 0 minutes) were measured.
  • mice were injected, i.p., with a single bolus (lOul/gram body weight) of 30% Dextrose solution (Hospira, Illinois) and blood glucose levels were measured at 15, 30, 60, 120 and 180-minutes post glucose administration. Blood samples were obtained by a tail nick and blood glucose levels were monitored using a OneTouch Ultra 2 glucose monitor (LifeScan, Inc.) [00247] Insulin Tolerance Test
  • ITT Insulin Tolerance Test
  • the rat PK study was done at Charles River Laboratories, One Innovation Dr, 3 Biotech, Worcester, MA 01605. 5 Male Sprague-Dawley rats per group were allowed to acclimate after receiving at test facility for a minimum of 3 days before dosing. GLP1R-3 and GLP1R59-2 were dosed at 10 mg/kg by IV in lOOmM Hepes, lOOmM NaCl, 50mM NaAc, pH 6.0 vehicle. Serial blood samples were collected via jugular vein cannula with ⁇ 250ul volume at each time point: pre-dose, 0.0833, 0.25, 0.5, 1, 2, 4, 8, 24, 48, 72, 96, 168, 240 and 336 hours post dose.
  • Plasma samples were collected into K2EDTA tubes and stored on wet ice until processed to plasma by centrifugation (3500 rpm for 10 minutes at 5°C) within 30 minutes of collection. Plasma samples were then transferred into an appropriate tube containing DPP-4 (3.3pL for lOOpL of plasma) and frozen on dry ice.
  • sheep antiHuman IgG (1 mg/mL) was used as coating reagent) (The binding site, Lot No. AU003.M)
  • goat anti -Human IgG, HRP (H&L) (1 mg/mL) was used as detection reagent) (Bethyl, cat# A80- 319P) in an ELISA assay.
  • Stock solutions of human IgG standards and QCs were prepared by spiking human IgG into rat plasma. A minimum of two wells were used to analyze each study samples, QC’s, standards, and blank. A 4-parameter logistic (4PL) model was used to fit the sigmoid calibration curve. The semi-logarithmic sigmoid calibration curve was obtained by plotting the absorbance response against concentration. Concentrations of analyte in the test samples were determined by computer interpolation from the plot of the calibration curve.
  • GPCR interactions which include interactions of GPCRs with ligands, peptides, antibodies, endogenous extracellular loops and small molecules were analyzed to map the GPCR binding molecular determinants. Crystal structures of almost 150 peptides, ligand or antibodies bound to ECDs of around 50 GPCRs (http://www.gpcrdb.org) were used to identify GPCR binding motifs. Over 1000 GPCR binding motifs were extracted from this analysis. In addition, by analysis of all solved structures of GPCRs (zhanglab.ccmb.med.umich.edu/GPCR- EXP/), over 2000 binding motifs from endogenous extracellular loops of GPCRs were identified.
  • binding motifs were placed in one of five different stem regions : C ARDLRELECEEWTxxxxxSRGPC VDPRGVAGSFD VW, CARDMYYDFxxxxxEVVPADDAFDIW, CARDGRGSLPRPKGGPxxxxxYDSSEDSGGAFDIW, CARANQHFxxxxxGYHYYGMDVW, CAKHMSMQxxxxxRADLVGDAFDVW.
  • CDR variants were selected by comparing the germline CDRs with the near-germline space of single, double and triple mutations observed in the CDRs within the V-gene repertoire of at least two out of 12 human donors. All CDRs have were pre-screened to remove manufacturability liabilities, cryptic splice sites or nucleotide restriction sites.
  • the CDRs were synthesized as an oligo pool and incorporated into the selected antibody scaffolds.
  • the heavy chain (VH) and light chain (VL) genes were linked by (648)3 linker.
  • the resulting scFv (VH-linker-VL) gene pool was cloned into a phagemid display vector at the N-terminal of the Ml 3 gene-3 minor coat protein.
  • the final size of the GPCR library is 1 x 10 10 in a scFv format.
  • Next-generation sequencing (NGS) was performed on the final phage library to analyze the HCDR3 length distribution in the library for comparison with the HCDR3 length distribution in B-cell populations from three healthy adult donors.
  • the HCDR3 sequences from the three healthy donors used were derived from a publicly available database with over 37 million B-cell receptor sequences 31 .
  • the HCDR3 length in the GPCR library is much longer than the HCDR3 length observed in B-cell repertoire sequences.
  • the median HCDR3 length in the GPCR library (which shows a biphasic pattern of distribution) is two or three times longer (33 to 44 amino acids) than the median lengths observed in natural B-cell repertoire sequences (15 to 17 amino acids) (Fig. 11).
  • the biphasic length distribution of HCDR3 in the GPCR library is mainly caused by the two groups of stems (8aa, 9aaxxxxxl0aa, 12aa) and (14aa, 16aa xxxxxl8aa, 14aa) used to present the motifs within HCDR3.
  • Phage panning against GLP-1R over-expressing cell lines resulted in clonal enrichment
  • a GLP-1R over-expressing CHO stable cell line was created with a FLAG tag presented on the N-terminus of the receptor in order to detect cell surface expression and an EGFP tag on the C-terminus to track total receptor expression.
  • Flow cytometry analysis of these cells confirmed that the majority of the receptor (> 80%) was expressed at the cell surface (Fig. 12A).
  • These GLP-1R- expressing CHO cells were used for five rounds of phage panning against the GPCR-focused library. The selection scheme is outlined in Fig. 12B.
  • variable heavy chain (VH) from the output of each panning round was PCR amplified and sequenced by MiSeq. As the percent unique HCDR3 decreases in each round output pool NGS sequencing, significant clonal enrichment was observed from round 1 to round 5 (Fig. 13), indicating a target specific clonal selection in the panning process. Approx. 1000 clones in total (from round 4 and round 5) were picked for single clonal NGS sequencing and -100 unique VH-VL pairs were selected to be reformatted and expressed as full length human IgG2 at 1ml scale.
  • IgG binders directed to GLP-1R contain either GLP-1, GLP-2 or unique HCDR3 motifs identified
  • Purified IgG clones were tested for specific binding to GLP-lR-expressing CHO cells. A single-point flow cytometry analysis using lOOnM of IgG concentration revealed that out of 100 IgG unique clones tested, 13 IgG clones bound specifically to GLP-lR-positive cells (GFP+) and not parental CHO cells (GFP-).
  • IgGs of the 13 binders are negative antagonists in GLP-1R mediated cAMP signaling
  • the 13 IgG binders were next assessed for their functional activity in the cAMP signaling pathway by using GLP-1R over-expressing CHO-K1 cells purchased from DiscoverX that are designed and validated for assessing GLP-1 R-induced cAMP signaling.
  • the IgG clones were tested for agonist activity as compared with the peptide agonist GLP- 1 7-36 in dose titrations. While GLP-1 7-36 stimulation resulted in a cAMP signal, none was observed for the IgG clones, indicating that they are not activating.
  • the panel of IgG clones were tested for antagonist activity by pre-incubating GLP-lR-expressing cells with a fixed concentration of IgG to allow binding to occur and then stimulating the cells with GLP-1 7-36 in a dose dependent manner.
  • GLP1R-3 Ligand competition binding assays, the IgG effects on the GLP-1 dose response in cAMP signaling, and beta-arrestin recruitment assays were conducted, resulting in characterization of GLP1R-3 as follows:
  • GLP1R-3 binds to the orthosteric site on the receptor
  • N-terminal FLAG-tagged and C terminal GFP -tagged GLP-1R over-expressing CHO cells were incubated with a dose titration of GLP1R-3 starting at 100 nM in the presence or absence of a fixed concentration of the peptide agonist GLP-1 7-36 (IpM).
  • IpM the concentration of the peptide agonist GLP-1 7-36
  • GLP-1 7-36 peptide Whilst the presence of GLP-1 7-36 peptide does not completely ablate GLP1R-3 binding, this observation suggests that the antibody may bind to an overlapping epitope, or GLP1R-3 have stronger binding affinity for GLP-1 7-36 to compete for binding. (Fig. 16A).
  • GLP1R-3 antagonizes GLP-1 activated cAMP signaling.
  • the next step was to determine if GLP1R-3 exhibits competitive antagonism for GLP-1R in a dose-dependent manner.
  • GLP-1 7-36-induced cAMP signaling was examined in the presence of a constant concentration (100 nM) of GLP1R-3 with a dose titration of GLP-1 7-36 starting at 20 nM with a 3-fold down titration, and a clear dose-dependent inhibition of the cAMP signal was observed.
  • the EC50 for GLP-1 7-36 peptide is 0.025 nM without presence of GLP1R-3, and 0.11 nM in the presence of 100 nM GLP1R-3 (Fig. 16B), supporting that GLP1R-3 is a competitive antagonist.
  • GLP1R-3 reduces f-arrestin recruitment upon GLP-1R activation.
  • P-arrestins are recruited to the GPCR from the cytosol, thereby excluding the receptor from further G protein interactions and leading to signal arrest, hence the name “arrestin”.
  • GLP-1R over-expressing CHO-K1 cells DiscoverX that are specifically designed and validated for assessing GLP-1R P-arrestin recruitment were employed in the following manner.
  • GLP1R-3 is a competitive antagonist to GLP-1 7-36 for GLP-1 R.
  • GLP1R-59-2 a GLP-1R agonist antibody (GLP1R-59-2) by linking the native GLP-1 7-36 peptide to the light chain N-terminal of a functionally inactive but GLP-lR-specific binder GLP1R-2 (Fig. 17) was engineered. GLP-1R binding assays, cAMP assays, and P-arrestin recruitment assays were conducted, resulting in characterization of GLP1R-59-2 as described here:
  • GLP 1R-59-2 specifically binds to GLP-lR-expressing CHO cells.
  • Flow cytometry analysis revealed that GLP1R-59-2 bound specifically to GLP-lR-positive cells (GFP+) and not parental CHO cells (GFP-), specific binding was also confirmed by GLP1R-59-2 dose titrations producing an apparent binding ECso of 15.5 nM (Fig. 18A).
  • GLP 1R-59-2 induces a GLP-1R cAMP response similar to GLP-1 7-36.
  • GLP1R-59-2 was tested for agonist activity as compared with GLP-1 7-36 for stimulating GLP-1R overexpressing CHO-K1 cells (DiscoverX) with separate dose titration analyses conducted for both ligand and antibody. It was found that both induced similar cAMP signaling profile and their dose response curves had almost overlapping ECso values, 0.042nM for GLP1R-59-2 and 0.085nM for GLP-1 7-36. (Fig. 18B) supporting the hypothesis that GLP1R-59-2 can act as an effective agonist for GLP-1R.
  • GLP 1R-59-2 is less efficacious for -arrestin recruitment to GLP-1R than GLP-1 7-36.
  • GLP1R-59-2 was able to induce a similar level of p-arrestin recruitment to GLP-1R as GLP-1 7-36
  • GLP-1R over-expressing CHO-K1 cells were stimulated with dose titrations of each. It was found that less P-arrestin recruitment occurred with GLP1R-59-2 stimulation than with GLP-1 7-36 stimulation (Fig. 18C). Whilst GLP1R-59-2 is less efficacious than GLP-1 7-36 for the maximal P-arrestin recruitment, it would appear that the agonist IgG is slightly more potent with an ECso of 0.042nM, and 0.085nM for GLP-1 7-36, respectively.
  • Endogenous GLP-1 peptide has a very short serum half-life of only a few minutes, however GLP-1R antibodies can have significantly longer half-lives. This can be a considerable advantage over the current GLP-1 peptide analog therapeutics.
  • An in vivo PK rat study was performed to evaluate the half-life of the antagonist GLP1R-3 and agonist GLP1R-59-2 in IgG format.
  • GLP1R-3 exhibited an antibody-like in vivo half-life of ⁇ 1 -week in rats, while the agonist GLP-1 peptide-antibody fusion, GLP1R-59-2 exhibited > 2-day half-life in rats (Figs. 19A-19B).
  • Liraglutide the approved GLP-1R agonist for the treatment of Type II diabetes has a 13 -hour half-life.
  • Agonist GLP1R-59-2 was tested for it’s in vivo pharmacodynamic (PD) effects in Glucose tolerance test (GTT) using wild-type C57BL/6NHsd mouse model, in comparison with the vehicle control.
  • Agonist mAb GLP1R-59-2 treatment either dose (5 mg/kg and 10 mg/kg) or dosing regimen (2 hrs, 13+2 hrs, and 15 hrs before glucose challenge), significantly stabilized blood glucose even after a glucose challenge (Fig. 20A).
  • Fig. 20A Compared to control mice GLP1R-59-2 treatments are all significant (p ⁇ 0.001) at reducing Area Under the Curve (AUC) in an GTT (Fig. 20B) However, there is no significant difference between each individual treatment timing or dose.
  • Antagonist, GLP1R-3 mAb and GLP-1 peptide Exendin 9-39 treatment significantly stabilizes a higher blood glucose in wild-type C57BL/6NHsd mice (Fig. 21 A).
  • GLP1R-3 mAb (20mg/kg) and Exendin (1 mg/kg) treatments are both significant (p ⁇ 0.0001) at stabilizing Area Under the Curve (AUC) in an ITT (Fig. 21B).
  • AUC Area Under the Curve
  • Another experiment using a single 6 hour dosing regimen, antagonist, GLP1R-3 mAb treatment also significantly stabilizes a higher blood glucose after an insulin challenge compared to GLP-1 peptide Exendin 9-39 (1.0 or 0.23 mg/kg dose) or control (Fig. 22A).
  • GLP1R-3 mAb (20 mg/kg) treatment at 6 hours significantly (p ⁇ 0.05) stabilizes Area Under the Curve (AUC) in an ITT.
  • AUC Area Under the Curve
  • GLP1R-3 mAb treatment was also compared to a comparator antibody GLP1R-226-1 and GLP1R-226-2.
  • GLP1R-3 mAb treatment in a single 6 hour dosing regimen significantly stabilized a higher blood glucose after an insulin challenge (at time 0) compared to GLP1R-226-1 (20 mg/kg) or control (Figs. 23A-23B).
  • GLP1R-3 mAb (20mg/kg) treatment at 6 hours significantly (p ⁇ 0.05) stabilized Area Under the Curve (AUC) in an ITT. There was no significant difference (p ⁇ 0.05) between control vs. GLP1R-226-1 or GLP1R-226-2 with a single 6 hour treatment.
  • GLP1R-3 was optimized to generate additional GLP1R variants.
  • the GLP1R-221 and GLP1R-222 variants were assayed in competition assays. Data is seen in Figs. 25A-25B The variants were also assayed in a cAMP assay. Briefly, cells were preincubated with anti-GLPIR antibody at 100 nM followed by agonist stimulation 3X titration from 12.5 nM. Data is seen in Fig. 26 with improved variants highlighted in green.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Diabetes (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Endocrinology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Emergency Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hematology (AREA)
  • Public Health (AREA)
  • Obesity (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Virology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2021/047616 2020-08-26 2021-08-25 Methods and compositions relating to glp1r variants Ceased WO2022046944A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP21862681.0A EP4204460A4 (en) 2020-08-26 2021-08-25 METHODS AND COMPOSITIONS RELATING TO GLP1R VARIANTS
CA3190667A CA3190667A1 (en) 2020-08-26 2021-08-25 Methods and compositions relating to glp1r variants
JP2023513296A JP7836295B2 (ja) 2020-08-26 2021-08-25 Glp1r変異体に関する方法および組成物
CN202180073480.2A CN116829946A (zh) 2020-08-26 2021-08-25 涉及glp1r变体的方法和组合物
AU2021331088A AU2021331088A1 (en) 2020-08-26 2021-08-25 Methods and compositions relating to glp1r variants
KR1020237010070A KR20230074151A (ko) 2020-08-26 2021-08-25 Glp1r 변이체에 관한 방법 및 조성물

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202063070734P 2020-08-26 2020-08-26
US63/070,734 2020-08-26
US202063081801P 2020-09-22 2020-09-22
US63/081,801 2020-09-22

Publications (2)

Publication Number Publication Date
WO2022046944A2 true WO2022046944A2 (en) 2022-03-03
WO2022046944A3 WO2022046944A3 (en) 2022-04-07

Family

ID=80353886

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/047616 Ceased WO2022046944A2 (en) 2020-08-26 2021-08-25 Methods and compositions relating to glp1r variants

Country Status (7)

Country Link
US (2) US12391762B2 (https=)
EP (1) EP4204460A4 (https=)
JP (1) JP7836295B2 (https=)
KR (1) KR20230074151A (https=)
AU (1) AU2021331088A1 (https=)
CA (1) CA3190667A1 (https=)
WO (1) WO2022046944A2 (https=)

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11452980B2 (en) 2013-08-05 2022-09-27 Twist Bioscience Corporation De novo synthesized gene libraries
US11492727B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for GLP1 receptor
US11492728B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for antibody optimization
US11492665B2 (en) 2018-05-18 2022-11-08 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US11512347B2 (en) 2015-09-22 2022-11-29 Twist Bioscience Corporation Flexible substrates for nucleic acid synthesis
US11550939B2 (en) 2017-02-22 2023-01-10 Twist Bioscience Corporation Nucleic acid based data storage using enzymatic bioencryption
US11562103B2 (en) 2016-09-21 2023-01-24 Twist Bioscience Corporation Nucleic acid based data storage
US11691118B2 (en) 2015-04-21 2023-07-04 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US11697668B2 (en) 2015-02-04 2023-07-11 Twist Bioscience Corporation Methods and devices for de novo oligonucleic acid assembly
US11745159B2 (en) 2017-10-20 2023-09-05 Twist Bioscience Corporation Heated nanowells for polynucleotide synthesis
US11807956B2 (en) 2015-09-18 2023-11-07 Twist Bioscience Corporation Oligonucleic acid variant libraries and synthesis thereof
WO2024027715A1 (en) * 2022-08-01 2024-02-08 Sciwind Biosciences Usa Co., Ltd Anti-glp-1r antibodies and uses thereof
US12091777B2 (en) 2019-09-23 2024-09-17 Twist Bioscience Corporation Variant nucleic acid libraries for CRTH2
US12134656B2 (en) 2021-11-18 2024-11-05 Twist Bioscience Corporation Dickkopf-1 variant antibodies and methods of use
US12173282B2 (en) 2019-09-23 2024-12-24 Twist Bioscience, Inc. Antibodies that bind CD3 epsilon
US12202905B2 (en) 2021-01-21 2025-01-21 Twist Bioscience Corporation Methods and compositions relating to adenosine receptors
US12258406B2 (en) 2021-03-24 2025-03-25 Twist Bioscience Corporation Antibodies that bind CD3 Epsilon
US12270028B2 (en) 2017-06-12 2025-04-08 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US12357959B2 (en) 2018-12-26 2025-07-15 Twist Bioscience Corporation Highly accurate de novo polynucleotide synthesis
US12391762B2 (en) 2020-08-26 2025-08-19 Twist Bioscience Corporation Methods and compositions relating to GLP1R variants
US12570750B2 (en) 2019-12-09 2026-03-10 Twist Bioscience Corporation Antibodies that bind adenosine A2A receptors and methods of use thereof to treat cancer and neurological diseases

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX2022013499A (es) 2020-04-27 2023-01-16 Twist Bioscience Corp Bibliotecas de ácidos nucleicos variantes para coronavirus.
CN117043171A (zh) 2020-08-28 2023-11-10 特韦斯特生物科学公司 用于合成的装置和方法
EP4229210A4 (en) 2020-10-19 2025-01-08 Twist Bioscience Corporation METHOD FOR THE SYNTHESIS OF OLIGONUCLEOTIDES USING BOUND NUCLEOTIDES
WO2022235584A1 (en) 2021-05-03 2022-11-10 Twist Bioscience Corporation Variant nucleic acid libraries for glycans
US12201857B2 (en) 2021-06-22 2025-01-21 Twist Bioscience Corporation Methods and compositions relating to covid antibody epitopes
WO2023023285A2 (en) 2021-08-19 2023-02-23 Twist Bioscience Corporation Methods and compositions relating to covalently closed nucleic acids
EP4460516A2 (en) 2022-01-03 2024-11-13 Twist Bioscience Corporation Bispecific sars-cov-2 antibodies and methods of use

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5474796A (en) 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
WO2015021080A2 (en) 2013-08-05 2015-02-12 Twist Bioscience Corporation De novo synthesized gene libraries

Family Cites Families (160)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6492107B1 (en) 1986-11-20 2002-12-10 Stuart Kauffman Process for obtaining DNA, RNA, peptides, polypeptides, or protein, by recombinant DNA technique
CA2124087C (en) 1991-11-22 2002-10-01 James L. Winkler Combinatorial strategies for polymer synthesis
US5573905A (en) 1992-03-30 1996-11-12 The Scripps Research Institute Encoded combinatorial chemical libraries
US5368823A (en) 1993-02-11 1994-11-29 University Of Georgia Research Foundation, Inc. Automated synthesis of oligonucleotides
US7135312B2 (en) 1993-04-15 2006-11-14 University Of Rochester Circular DNA vectors for synthesis of RNA and DNA
US5455239A (en) 1993-08-05 1995-10-03 Merck & Co. Inc. 3-aryl of heteroaryl-7-heteroaralkylamido cephalosporin compounds, compositions and methods of use
ATE214633T1 (de) 1993-10-28 2002-04-15 Houston Advanced Res Ct Mikrofabriziertes poröses durchflussgerät
US6893816B1 (en) 1993-10-28 2005-05-17 Houston Advanced Research Center Microfabricated, flowthrough porous apparatus for discrete detection of binding reactions
US6352842B1 (en) 1995-12-07 2002-03-05 Diversa Corporation Exonucease-mediated gene assembly in directed evolution
US6013440A (en) 1996-03-11 2000-01-11 Affymetrix, Inc. Nucleic acid affinity columns
CA2276462C (en) 1996-12-31 2007-06-12 High Throughput Genomics, Inc. Multiplexed molecular analysis system apparatus and method
WO1998041531A2 (en) 1997-03-20 1998-09-24 University Of Washington Solvent for biopolymer synthesis, solvent microdroplets and methods of use
US6028189A (en) 1997-03-20 2000-02-22 University Of Washington Solvent for oligonucleotide synthesis and methods of use
US6419883B1 (en) 1998-01-16 2002-07-16 University Of Washington Chemical synthesis using solvent microdroplets
EP0991930B1 (en) 1997-06-26 2004-06-16 Perseptive Biosystems, Inc. High density sample holder for analysis of biological samples
DK1144616T4 (da) 1999-01-19 2009-03-30 Unilever Nv Fremgangsmåde til fremstilling af antistoffragmenter
ATE296310T1 (de) 1999-03-08 2005-06-15 Metrigen Inc Syntheseverfahren zum ökonomischen aufbau langer dna-sequenzen und zusammensetzungen hierfür
US6472147B1 (en) 1999-05-25 2002-10-29 The Scripps Research Institute Methods for display of heterodimeric proteins on filamentous phage using pVII and pIX, compositions, vectors and combinatorial libraries
US20020025561A1 (en) 2000-04-17 2002-02-28 Hodgson Clague Pitman Vectors for gene-self-assembly
US7163660B2 (en) 2000-05-31 2007-01-16 Infineon Technologies Ag Arrangement for taking up liquid analytes
JP4361271B2 (ja) 2000-10-10 2009-11-11 バイオトローブ・インコーポレイテツド アッセイ、合成、および保存用の器具、ならびに、その作製、使用、および操作の方法
US6693187B1 (en) 2000-10-17 2004-02-17 Lievre Cornu Llc Phosphinoamidite carboxlates and analogs thereof in the synthesis of oligonucleotides having reduced internucleotide charge
US6905816B2 (en) 2000-11-27 2005-06-14 Intelligent Medical Devices, Inc. Clinically intelligent diagnostic devices and methods
US20020164824A1 (en) 2001-02-16 2002-11-07 Jianming Xiao Method and apparatus based on bundled capillaries for high throughput screening
US7211654B2 (en) 2001-03-14 2007-05-01 Regents Of The University Of Michigan Linkers and co-coupling agents for optimization of oligonucleotide synthesis and purification on solid supports
US20040161741A1 (en) 2001-06-30 2004-08-19 Elazar Rabani Novel compositions and processes for analyte detection, quantification and amplification
AU2003207448A1 (en) 2002-01-04 2003-07-24 Board Of Regents, The University Of Texas System Proofreading, error deletion, and ligation method for synthesis of high-fidelity polynucleotide sequences
AU2003216341A1 (en) * 2002-02-20 2003-09-09 Dyax Corporation Mhc-peptide complex binding ligands
US20070275411A1 (en) 2006-05-25 2007-11-29 Mcgall Glenn H Silane mixtures
US7563600B2 (en) 2002-09-12 2009-07-21 Combimatrix Corporation Microarray synthesis and assembly of gene-length polynucleotides
JP2006503586A (ja) 2002-10-28 2006-02-02 ゼオトロン コーポレイション アレイオリゴマー合成および使用
US7422911B2 (en) 2002-10-31 2008-09-09 Agilent Technologies, Inc. Composite flexible array substrate having flexible support
US7285269B2 (en) 2002-12-02 2007-10-23 Amgen Fremont, Inc. Antibodies directed to tumor necrosis factor
US7879580B2 (en) 2002-12-10 2011-02-01 Massachusetts Institute Of Technology Methods for high fidelity production of long nucleic acid molecules
US7932025B2 (en) 2002-12-10 2011-04-26 Massachusetts Institute Of Technology Methods for high fidelity production of long nucleic acid molecules with error control
AU2003303396A1 (en) 2002-12-23 2004-07-22 Agilent Technologies, Inc. Comparative genomic hybridization assays using immobilized oligonucleotide features and compositions for practicing the same
US7202264B2 (en) 2003-01-31 2007-04-10 Isis Pharmaceuticals, Inc. Supports for oligomer synthesis
JP2004268394A (ja) 2003-03-07 2004-09-30 Canon Inc インクジェット記録装置及びその制御方法
WO2005018536A2 (en) * 2003-05-23 2005-03-03 Human Genome Sciences, Inc. Agonist antibodies that specifically bind the glucagon like peptide-1 receptor
CA2531197A1 (en) 2003-05-30 2005-01-06 The Board Of Trustees Of The University Of Illinois Gene expression profiles that identify genetically elite ungulate mammals
US8133670B2 (en) 2003-06-13 2012-03-13 Cold Spring Harbor Laboratory Method for making populations of defined nucleic acid molecules
AU2005222788A1 (en) 2004-02-27 2005-09-29 President And Fellows Of Harvard College Polynucleotide synthesis
US8825411B2 (en) 2004-05-04 2014-09-02 Dna Twopointo, Inc. Design, synthesis and assembly of synthetic nucleic acids
EP1841788A4 (en) 2004-12-22 2009-01-21 Univ Singapore NEW TOXIN FROM A SERPENT
US20070196834A1 (en) 2005-09-09 2007-08-23 Francesco Cerrina Method and system for the generation of large double stranded DNA fragments
JP5055282B2 (ja) 2005-09-14 2012-10-24 イルミナ インコーポレイテッド 連続的なポリマー合成器
EP1939621B1 (en) 2005-09-16 2014-11-19 Azbil Corporation Method for manufacturing substrate for biochip, and method for manufacturing biochip
CA2648149A1 (en) 2006-03-31 2007-11-01 Solexa, Inc. Systems and devices for sequence by synthesis analysis
CN101495654A (zh) 2006-04-19 2009-07-29 阿普里拉股份有限公司 无凝胶珠基测序的试剂、方法和文库
WO2008054543A2 (en) 2006-05-20 2008-05-08 Codon Devices, Inc. Oligonucleotides for multiplex nucleic acid assembly
AT503902B1 (de) 2006-07-05 2008-06-15 F Star Biotech Forsch & Entw Verfahren zur manipulation von immunglobulinen
DE102006039479A1 (de) 2006-08-23 2008-03-06 Febit Biotech Gmbh Programmierbare Oligonukleotidsynthese
CL2007002668A1 (es) * 2006-09-20 2008-05-09 Amgen Inc Proteina de union a antigeno que se une al receptor de glucagon humano; acido nucleico que la codifica; metodo de produccion; composicion farmaceutica que la comprende; y su uso para tratar o prevenir la diabetes tipo 2.
EP2078077A2 (en) 2006-10-04 2009-07-15 Codon Devices, Inc Nucleic acid libraries and their design and assembly
US20080085511A1 (en) 2006-10-05 2008-04-10 Peck Bill J Preparation of biopolymer arrays
US20080085514A1 (en) 2006-10-10 2008-04-10 Peck Bill J Methods and devices for array synthesis
WO2008063135A1 (en) 2006-11-24 2008-05-29 Agency For Science, Technology And Research Apparatus for processing a sample in a liquid droplet and method of using the same
KR100827449B1 (ko) 2007-02-07 2008-05-07 삼성전자주식회사 광분해성 화합물과 상기 화합물이 커플링된 올리고머프로브 어레이용 기판, 올리고머 프로브 어레이 및 이의제조 방법
JP4582224B2 (ja) 2008-05-02 2010-11-17 ソニー株式会社 マイクロビーズ作製方法及びマイクロビーズ
JP4667490B2 (ja) 2008-07-09 2011-04-13 三菱電機株式会社 加熱調理器
WO2010025310A2 (en) 2008-08-27 2010-03-04 Westend Asset Clearinghouse Company, Llc Methods and devices for high fidelity polynucleotide synthesis
NZ591543A (en) 2008-09-30 2012-11-30 Abbott Lab Improved antibody libraries
US20100301398A1 (en) 2009-05-29 2010-12-02 Ion Torrent Systems Incorporated Methods and apparatus for measuring analytes
JP2012507513A (ja) 2008-11-06 2012-03-29 エージェンシー フォー サイエンス,テクノロジー アンド リサーチ バイオポリマー合成用器具
EP2364326B1 (en) 2008-12-05 2018-07-04 Glaxo Group Limited Methods for selecting protease resistant polypeptides
EP2398915B1 (en) 2009-02-20 2016-08-24 Synthetic Genomics, Inc. Synthesis of sequence-verified nucleic acids
US8709717B2 (en) 2009-04-03 2014-04-29 Illumina, Inc. Generation of uniform fragments of nucleic acids using patterned substrates
ES2617281T3 (es) * 2009-10-28 2017-06-16 Janssen Biotech, Inc. Anticuerpos anti-glp-1r y sus usos
US8716467B2 (en) 2010-03-03 2014-05-06 Gen9, Inc. Methods and devices for nucleic acid synthesis
WO2011109031A1 (en) 2010-03-05 2011-09-09 Synthetic Genomics, Inc. Methods for cloning and manipulating genomes
EP2630264A4 (en) 2010-10-22 2014-04-02 Harvard College Orthogonal amplification and assembly of nucleic acid sequences
CN103502448B (zh) 2010-11-12 2017-03-29 Gen9股份有限公司 核酸合成的方法和设备
US9487807B2 (en) 2010-12-27 2016-11-08 Ibis Biosciences, Inc. Compositions and methods for producing single-stranded circular DNA
CN103597068A (zh) 2011-03-30 2014-02-19 独立行政法人国立长寿医疗研究中心 膜分选培养器、膜分选培养试剂盒、和使用其的干细胞分选方法、以及分离膜
WO2013030827A1 (en) 2011-09-01 2013-03-07 Genome Compiler Corporation System for polynucleotide construct design, visualization and transactions to manufacture the same
US8840981B2 (en) 2011-09-09 2014-09-23 Eastman Kodak Company Microfluidic device with multilayer coating
NO2723764T3 (https=) 2011-09-15 2018-05-26
CN107058059B (zh) 2011-09-26 2020-08-07 基因技术股份公司 高效的小体积核酸合成
US8987174B2 (en) 2011-10-28 2015-03-24 Prognosys Biosciences, Inc. Methods for manufacturing molecular arrays
WO2013096692A1 (en) 2011-12-21 2013-06-27 Illumina, Inc. Apparatus and methods for kinetic analysis and determination of nucleic acid sequences
WO2013093693A1 (en) 2011-12-22 2013-06-27 Rinat Neuroscience Corp. Staphylococcus aureus specific antibodies and uses thereof
EP2825653A4 (en) * 2012-03-14 2016-01-20 Innovative Targeting Solutions Inc PRODUCTION OF TARGETED SEQUENCE DIVERSITY IN FUSION PROTEINS
WO2014021938A1 (en) 2012-08-02 2014-02-06 The Board Of Trustees Of The Leland Stanford Junior University Methods and apparatus for nucleic acid synthesis using oligo-templated polymerization
KR20140048733A (ko) 2012-10-16 2014-04-24 삼성전자주식회사 다중 웰 플레이트 및 상기 다중 웰 플레이트를 이용한 표적 물질 분석 방법
EP3066120B1 (en) 2013-11-04 2018-10-10 INSERM (Institut National de la Santé et de la Recherche Médicale) Synthetic single domain antibody
US20160297883A1 (en) 2013-12-04 2016-10-13 Innovative Targeting Solutions, Inc. G-protein coupled receptor agonists and methods
WO2016022557A1 (en) 2014-08-05 2016-02-11 Twist Bioscience Corporation Cell free cloning of nucleic acids
US10450562B2 (en) 2014-09-09 2019-10-22 Igenomx International Genomics Corporation Methods and compositions for rapid nucleic acid library preparation
CA2975855C (en) 2015-02-04 2025-09-23 Twist Bioscience Corporation SYNTHETIC GENE COMPOSITIONS AND ASSEMBLY METHODS
US10669304B2 (en) 2015-02-04 2020-06-02 Twist Bioscience Corporation Methods and devices for de novo oligonucleic acid assembly
US10745456B2 (en) 2015-04-01 2020-08-18 The Scripps Research Institute Methods and compositions related to GPCR agonist polypeptides
EP3283512A4 (en) 2015-04-17 2018-10-03 Distributed Bio Inc Method for mass humanization of non-human antibodies
US9981239B2 (en) 2015-04-21 2018-05-29 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US11685773B2 (en) 2015-04-30 2023-06-27 Abcheck S.R.O. Method for mass humanization of rabbit antibodies
US20160333340A1 (en) 2015-05-11 2016-11-17 Twist Bioscience Corporation Compositions and methods for nucleic acid amplification
TW201713690A (zh) * 2015-08-07 2017-04-16 再生元醫藥公司 抗angptl8抗體及其用途
EP3350314A4 (en) 2015-09-18 2019-02-06 Twist Bioscience Corporation OLIGONUCLEIC ACID VARIANT LIBRARIES VARIANT AND SYNTHESIS THEREOF
KR102794025B1 (ko) 2015-09-22 2025-04-09 트위스트 바이오사이언스 코포레이션 핵산 합성을 위한 가요성 기판
US20190062441A1 (en) * 2015-10-07 2019-02-28 Remd Biotherapeutics, Inc. Methods For Treating Rare Genetic Disorders Using Glucagon Receptor Antagonistic Antibodies
CN115920796A (zh) 2015-12-01 2023-04-07 特韦斯特生物科学公司 功能化表面及其制备
CA3027127A1 (en) 2016-06-10 2017-12-14 Twist Bioscience Corporation Systems and methods for automated annotation and screening of biological sequences
CN110088281A (zh) 2016-08-03 2019-08-02 特韦斯特生物科学公司 用于多核苷酸合成的纹理化表面
EP3500672A4 (en) 2016-08-22 2020-05-20 Twist Bioscience Corporation DE NOVO SYNTHETIZED NUCLEIC ACID LIBRARIES
ES2981703T3 (es) 2016-09-02 2024-10-10 Lentigen Tech Inc Composiciones y métodos para tratar cáncer con DuoCars
US10417457B2 (en) 2016-09-21 2019-09-17 Twist Bioscience Corporation Nucleic acid based data storage
IL266681B2 (en) 2016-11-18 2025-01-01 Twist Bioscience Corp Polynucleotide libraries with controlled stoichiometry and their synthesis
GB2573069A (en) 2016-12-16 2019-10-23 Twist Bioscience Corp Variant libraries of the immunological synapse and synthesis thereof
EP4556433A3 (en) 2017-02-22 2025-08-06 Twist Bioscience Corporation Nucleic acid based data storage
AU2018234624B2 (en) 2017-03-15 2023-11-16 Twist Bioscience Corporation De novo synthesized combinatorial nucleic acid libraries
WO2018170169A1 (en) 2017-03-15 2018-09-20 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
WO2018231864A1 (en) 2017-06-12 2018-12-20 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
WO2018231872A1 (en) 2017-06-12 2018-12-20 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US11407837B2 (en) * 2017-09-11 2022-08-09 Twist Bioscience Corporation GPCR binding proteins and synthesis thereof
CN111565834B (zh) 2017-10-20 2022-08-26 特韦斯特生物科学公司 用于多核苷酸合成的加热的纳米孔
EP3701023A4 (en) 2017-10-27 2021-07-28 Twist Bioscience Corporation POLYNUCLEOTIDE CLASSIFICATION SYSTEMS AND METHODS
KR102804057B1 (ko) 2018-01-04 2025-05-07 트위스트 바이오사이언스 코포레이션 Dna 기반 디지털 정보 저장
CA3100739A1 (en) 2018-05-18 2019-11-21 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US10969965B2 (en) 2018-12-24 2021-04-06 Western Digital Technologies, Inc. Dynamic performance density tuning for data storage device
WO2020139871A1 (en) 2018-12-26 2020-07-02 Twist Bioscience Corporation Highly accurate de novo polynucleotide synthesis
CA3131514A1 (en) 2019-02-25 2020-09-03 Twist Bioscience Corporation Compositions and methods for next generation sequencing
CN113766930B (zh) 2019-02-26 2025-07-22 特韦斯特生物科学公司 Glp1受体的变异核酸文库
JP2022522668A (ja) 2019-02-26 2022-04-20 ツイスト バイオサイエンス コーポレーション 抗体を最適化するための変異体核酸ライブラリ
US20220243195A1 (en) 2019-06-21 2022-08-04 Twist Bioscience Corporation Barcode-based nucleic acid sequence assembly
US11332738B2 (en) 2019-06-21 2022-05-17 Twist Bioscience Corporation Barcode-based nucleic acid sequence assembly
CA3148245A1 (en) 2019-07-22 2021-01-28 Igenomx International Genomics Corporation Methods and compositions for high throughput sample preparation using double unique dual indexing
JP2022548783A (ja) 2019-09-23 2022-11-21 ツイスト バイオサイエンス コーポレーション 単一ドメイン抗体のバリアント核酸ライブラリー
EP4034566A4 (en) 2019-09-23 2024-01-24 Twist Bioscience Corporation VARIANT NUCLEIC ACID BANKS FOR CRTH2
BR112022011235A2 (pt) 2019-12-09 2022-12-13 Twist Bioscience Corp Bibliotecas de variantes de ácido nucleico para receptores de adenosina
MX2022013499A (es) 2020-04-27 2023-01-16 Twist Bioscience Corp Bibliotecas de ácidos nucleicos variantes para coronavirus.
JP7702428B2 (ja) 2020-05-12 2025-07-03 リジェネロン・ファーマシューティカルズ・インコーポレイテッド 抗glp1rアンタゴニスト抗体およびその使用方法
CA3184821A1 (en) 2020-07-07 2022-01-13 Jeremy Lackey Devices and methods for light-directed polymer synthesis
WO2022046797A1 (en) 2020-08-25 2022-03-03 Twist Bioscience Corporation Compositions and methods for library sequencing
EP4204460A4 (en) 2020-08-26 2024-09-25 Twist Bioscience Corporation METHODS AND COMPOSITIONS RELATING TO GLP1R VARIANTS
CN117043171A (zh) 2020-08-28 2023-11-10 特韦斯特生物科学公司 用于合成的装置和方法
CA3194398A1 (en) 2020-10-05 2022-04-14 Twist Bioscience Corporation Hybridization methods and reagents
EP4229210A4 (en) 2020-10-19 2025-01-08 Twist Bioscience Corporation METHOD FOR THE SYNTHESIS OF OLIGONUCLEOTIDES USING BOUND NUCLEOTIDES
US20220206001A1 (en) 2020-10-22 2022-06-30 Twist Bioscience Corporation Methods and systems for detecting coronavirus
US20220135965A1 (en) 2020-10-26 2022-05-05 Twist Bioscience Corporation Libraries for next generation sequencing
US20220135690A1 (en) 2020-11-03 2022-05-05 Twist Bioscience Corporation Methods and compositions relating to chemokine receptor variants
KR20230147617A (ko) 2021-01-21 2023-10-23 트위스트 바이오사이언스 코포레이션 아데노신 수용체에 관한 방법 및 조성물
US20220277808A1 (en) 2021-02-19 2022-09-01 Twist Bioscience Corporation Libraries for identification of genomic variants
US20220323924A1 (en) 2021-03-24 2022-10-13 Twist Bioscience Corporation Electrochemical polynucleotide synthesis
EP4314075A4 (en) 2021-03-24 2025-04-09 Twist Bioscience Corporation VARIANT NUCLEIC ACID BANKS FOR CD3
WO2022204309A1 (en) 2021-03-24 2022-09-29 Twist Bioscience Corporation Variant nucleic acid libraries for tigit
US20220356463A1 (en) 2021-04-09 2022-11-10 Twist Bioscience Corporation Libraries for mutational analysis
WO2022235584A1 (en) 2021-05-03 2022-11-10 Twist Bioscience Corporation Variant nucleic acid libraries for glycans
WO2022235579A1 (en) 2021-05-03 2022-11-10 Twist Bioscience Corporation Variant nucleic acid libraries for ion channels
US12201857B2 (en) 2021-06-22 2025-01-21 Twist Bioscience Corporation Methods and compositions relating to covid antibody epitopes
WO2023023183A2 (en) 2021-08-17 2023-02-23 Twist Bioscience Corporation Sars-cov-2 antibodies and related compositions and methods of use
US20230192819A1 (en) 2021-08-17 2023-06-22 Twist Bioscience Corporation Single domain antibodies for sars-cov-2
WO2023023285A2 (en) 2021-08-19 2023-02-23 Twist Bioscience Corporation Methods and compositions relating to covalently closed nucleic acids
JP2024547018A (ja) 2021-10-18 2024-12-26 ツイスト バイオサイエンス コーポレーション 連続配列決定に関する方法および組成物
WO2023076419A2 (en) 2021-10-27 2023-05-04 Twist Bioscience Corporation Sars-cov-2 antibodies and methods of use
EP4466284A2 (en) 2021-10-27 2024-11-27 Twist Bioscience Corporation Multispecific sars-cov-2 antibodies and methods of use
US20230158469A1 (en) 2021-11-01 2023-05-25 Twist Bioscience Corporation Devices and methods for synthesis
WO2023091609A2 (en) 2021-11-18 2023-05-25 Twist Bioscience Corporation Cytokine variant antibodies and methods of use
US12134656B2 (en) 2021-11-18 2024-11-05 Twist Bioscience Corporation Dickkopf-1 variant antibodies and methods of use
EP4441099A2 (en) 2021-12-01 2024-10-09 Twist Bioscience Corporation Neuropilin-1 variant antibodies and methods of use
EP4444905A2 (en) 2021-12-08 2024-10-16 Twist Bioscience Corporation Nanoelectric devices and use thereof
US20230323449A1 (en) 2021-12-17 2023-10-12 Twist Bioscience Corporation Compositions and methods for detection of variants

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5474796A (en) 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
WO2015021080A2 (en) 2013-08-05 2015-02-12 Twist Bioscience Corporation De novo synthesized gene libraries

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
"Antibody-antigen interactions: Contact analysis and binding site topography", J. MOL. BIOL., vol. 262, pages 732 - 745
AL-LAZIKANI ET AL., JMB, vol. 273, 1997, pages 927 - 948
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402
HONEGGER APLUCKTHUN A: "Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool", J MOL BIOL, vol. 309, no. 3, 8 June 2001 (2001-06-08), pages 657 - 70, XP004626893, DOI: 10.1006/jmbi.2001.4662
KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, NATIONAL INSTITUTES OF HEALTH
KARLINALTSCHUL, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5877
LEFRANC MP ET AL.: "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains", DEV COMP IMMUNOL, vol. 27, no. 1, January 2003 (2003-01-01), pages 55 - 77, XP055585227, DOI: 10.1016/S0145-305X(02)00039-3
MACCALLUM ET AL., J. MOL. BIOL., vol. 262, 1996, pages 732 - 745
WHITELEGG NRREES AR: "WAM: an improved algorithm for modelling antibodies on the WEB", PROTEIN ENG, vol. 13, no. 12, December 2000 (2000-12-01), pages 819 - 24
WOOTTONFEDERHEN, COMPUTERS AND CHEMISTRY, vol. 17, 1993, pages 149 - 163

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11559778B2 (en) 2013-08-05 2023-01-24 Twist Bioscience Corporation De novo synthesized gene libraries
US12569822B2 (en) 2013-08-05 2026-03-10 Twist Bioscience Corporation De novo synthesized gene libraries
US11452980B2 (en) 2013-08-05 2022-09-27 Twist Bioscience Corporation De novo synthesized gene libraries
US11697668B2 (en) 2015-02-04 2023-07-11 Twist Bioscience Corporation Methods and devices for de novo oligonucleic acid assembly
US11691118B2 (en) 2015-04-21 2023-07-04 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US11807956B2 (en) 2015-09-18 2023-11-07 Twist Bioscience Corporation Oligonucleic acid variant libraries and synthesis thereof
US11512347B2 (en) 2015-09-22 2022-11-29 Twist Bioscience Corporation Flexible substrates for nucleic acid synthesis
US12056264B2 (en) 2016-09-21 2024-08-06 Twist Bioscience Corporation Nucleic acid based data storage
US11562103B2 (en) 2016-09-21 2023-01-24 Twist Bioscience Corporation Nucleic acid based data storage
US11550939B2 (en) 2017-02-22 2023-01-10 Twist Bioscience Corporation Nucleic acid based data storage using enzymatic bioencryption
US12270028B2 (en) 2017-06-12 2025-04-08 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
US11745159B2 (en) 2017-10-20 2023-09-05 Twist Bioscience Corporation Heated nanowells for polynucleotide synthesis
US11492665B2 (en) 2018-05-18 2022-11-08 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US12522868B2 (en) 2018-05-18 2026-01-13 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US11732294B2 (en) 2018-05-18 2023-08-22 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
US12357959B2 (en) 2018-12-26 2025-07-15 Twist Bioscience Corporation Highly accurate de novo polynucleotide synthesis
US11492727B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for GLP1 receptor
US11492728B2 (en) 2019-02-26 2022-11-08 Twist Bioscience Corporation Variant nucleic acid libraries for antibody optimization
US12565715B2 (en) 2019-02-26 2026-03-03 Twist Bioscience Corporation Variant nucleic acid libraries for antibody optimization
US12331427B2 (en) 2019-02-26 2025-06-17 Twist Bioscience Corporation Antibodies that bind GLP1R
US12091777B2 (en) 2019-09-23 2024-09-17 Twist Bioscience Corporation Variant nucleic acid libraries for CRTH2
US12173282B2 (en) 2019-09-23 2024-12-24 Twist Bioscience, Inc. Antibodies that bind CD3 epsilon
US12570750B2 (en) 2019-12-09 2026-03-10 Twist Bioscience Corporation Antibodies that bind adenosine A2A receptors and methods of use thereof to treat cancer and neurological diseases
US12391762B2 (en) 2020-08-26 2025-08-19 Twist Bioscience Corporation Methods and compositions relating to GLP1R variants
US12202905B2 (en) 2021-01-21 2025-01-21 Twist Bioscience Corporation Methods and compositions relating to adenosine receptors
US12258406B2 (en) 2021-03-24 2025-03-25 Twist Bioscience Corporation Antibodies that bind CD3 Epsilon
US12134656B2 (en) 2021-11-18 2024-11-05 Twist Bioscience Corporation Dickkopf-1 variant antibodies and methods of use
WO2024027715A1 (en) * 2022-08-01 2024-02-08 Sciwind Biosciences Usa Co., Ltd Anti-glp-1r antibodies and uses thereof

Also Published As

Publication number Publication date
KR20230074151A (ko) 2023-05-26
US12391762B2 (en) 2025-08-19
JP2023539245A (ja) 2023-09-13
EP4204460A4 (en) 2024-09-25
US20220064313A1 (en) 2022-03-03
EP4204460A2 (en) 2023-07-05
US20250340658A1 (en) 2025-11-06
WO2022046944A3 (en) 2022-04-07
AU2021331088A1 (en) 2023-05-04
JP7836295B2 (ja) 2026-03-26
CA3190667A1 (en) 2022-03-03
AU2021331088A9 (en) 2024-09-12

Similar Documents

Publication Publication Date Title
US12391762B2 (en) Methods and compositions relating to GLP1R variants
US12331427B2 (en) Antibodies that bind GLP1R
US12570750B2 (en) Antibodies that bind adenosine A2A receptors and methods of use thereof to treat cancer and neurological diseases
US12202905B2 (en) Methods and compositions relating to adenosine receptors
US12091777B2 (en) Variant nucleic acid libraries for CRTH2
US20220135690A1 (en) Methods and compositions relating to chemokine receptor variants
US20230265198A1 (en) Neuropilin-1 variant antibodies and methods of use
AU2022390457A1 (en) Dickkopf-1 variant antibodies and methods of use
CN116829946A (zh) 涉及glp1r变体的方法和组合物
HK40100779A (zh) 涉及glp1r变体的方法和组合物

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21862681

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 3190667

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2023513296

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 202317021568

Country of ref document: IN

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021862681

Country of ref document: EP

Effective date: 20230327

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21862681

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 202180073480.2

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 2021331088

Country of ref document: AU

Date of ref document: 20210825

Kind code of ref document: A