WO2021251708A1 - Nk 세포의 활성화 및 증폭을 위해 유전적으로 조작된 세포주, 및 그의 용도 - Google Patents

Nk 세포의 활성화 및 증폭을 위해 유전적으로 조작된 세포주, 및 그의 용도 Download PDF

Info

Publication number
WO2021251708A1
WO2021251708A1 PCT/KR2021/007092 KR2021007092W WO2021251708A1 WO 2021251708 A1 WO2021251708 A1 WO 2021251708A1 KR 2021007092 W KR2021007092 W KR 2021007092W WO 2021251708 A1 WO2021251708 A1 WO 2021251708A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
genetically engineered
mbil
feeder
Prior art date
Application number
PCT/KR2021/007092
Other languages
English (en)
French (fr)
Inventor
조덕
도준상
판티민창
김진호
Original Assignee
사회복지법인 삼성생명공익재단
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210046106A external-priority patent/KR102584532B1/ko
Application filed by 사회복지법인 삼성생명공익재단, 서울대학교산학협력단 filed Critical 사회복지법인 삼성생명공익재단
Priority to US17/996,569 priority Critical patent/US20230203443A1/en
Priority to JP2022570170A priority patent/JP2023526804A/ja
Priority to EP21821487.2A priority patent/EP4163367A4/en
Priority to CN202180030746.5A priority patent/CN115461451A/zh
Publication of WO2021251708A1 publication Critical patent/WO2021251708A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0646—Natural killers cells [NK], NKT cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/23—Interleukins [IL]
    • C12N2501/2302—Interleukin-2 (IL-2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/23—Interleukins [IL]
    • C12N2501/2315—Interleukin-15 (IL-15)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/23—Interleukins [IL]
    • C12N2501/2318—Interleukin-18 (IL-18)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/23—Interleukins [IL]
    • C12N2501/2321—Interleukin-21 (IL-21)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/99—Coculture with; Conditioned medium produced by genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Definitions

  • NK cells a genetically engineered cell line for activation and amplification of NK cells, and uses thereof, specifically, to a method for proliferating NK cells using the same, or to a method for measuring the activity of NK cells using the same.
  • NK cells are a type of cytotoxic lymphocytes important for innate immunity. NK cells respond to virus-infected cells or cancer cells, and these responses are signals generated by activating receptors and inhibitory receptors of NK cells with their respective ligands. ) depends on Normally, when the activation signal is stronger than the inhibitory signal, NK cells can attack the target cell, but when the inhibitory signal is stronger, they do not attack. Therefore, normal cells are not attacked by NK cells because the inhibitory receptor ligand (MHC, major histocompatibility complex) of NK cells is present and emits an inhibitory signal.
  • MHC inhibitory receptor ligand
  • Some of the cancer cells may decrease due to the occurrence of MHC abnormalities on the cell surface.
  • NK cells attack the target cells. It secretes perforin to puncture the cell membrane of infected cells or cancer cells, and has cytotoxicity to kill these cells by releasing granzyme. Defects in the number or anticancer activity of NK cells are found in B-cell lymphoma and many cancer patients, and it is known that NK cell dysfunction is closely related to the occurrence of these cancers.
  • a treatment for cancer patients utilizing the anticancer power of these NK cells is emerging, and it is important to develop an amplification method to secure a large number of high-performance NK cells.
  • people with reduced or abnormal NK cell function are known to be related to cancer and various diseases, so the development of a method for measuring NK cell activity is required.
  • NK cells The previously reported methods for proliferation of NK cells are methods using various expensive cytokines at high concentrations or using peripheral blood mononuclear cells or cancer cell lines together. However, this requires high cost and the amplification rate is not very high.
  • a number of studies show that, in addition to NK cells, other lymphocytes such as T cells are amplified, it is inappropriate for NK cell-based immune cell therapy. Therefore, the development of an efficient method for selectively amplifying only NK cells is a major subject, and research on this is being made (Korean Patent No. 10-1525199), but it is still incomplete.
  • the cytotoxicity test is a test that directly kills target cancer cells (K562 cell line) and is currently being used in clinical laboratories. Recently, a cytotoxicity test using whole blood, which does not require a cell separation process, has been introduced instead of peripheral blood mononuclear cells that require a complicated cell separation process. However, when whole blood is used, various types of cytokines are required, but the problem of increasing the cost of the examination has emerged, which needs to be overcome.
  • One aspect is a cell line genetically engineered to express membrane bound interleukin-18 (mbIL-18), and membrane bound interleukin-21 (mbIL-21), or cultured It provides feeder cells.
  • mbIL-18 membrane bound interleukin-18
  • mbIL-21 membrane bound interleukin-21
  • Another aspect is a method comprising: obtaining a blood sample containing mixed immune cells; and contacting at least a portion of the population of NK cells with genetically engineered cells to activate NK cells, wherein the genetically engineered cells are membrane bound interleukin-18 (mbIL-18). ), and a method genetically engineered to express membrane bound interleukin-21 (mbIL-21).
  • mbIL-18 membrane bound interleukin-18
  • mbIL-21 membrane bound interleukin-21
  • Another aspect is a method comprising: obtaining a blood sample containing a mixed population of NK cells; activating NK cells by contacting at least a portion of the mixed population of NK cells with genetically engineered cells to activate the NK cells, wherein the genetically engineered cells contain membrane bound interleukin-18 (membrane bound interleukin-18). -18: mbIL-18), and a membrane bound interleukin-21 (mbIL-21) genetically engineered to express; And to provide a method of examining the activity of NK cells comprising the step of analyzing the degree of activation of the activated NK cells.
  • Another aspect includes obtaining a blood sample containing a population of mixed NK cells; activating NK cells by contacting at least a portion of the mixed population of NK cells with genetically engineered cells to activate the NK cells, wherein the genetically engineered cells contain membrane bound interleukin-18 (membrane bound interleukin-18). -18: mbIL-18), and genetically engineered to express membrane bound interleukin-21 (mbIL-21); And to provide a method for diagnosing an NK cell-related disease or a method for providing information on diagnosis, comprising analyzing the degree of activation of the activated NK cells.
  • One aspect provides a cell line genetically engineered to express membrane bound interleukin-18 (mbIL-18), and membrane bound interleukin-21 (mbIL-21). .
  • the cell line can be used as feeder cells to selectively amplify only NK cells.
  • the K562 cell line which is a representative nutrient support cell used for NK cell proliferation, is only used for the proliferation of NK cells, so the K562 cell line itself should not proliferate. Therefore, before culturing with NK cells, the K562 cell line is pre-treated through irradiation with strong radiation (eg, 50 to 100 Gy) so that the K562 cell line itself does not proliferate at all, but only helps the proliferation of NK cells. do.
  • strong radiation eg, 50 to 100 Gy
  • cytokines such as IL-2 and IL-15 must be continuously exposed to NK cells.
  • the cancer cell line pretreated with radiation cannot survive for a long time in the culture process itself.
  • the selective proliferation efficiency of NK cells is lowered.
  • NK cells were briefly exposed to IL-18 or IL-21 in the presence of K562, the cell amplification effect did not appear until day 21.
  • the feeder cell line genetically engineered to express mbIL-18 and mbIL-21 does not reduce NK cell proliferation efficiency despite short-term expression of IL-18 and IL-21. It can be selectively amplified.
  • feeder cells also called support cells
  • a feeder cell that can be used herein, an animal cell line into which a gene is introduced, a human chronic myelogenous leukemia cell line (eg, K562 cell), RPMI8866, EBV_LCL, 721.221, HFWT, NK-92, etc. can
  • genetic engineering or “genetically engineered” refers to the act of introducing one or more genetic modifications into a cell or a cell made thereby.
  • the genetically engineered cell may include an exogenous gene encoding the above-mentioned gene.
  • exogenous means that a referenced molecule or referenced activity has been introduced into a host cell.
  • the molecule may be introduced, for example, as non-chromosomal genetic material such as a plasmid or the introduction of an encoding nucleic acid into the host genetic material, such as by insertion into a host chromosome.
  • the term “exogenous” indicates that the encoding nucleic acid has been introduced into an organism in an expressible form.
  • biosynthetic activity the term “exogenous” refers to an activity introduced into a host parent cell.
  • Its source may be, for example, a homologous or heterologous encoding nucleic acid which, after introduction into a host parent cell, expresses the stated activity.
  • endogenous refers to the stated molecule or activity present in the host cell.
  • endogenous refers to the expression of the encoding nucleic acid contained within an individual.
  • heterologous refers to a molecule or activity from an origin other than the species mentioned and the term “homologous” refers to a molecule or activity from a host parent cell.
  • exogenous expression of an encoding nucleic acid may utilize either or both heterologous or homologous encoding nucleic acids.
  • the cell may contain nucleic acids encoding mbIL-18 and mbIL-21. More specifically, the cell may be transformed with a vector containing a nucleic acid encoding mbIL-18 and mbIL-21.
  • the term “vector” refers to a vector capable of expressing a target protein in a suitable host cell, and refers to a genetic construct comprising regulatory elements operably linked to express a gene insert.
  • a vector according to an embodiment may include expression control elements such as a promoter, an operator, a start codon, a stop codon, a polyadenylation signal, and/or an enhancer, and the promoter of the vector may be constitutive or inducible.
  • the vector may be an expression vector capable of stably expressing the fusion protein in a host cell.
  • the expression vector may be a conventional vector used to express a foreign protein in plants, animals or microorganisms in the art.
  • the recombinant vector can be constructed through various methods known in the art.
  • the vector may include a selectable marker for selecting host cells containing the vector, and in the case of a replicable vector, it may include an origin of replication.
  • the vector may be self-replicating or introduced into host DNA, wherein the vector is selected from the group consisting of a plasmid, a lentivirus, an adenovirus, an adeno-associated virus, a retrovirus, a herpes simplex virus, and a basinia virus. it could be
  • the polynucleotide sequence encoding the above-described fusion protein may be operably linked to a promoter.
  • operably linked refers to a functional linkage between a nucleic acid expression control sequence (eg, a promoter, signal sequence, or an array of transcriptional regulator binding sites) and another nucleic acid sequence, whereby The regulatory sequence will regulate the transcription and/or translation of the other nucleic acid sequence.
  • membrane bound interleukin refers to an interleukin bound to a cell membrane, and may have a meaning distinct from secretion of interleukin to the outside of the cell.
  • mbIL-18 is a nucleic acid sequence of SEQ ID NO: 1 or an amino acid sequence thereof and about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, It may have a sequence homology of about 97% or more, about 98% or more, or about 99% or more.
  • mbIL-21 is a nucleic acid sequence of SEQ ID NO: 2 or an amino acid sequence thereof and about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, It may have a sequence homology of about 97% or more, about 98% or more, or about 99% or more.
  • Another aspect comprises cells genetically engineered to express membrane bound interleukin-18 (mbIL-18), and membrane bound interleukin-21 (mbIL-21). It provides a composition for NK cell culture.
  • mbIL-18 membrane bound interleukin-18
  • mbIL-21 membrane bound interleukin-21
  • composition for culturing NK cells comprising cells genetically engineered to express mbIL-18 and mbIL-21 according to an embodiment may induce amplification and/or activation of NK cells (eg, natural killer cells). It can be usefully used for culturing, isolation, or proliferation of NK cells.
  • NK cells eg, natural killer cells
  • Another aspect is a method comprising: obtaining a blood sample containing a population of mixed immune cells; and contacting at least a portion of the mixed population of NK cells with genetically engineered cells to activate NK cells, wherein the genetically engineered cells are membrane bound interleukin-18 (mbIL). -18), and a method genetically engineered to express membrane bound interleukin-21 (mbIL-21).
  • mbIL-18 membrane bound interleukin-18
  • mbIL-21 membrane bound interleukin-21
  • the contacting step is to stimulate, activate, or expand the subpopulation of NK cells by co-culturing the population of NK cells mixed with the genetically engineered cells.
  • stimulation of NK cells refers to the activity of natural killer cells in vitro or in vivo, for example, increasing cytotoxic activity, or generating, increasing, amplifying, or proliferating activated natural killer cells. can mean that
  • non-limiting examples of said NK cells include macrophages, B lymphocytes, T lymphocytes, mast cells, monocytes, dendritic cells, eosinophils, natural killer cells, basophils, neutrophils.
  • the NK cells are selected from the group consisting of macrophages, B lymphocytes, T lymphocytes (CD8+ CTL), mast cells, monocytes, dendritic cells, eosinophils, natural killer cells, basophils, or neutrophils. It may be either one.
  • the NK cells may be natural killer cells or T lymphocytes.
  • the mixed NK cells may include one or more selected from the group consisting of macrophages, B lymphocytes, T lymphocytes, mast cells, monocytes, dendritic cells, eosinophils, natural killer cells, basophils, and neutrophils.
  • NK cells are cytotoxic lymphocytes constituting a major component of the innate immune system, and are defined as large granular lymphocytes (LGL) and lymphoid progenitor cells ( constitutes a third cell differentiated from common lymphoid progenitor (CLP) producing B and T lymphocytes.
  • LGL large granular lymphocytes
  • CLP common lymphoid progenitor
  • NK cells include natural killer cells without further modification derived from any tissue source, and may include mature natural killer cells as well as natural killer progenitor cells.
  • NK cells are activated in response to interferon or macrophage-derived cytokines, and NK cells are of two types that control the cytotoxic activity of cells, labeled with “activating receptors” and “inhibiting receptors”. contain surface receptors.
  • Natural killer cells can be generated from any source, for example, hematopoietic cells, such as hematopoietic stems or progenitors, from placental tissue, placental perfusate, umbilical cord blood, placental blood, peripheral blood, spleen, liver, and the like.
  • the natural killer cells may be activated natural killer cells.
  • the activated natural killer cells may refer to cells in which cytotoxicity or intrinsic immunomodulatory ability of natural killer cells is activated compared to parental cells, for example, hematopoietic cells or natural killer progenitor cells.
  • activated natural killer cells or activated natural killer cell-enriched populations are one or more functionally relevant markers, e.g., CD16, CD57, CD69, CD94, CD161, CD158a, CD158b, NKp30 , NKp44, NKp46, DNAM-1, 2B4, NKp46, CD94, KIR (e.g., KIR2DL1, KIR2DL2/3, KIR3DL1), and the NKG2 family of activating receptors (e.g., NKG2A, NKG2C, NKG2D) can be evaluated.
  • functionally relevant markers e.g., CD16, CD57, CD69, CD94, CD161, CD158a, CD158b, NKp30 , NKp44, NKp46, DNAM-1, 2B4, NKp46, CD94, KIR (e.g., KIR2DL1, KIR2DL2/3, KIR3DL1), and the NKG2 family of activating receptors (e.g., NKG
  • the co-culture may be made in the presence of cytokines.
  • cytokine may refer to a protein ( ⁇ 5-20 kDa) that plays a role in cell signaling. Cytokines are released by cells and affect the behavior of cytokine-releasing cells and/or other cells. Non-limiting examples of cytokines include chemokines, interferons, interleukins, lymphokines, tumor necrosis factors, monokines, and colony stimulating factors. Cytokines can be produced by a wide range of cells including, but not limited to, immune cells such as macrophages, B lymphocytes, T lymphocytes, mast cells and monocytes, endothelial cells, fibroblasts and stromal cells. can Cytokines may be produced by more than one type of cell.
  • Cytokines act through receptors and are of particular importance in the immune system, regulating the balance between humoral and cellular immune responses, and regulating the maturation, growth and responsiveness of cell populations.
  • a cytokine herein may be a naturally occurring cytokine or may be a mutated version of a naturally occurring cytokine.
  • naturally occurring may also refer to wild-type and includes allelic variants.
  • a mutated version or “mutation” of a naturally occurring cytokine refers to specific mutations made to a naturally occurring sequence to alter the function, activity and/or specificity of the cytokine.
  • the mutations may enhance the function, activity and/or specificity of a cytokine.
  • the mutations may reduce the function, activity and/or specificity of the cytokine. Mutations may include deletions or additions of one or more amino acid residues of the cytokine.
  • the cytokines are BMP (Bone morphogenetic protein) family, CCL (Cheomkine ligands) family, CMTM (CKLF-like MARVEL transmembrane domain containing member) family, CXCL (CXC motif ligand ligand) family, GDF (Growth/differentiation factor) family, Growth hormone, IFN (Interferon) family, IL (Interleukin) family, TNF (Tumor necrosis factors) family, GPI (glycophosphatidylinositol), SLUPR-1 (Secreted Ly-6/uPAR- Related Protein 1), SLUPR-2 (Secreted Ly) It may be any one selected from the group consisting of -6/uPAR-Related Protein 2) and combinations thereof.
  • BMP BMP
  • CCL Cheomkine ligands
  • CMTM CKLF-like MARVEL transmembrane domain containing member
  • CXCL CXC motif ligand
  • the cytokine is an interleukin or a mutant thereof.
  • Many interleukins are synthesized by helper CD4 T lymphocytes, as well as monocytes, macrophages, and endothelial cells. Interleukins can promote the development and differentiation of T and B lymphocytes and hematopoietic cells.
  • Non-limiting examples of interleukins include IL1, IL2, IL3, IL4, IL5, IL6, IL7, IL8 (CXCL8), IL9, IL10, IL11, IL12, IL13, IL14, IL15, IL16, IL17, IL18, IL19, IL20, IL21, IL22, IL23, IL24, IL25, IL26, IL27, IL28, IL29, IL30, IL31, IL32, IL33, IL35, or IL36.
  • the cytokine is IL1, IL2, IL3, IL4, IL5, IL6, IL7, IL8 (CXCL8), IL9, IL10, IL11, IL12, IL13, IL14, IL15, IL16, IL17, IL18 , IL19, IL20, IL21, IL22, IL23, IL24, IL25, IL26, IL27, IL28, IL29, IL30, IL31, IL32, IL33, IL35, or wild-type and mutant forms of IL36, including but not limited to interleukin or a mutant thereof.
  • the cytokines added to the co-culture may be IL-18 and IL-21. More specifically, the co-culture may include adding IL-18 and IL-21 to the culture medium while culturing in the presence of IL-2 and IL-15.
  • the IL-21 may be used at a concentration of 1 to 20 ng/ml, 1 to 15 ng/ml, 1 to 10 ng/ml, or 2 to 8 ng/ml.
  • the IL-18 is 10-200 ng/ml, 10-180 ng/ml, 20-160 ng/ml, 20-120 ng/ml, 20-40 ng/ml, 20-80 ng/ml, 40-160 ng/ml, 40-120 ng/ml, 40-80 ng/ml, 80-160 ng/ml, or 80-120 ng/ml.
  • the proliferation of NK cells can be further synergistically increased.
  • the co-culture may be performed for 2 to 30 days.
  • the genetically engineered cells may be treated with 50 Gy to 300 Gy radiation.
  • the sample may be a biological sample derived from a subject, for example, a mammal including a human.
  • the biological sample may be isolated from a subject, and may be blood, whole blood, serum, plasma, lymph, urine, feces, tissue, cell, organ, bone marrow, saliva, sputum, cerebrospinal fluid, or a combination thereof.
  • the biological sample may include PBMCs, purified NK cells, or primary resting cells (ie, directly isolated from blood).
  • Another aspect is a method comprising: obtaining a blood sample containing a mixed population of NK cells; activating NK cells by contacting at least a portion of the mixed population of NK cells with genetically engineered cells to activate the NK cells, wherein the genetically engineered cells contain membrane bound interleukin-18 (membrane bound interleukin-18). -18: mbIL-18), and genetically engineered to express membrane bound interleukin-21 (mbIL-21); And it provides a method of examining the activity of NK cells comprising the step of analyzing the degree of activation of the activated NK cells.
  • Another aspect provides a method comprising: obtaining a blood sample containing a mixed population of NK cells; activating NK cells by contacting at least a portion of the mixed population of NK cells with genetically engineered cells to activate the NK cells, wherein the genetically engineered cells contain membrane bound interleukin-18 (membrane bound interleukin-18). -18: mbIL-18), and genetically engineered to express membrane bound interleukin-21 (mbIL-21); And it provides a method of diagnosing a NK cell-related disease comprising the step of analyzing the degree of activation of the activated NK cells or a method of providing information about the diagnosis.
  • the step of comparing the activation of the NK cells compared to the normal NK cells is specifically, using the normal NK cells as a control and the above-mentioned genetically engineered cells under the same conditions as the experimental group.
  • the activation phenomenon in normal NK cells is significantly higher in the experimental group, does not appear, or the degree is significantly low in the experimental group, this includes judging as abnormal.
  • pathological signs of abnormal NK cell-related diseases, viral infection, the presence of cancer cells, and specific cancers can be determined, and the prognosis for these diseases can be predicted.
  • the term "normal NK cells” refers to NK cells possessed by or derived from an individual without the disease, wherein the individual without the disease has at least a physical, genetic, or exogenous disease known to affect NK cell activity. have no conditions
  • the method may further include isolating the NK cells required from the sample. If necessary, the above step may be performed after stimulation in the presence of other blood cells or lymphocytes, and the stimulation step may be performed after the above step is performed to obtain a sample containing only NK cells as lymphocytes.
  • the degree of purification of the isolated NK cells and the composition of the sample may be varied to the extent required for the experiment. NK cells may be used as purified from the sample if necessary, and may be used after proliferating to secure conditions or cell amount suitable for the experiment.
  • the step of isolating the NK cells may not be essential.
  • the step of measuring the degree of activation may include at least one selected from measurement of a cytokine secreted by degranulation activity, cytotoxicity activity, and NK cell stimulation.
  • the degranulation activity may mean inducing lysis of a target cell by, for example, secretion of perforin or granzyme, which may be analyzed using FACS.
  • a method of measuring CD107a expression proportional to degranulation using a fluorochrome-conjugated antibody after stimulation of PBMCs or pure NK cells isolated from whole blood samples may be used.
  • the cytotoxic activity is, for example, after incubation with a culture containing target cells capable of activating NK cells labeled with europium fluorescent dye, the amount of fluorescent dye released through target cell lysis It can be measured using a microplate reader (microplate reader).
  • the cytokine may be selected from IFN- ⁇ , TNF- ⁇ , TNF- ⁇ , MIP-1 ⁇ , MIP-1 ⁇ PANTES, IL-8 and IL-10.
  • the analysis of the expression of immunoactivators of NK cells as described above may be performed using FACS, intracellular cytokine staining, or ELISA. Specifically, after staining the NK cell surface using a specific fluorochrome-conjugated antibody, the cells are permeabilized and fluorochrome-conjugated with another specific immunoactivating factor (e.g., IFN- ⁇ antibody A method of measuring the expression of immune activation factors in NK cells by staining with cytokines may be used.
  • the disease related to the activity of NK cells is as showing abnormal NK cell activity, for example, hypersensitive immune disease, autoimmune disease, immune rejection reaction, immunodeficiency disease, histiocytosis, cancer, type 2 diabetes, parasitic infections and viral diseases.
  • the hypersensitive immune disease is one or more selected from asthma and sinusitis
  • the autoimmune disease is one or more selected from lupus, multiple sclerosis, type 1 diabetes, and rheumatoid arthritis
  • the histiocytosis is HLH, XLP1 , and may be any one or more selected from XLP2.
  • Hemophagocytic lymphohistiocytosis is characterized by group 2 Langerhans cell histiocytosis, erythrophagocytic lymphohistiocytosis (familial, sporadic), infection-associated hemophagocytic syndrome, virus-associated hemophagocytic syndrome, and massive lymphadenopathy. may include the meaning of histiocytosis, or reticulocytosis.
  • cancer includes tumors, blood cancers, or solid cancers, and includes those that impair the synergistic activity of NK cells of an individual or do not cause synergistic activity of NK cells as target cells under certain conditions.
  • the cancer is lung cancer, liver cancer, esophageal cancer, stomach cancer, colorectal cancer, small intestine cancer, pancreatic cancer, melanoma, breast cancer, oral cancer, brain tumor, thyroid cancer, parathyroid cancer, kidney cancer, cervical cancer, sarcoma, prostate cancer, urethra cancer It may be selected from the group consisting of cancer, bladder cancer, testicular cancer, blood cancer, lymphoma, skin cancer, psoriasis and fibroadenoma. In one embodiment, the cancer may be pancreatic cancer or B cell lymphoma. In one embodiment, the viral disease may be hepatitis B. In one embodiment, the immunodeficiency disease may be DiGeorge syndrome or Chedial-Higashi syndrome.
  • the information on the NK cell activity-related disease can be determined as abnormal NK cells when activation of NK cells of the test group is not detected compared to normal NK cells, or NK cells that have lost activity for a specific receptor are abnormal for target cells In the case of causing or not causing the activity as a result, it can be determined that the target cell is related to a specific disease.
  • Another aspect provides NK cells produced by the method for proliferating NK cells.
  • Another aspect provides a cell therapy product comprising the immune cells or a cell population thereof as an active ingredient.
  • Another aspect provides a pharmaceutical composition for the prevention or treatment of cancer or infectious diseases using the immune cells or cell populations thereof as an active ingredient.
  • Another aspect provides the use of said immune cell or cell population thereof for the manufacture of a medicament.
  • Another aspect provides a method of treating a disease comprising administering the immune cells or a cell population thereof to a subject.
  • disease may refer to a pathological condition, particularly cancer, infectious disease, inflammatory disease, metabolic disease, autoimmune disorder, degenerative disease, apoptosis-related disease, and graft rejection.
  • treatment refers to or includes the alleviation, progression inhibition or prevention of a disease, disorder or condition, or one or more symptoms thereof
  • active ingredient or “pharmaceutically effective amount” refers to the disease, disorder or condition , or any amount of the composition used in the practice of the invention provided herein sufficient to alleviate, inhibit or prevent the progression of one or more symptoms thereof.
  • administering As used herein, the terms “administering,” “introducing,” and “implanting” are used interchangeably and into a subject by a method or route that results in at least partial localization of the composition according to one embodiment to a desired site. It may mean a batch of a composition according to an embodiment. Administration can be by any suitable route that delivers at least a portion of a cell or cellular component of a composition according to an embodiment to a desired location in a surviving individual. The survival period of the cells after administration to a subject may be as short as several hours, for example, 24 hours to several days, or as long as several years.
  • isolated cell eg, "isolated immune cell” and the like, refers to a cell substantially isolated from a tissue from which the cell originates, eg, a hematopoietic cell.
  • the method of administering the pharmaceutical composition is not particularly limited, but may be administered parenterally or orally, such as intravenously, subcutaneously, intraperitoneally, inhalation or topical application, depending on the desired method.
  • the dosage varies according to the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate, and severity of disease.
  • a daily dose refers to an amount of a therapeutic agent according to one aspect sufficient to treat a disease state ameliorated by being administered to a subject in need thereof.
  • An effective amount of a therapeutic agent depends on the particular compound, the disease state and its severity, and the individual in need of treatment, which can be routinely determined by one of ordinary skill in the art.
  • the dosage for the human body of the composition according to one aspect may vary depending on the patient's age, weight, sex, dosage form, health status, and disease degree. Based on an adult patient weighing 70 kg, for example, about 1,000-10,000 cells/time, 1,000-100,000 cells/time, 1,000-1000,000 cells/time, 1,000-10,000,000, 1,000-100,000,000 cells/time, 1,000 to 1,000,000,000 cells/time, 1,000 to 10,000,000,000 cells/time, may be administered in divided doses once or several times a day at regular time intervals, or may be administered several times at regular time intervals.
  • the term 'individual' refers to a subject in need of treatment for a disease, and more specifically refers to mammals such as human or non-human primates, mice, rats, dogs, cats, horses and cattle. .
  • the pharmaceutical composition according to one embodiment may include a pharmaceutically acceptable carrier and/or additive.
  • a pharmaceutically acceptable carrier and/or additive for example, sterile water, physiological saline, conventional buffers (phosphoric acid, citric acid, other organic acids, etc.), stabilizers, salts, antioxidants (ascorbic acid, etc.), surfactants, suspending agents, isotonic acid, or preservatives, etc. can do.
  • organic materials such as biopolymers, inorganic materials such as hydroxyapatite, specifically collagen matrix, polylactic acid polymers or copolymers, polyethylene glycol polymers or copolymers and chemical derivatives thereof, etc. may also be combined for topical administration.
  • the pharmaceutical composition according to one embodiment is formulated in a dosage form suitable for injection, immune cells, immune cells, or substances that increase their activity are dissolved in a pharmaceutically acceptable carrier or in a dissolved solution state. It may be frozen.
  • the pharmaceutical composition according to one embodiment may contain a suspending agent, a solubilizing agent, a stabilizer, an isotonic agent, a preservative, an adsorption inhibitor, a surfactant, a diluent, an excipient, a pH adjuster, an analgesic agent, Buffers, reducing agents, antioxidants and the like may be included as appropriate.
  • a suspending agent e.g., a solubilizing agent, a stabilizer, an isotonic agent, a preservative, an adsorption inhibitor, a surfactant, a diluent, an excipient, a pH adjuster, an analgesic agent, Buffers, reducing agents, antioxidants and the like may be included as appropriate.
  • Pharmaceutically acceptable carriers and agents suitable for the present invention including those exemplified above, are described in detail in Remington's Pharmaceutical Sciences, 19th ed., 1995.
  • the pharmaceutical composition according to one embodiment is formulated in a unit dosage form by using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person of ordinary skill in the art to which the present invention pertains. It may be prepared as or by putting it in a multi-dose container. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of a powder, granules, tablets or capsules.
  • the proliferation and activity of NK cells can be increased at least 2-fold to several-fold, and the NK cells can be proliferated and used as a cell therapeutic agent.
  • 1A is a graph confirming the expression characteristics of mbIL-18 and mbIL-21 in feeder cells according to an aspect.
  • 1A is a schematic diagram showing the gene of a lentivirus that produces mbIL-18 and mbIL-21 in order to prepare feeder cells according to an aspect.
  • 1B is a graph confirming the expression characteristics of mbIL-18 and mbIL-21 in feeder cells according to an aspect.
  • 2A is a graph showing the fold expansion (left) and purity (right) of NK cells when feeder cells and NK cells according to an aspect are cultured in complete RPMI 1640 medium.
  • Figure 2b is a graph showing the fold expansion (left) and purity (right) of NK cells when the feeder cells and NK cells according to an aspect are cultured in DS medium.
  • 2c is a graph comparing the fold expansion (left) and purity (right) of NK cells when feeder cells and NK cells according to an aspect are cultured in complete RPMI 1640 medium and DS medium.
  • 3a and 3b show NK cells amplified using feeder cells (blue) and K562 feeder cells (red) according to an aspect in RPMI 1640 medium and DS medium, and then expressed in the amplified NK cells It is a graph comparing markers.
  • Figure 4a is a graph confirming the cytotoxicity of normal donor (HD) NK cells amplified using feeder cells according to an aspect.
  • Figure 4b is a graph confirming the ADCC cytotoxicity of normal donor (HD) NK cells amplified using feeder cells according to an aspect.
  • 5A and 5B are graphs measuring CD107a expression of NK cells stimulated by feeder cells according to an aspect.
  • 5c and 5d are graphs measuring target cell lysis rate of NK cells stimulated by feeder cells according to an aspect.
  • Feeder cells expressing membrane bound interleukin-18 (mbIL-18) and membrane bound interleukin-21 (mbIL-21) were prepared.
  • the human-derived mbIL18 gene (SEQ ID NO: 1) and mbIL21 gene (SEQ ID NO: 2) were cloned into a lentiviral vector, pCDH-CMV-RFP, to prepare a recombinant lentivirus production vector (Fig. 1a). Then, the recombinant gene (pCDH-CMV-RFP-mbIL-1821) prepared above for virus production was transfected into 293FT cells using lipofectamin3000 (Invitrogen) together with a packaging vector. After a period of time, the cells were cultured for 48 hours by changing to a new medium, and then the medium containing the virus was recovered.
  • the recovered medium was centrifuged at 500 ⁇ g for 10 minutes, and only the pure medium containing the virus was separated using a 0.45 ⁇ m filter to produce an mbIL18-mbIL21-expressing lentivirus. Thereafter, 1 ml of mbIL18-mbIL21 expressing lentivirus was dissolved in 9 ml of a medium containing K562 cells, and added together with polybrene (8 ⁇ g/ml), and cell culture was performed for 48 hours.
  • mRNA and surface protein expression levels were checked.
  • RNA of the K562-mbIL18-mbIL21 cell line and the K562 feeder cell line prepared in Example 1 was isolated using RNeasy Mini Kit (Qiagen, Venlo, Netherlands) and IMPLEN Nanophotometer P330 (IMPLEN, Munich, Germany) was used for quantification. Thereafter, the isolated RNA was converted to cDNA using the QuantiTect Reverse Transcription Kit (Qiagen), and then PCR was performed in a standard 20 ⁇ l reaction volume using the QuantiTect SYBR Green PCR Kit (Qiagen) and Rotor-Gene Q (Qiagen). did At this time, the primers were used in Table 1, and all experiments were repeated three times.
  • 1B is a graph confirming the expression characteristics of mbIL-18 and mbIL-21 in feeder cells according to an aspect.
  • the genetically engineered feeder cells according to one embodiment have the expression characteristics of mbIL-18 and mbIL-21.
  • NK cell activation and amplification according to the medium of the genetically engineered feeder cells according to an aspect was confirmed.
  • the K562-mbIL18-mbIL21 cell line prepared in Example 1 was cultured in a T-75 flask containing 25 ml of complete RPMI 1640 medium at 37° C. in an incubator supplied with 5% CO 2 . Thereafter, centrifugation was performed for 3 minutes under 400 ⁇ g conditions, and the cell pellet was resuspended in 5 ml of complete RPMI 1640 medium to harvest feeder cells. Thereafter, in order to prevent excessive growth of the feeder cells, the feeder cells were irradiated with gamma rays at 100 Gy using a Gammacell 3000 Elan radiator and used in subsequent experiments.
  • PBMCs peripheral blood mononuclear cells
  • NK cells The amplification of NK cells was confirmed using FITC (Fluorescein isothiocyanate)-conjugated mouse anti-human CD 3 and PE-Cy5-conjugated mouse anti-human CD 56 monoclonal antibodies, K562 cells and IL-2/IL-15 Each fold expansion was confirmed using the purity of NK cells when treated as a baseline.
  • FITC Fluorescein isothiocyanate
  • 2A is a graph showing the fold expansion (left) and purity (right) of NK cells when feeder cells and NK cells according to an aspect are cultured in complete RPMI 1640 medium.
  • NK cells increased until the 35th day after culture, but it was confirmed that further amplification did not occur thereafter.
  • the feeder cells of Example 1 it was confirmed that the fold expansion of NK cells increased until day 42.
  • the purity of the NK cells cultured using the feeder cells of Example 1 was significantly higher than that of the NK cells cultured using the K562 feeder cells. That is, feeder cells according to one aspect not only significantly increase the activity of NK cells, but also allow long-term culture of NK cells, so that NK cells can be ocean-proliferated and used as a cell therapeutic agent.
  • Figure 2b is a graph showing the fold expansion (left) and purity (right) of NK cells when the feeder cells and NK cells according to an aspect are cultured in DS medium.
  • Figure 2c is a graph comparing the fold expansion (left) and purity (right) of NK cells when feeder cells and NK cells according to an aspect are cultured in complete RPMI 1640 medium and DS medium.
  • the feeder cells according to an aspect can selectively amplify NK cells according to the type of medium, and thus may have medium-selective characteristics. .
  • NK cells amplified by K562-mbIL18-mbIL2 cells in RPMI 1640 medium and DS medium were confirmed.
  • PBMCs peripheral blood mononuclear cells
  • whole blood:PBS from a normal donor was diluted in a 1:2 ratio (10 ml whole blood: 20 ml PBS) and overlaid on 15 ml Lymphoprep.
  • centrifugation was performed without brake at 1200 ⁇ g conditions for 25 minutes at room temperature (acceleration 1, deceleration 0), cells were harvested from the buffy coat layer, and PBS at 400 ⁇ g for 7 minutes. washed three times.
  • FACS buffer PBS containing 1% FBS
  • APC-Cyanine7-conjugated mouse anti-human CD3 and PE-Cyanine7-conjugated anti-human CD56 membranes were The antibody was treated for 15 minutes.
  • Cells were then harvested and further stained with different fluorescence-conjugated anti-human CD16, CD67, CD69, NK2G2A, NK2G2C, NKG2D, DNAM-1, NKp30, NKp46, KIR2DL1, KIR2DL2/3 and KIR3DL1 membrane antibodies, respectively, for 30 min. did Thereafter, the cells were washed with FACS buffer, and data were acquired using a FACS Calibur and analyzed with Kaluza.
  • 3a and 3b show NK cells amplified using feeder cells (blue) and K562 feeder cells (red) according to an aspect in RPMI 1640 medium and DS medium, and then expressed in the amplified NK cells It is a graph comparing markers.
  • the NK cells amplified by the feeder cells have complete functional properties of the NK cells.
  • cytotoxicity of NK cells to target cells on day 14 was measured for 4 hours by a CFSE-based assay.
  • target cells were added to FACS buffer, then stained with 0.5 ⁇ M CFSE at 37° C. for 10 minutes, and washed twice with complete medium (RPMI or DS). Then, 5 ⁇ 10 4 target cells were placed in a 96-well round bottom plate in triplicate, and the ratio of NK cells derived from a normal donor (HD) of Experimental Example 3 to effector-to-target (E:T) was 0.5:1 , 1:1 and 2:1 were mixed. The plate was centrifuged at 1,500 rpm for 3 minutes and then incubated at 37° C., 5% CO 2 in an incubator for 4 hours.
  • HD normal donor
  • E:T effector-to-target
  • the mixed cells were transferred to a FACS tube and 1 ⁇ l of 1 mg/mL propidium iodide (PI) (Sigma Aldrich, St. Louis, MO, USA) was added to each tube. Cells were then harvested on a FACS Calibur and analyzed using Kaluza software. The percentage of target cells that died (CFSF-positive and PI-positive) was calculated after subtracting the percentage of target cells that died spontaneously.
  • PI propidium iodide
  • Figure 4a is a graph confirming the cytotoxicity of normal donor (HD) NK cells amplified using feeder cells according to an aspect.
  • Figure 4b is a graph confirming the ADCC cytotoxicity of normal donor (HD) NK cells amplified using feeder cells according to an aspect.
  • Fig. 4a it was confirmed that the NK cells amplified using the feeder cells of Example 1 exhibited the same cytotoxicity as the NK cells amplified using the K562 feeder cells.
  • the cytotoxicity of the NK cells cultured in the DS medium exhibited the same cytotoxicity as the NK cells cultured in the RPMI medium.
  • the NK cells amplified using the feeder cells of Example 1 showed similar ADCC activity in the NK cells amplified using the K562 feeder cells and the Raji cells bound to Rituximab.
  • ADCC of NK cells cultured in DS medium exhibited ADCC activity similar to that of NK cells cultured in RPMI medium. That is, the NK cells amplified by the feeder cells according to an aspect exhibit cytotoxicity, and thus can be utilized as an antibody therapeutic.
  • the level of CD107a expression on the NK cell surface proportional to degranulation was measured. Specifically, 100 ⁇ l of whole blood from the normal donor (HD) of Experimental Example 3, 2 ⁇ 10 5 K562-mbIL18-mbIL21 feeder cells prepared in Example 1 or K562 cultured progenitor cells, and PE-conjugated anti-human CD107a were cultured in FACS tubes. After 1 hour, monensin and brefeldin A (BD Biosciences) were added and further incubated for 4 hours. Then, NK cells were obtained by staining with anti-human CD3 and CD56 antibodies, and CD107a expression was measured.
  • 5A and 5B are graphs measuring CD107a expression of NK cells stimulated by feeder cells according to an aspect.
  • the NK cells stimulated by the feeder cells of Example 1 increased the expression of CD107a in a concentration-dependent manner of IL-2.
  • the NK cells stimulated by the feeder cells of Example 1 showed significantly higher CD107a expression at the same concentration of IL-2 compared to the NK cells stimulated by the K562 feeder cells. high was confirmed.
  • NK cell activation using feeder cells can be more usefully used as a method for diagnosing NK cell activity than using K562 feeder cells.
  • target cells K562 feeder cells or feeder cells of Example 1
  • FACS buffer FACS buffer
  • complete medium RPMI or DS
  • 5 ⁇ 10 4 target cells were placed in a FACS tube in triplicate, and the complete medium supplemented with IL-2 and the normal donor (HD) whole blood were mixed at a volume ratio of 200ul, 100ul, and 50ul.
  • the FACS tube was incubated at 37° C., 5% CO 2 in an incubator for 16-20 hours. Then, the mixed cells were transferred to a FACS tube and 1 ⁇ l of 1 mg/mL propidium iodide (PI) (SigmaAldrich, St. Louis, MO, USA) was added to each tube. Cells were then harvested on a FACS Calibur and analyzed using Kaluza software. The percentage of target cells that died (CFSF-positive and PI-positive) was calculated after subtracting the percentage of target cells that died spontaneously.
  • PI propidium iodide
  • 5c and 5d are graphs measuring target cell lysis rate of NK cells stimulated by feeder cells according to an aspect.
  • the NK cells stimulated by the feeder cells of Example 1 increased the target cell lysis rate in a concentration-dependent manner of IL-2.
  • the NK cells stimulated by the feeder cells of Example 1 had a significant target cell lysis rate at the same IL-2 concentration compared to the NK cells stimulated by the K562 feeder cells. was found to be high.
  • NK cell activation using feeder cells can be more usefully used as a method for diagnosing NK cell activity than using K562 feeder cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Endocrinology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

NK 세포의 활성화를 위해 유전적으로 조작된 세포에 관한 것으로, 일 양상에 따른 NK 세포의 활성화를 위해 유전적으로 조작된 세포에 의하면 시료로부터 NK 세포의 증식 및 활성화를 상승적으로 유도할 수 있어, NK 세포를 증식하는 방법, 또는 그에 의해 증식된 NK 세포, 또는 NK 세포 활성도를 측정하는 방법, 또는 NK 세포 활성 관련 질환을 진단하는 방법에 유용하게 사용될 수 있는 효과가 있다.

Description

NK 세포의 활성화 및 증폭을 위해 유전적으로 조작된 세포주, 및 그의 용도
본 출원은 2020년 6월 9일 출원된 대한민국 특허출원 제 10-2020-0069854호 및 2021년 4월 8일 출원된 대한민국 특허출원 제 10-2021-0046106호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
NK 세포의 활성화 및 증폭을 위해 유전적으로 조작된 세포주, 및 그의 용도, 구체적으로, 그를 이용한 NK 세포를 증식하는 방법, 또는 그를 이용한 NK 세포의 활성도를 측정하는 방법에 관한 것이다.
NK 세포(natural killer cell)는 선천적 면역에 중요한 세포독성 림프구의 한 종류이다. NK 세포는 바이러스 감염된 세포나 암세포에 반응하는데, 이들 반응은 NK 세포의 여러 활성 수용체(activating receptor)와 억제 수용체 (inhibitory receptor)가 대상 세포가 갖는 각각의 리간드(ligand)와 반응하여 내는 시그널(signal)에 의해 좌우된다. 통상적으로 활성시그널이 억제 시그널 보다 강하면 NK 세포는 대상 세포를 공격할 수 있지만, 억제시그널이 더 강하면 공격하지 않는다. 따라서, 정상세포는 NK 세포의 억제 수용체 리간드(MHC, major histocompatibility complex)가 존재하여 억제시그널을 내므로 NK 세포에게 공격당하지 않는다.
암세포 중 일부는 세포 표면에 MHC의 이상이 발생하여 감소할 수 있다. 이러한 경우에는 NK 세포의 억제시그널이 없어 NK 세포가 대상 세포를 공격하게 된다. 퍼포린(perforin)을 분비해 감염 세포나 암세포의 세포막에 구멍을 내고, 여기에 그랜자임(granzyme)을 내어 이 세포들을 사멸시키는 세포독성을 갖는다. B 세포 림프종 및 많은 암환자의 경우 NK 세포의 수나 항암활성에 결함이 발견되고 있으며 NK 세포의 기능 이상은 이러한 암의 발생과 밀접한 관련을 가지고 있음이 알려져 있다.
따라서, 이러한 NK 세포의 항암력을 활용한 암 환자의 치료법이 대두되고 있는데, 고 성능의 많은 NK 세포를 확보하기 위한 증폭법의 개발이 중요하다. 또한 NK 세포의 기능 저하나 이상이 있는 사람은 암 이나 각종 질환과 연관성이 알려져서 NK세포의 활성도 측정법 개발이 요구되고 있다.
종래 보고된 NK 세포의 증식 방법은 고가의 다양한 사이토카인을 고농도로 이용하거나 말초혈액단핵구나 암세포주를 함께 사용하는 방법들이다. 그런데, 이는 고 비용이 소요될 뿐 아니라 증폭율도 그리 높지 않은 실정이다. 또한, 다수의 연구에서는 NK 세포 외에도 T 세포 등 다른 림프구의 증폭이 동반되어 나타나, NK 세포 기반의 면역 세포 치료에 부적합한 면을 보이기도 한다. 따라서, NK 세포만을 선택적으로 증폭하기 위한 효율적인 방법에 대한 개발이 주요한 과제의 대상이 되고 있고, 이에 대한 연구가 이루어지고 있으나 (한국등록특허 10-1525199), 아직은 미비한 실정이다.
한편, NK 세포의 활성도 검사법 중 세포독성능(cytotoxicity) 검사는 표적 암세포(K562 세포주)를 직접 살해하는 기능을 보는 검사법으로 현재 임상 검사실에서 사용되고 있다. 최근 복잡한 세포분리과정이 필요한 말초혈액단핵구 대신 세포분리과정이 불필요한 전혈을 사용한 세포독성능 검사가 소개되고 있다. 다만, 전혈을 사용할 경우에는 여러 종류의 사이토카인이 필요한데, 검사 비용이 증가하는 문제점이 대두되어 극복이 필요한 실정이다.
일 양상은 막 결합성 인터루킨-18(membrane bound interleukin-18: mbIL-18), 및 막 결합성 인터루킨-21(membrane bound interleukin-21: mbIL-21) 을 발현하도록 유전적으로 조작된 세포주, 또는 배양보조세포(feeder cell)를 제공하는 것이다.
또 다른 양상은 혼합된 NK 세포의 집단(mixed immune cells)을 함유하는 혈액 시료를 수득하는 단계; 및 상기 NK 세포의 집단의 적어도 일부분을 NK 세포를 활성화하기 위해 유전적으로 조작된 세포와 접촉시키는 단계로서, 상기 유전적으로 조작된 세포는 막 결합성 인터루킨-18(membrane bound interleukin-18: mbIL-18), 및 막 결합성 인터루킨-21(membrane bound interleukin-21: mbIL-21) 을 발현하도록 유전적으로 조작된 것인 단계를 포함하는, NK 세포를 증식시키는 방법을 제공하는 것이다.
또 다른 양상은 혼합된 NK 세포의 집단을 함유하는 혈액 시료를 수득하는 단계; 상기 혼합된 NK 세포의 집단의 적어도 일부분을 NK 세포를 활성화하기 위해 유전적으로 조작된 세포와 접촉시켜 NK 세포를 활성화시키는 단계로서, 상기 유전적으로 조작된 세포는 막 결합성 인터루킨-18(membrane bound interleukin-18: mbIL-18), 및 막 결합성 인터루킨-21(membrane bound interleukin-21: mbIL-21) 을 발현하도록 유전적으로 조작된 것인 단계; 및 상기 활성화된 NK 세포의 활성화 정도를 분석하는 단계를 포함하는 NK 세포의 활성도를 검사하는 방법을 제공하는 것이다.
또 다른 양상은, 혼한됩 NK 세포의 집단을 함유하는 혈액 시료를 수득하는 단계; 상기 혼합된 NK 세포의 집단의 적어도 일부분을 NK 세포를 활성화하기 위해 유전적으로 조작된 세포와 접촉시켜 NK 세포를 활성화시키는 단계로서, 상기 유전적으로 조작된 세포는 막 결합성 인터루킨-18(membrane bound interleukin-18: mbIL-18), 및 막 결합성 인터루킨-21(membrane bound interleukin-21: mbIL-21)을 발현하도록 유전적으로 조작된 것인 단계; 및 상기 활성화된 NK 세포의 활성화 정도를 분석하는 단계를 포함하는 NK 세포 관련 질환을 진단하는 방법 또는 진단에 관한 정보를 제공하는 방법을 제공하는 것이다.
일 양상은 막 결합성 인터루킨-18(membrane bound interleukin-18: mbIL-18), 및 막 결합성 인터루킨-21(membrane bound interleukin-21: mbIL-21)을 발현하도록 유전적으로 조작된 세포주를 제공한다.
상기 세포주는 NK 세포만을 선택적으로 증폭하게 하는 배양보조세포로 사용될 수 있다. 일반적으로, NK 세포 증식에 사용되는 대표적인 영양보조세포인 K562 세포주는 NK 세포의 증식을 위해 사용될 뿐이므로 K562 세포주 자체가 증식 해서는 안된다. 따라서, NK 세포와 배양하기 전, 상기 K562 세포주에 강력한 방사선(예를 들어, 50~100 Gy)의 조사를 통한 전처리를 수행하여 상기 K562 세포주 자체는 전혀 증식하지 않고, NK 세포의 증식만을 돕도록 한다. 한편, NK 세포의 효율적인 증식을 위해서는 IL-2, IL-15 등과 같은 대부분의 사이토카인이 NK 세포에 지속적으로 노출되어야 한다. 따라서, 암 세포주 기반 영양보조세포에 IL-2 및/또는 IL-15 등과 같은 사이토카인을 발현하도록 유전적으로 조작하는 경우, 방사선 조사 등으로 전처리한 암 세포주 자체가 배양 과정에서 장시간 생존할 수 없는 바 NK 세포의 선택적 증식 효율이 떨어진다는 문제점이 있다. 일 실시예에서는, K562 의 존재 하에 NK 세포를 IL-18 또는 IL-21로 단기간 노출하였을 경우, 21일 째까지 세포 증폭 효과가 나타나지 않았으나 IL-18 및 IL-21로 동시에 노출하였을 경우, 28일 이후 세포 증폭 효과가 나타나는 것을 확인하였다. 따라서, IL-18 및 IL-21의 경우, 배양 시작 일에 단 한번의 노출 및 단기간 노출에도 불구하고 NK 세포의 증식에 효과가 있음을 알 수 있다. 즉, 일 양상에 따른 mbIL-18 및 mbIL-21을 발현하도록 유전적으로 조작된 배양보조세포주는 IL-18 및 IL-21의 단기간 발현에도 불구하고 NK 세포 증식 효율이 감소되지 않는 바, NK 세포만을 선택적으로 증폭시킬 수 있다.
본 명세서에서 사용되는 용어, “배양보조세포 (feeder cells, 지지세포라고도 한다)”는 방사선 조사에 의해 분열 증식하는 능력은 없지만 대사 활성이 있기 때문에 여러 가지 대사물질을 생산하여 목적 NK 세포의 증식을 돕는 세포를 의미할 수 있다. 본 명세서에서 사용될 수 있는 배양보조세포로는 유전자가 도입된 동물 세포주(cell line)로서, 인간만성골수백혈병세포주(예를 들어, K562 세포), RPMI8866, EBV_LCL, 721.221, HFWT, NK-92 등인 것일 수 있다.
본 명세서에서 용어 "유전적 조작 (genetic engineering)" 또는 "유전적으로 조작된 (genetically engineered)"은 세포에 대하여 하나 이상의 유전적 변형 (genetic modification)을 도입하는 행위 또는 그에 의하여 만들어진 세포를 의미한다.
상세하게는 상기 유전적으로 조작된 세포는 상기 언급된 유전자를 코딩하는 외인성 유전자 (exogenous gene)를 포함하는 것일 수 있다. 용어 "외인성 (exogenous)"은 언급된 분자 (referenced molecule) 또는 언급된 활성 (referenced activity)이 숙주 세포로 도입된 것을 의미한다. 분자는 예를 들면, 숙주 염색체 내로의 삽입에 의하는 것과 같은 코딩 핵산 (encoding nucleic acid)의 숙주 유전 물질 내로의 도입 또는 플라스미드와 같은 비염색체 유전물질로서 도입될 수 있다. 코딩 핵산의 발현과 관련하여, 상기 용어 "외인성"은 상기 코딩 핵산이 개체 내로 발현 가능한 형태로 도입된 것을 나타낸다. 생합성 활성과 관련하여, 상기 용어 "외인성"은 숙주 모세포에 도입된 활성을 나타낸다. 그 기원 (source)은 예를 들면, 숙주 모세포에 도입된 후 언급된 활성을 발현하는 동질성 (homologous) 또는 이질성 (heterologous) 코딩 핵산일 수 있다. 그러므로, 용어 "내인성 (endogenous)"은 상기 숙주 세포에 존재하는 언급된 분자 또는 활성을 나타낸다. 비슷하게, 코딩 핵산의 발현과 관련하여, 상기 용어 "내인성"은 개체 내에 포함된 코딩 핵산의 발현을 나타낸다. 용어 "이질성 (heterologous)"은 언급된 종 외의 다른 기원으로부터의 분자 또는 활성을 나타내고 용어 "동질성 (homologous)"은 숙주 모세포로부터의 분자 또는 활성을 나타낸다. 따라서, 코딩 핵산의 외인성 발현은 이질성 (heterologous) 또는 동질성 (homologous) 코딩 핵산 중 어느 하나 또는 둘 다를 이용할 수 있다.
따라서, 상기 세포는 mbIL-18, 및 mbIL-21을 암호화하는 핵산을 포함하는 것일 수 있다. 더욱 상세하게는 상기 세포는 mbIL-18, 및 mbIL-21을 암호화하는 핵산을 포함하는 벡터로 형질 전환된 것일 수 있다.
본 명세서에서 사용되는 용어, "벡터"는 적당한 숙주세포에서 목적 단백질을 발현할 수 있는 벡터로서, 유전자 삽입물이 발현되도록 작동 가능하게 연결된 조절 요소를 포함하는 유전자 작제물을 지칭한다. 일 실시예에 따른 벡터는 프로모터, 오퍼레이터, 개시코돈, 종결코돈, 폴리아데닐화 시그널, 및/또는 인핸서와 같은 발현 조절 요소를 포함할 수 있으며, 벡터의 프로모터는 구성적 또는 유도성일 수 있다. 또한, 상기 벡터는, 숙주 세포 내에서 안정적으로 상기 융합 단백질을 발현시킬 수 있는, 발현용 벡터일 수 있다. 상기 발현용 벡터는 당업계에서 식물, 동물 또는 미생물에서 외래의 단백질을 발현하는 데 사용되는 통상의 것을 사용할 수 있다. 상기 재조합 벡터는 당업계에 공지된 다양한 방법을 통해 구축될 수 있다. 예를 들어, 상기 벡터는 벡터를 함유 하는 숙주세포를 선택하기 위한 선택성 마커를 포함하고, 복제 가능한 벡터인 경우, 복제 기원을 포함할 수 있다. 또한, 벡터는 자가 복제하거나 숙주 DNA에 도입될 수 있으며, 상기 벡터는 플라스미드, 렌티바이러스, 아데노바이러스, 아데노-관련 바이러스, 레트로바이러스, 헤르페스 심플렉스 바이러스, 및 배시니아 바이러스로 구성되는 군으로부터 선택되는 것일 수 있다.
또한, 상기 벡터에서, 전술한 융합 단백질을 암호화하는 폴리뉴클레오티드 서열은 프로모터에 작동 가능하게 연결되어 있을 수 있다. 본 명세서에서 사용된 용어, "작동 가능하게 연결된"은 핵산 발현 조절 서열(예: 프로모터, 시그널 서열, 또는 전사조절인자 결합 위치의 어레이)과 다른 핵산 서열사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절 서열은 상기 다른 핵산 서열의 전사 및/또는 번역을 조절하게 된다.
본 명세서에서 "막 결합성 인터루킨(membrane bound interleukin)"은 세포막에 결합된 인터루킨을 의미하는 것으로, 세포 외로 인터루킨을 분비하는 것과는 구분되는 의미일 수 있다. mbIL-18은 서열번호 1의 핵산 서열 또는 그의 아미노산 서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 것일 수 있다. mbIL-21은 서열번호 2의 핵산 서열 또는 그의 아미노산 서열과 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 것일 수 있다.
다른 양상은 막 결합성 인터루킨-18(membrane bound interleukin-18: mbIL-18), 및 막 결합성 인터루킨-21(membrane bound interleukin-21: mbIL-21)을 발현하도록 유전적으로 조작된 세포를 포함하는 NK 세포 배양용 조성물을 제공한다.
상기 유전적으로 조작된 세포의 구체적인 내용은 전술한 바와 같다.
일 구체예에 따른 mbIL-18, 및 mbIL-21을 발현하도록 유전적으로 조작된 세포를 포함하는 NK 세포 배양용 조성물은 NK 세포(예를 들면, 자연살해세포)의 증폭 및/또는 활성화를 유도할 수 있어 NK 세포의 배양, 분리, 또는 증식 등에 유용하게 사용될 수 있다.
또 다른 양상은 혼합된 NK 세포(mixed immune cells)의 집단을 함유하는 혈액 시료를 수득하는 단계; 및 상기 혼합된 NK 세포의 집단의 적어도 일부분을 NK 세포를 활성화하기 위해 유전적으로 조작된 세포와 접촉시키는 단계로서, 상기 유전적으로 조작된 세포는 막 결합성 인터루킨-18(membrane bound interleukin-18: mbIL-18), 및 막 결합성 인터루킨-21(membrane bound interleukin-21: mbIL-21)을 발현하도록 유전적으로 조작된 것인 단계를 포함하는, NK 세포를 증식시키는 방법을 제공한다.
일 구체예에 있어서, 상기 접촉시키는 단계는 상기 유전적으로 조작된 세포와 혼합된 NK 세포의 집단을 공배양하여 상기 NK 세포의 서브 집단(subpopulation)을 자극, 활성화 또는 증폭(expanding)시키는 것인 단계를 포함하는 것일 수 있다.
본 명세서에서 용어 "NK 세포의 자극"은 시험관 내 또는 생체 내에서 자연살해세포의 활성, 예를 들면, 세포독성 활성을 증가시키거나, 활성화된 자연살해세포가 생성, 증가, 증폭, 또는 증식되는 것을 의미할 수 있다.
일 구체예에 있어서, 상기 NK 세포의 비-제한적 예에는 대식세포, B 림프구, T 림프구, 비만 세포, 단핵구, 수지상 세포, 호산구, 자연 살해 세포, 호염기구, 호중구가 포함된다. 따라서, 특정 구체예들에서, 상기 NK 세포는, 대식세포, B 림프구, T 림프구(CD8+ CTL), 비만 세포, 단핵구, 수지상 세포, 호산구, 자연살해세포, 호염기구, 또는 호중구로 이루어진 군으로부터 선택된 어느 하나인 것일 수 있다. 특정 구체예에서, NK 세포는 자연살해세포 또는 T 림프구일 수 있다. 상기 혼합된 NK 세포는 대식세포, B 림프구, T 림프구, 비만 세포, 단핵구, 수지상 세포, 호산구, 자연살해세포, 호염기구, 및 호중구로 이루어진 군으로부터 선택된 하나 이상을 포함하는 것일 수 있다.
본 명세서에서 용어 "자연살해세포(Natural Killer cells)" 또는 "NK 세포"는 선천성 면역계의 주요 성분을 구성하는 세포독성 림프구로서, 대형과립림프구(large granular lymphocyte, LGL)로 정의되고 림프계 전구세포(common lymphoid progenitor, CLP) 생성 B 및 T 림프구로부터 분화된 제3의 세포를 구성한다. 상기 "자연살해세포" 또는 "NK 세포"는 임의의 조직 공급원(source)으로부터 유래된 추가적인 변형이 없는 자연살해세포를 포함하고, 성숙한 자연살해세포뿐 아니라, 자연살해 전구세포를 포함할 수 있다. 상기 자연살해세포는 인터페론 또는 대식세포-유래 사이토카인에 대한 반응으로 활성화되고, 자연살해 세포는 "활성화 수용체" 및 "억제성 수용체"로 표지되는, 세포의 세포 독성 활성을 제어하는 2가지 유형의 표면 수용체를 포함한다. 자연살해세포는 임의의 공급원, 예를 들어 태반 조직, 태반 관류액, 제대혈, 태반혈, 말초혈, 지라, 간 등으로부터의 조혈 세포, 예를 들어 조혈 줄기 또는 전구체로부터 생성될 수 있다.
일 구체예에 있어서, 상기 자연살해세포는 활성화된 자연살해세포 일 수 있다. 상기 활성화된 자연살해세포는 모세포, 예를 들면, 조혈 세포, 또는 자연살해전구세포에 비해, 세포 독성, 또는 자연살해세포의 본연의 면역조절능이 활성화된 세포를 의미할 수 있다.
일 구체예에 있어서, 활성화된 자연살해세포 또는 활성화된 자연살해세포가 풍부한(enriched) 집단은 1종 이상의 기능적으로 관련된 마커, 예를 들어 CD16, CD57, CD69, CD94, CD161, CD158a, CD158b, NKp30, NKp44, NKp46, DNAM-1, 2B4, NKp46, CD94, KIR(예를 들어, KIR2DL1, KIR2DL2/3, KIR3DL1), 및 활성화 수용체의 NKG2 패밀리(예를 들어, NKG2A, NKG2C, NKG2D)를 검출함으로써 평가될 수 있다.
일 구체예에 있어서, 상기 공배양은 사이토카인의 존재 하에서 이루어지는 것일 수 있다.
본 명세서에서 사용되는 용어, "사이토카인"은 세포 신호전달의 역할을 하는 단백질 (~5-20 kDa)을 의미할 수 있다. 사이토카인은 세포에 의해 방출되고 사이토카인을 방출하는 세포들 및/또는 다른 세포들의 거동에 영향을 준다. 사이토카인의 비-제한적 예들에는 케모카인, 인터페론, 인터루킨, 림포카인, 종양 괴사 인자, 모노카인, 및 콜로니 자극 인자들이 포함된다. 사이토카인은 면역 세포 들, 가령, 대식세포, B 림프구들, T 림프구들, 비만 세포 및 단핵구, 내피 세포, 섬유모세포 및 간질 세포들을 비롯한 (그러나 이에 제한되는 것은 아님) 광범위한 세포들에 의해 생성될 수 있다. 사이토카인은 하나 이상의 유형의 세포에 의해 생성될 수 있다. 사이토카인은 수용체들을 통해 작용하며 면역계에서 특히 중요하고, 체액성 및 세포계 면역 반응들 사이의 균형을 조절하며, 세포 집단의 성숙, 성장 및 반응성 (responsiveness)을 조절한다. 본 명세서의 사이토카인은 자연 발생 사이토카인일 수 있거나 또는 자연 발생 사이토카인의 돌연변이 버전일 수 있다. 본 출원에서 사용되는, "자연 발생"은 또한 야생형으로도 지칭될 수 있으며, 대립유전자 변종들을 포함한다. 자연 발생 사이토카인의 돌연변이된 버전 또는 "돌연변이"는 사이토카인의 기능, 활성 및/또는 특이성을 변화시키기 위하여 자연 발생 서열에 대해 이루어진 특정 돌연변이들을 지칭한다. 한 구체예에서, 돌연변이들은 사이토카인의 기능, 활성 및/또는 특이성을 향상시킬 수 있다. 또 다른 구체예에서, 돌연변이들은 사이토카인의 기능, 활성 및/또는 특이성을 감소시킬 수 있다. 돌연변이는 사이토카인의 하나 이상의 아미노산 잔기들의 결실 또는 부가를 포함할 수 있다.
상기 사이토카인은 BMP (Bone morphogenetic protein) 패밀리, CCL (Cheomkine ligands) 패밀리, CMTM (CKLF-like MARVEL transmembrane domain containing member) 패밀리, CXCL (C-X-C motif ligand ligand) 패밀리, GDF (Growth/differentiation factor) 패밀리, 성장 호르몬, IFN (Interferon) 패밀리, IL (Interleukin) 패밀리, TNF (Tumor necrosis factors) 패밀리, GPI(glycophosphatidylinositol), SLUPR-1(Secreted Ly-6/uPAR-Related Protein 1), SLUPR-2(Secreted Ly-6/uPAR-Related Protein 2) 및 이들의 조합으로 구성된 군으로부터 선택되는 어느 하나일 수 있다.
일 구체예에 있어서, 상기 사이토카인은 인터루킨 또는 이의 돌연변이이다. 다수의 인터루킨들은 보조 CD4 T 림프구들, 뿐만 아니라 단핵구, 대식세포, 및 내피 세포에 의해 합성된다. 인터루킨들은 T 및 B 림프구들 및 조혈 세포들의 발달 및 분화를 촉진시킬 수 있다. 인터루킨들의 비-제한적 예들에는 IL1, IL2, IL3, IL4, IL5, IL6, IL7, IL8 (CXCL8), IL9, IL10, IL11, IL12, IL13, IL14, IL15, IL16, IL17, IL18, IL19, IL20, IL21, IL22, IL23, IL24, IL25, IL26, IL27, IL28, IL29, IL30, IL31, IL32, IL33, IL35, 또는 IL36이 포함된다. 그러므로, 특정 구체예들에서, 상기 사이토카인은 IL1, IL2, IL3, IL4, IL5, IL6, IL7, IL8 (CXCL8), IL9, IL10, IL11, IL12, IL13, IL14, IL15, IL16, IL17, IL18, IL19, IL20, IL21, IL22, IL23, IL24, IL25, IL26, IL27, IL28, IL29, IL30, IL31, IL32, IL33, IL35, 또는 IL36의 야생형 및 돌연변이 형태들을 비롯한 (그러나 이에 제한되는 것은 아니다) 인터루킨 또는 이의 돌연변이이다.
다른 구체예에 있어서, 상기 공배양에 첨가되는 사이토카인은 IL-18 및 IL-21일 수 있다. 더욱 상세하게는, 상기 공배양은 IL-2 및 IL-15의 존재 하에서 배양하면서, IL-18 및 IL-21을 배양 배지에 첨가하는 것을 포함할 수 있다. 상기 IL-21은 1 내지 20 ng/㎖, 1 내지 15 ng/㎖, 1 내지 10 ng/㎖, 또는 2 내지 8 ng/㎖의 농도로 사용될 수 있다. 상기 IL-18은 10 내지 200 ng/㎖, 10 내지 180 ng/㎖, 20 내지 160 ng/㎖, 20 내지 120 ng/㎖, 20 내지 40 ng/㎖, 20 내지 80 ng/㎖, 40 내지 160 ng/㎖, 40 내지 120 ng/㎖, 40 내지 80 ng/㎖, 80 내지 160 ng/㎖, 또는 80 내지 120 ng/㎖의 농도로 사용될 수 있다. 일 구체예에 있어서, 공배양시 상기 IL-18 및 IL-21에 세포를 노출시킴으로써, NK 세포의 증식을 더욱 상승적으로 증가시킬 수 있다.
일 구체예에 있어서, 상기 공배양은 2일 내지 30일 동안 수행되는 것일 수 있다.
일 구체예에 있어서, 상기 유전적으로 조작된 세포는 50 Gy 내지 300 Gy 방사선 처리된 것일 수 있다.
일 구체예에 있어서, 상기 시료는 개체, 예를 들면, 인간을 포함한 포유류 등으로부터 유래된 생물학적 시료일 수 있다. 또한, 상기 생물학적 시료는 개체로부터 분리된 것일 수 있으며, 혈액, 전혈, 혈청, 혈장, 림프액, 소변, 분변, 조직, 세포, 기관, 골수, 타액, 객담, 뇌척수액 또는 그들의 조합일 수 있다. 또한 상기 생물학적 시료는 PBMC, 정제된 NK 세포 또는 일차성 휴지기의 세포(primary resting cell) (즉, 혈액에서 바로 분리한)를 포함하는 것일 수 있다.
또 다른 양상은 혼합된 NK 세포의 집단을 함유하는 혈액 시료를 수득하는 단계; 상기 혼합된 NK 세포의 집단의 적어도 일부분을 NK 세포를 활성화하기 위해 유전적으로 조작된 세포와 접촉시켜 NK 세포를 활성화시키는 단계로서, 상기 유전적으로 조작된 세포는 막 결합성 인터루킨-18(membrane bound interleukin-18: mbIL-18), 및 막 결합성 인터루킨-21(membrane bound interleukin-21: mbIL-21)을 발현하도록 유전적으로 조작된 것인 단계; 및 상기 활성화된 NK 세포의 활성화 정도를 분석하는 단계를 포함하는 NK 세포의 활성도를 검사하는 방법을 제공한다.
또 다른 양상은, 혼합된 NK 세포의 집단을 함유하는 혈액 시료를 수득하는 단계; 상기 혼합된 NK 세포의 집단의 적어도 일부분을 NK 세포를 활성화하기 위해 유전적으로 조작된 세포와 접촉시켜 NK 세포를 활성화시키는 단계로서, 상기 유전적으로 조작된 세포는 막 결합성 인터루킨-18(membrane bound interleukin-18: mbIL-18), 및 막 결합성 인터루킨-21(membrane bound interleukin-21: mbIL-21)을 발현하도록 유전적으로 조작된 것인 단계; 및 상기 활성화된 NK 세포의 활성화 정도를 분석하는 단계를 포함하는 NK 세포 관련 질환을 진단하는 방법 또는 진단에 관한 정보를 제공하는 방법을 제공한다.
본 발명의 NK 세포의 활성도를 검사하는 방법에서, 정상 NK 세포 대비 상기 NK 세포의 활성화를 비교하는 단계는, 구체적으로 정상적인 NK 세포를 대조군으로 실험군과 동등한 조건에서 상기 언급된 유전적으로 조작된 세포로 자극하였을 때, 정상적인 NK 세포에서 나타나는 활성화 현상이 실험군에서 현저하게 높거나, 나타나지 않거나 그 정도가 현저하게 적은 경우 비정상으로 판단하는 것을 포함한다. 상기 단계에 의하여 비정상적인 NK 세포와 관련한 질환의 병리학적 징후, 바이러스 감염, 암 세포의 존재, 및 특정 암을 판단하고 상기 질병들에 대해 예후 예측 할 수 있다. 상기 "정상 NK 세포"는 질병을 갖지 않는 개체가 갖는 또는 그러한 개체로부터 유래된 NK 세포를 말하며, 상기 질병을 갖지 않는 개체는 적어도 NK 세포 활성에 영향을 미치는 것이라 알려진 신체적, 유전적, 또는 외래적 조건을 갖지 않는다.
일 구체예에서, 상기 방법은 상기 시료 중 필요로 하는 NK 세포를 분리하는 단계를 더 포함할 수 있다. 필요에 따라 다른 혈구 또는 림프구와 함께 존재하는 중에 자극 후 상기 단계가 이루어질 수 있고, 림프구로서 NK 세포만을 포함하는 시료로 하기 위해 상기 단계가 이루어진 후 상기 자극하는 단계가 이루어질 수 있다. 분리된 NK 세포의 정제도 및 그 시료의 구성은 실험에 필요한 정도로 다양할 수 있다. NK 세포는 필요에 따라 시료에서 정제된 그대로를 사용할 수 있고, 실험에 적합한 조건 또는 세포량을 확보하기 위하여 증식시킨 후 사용할 수 있다.
그러나, 특정 인자의 조합의 경우 NK 세포에 특이적이므로, 본 발명의 방법에서 상기 NK 세포에 특이적인 인자의 조합을 이용하는 경우, 상기 NK 세포를 분리하는 단계는 필수적이지 않을 수 있다.
일 구체예에서, 상기 활성화 정도를 측정하는 단계는 탈과립화(degranulation) 활성, 세포독성(cytotoxicity) 활성 및 NK 세포 자극에 의해 분비된 사이토카인의 측정 중 선택된 하나 이상을 포함하는 것일 수 있다.
상기 탈과립화 활성은 예를 들어, 퍼포린(perforin) 또는 그랜자임(granzyme) 분비로 표적 세포의 용해를 유도하는 것을 의미할 수 있고, 이를 FACS를 이용해 분석할 수 있다. 구체적으로, 전혈 시료에서 분리한 PBMC 혹은 순수 분리된 NK 세포를 자극한 후, 탈과립화와 비례하는 CD107a 발현을 플루오로크롬-접합된 항체를 이용하여 측정하는 방법을 이용할 수 있다.
상기 세포독성 활성은 예를 들어, 유로피움(europium) 형광 염료로 표지된 NK 세포를 활성화시킬 수 있는 표적 세포를 포함하는 배양물과 배양한 후, 표적 세포 용해를 통해 배출된 형광 염료의 양을 마이크로플레이트 리더(microplate reader)를 이용하여 측정할 수 있다.
일 구체예에서, 상기 사이토카인은 IFN-γ, TNF-α, TNF-β, MIP-1α, MIP-1βPANTES, IL-8 및 IL-10 중 선택되는 것일 수 있다. 상기와 같은 NK 세포의 면역활성인자 발현 분석은 FACS, 세포 내 시토킨 염색 또는 ELISA 등을 이용하여 이루어질 수 있다. 구체적으로 플루오로크롬-접합된 특정 항체를 이용하여 NK 세포 표면을 염색한 후 세포를 투과성화(permeabilization)하고 플로오로크롬-접합된 다른 특정 면역활성인자(예를 들어, IFN-γ항체로 상기 사이토카인 등을 염색하여 NK 세포 내의 면역활성인자의 발현을 측정하는 방법을 이용할 수 있다.
일 구체예에서, 상기 NK 세포의 활성과 관련된 질환은 비정상적인 NK 세포의 활성도를 보이는 것으로서, 예를 들어, 과민성 면역질환, 자가면역질환, 면역거부반응, 면역결핍질환, 조직구증, 암, 2형 당뇨병, 기생충 감염 질환 및 바이러스 질환일 수 있다. 상기 과민성 면역질환은 천식 및 축농증 중 선택된 하나 이상의 것이거나, 상기 자가면역질환은 루푸스, 다발성 경화증(multiple sclerosis), 1형 당뇨병 및 류마티스 관절염 중 선택된 하나 이상의 것이거나, 또는 상기 조직구증은 HLH, XLP1, 및 XLP2에서 선택된 어느 하나 이상의 것일 수 있다. 혈구탐식성 림프조직구증(HLH)은 제 2군 랑게르한스 세포 조직구증, 적혈구탐식성 림프조직구증식증 (가족성, 산발성), 감염연관성 혈구탐식증후군, 바이러스 연관성 혈구탐식증후군, 거대한 림프절병증을 동반한 조직구증, 또는 망상조직구증의 의미를 포함할 수 있다. 상기 "암"은 종양, 혈액암 또는 고형암을 포함하는 의미으로서, 개체의 NK 세포의 시너지 활성을 손상시키거나 또는 특정 조건에서 표적 세포로서 NK 세포의 시너지 활성을 일으키지 않는 것을 포함한다. 일 구체예에서, 상기 암은 폐암, 간암, 식도암, 위암, 대장암, 소장암, 췌장암, 흑색종, 유방암, 구강암, 뇌종양, 갑상선암, 부갑상선암, 신장암, 자궁경부암, 육종, 전립선암, 요도암, 방광암, 고환암, 혈액암, 림프종, 피부암, 건선 및 섬유선종으로 이루어진 군에서 선택된 것일 수 있다. 일 구체예에서, 상기 암은 췌장암 또는 B 세포 림프종(B cell lymphoma)일 수 있다. 일 구체예에서, 상기 바이러스 질환은 B형 간염일 수 있다. 일 구체예에서, 상기 면역결핍질환은 디조지증후군(DiGeorge synderome) 또는 체디악히가시증후군(Chedial-Higashi syndrome)일 수 있다.
상기 NK 세포 활성 관련 질환에 대한 정보는, 정상 NK 세포 대비 실험군 NK 세포의 활성화가 검출되지 않는 경우 비정상적인 NK 세포로 판단할 수 있고, 또는 특정 수용체에 대해 활성을 상실한 NK 세포가 표적 세포에 대해 비정상적으로 활성을 일으키거나 일으키지 않는 경우 상기 표적 세포가 특정한 질병과 관련이 있음을 판단할 수 있다.
또 다른 양상은 상기 NK 세포의 증식 방법에 의해 제조된 NK 세포를 제공한다.
또 다른 양상은 상기 면역세포 또는 그의 세포 집단을 유효성분으로 포함하는 세포치료제를 제공한다.
또 다른 양상은 상기 면역세포 또는 그의 세포 집단을 유효성분으로 암 또는 감염성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또 다른 양상은 상기 면역세포 또는 그의 세포 집단을 의약의 제조에 사용하기 위한 용도를 제공한다.
또 다른 양상은 상기 면역세포 또는 그의 세포 집단을 개체에 투여하는 단계를 포함하는 질환 치료 방법을 제공한다.
본 명세서에서 있어서 용어 "질환"은 하나의 병리적 상태, 특히 암, 감염성 질환, 염증성 질환, 대사성 질환, 자가면역성 장애, 퇴행성 질환, 세포사멸 관련 질환 및 이식편 거부를 의미할 수 있다.
본 명세서에서 용어 "치료"는 질환, 장애 또는 병태, 또는 그의 하나 이상의 증상의 경감, 진행 억제 또는 예방을 지칭하거나, 그를 포함하며, "유효성분" 또는 "약제학적 유효량"은 질환, 장애 또는 병태, 또는 그의 하나 이상의 증상의 경감, 진행 억제 또는 예방에 충분한 본원에서 제공되는 발명을 실시하는 과정에서 이용되는 조성물의 임의의 양을 의미할 수 있다.
본 명세서에서 용어, "투여하는," "도입하는" 및 "이식하는"은 상호교환적으로 사용되고 일 구체예에 따른 조성물의 원하는 부위로의 적어도 부분적 국소화를 초래하는 방법 또는 경로에 의한 개체내로의 일 구체예에 따른 조성물의 배치를 의미할 수 있다. 일 구체예에 따른 조성물의 세포 또는 세포 성분의 적어도 일부를 생존하는 개체 내에서 원하는 위치로 전달하는 임의의 적절한 경로에 의해 투여될 수 있다. 개체 투여 후 세포의 생존 기간은 짧으면 수 시간, 예를 들면 24시간 내지 수일 내지 길면 수년일 수 있다.
본 명세서에서 용어 "분리된 세포", 예컨대, "분리된 면역세포" 등은 세포가 기원하는 조직, 예컨대, 조혈 세포로부터 실질적으로 분리된 세포를 의미한다.
일 구체예에 약학적 조성물의 투여방법은 특별히 제한되는 것은 아니나, 목적하는 방법에 따라 정맥내, 피하, 복강 내, 흡입 또는 국소적용과 같이 비경구 투여하거나 경구 투여할 수 있다. 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가 다양하다. 일일 투여량은 치료를 필요로 하는 개체에 투여됨으로서 경감된 질병 상태에 대한 치료에 충분한 일 양상에 따른 치료용 물질의 양을 의미한다. 치료용 물질의 효과적인 양은 특정 화합물, 질병 상태 및 그의 심각도, 치료를 필요로 하는 개체에 따라 달라지며, 이는 당업자에 의해 통상적으로 결정될 수 있다. 비제한적 예로서, 일 양상에 따른 조성물의 인체에 대한 투여량은 환자의 나이, 몸무게, 성별, 투여 형태, 건강 상태 및 질환 정도에 따라 달라질 수 있다. 몸무게가 70 ㎏인 성인 환자를 기준으로 할 때 예를 들어 약 1,000~10,000 세포/회, 1,000~100,000세포/회, 1,000~1000,000 세포/회, 1,000~10,000,000, 1,000~100,000,000 세포/회, 1,000~1,000,000,000세포/회, 1,000~10,000,000,000 세포/회로, 일정시간 간격으로 1일 1회 내지 수회에 분할 투여할 수도 있고, 일정 시간 간격으로 여러 번 투여할 수 있다.
'개체'란 질환의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로 인간 또는 비-인간인 영장류, 생쥐(mouse), 쥐(rat), 개, 고양이, 말 및 소 등의 포유류를 의미한다.
일 구체예에 따른 약학적 조성물은 약학적으로 허용가능한 담체 및/또는 첨가물을 포함할 수 있다. 예를 들어, 멸균수, 생리식염수, 관용의 완충제(인산, 구연산, 그 밖의 유기산 등), 안정제, 염, 산화방지제(아스코르브산 등), 계면활성제, 현탁제, 등장화제, 또는 보존제 등을 포함할 수 있다. 국소 투여를 위해, 생체고분자(biopolymer) 등의 유기물, 하이드록시아파타이트 등의 무기물, 구체적으로는 콜라겐 매트릭스, 폴리락트산 중합체 또는 공중합체, 폴리에틸렌글리콜 중합체 또는 공중합체 및 그의 화학적 유도체 등과 조합시키는 것도 포함할 수 있다. 일 구체예에 따른 약학적 조성물이 주사에 적당한 제형으로 조제되는 경우에는, 면역세포, 면역세포, 또는 그의 활성을 증가시키는 물질은 약학적으로 허용가능한 담체 중에 용해되어 있거나 또는 용해되어 있는 용액상태로 동결된 것일 수 있다.
일 구체예에 따른 약학적 조성물은 그 투여방법이나 제형에 따라 필요한 경우, 현탁제, 용해보조제, 안정화제, 등장화제, 보존제, 흡착방지제, 계면활성화제, 희석제, 부형제, pH 조정제, 무통화제, 완충제, 환원제, 산화방지제 등을 적절히 포함할 수 있다. 상기에 예시된 것들을 비롯하여 본 발명에 적합한 약학적으로 허용되는 담체 및 제제는 문헌[Remington's Pharmaceutical Sciences, 19th ed., 1995]에 상세히 기재되어 있다. 일 구체예에 따른 약학적 조성물은 당해 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질 중의 용액, 현탁액 또는 유화액 형태이거나 분말, 과립, 정제 또는 캡슐 형태일 수 있다.
일 양상에 따른 유전적으로 조작된 세포에 의하면, 유전적으로 조작되지 않은 세포이 비해, NK 세포의 증식 및 활성을 적어도 2배 내지 수배 증가시킬 수 있는바, NK 세포를 증식시켜 세포 치료제로 사용할 수 있다.
도 1a는 일 양상에 따른 배양보조세포에서 mbIL-18 및 mbIL-21의 발현 특성을 확인한 그래프이다.
도 1a는 일 양상에 따른 배양보조세포를 제조하기 위하여 mbIL-18 및 mbIL-21을 생산하는 렌티바이러스의 유전자를 나타낸 모식도이다.
도 1b는 일 양상에 따른 배양보조세포에서 mbIL-18 및 mbIL-21의 발현 특성을 확인한 그래프이다.
도 2a는 일 양상에 따른 배양보조세포 및 NK 세포를 완전 RPMI 1640 배지에서 배양하였을 때, NK 세포의 Fold expansion(좌) 및 순도(우)를 나타낸 그래프이다.
도 2b는 일 양상에 따른 배양보조세포 및 NK 세포를 DS 배지에서 배양하였을 때, NK 세포의 Fold expansion(좌) 및 순도(우)를 나타낸 그래프이다.
도 2c는 일 양상에 따른 배양보조세포 및 NK 세포를 완전 RPMI 1640 배지 및 DS 배지에서 배양하였을 때, NK 세포의 Fold expansion(좌) 및 순도(우)를 비교한 그래프이다.
도 3a 및 도 3b는 RPMI 1640 배지 및 DS 배지에서 일 양상에 따른 배양보조세포(파란색) 및 K562 배양보조세포(붉은색)를 이용하여 NK 세포를 증폭시킨 후, 상기 증폭된 NK 세포에서 발현하는 마커를 비교한 그래프이다.
도 4a는 일 양상에 따른 배양보조세포를 이용하여 증폭된 정상인 공여자(HD) NK 세포의 세포 독성을 확인한 그래프이다.
도 4b는 일 양상에 따른 배양보조세포를 이용하여 증폭된 정상인 공여자(HD) NK 세포의 ADCC 세포 독성을 확인한 그래프이다.
도 5a 및 도 5b는 일 양상에 따른 배양보조세포에 의해 자극된 NK 세포의 CD107a 발현을 측정한 그래프이다.
도 5c 및 도 5d는 일 양상에 따른 배양보조세포에 의해 자극된 NK 세포의 표적세포 용해율을 측정한 그래프이다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. 유전적으로 조작된 배양보조세포(Feeder cell)의 제조
막 결합성 인터루킨-18(membrane bound interleukin-18: mbIL-18), 및 막 결합성 인터루킨-21(membrane bound interleukin-21: mbIL-21)을 발현하는 배양보조 세포를 제조하였다.
구체적으로, 인간 유래 mbIL18 유전자(서열번호 1) 및 mbIL21 유전자(서열번호 2)를 렌티바이러스 벡터인 pCDH-CMV-RFP에 클로닝하여 재조합 렌티바이러스 생산용 벡터를 제작하였다(도 1a). 이후, 바이러스 생산을 위해 상기 제작된 재조합 유전자 (pCDH-CMV-RFP-mbIL-1821)를 293FT 세포에 패키징 벡터와 함께 lipofectamin3000 (Invitrogen)을 이용하여 형질주입 시켰다. 시간이 지난 뒤, 새로운 배지로 교환하여 48 시간 동안 세포를 배양 한 후, 바이러스가 함유된 배지를 회수하였다. 회수된 배지는 500 × g에서 10 분간 원심분리하고, 0.45 ㎛ 필터를 이용하여 바이러스가 함유된 순수한 배지만을 분리하여 mbIL18-mbIL21 발현 렌티바이러스를 생산하였다. 이후, K562 세포를 포함하는 배지 9 ㎖에 mbIL18-mbIL21 발현 렌티바이러스 1 ㎖를 녹여 폴리브렌(polybrene) (8 ㎍/ml)과 함께 첨가하여, 48 시간 동안 세포 배양을 진행하였다. 다음으로, 감염된 세포만 선별하기 위해서, 초고속유세포자동분리기를 이용하여 적색 형광을 발현하는 세포만 선별하였고, mbIL18-mbIL21의 발현 여부를 유세포분석기 (FACS)를 통해 분석하여, mbIL18-mbIL21이 발현된 K562 세포주(이하, "K562-mbIL18-mbIL21")를 생산하였다.
[실험예]
실험예 1. 유전적으로 조작된 배양보조세포의 세포 특성
일 양상에 따른 유전적으로 조작된 배양보조세포의 mbIL-18 및 mbIL-21 발현 특성을 확인하기 위하여, mRNA 및 표면 단백질 발현 수준을 확인하였다.
구체적으로, 상기 실시예 1에서 제조한 K562-mbIL18-mbIL21 세포주 및 K562 배양보조세포주의 총 RNA를 RNeasy Mini Kit (Qiagen, Venlo, Netherlands)를 사용하여 분리하고 IMPLEN Nanophotometer P330 (IMPLEN, Munich, Germany)을 사용하여 정량화하였다. 이후, 분리된 RNA를 QuantiTect Reverse Transcription Kit (Qiagen)를 사용하여 cDNA로 전환한 후, QuantiTect SYBR Green PCR Kit (Qiagen) 및 Rotor-Gene Q (Qiagen)를 사용하여 표준 20 ㎕ 반응 부피로 PCR을 수행하였다. 이때, 프라이머는 하기 표 1을 사용하였고, 모든 실험을 3회 반복 실시하였다.
유전자 방향 프라이머 서열 (5' to 3') Accession No.
IL-18 Forward CATTGACCAAGGAAATCGGC NM_001562
Reverse CACAGAGATAGTTACAGCCATACC
IL-21 Forward AAGCTGAAGAGGAAACCACC NM_021803
Reverse TCTTTCTAGGAATTCTTTGGGTGG
GAPDH Forward ACATCGCTCAGACACCATG NM_002046
Reverse TGTAGTTGAGGTCAATGAAGGG
도 1b는 일 양상에 따른 배양보조세포에서 mbIL-18 및 mbIL-21의 발현 특성을 확인한 그래프이다.
그 결과, 도 1b에 나타낸 바와 같이, 실시예 1의 배양보조세포에서는 mbIL-18 및 mbIL-21 mRNA가 검출되었으나, K562 배양보조세포에서는 mbIL-18 및 mbIL-21 mRNA가 검출되지 않았다. 즉, 일 구체예에 따라 유전적으로 조작된 배양보조세 포는 mbIL-18 및 mbIL-21의 발현 특성을 가지는 것을 알 수 있다.
실험예 2. K562-mbIL18-mbIL21 세포에 의한 NK 세포의 활성화 및 증폭
일 양상에 따른 유전적으로 조작된 배양보조세포의 배지에 따른 NK 세포 활성화 및 증폭을 확인하였다.
2-1. 완전 RPMI 1640 배지
구체적으로, 상기 실시예 1에서 제조한 K562-mbIL18-mbIL21 세포주를 5 % CO2가 공급된 배양기에서 37 ℃의 25 ㎖의 완전 RPMI 1640 배지가 들어있는 T-75 플라스크에서 배양시켰다. 이후, 400 × g 조건 하에서 3 분간 원심 분리를 진행하였고, 5 ㎖의 완전 RPMI 1640 배지에서 세포 펠릿을 재부유시켜 배양보조세포 (feeder cell)를 수확하였다. 이후에, 상기 배양보조세포의 과도한 성장을 방지하기 위해서, 상기 배양보조세포에 Gammacell 3000 Elan 방사기를 이용하여 100 Gy로 감마선을 조사하여 이후 실험에 사용하였다.
말초혈액단핵구 (PBMCs)의 분리를 위해서, 정상인 공여자의 전혈 : PBS를 1:2 비율 (10 ㎖ 전혈 : 20 ㎖ PBS)로 희석하여, 15 ㎖ Lymphoprep상에서 오버레이 하였다. 다음으로, 상온에서 25 분 동안 1200 × g 조건으로 브레이크 없이 원심 분리를 진행 (가속 1, 감속 0)하고, 연막층 (buffy coat layer)에서 세포를 수확하고, 7분 동안 400 × g에서 PBS로 세 번 세척하였다. 상기 분리된 말초혈액단핵구 3 × 106 개 및 100 Gy-조사된 K562-mbIL18-mbIL21 0.5 × 106 개를 1 ㎖ NK 세포 배지가 포함된 24 웰 플레이트 상에 접종한 후, 20 U/㎖ IL-2가 함유된 1 ㎖ NK 세포 배지를 추가하여 총 배지 부피는 2 ㎖/well, IL-2의 최종 농도는 10 U/㎖로 한 뒤, 부드럽게 pipetting 하여 혼합시킨 후, 37 ℃ 5 % CO2 배양기에서 배양하였다. 배양 7 일째에 배지에 100 U/㎖로의 IL-2 및 5 ng/㎖의 IL-15를 배지에 첨가하였고, 새로운 배지로 2-3일마다 교체하면서, 14일 동안 배양하였다. 대조군으로는 K562 세포를 사용하였다.
NK 세포의 증폭은 FITC (Fluorescein isothiocyanate)-접합 마우스 항-인간 CD 3 및 PE-Cy5-접합 마우스 항-인간 CD 56 모노클로날 항체를 사용하여 확인하였고, K562 세포와 IL-2/IL-15 처리하였을 때의 NK 세포의 순도를 baseline으로 하여 각각의 Fold expansion을 확인하였다.
도 2a는 일 양상에 따른 배양보조세포 및 NK 세포를 완전 RPMI 1640 배지에서 배양하였을 때, NK 세포의 Fold expansion(좌) 및 순도(우)를 나타낸 그래프이다.
그 결과, 도 2a에 나타낸 바와 같이, K562 배양보조세포의 경우, NK 세포가 배양 후 35일 째까지 증가하였으나, 이후 더 이상의 증폭이 일어나지 않는 것을 확인할 수 있었다. 반면, 실시예 1의 배양보조세포의 경우, NK 세포의 Fold expansion이 42일째까지 증가하는 양상을 나타내는 것을 확인할 수 있었다. 또한, K562 배양보조세포를 이용하여 배양한 NK 세포와 비교하여 실시예 1의 배양보조세포를 이용하여 배양한 NK 세포의 순도가 유의적으로 높은 것을 확인할 수 있었다. 즉, 일 양상에 따른 배양보조세포는 NK 세포의 활성을 현저하게 증가시킬 뿐만 아니라, NK 세포의 장기 배양이 가능하므로, NK 세포를 대양 증식하여 세포 치료제로 사용할 수 있다.
2-2. DS (DMEM + Supplements) 배지
DMEM 배양 배지에 글루코스 4.5 g/L, 글루타민 584 mg/L이 보충된 Miller group 에서 발표한 DS media (JOURNAL OF HEMATOTHERAPY 4:149-158 (1995))를 사용하였다는 점을 제외하고는 상기 실험예 2-1과 동일한 방법으로 수행하였다.
도 2b는 일 양상에 따른 배양보조세포 및 NK 세포를 DS 배지에서 배양하였을 때, NK 세포의 Fold expansion(좌) 및 순도(우)를 나타낸 그래프이다.
그 결과, 도 2b에 나타낸 바와 같이, 실시예 1의 배양보조세포 및 비교예 1의 세포 모두 42일째까지 NK 세포의 Fold expansion이 증가하는 것을 확인할 수 있었다. 그러나, 비교예 1의 세포에 비해 실시예 1의 배양보조세포에서, NK 세포의 Fold expansion이 약 2배 내지 6배 이상 현저하기 증가하는 것을 확인할 수 있었다. 또한, K562 배양보조세포를 이용하여 배양한 NK 세포와 비교하여 실시예 1의 배양보조세포를 이용하여 배양한 NK 세포의 순도가 유의적으로 높은 것을 확인할 수 있었다.
상기의 결과를 바탕으로, RPMI 1640 배지 및 DS 배지에서의 NK 증폭 효율을 비교하였다.
도 2c는 일 양상에 따른 배양보조세포 및 NK 세포를 완전 RPMI 1640 배지 및 DS 배지에서 배양하였을 때, NK 세포의 Fold expansion(좌) 및 순도(우)를 비교한 그래프이다.
그 결과, 도 2c에 나타낸 바와 같이, 배지의 종류에 관계 없이 실시예 1의 세포는 K562 배양보조세포에 비해 NK 세포의 Fold expansion 및 순도가 증가한 것을 확인할 수 있었다. 그러나, 상이한 배지에서 배양한 동일한 세포를 비교하였을 때, 실시예 1의 세포는 완전 RPMI 1640 배지에 비해 DS 배지에서 NK 세포의 Fold expansion이 현저하게 높은 것을 확인할 수 있었다. 즉, 일 양상에 따른 배양보조세포는 배지의 종류에 따라 NK 세포를 선택적으로 증폭시킬 수 있는바, 배지 선택적 특징을 가질 수 있다. .
실험예 3. K562-mbIL18-mbIL21 세포에 의해 증폭된 NK 세포의 표현형 특성
RPMI 1640 배지 및 DS 배지에서 K562-mbIL18-mbIL2 세포에 의해 증폭된 NK 세포의 표현형 특성을 확인하였다.
구체적으로, 말초혈액단핵구 (PBMCs)의 분리를 위해서, 정상인 공여자의 전혈 : PBS를 1:2 비율 (10 ㎖ 전혈 : 20 ㎖ PBS)로 희석하여, 15 ㎖ Lymphoprep상에서 오버레이 하였다. 다음으로, 상온에서 25 분 동안 1200 × g 조건으로 브레이크 없이 원심 분리를 진행 (가속 1, 감속 0)하고, 연막층 (buffy coat layer)에서 세포를 수확하고, 7분 동안 400 × g에서 PBS로 세 번 세척하였다. 이후, 증폭된 정상인 공여자 유래 NK 세포 2 × 105 개를 FACS 버퍼(FBS 1% 포함 PBS)로 세척한 후, APC-Cyanine7-접합 마우스 항-인간 CD3 및 PE-Cyanine7-접합 항-인간 CD56 멤브레인 항체로 15분간 처리하였다. 이후, 세포를 수득하고 각각 다른 형광-접합된 항-인간 CD16, CD67, CD69, NK2G2A, NK2G2C, NKG2D, DNAM-1, NKp30, NKp46, KIR2DL1, KIR2DL2/3 및 KIR3DL1 멤브레인 항체로 30분 동안 추가 염색하였다. 이후, 상기 세포를 FACS 버퍼로 세척한 뒤, FACS Calibur를 이용하여 데이터를 획득하고 Kaluza로 분석하였다.
도 3a 및 도 3b는 RPMI 1640 배지 및 DS 배지에서 일 양상에 따른 배양보조세포(파란색) 및 K562 배양보조세포(붉은색)를 이용하여 NK 세포를 증폭시킨 후, 상기 증폭된 NK 세포에서 발현하는 마커를 비교한 그래프이다.
그 결과, 도 3a 및 도 3b에 나타낸 바와 같이, 일 양상에 따른 배양보조세포를 이용하여 증폭된 NK 세포에서 CD16, CD67, CD69, NK2G2A, NK2G2C, NKG2D, DNAM-1, NKp30, NKp46, KIR2DL1, KIR2DL2/3 및 KIR3DL1와 같은 표면 마커가 발현되는 것을 확인할 수 있었다.
즉, 일 양상에 따른 배양보조세포에 의해 증폭된 NK 세포는 NK 세포의 완전한 기능적 특성을 가지는 것을 알 수 있다.
실험예 4. K562-mbIL18-mbIL21 세포에 의해 증폭된 NK 세포의 세포 독성 확인
일 양상에 따른 배양보조세포에 의해 증폭된 NK 세포의 항체 치료제로서의 효능을 확인하기 위하여 표적 세포에 대한 NK 세포의 14일 째 세포 독성을 CFSE-기반 분석에 의해 4시간 동안 측정하였다.
구체적으로, 표적 세포를 FACS 버퍼에 첨가한 후, 37℃에서 10분 동안 0.5 μM CFSE로 염색하고, 완전 배지(RPMI 또는 DS)로 2회 세척하였다. 이후, 표적 세포 5 × 104 개를 96-웰 둥근 바닥 플레이트에 3중으로 배치하고 상기 실험예 3의 정상인 공여자(HD) 유래 NK 세포와 effector-to-target (E:T)의 비율 0.5:1, 1:1 및 2:1가 되도록 혼합하였다. 플레이트를 1,500 rpm에서 3분 동안 원심분리한 후 37℃, 5% CO2 배양기에서 4시간 동안 배양하였다. 이후, 혼합된 세포를 FACS 튜브로 옮기고 각각의 튜브에 1 ㎕의 1 mg/mL PI(propidium iodide) (Sigma Aldrich, St. Louis, MO, USA)를 첨가하였다. 이후, FACS Calibur에서 세포를 획득하고, Kaluza 소프트웨어를 사용하여 분석하였다. 죽은 표적 세포의 백분율(CFSF-양성 및 PI-양성)은 자발적으로 죽은 표적 세포의 백분율을 뺀 후 계산하였다.
도 4a는 일 양상에 따른 배양보조세포를 이용하여 증폭된 정상인 공여자(HD) NK 세포의 세포 독성을 확인한 그래프이다.
도 4b는 일 양상에 따른 배양보조세포를 이용하여 증폭된 정상인 공여자(HD) NK 세포의 ADCC 세포 독성을 확인한 그래프이다.
그 결과, 도 4a에 나타낸 바와 같이, 실시예 1의 배양보조세포를 이용하여 증폭된 NK 세포는 K562 배양보조세포를 이용하여 증폭된 NK 세포와 동일한 세포 독성을 나타내는 것을 확인할 수 있었다. 또한, DS 배지에서 배양된 NK 세포의 세포 독성은 RPMI 배지에서 배양된 NK 세포와 동일한 세포 독성을 나타내는 것을 확인할 수 있었다. 또한, 도 4b에 나타낸 바와 같이, 실시예 1의 배양보조세포를 이용하여 증폭된 NK 세포는 K562 배양보조세포를 이용하여 증폭된 NK 세포와 Rituximab에 결합된 Raji 세포에서 유사한 ADCC 활성을 나타내는 것을 확인할 수 있었다. 또한, DS 배지에서 배양된 NK 세포의 ADCC는 RPMI 배지에서 배양된 NK 세포와 유사한 ADCC 활성을 나타내는 것을 확인할 수 있었다. 즉, 일 양상에 따른 배양보조세포에 의해 증폭된 NK 세포는 세포 독성을 나타냄에 따라 항체 치료제로 활용 가능하다.
실험예 5. K562-mbIL18-mbIL21 세포에 의해 자극된 NK 세포의 활성도 확인
5-1. CD107a 발현에 의한 탈과립 활성 확인
일 양상에 따른 유전적으로 조작된 배양보조세포에 의해 자극된 NK 세포의 전혈에서의 세포 활성도를 확인하기 위하여 탈과립화와 비례하는 NK 세포 표면에서의 CD107a 발현 정도를 측정하였다. 구체적으로, 상기 실험예 3의 정상인 공여자(HD) 전혈 100 ㎕, K562 배양조보세포 또는 실시예 1에서 제조한 K562-mbIL18-mbIL21 배양보조세포주 2 × 105개 및 PE-접합된 항-인간 CD107a를 FACS 튜브에서 배양하였다. 1시간 후, Monensin 및 brefeldin A (BD Biosciences)를 추가하여 4시간 동안 추가로 배양하였다. 이후, NK 세포를 항-인간 CD3 및 CD56 항체로 염색하여 수득하고, CD107a 발현을 측정하였다.
도 5a 및 도 5b는 일 양상에 따른 배양보조세포에 의해 자극된 NK 세포의 CD107a 발현을 측정한 그래프이다.
그 결과, 도 5a에 나타낸 바와 같이, 실시예 1의 배양보조세포에 의해 자극된 NK 세포는 IL-2의 농도 의존적으로 CD107a 발현이 증가하는 것을 확인할 수 있었다. 구체적으로, 도 5b에 나타낸 바와 같이, 실시예 1의 배양보조세포에 의해 자극된 NK 세포는 K562 배양보조세포에 의해 자극된 NK 세포와 비교하여 동일한 IL-2의 농도에서 CD107a 발현이 유의적으로 높은 것을 확인할 수 있었다.
즉, 일 양상에 따른 배양보조세포를 이용한 NK 세포 활성화는 K562 배양보조세포를 사용하는 것보다 NK 세포 활성도 진단 방법으로서 더 유용하게 사용될 수 있다.
5-2. 세포 용해(cell lysis)에 의한 세포 독성 확인
일 양상에 따른 유전적으로 조작된 배양보조세포에 의해 자극된 NK 세포의 전혈에서의 세포 활성도를 확인하기 위하여 표적 세포의 세포 독성을 CFSE-기반 분석에 의해 16~20시간 동안 측정하였다. 구체적으로, 표적 세포(K562 배양보조세포 또는 실시예 1의 배양보조세포)를 FACS 버퍼에 첨가한 후, 37℃에서 10분 동안 0.5 μM CFSE로 염색하고, 완전 배지(RPMI 또는 DS)로 2회 세척하였다. 이후, 표적 세포 5 × 104 개를 FACS 튜브에 3중으로 배치하고 IL-2가 첨가된 완전 배지와 상기 정상인 공여자(HD) 전혈을 volume 비율 200ul, 100ul, 50ul을 혼합하였다. FACS 튜브를 37℃, 5% CO2 배양기에서 16~20시간 동안 배양하였다. 이후, 혼합된 세포를 FACS 튜브로 옮기고 각각의 튜브에 1 ㎕의 1 mg/mL PI(propidium iodide) (SigmaAldrich, St. Louis, MO, USA)를 첨가하였다. 이후, FACS Calibur에서 세포를 획득하고, Kaluza 소프트웨어를 사용하여 분석하였다. 죽은 표적 세포의 백분율(CFSF-양성 및 PI-양성)은 자발적으로 죽은 표적 세포의 백분율을 뺀 후 계산하였다.
도 5c 및 도 5d는 일 양상에 따른 배양보조세포에 의해 자극된 NK 세포의 표적세포 용해율을 측정한 그래프이다.
그 결과, 도 5c에 나타낸 바와 같이, 실시예 1의 배양보조세포에 의해 자극된 NK 세포는 IL-2의 농도 의존적으로 표적 세포 용해율이 증가하는 것을 확인할 수 있었다. 구체적으로, 도 5d에 나타낸 바와 같이, 실시예 1의 배양보조세포에 의해 자극된 NK 세포는 K562 배양보조세포에 의해 자극된 NK 세포와 비교하여 동일한 IL-2의 농도에서 표적 세포 용해율이 유의적으로 높은 것을 확인할 수 있었다.
즉, 일 양상에 따른 배양보조세포를 이용한 NK 세포 활성화는 K562 배양보조세포를 사용하는 것보다 NK 세포 활성도 진단 방법으로서 더 유용하게 사용될 수 있다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.

Claims (15)

  1. 막 결합성 인터루킨-18(membrane bound interleukin-18: mbIL-18), 및 막 결합성 인터루킨-21(membrane bound interleukin-21: mbIL-21)을 발현하도록 유전적으로 조작된 NK 세포의 배양을 위한 배양보조세포.
  2. 청구항 1에 있어서, 상기 배양보조세포는 K562, RPMI8866, EBV_LCL, 721.221, HFWT, 및 NK-92세포로 구성된 군에서 선택되는 것인 배양보조세포.
  3. 청구항 1에 있어서, 막 결합성 인터루킨-21 및 막 결합성 인터루킨-21를 암호화하는 핵산을 포함하는 것인 배양보조세포.
  4. 청구항 1 내지 3 중 어느 한 항의 배양보조세포를 포함하는 NK 세포 배양용 조성물.
  5. NK 세포의 집단을 함유하는 혈액 시료를 수득하는 단계; 및
    상기 NK 세포의 집단의 적어도 일부분을 NK 세포를 활성화하기 위해 유전적으로 조작된 세포와 접촉시키는 단계로서, 상기 유전적으로 조작된 세포는 막 결합성 인터루킨-18(membrane bound interleukin-18: mbIL-18), 및 막 결합성 인터루킨-21(membrane bound interleukin-21: mbIL-21) 을 발현하도록 유전적으로 조작된 것인 단계를 포함하는, NK 세포를 증식시키는 방법.
  6. 청구항 5에 있어서, 상기 접촉시키는 단계는 상기 유전적으로 조작된 세포와 NK 세포의 집단을 공배양하여 상기 NK 세포의 서브 집단(subpopulation)을 증폭(expanding)시키는 것인 단계를 포함하는 것인 방법.
  7. 청구항 6에 있어서, 상기 공배양은 사이토카인의 존재 하에서 이루어지는 것인 방법.
  8. 청구항 7에 있어서, 상기 사이토카인은 IL1, IL2, IL3, IL4, IL5, IL6, IL7, IL8 (CXCL8), IL9, IL10, IL11, IL12, IL13, IL14, IL15, IL16, IL17, IL18, IL19, IL20, IL21, IL22, IL23, IL24, IL25, IL26, IL27, IL28, IL29, IL30, IL31, IL32, IL33, IL35, 및 IL36로 이루어진 군으로부터 선택되는 1 종 이상인 것인 방법.
  9. 청구항 8에 있어서, 상기 사이토카인은 IL-18 및 IL-21인 것인 방법.
  10. 청구항 6에 있어서, 상기 공배양은 2일 내지 30일 동안 수행되는 것인 방법.
  11. 청구항 5에 있어서, 상기 혈액 시료는 전혈 시료인 것인 방법.
  12. 청구항 5에 있어서, 상기 유전적으로 조작된 세포는 50 Gy 내지 300 Gy 방사선 처리된 것인 방법.
  13. NK 세포의 집단을 함유하는 혈액 시료를 수득하는 단계;
    상기 NK 세포의 집단의 적어도 일부분을 NK 세포를 활성화하기 위해 유전적으로 조작된 세포와 접촉시켜 NK 세포를 활성화시키는 단계로서, 상기 유전적으로 조작된 세포는 막 결합성 인터루킨-18(membrane bound interleukin-18: mbIL-18), 및 막 결합성 인터루킨-21(membrane bound interleukin-21: mbIL-21) 을 발현하도록 유전적으로 조작된 것인 단계; 및
    상기 활성화된 NK 세포의 활성화 정도를 분석하는 단계를 포함하는 NK 세포의 활성도를 검사하는 방법.
  14. 청구항 13에 있어서, 상기 혈액 시료는 전혈 시료인 것인 방법.
  15. 청구항 13에 있어서, 상기 NK 세포의 활성화 정도를 분석하는 단계는 탈과립화 활성, 세포독성 활성 및 NK 세포 자극에 의해 분비된 사이토카인의 측정 중 선택된 하나 이상을 포함하는 것인 방법.
PCT/KR2021/007092 2020-06-09 2021-06-07 Nk 세포의 활성화 및 증폭을 위해 유전적으로 조작된 세포주, 및 그의 용도 WO2021251708A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US17/996,569 US20230203443A1 (en) 2020-06-09 2021-06-07 Genetically manipulated cell strain for activating and amplifying nk cells and use thereof
JP2022570170A JP2023526804A (ja) 2020-06-09 2021-06-07 Ｎｋ細胞の活性化及び増幅のために遺伝的に操作された細胞株、及びその用途
EP21821487.2A EP4163367A4 (en) 2020-06-09 2021-06-07 GENETICALLY MODIFIED CELL STRAIN TO ACTIVATE AND AMPLIFY NK CELLS AND ITS USE
CN202180030746.5A CN115461451A (zh) 2020-06-09 2021-06-07 用于激活和增幅nk细胞的经基因改造的细胞株以及其用途

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2020-0069854 2020-06-09
KR20200069854 2020-06-09
KR1020210046106A KR102584532B1 (ko) 2020-06-09 2021-04-08 Nk 세포의 활성화 및 증폭을 위해 유전적으로 조작된 세포주, 및 그의 용도
KR10-2021-0046106 2021-04-08

Publications (1)

Publication Number Publication Date
WO2021251708A1 true WO2021251708A1 (ko) 2021-12-16

Family

ID=78846369

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/007092 WO2021251708A1 (ko) 2020-06-09 2021-06-07 Nk 세포의 활성화 및 증폭을 위해 유전적으로 조작된 세포주, 및 그의 용도

Country Status (5)

Country Link
US (1) US20230203443A1 (ko)
EP (1) EP4163367A4 (ko)
JP (1) JP2023526804A (ko)
CN (1) CN115461451A (ko)
WO (1) WO2021251708A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114196628A (zh) * 2021-12-21 2022-03-18 杭州中赢生物医疗科技有限公司 一种nk细胞的培养基及培养方法
RU2803178C1 (ru) * 2022-12-08 2023-09-07 Общество с ограниченной ответственностью "Текон Медицинские приборы" Рекомбинантная клеточная линия TMDK562-15, проявляющая способность к активации и пролиферации ЕК клеток человека

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101684456A (zh) * 2008-09-28 2010-03-31 江门罗森生物制药有限公司 一种体外培养条件下扩增人nk细胞的方法
KR101525199B1 (ko) 2012-09-13 2015-06-04 (주)케이셀바이오 100㎖ 이하 말초혈액으로부터 ｎｋ세포의 대량 증식 방법
CN105838677A (zh) * 2016-05-20 2016-08-10 深圳市科晖瑞生物医药有限公司 一种高效扩增冷冻保存nk细胞的方法及其应用
KR20190133732A (ko) * 2017-03-27 2019-12-03 싱가포르국립대학교 자연 살해 세포의 ex vivo 확장 및 활성화를 위한 자극성 세포주
KR20190135912A (ko) * 2018-05-29 2019-12-09 사회복지법인 삼성생명공익재단 Ox40l을 발현하는 배양보조세포 및 이를 이용한 자연살해세포 배양 방법
KR20200069854A (ko) 2018-12-07 2020-06-17 호남대학교 산학협력단 전기 차량용 듀얼모터 구동 시스템
KR20210046106A (ko) 2019-10-17 2021-04-28 말레동현필터시스템 주식회사 흡기 매니 폴드의 마운팅 장치

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4326944B2 (ja) * 2001-07-19 2009-09-09 イネイト・ファーマ ナチュラルキラー細胞活性に関与する表面分子ｎｔｂ−ａ
HRP20230424T1 (hr) * 2012-06-28 2023-07-07 University Of Central Florida Research Foundation Incorporated Postupci i pripravci za prirodnoubilačke stanice
CN105985931A (zh) * 2016-06-21 2016-10-05 黑龙江天晴干细胞股份有限公司 一种nk细胞体外扩增组合物及nk细胞扩增方法
US12060577B2 (en) * 2017-05-19 2024-08-13 Case Western Reserve University Compositions for expanding natural killer cells
JP7273421B2 (ja) * 2018-02-21 2023-05-15 ボード オブ リージェンツ，ザ ユニバーシティ オブ テキサス システム ナチュラルキラー細胞の活性化および拡大のための方法ならびにその使用
US20220033778A1 (en) * 2018-11-29 2022-02-03 Board Of Regents, The University Of Texas System Methods for ex vivo expansion of natural killer cells and use thereof

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101684456A (zh) * 2008-09-28 2010-03-31 江门罗森生物制药有限公司 一种体外培养条件下扩增人nk细胞的方法
KR101525199B1 (ko) 2012-09-13 2015-06-04 (주)케이셀바이오 100㎖ 이하 말초혈액으로부터 ｎｋ세포의 대량 증식 방법
CN105838677A (zh) * 2016-05-20 2016-08-10 深圳市科晖瑞生物医药有限公司 一种高效扩增冷冻保存nk细胞的方法及其应用
KR20190133732A (ko) * 2017-03-27 2019-12-03 싱가포르국립대학교 자연 살해 세포의 ex vivo 확장 및 활성화를 위한 자극성 세포주
KR20190135912A (ko) * 2018-05-29 2019-12-09 사회복지법인 삼성생명공익재단 Ox40l을 발현하는 배양보조세포 및 이를 이용한 자연살해세포 배양 방법
KR20200069854A (ko) 2018-12-07 2020-06-17 호남대학교 산학협력단 전기 차량용 듀얼모터 구동 시스템
KR20210046106A (ko) 2019-10-17 2021-04-28 말레동현필터시스템 주식회사 흡기 매니 폴드의 마운팅 장치

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
MILLER, JOURNAL OF HEMATOTHERAPY, vol. 4, 1995, pages 149 - 158
See also references of EP4163367A4
SOONHO KWEON, PHAN MINH-TRANG THI, CHUN SEJONG, YU HONGBI, KIM JINHO, KIM SEOKHO, LEE JAEMIN, ALI ALAA KASSIM, LEE SEUNG-HWAN, KIM: "Expansion of Human NK Cells Using K562 Cells Expressing OX40 Ligand and Short Exposure to IL-21", FRONTIERS IN IMMUNOLOGY, vol. 10, 1 January 2019 (2019-01-01), pages 1 - 12, XP055657781, DOI: 10.3389/fimmu.2019.00879 *
THANGARAJ JAYA LAKSHMI; AHN SEO-YEON; JUNG SUNG-HOON; VO MANH-CUONG; CHU TAN-HUY; THI PHAN MINH-TRANG; KWON MINSUK; LEE KYUNG-HWA;: "Expanded natural killer cells augment the antimyeloma effect of daratumumab, bortezomib, and dexamethasone in a mouse model", CELLULAR & MOLECULAR IMMUNOLOGY, vol. 18, no. 7, 12 May 2021 (2021-05-12), London, pages 1652 - 1661, XP037495111, ISSN: 1672-7681, DOI: 10.1038/s41423-021-00686-9 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114196628A (zh) * 2021-12-21 2022-03-18 杭州中赢生物医疗科技有限公司 一种nk细胞的培养基及培养方法
CN114196628B (zh) * 2021-12-21 2024-03-19 杭州中赢生物医疗科技有限公司 一种nk细胞的培养基及培养方法
RU2803178C1 (ru) * 2022-12-08 2023-09-07 Общество с ограниченной ответственностью "Текон Медицинские приборы" Рекомбинантная клеточная линия TMDK562-15, проявляющая способность к активации и пролиферации ЕК клеток человека

Also Published As

Publication number Publication date
EP4163367A4 (en) 2024-06-26
US20230203443A1 (en) 2023-06-29
JP2023526804A (ja) 2023-06-23
CN115461451A (zh) 2022-12-09
EP4163367A1 (en) 2023-04-12

Similar Documents

Publication Publication Date Title
KR102584532B1 (ko) Nk 세포의 활성화 및 증폭을 위해 유전적으로 조작된 세포주, 및 그의 용도
KR102236011B1 (ko) Nk 세포의 대량증식 배양방법
CN114958738A (zh) 用于生产TCRγδ+T细胞的方法
WO2012030057A2 (ko) 자기활성화 림프구 배양용 배지 조성물 및 이를 이용한 자기활성화 림프구 배양방법
WO2021251707A1 (ko) Nk 세포의 활성화 및 증폭을 위해 유전적으로 조작된 세포주, 및 그의 용도
JP5840876B2 (ja) Ｎｋ細胞を増幅するための組成物及び方法
KR20190135912A (ko) Ox40l을 발현하는 배양보조세포 및 이를 이용한 자연살해세포 배양 방법
EP1233058B1 (en) Method of proliferating natural killer cells
Ishida et al. Expansion of natural killer cells but not T cells in human interleukin 2/interleukin 2 receptor (Tac) transgenic mice.
WO2021251708A1 (ko) Nk 세포의 활성화 및 증폭을 위해 유전적으로 조작된 세포주, 및 그의 용도
Alhaj Hussen et al. CD4+ CD8+ T-lymphocytes in xenogeneic and human graft-versus-host disease
Drakes et al. Colon lamina propria dendritic cells induce a proinflammatory cytokine response in lamina propria T cells in the SCID mouse model of colitis
KR101447546B1 (ko) 제대혈 ｃｄ14 양성 단핵세포로부터 자연살해세포 분화 및 증식 방법
WO2019231243A1 (ko) Ox40l을 발현하는 배양보조세포 및 이를 이용한 자연살해세포 배양 방법
EP4349969A1 (en) Composition containing feeder cell for proliferating natural killer cell
WO2017003153A1 (ko) 제대혈 단핵세포 또는 이로부터 유래된 세포로부터 자연살해세포를 제조하는 방법
WO2023096352A1 (ko) Hla-e를 발현하도록 유전적으로 조작된 배양보조세포주, 및 그의 용도
US20230302130A1 (en) Poly-donor cd4+ t cells expressing il-10 and uses thereof
US20230055186A1 (en) Engineered immune killer cell, preparation method therefor and use thereof
WO2024177425A1 (ko) 제대혈 유래 자연 살해 세포의 확장배양방법
KR20230078501A (ko) Hla-e를 발현하도록 유전적으로 조작된 배양보조세포주, 및 그의 용도
RU2786210C1 (ru) Биомедицинский клеточный продукт со специфической противоопухолевой активностью, представленный популяциями лимфокин-активированных киллеров и анти-HER2 CAR-γδΤ-ОИЛ и анти-HER2 CAR-T-NK
JPWO2005078072A1 (ja) Ｔ細胞免疫活性を調節する制御性細胞
Li et al. Macrophage precursors derived from murine bone marrow develop into B220+ LAK cells under the influence of Interleukin-2: A resemblance of these LAK cells to the reported NK-1.1+ CD3–B220+ LAK subset found in spleen cultures
Zhao et al. Human Cord Blood Stem Cell-Modulated Regulatory T Lymphocytes Reverse the

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21821487

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022570170

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021821487

Country of ref document: EP

Effective date: 20230109