WO2021232099A1 - Oligonucleotides - Google Patents

Oligonucleotides Download PDF

Info

Publication number
WO2021232099A1
WO2021232099A1 PCT/AU2021/050469 AU2021050469W WO2021232099A1 WO 2021232099 A1 WO2021232099 A1 WO 2021232099A1 AU 2021050469 W AU2021050469 W AU 2021050469W WO 2021232099 A1 WO2021232099 A1 WO 2021232099A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
bases
modified
region
continuous
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2021/050469
Other languages
English (en)
French (fr)
Inventor
Michael Paul Marie Gantier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hudson Institute of Medical Research
Original Assignee
Hudson Institute of Medical Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2020901606A external-priority patent/AU2020901606A0/en
Priority to MX2022014495A priority Critical patent/MX2022014495A/es
Priority to AU2021276730A priority patent/AU2021276730A1/en
Priority to JP2022570608A priority patent/JP2023526090A/ja
Priority to BR112022023310A priority patent/BR112022023310A2/pt
Priority to KR1020227044467A priority patent/KR20230013266A/ko
Application filed by Hudson Institute of Medical Research filed Critical Hudson Institute of Medical Research
Priority to EP21807588.5A priority patent/EP4153751A4/en
Priority to US17/926,383 priority patent/US20230348903A1/en
Priority to CN202180049291.1A priority patent/CN115916978A/zh
Priority to CA3171986A priority patent/CA3171986A1/en
Publication of WO2021232099A1 publication Critical patent/WO2021232099A1/en
Anticipated expiration legal-status Critical
Priority to US18/213,116 priority patent/US12448622B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/117Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/17Immunomodulatory nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/335Modified T or U
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/344Position-specific modifications, e.g. on every purine, at the 3'-end
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/11Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/50Methods for regulating/modulating their activity
    • C12N2320/53Methods for regulating/modulating their activity reducing unwanted side-effects
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/30Production chemically synthesised
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to oligonucleotides that maintain a Toll-Like Receptor 7 (TLR7) response and/or which potentiate Toll-Like Receptor 8 (TLR8) sensing.
  • TLR7 Toll-Like Receptor 7
  • TLR8 Toll-Like Receptor 8
  • mRNA messenger RNA
  • RNAse-Hl with antisense oligonucleotides [ASOs] such as inotersen, or volanesorsen
  • Ago2 with small interfering RNAs [siRNAs] such as patisiran, inclisiran or givosiran
  • ASOs antisense oligonucleotides
  • siRNAs small interfering RNAs
  • patisiran, inclisiran or givosiran small interfering RNAs
  • splicing modulation with ASOs such as eteplirsen and nusinersen
  • modifications can either be used to stabilise the phosphodiester (PO) intemucleotide linkages, as seen with the phosphorothioate (PS) backbone modification, or to stabilise the bases with sugar modifications (e.g. with 2’-0-methyl [2’OMe], 2’- methoxyethyl [2’MOE], 2’-fluoro [2’F], or locked nucleic acid [LNA]) (Yin and Rogge, 2019).
  • sugar modifications e.g. with 2’-0-methyl [2’OMe], 2’- methoxyethyl [2’MOE], 2’-fluoro [2’F], or locked nucleic acid [LNA]
  • TLRs Toll-Like-Receptors
  • RAG-I retinoic acid-inducible gene-I
  • NOD-like receptors NOD-like receptors
  • cGAS cyclic-GMP-AMP synthase
  • discrimination between self and non-self nucleic acids by innate immune sensors can be modulated by the presence of nucleic acid modifications rarely encountered in pathogens - as seen with 2’-Omethylated (2’OMe) nucleosides that are 25 times more abundant in human ribosomal RNA than bacterial RNA (Kariko et al., 2005).
  • TLR7 and TLR8 selectively detect RNA molecules and bases analogues (such as imidazoquinolines and nucleoside analogues), and are inhibited by 2’OMe bases, facilitating molecular discrimination between self and non-self RNAs (Kariko et al., 2005).
  • incorporation of select base modifications in therapeutic oligonucleotides is a useful strategy to help mitigate aberrant immune responses by TLR7 and TLR8 (Kariko et al.,2005; Hamm et al., 2010), and is widely applied to therapeutic siRNAs (Coutinho et al., 2019).
  • TLR7 Toll-Like Receptor 7
  • TLR8 Toll-Like Receptor 7
  • TLR7 Toll -Like Receptor 7
  • the present invention provides an oligonucleotide comprising three continuous pyrimidine bases within seven bases of the 5’ and/or 3’ end of the oligonucleotide.
  • the invention relates to an oligonucleotide comprising two continuous cytosine bases at or towards the 5’ end of the oligonucleotide.
  • one or both of the two continuous cytosine bases are modified and/or which have a modified backbone.
  • the oligonucleotide of the above aspects comprises a) a 5 ’ region comprising bases which are modified and/or which have a modified backbone, b) a middle region comprising ribonucleic acid, deoxyribonucleic acid, or combination thereof, bases, and c) a 3 ’ region comprising bases which are modified and/or which have a modified backbone.
  • the present invention provides an oligonucleotide comprising a 5’ region, a 3’ region and a middle region comprising ribonucleic acid, deoxyribonucleic acid, or combination thereof, bases, wherein one or both of the 5’ region and the 3’ region comprise bases which are modified and/or which have a modified backbone, and at least one of the following apply; a) the 5 ’ region comprises three continuous pyrimidine bases which are modified and/or which have a modified backbone, b) the 5’ region comprises bases which are modified and/or which have a modified backbone and the junction between the 5’ region and middle region comprises three continuous pyrimidine bases, c) the 3 ’ region comprises three continuous pyrimidine bases which are modified and/or which have a modified backbone, d) the 3’ region comprises bases which are modified and/or which have a modified backbone and the junction between the 3’ region and middle region comprises three continuous pyrimidine bases, and e) the 5’ region comprises
  • the middle region is about 20, about 15 or about 10 bases in length.
  • the 5’ region and/or the 3’ region are about 7, about 5, or about 3 bases in length.
  • the three continuous pyrimidine bases are at or towards the 5’ and/or 3’ end of the oligonucleotide.
  • Examples of the 5 ’ three continuous pyrimidine bases of the invention include, but are not limited to, those having the sequence 5’-CUU-3’, 5’-CUT-3’, 5’-CCU-3’, 5’- UUC-3’, 5’-UUU-3’ or 5’-CTT-3’.
  • the 5’ three continuous pyrimidine bases comprise the sequence 5’-CUU-3'
  • Examples of the 3 ’ three continuous pyrimidine bases of the invention include, but are not limited to, those having the sequence 5’-UUC-3’, 5’-TUC-3’ 5’-UCC-3’, 5’- CUU-3’, 5’-UUU-3’ or 5’-TTC-3’.
  • the 3’ three continuous pyrimidine bases have the sequence 5’-UUC-3'
  • the 3’ pyrimidine bases have the sequence 5’-CUUC-3'.
  • one, two or all three of the pyrimidine bases are a modified base and/or have a modified backbone.
  • the three continuous pyrimidine bases at the junction have the sequence 5’-mCmUT-3’, 5’-mCTT-3’, 5’-TmUmC-3’ or 5’-TTmC-3’, where m is a modified base and/or has a modified backbone.
  • modified bases useful for the invention include, but are not limited to, those which comprises a 2'-0-methyl, 2'-0-methoxyethoxy, 2'-fluoro, 2'-allyl, 2'-0- [2-(methylamino)-2-oxoethyl], 4'-thio, 4'-CH2-0-2'-bridge, 4'-(CH2)2-0-2'-bridge, 2'- LNA, 2'-amino, fluoroarabinonucleotide, threose nucleic acid or 2'-0 ⁇ (N- methly carbamate).
  • the modified base comprises a 2'-0-methyl, 2'-fluoro, 2'-allyl, 2'-0-[2-(methylamino)-2-oxoethyl], 4'-thio, 4'-CH2-0-2'-bridge, 4'- (CH2)2-0-2'-bridge, 2'-amino, fluoroarabinonucleotide, threose nucleic acid or 2'-0— (N -methly carbamate) .
  • modified backbones useful for the invention include, but are not limited to, those which comprise a phosphorothioate, a non-bridging oxygen atom substituting a sulfur atom, a phosphonate such as a methylphosphonate, a phosphodiester, a phosphoromorpholidate, a phosphoropiperazidate, amides, methylene (methylamino), fromacetal, thioformacetal, a peptide nucleic acid or a phosphoroamidate such as a morpholino phosphorodiamidate (PMO), N3’-P5’ phosphoramidite or thiophosphoroamidite .
  • PMO morpholino phosphorodiamidate
  • the oligonucleotide has/is a ribonucleic acid, deoxyribonucleic acid, DNA phosphorothioate, RNA phosphorothioate, 2'-0- methy 1-oligonucleotide, 2'-0-methyl-oligodeoxyribonucleotide, 2'-0-hydrocarbyl ribonucleic acid, 2'-0-hydrocarbyl DNA, 2'-0-hydrocarbyl RNA phosphorothioate, 2'- 0-hydrocarbyl DNA phosphorothioate, 2'-F-phosphorothioate, 2'-F -phosphodiester, 2'- methoxyethyl phosphorothioate, 2-methoxyethyl phosphodiester, deoxy methylene(methylimino) (deoxy MMI), 2'-0-hydrocarby MMI, deoxy-methylphos- phonate, 2'-
  • the modified base comprises a 2'0-methyl and the oligonucleotide comprises a phosphorothioate backbone.
  • the two continuous cytosine bases comprise a 2’-LNA and a phosphorothioate backbone.
  • one, two or all three of the three continuous pyrimidine bases do not hybridize to a target polynucleotide.
  • one or both of the two continuous cytosine bases do not hybridize to a target polynucleotide.
  • the present invention provides an oligonucleotide comprising i) 5’-CUUGU-3’, 5’-CCUAU-3’, 5’-CAUUA-3’, 5’-CGAAU-3’ 5’-CUUAU-3’, 5’-CUUUA-3’ or 5’ACUGU-3’ at the 5’ end, and ii) 5’-CUUCU-3’ 5’-CAUAU-3’ 5’-CUUCU-3’ 5’-AAUUU-3’ 5’-AAAUU-3’ 5’-CCUUC-3’, 5’-AAUCA-3’ or 5’-CGUCU-3’ at the 3’ end.
  • the oligonucleotide comprises a terminal 5’U. In another embodiment, the oligonucleotide comprises a terminal 5’UC.
  • any one of the following is modified to comprise a 5 ’region, preferably end, and/or a 3 ’region, preferably end, as described above;
  • GUAACCAAGAGUAUUCCAUTT-3 strands of the siR A used to treat polyneuropathy referred to as Patisiran
  • 5 ’ -TCACTTTCATAATGCTGG-3 ’ which is fully 2'-0-methoxyethyl (MOE) modified on a phosphorothioate backbone (antisense oligonucleotide used to treat spinal muscular atrophy referred to as Nusinersen); 5'-XGTTGCCTCCGGTTCTGAAGGTGTTC-3' where bases are linked through a synthetic neutral phosphorodiamidate morpholino oligomer (PMO) backbone and X is hydrophilic triethylene glycol chain (antisense oligonucleotide used to treat Duchenne muscular dystrophy referred to as Golodirsen); or
  • oligonucleotides may have other modifications such as those standard in the art.
  • an oligonucleotide of any of the above aspects does not inhibit Toll -like receptor 7 (TLR7) activity when administered to an animal.
  • the animal is a human.
  • the present invention provides an oligonucleotide comprising one or more modified bases and at least four thymidines, wherein the oligonucleotide potentiates Toll-like receptor 8 (TLR8) activity when administered to an animal.
  • TLR8 Toll-like receptor 8
  • the oligonucleotide comprises a 5’U. In another embodiment, the oligonucleotide comprises a 5’UC.
  • the oligonucleotides comprises: a) a 5’ region at least five bases in length which are modified and/or which have a modified backbone, b) a middle region comprising a stretch of ten bases, wherein at least four of the bases are thymidine, c) a 3’ region at least five bases in length.
  • the at least four thymidine bases are in a continuous stretch.
  • one, two, three or four of the at least four thymidine bases are not in a continuous stretch.
  • the present invention provides an oligonucleotide comprising a) a 5’ region at least five bases in length, wherein the 5’ end consists of terminal 5 ’ -mUmC-3 ’ or terminal 5 ’ -mCmU-3 ’ , where m is a modified base and/or has a modified backbone, b) a middle region comprising a stretch of ten bases, wherein at least two of the bases are thymidine, and c) a 3 ’ region at least five bases in length and/or has a modified backbone, wherein the oligonucleotide potentiates Toll-like receptor 8 (TLR8) activity when administered to an animal (such as a human).
  • TLR8 Toll-like receptor 8
  • an oligonucleotide of the above two aspects is also an oligonucleotide as defined for the other aspects.
  • the oligonucleotide can be any size. Examples of suitable sizes include, but are not limited to at least about 10, at least about 18, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at about least 40, between about 10 and about 50 nucleotides, between about 18 and about 50 nucleotides, between about 18 and about 30 nucleotides, between about 20 and about 30 nucleotides, between about 20 and 1,000 nucleotides, between about 20 and 5,000 nucleotides, or about 20 bases in length.
  • an oligonucleotide of the invention can be used for a variety of purposes.
  • the oligonucleotide is an antisense oligonucleotide such as for hybridizing to a target mRNA to reduce translation thereof.
  • the oligonucleotide is, or forms part of, a stranded oligonucleotide for gene silencing (such as RNA interference).
  • the oligonucleotide is used to potentiate Toll-like receptor 8 (TLR8) activity but does not hybridize to a target RNA.
  • TLR8 Toll-like receptor 8
  • the oligonucleotide is a gapmer antisense oligonucleotide. In an embodiment, one, two or all three of the three continuous pyrimidine bases are removed by an endonuclease in vivo.
  • the antisense oligonucleotide down regulates expression of a gene and potentiates Toll-like receptor 8 (TLR8) activity.
  • TLR8 Toll-like receptor 8
  • the double stranded oligonucleotide for gene silencing is an siRNA or an shR A.
  • the oligonucleotide is between 10 and 16 bases in length and potentiates Toll-like receptor 8 (TLR8) activity when administered to an animal (such as a human).
  • TLR8 Toll-like receptor 8
  • the present invention provides a method for selecting an oligonucleotide for reducing the expression of a target gene, the method comprising i) scanning a target polynucleotide, or complement thereof, for a region with at least three continuous pyrimidine bases; ii) producing one or more candidate oligonucleotides comprising the three continuous pyrimidine bases, wherein one or both of the following apply; a) the candidate oligonucleotide comprises three continuous pyrimidine bases within seven bases of the 5’ end of the oligonucleotide, and b) the candidate oligonucleotide comprises three continuous pyrimidine bases within seven bases of the 3’ end of the oligonucleotide, iii) testing the ability of the one or more candidate oligonucleotides to reduce expression of the target gene, and iv) selecting an oligonucleotide which reduces expression of the target gene.
  • the three continuous pyrimidine bases of a candidate oligonucleotide have a modified base and/or a modified backbone.
  • the present invention provides a method for selecting an oligonucleotide for reducing the expression of a target gene, the method comprising i) scanning a target polynucleotide, or complement thereof, for a region with at least three continuous pyrimidine bases; ii) producing one or more candidate oligonucleotides comprising a 5 ’ region, a 3 ’ region and a middle region comprising ribonucleic acid, deoxyribonucleic acid, or combination thereof, bases, wherein one or both of the 5’ region and the 3’ region comprise bases which are modified and/or which have a modified backbone, and at least one of the following apply; a) the 5’ region comprises three continuous pyrimidine bases which are modified and/or which have a modified backbone, b) the 5’ region comprises bases which are modified and/or which have a modified backbone and the junction between the 5’ region and middle region comprises three continuous pyrimidine bases, c) the 3’ region comprises three continuous pyrimidine
  • the present invention provides a method for selecting an oligonucleotide for reducing the expression of a target gene, the method comprising i) scanning a target polynucleotide, or complement thereof, for a region with one of the following sequences 5’-CUUGU-3’, 5’-CCUAU-3' 5’-CAUUA-3’, 5’-CGAAU- 3’ 5’-CUUAU-3’, 5’-CUUUA-3’, 5’ACUGU-3’, 5’-CUUCU-3’ 5’-CAUAU-3’ 5’- CUUCU-3’ 5’-AAUUU-3’ 5’-AAAUU-3’ 5’-CCUUC-3’, 5’-AAUCA-3’ or 5’- CGUCU-3’, wherein the U may be a T, ii) producing one or more candidate oligonucleotides comprising a) 5’-CUUGU-3’, 5’-CCUAU-3’, 5’-CAUUA-3’
  • the present invention resides in a method for selecting an oligonucleotide for reducing the expression of a target gene, the method comprising i) scanning a target polynucleotide, or complement thereof, for a region with at least two continuous cytosine bases; ii) producing one or more candidate oligonucleotides comprising the two continuous cytosine bases, wherein the candidate oligonucleotide comprises two continuous cytosine bases at or towards the 5 ’ end of the oligonucleotide, iii) testing the ability of the one or more candidate oligonucleotides to reduce expression of the target gene, and iv) selecting an oligonucleotide which reduces expression of the target gene.
  • the two continuous cytosine bases of the oligonucleotide have a modified base and/or a modified backbone.
  • the oligonucleotide comprises: a) a 5 ’ region comprising bases which are modified and/or which have a modified backbone, b) a middle region comprising ribonucleic acid, deoxyribonucleic acid, or combination thereof, bases, and c) a 3 ’ region comprising bases which are modified and/or which have a modified backbone.
  • the 5’ region and/or the 3’ region are about 3 bases in length.
  • the middle region is about 10 bases in length.
  • the invention relates to a method for selecting an oligonucleotide for reducing the expression of a target gene, the method comprising i) scanning a target polynucleotide, or complement thereof, for a region with at least two continuous cytosine bases; ii) producing one or more candidate oligonucleotides comprising a 5 ’ region, a 3 ’ region and a middle region comprising ribonucleic acid, deoxyribonucleic acid, or combination thereof, bases, wherein one or both of the 5’ region and the 3’ region comprise bases which are modified and/or which have a modified backbone, and the 5’ region comprises two continuous cytosine bases which are modified and/or which have a modified backbone, iii) testing the ability of the one or more candidate oligonucleotides to reduce expression of the target gene, and iv) selecting an oligonucleotide which reduces expression of the target gene.
  • the 5’ region and/or the 3’ region are about 3 bases in length.
  • the middle region is about 10 bases in length.
  • one or both of the two continuous cytosine bases are a modified base and/or have a modified backbone.
  • the two continuous cytosine bases comprise a 2’- LNA and a phosphorothioate backbone.
  • the method further comprises testing the ability of the one or more candidate oligonucleotides to inhibit Toll-like receptor 7 (TLR7) activity, and selecting an oligonucleotide which does not inhibit TLR7 activity.
  • TLR7 Toll-like receptor 7
  • the methods of the above aspects are suitably for decreasing the TLR7 inhibitory activity of the oligonucleotide.
  • TLR8 Toll-like receptor 8
  • the present invention provides a method for selecting an oligonucleotide for reducing the expression of a target gene, the method comprising i) scanning a target polynucleotide, or complement thereof, for a region comprising at least four of the bases are thymidine; ii) producing one or more candidate oligonucleotides comprising one or more modified bases and at least four thymidines, iii) testing the ability of the one or more candidate oligonucleotides to reduce expression of the target gene and to potentiate Toll-like receptor 8 (TLR8) activity, and iv) selecting an oligonucleotide which reduces expression of the target gene and which potentiates TLR8 activity.
  • TLR8 Toll-like receptor 8
  • the present invention provides a method for selecting an oligonucleotide which potentiates Toll-like receptor 8 (TLR8) activity, the method comprising i) scanning a target polynucleotide, or complement thereof, for a region with the sequence UC or CU and a stretch of ten bases, wherein at least two of the bases are thymidine; ii) producing one or more candidate oligonucleotides comprising; a) a 5 ’ region at least five bases in length, wherein the 5 ’ end consists of terminal 5’-mUmC-3’ or terminal 5’-mCmU-3’, where m is a modified base and/or has a modified backbone, b) a middle region comprising a stretch of ten bases, wherein at least two of the bases are thymidine, and c) a 3 ’ region at least five bases in length and/or has a modified backbone, iii) testing the ability of the one or more
  • oligonucleotide In some instances it may not be possible to design a suitable oligonucleotide with the required pyrimidine bases. Alternatively, in other instances it may be desirable to improve the functioning of a pre-existing oligonucleotide which lacks the required pyrimidine bases.
  • the present invention provides a method of reducing the Toll-like receptor 7 (TLR7) inhibitory activity of an oligonucleotide, the method comprising modifying the oligonucleotide by adding a sequence of nucleotides to the 5’ and/or 3’ end of the oligonucleotide such that the modified oligonucleotide comprises three continuous pyrimidine bases within seven bases of the 5’ and/or 3’ end of the oligonucleotide.
  • TLR7 Toll-like receptor 7
  • one, two or all three of the pyrimidine bases are a modified base and/or have a modified backbone.
  • the present invention provides a method of reducing the Toll like receptor 7 (TLR7) inhibitory activity of an oligonucleotide, the method comprising modifying the oligonucleotide such that the modified oligonucleotide comprises at least one of the following; a) the 5 ’ region comprises three continuous pyrimidine bases which are modified and/or which have a modified backbone, b) the 5’ region comprises bases which are modified and/or which have a modified backbone and the junction between the 5’ region and middle region comprises three continuous pyrimidine bases, c) the 3 ’ region comprises three continuous pyrimidine bases which are modified and/or which have a modified backbone, and d) the 3’ region comprises bases which are modified and/or which have a modified backbone and the junction between the 3’ region and middle region comprises three continuous pyrimidine bases.
  • TLR7 Toll like receptor 7
  • the three continuous pyrimidine bases are at the 5’ and/or 3’ end of the modified oligonucleotide.
  • the invention provides a method of reducing the Toll-like receptor 7 (TLR7) inhibitory activity of an oligonucleotide, the method comprising modifying the oligonucleotide by adding a sequence of nucleotides to the 5’ end of the oligonucleotide such that the modified oligonucleotide comprises two continuous cytosine bases at or towards the 5’ end of the oligonucleotide.
  • TLR7 Toll-like receptor 7
  • one or both of the two continuous cytosine bases are a modified base and/or have a modified backbone.
  • the invention resides in a method of reducing the Toll-like receptor 7 (TLR7) inhibitory activity of an oligonucleotide, the method comprising modifying the oligonucleotide such that the modified oligonucleotide comprises a 5’ region comprising two continuous cytosine bases which are modified and/or which have a modified backbone.
  • TLR7 Toll-like receptor 7
  • the two continuous cytosine bases are at or towards the 5’ end of the modified oligonucleotide.
  • the two continuous cytosine bases comprise a 2’-LNA and a phosphorothioate backbone.
  • the method further comprises testing the ability of the modified oligonucleotide to inhibit TLR7 activity, and selecting an oligonucleotide which inhibits (TLR7) activity to a lesser extent than the unmodified oligonucleotide.
  • oligonucleotide selected using the method of the invention, or modified using a method of the invention.
  • the present invention resides in an oligonucleotide comprising, consisting of or consisting essentially of a nucleic acid sequence set forth in Tables 1 to 6 or a variant thereof.
  • the present invention provides a composition comprising an oligonucleotide of the invention.
  • the composition further comprises a pharmaceutically acceptable carrier.
  • composition further comprises an immune response modifier.
  • the present invention provides a method of reducing expression of a target gene in a cell, the method comprising contacting the cell with an oligonucleotide of the invention.
  • the present invention provides a method of treating or preventing a disease in a subject, the method comprising administering to the subject an oligonucleotide of the invention, wherein the oligonucleotide reduces the expression of a target gene involved in the disease.
  • the animal has been, or will be, administered with an immune response modifier.
  • the immune response modifier is a Toll-like receptor (TLR) agonist.
  • TLR Toll-like receptor
  • suitable Toll-like receptor (TLR) agonists include, but are not limited to, a base analogue (including: a guanosine analogue, a deaza-adenosine analogue, an imidazoquinoline or a derivative, a hydroxyadenine compound or a derivative, a thiazoloquinolone compound or a derivative, a benzoazepine compound or a derivative), or an RNA molecule.
  • the TLR agonist is Guanosine, Uridine, Resiquimod (R848), Loxoribine, Isatoribine, Imiquimod, CL075, CL097, CL264, CL307, 852A, or TL8-506.
  • an oligonucleotide of the invention in the manufacture of a medicament for treating or preventing a disease in a subject, wherein the oligonucleotide reduces the expression of a target gene involved in the disease.
  • an oligonucleotide of the invention for use in treating or preventing a disease in a subject, wherein the oligonucleotide reduces the expression of a target gene involved in the disease.
  • composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.
  • FIG. 1 ASO-dependent modulation of R848 sensing by TLR7/8.
  • HEK-TLR7 (B) and HEK-TLR8 (C) cells expressing an NF- K B-luciferase reporter were treated with 500 nM indicated ASOs for 50 min prior to stimulation with 1 ⁇ g/ml R848. NF- K B-luciferase levels were measured after overnight incubation. Percentages
  • E, F PBMCs from two blood donors were incubated 20-45 min with 100 nM ASO, and stimulated with 0.5 ⁇ g/ml R848 for 4 h prior to TNF- a ELISA (E), or 24 h prior to IFN-a ELISA (F).
  • G [cGAS]AS02 sequence variants used.
  • the central DNA region is highlighted in light grey.
  • the DNA bases are in black
  • the five 5’ and 3’ bases of AS02, ASOs-Cys3 and ASO-PO are 2’OMe bases
  • the three 5 ’ and 3 ’ bases of AS02-LNA are LNA bases
  • the five 5 ’ and 3 ’ bases of AS02- MOE are 2’MOE bases.
  • Underlined bases are on a PS backbone.
  • H, I HEKTLR7 (H) and HEK-TLR8 (I) cells expressing an NF- K B-luciferase reporter were treated with 500 nM indicated ASOs for 20 min prior to stimulation with 1 ⁇ g/ml R848. NF- K B-luciferase levels were measured after overnight incubation. Percentages (H) or fold increases (I) relative to the condition “R848 without ASO” condition are averaged from three (I) or two (H) independent experiments in biological triplicate ( ⁇ s.e.m and ordinary one-way ANOVA with Dunnett’s multiple comparison tests to the NT condition [H] or the “R848 without ASO” condition [I] are shown). * P ⁇ 0.05, ** P£0.01, *** P ⁇ 0.001, **** P ⁇ 0.0001, ns: non-significant.
  • FIG. 1 Identification of ASOs with low TLR7 inhibition and high TLR8 potentiation.
  • A, B HEK-TLR7 (A) and HEK-TLR8 (B) cells expressing an NF- K B-luciferase reporter were treated with 100 nM or 500 nM indicated ASOs for 20-50 min prior to stimulation with 1 ⁇ g/ml R848. NF- K B-luciferase levels were measured after overnight incubation. Percentages (A) or fold increases (B) relative to the condition “R848 without ASO” are averaged from biological duplicates (averaged data are provided in Table 2).
  • HEK-TLR7 left panels
  • HEK-TLR8 right panels
  • cells expressing an NF- K B-luciferase reporter were treated with increasing ASOs concentrations (4, 20, 100 and 500 nM) (C) or with 500 nM ASOs (D) for 20 min prior to stimulation with 1 ⁇ g/ml R848 (C) or with increasing R848 concentrations (0.0156, 0.031, 0.0620.125, 0.250, 0.5, 1 ⁇ g/ml) (D).
  • NF- K B-luciferase levels were measured after overnight incubation.
  • FIG. 2A Top: sequence alignments of ASOs from the screens on HEK-TLR7 cells (Fig. 2A) which displayed low TLR7 inhibition at 100 nM and harboured significantly enriched motif (see Table 2 for detail of the 17 ASOs used in this analysis).
  • [CD.] is CDKN2B- AS1;
  • CT.] is CTNNB1.
  • the central DNA region is highlighted in light grey and the 3’ and 5’ 2’OMe flanking regions are highlighted in dark grey.
  • HEK-TLR7 cells expressing an NF- K B luciferase reporter were treated with 100 nM (B) or 500 nM (E) indicated ASOs for 20 min prior to stimulation with 1 ⁇ g/ml R848. NF- K B-luciferase levels were measured after overnight incubation. Percentages relative to the condition “R848 without ASO” are averaged from three (B) or two (E) independent experiments in biological triplicate ( ⁇ s.e.m and ordinary one-way ANOVA with Dunnett’s multiple comparison tests to the NT condition [B] or Mann- Whitney U tests
  • C, D Sequence alignments of ASOs from the PINT series (C) and [cGAS]AS011 variants (D).
  • C The conserved region between all the sequences is highlighted in light grey.
  • the 2’OMe flanking regions are highlighted in dark grey.
  • D The central DNA region is highlighted in light grey and the 3’ and 5’ 2’OMe flanking regions are highlighted in dark grey.
  • C, D CUU motifs are in bold light grey, while UUC motifs are underlined.
  • HEK-TLR8 cells expressing an NF- K B-luciferase reporter were treated with 100 nM (F) or 500 nM (G) indicated ASOs for 20 min prior to stimulation with 1 ⁇ g/ml R848.
  • NF- K B-luciferase levels were measured after overnight incubation.
  • Fold increases relative to the condition “R848 without ASO” are averaged from three (F) or two (G) independent experiments in biological triplicate ( ⁇ s.e.m and ordinary one-way ANOVA with Dunnett’s multiple comparison tests to the NT condition [F] or Mann-Whitney U tests [G] are shown).
  • MOLM13 and OCIAML3 cells were incubated overnight with 500 nM ASOs, stimulated with 1 ⁇ g/ml R848 for 8 h (MOLM13) or 24 h (OCI-AML3), and IP- 10 levels in supernatants determined by ELISA. Data shown are averaged from five (MOML13) or four (OCI-AML3) independent experiments for all conditions with exception of the ASO only conditions (carried out in two independent experiments) in biological triplicate ( ⁇ s.e.m and ordinary one-way ANOVA with Dunnett’s multiple comparison tests to the “R848 without ASO” condition are shown).
  • C HEK-TLR8 cells expressing a CCL5-luciferase reporter (right-hand side) or an IFN- b-luciferase reporter (left-hand side) were treated with 500 nM indicated ASOs for 20 min prior to stimulation with 1 ⁇ g/ml R848. Luciferase levels were measured after overnight incubation. Data are shown as fold increase to NT condition, and are averaged from two independent experiments in biological triplicate ( ⁇ s.e.m and ordinary one-way ANOVA with Dunnett’s multiple comparison tests to the NT condition are shown).
  • HEK-TLR8 cells expressing an IEN-b-luciferase reporter were treated with 500 nM AS0852-dT (or NT) for 20 min prior to stimulation with increasing doses of R848 (1, 5, 10, 15 ⁇ g/ml). IEN-b-luciferase levels were measured after overnight incubation. Data are shown as fold increase to NT condition, and are averaged from two independent experiments in biological triplicate ( ⁇ s.e.m and ordinary one-way ANOVA with Tukey’s multiple comparison tests to the NT condition and selected pairs of conditions are shown). * P ⁇ 0.05, ** P ⁇ 0.01, *** P ⁇ 0.001, **** P ⁇ 0.0001, ns: non-significant.
  • HeLa cells were reverse-transfected with InM (left-hand side) or lOnM of (right- hand side) HPRT-targeting ASOs as detailed in Example 1 and Table 3, and HPRT levels measured by RT-qPCR after 24h incubation. HPRT levels were reported to SFRS9 expression, and further normalised to the average of the non-targeting ASONC1 and ASONC5 control conditions. Data shown represent the average of three independent experiments conducted in biological triplicate ( ⁇ s.e.m).
  • HEKTLR7 (B) and HEK-TLR8 (C) cells expressing an NF- K B-luciferase reporter were treated with 500 nM ASOs for 20 min prior to stimulation with 1 ⁇ g/ml R848. NF- K B-luciferase levels were measured after overnight incubation. Percentages (B) or fold increases (C) relative to the condition “R848 without ASO” (B) or NT condition (C) are averaged from three independent experiments in biological triplicate ( ⁇ s.e.m and ordinary one-way ANOVA with Dunnett’s multiple comparison tests to the NT condition
  • FIG. 7 AS0852-dT potentiation of TLR7 and TLR8 ligands.
  • HEK-TLR8 cells expressing an NF- K B-luciferase reporter were treated with 100 nM AS0852-dT (or NT) for 20 min prior to stimulation with Loxoribine (5mM), CL075 (l ⁇ g/ml), Gardiquimod (l ⁇ g/ml).
  • Loxoribine 5mM
  • CL075 l ⁇ g/ml
  • Gardiquimod l ⁇ g/ml
  • NF- K B-luciferase levels were measured after overnight incubation. Data are shown as fold increase to NT condition, and are averaged from two independent experiment in biological triplicate ( ⁇ s.e.m. and ordinary one-way ANOVA with Mann- Whitney U tests are shown).
  • FIG. 8 Basal activities of ASOs on TLR7, 8, 9 HEK cells and THP-1 cells.
  • A, B, C HEK-TLR7 (A), TLR8 (B), and TLR9 (C) cells expressing an NF- K B-luciferase reporter were treated with 500 nM indicated ASOs. NF- K B-luciferase levels were measured after overnight incubation.
  • A, B cells were treated with 1 ⁇ g/ml R848 as positive control, alone or in the presence of AS02 at 500 nM (for panel B only).
  • C HEK-TLR9 cells were stimulated with 200 nM of ODN 2006 as a positive control.
  • Fold increases relative to the NT condition are averaged from two (A, B) or three independent experiments (C) in biological triplicate ( ⁇ s.e.m and ordinary one-way ANOVA with Dunnett’s multiple comparison tests [A, B] or Tukey’s multiple comparison tests to the NT condition and selected pairs of conditions [C] are shown).
  • D WT THP-1 were pre-treated overnight with 100 nM ASO (except condition “852-dT 500nM” with 500 nM ASO used), and stimulated with 1 ⁇ g/ml R848 for 8 h and IP- 10 levels in supernatants determined by ELISA.
  • THP-1 cells and HEK-TLR8 cells expressing an NF- K B-luciferase reporter were pre-treated (overnight for THP-1, and ⁇ 30 min for HEK) with indicated concentrations of ASOs, prior to R848 stimulation for 7h (THP-1, IP-10 ELISA) or overnight for NF- K B-Luciferase. Data shown are averaged from 3 independent experiments in biological triplicate. For HEK-TLR8, the NF- K B- luciferase values are reported to the R848 condition. All ASO conditions are with R848 co-stimulation. SEM and One-way ANOVA with Dunnett’s multiple comparisons to R848 only condition are shown.
  • FIG. 10 Sequence-specific potentiation of uridine sensing by ASOs.
  • THP-1 cells and HEK-TLR8 cells expressing an NF- K B-luciferase reporter or a RANTES-luciferase reporter were pre-treated (overnight for THP-1, and ⁇ 30 min for HEK) with 100 nM (THP-1) or 500 nM ASOs (HEKs), prior to uridine stimulation (20 mM) for 7h (THP-1, IP-10 ELISA) or overnight for HEK-TLR8 cells.
  • Data shown are averaged from 3 (THP- 1 and RANTES-Luc HEKs) or 2 (NF- K B-LUC HEKS) independent experiments in biological triplicate.
  • NF- K B-luciferase values are reported to R848 condition; for RANTES-luciferase values are reported to NT condition. All ASO conditions are with Uridine co-stimulation (except R848 conditions at 1 ug/ml). SEM and One-way ANOVA with Dunnett’s multiple comparisons to “Uridine only” condition are shown.
  • FIG. 11 Identification of LNA and 2’MOE gapmer ASOs potentiating TLR8 sensing.
  • HEK-TLR8 cells expressing an NF- K B-luciferase reporter were pre-treated for ⁇ 30 min with indicated concentrations of ASOs, prior to R848 stimulation (1 ⁇ g/ml) overnight.
  • Fold increases relative to the condition ‘R848 without ASO’ are averaged from biological duplicates (averaged data are provided in Table 1).
  • Stimulations with 100 nM and 500 nM ASO were performed in independent experiments (data shown for each concentration is from a single experiment).
  • FIG. 12 Validation of LNA ASOs potentiating TLR8.
  • THP-1 cells and HEK-TLR8 cells expressing an NF- K B-luciferase reporter were pre-treated (overnight for THP-1, and ⁇ 30 min for HEK) with indicated concentrations of LNA ASOs, prior to R848 stimulation for 7h (THP-1, IP-10 ELISA) or overnight for NF- K B-Luciferase. Data shown are averaged from 3 independent experiments in biological triplicate (THP-1) or duplicate (HEKs).
  • THP-1 biological triplicate
  • HEKs duplicate
  • FIG. 14 Potentiation of TLR8 sensing by dT20 does not persist after wash off of the oligonucleotides.
  • HEK-TLR8 cells expressing an NF- K B-luciferase reporter were pre-treated overnight with 500 nM dT20, prior to be washed (or not) and stimulated with R848 stimulation (1 ⁇ g/ml) overnight. Data shown are averaged from 2 independent experiments in biological triplicate, and reported to R848 only condition. SEM and One way ANOVA with Dunnett’s multiple comparisons to R848 only condition are shown.
  • THP-1 cells were incubated with 100 nM indicated ASOs overnight (purple) or for 2.5 h, prior to R848 stimulation (1 ⁇ g/ml) for ⁇ 7 h.
  • IP-10 levels were measured by ELISA. Data shown are from a single experiment in biological triplicate (each dot represents a biological replicate). All ASO conditions are with R848 co-stimulation.
  • FIG. 15 Co-culture of phagocytes with ASO-transfected cells leads to sequence specific TLR8 potentiation.
  • HEK WT cells were transfected with 500 nM AS03 (non- TLR8 potentiating) or 500 nM 852dT (strongly potentiating TLR8), for 4 h, prior to UV treatment (254 nm at 120 mJ/cm2), extensive washing (2x 5ml - to remove untransfected ASOs), and co-culture with 6-day PMA-differentiated THP-1 overnight, before 24 h R848 stimulation (at 5 ⁇ g/ml).
  • TNF ⁇ levels were measured by ELISA. Data shown are relative to AS03 or ASO 852dT conditions, and averaged from 2 independent experiments with biological replicate. SEM and unpaired two-tailed t-test are shown.
  • FIG. 16 TLR8 -potentiation by fully a 2’Ome modified ASO.
  • HEK-TLR8 cells expressing an NF- K B-luciferase reporter were pre-treated for ⁇ 30 min with 500 nM indicated 2’MOE ASOs, prior to R848 stimulation (1 ⁇ g/ml) overnight. All ASO conditions are with R848 co-stimulation. Fold increases relative to the condition ‘R848 without ASO’ are averaged from 3 independent experiments in biological triplicate ( ⁇ SEM and One-way ANOVA with Dunnett’s multiple comparisons to R848 only condition are shown).
  • Figure 17. 5 ’-end CUU motifs modulate TLR7 sensing in the context of 2’OMe ASOs, not LNA ASOs.
  • HEK-TLR7 cells expressing an NF- K B-luciferase reporter were pre- treated for ⁇ 30 min with 500 nM indicated 2’MOE ASOs, prior to R848 stimulation (1 ⁇ g/ml) overnight. All ASO conditions are with R848 co-stimulation. Data shown are averaged from 3 independent experiments in biological triplicate, and reported to R848 only condition. SEM and One-way ANOVA with Dunnett’s multiple comparisons to “660-Muf ’ condition are shown.
  • FIG. 18 Identification of LNA and 2’MOE gapmer ASOs that do not inhibit TLR7 sensing.
  • HEK-TLR7 cells expressing an NF- K B-luciferase reporter were pre-treated for ⁇ 30 min with indicated concentrations of ASOs, prior to R848 stimulation (1 ⁇ g/ml) overnight.
  • Fold increases relative to the condition ‘R848 without ASO’ are averaged from biological duplicates (averaged data are provided in Table 2).
  • Stimulations with 100 nM and 500 nM ASO were performed in independent experiments (data shown for each concentration is from a single experiment).
  • FIG. 19 Validation of LNA and 2’MOE gapmer ASOs with limited TLR7 inhibition.
  • HEK-TLR7 cells expressing an NF- K B-luciferase reporter were pre-treated for ⁇ 30 min with 500 nM indicated 2’MOE ASOs, prior to R848 stimulation ( 1 ⁇ g/ml) overnight. All ASO conditions are with R848 co-stimulation. Data shown are averaged from 3 independent experiments (for LNA) or a single experiment (for 2’MOE) in biological triplicate, and reported to R848 only condition. SEM and One-way ANOVA with Dunnett’s multiple comparisons to “R848 only” condition are shown for LNA ASOs (left).
  • Hatched bars refer to ASOs with a 5’ +C+C motif.
  • the inventors note that El and a few other ASOs (not shown) entirely ablated TLR7 sensing - but G1-A2-C1-A9 did not.
  • SEQ ID NO: 1 and SEQ ID NO: 2 represent the nucleotide sequences of negative targeting controls ASOs from Table 1.
  • SEQ ID NO:3 through SEQ ID NO:20 represent the nucleotide sequences of ASOs targeting human cGAS mRNA and modified versions thereof from Table 1.
  • SEQ ID NO: 21 and SEQ ID NO: 22 represent the nucleotide sequences of AS0852 and AS0852-DT from Table 1.
  • SEQ ID NO: 23 and SEQ ID NO:24 represent the nucleotide sequences of ASO2504 and ASO2504-dT from Table 1.
  • SEQ ID NO: 25 represents the nucleotide sequences of dT20 from Table 1.
  • SEQ ID NO:26 through SEQ ID NO:34 represent the nucleotide sequences of Hs HPRT F517, Hs HPRT R591, Hs HPRT P554 FAM, Hs SFRS9 F594, Hs SFRS9 R690, Hs SFRS9 P625 HEX, ODN 2006, ISD70-FWD and ISD70-REV respectively from Table 1.
  • SEQ ID NO:35 through SEQ ID NO:82 represent the nucleotide sequences of CDKN2B-AS 1 ASOs from Table 2.
  • SEQ ID NO:83 through SEQ ID NO: 130 represent the nucleotide sequences of CTNNB1 ASOs from Table 2.
  • SEQ ID NO: 131 through SEQ ID NO: 178 represent the nucleotide sequences of EGFR ASOs from Table 2.
  • SEQ ID NO: 179 through SEQ ID NO:226 represent the nucleotide sequences of LINC-PINT ASOs from Table 2.
  • SEQ ID NO:227 through SEQ ID NO:273 represent the nucleotide sequences of HPRT ASOs from Table 3.
  • SEQ ID NO:274 through SEQ ID NO:282 represent the nucleotide sequences of ASOl-UC, AS02 LNA, AS02-LNA Mutl, AS02-LNA Mut2, ASO 660, ASO 660-Mut, C2Mut-1, C2Mutl-PS, C2Mutl-20Me respectively of Table 4.
  • SEQ ID NO:283 through SEQ ID NO:373 represent the LNA-modified nucleotide sequences of Table 5.
  • SEQ ID NO:374 through SEQ ID NO:449 represent the 2 -MOE- modified nucleotide sequences of Table 6.
  • the term about refers to +/- 10%, more preferably +/-5%, more preferably +/-1%, of the designated value.
  • oligonucleotide sequence consisting essentially of in the context of an oligonucleotide sequence is meant the recited oligonucleotide sequence together with an additional one, two or three nucleic acids at the 5 ’ or 3 ’ end thereof.
  • the phrase “does not inhibit Toll-like receptor 7 (TLR7) activity” or variations thereof means that after administration to an animal of an oligonucleotide of the invention the animal is still able to elicit a TLR7 based immune response, such as to a pathogen.
  • TLR7 based immune response in the presence of the oligonucleotide is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99% or 100% of the response in the absence of the oligonucleotide.
  • the phrase “reducing the Toll-like receptor 7 (TLR7) inhibitory activity of an oligonucleotide” or the like means that after being modified in accordance with the invention, an animal administered with the modified oligonucleotide is able to mount a stronger TLR7 based immune response when compared to the starting (unmodified) oligonucleotide.
  • TLR7 Toll-like receptor 7
  • TLR8 Toll-like receptor 8
  • an “immune response modifier” refers to any agent that mimics, augments, or require participation of host immune cells for optimal effectiveness, and/or has a known ability to activate, augment, or enhance specific immune responses.
  • immune response modifiers include, but are not limited to, Toll-like receptor (TLR) agonists including Resiquimod (R848), Loxoribine, Isatoribine, Imiquimod, CL075, CL097, CL264, CL307, 852A, and/or TL8-506.
  • TLR Toll-like receptor
  • a base analogue including: a guanosine analogue, a deaza-adenosine analogue, an imidazoquinoline or a derivative, a hydroxyadenine compound or a derivative, a thiazoloquinolone compound or a derivative, a benzoazepine compound or a derivative
  • RNA molecule including: a guanosine analogue, a deaza-adenosine analogue, an imidazoquinoline or a derivative, a hydroxyadenine compound or a derivative, a thiazoloquinolone compound or a derivative, a benzoazepine compound or a derivative
  • phrases “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, and/or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • treating include administering a therapeutically effective amount of a compound(s) described herein sufficient to reduce or eliminate at least one symptom of a disease.
  • preventing include administering a therapeutically effective amount of a compound(s) described herein sufficient to stop or hinder the development of at least one symptom of a disease.
  • oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), wherein the polymer or oligomer of nucleotide monomers contains any combination of nucleobases (referred to in the art and herein as simply as “base”), modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges (also referred to herein as "intemucleotidic linkage").
  • Oligonucleotides can be single-stranded or double-stranded or a combination thereof.
  • a single-stranded oligonucleotide can have double -stranded regions and a double-stranded oligonucleotide can have single-stranded regions (such as a microRNA or shRNA).
  • Gapmer refers to an oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the "gap” and the external regions may be referred to as the "wings.”
  • a “target” such as a “target gene” or “target polynucleotide” refers to a molecule upon which an oligonucleotide of the invention directly or indirectly exerts its effects.
  • the oligonucleotide of the invention or portion thereof and the target, or a product of the target such as mRNA encoded by a gene, or portion thereof, are able to hybridize under physiological conditions.
  • the phrase “reduces expression of the target gene” or the like refers to an oligonucleotide of the invention reducing the ability of a gene to exert is biological effect. This can be directly or indirectly achieved by reduction in the amount of RNA encoded by the gene and/or reduction of the amount of protein translated from an RNA.
  • an oligonucleotide of the invention will be synthesized in vitro. However, in some instances where modified bases and backbone are not required they can be expressed in vitro or in vivo in a suitable system such as by a recombinant virus or cell.
  • An oligonucleotide of the invention may be conjugated to one or more moieties or groups which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. These moieties or groups may be covalently bound to functional groups such as primary or secondary hydroxyl groups. Exemplary moieties or groups include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
  • Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins and dyes.
  • the oligonucleotide described herein may comprise a synthetic oligonucleotide sequence.
  • a “synthetic oligonucleotide sequence” refers to an oligonucleotide sequence which lacks a corresponding sequence that occurs naturally.
  • a synthetic oligonucleotide sequence is not complementary to a specific RNA molecule, such as one encoding an endogenous polypeptide.
  • the synthetic oligonucleotide sequence is suitably not capable of interfering with a post-transcriptional event, such as RNA translation.
  • an oligonucleotide “variant” shares a definable nucleotide sequence relationship with a reference nucleic acid sequence.
  • the reference nucleic acid sequence may be one of those provided in Tables 1 through 6 (e.g., SEQ ID NOs. 1-449), for example.
  • the "variant" oligonucleotide may have one or a plurality of nucleic acids of the reference nucleic acid sequence deleted or substituted by different nucleic acids.
  • oligonucleotide variants share at least 70% or 75%, preferably at least 80% or 85% or more preferably at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with a reference nucleic acid sequence.
  • Oligonucleotides of the invention may have nucleobase ("base") modifications or substitutions.
  • bases include oligonucleotides comprising one of the following at the 2' position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl - O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Cl to CIO alkyl or C2 to CIO alkenyl and alkynyl.
  • the oligonucleotide comprises one of the following at the 2' position: 0[(CH 2 )n0]mCH 3 , 0(CH 2 )n0CH 3 , 0(CH 2 )nNH 2 , 0(CH 2 )nCH 3 , 0(CH 2 )n0NH 2 , and 0(CH 2 )n0N[(CH 2 )nCH 3 ]2, where n and m are from 1 to about 10.
  • modified oligonucleotides include oligonucleotides comprising one of the following at the 2' position: Cl to CIO lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, C1, Br, CN, CF , OCF , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
  • the modification includes 2'-methoxyethoxy (2'-0- CH2CH20CH3 (also known as 2'-0-(2-methoxyethyl) or 2'-MOE) (Martin et al., 1995), that is, an alkoxyalkoxy group. In some embodiments, the modification does not comprise 2'-MOE.
  • the modification includes 2'- dimethylaminooxyethoxy, that is, a 0(CH 2 ) 2 0N(CH 3 ) 2 group (also known as 2'- DMAOE), or 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-0-dimethyl- amino-ethoxy -ethyl or 2'-DMAEOE), that is, 2'-0-CH 2 -0-CH 2 -N(CH 3 ) 2 .
  • 2'- dimethylaminooxyethoxy that is, a 0(CH 2 ) 2 0N(CH 3 ) 2 group (also known as 2'- DMAOE), or 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-0-dimethyl- amino-ethoxy -ethyl or 2'-DMAEOE), that is, 2'-0-CH 2 -0-CH 2 -N(CH 3 ) 2 .
  • the 2'-modification may be in the arabino (up) position or ribo (down) position.
  • a 2'-arabino modification is 2'-F.
  • Oligonucleotides may also have sugar mimetics, such as cyclobutyl moieties in place of the pentofuranosyl sugar.
  • Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, US 4,981,957, US 5,118,800, US 5,319,080, US 5,359,044, US 5,393,878, US 5,446,137, US 5,466,786, US 5,514,785, US 5,519,134, US 5,567,811, US 5,576,427, US 5,591,722, US 5,597,909, US 5,610,300, US 5,627,053, US 5,639,873, US 5,646,265, US 5,658,873, US 5,670,633, US 5,792,747, and US 5,700,920.
  • a further modification of the sugar includes Uocked Nucleic Acids (UNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety.
  • the linkage is a methylene (-CH2- )n group bridging the 2' oxygen atom and the 4' carbon atom, wherein n is 1 or 2.
  • UNAs and preparation thereof are described in WO 98/39352 and WO 99/14226. In some embodiments, however, the modification does not comprise UNA.
  • Modified nucleobases include other synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-CC-CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted a
  • nucleobases include tricyclic pyrimidines, such as phenoxazine cytidine(lH-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H- pyrimido[5,4-b][l,4]benzothiazin-2(3H)-one), G-clamps such as, for example, a substituted phenoxazine cytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4- b][l,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido [3', 2' : 4,5]pyrrolo [2,3 -d]pyrimidin-2
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7- deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in US 3,687,808, those disclosed in J.I. Kroschwitz (editor), The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, John Wiley and Sons (1990), those disclosed by Englisch et al. (1991), and those disclosed by Y.S. Sanghvi, Chapter 15: Antisense Research and Applications, pages 289-302, S.T. Crooke, B. Lebleu (editors), CRC Press, 1993.
  • nucleobases are particularly useful for increasing the binding affinity of the oligonucleotide. These include 5 -substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2- aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 oC. In one embodiment, these nucleobase substitutions are combined with 2'-0-methoxyethyl sugar modifications.
  • reference to an A, T, G, U or C can either mean a naturally occurring base or a modified version thereof.
  • two or more bases e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 bases inclusive of any range therein
  • all bases of the oligonucleotide described herein are modified.
  • no bases of the oligonucleotide described herein are modified.
  • Oligonucleotides of the present disclosure include those having modified backbones or non-natural intemucleoside linkages. Oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
  • Modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates, and boranophosphates having normal 3'- 5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more intemucleotide linkages is a 3' to 3', 5' to 5' or 2' to
  • Oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3 '-most intemucleotide linkage, that is, a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof).
  • Various salts, mixed salts and free acid forms are also included.
  • Modified oligonucleotide backbones that do not include a phosphorus atom therein include, for example, backbones formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • riboacetyl backbones alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
  • antisense oligonucleotide shall be taken to mean an oligonucleotide that is complementary to at least a portion of a specific mRNA molecule, such as encoding an endogenous polypeptide and capable of interfering with a post- transcriptional event such as mRNA translation.
  • mRNA translation a post- transcriptional event
  • the antisense oligonucleotide hybridises under physiological conditions, that is, the antisense oligonucleotide (which is fully or partially single stranded) is at least capable of forming a double stranded polynucleotide with mRNA, such as encoding an endogenous polypeptide, under normal conditions in a cell.
  • Antisense oligonucleotides may include sequences that correspond to the structural genes or for sequences that effect control over the gene expression or splicing event.
  • the antisense sequence may correspond to the targeted coding region of endogenous gene, or the 5 '-untranslated region (UTR) or the 3'-UTR or combination of these. It may be complementary in part to intron sequences, which may be spliced out during or after transcription, preferably only to exon sequences of the target gene. In view of the generally greater divergence of the UTRs, targeting these regions provides greater specificity of gene inhibition.
  • the antisense oligonucleotide may be complementary to the entire gene transcript, or part thereof.
  • the degree of identity of the antisense sequence to the targeted transcript should be at least 90% and more preferably 95-100%.
  • the antisense RNA or DNA molecule may of course comprise unrelated sequences which may function to stabilize the molecule such as described herein.
  • RNA interference refers generally to a process in which a dsRNA molecule reduces the expression of a nucleic acid sequence with which the double-stranded RNA molecule shares substantial or total homology.
  • RNA interference can be achieved using non-RNA double stranded molecules (see, for example, US 20070004667).
  • the double-stranded regions should be at least 19 contiguous nucleotides, for example about 19 to 23 nucleotides, or may be longer, for example 30 or 50 nucleotides, or 100 nucleotides or more.
  • the full-length sequence corresponding to the entire gene transcript may be used. Preferably, they are about 19 to about 23 nucleotides in length.
  • the degree of identity of a double-stranded region of a nucleic acid molecule to the targeted transcript should be at least 90% and more preferably 95-100%.
  • the nucleic acid molecule may of course comprise unrelated sequences which may function to stabilize the molecule.
  • short interfering RNA refers to a polynucleotide which comprises ribonucleotides capable of inhibiting or down regulating gene expression, for example by mediating RNAi in a sequence-specific manner, wherein the double stranded portion is less than 50 nucleotides in length, preferably about 19 to about 23 nucleotides in length.
  • the siRNA can be a nucleic acid molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the siRNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary. The two strands can be of different length.
  • siRNA is meant to be equivalent to other terms used to describe polynucleotides that are capable of mediating sequence specific RNAi, for example micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid (siNA), short interfering modified oligonucleotide, chemically-modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others.
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • siNA short interfering nucleic acid
  • siRNAi chemically-modified siRNA
  • ptgsRNA post-transcriptional gene silencing RNA
  • RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • siRNA molecules can be used to epigenetically silence genes at both the post- transcriptional level or the pre-transcriptional level.
  • epigenetic regulation of gene expression by siRNA molecules can result from siRNA mediated modification of chromatin structure to alter gene expression.
  • RNA short-hairpin RNA
  • shRNA an RNA molecule where less than about 50 nucleotides, preferably about 19 to about 23 nucleotides, is base paired with a complementary sequence located on the same RNA molecule, and where said sequence and complementary sequence are separated by an unpaired region of at least about 4 to about 15 nucleotides which forms a single-stranded loop above the stem structure created by the two regions of base complementarity.
  • An Example of a sequence of a single- stranded loop includes: 5’ UUCAAGAGA 3’.
  • shRNAs are dual or bi-finger and multi-finger hairpin dsRNAs, in which the RNA molecule comprises two or more of such stem-loop structures separated by single-stranded spacer regions.
  • oligonucleotide in addition to design elements of the invention, there are many known factors to be considered when producing an oligonucleotide.
  • the specifics depend on the purpose of the oligonucleotide but include features such as strength and stability of the oligonucleotide-target nucleic acid interaction, such as the mRNA secondary structure, thermodynamic stability, the position of the hybridization site, and/or functional motifs.
  • Some methods the invention involve scanning a target polynucleotide, or complement thereof, for specific features. This can be done by eye or using computer programs known in the art.
  • Software programs which can be used to design, analyse and predict functional properties of antisense oligonucleotides include Mfold, Sfold, NUPACK, Nanofolder, Hyperfbld, and/or RNA designer.
  • Software programs which can be used to design, analyse and predict functional properties of oligonucleotides for gene silencing include dsCheck, E-RNAi and/or siRNA-Finder.
  • available software is used to select potentially useful oligonucleotides, and then these are scanned for desired features as described herein.
  • software could readily be developed to scan a target polynucleotide, or complement thereof, for desired features as described herein.
  • candidate oligonucleotides can be tested for their desired activity using standard procedures in the art. This may involve administering the candidate to cells in vitro expressing the gene of interest and analysing the amount of gene product such as RNA and/or protein. In another example, the candidate is administered to an animal, and the animal screened for the amount of target RNA and/or protein and/or using a functional assay. In another embodiment, the oligonucleotide is tested for its ability to hybridize to a target polynucleotide (such as mRNA).
  • a target polynucleotide such as mRNA
  • expression and oligonucleotide activity can be determined by mRNA reverse transcription quantitative real-time PCR (RT-qPCR).
  • RNA can be extracted and purified from cells which have been incubated with a candidate oligonucleotide. cDNA is then synthesized from isolated RNA and RT-qPCR can be performed, using methods and reagents known the art.
  • RNA can be purified from cells using the ISOFATE II RNA Mini Kit (Bioline) and cDNA can be synthesized from isolated RNA using the High-Capacity cDNA Archive kit (Thermo Fisher Scientific) according to the manufacturer’s instructions.
  • RT-qPCR can be performed using the Power SYBR Green Master Mix (Thermo Fisher Scientific) on the HT7900 and QuantStudio 6 RT-PCR system (Thermo Fisher Scientific), according to manufacturer’s instructions.
  • TLR7 activity in cells may be measured by expression and/or secretion of one or more proinflammatory cytokines (e.g. TNF ⁇ , IP-10), and/or activation or expression of transcription factors (e.g. NF- K B).
  • proinflammatory cytokines e.g. TNF ⁇ , IP-10
  • transcription factors e.g. NF- K B
  • an oligonucleotide to inhibit TLR7 activity can, for example, be analysed by incubating cells which express TLR7 with an oligonucleotide, then stimulating said cells with a TLR7 agonist, and analysing the overall TLR7 response in the cell population, or analysing the proportion of cells having TLR7 -positive activity after a defined period of time.
  • inhibition of TLR7 activity can be identified by observation of an overall decreased TLR7 response of the cell population, or a lower proportion of cells having TLR7 -positive activity as compared to positive control condition in which cells are treated with a TLR7 agonist in the absence of the oligonucleotide (or in the presence of an appropriate control inhibitory agent).
  • 293XLhTLR7 referred to as HEK-TLR7
  • HEK-TLR7 293XLhTLR7 (referred to as HEK-TLR7) cells are transfected with pNF- K B-Luc4 reporter, incubated with an oligonucleotide, and then stimulated with R848.
  • TLR7 activity can be determined by a luciferase assay, which measures activated NF- K B by luminescence.
  • TLR7 activity can also be analysed by measuring cytokine levels, for example by ELISA.
  • TLR8 activity in cells may be measured by expression and/or secretion of one or more proinflammatory cytokines (e.g. TNF ⁇ , IP-10), and/or activation or expression of transcription factors (e.g. NF- K B).
  • proinflammatory cytokines e.g. TNF ⁇ , IP-10
  • transcription factors e.g. NF- K B
  • the ability of an oligonucleotide to potentiate TLR8 activity can, for example, be analysed by incubating cells which express TLR8 with an oligonucleotide, then stimulating said cells with a TLR8 agonist, and analysing the overall TLR8 response in the cell population, or analysing the proportion of cells having TLR8-positive activity after a defined period of time.
  • potentiation of TLR8 activity can be identified by observation of an overall decreased TLR8 response of the cell population, or a higher proportion of cells having TLR8-positive activity as compared to a negative control condition in which cells are treated with TLR8 agonist in the absence of the oligonucleotide (or in the presence of an appropriate control non-potentiating agent).
  • 293XLhTLR8 referred to as HEK-TLR8
  • HEK-TLR8 293XLhTLR8 (referred to as HEK-TLR8) cells are transfected with pNF- K B-Luc4 reporter, incubated with an oligonucleotide, and then stimulated with R848.
  • TLR8 activity can be determined by a luciferase assay, which measures activated NF- K B by luminescence. TLR8 activity can also be analysed by measuring cytokine levels, for example by ELISA.
  • Potentiation refers to an increase in a functional property relative to a control condition. Potentiation of TLR8 activity may be greater than about 100%, e.g. about 2 fold, about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold, about 11 fold, about 12 fold, about 13 fold, about 14 fold, about 15 fold, about 20 fold or about 50 fold. Preferably, the level of TLR8 potentiation is between about 2 fold and 50 fold, between about 2 fold and 20 fold, and/or between about 5 fold and 20 fold greater.
  • Oligonucleotides of the invention are designed to be administered to an animal.
  • the animal is a vertebrate.
  • the animal can be a mammal, avian, chordate, amphibian or reptile.
  • Exemplary subjects include but are not limited to human, primate, livestock (e.g. sheep, cow, chicken, horse, donkey, pig), companion animals (e.g. dogs, cats), laboratory test animals (e.g. mice, rabbits, rats, guinea pigs, hamsters), captive wild animal (e.g. fox, deer).
  • the mammal is a human.
  • Oligonucleotides of the invention can be used to target any gene/polynucleotide/function of interest.
  • the oligonucleotide is used to modify a trait of an animal, more typically to treat or prevent a disease.
  • the disease will benefit from the animal being able to mount a TLR7 and/or TLR8 response following administration of the oligonucleotide, in particular where the TLR7 response is not inhibited and/or the TLR8 response is potentiated.
  • oligonucleotide of the invention include, but are not limited, to cancer (for example breast cancer, ovarian cancer, cancers of the central nervous system, gastrointestinal cancer, bladder cancer, skin cancer, lung cancer, head and neck cancers, haematological and lymphoid cancers, bone cancer) rare genetic diseases, neuromuscular and neurological diseases (for example, spinal muscular atrophy, Amyotrophic Lateral Sclerosis, Duchenne muscular dystrophy, Huntington’s disease, Batten disease, Parkinson’s disease, amyotrophic lateral sclerosis, Ataxia-telangiectasia, cerebral palsy) viruses (for example, cytomegalovirus, hepatitis C virus, Ebola hemorrhagic fever virus, human immunodeficiency virus, coronaviruses), cardiovascular disease (for example, familial hypercholesterolemia, hypertriglyceridemia), autoimmune and inflammatory diseases (for example arthritis, lupus, pouchitis, psoria
  • cancer for example breast cancer,
  • target genes (polynucleotides) of oligonucleotides of the invention include, but not limited to, PLK1ERBB2, PIK3CA, ERBB3, HDAC1, MET, EGFR, TYMS, TUBB4B, FGFR2, ESR1, FASN, CDK4, CDK6, NDUFB4, PPAT, NDUFB7, DNMT1, BCL2, ATP1A1, HDAC3, FGFR1, NDUFS2, HDAC2, NDUFS3, HMGCR, IGF1R, AKT1, BCL2L1, CDK2, MTOR, PDPK1, CSNK2A1, PIK3CB, CDK12, MCL1, ATR, PLK4, MEN1, PTK2, FZD5, KRAS, WRN, CREBBP, NRAS, MAT2A, RHOA, TPX2, PPP2CA, ALDOA, RAE1, SKP1, ATP5A1, EIF4G1, CTNNB1, TLRC, CD
  • the gene to be targeted includes PKN3, VEGFA, KIF11, MYC, EPHA2, KRAS (G12), ERBB3, BIRC5, HIF1A, BCL2, STAT3, AR, EPAS1, BRCA2, or CFU.
  • oligonucleotides which can be modified as described herein include, but are not limited to, inclisiran, mipomersen (Kynamro), nusinersen (Spinraza), eteplirsen (Exondys51), miravirsen (SPC3649), RG6042 (IONIS-HTTRx), inotersen, volanesorsen, golodirsen (Vyondys53), fomivirsen (Vitravene), patisiran, givosiran, inclisiran, danvatirsen and IONIS-AR-2.5Rx.
  • Oligonucleotides of the disclosure may be admixed, encapsulated, conjugated (such as fused) or otherwise associated with other molecules, molecule structures or mixtures of compounds, resulting in, for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
  • Oligonucleotides of the disclosure may be administered in a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier may be solid or liquid.
  • Useful examples of pharmaceutically acceptable carriers include, but are not limited to, diluents, solvents, surfactants, excipients, suspending agents, buffering agents, lubricating agents, adjuvants, vehicles, emulsifiers, absorbants, dispersion media, coatings, stabilizers, protective colloids, adhesives, thickeners, thixotropic agents, penetration agents, sequestering agents, isotonic and absorption delaying agents that do not affect the activity of the active agents of the disclosure.
  • the pharmaceutical carrier is water for injection (WFI) and the pharmaceutical composition is adjusted to pH 7.4, 7.2-7.6.
  • the salt is a sodium or potassium salt.
  • oligonucleotides may contain chiral (asymmetric) centers or the molecule as a whole may be chiral.
  • the individual stereoisomers (enantiomers and diastereoisomers) and mixtures of these are within the scope of the present disclosure.
  • Oligonucleotides of the disclosure may be pharmaceutically acceptable salts, esters, or salts of the esters, or any other compounds which, upon administration are capable of providing (directly or indirectly) the biologically active metabolite.
  • pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the oligonucleotide that retain the desired biological activities of the parent compounds and do not impart undesired toxicological effects upon administration. Examples of pharmaceutically acceptable salts and their uses are further described in US 6,287,860.
  • Oligonucleotides of the disclosure may be prodrugs or pharmaceutically acceptable salts of the prodrugs, or other bioequivalents.
  • the term "prodrugs” as used herein refers to therapeutic agents that are prepared in an inactive form that is converted to an active form (i.e., drug) upon administration by the action of endogenous enzymes or other chemicals and/or conditions.
  • prodrug forms of the oligonucleotide of the disclosure are prepared as SATE [(S acetyl-2 -thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510, WO 94/26764 and US 5,770,713.
  • a prodrug may, for example, be converted within the body, e. g. by hydrolysis in the blood, into its active form that has medical effects.
  • Pharmaceutical acceptable prodrugs are described in T. Higuchi and V. Stella, Prodrugs as Novel Delivery Systems, Vol. 14 of the A. C. S. Symposium Series (1976); "Design of Prodrugs” ed. H. Bundgaard, Elsevier, 1985; and in Edward B. Roche, ed., Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press, 1987.
  • solvates For example, a complex with water is known as a "hydrate”.
  • oligonucleotides of the invention can be complexed with a complexing agent to increase cellular uptake of oligonucleotides.
  • a complexing agent includes cationic lipids. Cationic lipids can be used to deliver oligonucleotides to cells.
  • cationic lipid includes lipids and synthetic lipids having both polar and non-polar domains and which are capable of being positively charged at or around physiological pH and which bind to polyanions, such as nucleic acids, and facilitate the delivery of nucleic acids into cells.
  • cationic lipids include saturated and unsaturated alkyl and alicyclic ethers and esters of amines, amides, or derivatives thereof.
  • Straight-chain and branched alkyl and alkenyl groups of cationic lipids can contain, e.g., from 1 to about 25 carbon atoms.
  • Preferred straight chain or branched alkyl or alkene groups have six or more carbon atoms.
  • Alicyclic groups include cholesterol and other steroid groups.
  • Cationic lipids can be prepared with a variety of counterions (anions) including, e.g., C1-, Br-, I-, F-, acetate, trifluoroacetate, sulfate, nitrite, and nitrate.
  • counterions e.g., C1-, Br-, I-, F-, acetate, trifluoroacetate, sulfate, nitrite, and nitrate.
  • cationic lipids examples include polyethylenimine, polyamidoamine (PAMAM) starburst dendrimers, Lipofectin (a combination of DOTMA and DOPE), Lipofectase, LIPOFECTAMINETM (e.g, LIPOFECTAMINETM 2000), DOPE, Cytofectin (Gilead Sciences, Foster City, Calif.), and Eufectins (JBL, San Luis Obispo, Calif.).
  • Exemplary cationic liposomes can be made from N-[l-(2,3-dioleoloxy)-propyl]- N,N,N-trimethylammonium chloride (DOTMA), N-[l-(2,3-dioleoloxy)-propyl]-N,N,N- trimethylammonium methylsulfate (DOTAP), 3.beta.-[N— (N',N'- dimethylaminoethane)carbamoyl]cholesterol (DC-Chol), 2,3,-dioleyloxy-N- [2(sperminecarboxamido)ethyl]-N,N-dimethyl-l-propanaminium trifluoroacetate
  • DOTMA N-[l-(2,3-dioleoloxy)-propyl]-N,N,N-trimethylammonium chloride
  • DOTAP N-[l-(2,3-dioleoloxy)-propy
  • Oligonucleotides can also be complexed with, e.g., poly (L-lysine) or avidin and lipids may, or may not, be included in this mixture, e.g., steryl-poly (L-lysine).
  • Cationic lipids have been used in the art to deliver oligonucleotides to cells (see, e.g., US 5,855,910; 5,851,548; 5,830,430; 5,780,053; 5,767,099; Lewis et al., 1996; Hope et al., 1998).
  • Other lipid compositions which can be used to facilitate uptake of the instant oligonucleotides can be used in connection with the methods of the invention.
  • other lipid compositions are also known in the art and include, e.g., those taught in US 4,235,871; US 4,501,728; 4,837,028; 4,737,323.
  • lipid compositions can further comprise agents, e.g., viral proteins to enhance lipid-mediated transfections of oligonucleotides.
  • agents e.g., viral proteins to enhance lipid-mediated transfections of oligonucleotides.
  • N-substituted glycine oligonucleotides can be used to optimize uptake of oligonucleotides.
  • a composition for delivering oligonucleotides of the invention comprises a peptide having from between about one to about four basic residues. These basic residues can be located, e.g., on the amino terminal, C-terminal, or internal region of the peptide. Families of amino acid residues having similar side chains have been defined in the art.
  • amino acids with basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid, glutamic acid
  • uncharged polar side chains e.g., glycine (can also be considered non-polar
  • asparagine, glutamine, serine, threonine, tyrosine, cysteine nonpolar side chains
  • nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
  • beta- branched side chains e.g., threonine, valine, isoleucine
  • aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine
  • a majority or all of the other residues of the peptide can be selected from the non-basic amino acids, e.g., amino acids other than lysine, arginine, or histidine.
  • amino acids other than lysine, arginine, or histidine Preferably a preponderance of neutral amino acids with long neutral side chains are used.
  • oligonucleotides are modified by attaching a peptide sequence that transports the oligonucleotide into a cell, referred to herein as a "transporting peptide.”
  • the composition includes an oligonucleotide which is complementary to a target nucleic acid molecule encoding the protein, and a covalently attached transporting peptide.
  • the oligonucleotide is attached to a targeting moiety such as N-acetylgalactosamine (GalNAc), an antibody, antibody-like molecule or aptamer (see, for example, Toloue and Ford (2011) and Esposito et al. (2016)).
  • a targeting moiety such as N-acetylgalactosamine (GalNAc), an antibody, antibody-like molecule or aptamer (see, for example, Toloue and Ford (2011) and Esposito et al. (2016)).
  • the oligonucleotide of the disclosure is administered systemically.
  • systemic administration is a route of administration that is either enteral or parenteral.
  • enteral refers to a form of administration that involves any part of the gastrointestinal tract and includes oral administration of, for example, the oligonucleotide in tablet, capsule or drop form; gastric feeding tube, duodenal feeding tube, or gastrostomy; and rectal administration of, for example, the oligonucleotide in suppository or enema form.
  • parenteral includes administration by injection or infusion. Examples include, intravenous (into a vein), intraarterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), subcutaneous (under the skin), intraosseous infusion (into the bone marrow), intradermal, (into the skin itself), intrathecal (into the spinal canal), intraperitoneal (infusion or injection into the peritoneum), intravesical (infusion into the urinary bladder) transdermal (diffusion through the intact skin), transmucosal (diffusion through a mucous membrane), inhalational.
  • administration of the pharmaceutical composition is subcutaneous.
  • the oligonucleotide may be administered as single dose or as repeated doses on a period basis, for example, daily, once every two days, three, four, five, six seven, eight, nine, ten, eleven, twelve, thirteen or fourteen days, once weekly, twice weekly, three times weekly, every two weeks, every three weeks, every month, every two months, every three months to six months or every 12 months.
  • administration is 1 to 3 times per week, or once every week, two weeks, three weeks, four weeks, or once every two months.
  • administration is once weekly.
  • a low dose administered for 3 to 6 months such as about 25- 50mg/week for at least three to six months and then up to 12 months and chronically.
  • Illustrative doses are between about 10 to 5,000mg. Illustrative doses include 25, 50, 100, 150, 200, 1,000, 2,000mg. Illustrative doses include 1.5mg/kg (about 50 to lOOmg) and 3mg/kg (100-200mg), 4.5mg/kg (150-300mg), lOmg/kg, 20mg/kg or 30mg/kg. In one embodiment doses are administered once per week. Thus in one embodiment, a low dose of approximately 10 to 30, or 20 to 40, or 20 to 28mg may be administered to subjects typically weighing between about 25 and 65kg. In one embodiment the oligonucleotide is administered at a dose of less than 50mg, or less than 30mg, or about 25mg per dose to produce a therapeutic effect.
  • PBMCs peripheral blood mononuclear cells
  • PBMCs were isolated from whole blood donations via density centrifugation using Histopaque-1770 (Sigma-Aldrich) as previously reported (Gantier et al., 2010), and plated in RPMI 1640 plus L-glutamine medium (Thermo Fisher Scientific) complemented with lx antibiotic/antimycotic and 10% heat-inactivated foetal bovine serum (referred to as complete RPMI).
  • 293XL-hTLR8-HA (referred to as HEK-TLR8) and 293XL-hTLR7-HA (referred to as HEK-TLR7) and 293XL-hTLR9-HA stably expressing TLR8, TLR7, and TLR9 respectively, were purchased from Invivogen, and were maintained in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific) supplemented with 10% heat- inactivated foetal bovine serum (Thermo Fisher Scientific) and 1 c antibiotic/antimycotic (Thermo Fisher Scientific) (referred to as complete DMEM) supplemented with 10 ⁇ g/ml Blasticidin (Invivogen).
  • Dulbecco’s modified Eagle’s medium Thermo Fisher Scientific
  • Thermo Fisher Scientific 1 c antibiotic/antimycotic
  • Parental wild-type (WT) THP-1, UNC93B1- deficient THP-1 (Schmid-Burgk et al., 2014) and matched clones reconstituted with fluorescent wild-type UNC93B1 (Pelka et al., 2014) were grown in complete RPMI.
  • OCI-AMF3 and MOFM13 were grown in RPMI supplemented with 20% heat inactivated foetal bovine serum and 1 c antibiotic/antimycotic (their identity was confirmed by in house cell line identification service relying on PowerPlex HS16 System kit, Promega). All the cells were cultured at 37°C with 5% C02. Cell lines were passaged 2-3 times a week and tested for mycoplasma contamination on routine basis by PCR.
  • THP-1, MOLM13 and OCI-AML3 were treated overnight with ASOs, prior to stimulation with 1 ⁇ g/ml R848 (Invivogen).
  • HEK-TLR7 and HEKTLR8 were treated with indicated concentration of ASOs for 20-50 min, prior to stimulation with R848, CL075, Gardiquimod (all from Invivogen), or 7-Allyl-7,8-dihydro-8- oxoguanosine (Loxoribine - SigmaAldrich). All ASOs were synthesised by Integrated DNA Technologies (IDT), and resuspended in RNase-free TE buffer, pH 8.0 (Thermo Fisher Scientific). ASO sequences and modifications are provided in Table 1, 2 and 3.
  • the cGAS ligand ISD70 (Table 1) was prepared as previously described (Pepin et al., 2020) and transfected with lipofectamine 2000 at 2.5 ⁇ g/ml final concentration.
  • the Class B CpG oligonucleotide human TLR9 ligand ODN 2006 was synthesised by IDT and resuspended in RNase-free TE buffer
  • HEK293 cells stably expressing TLR7, 8 or 9 were transfected with pNF-kB- Luc4 reporter (Clontech), pLuc-IFN-b (a kind gift from K. Fitzgerald, University of Massachusetts) or pCCL5[RANTES]-Luc (a kind gift from G. Scholz, University of Melbourne) with lipofectamine 2000 (Thermo Fisher Scientific), according to the manufacturer’s protocol. Briefly, 500,000-700,000 cells were reverse-transfected with 400 ng of reporter with 1.2 ⁇ l of lipofectamine 2000 per well of a 6-well plate, and incubated for 3-24 h at 37°C with 5% C02.
  • the cells were collected from the 6-wells and aliquoted into 96-wells, just before ASO and overnight TLR stimulation (as above described). The next day, the cells were lysed in 40 ⁇ l (for a 96-well plate) of IX Glo Lysis buffer (Promega) for 10 min at room temperature. 15 ⁇ l of the lysate was then subjected to firefly luciferase assay using 40 ⁇ l of Luciferase Assay Reagent (Promega). Luminescence was quantified with a Fluostar OPTIMA (BMG LABTECH) luminometer.
  • IX Glo Lysis buffer Promega
  • Each ASO was reverse-transfected in biological triplicate in 96-well plates by complexing the various ASO doses with 0.5 ⁇ l Lipofectamine 2000 (Thermo Fisher Scientific) in OptiMEM I (Thermo Fisher Scientific) for a total volume of 50 ⁇ l in each well.
  • HeLa cells (20,000) were suspended in 100 ⁇ l DMEM supplemented with 10% foetal calf serum (FCS), added to the lipid-ASO complexes, then incubated for 24 h at 37°C and 5% C02.
  • RNA was collected with the SV Total RNA Isolation Kit (Promega) with DNase 1 treatment.
  • cDNA was synthesized from ⁇ 200 ng total RNA with anchored oligonucleotide dT and random hexamer primers (Integrated DNA Technologies) using Superscript II Reverse Transcriptase (Thermo Fisher Scientific) as per the manufacturer’s instructions.
  • qPCR reactions were performed using ⁇ 10 ng cDNA with Immolase DNA polymerase (Bioline), 500 nM of each primer and 250 nM probe in 10 m ⁇ reactions in 384-well plate format. Amplification reactions were run on an Applied Biosystems 7900HT (Thermo Fisher Scientific). All qPCR reactions were performed in triplicate for each sample and averaged.
  • the primers used were the following: Human RSAD2: hRSAD2-RT-FWD TGGTGAGGTTCTGCAAAGTAG; hRSAD2-RT-REV GTCACAGGAGATAGCGAGAATG; hlFITl: hlFITl-FWD
  • hIFI44 hIFI44-FWD ATGGCAGTGACAACTCGTTTG; hIFI44: TCCTGGTAACTCTCTTCTGCATA; hIFNB: hIFNB-FWD GCTTGGATTCCTACAAAGAAGCA; hIFNBREV:
  • the inventors initially investigated the activity of a panel of 11 2’OMe gapmer ASOs targeted to the mRNA of the innate immune sensor cGAS, on immune responses of undifferentiated THP-1 cells. Surprisingly, overnight pre-treatment with the ASOs led to strong potentiation of IP- 10 and TNF- ⁇ production upon R848 stimulation of TLR7/8 in the cells, for select ASOs (e.g. AS02, AS09, ASOll, but not AS04 - Figure 1A). Previous studies have reported that T-rich PS oligonucleotides could promote TLR8 sensing, while inhibiting TLR7 (Gorden et al., 2006; Jurk et al., 2006).
  • THP-1 can respond to both TLR7 and TLR8 ligands (Gantier et al., 2008), the inventors speculated that the sequence-specific effect of the ASOs on R848 sensing they observed could be due to their different activities on TLR7 and TLR8. To define this, the inventors next tested our panel of sequences in HEK 293 cells stably expressing TLR7 or TLR8 (referred to as HEK-TLR7 and HEKTLR8 hereafter), along with an NF- K B-luciferase reporter ( Figures IB, 1C, 8A and 8B).
  • TLR7 inhibition and TLR8 potentiation by select PS ASOs aligned with the previous reports that T-rich PS oligonucleotides could promote similar activities (Gorden et al., 2006; Jurk et al., 2006).
  • the finding that some 2’OMe ASO sequences had less inhibitory activity on TLR7 e.g. AS08 and ASOl 1
  • TLR7 inhibition promoted by the PS backbone may be counterbalanced in select 2’OMe gapmer ASOs.
  • the inventors reasoned that defining the modalities of this activity could help design ASOs with reduced immunosuppressive activities towards TLR7.
  • ASO 11 was able to potentiate TLR8 sensing of R848 while preserving TLR7 activity, suggested that the activities on TLR7 and 8 were not governed by the same sequence determinants.
  • the inventors screened a library of 192 2’OMe ASOs. It is noteworthy that these ASOs were designed to target 4 different transcripts (48 ASOs each), with a minimum of single base increments between the ASOs (Table 2). The screen was performed at two different ASO concentrations for each TLR and measured their impact on NF- K B luciferase induction by R848 in HEK-TLR7 and HEK-TLR8 cells ( Figures 2A, 2B and Table 2).
  • Table 2 196 ASO screen data.
  • the targeted gene names are provided in brackets (e.g. [EGFR]).
  • ASOs were synthesised with the following modifications: UPPERCASE alone for DNA, ‘m’ indicates 2'OMe base modifications, and *denotes the phosphorothioate backbone. Averaged NF- K B- Luciferase data from each screen at indicated ASO concentration is given (using l ⁇ g/ml R848 co-stimulation). Underlined sequences from the PINT family were studied further in Figure 3B and 3F. Sequences in black bold were used as 17 low TLR7 inhibitors and analysed with MEME for motif enrichment (along with [cGAS]AS08 and ASOl 1) shown in Figure 3A.
  • the inventors also analysed the PINT family (ASO108- 116) and [cGAS] ASO11 mutants for TLR8 potentiation. While two sequences were more potent (e.g. ASO108 and ASOl 10), most of the sequences displayed similar TLR8 potentiation, suggesting that the central region of these molecules was predominantly involved in TLR8 modulation ( Figures 3C, 3F). Similarly, the ASOl l mutations only mildly impacted TLR8 potentiation, although addition of the AS02 3’ end (ASOl l-Mutl) significantly decreased, while the AS02 5’ end (ASO11-Mut2) significantly increased TLR8 sensing ( Figures 3D, 3G). These results indicated that the control of TLR8 potentiation by 2’OMe-PS ASO was predominantly governed by the central 10-mer DNA region of the ASO, but that the 2’OMe ends also played a role.
  • the inventors also noted that the central 10-mer DNA region of the TLR8 potentiating AS0852 contained a central T-rich region (TTTCTGTGGT), while that of ASO2504 was A-rich (TAAAAAAATT). Comparison of the central DNA regions of the top and bottom 20 potentiators of TLR8 sensing confirmed a significant increased proportion of thymidine residues in the ASOs potentiating TLR8 sensing the most - with a median of 4 central thymidines ( Figure 3J and Table 2).
  • AS0852- dT was also more potent at inducing IP- 10 than AS0852, reaching similar levels of stimulation to those obtained with a 20-mer dT PS oligonucleotide (dT20) in THP-1 cells.
  • dT20 20-mer dT PS oligonucleotide
  • substitutions of the central regions for AS0852-dT and ASO2504-Mut did not significantly impact TLR7 sensing of R848, while dT20 blocked TLR7 activation. None of these ASOs used alone in HEK-TLR7, HEK-TLR8 or THP-1 cells impacted NF- K B luciferase in HEK cells and IP-10 production in THP-1 ( Figures 8A, 8B, 8D).
  • the inventors carried out RT-qPCR analyses of several IRF-driven genes including IFNB1, at 4 h after R848 stimulation of THP-1 cells. While little induction of IFIT1, RSAD2, IFI44 and IFNB1 was seen with R848 only, all these genes were significantly increased by co-stimulation with AS0852- dT ( Figure 4D). The inventors had observed that ASO co-stimulation strongly increased the sensitivity of TLR8 to R848 in HEK-TLR8 cells ( Figure 2D), suggesting that the effect seen on IFN-b induction may be due to increased sensitivity of TLR8 to R848.
  • IFN- -Luciferase reporter dose-responses to R848 (ranging from 1 to 15 ⁇ g/ml) in HEK-TLR8 cells demonstrated that high doses of R848 engaged the IFN-b response in these cells to a similar extent as with low dose R848+AS0852-dT.
  • the inventors next sought to establish proof-of-principle that bi-functional ASOs combining gene -targeting and TLR8 potentiation (while avoiding TLR7 inhibition) could be achieved.
  • the inventors tested a panel of 48 2OMe ASOs designed against the mRNA of the human HPRT gene.
  • ASOl-UC is a 22 nt molecule with appended 5’UC motif (with 7 2OMe bases on the 5’ end). While ASOl did not potentiate TLR8 in HEKTLR8 or THP-1 cells, its 5’end variant significantly promoted TLR8 potentiation in both models ( Figure 9). This is proof of principle that addition of a 5 ’ end UC motif could be used as a strategy to confer TLR8 potentiation to an otherwise non-potentiating 2’OMe gapmer ASOs.
  • the inventors also tested the effect of 5’end modification of ASO HPRT-660, which the inventors previously found was a strong potentiator of TLR8 (Fig. 5 - Alharbi et al., 2020).
  • the native sequence of ASO 660 contains a 5’CUU region, which the inventors mutated to a 5’GAA region (giving ASO 660-Mut).
  • This mutation entirely ablated TLR8 potentiation in HEK-TLR8 and THP-1 cells, confirming the importance of 5’end uridine residues in the potentiation of TLR8 by 2’OMe ASOs (Figure 9).
  • TLR8 potentiation is not limited to R848-like molecules
  • TLR8 R848-dependent activation of TLR8 is reliant on its binding to a site where uridine is normally binding (Tanji et al., 2015) (referred to as site 1).
  • site 1 a site where uridine is normally binding
  • site 2 degradation products of uridine-containing RNAs are binding to a second site of the TLR8 dimer (site 2), generally as short di nucleotides (e.g. UG or UUG or CG) (Tanji et al., 2015).
  • Uridine residues in the short RNAs binding to site 2 are not essential for TLR8 activation by uridine/R848 binding to site 1 as sensing of TLR8 by PS-ssRNA41 (lacking uridine) along with the TLR13 ligand Sal9 (with a single uridine residue) was potentiated with uridine (Shibata et al., 2016).
  • PS-polyA, polyC or polyG failed to potentiate TLR8 sensing of uridine - aligning with the structural data and rather suggesting binding to selective RNA motifs (Shibata et al., 2016).
  • TLR8 potentiation by 2’OMe ASOs is not limited to synthetic imidazoquinoline compounds and is also visible with natural uridine (which binds to site 1 of TLR8).
  • the CUU motif in ASO 660 is in a 5’ mCmUmU/mCmG context (all 2’OMe).
  • LNA AS02 Mut2 also contains a 5’ mCmUmU/+C+G context (where + is an LNA base). Since this does not result in TLR8 potentiation, the inventors speculate that the endonuclease necessary to release the CUU fragment is not effective in the context of an LNA base - noting that if the cleavage was operating at the 5 ’ mCmU/mU position, there would not be a difference of TLR8 potentiation between the LNA AS02 Mut2 and ASO 660, which both have this sequence.
  • TLR8 potentiation was greater than with LNA, but lesser than 2’OMe, with 50% (38/76) of the ASOs leading to >2 fold increased NF- K B luciferase at 500 nM, and with 34% (26/76) ASOs potentiating over 2 fold at 100 nM ( Figure 11).
  • the endonuclease degrading ASO Hl l in HEK cells may be absent in THP-1 cells).
  • the inventors also validated the results from the 2’MOE screen in a preliminary experiment in HEK-TLR8 cells (Figure 13). While this experiment only led to a modest TLR8 activation by R848 (which did not optimally activate the cells here), it validated the top potentiating ASOs (G9, D2, D7, B5, A9). Importantly, the inventors noted in the screen data that sequences with single nucleotide increments from the HPRT family exhibited different effects on TLR8.
  • TLR8 potentiation requires co-administration of site 1 and site 2 ligands
  • the inventors used a pre-treatment of the cells with their ASOs ( ⁇ 30 min in HEKs - overnight in THP-1 cells), prior to R848 stimulation.
  • the inventors always kept the ASOs in the supernatants during uridine or R848 stimulation.
  • the inventors pre-incubated PS-dT20 with HEK-TLR8 cells, and then washed them off prior to R848 stimulation ( Figure 14).
  • removal of dT20 from the supernatants at the time of R848 stimulation strongly decreased TLR8 potentiation by this oligonucleotide. This indicates that dT20 is rapidly degraded once in the endosome, and that its degradation products, presumably binding to site 2 of TLR8, are very short lived and essential to potentiate R848 activity.
  • EXAMPLE 12 TLR8 potentiation of co-cultured cells - and implications in cancer
  • the inventors were interested to test whether a cell transfected with one of their 2’OMe ASOs potentiating TLR8 (using 852dT as a model), when co-cultured with phagocytes, could potentiate TLR8 sensing in phagocytes.
  • the inventors reasoned that unprocessed ASOs or their degradation products could favor R848 sensing of TLR8, on the basis of a recent publication that showed that phagocytosis of apoptotic cells transfected with synthetic PS- modified DNA molecules resulted in phago-lysosomal delivery of the DNA in the phagocytes (Ahn et al., 2018).
  • the inventors also tested the capacity of fully 2’OMe-modified ASOs (with no central DNA « gap ») to potentiate TLR8. For this, the inventors compared the effect of ASO C2Mutl, and its variants either fully lacking 2’OMe (referred to as C2Mutl-PS), or fully 2’OMe modified (C2Mutl-20Me). These experiments showed that even in the absence of a central DNA region, this ASO was still significantly potentiating TLR8 (noting that this family of ASOs was not a strong potentiator compared to other sequences) (Figure 16).
  • LNA AS02 mut2 (also harboring a 5’ mCmUmU motif) retained TLR7 inhibition. Addition of a 5’UC motif in ASO 1-UC did not alter TLR7 inhibition (while it did strongly increase TLR8 potentiation).
  • TLR7 inhibition was predominant, with only 85% (78/91) of the ASOs leading to 50% decreased NF- K B luciferase at 500 nM, and 52% (48/91) of the ASOs leading to 80% decreased NF- K B luciferase at that dose.
  • TLR7 inhibition was however a bit less frequent than what the inventors observed for 2’OMe, for which >78% of the molecules inhibited TLR7 sensing by 80% fold at 500 nM (Fig. 2 - Alharbi et al., 2020).
  • the inventors next sought to validate these results in repeat experiments, focusing on the ASOs that did not inhibit TLR7. Specifically, the inventors noted that the LNA ASOs A9, H11, D1, H1 all had a 5’ +C+C motif (+ denotes LNA modification) - and that such motif was absent in all the strong TLR7 inhibitor (i.e. with > 75% inhibition at 500 nM). The inventors also included Al l, B1 and Cl l that inhibited TLR7.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Saccharide Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/AU2021/050469 2020-05-19 2021-05-19 Oligonucleotides Ceased WO2021232099A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
CA3171986A CA3171986A1 (en) 2020-05-19 2021-05-19 Oligonucleotides
US17/926,383 US20230348903A1 (en) 2020-05-19 2021-05-19 Oligonucleotides
JP2022570608A JP2023526090A (ja) 2020-05-19 2021-05-19 オリゴヌクレオチド
BR112022023310A BR112022023310A2 (pt) 2020-05-19 2021-05-19 Oligonucleotídeos
KR1020227044467A KR20230013266A (ko) 2020-05-19 2021-05-19 올리고뉴클레오티드
MX2022014495A MX2022014495A (es) 2020-05-19 2021-05-19 Oligonucleotidos.
EP21807588.5A EP4153751A4 (en) 2020-05-19 2021-05-19 Oligonucleotides
AU2021276730A AU2021276730A1 (en) 2020-05-19 2021-05-19 Oligonucleotides
CN202180049291.1A CN115916978A (zh) 2020-05-19 2021-05-19 寡核苷酸
US18/213,116 US12448622B2 (en) 2020-05-19 2023-06-22 Oligonucleotides

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2020901606 2020-05-19
AU2020901606A AU2020901606A0 (en) 2020-05-19 Oligonucleotides

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US17/926,383 A-371-Of-International US20230348903A1 (en) 2020-05-19 2021-05-19 Oligonucleotides
US18/213,116 Continuation US12448622B2 (en) 2020-05-19 2023-06-22 Oligonucleotides

Publications (1)

Publication Number Publication Date
WO2021232099A1 true WO2021232099A1 (en) 2021-11-25

Family

ID=78708815

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2021/050469 Ceased WO2021232099A1 (en) 2020-05-19 2021-05-19 Oligonucleotides

Country Status (10)

Country Link
US (2) US20230348903A1 (https=)
EP (1) EP4153751A4 (https=)
JP (1) JP2023526090A (https=)
KR (1) KR20230013266A (https=)
CN (1) CN115916978A (https=)
AU (1) AU2021276730A1 (https=)
BR (1) BR112022023310A2 (https=)
CA (1) CA3171986A1 (https=)
MX (1) MX2022014495A (https=)
WO (1) WO2021232099A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022213153A1 (en) * 2021-04-08 2022-10-13 Hudson Institute of Medical Research Oligonucleotides
US12448622B2 (en) 2020-05-19 2025-10-21 Hudson Institute of Medical Research Oligonucleotides

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118460654B (zh) * 2024-07-10 2025-02-14 凯莱英医药集团(天津)股份有限公司 一种Givosiran的制备方法
CN119592567B (zh) * 2024-12-10 2025-12-02 浙江大学 基于肿瘤剪接转换治疗的反义寡核苷酸及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007031319A1 (en) * 2005-09-14 2007-03-22 Gunther Hartmann Compositions comprising immunostimulatory rna oligonucleotides and methods for producing said rna oligonucleotides

Family Cites Families (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6320041B1 (en) 2001-04-13 2001-11-20 Trilink Biotechnologies, Inc. Pre-activated carbonyl linkers for the modification of oligonucleotides
US8153141B2 (en) 2002-04-04 2012-04-10 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US20050239733A1 (en) 2003-10-31 2005-10-27 Coley Pharmaceutical Gmbh Sequence requirements for inhibitory oligonucleotides
WO2005097993A2 (en) * 2004-02-19 2005-10-20 Coley Pharmaceutical Group, Inc. Immunostimulatory viral rna oligonucleotides
WO2006063152A2 (en) * 2004-12-08 2006-06-15 3M Innovative Properties Company Immunostimulatory combinations and methods
EP1819365B1 (en) 2004-12-09 2014-07-02 Alnylam Pharmaceuticals Inc. Compositions and methods for inducing an immune response in a mammal and methods of avoiding an immune response to oligonucleotide agents such as short interfering RNAs
CN101160401A (zh) * 2005-02-24 2008-04-09 科勒制药集团公司 免疫刺激寡核苷酸
US8076068B2 (en) 2005-09-14 2011-12-13 Gunther Hartmann Method for determining immunostimulatory activity of RNA oligonucleotides
KR20080059595A (ko) * 2005-09-27 2008-06-30 콜리 파마슈티칼 게엠베하 어댑터 올리고뉴클레오티드를 사용하는 tlr-매개 면역반응의 조절
PL1957647T3 (pl) * 2005-11-25 2015-07-31 Zoetis Belgium S A Oligorybonukleotydy immunostymulujące
CN101331229B (zh) * 2005-11-25 2012-08-29 科勒制药股份公司 免疫刺激性寡核糖核苷酸
EP2021008B1 (en) * 2006-04-07 2015-12-02 Idera Pharmaceuticals, Inc. Stabilized immune modulatory rna (simra) compounds for tlr7 and tlr8
AU2007268075C1 (en) 2006-06-01 2013-03-07 Trilink Biotechnologies Chemically modified oligonucleotide primers for nucleic acid amplification
AU2007280690C1 (en) * 2006-07-31 2012-08-23 Curevac Gmbh Nucleic acid of formula (I): GIXmGn, or (II): CIXmCn, in particular as an immune-stimulating agent/adjuvant
EP3342415B1 (en) * 2006-08-08 2022-01-26 Rheinische Friedrich-Wilhelms-Universität Bonn Structure and use of 5' phosphate oligonucleotides
WO2008019486A1 (en) 2006-08-16 2008-02-21 Protiva Biotherapeutics, Inc. Nucleic acid modulation of toll-like receptor-mediated immune stimulation
CA2692161C (en) * 2007-07-09 2015-09-29 Idera Pharmaceuticals, Inc. Stabilized immune modulatory rna (simra) compounds
JP5753382B2 (ja) * 2007-11-06 2015-07-22 アディウティーダ ファーマシューティカルズ ゲーエムベーハー 修飾されたオリゴリン酸基を含有する免疫賦活オリゴリボヌクレオチドアナログ
US20100047188A1 (en) * 2008-08-04 2010-02-25 Idera Pharmaceuticals, Inc. Modulation of toll-like receptor 8 expression by antisense oligonucleotides
US9631227B2 (en) 2009-07-06 2017-04-25 Trilink Biotechnologies, Inc. Chemically modified ligase cofactors, donors and acceptors
EP3191591A1 (en) * 2014-09-12 2017-07-19 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting complement component c5 and methods of use thereof
WO2016205323A1 (en) * 2015-06-18 2016-12-22 Alnylam Pharmaceuticals, Inc. Polynucleotde agents targeting hydroxyacid oxidase (glycolate oxidase, hao1) and methods of use thereof
ES2964690T3 (es) 2015-09-21 2024-04-09 Trilink Biotechnologies Llc Método para sintetizar ARN con caperuza 5'
WO2017100587A1 (en) * 2015-12-09 2017-06-15 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting programmed cell death 1 ligand 1 (pd-l1) and methods of use thereof
WO2018184003A1 (en) 2017-03-31 2018-10-04 Dana-Farber Cancer Institute, Inc. Modulating dsrna editing, sensing, and metabolism to increase tumor immunity and improve the efficacy of cancer immunotherapy and/or modulators of intratumoral interferon
US11603532B2 (en) * 2017-06-02 2023-03-14 Wave Life Sciences Ltd. Oligonucleotide compositions and methods of use thereof
CN115916978A (zh) 2020-05-19 2023-04-04 哈德森医学研究所 寡核苷酸

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007031319A1 (en) * 2005-09-14 2007-03-22 Gunther Hartmann Compositions comprising immunostimulatory rna oligonucleotides and methods for producing said rna oligonucleotides

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
AGRAWAL, S. ET AL.: "Mixed-backbone oligonucleotides as second generation antisense oligonucleotides: In vitro and in vivo studies", PROC. NATL. ACAD. SCI. USA., vol. 94, pages 2620 - 2625, XP002376373, DOI: 10.1073/pnas.94.6.2620 *
GOODCHILD, A. ET AL.: "Sequence determinants of innate immune activation by short interfering RNAs", BMC IMMUNOLOGY, vol. 10, 2009, pages 40, XP021056282, DOI: 10.1186/1471-2172-10-40 *
GORDEN, K. K. B. ET AL.: "Oligodeoxynucleotides differentially modulate activation of TLR7 and TLR8 by imidazoquinolines", J. IMMUNOL., vol. 177, 2006, pages 8164 - 8170, XP002610474 *
JURK, M. ET AL.: "Modulating responsiveness of human TLR7 and 8 to small molecule ligands with T-rich phosphorothiate oligodeoxynucleotides", EUR. J. IMMUNOL., vol. 36, 2006, pages 1815 - 1826, XP002474376, DOI: 10.1002/eji.200535806 *
KAND1MALLA, E. R. ET AL.: "Mixed backbone antisense oligonucleotides: design, biochemical and biological properties of oligonucleotides containing 2'-5'-ribo- and 3'-5'-deoxyribonucleotide segments", NUCLEIC ACIDS RESEARCH, vol. 25, 1997, pages 370 - 378, XP002598043, DOI: 10.1093/nar/25.2.370 *
See also references of EP4153751A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12448622B2 (en) 2020-05-19 2025-10-21 Hudson Institute of Medical Research Oligonucleotides
WO2022213153A1 (en) * 2021-04-08 2022-10-13 Hudson Institute of Medical Research Oligonucleotides

Also Published As

Publication number Publication date
US20240287510A1 (en) 2024-08-29
EP4153751A1 (en) 2023-03-29
CN115916978A (zh) 2023-04-04
EP4153751A4 (en) 2025-12-17
AU2021276730A1 (en) 2023-01-05
KR20230013266A (ko) 2023-01-26
US12448622B2 (en) 2025-10-21
BR112022023310A2 (pt) 2023-01-24
CA3171986A1 (en) 2021-11-25
US20230348903A1 (en) 2023-11-02
MX2022014495A (es) 2023-03-10
JP2023526090A (ja) 2023-06-20

Similar Documents

Publication Publication Date Title
US12448622B2 (en) Oligonucleotides
EP4023228A1 (en) Genome editing oligonucleotide without programmable nucleases
CN111893117B (zh) 治疗杜兴型肌营养不良症和贝克型肌营养不良症的具有改善特性的rna调节性寡核苷酸
JP2020039361A (ja) 筋強直性ジストロフィープロテインキナーゼ(dmpk)の発現を調節するための化合物及び方法
CN105452461B (zh) 生长激素受体的调节剂
CN105324119A (zh) 具有外显子跳跃效应的双链反义核酸
US20250243483A1 (en) Oligonucleotides
US20260062703A1 (en) Delivery of RNA Therapeutics Using Circular Prodrug Nucleic Acids
CN116370491A (zh) 反义寡核苷酸剂在治疗冠状病毒相关疾病中的应用
US20080255066A1 (en) Antisense oligonucleotide strategies for the enhancement of cancer therapies
CN117043340A (zh) 寡核苷酸
US12590307B2 (en) Translation enhancing nucleic acid compounds: ASO coupled translation-upregulation 1 (ACT-UP1) and uses thereof
RU2854980C2 (ru) Композиции и способы ингибирования экспрессии ангиопоэтин-подобного белка 3 (angptl3)
US20220073932A1 (en) Antisense oligonucleotides for allele specificity
JP7208911B2 (ja) 核酸分子発現の調節
HK40129500A (en) Translation enhancing nucleic acid compounds: aso coupled translation - upregulation 1 (act-up1) and uses thereof
WO2025165891A1 (en) Translation enhancing nucleic acid compounds: aso coupled translation - upregulation 1 (act-up1) and uses thereof
JP2025542119A (ja) パタチン様ホスホリパーゼドメイン含有3(pnpla3)の発現を阻害するための組成物及び方法
CN121002043A (zh) 环状反义核酸疗法
HK40079272A (en) Compounds and methods useful for modulating gene splicing

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21807588

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3171986

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022570608

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022023310

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 20227044467

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021807588

Country of ref document: EP

Effective date: 20221219

ENP Entry into the national phase

Ref document number: 2021276730

Country of ref document: AU

Date of ref document: 20210519

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112022023310

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20221116

WWE Wipo information: entry into national phase

Ref document number: 202327045130

Country of ref document: IN