WO2021085852A1 - 질소결핍 유도성 프로모터, 클로렐라 유래 신호 펩타이드 및 이를 포함하는 유전자 발현 시스템 - Google Patents

질소결핍 유도성 프로모터, 클로렐라 유래 신호 펩타이드 및 이를 포함하는 유전자 발현 시스템 Download PDF

Info

Publication number
WO2021085852A1
WO2021085852A1 PCT/KR2020/012425 KR2020012425W WO2021085852A1 WO 2021085852 A1 WO2021085852 A1 WO 2021085852A1 KR 2020012425 W KR2020012425 W KR 2020012425W WO 2021085852 A1 WO2021085852 A1 WO 2021085852A1
Authority
WO
WIPO (PCT)
Prior art keywords
chlorella
signal peptide
expression
present
gene
Prior art date
Application number
PCT/KR2020/012425
Other languages
English (en)
French (fr)
Inventor
김성룡
신준혜
Original Assignee
주식회사 피토맵
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 피토맵 filed Critical 주식회사 피토맵
Publication of WO2021085852A1 publication Critical patent/WO2021085852A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/53—Colony-stimulating factor [CSF]
    • C07K14/535—Granulocyte CSF; Granulocyte-macrophage CSF
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor

Definitions

  • the present invention was made in accordance with the project number 201955005 under the support of the Ministry of Oceans and Fisheries, and the research management institution of the project is the Polar Research Institute affiliated with Korea Ocean Research Institute, the name of the research project is "Research Service (other ceremonies 3)", and the name of the research project is "Polar Chlorella.
  • the expression system of the immune enhancing protein CSF through the transformation of the leading institution is the Sogang University Industry-Academic Cooperation Foundation, and the research period is from 2019.06.01 to 2020.05.31.
  • the present invention was made by the project number PJ01365901 under the support of the Rural Development Administration.
  • the research management institution for the project is the Research Center for Agricultural Biotechnology, the name of the research project is "Next Generation Biogreen 21", and the name of the research project is "Human-like glycoprotein production rice. Cell Line Development", the leading institution is the Sogang University Industry-Academic Cooperation Foundation, and the research period is 2018.02.01 ⁇ 2020.12.31.
  • the present invention relates to a nitrogen deficiency inducible promoter, a chlorella-derived signal peptide, and a gene expression system comprising the same.
  • Chlorella is a single-celled eukaryote belonging to green algae that grows by adapting to various growth environments, and has a fast growth characteristic that divides into four cells in about 6 hours.
  • useful substances such as lipids in cells and is a high nutrient, it is used commercially based on several advantages, such as being widely edible not only as a raw material for biodiesel but also as a generally safe substance (GRAS) have.
  • GRAS generally safe substance
  • chlorella transformation technology In order to establish a stable recombinant protein production platform in chlorella, the development of chlorella transformation technology should be preceded, and various techniques have been developed so far, and the present inventors have established a high-efficiency transformation system using an electroporation method. have.
  • the present inventors have made intensive research efforts to develop a gene expression control system that specifically induces gene expression under nitrogen deficiency conditions.
  • the present invention was completed by finding that the CANDI2 promoter discovered from Chlorella strongly induces the expression of the target gene under nitrogen deficiency conditions, and that the novel signal peptide discovered from Chlorella can effectively secrete the target protein outside the cell. was done.
  • an object of the present invention is to provide a nitrogen deficiency inducible promoter.
  • Another object of the present invention is to provide a novel signal peptide derived from chlorella.
  • Another object of the present invention is to provide an expression vector comprising the promoter of the present invention.
  • Another object of the present invention is to provide a transformant transformed with the expression vector of the present invention.
  • Another object of the present invention is to provide a method for expressing a foreign gene comprising the step of culturing the transformant of the present invention under nitrogen deficiency conditions.
  • Another object of the present invention is to provide a method for producing a foreign protein comprising culturing the transformant of the present invention in nitrogen-deficient conditions.
  • the present invention relates to a nitrogen deficiency inducible promoter comprising the nucleotide sequence represented by SEQ ID NO: 1.
  • the present inventors have made intensive research efforts to develop a gene expression control system that specifically induces gene expression under nitrogen deficiency conditions, and as a result, the CANDI2 promoter discovered from Chlorella strongly induces the expression of the target gene under nitrogen deficiency conditions. , It was found that a novel signal peptide discovered from chlorella can effectively secrete a target protein into the extracellular area.
  • promoter refers to a DNA sequence that regulates the expression of a gene encoding a foreign protein operably linked in a specific host cell.
  • the present inventors selected a scaffold with increased expression under nitrogen deficiency conditions of chlorella, named it CANDI2 ( Chlorella sp. ArM00029B Nitrogen Deficiency Inducible 2 ) gene, and discovered a promoter present upstream of the gene.
  • CANDI2 Chlorella sp. ArM00029B Nitrogen Deficiency Inducible 2
  • the promoter of the present invention is derived from chlorella, means that it exists upstream of the gene encoding the CANDI2 protein of chlorella, and any nucleotide sequence derived from nature or artificially synthesized can be used as the promoter.
  • the promoter may include a nucleotide sequence represented by SEQ ID NO: 1.
  • the nucleotide sequence represented by SEQ ID NO: 1 induces and enhances'expression' of a gene encoding a foreign protein operably linked downstream, that is, to the 3'end of the nucleotide sequence.
  • the nucleotide sequence represented by SEQ ID NO: 1 is only the smallest unit of a promoter having the property of inducing and improving the expression of the gene as described above, and the sequence of the promoter is not limited to the nucleotide sequence of SEQ ID NO: 1.
  • the present invention relates to a signal peptide for chlorella-derived cellulase consisting of the amino acid sequence represented by SEQ ID NO: 2.
  • the present invention provides a signal peptide consisting of an amino acid sequence represented by SEQ ID NO: 2 and a variant peptide thereof.
  • the "variant peptide" for the signal peptide represented by SEQ ID NO: 2 means a peptide in which one or more amino acid residues of the signal peptide represented by SEQ ID NO: 2 are deleted, added, inserted or substituted. As such, it refers to a peptide capable of performing the function of a signal peptide to secrete a protein out of a cell in the same manner as the signal peptide represented by SEQ ID NO: 2.
  • the gene encoding the signal peptide of the present invention includes all kinds of nucleotide sequences capable of encoding the amino acid represented by SEQ ID NO: 2.
  • the gene encoding the mutant peptide of the present invention also includes all kinds of nucleotide sequences capable of encoding the mutant peptide as in the case of the signal peptide, and is not limited by any specific nucleotide sequence.
  • the present invention relates to a signal peptide for Ras-related RABF1 (Ras-related RABF1) derived from Chlorella consisting of the amino acid sequence represented by SEQ ID NO: 3.
  • the present invention provides a signal peptide consisting of an amino acid sequence represented by SEQ ID NO: 3 and a variant peptide thereof.
  • the "variant peptide" for the signal peptide represented by SEQ ID NO: 3 means a peptide in which one or more amino acid residues of the signal peptide represented by SEQ ID NO: 3 are deleted, added, inserted or substituted. As a result, it refers to a peptide capable of performing the function of a signal peptide to secrete a protein out of a cell in the same manner as the signal peptide represented by SEQ ID NO: 3.
  • the gene encoding the signal peptide of the present invention includes all kinds of nucleotide sequences capable of encoding the amino acid represented by SEQ ID NO: 3.
  • the gene encoding the mutant peptide of the present invention also includes all kinds of nucleotide sequences capable of encoding the mutant peptide as in the case of the signal peptide, and is not limited by any specific nucleotide sequence.
  • the signal peptide of the present invention is a signal peptide for secreting proteins from microalgae, preferably green algae, and most preferably chlorella, to extracellularly with high efficiency.
  • a recombinant protein can be obtained in a high yield in a cell culture medium.
  • the present invention relates to an expression vector comprising the nitrogen deficiency inducible promoter and a transformant transformed with the expression vector.
  • expression vector is a vector capable of expressing a foreign gene of interest in a host cell, and refers to a vector including essential regulatory elements operably linked so that the gene insert is expressed.
  • Suitable expression vectors include, in addition to expression control sequences such as promoters, operators, start codons, stop codons, polyadenylation signals and enhancers, signal peptide sequences or leader sequences for membrane targeting or secretion, and can be variously prepared according to the purpose. .
  • the expression vector of the present invention may further include a nucleotide sequence encoding a signal peptide represented by SEQ ID NO: 2 or SEQ ID NO: 3.
  • operably linked refers to a functional linkage between a nucleic acid expression control sequence (eg, a promoter, a signal peptide sequence, or an array of transcriptional regulatory factor binding sites) and another nucleic acid sequence, thereby regulating the The sequence controls the transcription and/or translation of the other nucleic acid sequence.
  • a nucleic acid expression control sequence eg, a promoter, a signal peptide sequence, or an array of transcriptional regulatory factor binding sites
  • the nitrogen deficiency inducible promoter is included in the expression vector, and expression of a gene encoding a foreign protein operably linked downstream of the promoter can be regulated in a nitrogen deficiency-dependent manner.
  • the foreign protein refers to a protein to be produced, and may be any type of protein whose nucleotide sequence is known.
  • the foreign protein may be a hormone, a hormone analogue, an enzyme, an enzyme inhibitor, an antibody, and a fragment thereof, and may be, for example, a Granulocyte-Colony Stimulating Factor (G-CSF).
  • G-CSF Granulocyte-Colony Stimulating Factor
  • the expression vector may further include a multiple cloning site (MCS) into which a gene encoding a foreign protein can be operably inserted into the promoter.
  • MCS multiple cloning site
  • the gene encoding the foreign protein can be easily inserted into the expression vector by using the multi-cloning site.
  • the expression vector may further include a selection marker for selecting host cells containing the vector.
  • the selection marker may be all types of conventionally known selection markers, and an antibiotic resistance gene or a light-emitting gene may be used, but is not limited thereto.
  • the expression vector may be obtained by introducing the nitrogen deficiency inducible promoter into a conventionally known expression vector, or may be a recombinant expression vector artificially designed by a known method.
  • the introduction of the nitrogen deficiency inducible promoter to prepare an expression vector can be easily carried out by a person skilled in the art according to a known method.
  • Vectors for the production of the expression vector can be used a variety of known vectors capable of introducing the nitrogen deficiency inducible promoter, for example, may be a plasmid vector, a cozmid vector, a bacteriophage vector, a viral vector, etc. .
  • a vector stably present in host cells such as microalgae or plants and has a large number of copies.
  • the expression vector is introduced into a host cell, and the host cell can be transformed with the expression vector.
  • transformation refers to the genotyping of a cell by introducing a DNA chain fragment or plasmid containing a different kind of foreign gene from that of the original cell and binding it with the DNA existing in the original cell. It refers to a molecular biology technology that changes
  • the transformation means that the signal peptide, the nitrogen deficiency inducible promoter, and the gene encoding the target protein are inserted into a host cell to express the target protein.
  • the transformation can be easily performed by a person skilled in the art by a conventionally known transformation technology, and the transformation technology is a transformation method using glass beads known by Kindle (1990), a protoplast using a calcium/polyethylene glycol method. Transformation method, electroporation method, microinjection method, particle bombardment method, electrophration method, Agrobacterium method, gene gun or physical introduction method.
  • the transformation technique can be appropriately selected and performed by a person skilled in the art according to the type and characteristics of the host cell.
  • the host cell for transforming the expression vector is preferably a microalgae or plant, for example, may be chlorella, but is not limited thereto, and all cells having an RNA polymerase capable of recognizing the promoter of the present invention are Can be used.
  • the transformant transformed with the expression vector may be a microalgae or a plant.
  • the microalgae may be green algae, for example, chlorella.
  • the plant includes not only mature plants but also plant cells, plant tissues, and seeds of plants that can develop into mature plants.
  • the present invention relates to a gene construct in which a gene encoding a foreign protein is operably linked to a nitrogen deficiency inducible promoter comprising the nucleotide sequence represented by SEQ ID NO: 1.
  • the present invention relates to an expression vector comprising the gene construct and a transformant transformed with the expression vector.
  • the foreign protein refers to a protein to be produced, and may be any type of protein whose nucleotide sequence is known.
  • the foreign protein may be a hormone, a hormone analogue, an enzyme, an enzyme inhibitor, an antibody, and a fragment thereof, and may be, for example, a Granulocyte-Colony Stimulating Factor (G-CSF).
  • G-CSF Granulocyte-Colony Stimulating Factor
  • the gene encoding the foreign protein is operably linked to the nitrogen deficiency inducible promoter.
  • the operably linked means that the expression of the foreign gene is linked so that the expression of the foreign gene can be regulated by the activity of the nitrogen deficiency inducible promoter. Accordingly, the gene construct formed by operably linking a gene encoding a foreign protein to the nitrogen deficiency inducible promoter becomes an expression cassette that functions as a unit for expressing the gene encoding the foreign protein.
  • the gene construct is included in the expression vector, and the expression of the gene encoding the foreign protein can be regulated in a nitrogen-deficiency-dependent manner.
  • the expression vector including the gene construct may be introduced into a host cell, and the host cell may be transformed with the expression vector.
  • the transformant formed as described above can be used to express the foreign gene.
  • the present invention relates to a method of expressing a foreign gene comprising culturing the transformant under nitrogen deficiency conditions.
  • the culture may be appropriately performed by a person skilled in the art by varying the culture method, culture medium, culture conditions, etc. according to the type and characteristics of the transformant.
  • nitrogen deficiency can be induced using a nitrogen deficiency medium.
  • Expression of a gene encoding a foreign protein is induced in the transformant by the nitrogen deficiency, and the expression of the gene is regulated by the activity of a nitrogen deficiency inducible promoter.
  • Foreign genes can be easily expressed by using the gene construct as described above, an expression vector containing the same, and a transformant containing the expression vector.
  • the present invention relates to a method for producing a foreign protein comprising culturing the transformant under nitrogen deficiency conditions.
  • the foreign protein production method may further include the step of obtaining the foreign protein from the culture medium after culturing the transformant.
  • the transformant used in the foreign protein production method contains a signal peptide capable of secreting the transformed foreign protein to the outside of the cell, the desired foreign protein can be easily obtained from the culture medium after cultivation.
  • Foreign proteins can be isolated or recovered from the culture medium of the transformant using various methods known in the art. For example, it may be separated from the culture medium through a method including centrifugation, filtration, extraction, spray drying, evaporation or precipitation, but is not limited thereto.
  • foreign proteins include chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion), electrophoresis, fractional solubility (e.g., ammonium sulfate precipitation), or extraction of a variety of known in the art. It can be purified through the method.
  • the present invention relates to a nitrogen deficiency inducible promoter, a chlorella-derived signal peptide, and a gene expression system including the same, and can easily control gene expression and protein production under nitrogen deficiency conditions.
  • a nitrogen deficiency inducible promoter a chlorella-derived signal peptide
  • a gene expression system including the same can easily control gene expression and protein production under nitrogen deficiency conditions.
  • foreign proteins produced in chlorella can be secreted out of cells, and thus, industrially useful proteins can be usefully used for production and purification in chlorella.
  • 1A shows the expression pattern according to the results of RNA-Seq screening of chlorella under nitrogen deficiency conditions.
  • 1B to 1E are the results of qRT-PCR analysis of candidate genes under nitrogen deficiency conditions.
  • 2A and 2B are alignment results for the CANDI1 amino acid sequence.
  • 3A and 3B are alignment results for the CANDI2 amino acid sequence.
  • Figure 4 is a schematic diagram of the hG-CSF expression vector regulated by the CANDI promoter.
  • 5A is a genomic DNA PCR result for transformed chlorella UTEX395 and ArM0029B.
  • Figure 5b shows the expression of the hG-CSF transcript under nitrogen deficiency condition of the transformed chlorella UTEX395.
  • Figure 5c shows the expression of hG-CSF transcript in nitrogen deficiency condition of transformed chlorella ArM0029B.
  • 6A is a result of culturing transformed chlorella in a normal nitrogen-rich medium, and then transferring it to a nitrogen-deficient medium and confirming the expression of hG-CSF polypeptide.
  • M is a size marker
  • 1 is UTEX395-pSK401
  • 2 is UTEX395-pSK403
  • 3 is ArM0029B-pSK402
  • 4 is ArM0029B-pSK404
  • + is hG-CSF positive control.
  • Figure 6b is a result of confirming the expression of the hG-CSF polypeptide in the cell lysate or culture medium of the transformed chlorella ArM0029B-pSK404.
  • M denotes a size marker
  • C1 denotes a cell lysate
  • C2 denotes a sample of C1 denatured at 95° C. and then cultured overnight at 4° C.
  • L denotes a concentrated culture solution.
  • the present invention relates to a nitrogen deficiency inducible promoter comprising the nucleotide sequence represented by SEQ ID NO: 1.
  • Chlorella vulgaris ssp. UTEX395 and polar Chlorella sp . ArM0029B was cultured at 25°C in BG11 medium containing 3% glucose. Electroporation was performed for transformation of chlorella. The transformed chlorella colonies were transferred to a liquid medium and further cultured. The cultured cells were transferred to a liquid medium without glucose or nitrogen to induce expression of the hG-CSF gene for 3 days. RNA and protein were extracted by collecting cells and culture medium.
  • RNA sequencing was performed for ArM0029B. Through differential expression analysis using RNA sequencing data, genes showing a significant increase in nitrogen deficiency were screened (Table 2).
  • the transcription level of scaffold326G00910 has been shown to increase by a factor of 20.
  • the other three genes scaffold326G00270 , 73G00080, and 253G00910
  • Table 2 the other three genes ( scaffold326G00270 , 73G00080, and 253G00910 ) also rapidly increased the amount of transcription (Table 2).
  • chlorella was cultured in a nitrogen-deficient medium for 3 days, and then RT/qRT-PCR was performed. It was found that the transcripts of scaffold326G00910 and 326G00270 were significantly accumulated under the same conditions as the differential expression analysis results (FIG. 1 ).
  • scaffold326G00910 The expression of scaffold326G00910 was rapidly induced on day 1 in nitrogen-deficient medium and maintained until day 2, and the expression level decreased by half on day 3. scaffold326G00270 showed a similar expression pattern to scaffold326G00910.
  • the scaffold326G00270 transcript was hardly detected in the medium containing nitrogen and showed specific expression of nitrogen deficiency.
  • the other genes scaffold37G001690 and 73G00080
  • scaffold326G00910 and 326G00270 were finally selected to develop a nitrogen deficiency inducible promoter system, and these were named CANDI1 ( Chlorella sp. ArM00029B Nitrogen Deficiency Inducible 1 ) and CANDI2 , respectively.
  • the CANDI2 sequence showed 73% and 74% homology with the ammonium transporters of M. conductrix and C. sorokiniana, respectively (Fig. 3). Ammonium transporters play an important role in nitrogen metabolism to balance nitrogen levels in cells. Therefore, CANDI1 and CANDI2 genes are expected to be involved in metabolism to maintain a nitrogen source for cell survival in nitrogen deficient conditions.
  • the sequence of the promoter region over the 1 kb-length region upstream of the translation initiation codon (ATG) including the 5'- UTR (untranslated region) Amplified using Mick DNA was constructed by cloning based on pJKS136.
  • the CANDI2 promoter sequence obtained from the genomic DNA of ArM0029B was inserted into pJKS136 using restriction enzymes Hin dIII and Bam HI to replace the RAmy3D promoter.
  • an appropriate signal peptide is also an essential factor in establishing an efficient protein expression system for secretion.
  • the use of signal peptides makes it easy to obtain proteins in liquid medium. Chlorella spp .
  • the proteins secreted into the medium were purified and then analyzed by mass spectrometry.
  • putative cellulase and Ras-related RABF1 were selected as proteins highly secreted by UTEX395 and ArM0029B, respectively.
  • the signal peptide sequence analyzed in silico using the SignalP program was fused in front of the codon-optimized hG-CSF sequence (FIG. 4).
  • the hG-CSF sequence fused with the signal peptide was inserted into the region between the CANDI promoter and the RAmy3D terminator using restriction enzymes Kpn I and Bam HI (FIG. 4).
  • the vector with the signal peptide of the cellulase of UTEX395 was named pSK401 and pSK403, which are controlled by the CANDI1 and CANDI2 promoters, respectively.
  • the vector having the signal peptide of Ras-related RABF1 of ArM0029B was named pSK402 and pSK404, which are controlled by the CANDI1 and CANDI2 promoters, respectively (Fig. 4). These vectors were electroporated using Chlorella spp . Introduced in.
  • Hygromycin-resistant colonies of UTEX395 and ArM0029B were obtained from the selection agar plate within 4 weeks of transformation. Individual colonies were transferred to a liquid medium containing hygromycin and incubated for 7 days.
  • the genomic DNA obtained from the culture medium was PCR using the hG-CSF primer (Table 1).
  • Figure 5a the introduction of the hG-CSF gene into Chlorella spp . was confirmed in the UTEX395 line containing pSK401 or pSK403 (left panel of Fig. 5A) and the ArM0029B line containing pSK402 or pSK404 (Fig. Right panel). These transformants have been successfully maintained for at least 1 year, indicating the stability of the transformation as previously reported.
  • transformed chlorella cultured in a standard nitrogen-rich liquid medium was transferred to a nitrogen-deficient medium and cultured for 3 days.
  • Cells were sampled on days 2 and 3 by centrifugation, and total RNA was extracted from the cells.
  • RNA was reverse transcribed and RT-PCR was performed using primers for detecting hG-CSF transcripts.
  • FIG. 5B the UTEX395 and ArM00029B transformed lines driven by the CANDI1 or CANDI2 promoter showed hG-CSF expression on the 2nd and 3rd days.
  • Chlorella cultured in a glucose- or nitrogen-deficient medium was collected by centrifugation at 8,000 rpm for 20 minutes, and then separated into a culture solution and chlorella, respectively.
  • chlorella cells were dispersed in 1M PBS buffer (pH 7.4) containing 1x Complete (Roche, Germany) and then homogenized. The homogenized solution was centrifuged at 14,000 rpm for 10 minutes, and then the supernatant was transferred to a new tube.
  • the culture solution was filtered with a 0.2 ⁇ m membrane, and then concentrated with a 5 kD cut-off Viva Flow 200 and Vivaspin 20 (Sartourious, USA).
  • the total protein obtained from the cell lysate and the culture medium was separated on a 12% NuPAGE gel (Invitrogen, USA), and then transferred to a nitrocellulose membrane.
  • the membrane was reacted with a polyclonal antibody against hG-CSF for 1 hour, and then reacted with an anti-rabbit IgG-HRP antibody.
  • HG-CSF synthesized in E. coli (Abcam, USA) was used as a positive control.
  • ArM0029B containing pSK404 induces high hG-CSF compared to other transformation lines (middle panel of FIG. 6A). Based on the results, the production of hG-CSF polypeptide was investigated using a transformed ArM0029B containing pSK404 under nitrogen deficiency. Cells cultured for 7 days in a nitrogen-rich medium were transferred to a nitrogen-deficient medium and cultured for 3 days. As shown in the right panel of FIG. 6A, the hG-CSF polypeptide was induced by nitrogen deficiency, which is consistent with the accumulation pattern of the hG-CSF transcript. Polypeptides were most often induced on day 3 in both transformation lines.
  • the expression vector system controlled by the CANDI promoter successfully induced the production of hG-CSF under nitrogen deficiency, indicating that this system is efficient in producing target proteins in chlorella.
  • the 32 kD hG-CSF detected in the cell lysate was incubated overnight at 4° C. with a protein loading dye containing dithiothreitol, and then 19 kD and 32 kD bands were separated (FIG. 6B, C2).
  • hG-CSF polypeptide was examined in the medium.
  • the hG-CSF protein was successfully detected from the medium concentrated about 500 times by Western blot (FIG. 6B).
  • the hG-CSF polypeptide was detected at 45 kD and a weak signal at 32 kD. Although there is a size mismatch problem, this result indicates that the expression system used in the present invention works well for the production of hG-CSF in transgenic chlorella.
  • the present invention relates to a nitrogen deficiency inducible promoter, a chlorella-derived signal peptide, and a gene expression system comprising the same.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 질소결핍 유도성 프로모터, 클로렐라 유래 신호 펩타이드 및 이를 포함하는 유전자 발현 시스템에 관한 것으로 질소결핍 조건 하에서 유전자의 발현 및 단백질 생산을 간편하게 조절할 수 있다. 본 발명의 유전자 발현 시스템을 이용하면 클로렐라에서 생산된 외래 단백질을 세포 밖으로 분비시킬 수 있으므로, 산업적으로 유용한 단백질을 클로렐라에서 생산 및 정제하기 위한 용도로 유용하게 사용할 수 있다.

Description

질소결핍 유도성 프로모터, 클로렐라 유래 신호 펩타이드 및 이를 포함하는 유전자 발현 시스템
본 발명은 해양수산부의 지원 하에서 과제번호 201955005에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 한국해양연구원 부설 극지연구소, 연구사업명은 "연구용역(기타부처3)", 연구과제명은 "극지 클로렐라의 형질전환을 통한 면역증강단백질 CSF의 발현 체계 확립", 주관기관은 서강대학교산학협력단, 연구기간은 2019.06.01 ~ 2020.05.31이다.
또한 본 발명은 농촌진흥청의 지원 하에서 과제번호 PJ01365901에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 농업생명공학연구단, 연구사업명은 "차세대바이오그린21", 연구과제명은 "인체 유사 당단백질 생산 벼 세포주 개발", 주관기관은 서강대학교산학협력단, 연구기간은 2018.02.01 ~ 2020.12.31이다.
본 특허출원은 2019년 10월 31일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2019-0138178호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
본 발명은 질소결핍 유도성 프로모터, 클로렐라 유래 신호 펩타이드 및 이를 포함하는 유전자 발현 시스템에 관한 것이다.
클로렐라는 녹조류에 속하는 단세포 진핵생물로서 다양한 생장환경에 적응하여 생장하며, 약 6시간만에 네 개의 세포로 분열되는 빠른 생장 특징을 갖는다. 또한 세포 내에 지질 등 풍부한 유용물질들을 합성하고 고영양체이기 때문에 바이오디젤의 원료로 뿐만 아니라 일반적으로 안전하다고 볼 수 있는 물질(GRAS)로서 오랫동안 널리 식용되어 오는 등 여러 장점을 기반으로 상업적으로 이용되고 있다.
최근에는 항체를 포함한 유용단백질 생산 플랫폼으로써 클로렐라를 이용하여 재조합 단백질을 대량 생산하기 위한 시도가 이루어지고 있다. 클로렐라에서 안정적인 재조합 단백질의 생산 플랫폼 구축을 위해서는 우선적으로 클로렐라의 형질전환 기술 개발이 선행되어야 하며 현재까지 다양한 방법의 기술들이 개발되고 있고, 본 발명자들은 전기천공법을 이용한 고효율 형질전환체계를 확립한 바 있다.
효과적인 형질전환체계 확립과 더불어 특정 발현 조건에서 구동되는 최적의 프로모터의 사용은 고효율의 단백질 생산에 있어 결정적인 요인 중 하나로 꼽힌다. 최적의 프로모터 사용은 또한 단백질 생산 시스템에서 사용되는 비용을 크게 절감하는 경제적인 효과를 가질 수 있다. 수년전에 규조류(diatom)인 Phaeodactylum tricornutum에서 nitrate reductase 유전자의 프로모터로 조절된 단백질 발현 시스템이 보고되었으며, 질산나트륨(NaNO3)이 첨가된 배지에 P. tricornutum를 배양할 경우 nitrate reductase 프로모터의 활성 증가로 인해 이 프로모터에 연결된 재조합 단백질 생산이 증가됨을 보였다. 이렇듯 재조합 단백질 생산 시스템에서 프로모터의 중요성에도 불구하고 유용 미세조류인 클로렐라에서의 연구는 거의 전무하다.
본 발명자들은 질소결핍 조건 하에서 특이적으로 유전자의 발현을 유도하는 유전자 발현조절 시스템을 개발하기 위하여 예의 연구 노력하였다. 그 결과, 클로렐라로부터 발굴한 CANDI2 프로모터가 질소결핍 조건 하에서 목적 유전자의 발현을 강하게 유도하며, 클로렐라로부터 발굴한 신규한 신호 펩타이드가 효과적으로 목적 단백질을 세포 외로 분비시킬 수 있음을 규명함으로써, 본 발명을 완성하게 되었다.
따라서 본 발명의 목적은 질소결핍 유도성 프로모터를 제공하는 데 있다.
본 발명의 다른 목적은 클로렐라 유래 신규 신호 펩타이드를 제공하는 데 있다.
본 발명의 다른 목적은 본 발명의 프로모터를 포함하는 발현벡터를 제공하는 데 있다.
본 발명의 또 다른 목적은 본 발명의 발현벡터로 형질전환 된 형질전환체를 제공하는 데 있다.
본 발명의 또 다른 목적은 본 발명의 형질전환체를 질소결핍 조건에서 배양하는 단계를 포함하는 외래 유전자의 발현 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 본 발명의 형질전환체를 질소결핍 조건에서 배양하는 단계를 포함하는 외래 단백질의 생산 방법을 제공하는데 있다.
본 발명의 일 양태에 따르면, 본 발명은 서열번호 1로 표시되는 뉴클레오타이드 서열을 포함하는 질소결핍 유도성 프로모터에 관한 것이다.
본 발명자들은 질소결핍 조건 하에서 특이적으로 유전자의 발현을 유도하는 유전자 발현조절 시스템을 개발하기 위하여 예의 연구 노력하였고 그 결과, 클로렐라로부터 발굴한 CANDI2 프로모터가 질소결핍 조건 하에서 목적 유전자의 발현을 강하게 유도하며, 클로렐라로부터 발굴한 신규한 신호 펩타이드가 효과적으로 목적 단백질을 세포 외로 분비시킬 수 있음을 규명하였다.
본 발명에서 용어 "프로모터"는 특정한 숙주세포에서 작동 가능하게 연결된 외래 단백질을 코딩하는 유전자의 발현을 조절하는 DNA 서열을 의미한다.
본 발명자들은 클로렐라의 질소결핍 조건에서 발현이 증가된 scaffold를 선발하여 이를 CANDI2(Chlorella sp. ArM00029B Nitrogen Deficiency Inducible 2) 유전자로 명명하고, 상기 유전자의 상류(upstream)에 존재하는 프로모터를 발굴하였다.
본 발명의 프로모터는 클로렐라에서 유래한 것으로서, 상기 클로렐라의 CANDI2 단백질을 코딩하는 유전자의 상류에 존재하는 것을 의미하며, 자연 유래 또는 인위적으로 합성한 뉴클레오타이드 서열이 모두 상기 프로모터로서 이용될 수 있다.
상기 프로모터는 서열번호 1로 표시되는 뉴클레오타이드 서열을 포함할 수 있다. 상기 서열번호 1로 표시되는 뉴클레오타이드 서열은 그 하류(downstream) 즉 상기 뉴클레오타이드 서열의 3' 말단 쪽에 작동가능하게 연결된 외래 단백질을 코딩하는 유전자의 '발현'을 유도 및 향상시킨다. 그러나, 상기 서열번호 1로 표시되는 뉴클레오타이드 서열은 상기와 같은 유전자의 발현을 유도 및 향상시키는 성질을 갖는 프로모터의 최소 단위일 뿐, 상기 프로모터의 서열이 상기 서열번호 1의 뉴클레오타이드 서열에 한정되지 아니한다.
본 발명의 다른 일 양태에 따르면, 본 발명은 서열번호 2로 표시되는 아미노산 서열로 이루어진 클로렐라 유래 셀룰라아제에 대한 신호 펩타이드에 관한 것이다.
본 발명은 서열번호 2로 표시되는 아미노산 서열로 이루어진 신호 펩타이드 및 그의 변이형 펩타이드를 제공한다. 본 발명에 있어서, 서열번호 2로 표시되는 신호 펩타이드에 대한 "변이형 펩타이드(variant)"는 서열번호 2로 표시되는 신호 펩타이드 중 하나 이상의 아미노산 잔기가 결실, 부가, 삽입 또는 치환된 펩타이드를 의미하는 것으로서, 상기 서열번호 2로 표시되는 신호 펩타이드와 동일하게 단백질을 세포 밖으로 분비시키는 신호 펩타이드 기능을 수행할 수 있는 펩타이드를 의미한다.
본 발명의 신호 펩타이드를 코딩하는 유전자는 상기 서열번호 2로 표시되는 아미노산을 코딩할 수 있는 모든 종류의 뉴클레오타이드 서열을 포함한다. 또한, 본 발명의 변이형 펩타이드를 코딩하는 유전자도 상기 신호 펩타이드의 경우와 마찬가지로 변이형 펩타이드를 코딩할 수 있는 모든 종류의 염기서열을 포함하며, 특정한 어느 한 염기서열에 의해 한정되는 것은 아니다.
본 발명의 다른 일 양태에 따르면, 본 발명은 서열번호 3으로 표시되는 아미노산 서열로 이루어진 클로렐라 유래 Ras-연관 RABF1(Ras-related RABF1)에 대한 신호 펩타이드에 관한 것이다.
본 발명은 서열번호 3으로 표시되는 아미노산 서열로 이루어진 신호 펩타이드 및 그의 변이형 펩타이드를 제공한다. 본 발명에 있어서, 서열번호 3으로 표시되는 신호 펩타이드에 대한 "변이형 펩타이드(variant)"는 서열번호 3으로 표시되는 신호 펩타이드 중 하나 이상의 아미노산 잔기가 결실, 부가, 삽입 또는 치환된 펩타이드를 의미하는 것으로서, 상기 서열번호 3으로 표시되는 신호 펩타이드와 동일하게 단백질을 세포 밖으로 분비시키는 신호 펩타이드 기능을 수행할 수 있는 펩타이드를 의미한다.
본 발명의 신호 펩타이드를 코딩하는 유전자는 상기 서열번호 3으로 표시되는 아미노산을 코딩할 수 있는 모든 종류의 뉴클레오타이드 서열을 포함한다. 또한, 본 발명의 변이형 펩타이드를 코딩하는 유전자도 상기 신호 펩타이드의 경우와 마찬가지로 변이형 펩타이드를 코딩할 수 있는 모든 종류의 염기서열을 포함하며, 특정한 어느 한 염기서열에 의해 한정되는 것은 아니다.
본 발명의 신호 펩타이드는 미세조류, 바람직하게는 녹조류, 가장 바람직하게는 클로렐라에서 단백질을 높은 효율로 세포 외로 분비시키기 위한 신호 펩타이드이다.
하기 실시예에서 입증한 바와 같이, 본 발명의 신호 펩타이드를 이용한 경우, 재조합 단백질을 세포 배양 배지 내에서 높은 수율로 얻을 수 있다.
본 발명의 다른 양태에 따르면, 본 발명은 상기 질소결핍 유도성 프로모터를 포함하는 발현벡터 및 상기 발현벡터로 형질전환 된 형질전환체에 관한 것이다.
본 발명에서 용어 "발현벡터"는 숙주세포에서 목적으로 하는 외래 유전자를 발현할 수 있는 벡터로서, 유전자 삽입물이 발현되도록 작동가능하게 연결된 필수적인 조절 요소를 포함하는 벡터를 의미한다. 적합한 발현벡터는 프로모터, 오퍼레이터, 개시코돈, 종결코돈, 폴리아데닐화 시그널 및 인핸서와 같은 발현 조절 서열 외에도 막 표적화 또는 분비를 위한 신호 펩타이드 서열 또는 리더 서열을 포함하며 목적에 따라 다양하게 제조될 수 있다.
본 발명의 발현벡터는 서열번호 2 또는 서열번호 3으로 표시되는 신호 펩타이드를 코딩하는 뉴클레오타이드 서열을 추가로 포함할 수 있다.
본 명세서에서 용어 "작동가능하게 연결된"은 핵산 발현 조절 서열(예: 프로모터, 신호 펩타이드 서열, 또는 전사조절인자 결합 위치의 어레이)과 다른 핵산 서열사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절 서열은 상기 다른 핵산 서열의 전사 및/또는 트랜스레이션을 조절하게 된다.
상기 질소결핍 유도성 프로모터는 발현벡터에 포함되어, 상기 프로모터의 하류에 작동가능하게 연결된 외래 단백질을 코딩하는 유전자의 발현을 질소결핍 의존적으로 조절할 수 있다.
상기 외래 단백질은 생산하고자 하는 단백질을 의미하는 것으로서, 유전자의 뉴클레오타이드 서열이 알려진 모든 종류의 단백질일 수 있다. 특히, 상기 외래 단백질은 호르몬, 호르몬 유사체, 효소, 효소 저해제, 항체 및 이의 단편 등 일 수 있고, 예를 들어, G-CSF(Granulocyte-Colony Stimulating Factor) 일 수 있다.
상기 발현벡터는 외래 단백질을 코딩하는 유전자가 상기 프로모터에 작동가능하게 삽입될 수 있는 다중클로닝부위(multiple cloning site, MCS)를 더 포함할 수 있다. 상기 다중클로닝부위를 이용하여 외래 단백질을 코딩하는 유전자를 상기 발현벡터 내로 손쉽게 삽입할 수 있다.
상기 발현벡터에는 벡터를 함유하는 숙주세포를 선별하기 위한 선별 마커를 더 포함할 수 있다. 상기 선별 마커는 종래 공지된 모든 종류의 선별 마커일 수 있으며, 항생제 내성 유전자 또는 발광 유전자 등이 이용될 수 있으나, 이에 한정되지 아니한다.
상기 발현벡터는 종래에 알려진 발현벡터에 상기 질소결핍 유도성 프로모터를 도입한 것일 수 있고, 공지의 방법에 의하여 인위적으로 디자인된 재조합 발현벡터일 수 있다. 상기 질소결핍 유도성 프로모터를 도입하여 발현벡터를 제조하는 것은 본 발명이 속하는 기술분야의 당업자라면 공지의 방법에 따라 용이하게 실시 가능하다.
상기 발현벡터의 제조를 위한 벡터는 상기 질소결핍 유도성 프로모터를 도입할 수 있는 공지된 다양한 벡터를 사용가능하고, 예를 들어, 플라스미드 벡터, 코즈미드 벡터, 박테리오파아지 벡터 및 바이러스 벡터 등 일 수 있다. 특히, 미세조류 또는 식물과 같은 숙주세포 내에서 안정하게 존재하고 카피수가 많은 벡터를 사용하는 것이 바람직하다.
상기 발현벡터는 숙주세포에 도입되어, 상기 숙주세포를 상기 발현벡터로 형질전환 할 수 있다.
본 발명에서 사용되는 용어, “형질전환”은 본래의 세포가 가지고 있던 것과 다른 종류의 외래 유전자가 있는 DNA 사슬 조각 또는 플라스미드가 숙주 세포에 도입되어 원래 세포에 존재하던 DNA와 결합함으로써 세포의 유전형질을 변화시키는 분자생물학적 기술을 일컫는다. 본 발명의 목적상, 상기 형질전환은 상기 신호 펩타이드, 질소결핍 유도성 프로모터 및 목적 단백질을 코딩하는 유전자가 숙주세포 내로 삽입되어 목적 단백질을 발현하는 것을 의미한다.
상기 형질전환은 종래 공지된 형질전환 기술에 의해 당업자가 용이하게 수행할 수 있고, 상기 형질전환 기술은 Kindle(1990)에 의해 공지된 글라스 비드를 이용한 형질전환법, 칼슘/폴리에틸렌 글리콜법을 이용한 원형질체의 형질전환법, 전기천공법, 미량주사법, 입자 충격 투입법(particle bombardment), 전기충격법(electrophration), 아그로박테리움을 매개로 한 방법, 유전자 총 또는 물리적 도입법 등이 있다. 상기 형질전환 기술은 숙주세포의 종류 및 특성에 맞게 당업자가 적절히 선택하여 수행할 수 있다.
상기 발현벡터를 형질전환시키기 위한 숙주세포는 미세조류 또는 식물인 것이 바람직하고, 예를 들어, 클로렐라일 수 있으나 이에 한정되지 않으며, 본 발명의 프로모터를 인식할 수 있는 RNA 중합효소를 가진 세포는 모두 사용 가능하다.
상기 발현벡터로 형질전환 된 형질전환체는 미세조류 또는 식물일 수 있다.
상기 미세조류는 녹조류일 수 있고, 예를 들어, 클로렐라일 수 있다.
상기 식물은 성숙한 식물 뿐만 아니라 성숙한 식물로 발육할 있는 식물 세포, 식물 조직 및 식물의 종자 등을 모두 포함한다.
본 발명의 다른 양태에 따르면, 본 발명은 서열번호 1로 표시되는 뉴클레오타이드 서열을 포함하는 질소결핍 유도성 프로모터에 외래 단백질을 코딩하는 유전자가 작동가능하게 연결된 유전자 컨스트럭트에 관한 것이다.
본 발명의 다른 양태에 따르면, 본 발명은 상기 유전자 컨스트럭트를 포함하는 발현벡터 및 상기 발현벡터로 형질전환 된 형질전환체에 관한 것이다.
상기 외래 단백질은 생산하고자 하는 단백질을 의미하는 것으로서, 유전자의 뉴클레오타이드 서열이 알려진 모든 종류의 단백질일 수 있다. 특히, 상기 외래 단백질은 호르몬, 호르몬 유사체, 효소, 효소 저해제, 항체 및 이의 단편 등 일 수 있고, 예를 들어, G-CSF(Granulocyte-Colony Stimulating Factor) 일 수 있다.
상기 외래 단백질을 코딩하는 유전자는 상기 질소결핍 유도성 프로모터에 작동가능하게 연결된다. 상기 작동가능하게 연결된다는 것은 상기 외래 유전자의 발현이 상기 질소결핍 유도성 프로모터의 활성에 의해 조절될 수 있도록 연결되는 것을 의미한다. 따라서, 상기 질소결핍 유도성 프로모터에 외래 단백질을 코딩하는 유전자가 작동가능하게 연결되어 형성되는 상기 유전자 컨스트럭트는 상기 외래 단백질을 코딩하는 유전자를 발현하기 위한 단위로서 기능하는 발현 카세트가 된다.
상기 유전자 컨스트럭트는 발현벡터에 포함되어, 상기 외래 단백질을 코딩하는 유전자의 발현을 질소결핍 의존적으로 조절할 수 있다.
또한, 상기 유전자 컨스트럭트를 포함하는 상기 발현벡터는 숙주세포에 도입되어, 상기 숙주세포를 상기 발현벡터로 형질전환할 수 있다. 상기와 같이 형성된 형질전환체는 상기 외래 유전자를 발현시키는데 이용될 수 있다.
본 발명의 다른 양태에 따르면, 본 발명은 상기 형질전환체를 질소결핍 조건에서 배양하는 단계를 포함하는 외래 유전자의 발현 방법에 관한 것이다.
상기 배양은 상기 형질전환체의 종류 및 특성에 따라 배양 방법, 배양 배지, 배양 조건 등을 달리하여 당업자가 적절히 수행할 수 있다.
상기 배양에 있어서 질소결핍은 질소결핍 배지를 이용하여 유도할 수 있다.
상기 질소결핍에 의해 상기 형질전환체에서 외래 단백질을 코딩하는 유전자의 발현이 유도되며, 상기 유전자는 질소결핍 유도성 프로모터의 활성에 의하여 그 발현이 조절된다.
상기와 같은 유전자 컨스트럭트, 이를 포함하는 발현벡터 및 상기 발현벡터가 포함된 형질전환체를 이용하여 외래 유전자를 용이하게 발현시킬 수 있다.
본 발명의 다른 양태에 따르면, 본 발명은 상기 형질전환체를 질소결핍 조건에서 배양하는 단계를 포함하는 외래 단백질의 생산 방법에 관한 것이다.
상기 외래 단백질 생산 방법은 형질전환체 배양 후 배양 배지로부터 외래 단백질을 수득하는 단계를 추가로 포함할 수 있다.
상기 외래 단백질 생산 방법에 사용되는 형질전환체는 형질전환된 외래 단백질을 세포 외로 분비할 수 있는 신호 펩타이드를 포함하고 있기 때문에 배양 후 목적하는 외래 단백질을 배양 배지로부터 용이하게 수득할 수 있다.
당업계에 공지된 다양한 방법을 이용하여 상기 형질전환체의 배양 배지로부터 외래 단백질을 분리 또는 회수할 수 있다. 예를 들어, 원심분리, 여과, 추출, 분무 건조, 증발 또는 침전을 포함하는 방법을 통해 배양 배지로부터 분리할 수 있으나, 이에 제한되는 것은 아니다. 아울러, 외래 단백질은 크로마토그래피(예를 들어, 이온 교환, 친화성, 소수성 및 크기별 배제), 전기영동, 분별 용해도(예를 들면, 암모늄 설페이트 침전), 또는 추출을 포함하여 당업계에 공지된 다양한 방법을 통해서 정제할 수 있다.
본 발명은 질소결핍 유도성 프로모터, 클로렐라 유래 신호 펩타이드 및 이를 포함하는 유전자 발현 시스템에 관한 것으로 질소결핍 조건 하에서 유전자의 발현 및 단백질 생산을 간편하게 조절할 수 있다. 본 발명의 유전자 발현 시스템을 이용하면 클로렐라에서 생산된 외래 단백질을 세포 밖으로 분비시킬 수 있으므로, 산업적으로 유용한 단백질을 클로렐라에서 생산 및 정제하기 위한 용도로 유용하게 사용할 수 있다.
도 1a은 질소결핍 조건에서 클로렐라의 RNA-Seq 스크리닝 결과에 따른 발현 패턴을 나타낸다.
도 1b 내지 1e는 질소결핍 조건에서 후보자 유전자에 대한 qRT-PCR 분석 결과이다.
도 2a 및 2b는 CANDI1 아미노산 서열에 대한 얼라인먼트 결과이다.
도 3a 및 3b는 CANDI2 아미노산 서열에 대한 얼라인먼트 결과이다.
도 4는 CANDI 프로모터에 의해 조절되는 hG-CSF 발현 벡터에 대한 모식도이다.
도 5a는 형질전환 클로렐라 UTEX395 및 ArM0029B에 대한 지노믹 DNA PCR 결과이다.
도 5b는 형질전환 클로렐라 UTEX395의 질소 결핍 조건에서 hG-CSF 전사체 발현을 나타낸 것이다.
도 5c는 형질전환 클로렐라 ArM0029B의 질소 결핍 조건에서 hG-CSF 전사체 발현을 나타낸 것이다.
도 6a는 형질전환 클로렐라를 정상 질소-풍부 배지에서 배양한 다음, 질소 결핍 배지로 옮기고 hG-CSF 폴리펩타이드의 발현을 확인한 결과이다. 좌측 패널 및 중간 패널에서 M은 사이즈 마커, 1은 UTEX395-pSK401, 2는 UTEX395-pSK403, 3은 ArM0029B-pSK402, 4는 ArM0029B-pSK404, +는 hG-CSF 양성대조군을 나타낸다.
도 6b는 형질전환 클로렐라 ArM0029B-pSK404의 세포 용해물 또는 배양액에서 hG-CSF 폴리펩타이드의 발현을 확인한 결과이다. M은 사이즈 마커, C1은 세포 용해물, C2는 C1을 95℃에서 변성시킨 다음 4℃에서 하룻밤 동안 배양한 샘플, L은 농축한 배양액을 나타낸다.
본 발명은 서열번호 1로 표시되는 뉴클레오타이드 서열을 포함하는 질소결핍 유도성 프로모터에 관한 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시 예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당 업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
실시예 1. 형질전환 클로렐라
1-1. 클로렐라 종 및 성장 조건
Chlorella vulgaris ssp. UTEX395 및 극지 Chlorella sp. ArM0029B를 3% 글루코오스를 포함하는 BG11 배지에서 25℃조건으로 배양하였다. 클로렐라의 형질전환을 위해 전기천공법을 실시하였다. 형질전환된 클로렐라 콜로니는 액체 배지로 옮겨 더 배양하였다. 배양 세포를 글루코오스 또는 질소가 없는 액체 배지로 옮겨 3일 동안 hG-CSF 유전자의 발현을 유도하였다. 세포 및 배양액을 모아 RNA 및 단백질을 추출하였다.
1-2. RNA 시퀀싱 및 분석
ArM0029B 및 D3(질소 결핍 조건 하에서 3일 동안 배양)의 전사체 시퀀싱은 Illumina Hiseq2000 플랫폼(Illumina, USA)을 이용하여 실시하였다. ArM0029B 및 D3 간의 발현 차이를 분석하는데 DESeq(Anders and Huber, 2010)를 사용하였다. FDR을 갖는 차별적으로 발현된 전사체 목록을 P-값 <0.001로 조정하였다. DEG는 |log FC|>2의 폴드 변화값으로 결정하였다.
1-3. 지노믹 DNA 및 총 RNA 분리 후 PCR
CTAB 방법을 이용하여 클로렐라로부터 지노믹 DNA를 추출한 다음, 형질전환 유전자의 삽입을 조사하기 위해 지노믹 DNA PCR을 수행하였다. HPT(hygromycin phosphotransferase gene) 유전자 및 hG-CSF 유전자에 대한 프라이머를 이용하여 PCR을 실시하였다. 형질전환 유전자의 발현을 확인하기 위해 Trizol(Invitrogen, USA)을 이용하여 클로렐라로부터 총 RNA를 분리하고, TOPscript cDNA Synthesis Kit(Enzynomics, Korea)를 이용하여 cDNA를 합성하였다. CvUBI 또는 CvAct 유전자를 사용하여 정규화(normalization)한 다음, RT-PCR을 수행하였다. 본 발명에서 사용된 프라이머는 아래 표 1과 같다.
서열번호 프라이머 이름 서열(5'-3')
4 CvUBI-F GAGTCTTCGGACACCATCGAG
5 CvUBI-R CTTGTCCTGGTTGTACTTGCG
6 CvAct-F ATGCTTTGCCACATGCCATC
7 CvAct-R CCGCTGTCTAGCACGATACC
8 HPT-F CGACGTCTGTCGAGAAGTTT
9 HPT-R TGTATTGACCGATTCCTTGC
10 hG-CSF-F TCTCTGCCACAGAGCTTCCT　
11 hG-CSF-R CATCTGCTGCCAGATTGTTG
12 CANDI1-F TGGTGTTCATTGCCCTGTGT
13 CANDI1-R GGAGGTCCATAGCAACCGAG
14 CANDI2-F CGTGGTACCTCACAGGCTTT
15 CANDI2-R GCGACCACAGGGTAGACAAA
16 scaffold73G00080-F CTGTCACACGAGGTCAGCAA
17 scaffold73G00080-R GTACCGCCGGTCATGTACTC
18 scaffold37G001690-F GCCAAGCCCAGAATCAGTGT
19 scaffold37G001690-R TTGCATCTGCGTCTTTGTCG
20 BamH I_UTEX395 SP_CSF-F CGCGGATCCATGGCCGGCCGCATCACCCTGCTGCTGTGCCTGTGCCTGGTGGCCGGCGCCGCCGCCATGGCAGCCCTCTC
21 Kpn I_CSF-R GCCGGTACCGGGCTGTGCCAGG
22 BamH I_29B SP_CSF-F CGCGGATCCATGAAGGGCGCCCTGCTGCTGCTGCTGCTGGCCCTGGCCGCCAGCGCCGCCATCGCCCGCGACATGGCAGCCCTCTC
실시예 2. 질소 결핍 유도 CANDI1 및 CANDI2 유전자의 스크리닝
2-1. 질소 결핍 유도 유전자 스크리닝
최적 프로모터의 개발은 이종 생물학적 시스템에서 재조합 단백질 생산을 위한 전제 조건이다. 클로렐라에서 재조합 단백질의 발현 조절을 위한 타겟 프로모터로서 유도성 프로모터에 대한 실험을 실시하였다. 질소 결핍은 C. vulgaris에서 바이오디젤에 대한 지질 함량을 극적으로 증가시킨다고 알려져 있다. 따라서, 질소 결핍 하에서 유도된 유전자를 분리하기 위해 질소 결핍 조건에서 극지 Chlorella sp. ArM0029B에 대한 RNA 시퀀싱을 실시하였다. RNA 시퀀싱 데이터를 이용한 차등발현 분석을 통해 질소 결핍 상태에서 유의미한 증가를 보인 유전자를 스크리닝 하였다(표 2).
Genes Functional description 29B_vs_N_3d (log2Fold change)
scaffold37G001690 ammonium transporter (XP_002314518, 1.77E-44) 11.639
scaffold326G00270 ammonium transporter (AFV36360, 0.00E+00) 10.096
scaffold326G00910 urea carboxylase (XP_005643671, 0.00E+00) 9.862
scaffold73G00080 GOGAT, glutamate synthase (EMS25597, 0.00E+00) 9.749
scaffold326G00910의 전사 수준은 20배까지 증가하는 것으로 나타났다. 또한, 다른 3개 유전자(scaffold326G00270, 73G00080, 및 253G00910)도 전사량이 급격히 증가하였다(표 2). 마이크로어레이 데이터로부터 먼저 스크리닝된 유전자 가운데 최적의 유전자를 추가로 스크리닝 하기 위해 질소 결핍 배지에서 클로렐라를 3일 동안 배양한 다음, RT/qRT-PCR을 실시하였다. scaffold326G00910 및 326G00270의 전사체는 차등발현 분석 결과와 동일한 조건에서 상당히 축적된 것으로 나타났다(도 1).
scaffold326G00910의 발현은 질소 결핍 배지에서 1일째 신속하게 유도되어 2일 째까지 유지되고, 3일 째에 발현수준이 절반으로 감소하였다. scaffold326G00270은 scaffold326G00910과 유사한 발현 패턴을 나타냈다. scaffold326G00270 전사체는 질소를 포함하는 배지에서 거의 검출되지 않고 질소 결핍 특이적 발현을 나타냈다. 대조적으로 다른 유전자(scaffold37G001690 및 73G00080)는 질소 결핍 하에서 유도되지 않았다. 따라서, 질소 결핍 유도성 프로모터 시스템 개발을 위해 최종적으로 scaffold326G00910 및 326G00270을 선발하였으며, 이들은 각각 CANDI1(Chlorella sp. ArM00029B Nitrogen Deficiency Inducible 1) 및 CANDI2로 명명하였다.
실시예 3. CANDI 프로모터에 의해 구동되는 hG-CSF 발현 벡터의 구축
3-1. 인 실리코 분석
CANDI1 및 CANDI2 아미노산 서열을 이용한 블라스트 서칭은 NCBI Blast program(www.blast.ncbi.nlm.nih.gov/)을 이용하여 수행하였다. 서열 얼라인먼트 분석은 Clustal Omega program(www.ebi.ac.uk/Tools/msa/clustalo/)을 이용하여 수행하였다. 단백질에서 신호 펩타이드의 존재와 절단 부위의 위치는 SignalP-5.0 program(www.cbs.dtu.dk/services/SignalP/)을 통해 예측하였다.
3-2. CANDI1 및 CANDI2 유전자의 특징
블라스트 검색을 통한 CANDI1 및 CANDI2 유전자의 전장 DNA 서열에 기초하여 이들의 아미노산 서열을 추정하였다. 추정된 아미노산 서열을 이용한 블라스트 검색 결과, CANDI1은 우레아 카르복실라아제의 보존된 도메인을 갖는 것으로 나타났다(도 2). CANDI1은 Micractinium conductrix 및 Chlorella sorokiniana의 우레아 카르복실라아제와 각각 79% 및 77%의 상동성을 나타냈다(도 2). 우레아 카르복실라아제는 우레아를 암모늄으로 전환시키는 것으로 알려져 있고, 이는 우레아를 질소원으로 사용하기 위한 첫번째 단계로 간주된다. 일반적으로 질소 화합물의 분해에 의해 생성된 우레아는 많은 식물, 곰팡이, 및 박테리아의 질소원으로 사용되는 것으로 알려져 있다.
CANDI2 서열은 M. conductrix 및 C. sorokiniana의 암모늄 수송체와 각각 73% 및 74%의 상동성을 나타냈다(도 3). 암모늄 수송체는 세포에서 질소 수준의 균형을 유지하기 위해 질소 대사에서 중요한 역할을 한다. 따라서, CANDI1 및 CANDI2 유전자는 질소 결핍 조건에서 세포 생존을 위해 질소원을 유지하기 위한 대사에 관여할 것으로 예상된다.
3-3. CANDI 프로모터에 의해 구동되는 hG-CSF 발현 벡터의 구축
CANDI 유전자의 프로모터에 의해 구동되는 단백질 발현 벡터를 구축하기 위해, 5'- UTR(untranslated region)을 포함하는 번역 개시 코돈(ATG)의 상류 1 kb-길이 영역에 걸친 프로모터 영역의 서열을 ArM0029B의 지노믹 DNA를 사용하여 증폭시켰다. pJKS136을 기본으로 클로닝하여 hG-CSF 발현 벡터를 구축하였다. ArM0029B의 지노믹 DNA로부터 얻은 CANDI2 프로모터 서열은 제한효소 HindIII 및 BamHI을 사용하여 pJKS136으로 삽입하여 RAmy3D 프로모터를 대체하였다.
프로모터 외에 적절한 신호 펩타이드를 사용하는 것도 분비를 위한 효율적인 단백질 발현 시스템을 확립하는 데 필수 요소이다. 신호 펩타이드를 사용하면 액체 배지에서 단백질을 쉽게 수득할 수 있다. Chlorella spp. UTEX395 및 ArM0029B를 위한 신호 펩타이드를 선택하기 위해 배지에 분비된 단백질을 정제한 다음 질량분석법으로 분석하였다. 분석 결과, UTEX395 및 ArM0029B에서 많이 분비되는 단백질로 각각 putative cellulase 및 Ras-related RABF1가 선택되었다. SignalP program을 이용하여 인 실리코에서 분석한 신호 펩타이드 서열을 코돈 최적화된 hG-CSF 서열 앞에 융합시켰다(도 4). 신호 펩타이드와 융합된 hG-CSF 서열은 제한효소 Kpn I 및 BamHI을 사용하여 CANDI 프로모터 및 RAmy3D 터미네이터 사이 영역에 삽입하였다(도 4).
UTEX395의 셀룰라아제의 신호 펩타이드를 갖는 벡터는 pSK401 및 pSK403으로 명명하였고, 이는 각각 CANDI1 및 CANDI2 프로모터에 의해 제어된다. ArM0029B의 Ras-related RABF1의 신호 펩타이드를 갖는 벡터는 pSK402 및 pSK404으로 명명하였고, 이는 각각 CANDI1 및 CANDI2 프로모터에 의해 제어된다(도 4). 이들 벡터는 전기천공법을 이용하여 Chlorella spp. 에 도입하였다.
3-4. CANDI::hG-CSF 를 발현하는 형질전환 클로렐라 특성
형질전환 4주 내에 선별 한천 플레이트로부터 UTEX395 및 ArM0029B의 하이그로마이신 내성 콜로니를 수득하였다. 개별 콜로니를 하이그로마이신을 포함하는 액체 배지로 옮기고 7일 동안 배양하였다. 배양액으로부터 얻은 지노믹 DNA는 hG-CSF 프라이머를 이용하여 PCR 하였다(표 1). 도 5a에 도시된 바와 같이, Chlorella spp.으로의 hG-CSF 유전자 도입은 pSK401 또는 pSK403을 포함하는 UTEX395 라인(도 5a의 좌측 패널) 및 pSK402 또는 pSK404을 포함하는 ArM0029B 라인에서 확인하였다(도 5a의 우측 패널). 이들 형질전환체는 1년 이상 성공적으로 유지되었고, 이는 이전에 보고된 바와 같이 형질전환의 안정성을 나타낸다.
CANDI1 및 CANDI2 프로모터가 질소 결핍 하에서 hG-CSF 발현을 유도할 수 있는지를 조사하기 위해 표준 질소-풍부 액체 배지에서 배양한 형질전환 클로렐라를 질소 결핍 배지로 옮겨 3일 동안 배양하였다. 원심분리하여 2일 및 3일 째 세포를 샘플링하고, 세포로부터 총 RNA를 추출하였다. RNA를 역전사하고 hG-CSF 전사체를 검출하기 위한 프라이머를 사용하여 RT-PCR를 실시하였다. 도 5b에서 확인하는 바와 같이, CANDI1 또는 CANDI2 프로모터에 의해 구동되는 UTEX395 및 ArM00029B 형질전환 라인은 2일째 및 3일째에 hG-CSF 발현을 나타냈다. hG-CSF의 전사 수준은 2일째보다 3일째에 높게 나타났다(도 5b 및 5c). 이러한 결과는 1 kb-길이의 CANDI 프로모터가 실제로 질소 결핍에 반응하는 형질전환 클로렐라에서 하류 유전자의 발현을 유도한다는 것을 나타낸다.
실시예 4. 형질전환 클로렐라에서 hG-CSF 단백질의 발현
4-1. 면역블롯팅
글루코오스 또는 질소 결핍 배지에서 배양한 클로렐라를 8,000 rpm에서 20분간 원심분리하여 모은 다음, 배양액과 클로렐라로 각각 분리하였다. 총 단백질을 분리하기 위해 클로렐라 세포를 1x Complete(Roche, Germany)를 포함하는 1M PBS buffer(pH 7.4)로 분산시킨 다음 균질화하였다. 균질화 용액은 14,000 rpm에서 10분 동안 원심분리한 다음, 상등액을 새 튜브로 옮겼다. 배양액에 포함된 총 단백질을 분리 및 농축하기 위해 배양액을 0.2 μm 멤브레인으로 필터링한 다음, 5 kD cut-off Viva Flow 200 and Vivaspin20(Sartourious, USA)으로 농축하였다. 세포 용해물 및 배양액으로부터 얻은 총 단백질은 12% NuPAGE gel(Invitrogen, USA)에서 분리한 다음, 니트로셀룰로오스 멤브레인으로 트랜스퍼하였다. 멤브레인을 hG-CSF에 대한 폴리클로날 항체로 1시간 동안 반응시킨 다음, 항-토끼 IgG-HRP 항체와 반응시켰다. E. coli(Abcam, USA)에서 합성한 hG-CSF를 양성대조군으로 사용하였다.
4-2. hG-CSF 단백질 발현
CANDI 프로모터에 의해 유도된 hG-CSF 전사체가 형질전환 클로렐라에서 hG-CSF 폴리펩타이드로 번역되는지 여부를 조사하였다. 질소 결핍 배지로 옮기고 하루 후 UTEX395 및 ArM0029B의 형질전환 세포 용해물을 사용하여 hG-CSF 생산을 조사하였다. 도 6a(중간 패널)에 도시된 바와 같이, 웨스턴 블롯으로 형질전환 클로렐라에서 hG-CSF 폴리펩타이드를 검출하였다. 발현 시스템은 질소 결핍 하에서 hG-CSF 폴리펩타이드의 생성을 유도함을 보여주었다. 웨스턴 밴드는 예상된 크기인 19 kD 보다 큰 32 kD에서 주로 관찰되었고, 마이너한 밴드는 40 kD에서 관찰되었다(도 6a). E. Coli로부터 수득한 대조군 hG-CSF는 19 kD에서 메인 밴드가 나타났고, 40 kD에서 마이너 밴드가 나타났다(도 6a).
다른 형질전환 라인들과 비교하여 pSK404를 포함하는 ArM0029B가 hG-CSF를 높게 유도하는 것으로 나타났다(도 6a의 중간 패널). 결과에 기초하여 질소 결핍 하에서 pSK404를 포함하는 형질전환 ArM0029B를 사용하여 hG-CSF 폴리펩타이드 생성을 조사하였다. 질소-풍부 배지에서 7일 동안 배양한 세포를 질소 결핍 배지로 옮겨 3일 동안 배양하였다. 도 6a의 우측 패널에 도시된 바와 같이, hG-CSF 폴리펩타이드는 질소 결핍에 의해 유도되었으며 이는 hG-CSF 전사체의 축적 패턴과 일치한다. 폴리펩타이드는 두개 형질전환 라인에서 모두 3일 째에 가장 많이 유도되었다. 따라서, CANDI 프로모터에 의해 제어되는 발현 벡터 시스템은 질소 결핍 하에서 hG-CSF의 생성을 성공적으로 유도하였으며, 이는 이 시스템이 클로렐라에서 표적 단백질을 생성하는데 효율적임을 나타낸다. 세포 용해물에서 검출된 32 kD hG-CSF를 디티오트레이톨을 포함하는 단백질 로딩 염료로 하룻밤 동안 4℃에서 배양한 후 19 kD 및 32 kD의 밴드를 분리하였다(도 6b, C2).
또한, 배지에서 hG-CSF 폴리펩타이드의 생산을 검사하였다. 웨스턴 블롯으로 약 500배 농축된 배지로부터 hG-CSF 단백질을 성공적으로 검출하였다(도 6b). hG-CSF 폴리펩타이드는 45 kD에서 검출되었고, 32 kD에서 약한 신호로 검출되었다. 크기 불일치 문제가 있지만 이 결과는 본 발명에서 사용한 발현 시스템이 형질전환 클로렐라에서 hG-CSF의 생산에 잘 작동함을 나타낸다.
본 발명은 질소결핍 유도성 프로모터, 클로렐라 유래 신호 펩타이드 및 이를 포함하는 유전자 발현 시스템에 관한 것이다.

Claims (8)

  1. 서열번호 1로 표시되는 뉴클레오타이드 서열을 포함하는 질소결핍 유도성 프로모터.
  2. 서열번호 2로 표시되는 아미노산 서열로 이루어진 클로렐라 유래 셀룰라아제에 대한 신호 펩타이드.
  3. 서열번호 3 으로 표시되는 아미노산 서열로 이루어진 클로렐라 유래 Ras-연관 RABF1(Ras-related RABF1)에 대한 신호 펩타이드.
  4. 서열번호 1로 표시되는 뉴클레오타이드 서열을 포함하는 질소결핍 유도성 프로모터를 포함하는 발현벡터.
  5. 제 4 항에 있어서, 상기 발현벡터는 서열번호 2 또는 서열번호 3으로 표시되는 신호 펩타이드를 코딩하는 뉴클레오타이드 서열을 추가로 포함하는 것인, 발현벡터.
  6. 제 4 항 또는 제 5 항 중 어느 한 항의 발현벡터로 형질전환 된 형질전환체.
  7. 제 6 항의 형질전환체를 질소결핍 조건에서 배양하는 단계를 포함하는 외래 유전자의 발현 방법.
  8. 제 6 항의 형질전환체를 질소결핍 조건에서 배양하는 단계를 포함하는 외래 단백질의 생산 방법.
PCT/KR2020/012425 2019-10-31 2020-09-15 질소결핍 유도성 프로모터, 클로렐라 유래 신호 펩타이드 및 이를 포함하는 유전자 발현 시스템 WO2021085852A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020190138178A KR102223051B1 (ko) 2019-10-31 2019-10-31 질소결핍 유도성 프로모터, 클로렐라 유래 신호 펩타이드 및 이를 포함하는 유전자 발현 시스템
KR10-2019-0138178 2019-10-31

Publications (1)

Publication Number Publication Date
WO2021085852A1 true WO2021085852A1 (ko) 2021-05-06

Family

ID=75174133

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/012425 WO2021085852A1 (ko) 2019-10-31 2020-09-15 질소결핍 유도성 프로모터, 클로렐라 유래 신호 펩타이드 및 이를 포함하는 유전자 발현 시스템

Country Status (2)

Country Link
KR (1) KR102223051B1 (ko)
WO (1) WO2021085852A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114736842B (zh) * 2022-05-06 2023-12-22 宁波大学 一种利用聚球藻基因的启动子检测水体营养盐生物可利用度的方法

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998042822A1 (en) * 1997-03-21 1998-10-01 Bionebraska, Inc. Chlorella virus promoters
KR20060027015A (ko) * 2004-09-22 2006-03-27 부경대학교 산학협력단 클로렐라 바이러스 유래 신규 프로모터 및 그 용도
KR20070055647A (ko) * 2005-11-26 2007-05-31 부경대학교 산학협력단 클로렐라 바이러스 에이치에스-1 유래의 프로모터 및 그용도
KR20070055648A (ko) * 2005-11-26 2007-05-31 부경대학교 산학협력단 한국에서 분리한 클로렐라 바이러스 에스에스-2 유래 초기발현 유전자 프로모터 및 그 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998042822A1 (en) * 1997-03-21 1998-10-01 Bionebraska, Inc. Chlorella virus promoters
KR20060027015A (ko) * 2004-09-22 2006-03-27 부경대학교 산학협력단 클로렐라 바이러스 유래 신규 프로모터 및 그 용도
KR20070055647A (ko) * 2005-11-26 2007-05-31 부경대학교 산학협력단 클로렐라 바이러스 에이치에스-1 유래의 프로모터 및 그용도
KR20070055648A (ko) * 2005-11-26 2007-05-31 부경대학교 산학협력단 한국에서 분리한 클로렐라 바이러스 에스에스-2 유래 초기발현 유전자 프로모터 및 그 용도

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHOI, TAE JIN ET AL.: "Isolation of strong promoters for microalgae transformation vector and useful genes from algae viruses.", PLANT DIVERSITY RESEARCH, vol. PF 0330601-00, 2006, pages 1 - 209, XP009527702 *
CHU LILI, EWE DANIELA, RÍO BÁRTULOS CAROLINA, KROTH PETER G., GRUBER ANSGAR: "Rapid induction of GFP expression by the nitrate reductase promoter in the diatom Phaeodactylum tricornutum", PEERJ, vol. 4, pages e2344, XP055807209, DOI: 10.7717/peerj.2344 *

Also Published As

Publication number Publication date
KR102223051B1 (ko) 2021-03-04

Similar Documents

Publication Publication Date Title
WO2014088255A1 (ko) 식물체에서 목적 단백질의 번역 효율을 증진시키기 위한 염기서열
AU2023241333A1 (en) Metabolite production in endophytes (2)
WO2021085852A1 (ko) 질소결핍 유도성 프로모터, 클로렐라 유래 신호 펩타이드 및 이를 포함하는 유전자 발현 시스템
CN100374569C (zh) 一种磷酸甘露糖异构酶基因及其编码蛋白与应用
WO2018199546A1 (ko) 신규한 피루브산 전달효소
CN109082434A (zh) 一种毕赤酵母载体及其制备方法和重组毕赤酵母菌株
WO2013151211A1 (ko) 인간 엔테로키나아제 경사슬 단백질을 생산하는 식물체 및 이의 용도
WO2014017851A2 (en) Novel mars and method for producing target protein using the same
CN116949064A (zh) 一种木薯低温响应茉莉酸合成基因及应用
WO2022019560A1 (ko) N-당질화 돌연변이 벼, 이의 제조방법 및 이를 이용한 단백질 생산용 벼의 제조방법
WO2021100980A1 (ko) 클로렐라 불가리스 유래의 염 유도성 프로모터 및 이의 용도
CN109593768B (zh) 二球悬铃木PaGL1基因在调控植物表皮毛中的应用
WO2015182941A1 (ko) 신규 카탈라아제 신호서열 및 이를 이용한 카탈라아제 발현방법
KR20230107724A (ko) 변형된 식물 배유체 특이 프로모터 및 이의 용도
WO2020232734A1 (zh) 使不产毒微藻产生微囊藻毒素的方法及得到的产毒微藻
WO2020055084A1 (ko) 식물체의 게놈에 레플리콘의 삽입 없이 유전체를 교정하기 위한 바이러스 기반의 레플리콘 및 이의 용도
CN107177602B (zh) 与植物耐旱相关的NtDR1基因及其应用
KR100756889B1 (ko) 아그로박테리움 라이조제네스를 이용한 선별 마커가 결손된형질전환 감자 모상근
KR100597316B1 (ko) 클로렐라 바이러스 유래 신규 프로모터 및 그 용도
WO2020190031A1 (ko) Cgl1 및 cgl2의 발현이 억제된 형질전환 식물 및 이를 이용한 목적 단백질의 생산방법
WO2019088306A1 (ko) 질산환원효소 유래 서열을 포함하는 미세조류 형질전환용 재조합 벡터 및 이의 용도
CN117624331A (zh) 一种利用烟草生产胸腺素β4的方法
KR100797912B1 (ko) 클로렐라 바이러스 에이치에스-1 유래의 프로모터 및 그용도
WO2022211562A1 (ko) 고농도 co2 및/또는 산성에 대한 내성이 증진된 재조합 미세조류
CN113683669B (zh) 基于与醇溶蛋白的互作在植物中积累目标蛋白的方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20882869

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 16/09/2022)

122 Ep: pct application non-entry in european phase

Ref document number: 20882869

Country of ref document: EP

Kind code of ref document: A1