WO2021060714A1 - 셀라지넬라 로씨 추출물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물 - Google Patents
셀라지넬라 로씨 추출물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물 Download PDFInfo
- Publication number
- WO2021060714A1 WO2021060714A1 PCT/KR2020/011205 KR2020011205W WO2021060714A1 WO 2021060714 A1 WO2021060714 A1 WO 2021060714A1 KR 2020011205 W KR2020011205 W KR 2020011205W WO 2021060714 A1 WO2021060714 A1 WO 2021060714A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- extract
- cosmetic composition
- mmp
- skin aging
- rossi
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/08—Anti-ageing preparations
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/40—Chemical, physico-chemical or functional or structural properties of particular ingredients
- A61K2800/52—Stabilizers
- A61K2800/522—Antioxidants; Radical scavengers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/74—Biological properties of particular ingredients
- A61K2800/78—Enzyme modulators, e.g. Enzyme agonists
- A61K2800/782—Enzyme inhibitors; Enzyme antagonists
Definitions
- the present invention relates to a cosmetic composition for preventing skin aging and improving skin wrinkles, comprising a celaginella rosi extract.
- the causes of human skin aging are classified into two types, intrinsic aging and photo-aging, of which photoaging mainly refers to skin aging caused by ultraviolet rays.
- ultraviolet rays are divided into three types: ultraviolet A (UVA, 320-400nm), ultraviolet B (UVB, 280-320nm), and ultraviolet C (UVC, 190-280nm) depending on the wavelength.
- ultraviolet A ultraviolet A
- UVB ultraviolet B
- UVC ultraviolet C
- UVA ultraviolet A
- UVB ultraviolet B
- UVC ultraviolet C
- UV B is known to have a shorter wavelength than UV A and cannot penetrate deep into the skin, but it has much stronger energy than UV A, so it is known as a wavelength that causes sharp erythema on the skin surface and promotes photoaging of the skin.
- Collagen is a major matrix protein produced in fibroblasts of the skin, and is present in the extracellular interstitial, and is an important protein that accounts for 30% of the total weight of a living body protein.
- the main functions are known as the mechanical firmness of the skin, the resistance of connective tissue and the binding force of the tissue, support of cell adhesion, and induction of cell division and differentiation.
- Collagen is also destroyed by exposure to ultraviolet rays, which is an external cause of skin aging, and it is known that changes due to ultraviolet rays are proportional to the accumulation of time exposed to ultraviolet rays.
- Ultraviolet rays accumulate elastic fibrous substances in the dermal layer of the skin and denature collagen fibers, causing wrinkles and lowering elasticity.
- MMPs (Matrix Metalloproteinases) play a key role in the skin aging process caused by UV rays.
- the expression of MMP is induced by UV irradiation, which causes the decomposition of collagen and collagen fibers in the skin tissue, resulting in skin aging including wrinkle formation.
- MMP-1 is an enzyme that decomposes type II and III collagen, including type I collagen, which accounts for more than 90% of the collagen distributed in the human body, and is well known as a target for skin aging and wrinkle improvement.
- MMP-2 is also an enzyme that degrades type IV collagen that forms a basement membrane, and has been studied as a target for improving skin aging ( Int J Mol Sci. 2016; 17, 868).
- MMP-2 and MMP-9 play a major role in skin aging by further decomposing collagen fragments degraded by MMP-1 ( J Appl Biol Chem . 2018; 61, 9-15).
- skin aging involves not only MMPs, but also the production of free radicals, hydrogen peroxide or peroxides generated during the metabolic process of the body, and oxidation of cellular and tissue components due to the destruction of antioxidant defense mechanisms in the body. This causes damage to skin cells and tissues, accelerating skin aging.
- the present inventors completed the present invention by conducting research to discover a material for preventing skin aging and improving skin wrinkles.
- Patent Document 1 Korean Patent Publication No. 10-2007-0045157
- One object of the present invention is to provide a cosmetic composition for preventing skin aging and improving skin wrinkles, including Selaginella rossii extract.
- One aspect provides a cosmetic composition for preventing skin aging and improving skin wrinkles, including Selaginella rossii extract.
- the selesinella rosehip may be used as a stem, leaf, root, flower, seed, or whole plant.
- the Selesinella Rossi is distributed throughout Korea, northern China, Russia, etc., so it is easy to secure raw materials, and it is possible to purchase or use directly collected ones.
- the Celagenella Rossi extract can be obtained as follows. After washing the Celagenella Rossi with water to remove foreign substances, dry it in the shade, and add an appropriate amount of solvent to the dried Celagenella Rossi so that it is completely immersed. In this case, the dried Celagenella Rossi may be used as it is dried or may be pulverized and used in a powder form.
- Cellagenella Rossi can be extracted using a conventional extraction solvent, for example, (a) anhydrous or hydrated lower alcohol having 1 to 4 carbon atoms (e.g., methanol, ethanol, propanol, butanol, normal-propanol, iso -Propanol and normal-butanol), (b) a mixed solvent of the lower alcohol and water, (c) acetone, (d) ethyl acetate, (e) chloroform, (f) 1,3-butylene glycol, ( g) hexane, (h) diethyl ether, (i) butyl acetate (j) chloroform-methanol, or (k) distilled water.
- the extraction solvent may be extracted with an aqueous ethanol solution (70%, 95% (v/v) ethanol) in which ethanol and water are mixed in a volume ratio of 70:30 to 95:5, or ethyl acetate.
- the extract may be an ethanol extract or an ethyl acetate extract.
- the ethanol extract of Cellagenella Rossi has excellent antioxidant effect
- the ethylacetate extract of Cellagenella Rossi has excellent effect of inhibiting MMP expression and increasing the expression of collagen synthase, so it is used to prevent skin aging and improve skin wrinkles. Can be.
- it was confirmed that the extract of Celazinella rosi has a superior effect of inhibiting MMP expression than other Celazinella genus plants of the same genus.
- the amount of the extraction solvent may be 1 to 30 times the weight of Celazinella Rossi, but is not particularly limited.
- the extraction may be hot water extraction, room temperature immersion extraction, reflux cooling extraction, or ultrasonic extraction.
- the number of extractions may be 1 to 5 times.
- the extraction time may be 2 to 72 hours, 24 to 72 hours, or 48 hours when extracted at room temperature, but is not particularly limited.
- the cosmetic composition may further include fatty substances, organic solvents, solubilizers, thickening and gelling agents, softening agents, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic Cosmetics such as emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic actives, lipid vesicles or any other ingredients commonly used in cosmetics It may further include adjuvants commonly used in the field.
- fatty substances organic solvents, solubilizers, thickening and gelling agents, softening agents, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic Cosmetics such as emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes
- the cosmetic composition may contain various bases and/or additives necessary and appropriate for the formulation of the formulation, and within a range that does not deteriorate the effect, nonionic surfactants, silicone polymers, extender pigments, fragrances, preservatives, disinfectants, Oxidation stabilizers, organic solvents, ionic or nonionic thickeners, softening agents, antioxidants, free radical destroying agents, opacifying agents, stabilizers, emollients, silicones, ⁇ -hydroxy acids, antifoaming agents, moisturizing agents, vitamins, Insect repellents, flavors, preservatives, surfactants, anti-inflammatory agents, substance P antagonists, fillers, polymers, propellants, basification or acidifying agents, or colorants, and other known compounds may be further included.
- nonionic surfactants silicone polymers, extender pigments, fragrances, preservatives, disinfectants, Oxidation stabilizers, organic solvents, ionic or nonionic thickeners, softening agents,
- the skin aging and the skin wrinkles may be caused by exposure to ultraviolet rays of the skin.
- the celaginella rosi extract may exhibit an effect of preventing skin aging and improving skin wrinkles by inhibiting the expression of MMP-1, MMP-2, and MMP-9 increased by ultraviolet rays.
- the selesinella rosi extract may exhibit an effect of preventing skin aging and improving skin wrinkles by increasing the expression of COL1A1 and COL1A2 reduced by ultraviolet rays.
- the celaginella rosi extract exhibits remarkable DPPH radical scavenging activity, inhibits overexpression of MMP-1, MMP-2, and MMP-9 induced by ultraviolet rays in human skin cells, or by ultraviolet rays. Since it exhibits an activity of increasing the decrease in the expression of induced COLA1 and COLA2, it is possible to effectively improve skin aging by inhibiting the degradation of proteins such as skin collagen damaged by ultraviolet rays or the like.
- the cosmetic composition is composed of a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleansing, an oil, a powder foundation, an emulsion foundation, a wax foundation, and a spray. It may be any one formulation selected from the group.
- the cosmetic composition is formulated as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, and spray. May be, but is not limited thereto. More specifically, softening lotion, nourishing lotion, lotion, body lotion, nourishing cream, massage cream, moisture cream, hand cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, gel, patch, oil-in-water Basic cosmetics such as (oil-in-water, O/W) type and water-in-oil (W/O) type, color cosmetics such as lipstick, makeup base or foundation, hair tonic, gel or mousse, etc. It may be formulated as a cosmetic composition for hair such as hair fixatives, wool or hair dye.
- hair such as hair fixatives, wool or hair dye.
- the formulation of the cosmetic composition is a paste, cream or gel
- a carrier component animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide, etc. Can be used.
- the formulation of the cosmetic composition is a powder or spray
- lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component.
- a solvent, a solubilizing agent or an emulsifying agent may be used as a carrier component.
- a solvent for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan may be used. .
- the formulation of the cosmetic composition is a suspension
- a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tracant, and the like can be used.
- the formulation of the cosmetic composition is a surfactant-containing cleansing
- aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid Amide ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like
- aliphatic alcohol sulfate aliphatic alcohol ether sulfate
- sulfosuccinic acid monoester isethionate
- imidazolinium derivative methyltaurate
- sarcosinate fatty acid Amide ether sulfates
- alkylamidobetaines alkylamidobetaines
- the formulation of the cosmetic composition is a soap, a cleansing formulation containing a surfactant, or a cleansing formulation containing no surfactant
- the soap may be, for example, liquid soap, powder soap, solid soap and oil soap
- the cleansing formulation containing surfactant may be a cleansing foam, cleansing water, cleansing towel and cleansing pack
- the cleansing formulation containing no surfactant is cleansing. It may be a cream, a cleansing lotion, a cleansing water, and a cleansing gel, but is not limited thereto.
- the cosmetic composition for preventing skin aging and improving skin wrinkles comprising an extract or a fraction thereof, it has an excellent antioxidant effect and an effect of inhibiting overexpression of collagen-degrading enzyme, so it is used for preventing skin aging and improving skin wrinkles. It can be usefully used.
- 1 is a graph showing the results of confirming the cytotoxicity according to the treatment of the ethanol extract or ethyl acetate extract of Cellagenella Rossi in CCD-986sk skin cells.
- FIG. 2 is a graph showing the results of suppressing the overexpression of MMP-1 according to treatment with an ethanol extract or ethyl acetate extract of Celagenella Rossi in CCD-986sk cells irradiated with ultraviolet rays.
- FIG. 3 is a graph showing the results of confirming the inhibition of MMP-2 overexpression according to treatment with an ethanol extract or ethyl acetate extract of Celagenella Rossi in CCD-986sk cells irradiated with ultraviolet rays.
- FIG. 4 is a graph showing the results of confirming the inhibition of MMP-9 overexpression according to the treatment of an ethanol extract or ethyl acetate extract of Celazinella Rossi in CCD-986sk cells irradiated with ultraviolet rays.
- FIG. 5 is a graph showing the result that the expression of COL1A1 decreased in UV-irradiated CCD-986sk cells is recovered again by treatment with an ethanol extract of celaginella rosi or an ethyl acetate extract.
- Figure 6 is a graph showing the result that the expression of COL1A2 decreased in the UV-irradiated CCD-986sk cells is recovered again by treatment with an ethanol extract of celaginella rosi or an ethyl acetate extract.
- Figure 7 shows the results of comparing the MMP-1 expression inhibitory effect of Celajinella Rossi and the same genus plant extract.
- # is P ⁇ 0.01 when compared to the control group not treated with UV
- * is P ⁇ 0.05 when compared to the control group treated with only UV
- ** is P ⁇ 0.01 when compared to the control group treated with only UV .
- Selaginella rossii (Selaginella rossii) The whole above-ground part was collected (origin: Yanbian, China) and dried at room temperature. The dried product was prepared by cutting into an appropriate size and grinding using a blender.
- DPPH 2,2-diphenyl-2-picrylhydrazyl
- the celaginella rosi extract can be used for skin aging prevention according to its excellent antioxidant activity.
- CCD-986sk fibroblasts (Korea Cell Line Bank, Korea), which are normal human skin cells, contain 10% FBS (fetal bovine serum) (Atlas), 100 units/ml penicillin and 100 ⁇ g/ml streptomycin.
- FBS fetal bovine serum
- penicillin 100 units/ml penicillin
- streptomycin 100 ⁇ g/ml streptomycin.
- IMDM Iscove's Modified Dulbecco's Medium
- Welgene was cultured in a humidified 5% CO 2 incubator at 37°C.
- Example 3-1 the cells of Example 3-1 were placed in a 96-well plate at 5 ⁇ 10 3 cells/100 ⁇ l per well, and cultured in a humidified 5% CO 2 incubator at 37°C. After 24 hours, the 70% ethanol extract, 95% ethanol extract, and ethyl acetate extract of Example 1 were treated with 100 ⁇ l of IMDM medium at a final concentration of 100 ⁇ g/ml, respectively. After incubation for 24 hours, 100 ⁇ l of the medium was removed from each well, 10 ⁇ l of Cyto X TM (LPS solution, Korea) was added each to react for 60 minutes, and then at 450 nm using a microplate reader. The absorbance was measured.
- Cyto X TM LPS solution, Korea
- MMP (matrix metalloproteinase)-1 is an enzyme that causes skin aging and wrinkle formation by decomposing type I, II, and III collagen.
- Example 3-1 In order to confirm whether the generation of MMP-1 due to UV treatment in CCD-986sk cells was inhibited by treatment with Celazinella Rossi extract, the cells of Example 3-1 were treated with UV rays and Celazinella Rossi extract. The change in the concentration of MMP-1 was measured.
- Example 3-1 the cells of Example 3-1 were placed in a 6-well plate at 1.5 ⁇ 10 5 cells per well, and cultured in a humidified 5% CO 2 incubator at 37°C. After 24 hours, cells treated with ultraviolet B (UVB) 40mJ/cm 2 were treated with 70% ethanol extract, 95% ethanol extract, or ethyl acetate extract of Example 1 at a final concentration of 20 or 50 ⁇ g/ml, respectively. Incubated for 24 hours with the added IMDM medium. After incubation, in the supernatant of each well, the concentration of the synthesized MMP-1 was measured using an MMP-1 ELISA kit (Abcam).
- UVB ultraviolet B
- a 7500-Real-Time PCR system (Applied) using SYBR Green Master (Roche) using the characteristics of SYBR Green that intervenes in dsDNA (double strand deoxyribonucleic acid) together with an oligo synthesized to amplify each gene. Biosystems, Foster City, CA) confirmed the amplification process of cDNA in real time. The results were quantified and displayed by the expression of Actin. It was confirmed that the primers used formed a single amplicon of about 100 to 200 bp during the PCR amplification process.
- the nucleotide sequence used is shown in Table 3 below.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Dermatology (AREA)
- Gerontology & Geriatric Medicine (AREA)
- Biotechnology (AREA)
- Botany (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Birds (AREA)
- Epidemiology (AREA)
- Cosmetics (AREA)
Abstract
본 발명은 셀라지넬라 로씨 추출물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물에 관한 것으로, 우수한 항산화 효과 및 콜라겐 분해 효소의 과발현을 억제하는 효과를 나타내므로, 피부 노화 방지 및 피부 주름 개선 용도로 유용하게 활용될 수 있다.
Description
본 발명은 셀라지넬라 로씨 추출물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물에 관한 것이다.
사람의 피부노화를 일으키는 원인으로는 내적인 노화(intrinsic aging)와 광노화(photo-aging) 두가지로 구분되며, 그 중 광노화는 주로 자외선에 의한 피부노화를 의미한다.
일반적으로 자외선은 그 파장에 따라 자외선 A(UVA, 320-400nm), 자외선 B(UVB, 280-320nm) 및 자외선 C(UVC, 190-280nm) 등 세 가지로 구분된다. 태양광으로부터 지표에 도달하는 자외선 중 자외선 C는 대기권의 상층부에 있는 오존층에서 흡수, 산란되어 여과되므로 자연적 광화학 반응에 별다른 영향을 미치지 않는다. 자외선 A는 일차적으로는 태양으로부터 방출되나 인공 램프 등에 의해서도 방출되며 피부의 표피와 진피층에 깊숙하게 투과한다. 한편, 자외선 B는 자외선 A 보다 파장이 짧아서 피부 깊숙이 침투하지는 못한다고 알려져 있으나, 자외선 A 보다 훨씬 강한 에너지를 가지고 있어서 피부 표면에 예리한 홍반을 발생시키는 한편 피부의 광노화를 촉진시키는 파장으로 알려져 있다.
콜라겐은 피부의 섬유아세포에서 생성되는 주요 기질 단백질로서 세포외 간질에 존재하고, 생체 단백질 총중량의 30%를 차지하는 중요한 단백질로 견고한 3중 나선구조를 가지고 있다. 주된 기능으로는 피부의 기계적 견고성, 결합조직의 저항력과 조직의 결합력, 세포접착의 지탱, 세포분할과 분화의 유도 등이 알려져 있다. 콜라겐은 피부노화의 외적인 원인이 되는 자외선 노출에 의해서도 파괴되며, 자외선에 의한 변화는 자외선에 노출된 시간의 축적에 비례하는 것으로 알려져 있다. 자외선은 피부 진피층에서 탄력섬유성 물질을 축적시키고 교원 섬유를 변성시켜 피부에 주름이 생기게 만들고 탄력성을 저하시킨다.
자외선에 의한 피부노화과정에서 MMPs(Matrix Metalloproteinases)는 핵심적인 역할을 한다. 자외선 조사에 의해 MMP의 발현이 유도되는데, MMP는 피부조직의 콜라겐을 비롯한 교원섬유들의 분해를 야기하여 주름 생성을 비롯한 피부노화를 초래한다. 그 중, MMP-1은 인체 분포된 콜라겐 중 90%이상을 차지하는 type Ⅰ 콜라겐을 비롯한 type Ⅱ, Ⅲ 콜라겐을 분해하는 효소로, 피부노화 및 주름 개선의 표적으로 잘 알려져 있다. MMP-2 또한 기저막(basement membrane)을 형성하는 type Ⅳ 콜라겐을 분해하는 효소로, 피부노화 개선의 표적으로 연구되고 있다(
Int J Mol Sci. 2016; 17, 868). MMP-2와 MMP-9은 MMP-1에 의해 분해된 콜라겐 조각들을 더 잘게 분해하여 피부노화에 주요한 역할을 한다 (
J Appl Biol Chem. 2018; 61, 9-15).
또한, 피부노화에는 MMPs뿐만 아니라, 신체의 대사 과정 중에 발생하는 자유라디칼, 과산화수소 또는 과산화물의 생성, 및 생체 내 항산화 방어기전의 파괴에 따른 세포 및 조직 구성물질의 산화 등이 관여하며, 이와 같은 요소에 의해 피부세포 및 조직에 손상이 발생하여 피부의 노화가 가속화된다.
이에, 본 발명자들은 피부 노화 방지 및 피부 주름 개선용 소재를 발굴하기 위한 연구를 수행하여 본 발명을 완성하였다.
[선행기술문헌]
(특허문헌 1) 대한민국 특허공개 제10-2007-0045157호
본 발명의 하나의 목적은 셀라지넬라 로씨(
Selaginella rossii) 추출물울 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물을 제공하는 것이다.
일 양상은 셀라지넬라 로씨(
Selaginella rossii) 추출물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물을 제공한다.
상기 셀레지넬라 로씨는 줄기, 잎, 뿌리, 꽃, 종자, 또는 식물 전체를 사용할 수 있다. 상기 셀레지넬라 로씨는 국내 전역, 중국 북부, 러시아 등에 분포하고 있어 원료 확보가 용이하며, 구입하거나 직접 채취한 것을 사용할 수 있다.
상기 셀라지넬라 로씨 추출물은 하기와 같이 수득될 수 있다. 셀라지넬라 로씨를 물로 세척하여 이물질을 제거한 후 그늘에서 건조하고, 건조된 셀라지넬라 로씨에 적당한 양의 용매를 첨가하여 완전히 침지되도록 한다. 이 때, 건조된 셀라지넬라 로씨는 건조된 상태 그대로 사용하거나 분쇄하여 분말 형태로 사용할 수 있다. 셀라지넬라 로씨는 통상의 추출용매를 이용하여 추출할 수 있으며, 예를 들면, (a) 탄소수 1~4의 무수 또는 함수 저급 알코올(예: 메탄올, 에탄올, 프로판올, 부탄올, 노말-프로판올, 이소-프로판올 및 노말-부탄올 등), (b) 상기 저급 알코올과 물과의 혼합용매, (c) 아세톤, (d) 에틸아세테이트, (e) 클로로포름, (f) 1,3-부틸렌글리콜, (g) 헥산, (h) 디에틸에테르, (i) 부틸아세테이트 (j) 클로로포름-메탄올 또는 (k) 증류수를 이용하여 추출할 수 있다. 구체적으로, 상기 추출용매는 에탄올 및 물이 70:30 내지 95:5의 부피비로 혼합된 에탄올 수용액(70%, 95%(v/v) 에탄올), 또는 에틸아세테이트로 추출할 수 있다.
일 구체예에 따르면, 상기 추출물은 에탄올 추출물 또는 에틸아세테이트 추출물일 수 있다. 일 실시예에 따르면 셀라지넬라 로씨의 에탄올 추출물은 항산화 효과가 우수하며, 셀라지넬라 로씨의 에틸아세테이트 추출물은 MMP 발현 억제 및 콜라겐 합성 효소 발현 증가 효과가 우수하므로 피부 노화 방지 및 피부 주름 개선에 이용될 수 있다. 또한 일 실시예에 따르면, 셀라지넬라 로씨 추출물은 동속이종의 다른 셀라지넬라속 식물보다 MMP 발현 억제 효과가 우수함이 확인되었다.
상기 추출 용매의 양은 셀라지넬라 로씨 중량의 1 내지 30배일 수 있으나 특별히 한정되는 것은 아니다.
상기 추출은 열수 추출, 상온 침지 추출, 환류 냉각 추출, 또는 초음파 추출 방법을 사용할 수 있다. 추출 횟수는 1 내지 5회일 수 있다. 추출시간은 실온에서 추출하는 경우 2 내지 72시간, 24 내지 72시간, 또는 48시간일 수 있으나 특별히 한정되는 것은 아니다.
상기 화장료 조성물은 추가로 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속 이온 봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 친수성 또는 친유성 활성제, 지질 소낭 또는 화장품에 통상적으로 사용되는 임의의 다른 성분과 같은 화장품 분야에서 통상적으로 사용되는 보조제를 더 포함할 수 있다.
상기 화장료 조성물은 그 제형의 제제화에 필요하고 적절한 각종 기제 및/또는 첨가물을 포함할 수 있으며, 그 효과를 떨어트리지 않는 범위 내에서 비이온 계면활성제, 실리콘 폴리머, 체질안료, 향료, 방부제, 살균제, 산화 안정화제, 유기 용매, 이온성 또는 비이온성 증점제, 유연화제, 산화방지제, 자유 라디칼 파괴제, 불투명화제, 안정화제, 에몰리언트(emollient), 실리콘, α-히드록시산, 소포제, 보습제, 비타민, 곤충 기피제, 향료, 보존제, 계면활성제, 소염제, 물질 P 길항제, 충전제, 중합체, 추진제, 염기성화 또는 산성화제, 또는 착색제 등 공지의 화합물을 더 포함하여 제조될 수 있다.
일 구체예에 따르면, 상기 피부 노화 및 상기 피부 주름은 피부의 자외선 노출에 의해 발생하는 것일 수 있다.
일 구체예에 따르면, 상기 셀라지넬라 로씨 추출물은 자외선에 의해 증가된 MMP-1, MMP-2, 및 MMP-9의 발현을 억제함으로써 피부 노화 방지 및 피부 주름 개선 효과를 나타내는 것일 수 있다.
일 구체예에 따르면, 상기 셀레지넬라 로씨 추출물은 자외선에 의해 감소된 COL1A1과 COL1A2의 발현을 증가시킴으로써 피부 노화 방지 및 피부 주름 개선 효과를 나타내는 것일 수 있다.
일 실시예에 따르면, 상기 셀라지넬라 로씨 추출물은 현저한 DPPH 라디칼 소거 활성을 나타내고, 인간 피부세포에서 자외선에 의해 유도된 MMP-1, MMP-2및 MMP-9의 과발현을 억제하거나, 자외선에 의해 유도된 COLA1 및 COLA2의 발현 감소를 증가시키는 활성을 나타내므로, 자외선 등에 의해 손상되는 피부 콜라겐 등의 단백질 분해를 억제함으로써 피부노화를 효과적으로 개선할 수 있다.
일 구체예에 따르면, 상기 화장료 조성물은 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이로 이루어진 군에서 선택되는 어느 하나의 제형일 수 있다.
예를 들어, 상기 화장료 조성물은 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연화장수, 영양화장수, 로션, 바디 로션, 영양 크림, 마사지 크림, 모이스처 크림, 핸드크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 폼, 클렌징 워터, 팩, 젤, 패치, 수중유(oil-in-water, O/W)형, 유중수(water-in-oil, W/O)형 등의 기초 화장료, 립스틱, 메이크업베이스 또는 파운데이션 등의 색조 화장료, 헤어토닉, 젤 또는 무스 등의 정발제(hair fixatives), 양모제 또는 염모제 등의 모발용 화장료 조성물로 제형화될 수 있다.
상기 화장료 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로써, 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 사용될 수 있다.
상기 화장료 조성물의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 사용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸에테르와 같은 추진체를 포함할 수 있다.
상기 화장료 조성물의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 사용될 수 있다. 예를 들어, 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌글리콜 또는 소르비탄의 지방산 에스테르가 사용될 수 있다.
상기 화장료 조성물의 제형이 현탁액인 경우에는 담체 성분으로써, 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소 결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 사용될 수 있다.
상기 화장료 조성물의 제형이 계면활성제 함유 클렌징인 경우에는 담체 성분으로써, 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 사용될 수 있다.
상기 화장료 조성물의 제형이 비누, 계면활성제 함유 클렌징 또는 계면활성제 비함유 클렌징 제형일 경우, 피부에 도포한 후 닦아내거나 떼거나 물로 씻어낼 수 있다. 상기 비누는 예를 들어, 액상비누, 가루비누, 고형비누 및 오일비누일 수 있고, 계면활성제 함유 클린징 제형은 클렌징폼, 클렌징 워터, 클렌징 수건 및 클렌징 팩일 수 있으며, 계면활성제 비함유 클렌징 제형은 클렌징크림, 클렌징 로션, 클렌징 워터 및 클렌징 겔일 수 있으나, 이에 한정되는 것은 아니다.
셀라지넬라 로씨 추출물 또는 이의 분획물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물에 따르면, 우수한 항산화 효과 및 콜라겐 분해 효소의 과발현을 억제하는 효과를 나타내므로, 피부 노화 방지 및 피부 주름 개선 용도로 유용하게 활용될 수 있다.
도 1은 CCD-986sk 피부세포에서 셀라지넬라 로씨 에탄올 추출물 또는 에틸아세테이트 추출물의 처리에 따른 세포독성을 확인한 결과를 나타낸 그래프이다.
도 2는 자외선 조사한 CCD-986sk세포에서 셀라지넬라 로씨 에탄올 추출물 또는 에틸아세테이트 추출물의 처리에 따른 MMP-1의 과발현을 억제한 결과를 나타낸 그래프이다.
도 3은 자외선 조사한 CCD-986sk세포에서 셀라지넬라 로씨 에탄올 추출물 또는 에틸아세테이트 추출물의 처리에 따른 MMP-2 과발현의 억제를 확인한 결과를 나타낸 그래프이다.
도 4는 자외선 조사한 CCD-986sk세포에서 셀라지넬라 로씨 에탄올 추출물 또는 에틸아세테이트 추출물의 처리에 따른 MMP-9 과발현의 억제를 확인한 결과를 나타낸 그래프이다.
도 5는 자외선 조사한 CCD-986sk세포에서 감소된 COL1A1의 발현이 셀라지넬라 로씨 에탄올 추출물 또는 에틸아세테이트 추출물의 처리에 의해 다시 회복되는 결과를 나타낸 그래프이다.
도 6은 자외선 조사한 CCD-986sk세포에서 감소된 COL1A2의 발현이 셀라지넬라 로씨 에탄올 추출물 또는 에틸아세테이트 추출물의 처리에 의해 다시 회복되는 결과를 나타낸 그래프이다.
도 7은 셀라지넬라 로씨 및 이와 동속이종 식물 추출물의 MMP-1 발현 억제 효과를 비교한 결과를 나타낸 것이다. 도 7에서, #은 UV를 처리하지 않은 대조군과 비교할 때 P<0.01이며, *은 UV만 처리한 대조군과 비교할 때 P<0.05이며, **은 UV만 처리한 대조군과 비교할 때 P<0.01이다.
이하 본 발명을 하나 이상의 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. 셀라지넬라 로씨 추출물의 제조
셀라지넬라 로씨(
Selaginella rossii) 지상부 전체를 채취(원산지: 중국, 연변)하여 상온에서 건조하였다. 건조물은 적당한 크기로 절단하여 블렌더(blender mixer)를 이용하여 분쇄하여 준비하였다.
셀라지넬라 로씨 분쇄물 10g 당 70%(v/v) 에탄올 수용액, 95%(v/v) 에탄올 수용액, 또는 에틸아세테이트를 각각 100㎖씩 가하고 교반하면서 48시간 동안 실온에서 추출한 후, 여과지(Whatman, No. 2)를 사용하여 용매 가용부만을 회수하였다. 추출액은 감압 하에서 농축하여 셀라지넬라 로씨의 70% 에탄올 추출물, 95% 에탄올 추출물, 및 에틸아세테이트 추출물을 수득하였다.
실시예 2. 셀라지넬라 로씨 추출물의 DPPH 소거 활성 확인
실시예 1의 셀라지넬라 로씨 추출물의 항산화 활성을 확인하기 위하여, 셀라지넬라 로씨 추출물의 DPPH 소거 활성을 평가하였다.
구체적으로, 2,2-diphenyl-2-picrylhydrazyl(DPPH, sigma, USA)를 0.15mM이 되도록 메탄올에 용해하여 DPPH 용액을 제조하였다. 96 웰 플레이트에 메탄올로 희석된 시료 10㎕ 및 DPPH 용액을 함께 첨가한 후, 실온에서 40분간 반응시켰다. 반응액은 Microplate reader 680(Bio Rad Co., USA)을 이용하여 517nm에서 흡광도를 측정하여 DPPH 라디칼 소거능을 계산하였다.
그 결과, 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물, 및 에틸아세테이트 추출물은 우수한 DPPH 자유 라디칼 소거능을 나타내는 것으로 확인되었다(표 1).
구분 | 시료농도(㎍/㎖) | DPPH 라디칼 소거능(%) |
셀라지넬라 로씨 70% 에탄올 추출물 | 200 | 53.2 ± 0.8 |
셀라지넬라 로씨 95% 에탄올 추출물 | 200 | 67.6 ± 1.1 |
셀라지넬라 로씨 에틸아세테이트 추출물 | 200 | 13.7 ± 0.2 |
이와 같은 결과를 통하여, 셀라지넬라 로씨 추출물은 우수한 항산화 활성에 따른 피부 노화 방지 용도로 사용될 수 있음을 확인하였다.
실시예 3. 셀라지넬라 로씨 추출물의 MMP 과발현 억제 효과 확인
3-1. 세포 배양
인간 정상 피부 세포인 CCD-986sk 섬유아세포(한국세포주은행, 대한민국)는 10% FBS(fetal bovine serum)(Atlas), 100units/㎖ 페니실신(penicillin) 및 100㎍/㎖ 스트렙토마이신(streptomycin)이 함유된 IMDM(Iscove's Modified Dulbecco's Medium)(Welgene) 배지를 이용하여 37℃의 습윤한 5% CO
2 배양기에서 배양하였다.
3-2. 세포독성 평가
셀라지넬라 로씨 추출물이 세포 독성을 나타내는지 확인하기 위하여, 실시예 3-1의 세포에 대한 셀라지넬라 로씨 추출물의 세포독성 여부를 평가하였다.
구체적으로, 96-웰 플레이트에 실시예 3-1의 세포를 웰당 5×10
3 세포/100㎕씩 넣고, 37℃의 습윤한 5% CO
2 배양기에서 배양하였다. 24시간 후, 실시예 1의 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물 및 에틸아세테이트 추출물을 각각 최종 농도 100㎍/㎖로 IMDM 배지 100㎕와 함께 처리하였다. 24시간 배양한 뒤, 각 웰에서 배지를 100㎕씩 제거한 후, Cyto X
TM(LPS solution, 대한민국)을 10㎕씩 첨가하여 60분 동안 반응 시킨 다음 마이크로플레이트 판독기(Microplate Reader)를 사용하여 450nm에서 흡광도를 측정하였다.
그 결과, 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물 및 에틸아세테이트 추출물은 모두 50㎍/㎖의 농도까지 세포독성을 나타내지 않는 것으로 확인되었다(도 1).
3-3. CCD-986sk 세포에서 MMP-1 생성량 감소 확인
MMP(matrix metalloproteinase)-1은 type Ⅰ, Ⅱ, Ⅲ 콜라겐을 분해하여 피부 노화 및 주름 생성을 야기하는 효소이다.
CCD-986sk 세포에서 자외선 처리에 따른 MMP-1의 생성이 셀라지넬라 로씨 추출물의 처리에 의해 억제되는지 여부를 확인하기 위하여, 실시예 3-1의 세포에 자외선 및 셀라지넬라 로씨 추출물을 처리하여 MMP-1의 농도 변화를 측정하였다.
구체적으로, 6 웰 플레이트에 실시예 3-1의 세포를 웰당 1.5×10
5개씩 넣고 37℃의 습윤한 5% CO
2 배양기에서 배양하였다. 24시간 후, 자외선 B(UVB) 40mJ/cm
2 로 처리한 세포에 실시예 1의 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물 또는 에틸아세테이트 추출물을 각각 최종 농도 20 또는 50㎍/㎖로 첨가한 IMDM 배지로 24시간 동안 배양하였다. 배양 후, 각 웰의 상층액에서, MMP-1 ELISA 키트(Abcam사)를 사용하여 합성된 MMP-1의 농도를 측정하였다.
그 결과, 50㎍/㎖ 농도의 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물을 처리한 실험군은 대조군 대비 MMP-1의 생성이 각각 57.1%, 84.7%씩 감소된 것으로 확인되었다. 또한, 20㎍/㎖ 또는 50㎍/㎖ 농도의 에틸아세테이트 추출물을 처리한 실험군은 대조군 대비 MMP-1의 생성이 각각 86.2%, 99.5%씩 감소된 것으로 확인되었다(표 2).
구분 | 시료농도(㎍/㎖) | MMP-1 생성 억제율(%) |
셀라지넬라 로씨 70% 에탄올 추출물 | 20 | 5.0 ± 0.5 |
50 | 57.1 ± 3.8 | |
셀라지넬라 로씨 95% 에탄올 추출물 | 20 | 68.3 ± 1.4 |
50 | 84.7 ± 3.3 | |
셀라지넬라 로씨 에틸아세테이트 추출물 | 20 | 86.2 ± 1.1 |
50 | 99.5 ± 1.1 |
이와 같은 결과를 통하여, 셀라지넬라 로씨 추출물의 우수한 MMP-1 생성 억제 활성을 확인하였다.
3-4. CCD-986sk 세포에서 MMPs및 Collagen 유전자의 발현 조절 활성 확인
CCD-986sk 세포에서 자외선 처리에 따른 MMP-1, MMP-2, MMP-9, COL1A1, 및 COL1A2 유전자의 발현이 셀라지넬라 로씨 추출물의 처리에 의해 조절되는지 여부를 확인하였다.
구체적으로, 실시예 3-3의 방법으로 자외선 처리한 세포에 셀라지넬라 로씨 시료를 24시간 처리한 실험군에서 TRI reagent(Ambion)를 이용하여 총 RNA를 분리한 다음, High-capacity cDNA Reverse Transcription kit(Applied Biosystems)를 사용하여 cDNA를 합성하였다. 각각의 유전자를 증폭시킬 수 있도록 합성된 올리고(oligo)와 함께 dsDNA(double strand deoxyribonucleic acid)에 끼어들어가는 SYBR Green의 특성을 이용한 SYBR Green Master(Roche)를 사용하여 7500-Real-Time PCR system(Applied Biosystems, Foster City, CA)에서 실시간으로 cDNA의 증폭과정을 확인하였다. 결과는 Actin의 발현으로 정량화하여 표시하였다. 사용된 프라이머들은 PCR 증폭과정에서 100 내지 200bp 정도의 단일 앰플리콘(single amplicon)을 형성함을 확인하였다. 사용한 염기서열은 하기 표 3과 같다.
프라이머 | 프라이머 염기서열(5'→3') | 서열번호 | |
Actin | forward | GGCACCACACCTTCTACAAT | 서열번호 1 |
reverse | GCCTGGATAGCAACGTACAT | 서열번호 2 | |
MMP-1 | forward | AACACATCTGACCTACAGGATTGAAA | 서열번호 3 |
reverse | CTTGGTGAATGTCAGAGGTGTGA | 서열번호 4 | |
MMP-2 | forward | ACTGGAGCAAAAACAAGAAGACATAC | 서열번호 5 |
reverse | TCCATTTTCTTCTTCACCTCATTG | 서열번호 6 | |
MMP-9 | forward | GCGCTGGGCTTAGATCATTC | 서열번호 7 |
reverse | GTGCCGGATGCCATTCA | 서열번호 8 | |
COL1A1 | forward | TGGCCTCGGAGGAAACTTT | 서열번호 9 |
reverse | GCTTCCCCATCATCTCCATTC | 서열번호 10 | |
COL1A2 | forward | CGGTGGTGGTTATGACTTTGGT | 서열번호 11 |
reverse | GAAGGGTCTCAATCTGGTTGTTG | 서열번호 12 |
그 결과, 20㎍/㎖ 또는 50㎍/㎖ 농도의 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물 또는 에틸아세테이트 추출물 처리에 의하여 자외선 조사에 의해 과발현된 MMP-1의 발현이 유의적으로 억제된 것으로 확인되었다(도 2).
이와 같은 결과를 통하여, 셀라지넬라 로씨 추출물의 투여에 의하여 type Ⅰ, Ⅱ, Ⅲ 콜라겐을 분해하는 MMP-1의 발현이 억제됨으로써, 피부 노화 방지 및 주름 생성 개선 효과를 확인하였다.
또한, MMP-1에 의해 1차로 분해된 콜라겐 조각들을 더 잘게 분해하는 MMP-2와 MMP-9의 발현을 확인한 결과, 20 또는 50 ㎍/㎖ 농도의 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물, 또는 에틸아세테이트 추출물의 처리에 의하여 자외선 조사에 의해 과발현된 MMP-2와 MMP-9의 발현 역시 유의적으로 감소한 것으로 확인되었다(도 3, 도 4).
그 외에, MMPs들의 타겟인 콜라겐의 발현을 조절하는 COL1A1과 COL1A2 유전자의 발현을 확인한 결과, 20 또는 50 ㎍/㎖ 농도의 셀라지넬라 로씨 70% 에탄올 추출물, 95% 에탄올 추출물, 또는 에틸아세테이트 추출물의 처리에 의하여 자외선 조사에 의해 발현 저하된 COL1A1과 COL1A2 유전자의 발현이 유의적으로 증가한 것으로 확인되었다(도 5, 도 6).
3-5. 셀라지넬라 로씨와 동속이종 식물의 MMP-1 발현 억제 효과 비교
셀라지넬라 로씨와 동속이종 식물인 셀라지넬라 타마리시나(S. tamariscina) 및 셀라지넬라 인볼벤스(S. involvens)의 추출물의 UV에 의해 유도된 MMP-1 발현 억제 효과를 확인하고, 이를 셀라지넬라 로씨 추출물의 효과와 비교하였다(하기 표 4 참조). 구체적인 실험방법은 상기 실시예 3-4와 동일하다.
학명 | 채집 국가(지역) | 부위 | 추출용매 | |
SR | S. rossii | China (연변) | Whole plant | 95% EtOH Ex. |
ST | S. tamariscina | China (연변) | Whole plant | MeOH Ex. |
ST-L | S. tauntoniana | 한국 | Leaf | MeOH Ex. |
ST-S | S. tamariscina | 한국 | Stem | MeOH Ex. |
SI | S. involvens | 한국 | Whole plant | 95% EtOH Ex. |
실험결과, 셀라지넬라 로씨 추출물(SR)은 셀라지넬라 타마리시나(ST, ST-L, ST-S) 추출물 및 셀라지넬로 인볼벤스(SI) 추출물보다 MMP-1 발현 억제 효과가 우수함을 확인하였다. (도 7 참조)
이제까지 본 발명에 대하여 그 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.
Claims (6)
- 셀라지넬라 로씨( Selaginella rossii) 추출물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물.
- 제 1 항에 있어서, 상기 추출물은 에탄올 추출물 또는 에틸아세테이트 추출물인 것인 화장료 조성물.
- 제 1 항에 있어서, 상기 피부 노화 및 상기 피부 주름은 피부의 자외선 노출에 의해 발생하는 것인 화장료 조성물.
- 제 1 항에 있어서, 상기 셀라지넬라 로씨 추출물은 자외선에 의해 증가된 MMP-1, MMP-2 및 MMP-9의 발현을 억제함으로써 피부 노화 방지 및 피부 주름 개선 효과를 나타내는 것인 화장료 조성물.
- 제 1 항에 있어서, 상기 셀라지넬라 로씨 추출물은 자외선에 의해 감소된 COL1A1과 COL1A2의 발현을 증가시킴으로써 피부 노화 방지 및 피부 주름 개선 효과를 나타내는 것인 화장료 조성물.
- 제 1 항에 있어서, 상기 화장료 조성물은 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이로 이루어진 군에서 선택되는 어느 하나의 제형인 것인 화장료 조성물.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR20190118790 | 2019-09-26 | ||
KR10-2019-0118790 | 2019-09-26 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2021060714A1 true WO2021060714A1 (ko) | 2021-04-01 |
Family
ID=75166722
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2020/011205 WO2021060714A1 (ko) | 2019-09-26 | 2020-08-21 | 셀라지넬라 로씨 추출물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물 |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR102335262B1 (ko) |
WO (1) | WO2021060714A1 (ko) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20240054152A (ko) | 2022-10-18 | 2024-04-25 | 경북대학교 산학협력단 | 왓소니아(Selaginella martensii) 추출물을 유효성분으로 포함하는 피부개선용 화장료 조성물 |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2002179581A (ja) * | 2000-12-15 | 2002-06-26 | Yakult Honsha Co Ltd | 皮膚老化防止剤 |
KR20050105616A (ko) * | 2004-04-30 | 2005-11-04 | 한불화장품주식회사 | 설련 추출물 및 권백 추출물을 유효성분으로 함유하는피부외용제 조성물 |
KR20080105730A (ko) * | 2007-06-01 | 2008-12-04 | (주)아모레퍼시픽 | 바이플라보노이드를 함유하는 피부 주름 개선 화장료 |
CN102258442A (zh) * | 2011-07-15 | 2011-11-30 | 广州市娇兰化妆品有限公司 | 一种复方中药提取物及其在美白保湿抗衰老护肤品中的应用 |
KR20190073265A (ko) * | 2017-12-18 | 2019-06-26 | 한국생명공학연구원 | 셀라지넬라 로씨 추출물, 이의 분획물을 포함하는 대사증후군의 예방 또는 치료용 조성물 |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
TW200600092A (en) | 2004-05-31 | 2006-01-01 | Showa Denko Kk | Topical slimming preparation and a cosmetic containing a carnitine derivative |
-
2020
- 2020-08-21 KR KR1020200105022A patent/KR102335262B1/ko active IP Right Grant
- 2020-08-21 WO PCT/KR2020/011205 patent/WO2021060714A1/ko active Application Filing
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2002179581A (ja) * | 2000-12-15 | 2002-06-26 | Yakult Honsha Co Ltd | 皮膚老化防止剤 |
KR20050105616A (ko) * | 2004-04-30 | 2005-11-04 | 한불화장품주식회사 | 설련 추출물 및 권백 추출물을 유효성분으로 함유하는피부외용제 조성물 |
KR20080105730A (ko) * | 2007-06-01 | 2008-12-04 | (주)아모레퍼시픽 | 바이플라보노이드를 함유하는 피부 주름 개선 화장료 |
CN102258442A (zh) * | 2011-07-15 | 2011-11-30 | 广州市娇兰化妆品有限公司 | 一种复方中药提取物及其在美白保湿抗衰老护肤品中的应用 |
KR20190073265A (ko) * | 2017-12-18 | 2019-06-26 | 한국생명공학연구원 | 셀라지넬라 로씨 추출물, 이의 분획물을 포함하는 대사증후군의 예방 또는 치료용 조성물 |
Also Published As
Publication number | Publication date |
---|---|
KR20210036803A (ko) | 2021-04-05 |
KR102335262B1 (ko) | 2021-12-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101040507B1 (ko) | 천녀목란 추출물을 함유하는 광노화 방지용 및피부주름개선용 화장료 조성물 | |
KR102251854B1 (ko) | 편백잎 혼합 추출물을 유효성분으로 함유하는 피부 보습 및 주름 개선용 화장료 조성물 | |
KR101908077B1 (ko) | 천연 한방 추출물을 유효성분으로 포함하는 미백, 피부 노화 방지 또는 피부 주름 개선용 조성물 | |
KR102373899B1 (ko) | 피부의 주름 개선, 미백, 세포 재생, 상처 치유에 유효한 복합 천연물 추출물을 활성성분으로 함유하는 다 기능성 화장품 조성물 | |
WO2021060714A1 (ko) | 셀라지넬라 로씨 추출물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물 | |
KR20170055172A (ko) | 중머리풀 추출물을 유효성분으로 함유하는 화장료 조성물 | |
WO2021091284A2 (ko) | 비버눔 스텔라토토멘토섬 추출물을 포함하는 피부 노화 방지 및 피부 주름 개선용 화장료 조성물 | |
KR20080085432A (ko) | 멍게의 껍질 추출물을 함유하는 미백용 화장료 조성물 | |
KR101883307B1 (ko) | 황근 잎 추출물을 유효성분으로 함유하는 피부 주름 개선용 화장료 조성물 | |
KR20140081137A (ko) | 곰보버섯 자실체 추출물 또는 곰보버섯 균사체 추출물을 함유하는 피부 외용제 조성물 | |
KR20070111636A (ko) | 발아 녹두 추출물을 유효성분으로 함유하는 화장료 조성물 | |
KR102168533B1 (ko) | 한약재 추출물을 포함하는 미백 또는 안색 개선용 화장료 조성물 | |
KR20130047040A (ko) | 백굴채 추출물 및 트리히드록시 이소플라본을 함유하는 피부 미백용 조성물 | |
KR20120118946A (ko) | 미백 효능을 갖는 트리히드록시 이소플라본 및 감초 추출물의 복합체 | |
KR100416400B1 (ko) | 천화분 추출물의 제조방법 및 이를 함유하는 피부 미백용외용제 조성물 | |
KR101317433B1 (ko) | 지구자, 길경, 밀싹 및 세이지 추출물을 함유하는 미백 화장용 조성물 | |
KR101176525B1 (ko) | 벌나무 추출물을 유효성분으로 함유하는 화장료 조성물 | |
KR101825178B1 (ko) | 주름제거 및 미백효과가 강화된 황칠나무 추출물 및 d-아스파라긴산 함유 화장료 조성물 | |
KR100891387B1 (ko) | 히어리 추출물을 유효성분으로 함유하는 화장료 조성물 | |
CN111491615A (zh) | 包含槐树果实发酵液或其提取液作为有效成分的用于改善皮肤皱纹的化妆品组合物及其制备方法 | |
KR102062311B1 (ko) | 흰들버섯 추출물 제조방법, 이를 이용한 추출물 및 화장료 조성물 | |
KR102447998B1 (ko) | 탱자나무 열매 추출물을 유효성분으로 포함하는 피부 주름 개선용 화장료 조성물 | |
KR102335682B1 (ko) | 에퀴세툼 기간테움 발효추출물을 유효성분으로 함유하는 피부 보습용 화장료 조성물 | |
KR20150049078A (ko) | 광천수 함유 배지에서 배양된 생열귀 캘러스 함유 화장료 조성물 | |
KR102186533B1 (ko) | 불가리안 로즈오일 및 바위돌꽃뿌리 추출물을 포함하는 피부 미백용 화장료 조성물 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20869240 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 20869240 Country of ref document: EP Kind code of ref document: A1 |