WO2021020857A1 - 골 손실 질환의 예방, 개선 또는 치료를 위한 호장근 및 계심 추출물을 포함하는 조성물의 용도 - Google Patents

골 손실 질환의 예방, 개선 또는 치료를 위한 호장근 및 계심 추출물을 포함하는 조성물의 용도 Download PDF

Info

Publication number
WO2021020857A1
WO2021020857A1 PCT/KR2020/009914 KR2020009914W WO2021020857A1 WO 2021020857 A1 WO2021020857 A1 WO 2021020857A1 KR 2020009914 W KR2020009914 W KR 2020009914W WO 2021020857 A1 WO2021020857 A1 WO 2021020857A1
Authority
WO
WIPO (PCT)
Prior art keywords
bone
disease
extract
bone loss
hojanggeun
Prior art date
Application number
PCT/KR2020/009914
Other languages
English (en)
French (fr)
Inventor
정회윤
이도현
이헌종
Original Assignee
주식회사 노브메타파마
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 노브메타파마 filed Critical 주식회사 노브메타파마
Publication of WO2021020857A1 publication Critical patent/WO2021020857A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/70—Polygonaceae (Buckwheat family), e.g. spineflower or dock
    • A61K36/704—Polygonum, e.g. knotweed
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/54—Lauraceae (Laurel family), e.g. cinnamon or sassafras
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/306—Foods, ingredients or supplements having a functional effect on health having an effect on bone mass, e.g. osteoporosis prevention
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • the present invention relates to the use of a composition comprising an extract of Giliworm root and Pillaris for the prevention, improvement or treatment of a bone loss disease.
  • Bone formation (bone modeling) and remodeling (remodeling) processes play an important role in bone development, growth, and metabolic processes. Bone formation begins from birth and continues until adolescence, when the skeleton matures and growth ends, forming the maximum amount of bone from the 20s to the early 30s. For about 30 years after that, the bones are removed and the process of replenishing the bones is repeated. In this case, bone formation and bone resorption are paired with each other to maintain a balance. After this period, bone loss due to bone resorption cannot be sufficiently followed, resulting in a reduction in bone mass of 0.3 to 0.5% per annum.Especially in women, significant bone loss of 2 to 3% per annum at the beginning of menopause. You will suffer a loss.
  • Bone tissue constitutes the cartilage and skeletal system, serves as support and muscle attachment through mechanical functions, protects living organs and bone marrow, and preserves calcium and phosphorus ions to maintain homeostasis.
  • Bone tissue consists of several types of cells, such as cell substrates such as collagen and glycoprotein, and osteoblasts (osteoblasts), osteoclasts and bone cells.
  • bone tissue is a dynamic tissue that is formed by osteoblasts and continuously repetitively destroyed and absorbed by osteoclasts.
  • Osteoporosis is a disease caused by an increase in bone resorption than bone formation due to the collapse of the balance between osteoblasts and osteoclasts. As the calcification of the bone is reduced, the density of the bone is thinned, and the bone marrow cavity becomes wider, and as the condition progresses, the bone weakens, so it is easy to fracture even with a small impact.
  • Osteoporosis is not the symptom itself, but various fractures that are easily caused by bone weakness, especially femur fractures or vertebral fractures, limit long-term activities, making it impossible to lead a healthy life, and consequently contribute to 15% of the deaths of the elderly. It is known to do. Bone mass is influenced by a number of factors, such as genetic factors, nutritional intake, hormonal changes, and differences in exercise and lifestyle, and osteoporosis causes old age, lack of exercise, underweight, smoking, low calcium diet, menopause, Ovariectomy and the like are known. In particular, in the case of women, bone loss continues from the age of 30, and when menopause is reached, bone loss rapidly progresses due to hormonal changes.
  • osteoporosis varies in degree, but is an inevitable symptom for older people, especially postmenopausal women.
  • interest in osteoporosis and its treatment is gradually increasing.
  • global research institutes and pharmaceutical companies are investing heavily in the development of bone disease treatments.
  • the development of bone resorption inhibitors is actively progressing.
  • Bisphosphonate-based bone resorption inhibitors which are currently widely used, may cause lesions in the upper respiratory tract when incorrectly administered (Jang JS. Osteoporotic fracture-Medical treatment. Journal of the Korean Fracture Society. 2010;23(3):326-340). Osteoporosis is a disease in which long-term administration of drugs is essential, so the development of new materials with safety and efficacy is urgently required.
  • the main mechanism is a mechanism that inhibits the differentiation of osteoclasts that cause bone resorption or induces apoptosis of differentiated osteoclasts.
  • Osteoclasts differentiate from the hematopoietic stem cells of the bone marrow and increase the expression of TRAP (Tartate-resistant actid phosphatase) and Cath K (Cathepsin K), which act directly on bone resorption.
  • transcriptional regulators such as c-fos and NFATc1, which help the expression of the osteoclast gene, is accompanied by increased expression, and the expression of the RANK (receptor activator of nuclear factor ⁇ B) gene, which receives an osteoclast differentiation signal from outside the cell, is also increased.
  • RANK receptor activator of nuclear factor ⁇ B
  • polygonum cuspidatum Sieb. et Zucc. Reynoutria japonica Hou.
  • a perennial herbaceous plant belonging to the Mardiaceae family refers to the roots or rhizomes of plants of the genus and related plants.
  • Hojanggeun is distributed in Korea, Japan, Taiwan, and China, and in Korea, it grows in valleys across the country.
  • the rhizome is more than 1m high, and the rhizome extends sideways from the basement, is woody, yellowish brown, and has a clear node.
  • the stem grows straight and is hollow in a circular shape. There are no hairs on the surface and there are many red or purple spots. These roots, rhizomes and leaves have been used as medicinal materials from ancient times. Hojanggeun is known as palliative, diuretic, tonggyeong, and antitussive tablets, and has antibacterial and antiviral pharmacological effects.
  • Cinnamomum cassia Blume an evergreen tree belonging to the camphor family, is the stem bark of broilers or other similar plants, with the perilla and primary cortex removed. It is a long plank-shaped or cylindrical shape, and the length is 10-20cm, and the thickness is uneven. Both the outer and inner sides are reddish brown, and the quality is well broken. The bent side is reddish brown and rich in oil. It has a unique aroma and tastes spicy and sweet.
  • the pharmacological action of Gyesim is a cardiovascular agent that promotes blood circulation and is known to be good for heart breakdown, excitement, dry stomach suit, warmth health, whole meridians, positive position, body temperature control, improvement of weak constitution, and gustular wind.
  • the present inventors confirmed that the complex extracts of Hojanggeun and Gyesim showed a remarkably superior osteoclast differentiation inhibitory synergistic effect than each single extract, and completed the present invention.
  • Patent Document 1 Korean Patent Publication No. 10-2019-0047359
  • Another object of the present invention is to provide a health functional food composition for the prevention or improvement of bone loss disease, including the extract of janggeun and geunsim.
  • Another object of the present invention is to provide a method for preventing or treating bone loss disease, comprising administering to an individual in need thereof in an effective amount of a composition comprising an extract of Giliworm root and Pillaris.
  • Another object of the present invention is to provide a use of a composition comprising a ginseng root and ginseng extract in the manufacture of a medicament for preventing or treating bone loss disease.
  • a pharmaceutical composition for the prevention or treatment of bone loss disease comprising the extract of janggeun and geunsim.
  • the present invention provides a health functional food composition for the prevention or improvement of bone loss disease comprising the extract of janggeun and geunsim.
  • the present invention provides a method for preventing or treating a bone loss disease, comprising administering to an individual in need thereof in an effective amount a composition comprising the extracts of piriformis root and prickly pear.
  • the present invention also provides for the use of a composition comprising the extracts of prickly pear and prickly pear in the manufacture of a medicament for preventing or treating bone loss disorders.
  • the extracts of the rhizomes and ginsengshim may be extracted using water, C1 to C4 lower alcohols, or a mixture thereof as a solvent.
  • the extracts of chojanggeun and chicken syrup may be mixed in a weight ratio of 1:12 to 12:1.
  • the bone loss disease may be caused by bone resorption of osteoclasts.
  • the bone loss disease is osteoporosis, osteomalacia, rickets, osteopenia, fibrotic osteoitis, aplastic bone disease, bone insufficiency, bone atrophy, paget's disease, periodontitis, It may be any one or more selected from the group consisting of bone damage caused by rheumatoid arthritis, metabolic bone disease, and bone metastasis of cancer cells.
  • composition comprising the complex extract of Hojanggeun and Gisim of the present invention exhibits a synergistic effect on osteoclast differentiation or inhibition of activity, and is safe for the human body, unlike conventionally known drugs, which occurs due to excessive increase in osteoclast activity. It can be applied to pharmaceutical and food compositions for prevention, improvement or treatment of various bone loss diseases.
  • 1 is an osteoclast according to the treatment of a single extract of Hojanggeun, a single extract of chicken shim and a complex extract obtained by mixing them in various weight ratios (1:1, 1:2, 1:5, 1:10, 2:1, 10:1) It is a graph showing the differentiation inhibitory efficacy.
  • FIG. 2A is a micrograph of TRAP-stained osteoclasts
  • FIG. 2B is an osteoclast differentiation. It is a graph showing the inhibitory effect.
  • Figures 3a and 3b show the expression level of the main markers of differentiated osteoclasts according to the treatment of a single extract, a single extract, and a complex extract thereof
  • Figure 3a shows the expression level of TRAP
  • Figure 3b Represents the expression level of cathepsin K.
  • Figures 4a and 4b show the expression level of the main markers of differentiated osteoclasts according to the concentration of the complex extract treatment of jangchim muscle and gypsy
  • Figure 4a shows the expression level of TRAP
  • Figure 4b is the expression level of cathepsin K Is shown.
  • Figures 5a to 5c show the expression level of the main markers of differentiated osteoclasts according to the concentration of the complex extract treatment of Hojanggeun and Gisim
  • Figure 5a shows the expression level of RANK
  • Figure 5b is the expression level of c-fos
  • Figure 5c shows the expression level of NFATc1.
  • Figure 6a is a graph showing the analysis of the change in the bone density of the femur according to the treatment of the complex extract of the rhizomes and ginsengshim
  • Figure 6b is a change in the bone volume ratio
  • Figure 6c is the thickness of the trabecular bone trabecular bone (Tb.Th)
  • Figure 6d is the trabecular number (Tb.N)
  • 6e is a graph showing the trabecular spacing (Tb.Sp) numerically and analyzed.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of bone loss disease, comprising the extract of jangchim root and ginseng.
  • the present invention provides a health functional food composition for the prevention or improvement of bone loss disease comprising the extract of janggeun and geunsim.
  • the hojanggeun and chicken syrup may be purchased and used commercially, or may be directly collected or cultivated in nature.
  • an extract having the effect of preventing, improving, or treating bone loss disease can be obtained, a variety of sites can be used, for example, roots, above-ground parts, stems, leaves, flowers, trunks of fruits, and fruits. It can be extracted from the skin as well as plant tissue culture.
  • the extracts extracted after mixing jangjanggeun and chicken syrup at a specific weight ratio were used.
  • Gaujanggeun and chicken core can be used after washing and drying to remove foreign substances, and pulverized to increase extraction efficiency.
  • the method of preparing the complex extract of the root janggeun and gyesim may use conventional extraction methods in the art such as immersion extraction, static extraction, ultrasonic extraction, filtration, hot water extraction, and reflux extraction.
  • the extraction solvent may be used without limitation as long as it is a conventional extraction solvent in the art, preferably water, C1 ⁇ C4 alcohol, or a mixed solvent thereof, more preferably water, methanol or ethanol, and most Preferably, it may be ethanol.
  • the extraction solvent can be extracted by adding 1 to 20 times the weight of the ginseng root and chicken core.
  • the extraction time may be 0.5 to 48 hours, more preferably 1 to 36 hours, but is not limited thereto, and the number of extractions may be repeated once to 10 times.
  • the concentration may be concentrated under reduced pressure, and the concentration under reduced pressure may be performed using a vacuum vacuum concentrator or a vacuum rotary evaporator, but is not limited thereto.
  • the drying is preferably vacuum drying, vacuum drying, boiling drying, spray drying, or freeze drying, but is not limited thereto.
  • extract refers to a liquid component obtained by immersing a target substance in various solvents and then extracting at room temperature, low temperature, or warm state for a certain period of time, and removing the solvent from the liquid component. It means the result of obtained solid content etc.
  • it can be comprehensively interpreted as including all of the diluted solution of the resultant, the concentrate thereof, the preparation thereof, and the purified product.
  • the chojanggeun extract and the ginseng extract may be mixed in an optimal weight ratio to induce the most excellent synergistic effect, preferably 1:12 to 12:1, more preferably 1:10 to 12 :1, more preferably 1:9 to 11:1 may be mixed in a weight ratio.
  • the compound synergistic effect is reduced and thus the optimal activity cannot be exhibited.
  • bone loss refers to a symptom of bone loss caused by an imbalance between osteoclasts and osteoblasts
  • bone loss disease refers to all diseases related to the above symptoms. Therefore, the osteoclast activity is too high, bone loss, bone density is lowered, or osteoblast activity is reduced, including all diseases caused by the bone production does not occur smoothly.
  • Specific examples of the bone loss disease include osteoporosis, osteomalacia, rickets, osteopenia, fibrotic osteopathy, amorphous bone disease, bone insufficiency, bone atrophy, paget's disease, periodontitis, rheumatoid arthritis. , Metabolic bone disease and bone damage caused by bone metastasis of cancer cells, but are not limited thereto.
  • composition comprising the eosinophils and ginseng extract of the present invention can prevent, improve or treat bone loss diseases by inhibiting the differentiation or activity of osteoclasts to inhibit bone resorption.
  • composition comprising the chojanggeun and geunsim extract of the present invention may be characterized by inhibiting the activity of mature osteoclasts, the mature osteoclasts may be induced by RANKL (receptor activator of NF ⁇ B ligand).
  • osteoclast refers to a cell that performs a function of destroying and absorbing bone tissue. Osteoclasts are giant cells with a diameter of 20 to 100 ⁇ m, and contain 2 to 20 nuclei. The osteoclasts are differentiated from macrophages, and the formation of osteoclasts is dependent on the co-operative macrophage-colony stimulating factor (M-CSF), the receptor activator of NF- ⁇ B ligand (RANKL) and the co-stimulatory factor of the activator. Induced by M-CSF, the receptor activator of NF- ⁇ B ligand (RANKL) and the co-stimulatory factor of the activator. Induced by M-CSF, the receptor activator of NF- ⁇ B ligand (RANKL) and the co-stimulatory factor of the activator. Induced by M-CSF, the receptor activator of NF- ⁇ B ligand (RANKL) and the co-stimulatory factor of the activator. Induced by M
  • bone resorption refers to a process in which calcium escapes from bone tissue to make a hole in the bone and become brittle, and in the process, the bone matrix and bone minerals are simultaneously removed from the bone. Although it is a physiological phenomenon that occurs during bone growth or remodeling, bone resorption may also occur due to inflammation or bone metastasis of cancer cells.
  • the bone destruction inhibitory activity of the present invention means inhibiting osteoclast differentiation or bone resorption.
  • the complex extracts of Hojanggeun and Gishim significantly inhibit the differentiation of osteoclasts than each single extract, and as shown in Figs. 3 to 5, TRAP and ca, which are major markers of differentiated osteoclasts. It shows the effect of suppressing the expression of tepsin K gene and the expression of c-fos, RANK and NFATc1 genes that promote osteoclast differentiation.
  • prevention means any action that suppresses or delays the onset of a disease or condition. In the present invention, it means to inhibit the bone resorption of osteoclasts to delay the onset of or suppress the onset of a bone loss disease.
  • the term "improvement” refers to any action that improves or advantageously changes the disease or condition, and in the present invention, suppresses the differentiation of osteoclasts. It means to improve the symptoms of osteoporosis or bone loss diseases such as alveolar bone loss through the action.
  • the term "treatment” means all actions of delaying, stopping or reversing the progression of a disease or condition, and in the present invention, the differentiation of osteoclasts It means to stop, alleviate, alleviate, eliminate, or reverse the loss of alveolar bone or bone through an inhibitory action.
  • the term "synergy effect” refers to the effect that occurs when each component is administered in combination (combination) is greater than the sum of the effects that occur when administered alone as a single component [Chou and Talalay, Adv. Enzyme. Regul., 22:27-55, 1984].
  • the complex extract of Hojanggeun and Gyesim of the present invention increases the effect of preventing, improving or treating bone loss diseases than each of these single extracts.
  • administered in combination means that an extract or ingredient is administered together to a patient. That each extract or component is administered together means that each component can be administered at the same time or in any order or sequentially at different times in order to obtain the desired therapeutic effect.
  • patient refers to a subject suffering from a disease or disorder.
  • patient includes humans and veterinary subjects and refers to any single individual in need of treatment, including humans, cattle, dogs, guinea pigs, rabbits, chickens, insects, and the like.
  • the pharmaceutical composition of the present invention can be administered to mammals including humans by any method.
  • it can be administered orally or parenterally, and parenteral administration methods are not limited thereto, but intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal , Intranasal, intestinal, topical, sublingual or rectal administration.
  • the pharmaceutical composition of the present invention can be formulated as a formulation for oral administration or parenteral administration according to the route of administration as described above.
  • one or more buffers e.g., saline or PBS
  • carbohydrates e.g., glucose, mannose, sucrose, or dextran, etc.
  • antioxidants e.g., bacteriostatic agents, chelating agents (e.g., EDTA) Or glutathione
  • fillers e.g., extenders, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrants or surfactants, diluents or excipients.
  • adjuvants e.g., aluminum hydroxide
  • suspending agents thickening agents, wetting agents, disintegrants or surfactants, diluents or excipients.
  • Solid preparations for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions or capsules, and the like, and such solid preparations are at least one excipient in the pharmaceutical composition of the present invention, for example , Starch (including corn starch, wheat starch, rice starch, potato starch, etc.), Calcium carbonate, Sucrose, Lactose, Dextrose, Sorbitol, Mannitol, Xylitol, Erythritol Maltitol, Cellulose , Methyl cellulose, sodium carboxymethylcellulose, and hydroxypropylmethyl-cellulose or gelatin may be mixed and prepared.
  • tablets or dragees can be obtained by blending the active ingredient with a solid excipient, pulverizing it, adding a suitable auxiliary, and processing into a granule mixture.
  • Liquid preparations for oral use include suspensions, liquid solutions, emulsions, or syrups, but may include various excipients, such as wetting agents, sweetening agents, fragrances, or preservatives, in addition to water or liquid paraffin, which are simple diluents commonly used. .
  • cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as a disintegrant, and an anti-coagulant, a lubricant, a wetting agent, a fragrance, an emulsifier and a preservative may be additionally included.
  • the pharmaceutical composition of the present invention may be formulated according to a method known in the art in the form of an injection, a transdermal administration, and a nasal inhalation agent together with a suitable parenteral carrier.
  • a suitable parenteral carrier In the case of such injections, they must be sterilized and protected from contamination by microorganisms such as bacteria and fungi.
  • suitable carriers for injections include, but are not limited to, water, ethanol, polyol (eg, glycerol, propylene glycol and liquid polyethylene glycol, etc.), a mixture thereof and/or a solvent or dispersion medium containing vegetable oil. I can.
  • suitable carriers include isotonic solutions such as Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine or sterile water for injection, 10% ethanol, 40% propylene glycol and 5% dextrose. Etc. can be used.
  • PBS phosphate buffered saline
  • various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, sorbic acid, thimerosal, and the like may be additionally included.
  • the injection may further include an isotonic agent such as sugar or sodium chloride in most cases.
  • transdermal administration In the case of transdermal administration, ointments, creams, lotions, gels, external solutions, pasta, liniment, and air rolls are included.
  • transdermal administration' means that the active ingredient in an effective amount contained in the pharmaceutical composition is delivered into the skin by topically administering the pharmaceutical composition to the skin.
  • the compounds used according to the invention can be prepared using a suitable propellant, for example dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas, pressurized pack or It can be conveniently delivered from a nebulizer in the form of an aerosol spray.
  • a pressurized aerosol the dosage unit can be determined by providing a valve that delivers a metered amount.
  • gelatin capsules and cartridges for use in an inhaler or insufflator can be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, a formula generally known for all pharmaceutical chemistry.
  • the pharmaceutical composition of the present invention can provide a desirable effect of preventing, improving, or treating bone loss diseases when the complex extracts of Hojanggeun and Gyesim are included in an effective amount.
  • the term "effective amount" refers to an amount that exhibits a higher response compared to the negative control group, and preferably refers to an amount sufficient to prevent, ameliorate or treat a bone loss disease.
  • the complex extract of Hojanggeun and Gyesim may be contained in 0.01 to 99.9%, and the remaining amount may be occupied by a pharmaceutically acceptable carrier.
  • the effective amount of the complex extract of Hojanggeun and Gyesim contained in the pharmaceutical composition of the present invention will vary depending on the form in which the composition is commercialized.
  • the total effective amount of the pharmaceutical composition of the present invention may be administered to a patient in a single dose, and may be administered by a fractionated treatment protocol that is administered for a long time in multiple doses.
  • the pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the severity of the disease. For example, it may be administered in divided doses from 1 to several times so as to be administered in an amount of preferably 0.001 to 100 mg, more preferably 0.01 to 10 mg per 1 kg of body weight per day, based on the complex extract of Hojanggeun and Gyesim.
  • the dosage of the complex extract of Geunjanggeun and Gyesim is not only the administration route and the number of treatments of the pharmaceutical composition, but also the patient's age, weight, health condition, sex, disease severity, diet and excretion rate. Since the effective dose is determined, considering these points, if a person of ordinary skill in the art can use the complex extract of Giliworm root and Pseudomonas root, appropriate effective administration according to the specific use for the prevention, treatment or improvement of bone loss disease. You will be able to determine the amount.
  • the pharmaceutical composition according to the present invention is not particularly limited in its formulation, route of administration, and method of administration as long as it exhibits the effects of the present invention.
  • the pharmaceutical composition for preventing or treating bone loss disease of the present invention may be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, or methods using a biological response modifier.
  • the pharmaceutical composition for preventing or treating bone loss disease of the present invention may also be provided in the form of an external preparation comprising a complex extract of Hojanggeun and Gyesim.
  • the composition of the present invention may be a quasi-drug composition for preventing or improving bone loss disease and a quasi-drug containing the composition.
  • the external preparation may be applied directly into the skin or oral cavity.
  • the pharmaceutical composition for preventing or treating bone loss disease of the present invention for external use additionally fatty substances, organic solvents, solubilizers, thickening and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents ), fragrance, surfactant, water, ionic emulsifier, nonionic emulsifier, filler, sequestering agent, chelating agent, preservative, vitamin, blocker, wetting agent, essential oil, dye, pigment, hydrophilic activator, lipophilic activator Or it may contain adjuvants commonly used in the field of dermatology such as any other ingredients commonly used in skin external preparations such as lipid vesicles.
  • the ingredients may be introduced in an amount generally used in the field of dermatology.
  • the composition of the present invention is provided for external use, it is not limited thereto, but may be a formulation such as a liquid, ointment, patch, gel, cream, or spray.
  • the quasi-drug products of the present invention may include oral care products including toothpaste, toothpaste, and mouth spray, ointments, masks, poultices, patches, and transdermal absorbers.
  • the treatment of the complex extract of the present invention has inhibited the differentiation of osteoclasts.
  • the active ingredient When the active ingredient is applied to an oral care product, it is effective in preventing or improving alveolar bone diseases by inhibiting the differentiation of osteoclasts.
  • the quasi-drug composition may be a composition for oral care for preventing or improving bone loss.
  • the complex extract of Hojanggeun and Gyesim may be added as it is or may be appropriately used in accordance with a conventional method with other quasi-drug components.
  • the mixing amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment).
  • the contents of the pharmaceutical composition and health functional food composition of the present invention may be applied mutatis mutandis to the quasi-drug composition and the quasi-drug of the present invention.
  • health functional food includes both the meaning of “functional food” and “health food”.
  • the term "functional food” is the same term as food for special health use (FoSHU), and has a medical and medical effect processed so that a bioregulatory function is effectively displayed in addition to nutrition supply. Means high food.
  • the term “health food” refers to a food having an active health maintenance or promoting effect compared to general food
  • a health supplement food refers to a food for health supplement purposes.
  • functional food, health food, and health supplement food are used favorably.
  • the food may be prepared in various forms such as tablets, capsules, powders, granules, liquids, pills, etc. to obtain useful effects in improving or recovering bone loss diseases.
  • the health functional food composition of the present invention may also be prepared in the form of nutritional supplements, food additives, feed, etc., and is intended to be eaten by animals including humans or livestock.
  • Food compositions of this type can be prepared in various forms according to conventional methods known in the art.
  • General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods thereof (e.g., canned fruit, canned food, jam, marmalade, etc.), fish, meat and processed foods thereof (e.g. ham, sausage) Corn beef), bread and noodles (e.g. udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juice, various drinks, cookies, sweets, dairy products (e.g. butter, cheese, etc.), edible vegetable oil, margarine , Vegetable protein, retort food, frozen food, various seasonings (eg, soybean paste, soy sauce, sauce, etc.), etc. can be prepared by adding a complex extract of chojanggeun and chicken heart.
  • a nutritional supplement it is not limited thereto, but may be prepared by adding a complex extract of Hojanggeun and Gyesim to capsules, tablets, and pills.
  • the health functional food is not limited thereto, for example, liquefied, granulated, encapsulated, and powdered so that the complex extracts of Hojanggeun and Gyesim are prepared in the form of tea, juice, and drink so that they can be consumed (healthy beverage). It can be consumed in a form.
  • the complex extract of Hojanggeun and Gyesim in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate.
  • it can be prepared in the form of a composition by mixing the complex extract of the root and ginseng root and a known active ingredient known to be effective in preventing or improving bone loss disease.
  • the health drink composition may contain various flavoring agents or natural carbohydrates as an additional component, like a normal drink.
  • the natural carbohydrates described above include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose; Polysaccharides such as dextrin and cyclodextrin; It may be a sugar alcohol such as xylitol, sorbitol, and erythritol.
  • Sweeteners include natural sweeteners such as taumatin and stevia extract; Synthetic sweeteners such as saccharin and aspartame can be used.
  • the ratio of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the composition of the present invention.
  • the complex extract of Geunjanggeun and Gyesim may be contained as an active ingredient in a food composition for preventing or improving bone loss disease, the amount of which is an amount effective to obtain the above preventing or improving effect, for example, based on the total weight of the composition. It is preferably 0.01 to 100% by weight, but is not particularly limited thereto.
  • the food composition of the present invention may be prepared by mixing together with a complex extract of Hojanggeun and Gyesim with other active ingredients known to be effective in preventing or improving bone loss disease.
  • the health functional food of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives , Glycerin, alcohol, or a carbonating agent.
  • the health food of the present invention may contain flesh for the manufacture of natural fruit juice, fruit juice beverage, or vegetable beverage. These ingredients may be used independently or in combination. The ratio of these additives is not very important, but it is generally selected from 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.
  • the present invention also provides a method for preventing or treating a bone loss disease, comprising administering to an individual in need thereof in an effective amount a composition comprising an extract of Giliworm root and Pillaris.
  • the term “individual” includes any animal (eg, human, horse, pig, rabbit, dog, sheep, goat, non-human primate, cow, cat, guinea pig or rodent), but It is not limited thereto. These terms do not refer to a particular age or gender. Accordingly, it is intended to include adult/adult and newborn subjects, whether female/female or male/male, as well as fetuses.
  • the description of the composition including the effect of the composition including the extract of Hojanggeun and Pyramid and the composition including the route of administration, the number of administrations, and the amount of administration thereof is the same as described above, and thus description thereof is omitted.
  • the present invention also provides for the use of a composition comprising the extract of ginseng root and ginseng in the manufacture of a medicament for preventing or treating bone loss disease.
  • mice For cultivation of primary bone marrow macrophages derived from bone marrow, male C57BL/6 mice aged 6 to 8 weeks were purchased from Coretech.
  • the MEM- ⁇ medium used for cell culture was purchased from Welgene, FBS from Hyclone, and Sigma-Aldrich's erythrocyte (RBC) lysis buffer was purchased for red blood cell removal.
  • R&D Systems For cultivation of primary bone marrow macrophages derived from bone marrow, male C57BL/6 mice aged 6 to 8 weeks were purchased from Coretech.
  • the MEM- ⁇ medium used for cell culture was purchased from Welgene, FBS from Hyclone, and Sigma-Aldrich's erythrocyte (RBC) lysis buffer was purchased for red blood cell removal.
  • R&D Systems M-CSF and RNAKL proteins were purchased and used from R&D Systems.
  • RNA extraction For RNA extraction, MACHEREY-NAGEL's NucleoZOL was purchased, and Bio-Rad's iScript cDNA synthesis kit and iQ SYBR Green Supermix product were purchased for cDNA synthesis and real-time PCR analysis.
  • MEM- ⁇ is injected with a 10ml syringe (23G needle) to drain the bone marrow. Replace the bone marrow with an 18G needle and filter it through a 100um strainer. After centrifugation at 1,500 rpm for 5 minutes, the cells were released, 5 ml of RBC lysis buffer was added and reacted for 1.5 minutes. Add 15 ml of MEM- ⁇ and centrifuge at 1,500 rpm for 5 minutes. This process is repeated once more, and two more times with only 10 ml of MEM- ⁇ . The cells are dissolved in MEM- ⁇ medium containing 30 ng/ml of M-CSF and incubated for 3 days in a 100 mm Petri dish (37° C., 5% CO 2 ).
  • Bone marrow-derived primary macrophages cultured for 3 days were removed with trypsin, and then 2x10 4 cells per well were placed in a 96-well plate. At this time, 10 ng/ml of M-CSF is added to the MEM- ⁇ medium, and 20 ng/ml of RANKL is additionally added to induce differentiation.
  • the single extract of chojanggeun and the single extract of chicken shim prepared in Preparation Example 1 were each treated at a concentration of 20 ⁇ g/ml, and a composite extract prepared by mixing each single extract in various weight ratios in Preparation Example 2 Are respectively 1:1, 1:2, 1:5, 1:10, 2:1 and 10:1) after treatment at a concentration of 40 ⁇ g/ml (final DMSO concentration is 0.2%), 37°C, Incubation for 5 days in 5% CO 2 conditions, the medium is renewed every 48 hours, and the extract is treated anew.
  • the medium of the 96-well plate was removed, and 4% PFA was added to fix it at room temperature for 1 hour. After fixation, 4% PFA is removed, and the prepared TRAP staining solution is added and reacted at room temperature for 1 hour. When dyeing is complete, rinse once with distilled water and dry at room temperature. Dissolve the dye stained with DMSO and measure the absorbance at 540 nm to compare the TRAP activity (degree of osteoclast differentiation) according to the mixing weight ratio.
  • the graph of FIG. 1 is numerically shown in Table 3.
  • the predicted value of the TRAP activity inhibition rate (%) for each composite extract was calculated using the Colby formula, and it is shown in Table 3.
  • A is the drug effect of the active ingredient A
  • B is the drug effect of the active ingredient B
  • E is the predicted drug effect when ingredient A and ingredient B (A+B) are mixed as a predicted value.
  • Hojanggeun Mixed weight ratio of chicken core TRAP activity% TRAP activity inhibition% (actual value) % Inhibition of TRAP activity (predicted value) 1:1 Hojanggeun 1 63% 37% - Presence 1 92% 8% - Mix 1:1 30% 70% 42% 1:2 Hojanggeun 1 87% 13% - Presence 2 92% 8% - Mix 1:2 56% 44% 20% 1:5 Hojanggeun 1 97% 3% - Presence 5 100% 0% - Mix 1:5 86% 14% 3% 1:10 Hojanggeun 1 92% 8% - Presence 10 100% 0% - Mix 1:10 92% 8% 8% 2:1 Hojanggeun 2 78% 22% - Presence 1 91% 9% - Mix 2:1 66% 34% 29% 10:1 Hojanggeun 10 78% 22% - Presence 1 95% 5% - Mix 10:1 71% 29% 25.9%
  • the composite extract mixed in the weight ratio range has a remarkably excellent osteoclast differentiation inhibitory effect compared to each single extract.
  • Example 1-1 After removing the bone marrow-derived primary macrophages cultured for 3 days in Example 1-1 with trypsin, they were placed in a 96-well plate so that 2 ⁇ 10 4 cells per well would enter. At this time, 10 ng/ml of M-CSF is added to the MEM- ⁇ medium, and 20 ng/ml of RANKL is additionally added to induce differentiation. Hojanggeun single, chicken shim single and 1:1 complex extracts thereof were treated at concentrations of 20, 20, and 40 ⁇ g/ml, respectively (final DMSO concentration was 0.1%), and cultured for 5 days at 37°C and 5% CO 2 The medium is renewed every 48 hours, and the extract is treated anew.
  • TRAP staining solution 0.1M sodium acetate (pH5.0) and 0.5M sodium tartrate are mixed in a ratio of 9:1 to make a tartarate solution, and 1 mg of naphthol AS-MX phosphate per 10 ml of tartrate solution is added to N,N. It was added by dissolving in 100ul of'-dimethylformamide. Here, 5-6 mg of fast red violet was added and sufficiently dissolved, and then filtered through a 0.45 ⁇ m syringe filter to prepare.
  • the medium of the 96-well plate was removed, and 4% PFA was added and fixed at room temperature for 1 hour. After fixation, 4% PFA is removed, and the prepared TRAP staining solution is added and reacted at room temperature for 1 hour. When dyeing is complete, rinse once with distilled water and dry at room temperature. The degree of differentiation is analyzed by counting the number of differentiated osteoclasts (Multi-nucleated cells) that appear in each well after photographing under a microscope. At this time, the standard of MNC is to have three or more nuclei.
  • FIG. 2A it was confirmed that the amount of pink-stained osteoclasts was significantly reduced by treatment with a single, single or 1:1 complex extract thereof compared to the control group.
  • FIG. 2B it was confirmed that the composite extract inhibited the differentiation of osteoclasts more significantly than the single extracts. This can be seen as a synergistic effect due to the combination, and it is the basis for showing the efficacy of more effectively inhibiting the differentiation of osteoclasts than the single extracts of the complex extract of Hojanggeun and Gisim.
  • the number of MNCs per well of the undifferentiated control group was 100% as a basis, and the osteoclast differentiation inhibition rate (%) of each group was calculated and shown in Table 4.
  • the estimated osteoclast differentiation inhibition rate of the composite extract calculated by substituting the measured value of the osteoclast differentiation inhibition rate of the extract-treated group into the aforementioned Colby formula is also shown in Table 4.
  • Undifferentiated control Hojanggeun single extract Citrus single extract 1:1 complex extract of Hojanggeun and Gyesim Number of MNCs per well (pcs) 185 20 60 4 Differentiation inhibition rate% (actual value) - 89.2% 67.6% 97.8% Differentiation inhibition rate% (predicted value) - - - 96.5%
  • Bone marrow-derived primary macrophages cultured for 3 days were removed with trypsin, and then placed in a 12-well plate so as to contain 5x10 5 cells per well. At this time, 30 ng/ml of M-CSF is added to the MEM- ⁇ medium, and 20 ng/ml of RANKL is additionally added to induce differentiation. Hojanggeun single, chicken shim single, and 1:1 complex extracts thereof were treated at concentrations of 20, 20 and 40 ⁇ g/ml, respectively (final DMSO concentration was 0.1%), and cultured for 5 days at 37°C and 5% CO 2 The medium is renewed every 48 hours, and the extract is treated anew.
  • RNA is extracted according to the manufacturer's Total RNA isolation protocol, and cDNA is synthesized by Reverse Transcription Polymerase Chain Reaction using 1 ⁇ g of RNA using an iScript cDNA synthesis kit.
  • the synthesized cDNA is analyzed by conducting real-time PCR with iQ SYBR Green Supermix using the primer set in Table 2 corresponding to each gene. Each gene expression value is corrected by dividing it by the expression value of ⁇ -actin, a housekeeping gene.
  • the TRAP expression level of the control group treated with only RANKL was 100% as a basis, and the rate of inhibition of TRAP expression (%) of each group was calculated and shown in Table 5.
  • Table 5 also shows the estimated TRAP expression inhibition rate of the complex extract calculated by substituting the measured value of the TRAP expression inhibition rate of the extract-treated group into the aforementioned Colby formula.
  • the rate of inhibition of cathepsin K expression (%) of each group was calculated based on the level of cathepsin K expression of the control group treated with RANKL only, and the rate of inhibition of cathepsin K expression of the single extract-treated group was calculated.
  • Table 5 also shows the predicted values for the inhibition rate of cathepsin K expression of the composite extract calculated by substituting the measured values into the aforementioned Colby formula.
  • Bone marrow-derived primary macrophages cultured for 3 days were removed with trypsin, and then placed in a 12-well plate so as to contain 5x10 5 cells per well. At this time, 30 ng/ml of M-CSF is added to the MEM- ⁇ medium, and 20 ng/ml of RANKL is additionally added to induce differentiation. 1:1 complex extracts of Hojanggeun and Gyesim were treated at concentrations of 0, 10, 20, and 50 ⁇ g/ml respectively (final DMSO concentration was 0.1%) and incubated for 3 days at 37°C and 5% CO 2 for 48 hours. First, the medium is newly replaced.
  • TRAP and cathepsin K, c-fos, RANK, and NFATc1 gene expression were analyzed in the same manner as in Example 3-2.
  • Figs. 4a and 4b it was confirmed that the expression of TRAP and cathepsin K genes, which are major markers of differentiated osteoclasts, was significantly reduced in a concentration-dependent manner of the complex extracts of G.
  • the second group was set as the operation group that performed ovariectomy to which phosphate buffered saline was administered (operation group in Figs. 6a to 6e), and the third group contained estrogen of 0.5 mg/kg. It was set as a positive control group of the ovariectomy surgery group administered orally daily for 4 weeks at a concentration (operation group + estrogen in Figs. 6a to 6e), and the 4th group was a 1:1 complex extract of eosinophilia and gypsy root of 200 mg/kg. The concentration was set as an ovariectomy surgery group administered orally twice a day in the morning and in the afternoon for 4 weeks (operation group + complex extract in FIGS. 6A to 6E).
  • the osteoporosis improvement effect of the ovariectomy animal model was analyzed using Micro CT. Bone density of ovariectomized animals was measured by performing bone CT scans 2 mm in front of the growth plate of the femur using micro-CT (QuantumFX, Perkin Elmer, Massachusetts, USA). In addition, bone volume fraction (BV/TV, %) was measured, and trabecular thickness (Tb.Th), trabecular number (Tb.N) and space (trabecular spacing, Tb.Sp) were measured. ) was analyzed.

Abstract

본 발명은 골 손실 질환의 예방, 개선 또는 치료를 위한 호장근 및 계심 추출물을 포함하는 조성물의 용도에 관한 것이다.

Description

골 손실 질환의 예방, 개선 또는 치료를 위한 호장근 및 계심 추출물을 포함하는 조성물의 용도
본 발명은 골 손실 질환의 예방, 개선 또는 치료를 위한 호장근 및 계심 추출물을 포함하는 조성물의 용도에 관한 것이다.
뼈의 발생, 성장 및 대사과정에는 뼈의 형성(bone modeling)과 재형성(remodeling) 과정이 중요한 역할을 한다. 뼈의 형성은 태생기부터 시작하여 이후 골격이 성숙되어 성장이 끝나는 청장년기까지 지속되어 20대에서 30대 초반까지 최대 골량을 형성하게 된다. 이후 약 30년 동안은 뼈를 제거하고 다시 이를 보충하는 골재형성 과정을 반복하게 되는데 이때는 골형성과 골흡수가 서로 짝을 이루어 균형을 유지하게 된다. 이 시기가 지난 후에는 골 흡수에 따른 골소실을 골형성이 충분히 따라갈 수 없어 결국 연 0.3 ~ 0.5 % 정도의 골량 감소를 겪게 되며, 특히 여성의 경우에는 폐경 초기에 연 2 ~ 3 %의 상당한 골손실을 겪게 된다.
골 조직은 연골과 골격계를 구성하며 기계적 기능으로 지지와 근 부착의 역할을 하고, 생체기관 및 골수를 보호하는 기능을 하며, 칼슘과 인 이온의 항상성 유지를 위해 이들을 보존하는 기능을 담당한다. 골 조직은 교원질, 당단백질과 같은 세포 기질과 조골세포(골아세포; osteoblast), 파골세포 및 골세포 등 여러 종류의 세포들로 이루어진다.
또한, 골조직은 조골세포에 의해 형성되고 파골세포에 의해 파괴 흡수가 끊임없이 반복되는 동적인 조직으로, 골다공증은 조골세포와 파골세포의 평형이 무너져 골 흡수가 골 형성보다 항진됨으로서 유발되는 질병으로, 골조직의 석회가 감소되어 뼈의 치밀질이 엷어지고 그로 인해 골수강이 넓어지게 되며, 증세가 진전됨에 따라 뼈가 약해지기 때문에 작은 충격에도 골절되기 쉽다.
골다공증은 그 증세 자체보다는 골의 약화에 따라 용이하게 초래되는 각종 골절, 특히 대퇴골 골절 또는 척추골절 등이 장기간 활동을 제한하여 건강한 생활 을 영위할 수 없고, 결과적으로 노인층 사망의 15%에 대한 원인제공을 하는 것으로 알려져 있다. 골량은 유전적 요인, 영양 섭취, 호르몬의 변화, 운동 및 생활 습관의 차이 등 여러 가지 요인들에 의해 영향을 받으며, 골다공증의 원인으로는 노령, 운동 부족, 저체중, 흡연, 저칼슘 식이, 폐경, 난소 절제 등이 알려져 있다. 특히 여성의 경우 30세 이후부터 골 감소가 지속적으로 진행되며, 폐경기에 이르면 호르몬 변화에 의해 골 감소가 급격히 진행된다.
이와 같이 골다공증은 정도에 차이는 있으나 노년층, 특히 폐경기 이후의 여성에게 있어서는 피할 수 없는 증상으로, 선진국에서는 인구가 노령화됨에 따라 골다공증 및 그 치료제에 대한 관심이 점차 증가되고 있다. 또한 전 세계적으로 골질환 치료와 관련되어 약 1300억 달러의 시장이 형성되어 있는 것으로 알려져 있으며 앞으로 더 증가할 것으로 예상되기 때문에, 세계적인 각 연구 기관과 제약회사에서는 골질환 치료제 개발에 많은 투자를 하고 있고 현재 골흡수 억제제의 개발이 활발히 진행되고 있다.
1세대 골다공증 치료제로 사용된 칼슘 보충제는 그 효과가 미미하다는 것이 보고되었으며, 에스트로겐이나 칼시토닌을 이용한 호르몬 요법은 안정성 면에서 안전하지 못하다는 것이 보고되고 있다 (Jang JS. Osteoporotic fracture-Medical treatment. Journal of the Korean Fracture Society. 2010;23(3):326-340). 특히, 호르몬 요법의 경우 골밀도를 증가시키기는 하나 유방암, 심근경색, 정맥혈전증 등의 부작용이 보고된 바 있다 (Rossouw JE et al. Postmenopausal hormone therapy and risk of cardiovascular disease by age and years since menopause. JAMA. 2007;297:1465-1477). 현재 널리 사용되고 있는 비스포스포네이트 계열의 골흡수 억제제는 잘못된 투여시 상기도에 병소가 발견되기도 한다 (Jang JS. Osteoporotic fracture-Medical treatment. Journal of the Korean Fracture Society. 2010;23(3):326-340). 골다공증은 약물의 장기 투여가 필수적인 질환이므로 안정성과 효능이 확보된 신물질의 개발이 절실히 요구되고 있다.
골 흡수에 따른 골 소실을 골 형성이 충분히 따라갈 수 없어, 붕괴된 골 흡수와 골 형성의 균형을 맞춰주기 위해 골 흡수 억제 기전의 약물이 많이 연구되어 왔다. 주요 기전으로는 골 흡수를 야기하는 파골세포의 분화를 억제시키거나 분화된 파골세포의 세포사멸을 유도하는 기전이 이용된다. 파골세포는 골수의 조혈모세포로부터 분화하며 골 흡수에 직접적으로 작용하는 TRAP (Tartate-resistant actid phosphatase)과 Cath K (Cathepsin K)의 발현을 증가시키게 된다. 이 과정에서 파골 유전자의 발현을 돕는 c-fos, NFATc1 등의 전사조절인자들의 발현증가가 동반되고, 세포 외부로부터 파골세포 분화 신호를 받는 RANK (Receptor activator of nuclear factor κB) 유전자의 발현도 증가하게 된다. 이들 유전자는 파골세포 분화가 진행될수록 증가하는 특징이 있어 파골세포 분화의 지표로 사용되기도 한다.
한편, 마디풀과에 속하는 다년생 초본식물인 호장근(虎杖根) (Polygonum cuspidatum Sieb. et Zucc. = Reynoutria japonica Hou.)은 호장 및 동속 근연식물의 뿌리 또는 근경(根莖)을 말하는 것으로, 고장, 산장, 반장, 산통순, 반장근, 오부답, 산간, 반근, 웅황연, 토지유라고도 불린다. 호장근은 한국, 일본, 타이완, 중국 등에 분포하며, 우리나라에서는 전국 산야의 계곡에서 자란다. 호장근은 높이가 1m 이상이며 근경은 지하에서 옆으로 뻗고 목질이고 황갈색이며 마디가 분명하다. 줄기는 곧게 자라고 원계형으로 속이 비어 있다. 표면에는 털이 없고 적색 혹은 자색의 반점이 많이 나 있다. 이러한 뿌리, 근경과 잎 부위가 예로부터 약재로 사용되어 왔다. 호장근은 완화, 이뇨, 통경, 진해진정제로 알려져 있으며, 항균작용 및 항바이러스작용의 약리작용이 있다.
녹나무과에 속하는 상록교목인 계심(桂心)(Cinnamomum cassia Blume)은 육계 또는 기타 동속 근연식물의 줄기껍질로서 주피와 1차 피층을 제거한 것이다. 긴 널빤지모양 또는 원통모양이고 길이는 10~20cm이며, 두께는 고르지 않다. 바깥 면과 안쪽 면은 모두 적갈색이고 질은 잘 꺾어진다. 꺾인 면은 적갈색이 고 기름이 풍부하다. 특유한 방향이 있고 맛은 맵고 달다. 계심의 약리작용은 강심제로 혈액순환을 촉진하여 심장쇠약에 좋고 흥분, 건위정장, 온중보양, 온통경맥, 양위, 체온조절, 허약체질 개선, 구풍(驅風)에 좋은 것으로 알려져 있다.
이러한 배경 하에, 본 발명자들은 호장근과 계심의 복합 추출물이 각각의 단독 추출물보다 현저하게 우수한 파골세포 분화 억제 상승효과를 나타냄을 확인하고 본 발명을 완성하였다.
[선행기술문헌]
[특허문헌]
(특허문헌 1) 대한민국 공개특허 제10-2019-0047359호
본 발명의 목적은 호장근 및 계심 추출물을 포함하는 골 손실 질환의 예방 또는 치료용 약학 조성물을 제공하는 것이다.
본 발명의 다른 목적은 호장근 및 계심 추출물을 포함하는 골 손실 질환의 예방 또는 개선용 건강기능식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 호장근 및 계심 추출물을 포함하는 조성물을 유효량으로 이를 필요로 하는 개체에게 투여하는 것을 포함하는, 골 손실 질환의 예방 또는 치료방법을 제공하는 것이다.
본 발명의 다른 목적은 골 손실 질환을 예방 또는 치료하기 위한 약제의 제조 시 호장근 및 계심 추출물을 포함하는 조성물의 용도를 제공하는 것이다.
상술한 과제를 해결하기 위해, 호장근 및 계심 추출물을 포함하는 골 손실 질환의 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 호장근 및 계심 추출물을 포함하는 골 손실 질환의 예방 또는 개선용 건강기능식품 조성물을 제공한다.
추가로, 본 발명은 호장근 및 계심 추출물을 포함하는 조성물을 유효량으로 이를 필요로 하는 개체에게 투여하는 것을 포함하는, 골 손실 질환의 예방 또는 치료방법을 제공한다.
본 발명은 또한 골 손실 질환을 예방 또는 치료하기 위한 약제의 제조 시 호장근 및 계심 추출물을 포함하는 조성물의 용도를 제공한다.
본 발명의 바람직한 일실시예에 따르면, 상기 호장근 및 계심 추출물은 물, C1 내지 C4의 저급 알코올 또는 이들의 혼합물을 용매로 하여 추출한 것일 수 있다.
본 발명의 바람직한 다른 일실시예에 따르면, 상기 호장근 및 계심 추출물은 1:12 내지 12:1의 중량비로 혼합될 수 있다.
본 발명의 바람직한 또 다른 일실시예에 따르면, 상기 골 손실 질환은 파골세포의 골 흡수에 의해 유발되는 것일 수 있다.
본 발명의 바람직한 다른 일실시예에 따르면, 골 손실 질환은 골다공증, 골연화증, 구루병, 골감소증, 섬유성 골염, 무형성 골질환, 골형성 부전증, 골위축, 파제트(paget's disease), 치주염(periodontitis), 류마티스 관절염(rheumatoid arthritis), 대사성 골질환 및 암세포의 골전이에 의해 유발되는 뼈의 손상으로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있다.
본 발명의 호장근 및 계심의 복합 추출물을 포함하는 조성물은 파골세포 분화 또는 활성 억제에 대한 상승효과를 나타내며 종래에 공지된 약물들과 달리 인체에 안전하므로, 파골세포 활성의 과도한 증가에 따라 발생하는 다양한 골 손실 질환의 예방, 개선 또는 치료용 약학 및 식품 조성물 등에 응용될 수 있다.
도 1은 호장근 단일 추출물, 계심 단일 추출물 및 이들을 다양한 중량비 (1:1, 1:2, 1:5, 1:10, 2:1, 10:1)로 혼합한 복합 추출물 처리에 따른 파골세포 분화 억제 효능을 나타낸 그래프이다.
도 2a 및 2b는 호장근 단일 추출물, 계심 단일 추출물 및 이들의 복합 추출물의 처리에 따른 파골세포 분화 억제 효능을 보여주는 것으로, 도 2a는 TRAP 염색된 파골세포의 현미경 사진이고, 도 2b는 파골세포 분화 억제 효능을 나타낸 그래프이다.
도 3a 및 3b는 호장근 단일 추출물, 계심 단일 추출물, 및 이들의 복합 추출물의 처리에 따른 분화된 파골세포의 주요 마커의 발현 수준을 나타낸 것으로, 도 3a는 TRAP의 발현 수준을 나타낸 것이고, 도 3b는 카텝신 K의 발현 수준을 나타낸 것이다.
도 4a 및 4b는 호장근과 계심의 복합 추출물 처리 농도에 따른 분화된 파골세포의 주요 마커의 발현 수준을 나타낸 것으로, 도 4a는 TRAP의 발현 수준을 나타낸 것이고, 도 4b는 카텝신 K의 발현 수준을 나타낸 것이다.
도 5a 내지 5c는 호장근과 계심의 복합 추출물 처리 농도에 따른 분화된 파골세포의 주요 마커의 발현 수준을 나타낸 것으로, 도 5a는 RANK의 발현 수준을 나타낸 것이고, 도 5b는 c-fos의 발현 수준을 나타낸 것이며, 도 5c는 NFATc1의 발현 수준을 나타낸 것이다.
도 6a는 호장근과 계심의 복합 추출물 처리에 따른 대퇴골의 골밀도의 변화를 분석하여 나타낸 그래프이고, 도 6b는 골 체적비의 변화, 도 6c는 해면골소주의 두께 (trabecular thickness, Tb.Th), 도 6d는 해면골소주의 수(trabecular number, Tb.N), 6e는 해면골소주 공간(trabecular spacing, Tb.Sp)을 수치화하여 분석하여 나타낸 그래프이다.
상술한 바와 같이, 인구 노령화에 따라 골다공증 질환의 환자가 증가하고 있고, 골질환 치료와 관련된 시장의 규모가 점점 커지고 있으나, 종래의 골다공증 치료제는 효능 및 안전성에서 많은 문제가 보고되고 있어 효능 및 안전성이 확보된 신물질의 개발이 절실히 요구되고 있다. 이러한 배경 하에, 본 발명자들은 호장근과 계심의 복합 추출물이 각각의 단독 추출물보다 현저하게 우수한 파골세포 분화 억제 상승효과를 나타냄을 확인하고 호장근과 계심의 복합 추출물을 이용하여 골 손실 질환의 예방, 개선 또는 치료용 조성물을 제공함으로써 상술한 문제의 해결방안을 모색하였다. 본 발명의 호장근 및 계심의 복합 추출물을 포함하는 조성물은 파골세포 분화 억제 효능에 대한 상승효과를 나타내어 골 손실 질환의 치료에 효과적이며, 종래에 공지된 약물들과 달리 인체에 안전하다.
이하, 본 발명을 보다 상세히 설명한다.
본 발명에서 사용되는 모든 기술용어는, 달리 정의되지 않는 이상, 본 발명의 관련 분야에서 통상의 당업자가 일반적으로 이해하는 바와 같은 의미로 사용된다. 또한 본 명세서에는 바람직한 방법이나 시료가 기재되나, 이와 유사하거나 동등한 것들도 본 발명의 범주에 포함된다.
본 발명은 호장근 및 계심 추출물을 포함하는 골 손실 질환의 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 호장근 및 계심 추출물을 포함하는 골 손실 질환의 예방 또는 개선용 건강기능식품 조성물을 제공한다.
본 발명의 조성물에 있어서, 상기 호장근과 계심은 상업적으로 판매되는 것을 구입하여 사용하거나, 자연에서 직접 채취 또는 재배한 것을 사용할 수 있다. 골 손실 질환의 예방, 개선 또는 치료 효과를 갖는 추출물을 수득할 수 있는 한, 호장근은 다양한 부위를 사용할 수 있고, 예를 들어, 뿌리, 지상부, 줄기, 잎, 꽃, 열매의 몸통, 열매의 껍질뿐만 아니라 식물 조직 배양물로부터 추출 가능하다.
본 발명의 구체적인 일실시예에서는 호장근과 계심을 각각 특정 중량비로 혼합한 뒤 추출한 추출물을 사용하였다. 호장근과 계심은 이물질 제거를 위해 세척 및 건조 후 사용될 수 있으며, 추출 효율을 높이기 위해 분쇄하여 사용될 수 있다. 상기 호장근과 계심의 복합 추출물을 제조하는 방법은 침지 추출법, 정치 추출법, 초음파 추출법, 여과법, 열수 추출법 및 환류 추출법 등 당업계의 통상적인 추출방법을 사용할 수 있다. 추출용매는 당업계의 통상적인 추출용매라면 제한없이 사용할 수 있고, 바람직하게는 물, C1~C4의 알코올 또는 이들의 혼합용매일 수 있으며, 보다 바람직하게는 물, 메탄올 또는 에탄올일 수 있고, 가장 바람직하게는 에탄올일 수 있다. 또한, 추출용매는 호장근과 계심의 중량의 1~20배 첨가하여 추출할 수 있다.
또한, 추출시간은 0.5~48시간, 보다 바람직하게는 1~36시간일 수 있으나, 이에 제한되지 않으며, 추출 횟수는 1회 내지 10회 반복하여 추출할 수 있다.
필요한 경우에는 당업계에 공지된 방법에 따라 여과, 농축 및 동결 건조 등의 단계를 추가적으로 거쳐 분말로 제조될 수 있다. 상기 농축은 감압농축일 수 있고, 감압농축은 진공 감압 농축기 또는 진공 회전 증발기를 이용하여 수행될 수 있으나 이에 제한되지 않는다. 또한, 건조는 감압건조, 진공건조, 비등건조, 분무건조 또는 동결건조하는 것이 바람직하나 이에 제한되지 않는다.
본 발명에서의 용어, "추출물(extract)"이란, 목적하는 물질을 다양한 용매에 침지한 다음, 상온, 저온 또는 가온 상태에서 일정시간 동안 추출하여 수득한 액상성분, 상기 액상성분으로부터 용매를 제거하여 수득한 고형분 등의 결과물을 의미한다. 뿐만 아니라, 상기 결과물에 더하여, 상기 결과물의 희석액, 이들의 농축액, 이들의 조정제물, 정제물 등을 모두 포함하는 것으로 포괄적으로 해석될 수 있다.
본 발명의 조성물에서, 호장근 추출물과 계심 추출물은 가장 우수한 상승효과를 유도하기 위해 최적의 중량비로 혼합될 수 있으며, 바람직하게는 1:12 내지 12:1, 보다 바람직하게는 1:10 내지 12:1, 보다 더 바람직하게는 1:9 내지 11:1의 중량비로 혼합될 수 있다. 호장근 추출물과 계심 추출물을 상기 범위를 벗어난 중량비로 혼합하는 경우, 복합 상승효과가 감소하여 최적의 활성을 나타낼 수 없으므로, 상기 중량비 범위 내에서 호장근과 계심을 혼합하여 추출물을 제조하는 것이 바람직하다.
본 발명에서, 용어 “골 손실”은 파골세포와 조골세포의 불균형에 의하여 초래되는 뼈가 손실되는 증상을 의미하는 것으로, “골 손실 질환”은 상기 증상과 관련된 질환을 모두 포함하는 것을 의미한다. 따라서, 파골세포의 활성이 지나치게 높아져 뼈가 손실되어 골밀도가 낮아지거나, 조골세포의 활성이 저하되어 뼈의 생성이 원활하게 일어나지 않아 초래되는 질환을 모두 포함한다. 상기 골 손실 질환의 구체적인 예로는, 골다공증, 골연화증, 구루병, 골감소증, 섬유성 골염, 무형성 골질환, 골형성 부전증, 골위축, 파제트(paget's disease), 치주염(periodontitis), 류마티스 관절염(rheumatoid arthritis), 대사성 골질환 및 암세포의 골전이에 의해 유발되는 뼈의 손상 등이 있으나, 이로 제한되지 않는다.
본 발명의 호장근 및 계심 추추물을 포함하는 조성물은 파골세포의 분화 또는 활성을 억제하여 골 흡수를 억제함으로써 골 손실 질환을 예방, 개선 또는 치료할 수 있다. 또한, 본 발명의 호장근 및 계심 추추물을 포함하는 조성물은 성숙한 파골세포 활성을 억제하는 것을 특징으로 할 수 있으며, 상기 성숙한 파골세포는 RANKL(receptor activator of NFκB ligand)에 의해 유도될 수 있다.
본 발명에서, 용어 "파골세포" 는 골조직의 파괴, 흡수 기능을 수행하는 세포를 의미한다. 파골세포는 지름이 20 내지 100 ㎛인 거대세포로, 2 내지 20 개 가량의 핵을 포함하고 있다. 상기 파골세포는 대식세포에서 분화한 것으로, 파골세포의 형성은 상호 협력한 대식세포-콜로니 자극 인자(M-CSF), NF-κB 리간드의 수용체 활성자(RANKL) 및 상기 활성자의 공동 자극 인자에 의해 유도된다.
본 발명에서, 용어 "골 흡수"는 골 조직에서 칼슘이 빠져나가 뼈에 구멍이 나고 부서지기 쉽게 되는 과정을 의미하며, 그 과정에서는 골기질과 골미네랄이 동시에 골에서 제거된다. 골의 성장이나 개조 시에 생기는 생리적인 현상이지만, 염증이나 암세포의 골전이에 의해서도 골흡수 현상이 발생할 수 있다.
본 발명의 골 파괴 억제 활성은 파골세포의 분화 또는 골 흡수를 저해하는 것을 의미한다.
도 2에 나타난 바와 같이, 호장근과 계심의 복합 추출물은 각각의 단일 추출물보다 파골세포의 분화를 현저하게 억제하며, 도 3 내지 5에 나타난 바와 같이, 분화된 파골세포의 주요 마커인 TRAP 및 카텝신 K 유전자의 발현 억제와 파골세포 분화를 진행시키는 c-fos, RANK 및 NFATc1 유전자의 발현 억제 효과를 나타낸다.
본 발명의 골 손실 질환의 예방, 개선 또는 치료용 조성물에 있어서, 용어 “예방”은 질병 또는 병증의 발병을 억제하거나 지연시키는 모든 행위를 의미한다. 본 발명에 있어서는 파골세포의 골 흡수를 억제하여, 골 손실 질환의 발병 시기를 지연시키거나, 발병을 억제하는 것을 의미한다.
본 발명의 골 손실 질환의 예방, 개선 또는 치료용 조성물에 있어서, 용어 “개선”은 질병 또는 병증 상태를 호전 또는 이롭게 변경하는 모든 행위를 의미하는 것으로, 본 발명에 있어서는 파골세포의 분화를 억제하는 작용을 통해서 골다공증의 증상 또는 치조골 손실과 같은 골 손실 질환의 증상을 호전시키는 것을 의미한다.
본 발명의 골 손실 질환의 예방, 개선 또는 치료용 조성물에 있어서, 용어 “치료”는 질병 또는 병증의 진행을 지연, 중단 또는 역전시키는 모든 행위를 의미하는 것으로, 본 발명에 있어서는 파골세포의 분화를 억제하는 작용을 통해서 치조골 또는 뼈 등의 손실을 중단, 경감, 완화 또는 없애거나, 역전시키는 것을 의미한다.
용어 "상승 효과(synergy effect)"는 각 성분이 병용(조합) 투여될 때 발생되는 효과가, 단일 성분으로서 단독으로 투여될 때 발생되는 효과의 합보다 더 큰 것을 말한다[Chou and Talalay, Adv. Enzyme. Regul., 22:27-55, 1984]. 본 발명의 호장근 및 계심의 복합 추출물은 이들 각각의 단일 추출물 보다 골 손실 질환에 대한 예방, 개선 또는 치료효과를 상승시킨다.
용어 "병용 투여(administered in combination)"는 추출물 또는 성분이 환자에게 함께 투여되는 것을 의미한다. 각 추출물 또는 성분이 함께 투여된다는 것은 원하는 치료 효과를 얻기 위해서, 각 성분을 동일한 시간에 또는 임의의 순서로 또는 상이한 시간에 순차적으로 투여될 수 있음을 의미한다.
용어 "환자"는 질환 또는 장애에 걸린 대상체를 지칭한다. 환자라는 용어는 인간 및 수의학 대상체를 포함하며, 인간, 소, 개, 기니아 피그, 토끼, 닭, 곤충 등을 포함하여 치료가 요구되는 임의의 단일 개체를 의미한다.
본 발명의 약학적 조성물은 인간을 비롯한 포유동물에 어떠한 방법으로도 투여할 수 있다. 예를 들어, 경구 또는 비경구로 투여할 수 있으며, 비경구적인 투여방법으로는 이에 제한되는 것은 아니나, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장 내 투여일 수 있다.
본 발명의 약학적 조성물은 상술한 바와 같은 투여 경로에 따라 경구 투여용 또는 비경구 투여용 제제로 제형화할 수 있다. 제형화할 경우에는 하나 이상의 완충제(예를 들어, 식염수 또는 PBS), 카보하이드레이트(예를 들어, 글루코스, 만노스, 수크로스, 또는 덱스트란 등), 항산화제, 정균제, 킬레이트화제(예를 들어, EDTA 또는 글루타치온), 충진제, 증량제, 결합제, 아쥬반트(예를 들어, 알루미늄 하이드록사이드), 현탁제, 농후제, 습윤제, 붕해제 또는 계면활성제, 희석제 또는 부형제를 사용하여 조제될 수 있다.
경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 액제, 겔제, 시럽제, 슬러리제, 현탁액 또는 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 약학 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분(옥수수 전분, 밀 전분, 쌀 전분, 감자 전분 등 포함), 칼슘카보네이트(Calcium carbonate), 수크로스(Sucrose), 락토오스(Lactose), 덱스트로오스, 솔비톨, 만니톨, 자일리톨, 에리스리톨 말티톨, 셀룰로즈, 메틸 셀룰로즈, 나트륨 카르복시메틸셀룰로오즈 및 하이드록시프로필메틸-셀룰로즈 또는 젤라틴 등을 섞어 조제될 수 있다. 예컨대, 활성성분을 고체 부형제와 배합한 다음 이를 분쇄하고 적합한 보조제를 첨가한 후 과립 혼합물로 가공함으로써 정제 또는 당의정제를 수득할 수 있다.
단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제 또는 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물 또는 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제 또는 보존제 등이 포함될 수 있다.
또한, 경우에 따라 가교결합 폴리비닐피롤리돈, 한천, 알긴산 또는 나트륨 알기네이트 등을 붕해제로 첨가할 수 있으며, 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다.
비경구적으로 투여하는 경우 본 발명의 약학 조성물은 적합한 비경구용 담체와 함께 주사제, 경피 투여제 및 비강 흡입제의 형태로 당 업계에 공지된 방법에 따라 제형화 될 수 있다. 상기 주사제의 경우에는 반드시 멸균되어야 하며 박테리아 및 진균과 같은 미생물의 오염으로부터 보호되어야 한다. 주사제의 경우 적합한 담체의 예로는 이에 한정되지는 않으나, 물, 에탄올, 폴리올(예를 들어, 글리세롤, 프로필렌 글리콜 및 액체 폴리에틸렌 글리콜 등), 이들의 혼합물 및/또는 식물유를 포함하는 용매 또는 분산매질일 수 있다. 보다 바람직하게는, 적합한 담체로는 행크스 용액, 링거 용액, 트리에탄올 아민이 함유된 PBS(phosphate buffered saline) 또는 주사용 멸균수, 10% 에탄올, 40% 프로필렌 글리콜 및 5% 덱스트로즈와 같은 등장 용액 등을 사용할 수 있다. 상기 주사제를 미생물 오염으로부터 보호하기 위해서는 파라벤, 클로로부탄올, 페놀, 소르빈산, 티메로살 등과 같은 다양한 항균제 및 항진균제를 추가로 포함할 수 있다. 또한, 상기 주사제는 대부분의 경우 당 또는 나트륨 클로라이드와 같은 등장화제를 추가로 포함할 수 있다.
경피 투여제의 경우 연고제, 크림제, 로션제, 겔제, 외용액제, 파스타제, 리니멘트제, 에어롤제 등의 형태가 포함된다. 상기에서 '경피 투여'는 약학적 조성물을 국소적으로 피부에 투여하여 약학적 조성물에 함유된 유효한 양의 활성성분이 피부 내로 전달되는 것을 의미한다.
흡입 투여제의 경우, 본 발명에 따라 사용되는 화합물은 적합한 추진제, 예를 들면, 디클로로플루오로메탄, 트리클로로플루오로메탄, 디클로로테트라플루오로에탄, 이산화탄소 또는 다른 적합한 기체를 사용하여, 가압 팩 또는 연무기로부터 에어로졸 스프레이 형태로 편리하게 전달 할 수 있다. 가압 에어로졸의 경우, 투약 단위는 계량된 양을 전달하는 밸브를 제공하여 결정할 수 있다. 예를 들면, 흡입기 또는 취입기에 사용되는 젤라틴 캡슐 및 카트리지는 화합물, 및 락토오스 또는 전분과 같은 적합한 분말 기제의 분말 혼합물을 함유하도록 제형화할 수 있다. 비경구 투여용 제형은 모든 제약 화학에 일반적으로 공지된 처방서인 문헌(Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour)에 기재되어 있다.
본 발명의 약학 조성물은 호장근과 계심의 복합 추출물을 유효량으로 포함할 때 바람직한 골 손실 질환 예방, 개선 또는 치료 효과를 제공할 수 있다. 본원에서, 용어 “유효량”은 음성 대조군에 비해 그 이상의 반응을 나타내는 양을 말하며, 바람직하게는 골 손실 질환을 예방, 개선 또는 치료하기에 충분한 양을 말한다. 본 발명의 약학 조성물에 호장근과 계심의 복합 추출물은 0.01 내지 99.9% 포함될 수 있으며, 잔량은 약학적으로 허용가능한 담체가 차지할 수 있다. 본 발명의 약학 조성물에 포함되는 호장근과 계심의 복합 추출물의 유효량은 조성물이 제품화되는 형태 등에 따라 달라질 것이다.
본 발명의 약학 조성물의 총 유효량은 단일 투여량(single dose)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple dose)으로 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다. 본 발명의 약학 조성물은 질환의 정도에 따라 유효성분의 함량을 달리할 수 있다. 예를 들어, 호장근과 계심의 복합 추출물을 기준으로 하루에 체중 1 kg당 바람직하게 0.001 내지 100 mg, 더 바람직하게는 0.01 내지 10 mg의 양으로 투여되도록 1 내지 수회에 나누어 투여할 수 있다. 그러나 상기 호장근과 계심의 복합 추출물의 용량은 약학적 조성물의 투여 경로 및 치료 횟수뿐만 아니라 환자의 연령, 체중, 건강 상태, 성별, 질환의 중증도, 식이 및 배설율 등 다양한 요인들을 고려하여 환자에 대한 유효 투여량이 결정되는 것이므로, 이러한 점을 고려할 때 당 분야의 통상적인 지식을 가진 자라면 상기 호장근과 계심의 복합 추출물을 골 손실 질환의 예방, 치료 또는 개선을 위한 특정한 용도에 따른 적절한 유효 투여량을 결정할 수 있을 것이다. 본 발명에 따른 약학적 조성물은 본 발명의 효과를 보이는 한 그 제형, 투여 경로 및 투여 방법에 특별히 제한되지 아니한다.
본 발명의 골 손실 질환 예방 또는 치료용 약학 조성물은 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 또는 생물학적 반응조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
본 발명의 골 손실 질환 예방 또는 치료용 약학 조성물은 또한 호장근과 계심의 복합 추출물을 포함하는 외용제의 제형으로 제공할 수 있다. 이러한 측면에서, 본 발명의 조성물은 골 손실 질환 예방 또는 개선용 의약외품 조성물 및 상기 조성물을 포함하는 의약외품 일 수 있다.
상기 외용제는 피부 또는 구강 내에 직접 적용될 수 있다. 본 발명의 골 손실 질환 예방 또는 치료용 약학 조성물을 외용제로 사용하는 경우, 추가로 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 유화제, 비이온형 유화제, 충전제, 금속이온봉쇄제, 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 친수성 활성제, 친유성 활성제 또는 지질 소낭 등 피부 외용제에 통상적으로 사용되는 임의의 다른 성분과 같은 피부과학 분야에서 통상적으로 사용되는 보조제를 함유할 수 있다. 또한, 상기 성분들은 피부 과학 분야에서 일반적으로 사용되는 양으로 도입될 수 있다.
본 발명의 조성물이 외용제로 제공될 경우, 이에 제한되는 것은 아니나, 액제, 연고, 패취, 겔, 크림 또는 분무제 등의 제형일 수 있다. 본 발명의 일 구현예에 따르면, 본 발명의 외약외품은 치약, 양치액 및 마우스 스프레이를 포함하는 구강관리 제품, 연고제, 마스크, 습포제, 첩부제 및 경피흡수제 등을 포함할 수 있다.
본 발명의 호장근과 계심의 복합 추출물을 처리하는 경우 파골세포의 분화가 억제되었는바, 상기 유효성분을 구강관리 제품에 적용하는 경우, 파골세포의 분화를 억제하여 치조골 질환의 예방 또는 개선에 효과가 있다. 따라서, 상기 의약외품 조성물은 골 손실 예방 또는 개선을 위한 구강 관리용 조성물일 수 있다.
본 발명의 조성물을 의약외품 조성물로 사용하는 경우, 호장근과 계심의 복합 추출물을 그대로 첨가하거나 다른 의약외품 성분과 함께 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합량은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다.
본 발명의 의약외품 조성물 및 의약외품에 대하여 본 발명의 약학 조성물 및 건강기능식품 조성물의 내용이 준용될 수 있다.
본 발명에서, 용어 “건강기능식품”은 “기능성 식품”및 “건강 식품”의 의미를 모두 포함한다.
본 발명에서, 용어 “기능성 식품(functional food)”은 특정보건용 식품(food for special health use, FoSHU)와 동일한 용어로, 영양 공급 외에도 생체조절기능이 효율적으로 나타나도록 가공된 의학, 의료효과가 높은 식품을 의미한다.
본 발명에서 용어, “건강 식품(health food)”은 일반식품에 비해 적극적인 건강유지나 증진 효과를 가지는 식품을 의미하고, 건강보조식품(health supplement food)는 건강 보조 목적의 식품을 의미한다. 경우에 따라, 기능성식품, 건강식품, 건강보조식품의 용어는 호용된다. 상기 식품은 골 손실 질환의 개선 또는 회복에 유용한 효과를 얻기 위하여 정제, 캅셀, 분말, 과립, 액상, 환 등의 다양한 형태로 제조될 수 있다.
이러한 기능성 식품의 구체적인 예로, 상기 조성물을 이용하여 농산물, 축산물 또는 수산물의 특성을 살려 변형시키는 동시에 저장성을 좋게 한 가공식품을 제조할 수 있다.
본 발명의 건강기능식품 조성물은 또한, 영양 보조제 (nutritional supplement), 식품 첨가제 (food additives) 및 사료 등의 형태로 제조될 수 있으며, 인간 또는 가축을 비록한 동물을 취식 대상으로 한다.
상기 유형의 식품 조성물은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다. 일반 식품으로는 이에 한정되지 않지만 음료(알콜성 음료 포함), 과실 및 그의 가공식품(예: 과일통조림, 병조림, 잼, 마아말레이드 등), 어류, 육류 및 그 가공식품(예: 햄, 소시지 콘비이프 등), 빵류 및 면류(예: 우동, 메밀국수, 라면, 스파게이트, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예: 버터, 치이즈 등), 식용식물 유지, 마아가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(예: 된장, 간장, 소스 등) 등에 호장근과 계심의 복합 추출물을 첨가하여 제조할 수 있다.
또한, 영양보조제로는 이에 한정되지 않지만 캡슐, 타블렛, 환 등에 호장근과 계심의 복합 추출물을 첨가하여 제조할 수 있다.
또한, 건강기능식품으로는 이에 한정되지 않지만 예를 들면, 상기 호장근과 계심의 복합 추출물을 차, 쥬스 및 드링크의 형태로 제조하여 음용(건강음료)할 수 있도록 액상화, 과립화, 캡슐화 및 분말화하여 섭취할 수 있다. 또한, 상기 호장근과 계심의 복합 추출물을 식품 첨가제의 형태로 사용하기 위해서는 분말 또는 농축액 형태로 제조하여 사용할 수 있다. 또한, 상기 호장근과 계심의 복합 추출물과 골 손실 질환의 예방 또는 개선에 효과가 있다고 알려진 공지의 활성 성분과 함께 혼합하여 조성물의 형태로 제조할 수 있다.
본 발명의 식품 조성물이 건강음료 조성물로 이용되는 경우, 상기 건강음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로 함유할 수 있다. 상술한 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드; 말토스, 수크로스와 같은 디사카라이드; 덱스트린, 사이클로덱스트린과 같은 폴리사카라이드; 자일리톨, 소르비톨, 에리트리톨 등의 당알콜일 수 있다. 감미제는 타우마틴, 스테비아 추출물과 같은 천연 감미제; 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 mL 당 일반적으로 약 0.01 ~ 0.04 g, 바람직하게는 약 0.02 ~ 0.03 g 이다.
호장근과 계심의 복합 추출물은 골 손실 질환의 예방 또는 개선용 식품 조성물의 유효성분으로 함유될 수 있는데, 그 양은 상기 예방 또는 개선 효과를 얻기에 유효한 양으로, 예를 들어 전체 조성물 총 중량에 대하여 0.01 내지 100 중량%인 것이 바람직하나, 이에 특별히 한정되는 것은 아니다. 본 발명의 식품 조성물은 호장근과 계심의 복합 추출물과 함께 골 손실 질환의 예방 또는 개선에 효과가 있는 것으로 알려진 다른 활성성분과 함께 혼합하여 제조될 수 있다.
상기 외에 본 발명의 건강기능식품은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산, 펙트산의 염, 알긴산, 알긴산의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올 또는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 건강식품은 천연 과일주스, 과일주스 음료, 또는 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 혼합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부당 0.01 ~ 0.1 중량부의 범위에서 선택되는 것이 일반적이다.
본 발명은 또한, 호장근 및 계심 추출물을 포함하는 조성물을 유효량으로 이를 필요로 하는 개체에게 투여하는 것을 포함하는, 골 손실 질환의 예방 또는 치료방법을 제공한다.
본 발명의 방법에 있어서, 용어 “개체”는 임의의 동물 (예를 들어, 인간, 말, 돼지, 토끼, 개, 양, 염소, 비-인간 영장류, 소, 고양이, 기니피그 또는 설치류)을 포함하지만 이에 한정되지는 않는다. 이러한 용어는 특정 연령 또는 성별을 나타내지 않는다. 따라서, 여성/암컷이든 남성/수컷이든, 성인/성체 및 신생 대상체, 뿐만 아니라 태아가 포함되도록 의도된다.
본 발명의 방법에 있어서, 호장근 및 계심 추출물을 포함하는 조성물의 효과 및 이의 투여 경로, 투여 횟수, 투여량 등을 포함한 구성에 대한 설명은 전술한 바와 동일하므로, 그 기재를 생략한다.
본 발명은 또한, 골 손실 질환을 예방 또는 치료하기 위한 약제의 제조 시 호장근 및 계심 추출물을 포함하는 조성물의 용도를 제공한다.
이하, 본 발명을 실시예를 통해 보다 상세하게 설명한다. 단, 본 발명은 다양한 변경을 가할 수 있고 여러 가지 형태를 가질 수 있는바, 이하에서 기술하는 특정 실시예 및 설명은 본 발명의 이해를 돕기 위한 것일 뿐, 본 발 명을 특정한 개시 형태에 대해 한정하려는 것이 아니다. 본 발명의 범위는 본 발명의 사상 및 기술 범위에 포함되는 모든 변경, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다.
[제조예 1]
호장근 및 계심의 단일 추출물 제조
1-1. 호장근 단일 추출물의 제조
(주)휴먼허브(http://www.humanherb.co.kr/)에서 구입한 호장근 100g에 70% 에탄올 10ℓ를 가하고, 60℃에서 24시간 침지시킨 후 실온에서 추출액을 수득하였다. 다시 70% 에탄올 10ℓ를 가하고 추출하는 과정을 2회 더 반복하여 추출액을 수집하였다.
1-2. 계심 추출물의 제조
(주)휴먼허브(http://www.humanherb.co.kr/)에서 구입한 계심 100g에 70% 에탄올 10ℓ를 가하고, 60℃에서 24시간 침지시킨 후 실온에서 추출액을 수득하였다. 다시 70% 에탄올 10ℓ를 가하고 추출하는 과정을 2회 더 반복하여 추출액을 수집하였다.
[제조예 2]
호장근과 계심의 복합 추출물 제조
상기 제조예 1에서 제조된 호장근 추출물과 계심 추출물을 표 1에 나타난 중량비로 각각 혼합한 복합 추출물을 수득하였다.
호장근:계심의 혼합 중량비
제조예 2-1 1:1
제조예 2-2 1:2
제조예 2-3 1:5
제조예 2-4 1:10
제조예 2-5 2:1
제조예 2-6 5:1
제조예 2-7 10:1
[준비예 1]
세포 및 재료의 준비
골수 유래 일차 대식세포 (primary bone marrow macrophage) 배양을 위해 6~8주령의 수컷 C57BL/6 생쥐를 코아텍 사에서 구입하였다. 세포 배양에 사용한 MEM-α 배지는 Welgene 사에서 구입하였고 FBS는 하이클론 Hyclone 사에서, 적혈구 제거를 위해서는 Sigma-Aldrich 사의 적혈구 (RBC) 용해 버퍼를 구입하였다. M-CSF, RNAKL 단백질은 R&D Systems 사에서 구입하여 사용하였다.
파골세포 분화 정도 측정인 TRAP 염색을 위해 필요한 타르타르산, 아세트산나트륨, 나프톨 AS-MX 포스페이트 (Naphtol AS-MX phosphate), N,N'-디메틸포름아미드, 패스트 레드 바이올렛 (Fast red violet)은 Sigma-Aldrich 사에서 구입하였다.
RNA 추출을 위해 MACHEREY-NAGEL 사의 NucleoZOL을 구입하였고, cDNA 합성과 실시간 PCR 분석을 위해서는 Bio-Rad 사의 iScript cDNA 합성 키트와 iQ SYBR Green Supermix 제품을 구입하였다.
[준비예 2]
프라이머 합성
실시간 PCR을 위한 프라이머는 표 2와 같은 염기 서열로 Bioneer 사에서 합성하여 사용하였다.
유전자 이름 정방향 프라이머 (5'→3') 서열번호 역방향 프라이머 (5'→3') 서열번호
TRAP gaccacaacctgcagta 1 agggatccatgaagttg 2
Cathepsin K ccatctctgtgtccatc 3 ggtcacaattttcatca 4
c-fos gttccctgagcatgttgg 5 gcctagatgatgccggaaa 6
RANK gcttcttctcagatgtc 7 gtgcttctagctttcca 8
NFATc1 ctttccccgacatcata 9 gctcgtatggaccagaa 10
β-actin gggaaggtgacagcattg 11 atgaagtattaaggcggaagatt 12
[실시예 1]
호장근 단일, 계심 단일 및 이의 복합 추출물 처리에 따른 파골세포 분화유도 억제 효과 확인
1-1. 생쥐 골수 유래 일차 대식세포 추출 및 배양
생쥐의 대퇴골과 경골을 분리한 후 MEM-α를 10ml 주사기(23G 바늘)로 주입하여 골수를 빼낸다. 18G 바늘로 바꾸어 골수를 균일하게 푼 뒤 100um 스트레이너 (Strainer)를 통과시켜 걸러낸다. 1,500 rpm, 5분 원심분리하고 세포를 풀어 RBC 용해 버퍼 5ml을 넣고 1.5분 반응시킨다. MEM-α 15ml을 넣고 1,500 rpm, 5분 원심분리한다. 이 과정을 한번 더 반복하고, MEM-α 10ml만으로 두 번 더 진행한다. 세포를 30ng/ml의 M-CSF를 넣은 MEM-α 배지에 풀어 100mm 페트리 디쉬에서 3일간 배양한다 (37℃, 5% CO2).
1-2. 파골세포 분화유도 및 호장근 단일, 계심 단일 및 이의 복합 추출물 처리
3일간 배양한 골수 유래 일차 대식세포를 트립신으로 떼어낸 후 96 웰 플레이트에 웰 당 2x104 개의 세포가 들어가도록 넣는다. 이때 MEM-α 배지에는 10ng/ml 농도의 M-CSF를 첨가하고, 분화 유도를 위해서는 20ng/ml 농도의 RANKL을 추가로 첨가한다. 제조예 1에서 제조된 호장근 단일 추출물 및 계심 단일 추출물은 각각 20 ㎍/ml 농도로 처리하였고, 제조예 2에서 각 단일 추출물을 다양한 중량비로 혼합하여 제조된 복합 추출물 (호장근:계심의 혼합 중량비가 각각 1:1, 1:2, 1:5, 1:10, 2:1 및 10:1임)을 각각 40 ㎍/ml 농도로 처리한 후 (최종 DMSO 농도는 0.2%), 37℃, 5% CO2 조건에서 5일간 배양하며 48시간마다 배지를 새롭게 교체하며 추출물도 새롭게 처리한다.
1-3. TRAP 염색
분화 5일째에 96 웰 플레이트의 배지를 제거하고 4% PFA를 넣어 상온에서 1시간 동안 고정한다. 고정 후에는 4% PFA를 제거하고 준비한 TRAP 염색 용액을 넣어 상온에서 1시간 동안 반응시킨다. 염색이 완료되면 증류수로 1회 씻어내고 상온에서 건조시킨다. DMSO로 염색된 염료를 녹여내고 540nm에서 흡광도를 측정하여 혼합 중량비에 따른 TRAP 활성(파골세포 분화 정도)을 비교한다.
실험 결과, 도 1에 나타낸 바와 같이 여러 혼합 비율 중 호장근과 계심의 1:1 비율 혼합이 파골세포 분화 억제에 가장 좋은 효과를 나타내는 것을 확인할 수 있었다.
다양한 중량비로 혼합된 복합 추출물의 상승효과를 보다 구체적으로 확인하기 위해, 도 1의 그래프를 수치화하여 표 3에 나타내었다. 또한, 각 복합 추출물에 대한 TRAP 활성 억제율(%) 예측값을 콜비 (Colby) 공식을 이용하여 계산하였고 이를 표 3에 나타내었다.
[콜비 공식]
E = (A + B) - (A × B / 100)
상기 식에서, A는 활성성분 A의 약효이고, B는 활성성분 B의 약효이며, E는 예측치로 성분 A와 성분 B (A+B)가 혼합되었을 경우의 예측되는 약효이다.
호장근: 계심의 혼합 중량비 TRAP 활성% TRAP 활성 억제율%(실측치) TRAP 활성 억제율%(예측값)
1:1 호장근 1 63% 37% -
계심 1 92% 8% -
혼합 1:1 30% 70% 42%
1:2 호장근 1 87% 13% -
계심 2 92% 8% -
혼합 1:2 56% 44% 20%
1:5 호장근 1 97% 3% -
계심 5 100% 0% -
혼합 1:5 86% 14% 3%
1:10 호장근 1 92% 8% -
계심 10 100% 0% -
혼합 1:10 92% 8% 8%
2:1 호장근 2 78% 22% -
계심 1 91% 9% -
혼합 2:1 66% 34% 29%
10:1 호장근 10 78% 22% -
계심 1 95% 5% -
혼합 10:1 71% 29% 25.9%
그 결과, 모든 복합 추출물 처리군에서 실측치가 예측값과 동일하거나, 실측치가 예측값을 뛰어넘는 우수한 TRAP 활성 억제 효능이 나타남을 확인할 수 있었다. 따라서, 상기 중량비 범위로 혼합된 복합 추출물은 각각의 단일 추출물과 비교하여 현저히 우수한 파골세포 분화 억제 효능을 갖는 것으로 결론지을 수 있다.
[실시예 2]
호장근 단일, 계심 단일 및 이의 복합 추출물 처리에 따른 파골세포 분화유도 억제 효과 확인
2-1. 파골세포 분화유도 및 호장근 단일, 계심 단일 및 이의 복합 추출물 처리
상기 실시예 1-1에서 3일간 배양한 골수유래 일차 대식세포를 트립신으로 떼어낸 후 96 웰 플레이트에 웰 당 2x104 개의 세포가 들어가도록 넣는다. 이때 MEM-α 배지에는 10ng/ml 농도의 M-CSF를 첨가하고, 분화 유도를 위해서는 20ng/ml 농도의 RANKL을 추가로 첨가한다. 호장근 단일, 계심 단일 및 이들의 1:1 복합 추출물은 각각 20, 20 및 40 ㎍/ml 농도로 처리 후 (최종 DMSO 농도는 0.1%), 37℃, 5% CO2 조건에서 5일간 배양하며 48시간마다 배지를 새롭게 교체하며 추출물도 새롭게 처리한다.
2-3. TRAP 염색
TRAP 염색 용액은 0.1M 아세트산나트륨 (pH5.0)과 0.5M 타르타르산나트륨을 9:1의 비율로 섞어 타르타르산염 (Tartarate) 용액을 만들고, 타르타르산염 용액 10ml 당 나프톨 AS-MX 포스페이트 1mg을 N,N'-디메틸포름아미드 100ul에 녹여 첨가하였다. 여기에 패스트 레드 바이올렛 (Fast red violet)을 5~6mg 넣어 충분히 녹인 후 0.45㎛ 주사기 필터로 여과하여 준비하였다.
분화 5일째에 96-웰 플레이트의 배지를 제거하고 4% PFA를 넣어 상온에서 1시간 동안 고정한다. 고정 후에는 4% PFA를 제거하고 준비한 TRAP 염색 용액을 넣어 상온에서 1시간 동안 반응시킨다. 염색이 완료되면 증류수로 1회 씻어내고 상온에서 건조시킨다. 현미경으로 촬영 후 각 웰에 나타나는 분화된 파골세포인 MNC (Multi-nucleated cell)의 숫자를 세어 분화 정도를 분석한다. 이때, MNC의 기준은 핵이 3개 이상인 것으로 한다.
실험 결과, 도 2a에 나타난 바와 같이, 대조군에 비하여 호장근 단일, 계심 단일 또는 이들의 1:1 복합 추출물의 처리에 의해 분홍색으로 염색된 파골세포가 현저히 감소한 것을 확인할 수 있었다. 웰 전체에 나타나는 파골세포 수를 세어 보았을 때에도 현저한 감소를 확인할 수 있었고, 도 2b에 나타난 바와 같이 복합 추출물은 단일 추출물들에 비해 파골세포의 분화를 더욱 현저하게 억제시킨 것으로 확인되었다. 이는 복합에 의한 상승효과로 볼 수 있으며, 호장근과 계심의 복합 추출물이 단일 추출물들에 비해 파골세포 분화를 더욱 효과적으로 억제하는 효능을 나타내는 근거가 된다.
복합 추출물 처리군의 현저한 상승효과를 보다 구체적으로 확인하기 위해 미분화 대조군의 웰 당 MNC의 수를 100% 기준으로 하여, 각 군의 파골세포 분화 억제율(%)을 계산하여 표 4에 나타내었고, 단일 추출물 처리군의 파골세포 분화 억제율 실측치를 앞서 언급한 콜비 (Colby) 공식에 대입하여 계산된 복합 추출물의 파골세포 분화 억제율 예측값 또한 표 4에 나타내었다.
미분화 대조군 호장근 단일 추출물 계심 단일 추출물 호장근과 계심의 1:1 복합 추출물
웰 당 MNC 수(개) 185 20 60 4
분화 억제율%(실측치) - 89.2% 67.6% 97.8%
분화 억제율%(예측값) - - - 96.5%
그 결과, 복합 추출물 처리군에서 실측치가 예측값을 뛰어넘는 우수한 파골세포 분화 억제 효과가 나타남을 확인할 수 있었다.
[실시예 3]
호장근 단일, 계심 단일 및 이의 복합 추출물 처리에 따른 분화된 파골세포의 주요 마커 유전자의 발현 수준 확인
3-1. 파골세포 분화유도 및 호장근 단일, 계심 단일 및 이의 복합 추출물 처리
3일간 배양한 골수유래 일차 대식세포를 트립신으로 떼어낸 후 12-웰 플레이트에 웰 당 5x105 개의 세포가 들어가도록 넣는다. 이때 MEM-α 배지에는 30ng/ml 농도의 M-CSF를 첨가하고, 분화 유도를 위해서는 20ng/ml 농도의 RANKL을 추가로 첨가한다. 호장근 단일, 계심 단일, 및 이들의 1:1 복합 추출물은 각각 20, 20 및 40 ㎍/ml 농도로 처리 후 (최종 DMSO 농도는 0.1%) 37℃, 5% CO2 조건에서 5일간 배양하며 48시간마다 배지를 새롭게 교체하며 추출물도 새롭게 처리한다.
3-2. RNA 추출 및 유전자 발현 분석
12 웰 플레이트의 세포의 배지를 제거하고 PBS로 1회 세척한 후 NucleoZOL을 이용하여 세포를 바로 녹여낸다. 제조사의 총 RNA 분리 (Total RNA isolation) 프로토콜에 따라 RNA를 추출하고, 1㎍의 RNA를 iScript cDNA 합성 키트를 이용하여 역전사 중합효소 연쇄반응 (Reverse Transcription Polymerase Chain Reaction)으로 cDNA를 합성한다. 합성한 cDNA는 각 유전자에 해당하는 표 2의 프라이머 세트를 이용하여 iQ SYBR Green Supermix로 실시간 PCR을 진행하여 분석한다. 각 유전자 발현 값은 하우스키핑 유전자인 β-액틴 발현 값으로 나누어 보정한다.
실험 결과, 도 3a 및 3b에 나타낸 바와 같이, 분화된 파골세포의 주요 마커인 TRAP과 카텝신 K 유전자의 발현이 호장근 단일, 계심 단일, 및 이들의 1:1 복합 추출물의 처리에 의해 유의하게 감소한 것을 확인하였다. 특히, 단일 추출물들에 비해 복합 추출물에 의한 유전자 발현 감소가 더욱 현저하게 나타났다. 이러한 상승효과에 의해 호장근과 계심의 복합 추출물은 각각의 단일 추출물들에 비해 파골세포 분화를 더욱 효과적으로 억제한다는 것을 확인할 수 있었다.
단합 추출물 처리군의 현저한 상승효과를 보다 구체적으로 확인하기 위해 RANKL만 처리한 대조군의 TRAP 발현 수준을 100% 기준으로 하여, 각 군의 TRAP 발현 억제율(%)을 계산하여 표 5에 나타내었고, 단일 추출물 처리군의 TRAP 발현 억제율 실측치를 앞서 언급한 콜비 (Colby) 공식에 대입하여 계산된 복합 추출물의 TRAP 발현 억제율 예측값 또한 표 5에 나타내었다.
RANKL 처리 대조군 호장근 단일 추출물 계심 단일 추출물 호장근과 계심의 1:1 복합 추출물
TRAP 발현 수준 5502 3371 3809 1359
TRAP 발gus억제율%(실측치) - 38.7% 30.8% 75.3%
TRAP 발현억제율%(예측값) - - - 57.6%
그 결과, 복합 추출물 처리군에서 실측치가 예측값을 뛰어넘는 우수한 TRAP 발현 억제 효과가 나타남을 확인할 수 있었다.
마찬가지로, RANKL만 처리한 대조군의 카텝신 K 발현 수준을 100% 기준으로 하여, 각 군의 카텝신 K 발현 억제율(%)을 계산하여 표 6에 나타내었고, 단일 추출물 처리군의 카텝신 K 발현 억제율 실측치를 앞서 언급한 콜비 (Colby) 공식에 대입하여 계산된 복합 추출물의 카텝신 K 발현 억제율 예측값 또한 표 5에 나타내었다.
RANKL 처리 대조군 호장근 단일 추출물 계심 단일 추출물 호장근과 계심의 1:1 복합 추출물
카텝신 K발현 수준 2284 1016 1055 316
카텝신 K발현 억제율%(실측치) - 55.5% 53.8% 86.2%
카텝신 K발현 억제율%(예측값) - - - 79.4%
그 결과, 복합 추출물 처리군에서 실측치가 예측값을 뛰어넘는 우수한 카텝신 K 발현 억제 효과가 나타남을 확인할 수 있었다.
[실시예 4]
호장근과 계심의 복합 추출물 처리 농도에 따른 분화된 파골세포의 주요 마커 유전자 및 분화 진행 유전자의 발현 수준 확인
4-1. 파골세포 분화유도 및 호장근과 계심의 복합 추출물 처리
3일간 배양한 골수유래 일차 대식세포를 트립신으로 떼어낸 후 12-웰 플레이트에 웰 당 5x105 개의 세포가 들어가도록 넣는다. 이때 MEM-α 배지에는 30ng/ml 농도의 M-CSF를 첨가하고, 분화 유도를 위해서는 20ng/ml 농도의 RANKL을 추가로 첨가한다. 호장근과 계심의 1:1 복합 추출물은 0, 10, 20, 및 50 ㎍/ml 농도로 각각 처리 후 (최종 DMSO 농도는 0.1%) 37℃, 5% CO2 조건에서 3일간 배양하며 48시간째에 배지를 새롭게 교체한다.
4-2. RNA 추출 및 유전자 발현 분석
상기 실시예 3-2와 동일한 방법으로 TRAP 및 카텝신 K, c-fos, RANK 및 NFATc1 유전자 발현을 분석하였다. 실험 결과, 도 4a 및 4b에 나타낸 바와 같이, 분화된 파골세포의 주요 마커인 TRAP과 카텝신 K 유전자의 발현이 호장근과 계심의 복합 추출물 농도 의존적으로 유의하게 감소한 것을 확인하였다.
또한, 도 5a, 5b, 및 5c에 나타낸 바와 같이 파골세포 분화를 진행시키는 c-fos, RANK, NFATc1 유전자들의 발현도 호장근과 계심의 복합 추출물에 의해 현저하게 감소한 것을 확인할 수 있었다. 이와 같은 결과에 의해 호장근과 계심의 복합 추출물이 농도가 증가함에 따라 파골세포 분화를 효과적으로 억제하는 효능을 나타낸다는 것을 확인할 수 있었고, 이는 호장근과 계심의 복합 추출물이 뼈 건강과 골다공증의 치료에 적용될 수 있는 근거로 볼 수 있다.
[실시예 5]
난소절제 동물모델에서 장근과 계심의 복합 추출물 투여에 따른 골다공증 개선 효과 측정
5-1. 실험동물의 설계 및 실험 물질 처리 조성
호장근과 계심의 복합 추출물 투여에 따른 난소절제 동물모델의 골다공증 개선 효과를 측정하기 위하여 7주령의 SD 암컷 쥐(코아텍, 평택, 한국)를 구입하여 일정한 조건(온도: 22±2℃, 상대습도: 55±10%, 일주기: 12시간)으로 케이지에서 물과 먹이를 자유 공급하여 1주일간 순화를 거쳐 실험에 사용하였다. 이후 난소 절제 수술을 진행하였으며 9주령이 되었을 때에 CT로 골밀도를 측정한 후 개체간의 차이가 없도록 4개의 군으로 나누었으며, 제1 군은 인산완충식염수를 투여한 모의수술군 (Sham)으로 설정하였고 (도 6a 내지 6e에서 대조군), 제2 군은 인산완충식염수를 투여한 난소절제를 수행한 수술군으로 설정하였으며 (도 6a 내지 6e에서 수술군), 제3 군은 에스트로겐을 0.5 ㎎/㎏의 농도로 4주간 매일 경구투여한 난소절제 수술군의 양성대조군으로 설정하였고 (도 6a 내지 6e에서 수술군+에스트로겐), 제4 군은 호장근 및 계심의 1:1 복합 추출물을 200 ㎎/㎏의 농도로 오전, 오후 매일 2번, 4주간 경구투여한 난소절제 수술군으로 설정하였다 (도 6a 내지 6e에서 수술군 + 복합 추출물).
5-2. Micro CT 측정
양성대조군인 에스트로겐 또는 실험군인 복합 추추물의 투여를 4주간 진행한 후, 난소절제 동물모델의 골다공증 개선 효과를 Micro CT를 이용하여 분석하였다. 난소절제 동물의 골밀도는 micro-CT (QuantumFX, Perkin Elmer, Massachusetts, USA)를 이용하여 대퇴골 성장판 2 mm 앞쪽 3 mm 범위를 골 CT 촬영을 실시하여 측정하였다. 또한, 골 체적비 (bone volume fraction, BV/TV, %)를 측정하였고, 해면골소주의 두께 (trabecular thickness, Tb.Th), 수(trabecular number, Tb.N) 및 공간(trabecular spacing, Tb.Sp)을 분석하였다.
실험결과, 도 6a에 나타낸 바와 같이, 호장근과 계심의 복합 추출물을 200 mg/kg 투여한 군이 난소 절제군 (수술군) 보다 현저하게 대퇴골의 골밀도가 증가한 것을 관찰할 수 있었으며, 양성대조군 (에스트로겐)보다 효과가 좋음을 관찰할 수 있었다. 또한, 도 6b에 나타낸 바와 같이, 복합추출물 200 mg/kg을 투여한 군은 양성대조군인 에스트로겐보다 골체적비 (BV/TV)가 증가한 것을 확인할 수 있었고, 도 6c, 6d 및 6e에 나타낸 바와 같이 해면골소주 두께와 수는 모의수술군 (대조군)에 비해 난소 절제군 (수술군)이 현저하게 낮았고, 해면골소주 공간은 높았다. 그러나, 복합 추출물을 200 mg/kg 용량으로 4주간 투여한 복합 추출물 실험군에서는 폐경에 의해 발생되는 해면골소주 두께 및 해면골소주 수의 감소와 해면골소주 공간의 증가가 모두 유의적으로 억제되었다.
상기 실험결과는 난소절제 수술군, 모의수술군 (대조군), 복합 추출물 투여군 및 에스트로겐 투여군 간의 t 검정(t-test)으로 비교 검증을 실시하여 그 유의성을 검증하였으며, 통계학적으로 유의한 차이를 보였다(*p<0.05, **p<0.005, ***p<0.0005).
따라서, 복합 추출물의 투여가 골밀도 및 골체적비를 증가시키고, 해면골소주의 두께 및 수를 증가시키며, 해면골소주의 공간이 줄어들게 한다는 것을 확인함으로써, 복합 추출물에 대한 골다공증 치료 효과를 다시 한번 확인할 수 있었다.

Claims (20)

  1. 호장근 및 계심 추출물을 포함하는 골 손실 질환의 예방 또는 치료용 약학 조성물.
  2. 제1항에 있어서, 상기 호장근 및 계심 추출물은 물, C1 내지 C4의 저급 알코올 또는 이들의 혼합물을 용매로 하여 추출한 것인 골 손실 질환의 예방 또는 치료용 약학 조성물.
  3. 제1항에 있어서, 상기 호장근 및 계심 추출물은 1:12 내지 12:1의 중량비로 혼합되는 것인 골 손실 질환의 예방 또는 치료용 약학 조성물.
  4. 제1항에 있어서, 상기 골 손실 질환은 파골세포의 골 흡수에 의해 유발되는 것인 골 손실 질환의 예방 또는 치료용 약학 조성물.
  5. 제1항에 있어서, 상기 골 손실 질환은 골다공증, 골연화증, 구루병, 골감소증, 섬유성 골염, 무형성 골질환, 골형성 부전증, 골위축, 파제트(paget's disease), 치주염(periodontitis), 류마티스 관절염(rheumatoid arthritis), 대사성 골질환 및 암세포의 골전이에 의해 유발되는 뼈의 손상으로 구성된 군으로부터 선택되는 어느 하나 이상인 것인 골 손실 질환의 예방 또는 치료용 약학 조성물.
  6. 호장근 및 계심 추출물을 유효성분으로 포함하는 골 손실 질환의 예방 또는 개선용 건강기능식품 조성물.
  7. 제6항에 있어서, 상기 호장근 및 계심 추출물은 물, C1 내지 C4의 저급 알코올 또는 이들의 혼합물을 용매로 하여 추출한 것인 골 손실 질환의 예방 또는 개선용 건강기능식품 조성물.
  8. 제6항에 있어서, 상기 호장근 및 계심 추출물은 1:12 내지 12:1의 중량비로 혼합되는 것인 골 손실 질환의 예방 또는 개선용 건강기능식품 조성물.
  9. 제6항에 있어서, 상기 골 손실 질환은 파골세포의 골 흡수에 의해 유발되는 것인 골 손실 질환의 예방 또는 개선용 건강기능식품 조성물.
  10. 제6항에 있어서, 상기 골 손실 질환은 골다공증, 골연화증, 구루병, 골감소증, 섬유성 골염, 무형성 골질환, 골형성 부전증, 골위축, 파제트(paget's disease), 치주염(periodontitis), 류마티스 관절염(rheumatoid arthritis), 대사성 골질환 및 암세포의 골전이에 의해 유발되는 뼈의 손상으로 구성된 군으로부터 선택되는 어느 하나 이상인 것인 골 손실 질환의 예방 또는 개선용 건강기능식품 조성물.
  11. 호장근 및 계심 추출물을 포함하는 조성물을 유효량으로 이를 필요로 하는 개체에게 투여하는 것을 포함하는, 골 손실 질환의 예방 또는 치료방법.
  12. 제11항에 있어서, 상기 호장근 및 계심 추출물은 물, C1 내지 C4의 저급 알코올 또는 이들의 혼합물을 용매로 하여 추출한 것인, 골 손실 질환의 예방 또는 치료방법.
  13. 제11항에 있어서, 상기 호장근 및 계심 추출물은 1:12 내지 12:1의 중량비로 혼합되는 것인 골 손실 질환의 예방 또는 치료방법.
  14. 제11항에 있어서, 상기 골 손실 질환은 파골세포의 골 흡수에 의해 유발되는 것인 골 손실 질환의 예방 또는 치료방법.
  15. 제11항에 있어서, 상기 골 손실 질환은 골다공증, 골연화증, 구루병, 골감소증, 섬유성 골염, 무형성 골질환, 골형성 부전증, 골위축, 파제트(paget's disease), 치주염(periodontitis), 류마티스 관절염(rheumatoid arthritis), 대사성 골질환 및 암세포의 골전이에 의해 유발되는 뼈의 손상으로 구성된 군으로부터 선택되는 어느 하나 이상인 것인 골 손실 질환의 예방 또는 치료방법.
  16. 골 손실 질환을 예방 또는 치료하기 위한 약제의 제조 시 호장근 및 계심 추출물을 포함하는 조성물의 용도.
  17. 제16항에 있어서, 상기 호장근 및 계심 추출물은 물, C1 내지 C4의 저급 알코올 또는 이들의 혼합물을 용매로 하여 추출한 것인, 용도.
  18. 제16항에 있어서, 상기 호장근 및 계심 추출물은 1:12 내지 12:1의 중량비로 혼합되는 것인, 용도.
  19. 제16항에 있어서, 상기 골 손실 질환은 파골세포의 골 흡수에 의해 유발되는 것인, 용도.
  20. 제16항에 있어서, 상기 골 손실 질환은 골다공증, 골연화증, 구루병, 골감소증, 섬유성 골염, 무형성 골질환, 골형성 부전증, 골위축, 파제트(paget's disease), 치주염(periodontitis), 류마티스 관절염(rheumatoid arthritis), 대사성 골질환 및 암세포의 골전이에 의해 유발되는 뼈의 손상으로 구성된 군으로부터 선택되는 어느 하나 이상인 것인, 용도.
PCT/KR2020/009914 2019-07-30 2020-07-28 골 손실 질환의 예방, 개선 또는 치료를 위한 호장근 및 계심 추출물을 포함하는 조성물의 용도 WO2021020857A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020190092757A KR102302734B1 (ko) 2019-07-30 2019-07-30 호장근 및 계심 추출물을 포함하는 골 손실 질환의 예방, 개선 또는 치료용 조성물
KR10-2019-0092757 2019-07-30

Publications (1)

Publication Number Publication Date
WO2021020857A1 true WO2021020857A1 (ko) 2021-02-04

Family

ID=74228737

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/009914 WO2021020857A1 (ko) 2019-07-30 2020-07-28 골 손실 질환의 예방, 개선 또는 치료를 위한 호장근 및 계심 추출물을 포함하는 조성물의 용도

Country Status (2)

Country Link
KR (1) KR102302734B1 (ko)
WO (1) WO2021020857A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130059858A (ko) * 2011-11-29 2013-06-07 주식회사 진생사이언스 육계 추출물을 유효성분으로 함유하는 발육 성장 촉진용 또는 골다공증의 예방 및 치료용 약학 조성물
KR20130059859A (ko) * 2011-11-29 2013-06-07 주식회사 진생사이언스 골형성 증가 효과를 가지는 육계 추출물을 유효성분으로 하는 건강식품 조성물
KR20130059860A (ko) * 2011-11-29 2013-06-07 주식회사 진생사이언스 육계 추출물을 유효성분으로 하는 골형성 증가 효과를 가지는 식품첨가물
KR20150026517A (ko) * 2013-09-03 2015-03-11 한림대학교 산학협력단 호장근 추출물을 함유하는 골다공증 치료 및 예방용 조성물
KR20190047359A (ko) * 2017-10-27 2019-05-08 주식회사 노브메타파마 호장근과 계심을 함유하는 항혈전용 조성물

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130059858A (ko) * 2011-11-29 2013-06-07 주식회사 진생사이언스 육계 추출물을 유효성분으로 함유하는 발육 성장 촉진용 또는 골다공증의 예방 및 치료용 약학 조성물
KR20130059859A (ko) * 2011-11-29 2013-06-07 주식회사 진생사이언스 골형성 증가 효과를 가지는 육계 추출물을 유효성분으로 하는 건강식품 조성물
KR20130059860A (ko) * 2011-11-29 2013-06-07 주식회사 진생사이언스 육계 추출물을 유효성분으로 하는 골형성 증가 효과를 가지는 식품첨가물
KR20150026517A (ko) * 2013-09-03 2015-03-11 한림대학교 산학협력단 호장근 추출물을 함유하는 골다공증 치료 및 예방용 조성물
KR20190047359A (ko) * 2017-10-27 2019-05-08 주식회사 노브메타파마 호장근과 계심을 함유하는 항혈전용 조성물

Also Published As

Publication number Publication date
KR102302734B1 (ko) 2021-09-15
KR20210014541A (ko) 2021-02-09

Similar Documents

Publication Publication Date Title
KR101733261B1 (ko) 지방 분해 촉진 조성물
US20100105766A1 (en) Composition for inhibition or prevention of bone density reduction
EP3991742A1 (en) Coronavirus therapeutic agent comprising elaeocarpus sylvestris extract as active ingredient
KR101898688B1 (ko) 복합 추출물을 포함하는 근위축의 예방, 치료 또는 개선용 조성물
WO2014058142A1 (ko) 섬쑥부쟁이 추출물을 유효성분으로 함유하는 비만 또는 대사성질환의 예방 또는 치료용 약학적 조성물
KR102204346B1 (ko) 갱년기 증상 또는 골다공증 개선용 조성물
KR102519649B1 (ko) 캠퍼롤 및 에피카테킨 갈레이드를 포함하는 홍경천 추출물을 포함하는 전립선 관련 질환의 예방 또는 치료용 조성물
WO2016190566A9 (ko) 아위버섯 물 추출물을 유효성분으로 함유하는 대사성질환의 예방 및 치료용 약학적 조성물 또는 건강기능성식품
KR102171518B1 (ko) 지골피 추출물을 유효성분으로 함유하는 근 위축 예방 또는 치료용 조성물
JPWO2018016455A1 (ja) 滋養強壮剤
KR101621446B1 (ko) 감수 추출물 또는 이의 분획물을 함유하는 갑상선 질환의 예방 또는 치료용 조성물
WO2016093613A2 (ko) 진피 추출물을 포함하는 이상 체중 감소 증상의 예방 또는 치료용 조성물
WO2021020857A1 (ko) 골 손실 질환의 예방, 개선 또는 치료를 위한 호장근 및 계심 추출물을 포함하는 조성물의 용도
WO2011019153A2 (ko) 오미자, 황금 및 해동피의 혼합 생약재 추출물을 유효성분으로 포함하는 관절염 예방 또는 치료용 조성물
KR20140080289A (ko) 산화적 뇌손상 및 뇌기능 장애의 예방 또는 치료용 조성물 및 이의 제조방법
KR101436213B1 (ko) 긴잎모시풀 추출물을 포함하는 비만의 예방 또는 치료용 조성물
KR101131719B1 (ko) 백두옹 추출물을 유효성분으로 포함하는 염증성 질환 치료 및 예방용 조성물
KR102275268B1 (ko) 갱년기 증상 또는 골다공증 개선용 조성물
KR100760386B1 (ko) Ａｃｐ 혼합생약 추출물을 포함하는 관절염의 예방 및 치료용 조성물
KR101735294B1 (ko) 산화적 뇌손상 및 뇌기능 장애의 예방 또는 치료용 조성물 및 이의 제조방법
KR102347819B1 (ko) 갱년기 증상 또는 골다공증 개선용 조성물
KR20150051159A (ko) 상륙 추출물 또는 이의 분획물을 함유하는 갑상선 질환의 예방 또는 치료용 조성물
WO2021221457A1 (ko) 박하 추출물을 유효성분으로 함유하는 골질환의 예방, 개선 또는 치료용 조성물
WO2021020912A1 (ko) 인지기능 장애의 예방, 개선 또는 치료를 위한 호장근 및 계심 추출물을 포함하는 조성물의 용도
EP4356756A1 (en) Composition for preventing, improving, or treating degenerative arthritis comprising steamed ginger extract or 1-dehydro-6-gingerdione isolated therefrom as active ingredient

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20847120

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20847120

Country of ref document: EP

Kind code of ref document: A1