WO2020261231A1 - Chimeric antigen receptor with 4-1bb costimulatory domain - Google Patents

Chimeric antigen receptor with 4-1bb costimulatory domain Download PDF

Info

Publication number
WO2020261231A1
WO2020261231A1 PCT/IB2020/056097 IB2020056097W WO2020261231A1 WO 2020261231 A1 WO2020261231 A1 WO 2020261231A1 IB 2020056097 W IB2020056097 W IB 2020056097W WO 2020261231 A1 WO2020261231 A1 WO 2020261231A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
cancer
antigen
immune cell
car
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2020/056097
Other languages
English (en)
French (fr)
Inventor
Byoung S. Kwon
Kwanghee Kim
Jiwon Chung
Young Gyoon CHANG
Bo-Rim YI
Jungyun Lee
Sae Rom Lee
Hyuntae SON
Hye Mi Lee
Eun Hye Yoo
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Eutilex Co Ltd
Original Assignee
Eutilex Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/KR2019/010244 external-priority patent/WO2020032784A1/ko
Priority to CN202411914064.2A priority Critical patent/CN119955732A/zh
Application filed by Eutilex Co Ltd filed Critical Eutilex Co Ltd
Priority to US17/622,503 priority patent/US20220249565A1/en
Priority to KR1020227001944A priority patent/KR102957801B1/ko
Priority to CA3144875A priority patent/CA3144875A1/en
Priority to EP20831651.3A priority patent/EP3990626A4/en
Priority to AU2020307673A priority patent/AU2020307673A1/en
Priority to JP2021576820A priority patent/JP7829911B2/ja
Priority to CN202080047355.XA priority patent/CN114080452B/zh
Priority to MX2021015967A priority patent/MX2021015967A/es
Priority to BR112021026406A priority patent/BR112021026406A2/pt
Publication of WO2020261231A1 publication Critical patent/WO2020261231A1/en
Anticipated expiration legal-status Critical
Priority to JP2025076601A priority patent/JP2025118764A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14Blood; Artificial blood
    • A61K35/17Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/15Natural-killer [NK] cells; Natural-killer T [NKT] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31Chimeric antigen receptors [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/421Immunoglobulin superfamily
    • A61K40/4211CD19 or B4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4261Proteoglycans, e.g. glypican, brevican or CSPG4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70517CD8
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/303Liver or Pancreas
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • C12N15/625DNA sequences coding for fusion proteins containing a sequence coding for a signal sequence
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0646Natural killers cells [NK], NKT cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/10Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the structure of the chimeric antigen receptor [CAR]
    • A61K2239/11Antigen recognition domain
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/10Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the structure of the chimeric antigen receptor [CAR]
    • A61K2239/21Transmembrane domain
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/10Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the structure of the chimeric antigen receptor [CAR]
    • A61K2239/22Intracellular domain
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/31Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • C07K2317/53Hinge
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/33Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/43Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16041Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/10Plasmid DNA
    • C12N2800/106Plasmid DNA for vertebrates
    • C12N2800/107Plasmid DNA for vertebrates for mammalian

Definitions

  • CAR-T chimeric antigen receptors
  • immune cells comprising a chimeric antigen receptor (CAR), wherein the (CAR) comprises: (a) an extracellular domain comprising an antigen-binding domain; (b) a transmembrane domain; and (c) an intracellular domain comprising a
  • costimulatory endodomain wherein the costimulatory endodomain comprises an intracellular signaling domain from 4-1BB/CD137 and five additional amino acids.
  • the chimeric antigen receptor is a single polypeptide. In some embodiments, the chimeric antigen receptor is comprised of two polypeptides.
  • the costimulatory endodomain comprises an intracellular signaling domain from 4-1BB/CD137 and five additional amino acids, wherein the five additional amino acids are encoded by SEQ ID NO: 1.
  • the costimulatory endodomain comprises SEQ ID NO: 2.
  • the antigen-binding domain is humanized. In some embodiments, the antigen-binding domain is human. In some embodiments, the antigen-binding domain is an scFv. In some embodiments, the antigen-binding domain specifically binds an antigen associated with a disease. In some embodiments, the antigen-binding domain specifically binds a tumor antigen. In some embodiments, the antigen-binding domain specifically binds to an antigen selected from the group consisting of: glypican-3 (GPC3), malignancy variant receptor (MVR), and CD 19.
  • GPC3 glypican-3
  • MVR malignancy variant receptor
  • the transmembrane domain is a transmembrane domain selected from a protein selected from the group consisting of: 4-1BB/CD137, an activating NK cell receptor, an immunoglobulin protein, B7-H3, BALER, BLAME (SLAMF8), BTLA, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7- H3), CD28, CD29, CD3 delta, CD3 epsilon, CD3 gamma, CD3 zeta, CD30, CD4, CD40,
  • a protein selected from the group consisting of: 4-1BB/CD137, an activating NK cell receptor, an immunoglobulin protein, B7-H3, BALER, BLAME (SLAMF8), BTLA, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD
  • the transmembrane domain is a transmembrane domain from CD8a.
  • the intracellular domain further comprises an intracellular domain from O ⁇ 3z.
  • the chimeric antigen receptor further comprises a signal peptide or leader sequence. In some embodiments, the chimeric antigen receptor further comprises a hinge region. In some embodiments, the hinge region is a CD 8a hinge. In some embodiments, the chimeric antigen receptor further comprises an additional antigen-binding domain. In some embodiments, the additional antigen-binding domain is an scFv.
  • the immune cell is a human immune cell. In some embodiments, the human immune cell is an autologous human immune cell. In some embodiments, the human immune cell is an allogenic human immune cell. In some embodiments, the immune cell is a T cell. In some embodiments, the immune cell is an NK cell.
  • nucleic acids encoding a chimeric antigen receptor (CAR), wherein the chimeric antigen receptor comprises: (a) an extracellular domain comprising an antigen binding domain; (b) a transmembrane domain; and (c) an intracellular domain comprising a costimulatory endodomain, wherein the costimulatory endodomain comprises an intracellular signaling domain from 4-1BB/CD137 and five additional amino acids.
  • CAR chimeric antigen receptor
  • the chimeric antigen receptor is a single polypeptide. In some embodiments, the chimeric antigen receptor is comprised of two polypeptides.
  • the costimulatory endodomain comprises an intracellular signaling domain from 4-1BB/CD137 and five additional amino acids, wherein the five additional amino acids are encoded by a nucleotide sequence of SEQ ID NO: 1. In some embodiments, the costimulatory endodomain comprises SEQ ID NO: 2.
  • the antigen-binding domain is humanized. In some embodiments, the antigen-binding domain is human. In some embodiments, the antigen-binding domain is an scFv. In some embodiments, the antigen-binding domain specifically binds an antigen associated with a disease. In some embodiments, the antigen-binding domain specifically binds a tumor antigen. In some embodiments, the antigen-binding domain specifically binds to an antigen selected from the group consisting of: gly can-3 (GPC3), malignancy variant receptor (MVR), and CD 19.
  • GPC3 gly can-3
  • MVR malignancy variant receptor
  • the transmembrane domain is a transmembrane domain selected from a protein selected from the group consisting of: 4-1BB/CD137, an activating NK cell receptor, an immunoglobulin protein, B7-H3, BALER, BLAME (SLAMF8), BTLA, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7- H3), CD28, CD29, CD3 delta, CD3 epsilon, CD3 gamma, CD3 zeta, CD30, CD4, CD40,
  • a protein selected from the group consisting of: 4-1BB/CD137, an activating NK cell receptor, an immunoglobulin protein, B7-H3, BALER, BLAME (SLAMF8), BTLA, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD
  • the transmembrane domain is a transmembrane domain from CD8 alpha.
  • the intracellular domain further comprises an intracellular domain from E03z.
  • the chimeric antigen receptor further comprises a signal peptide or leader sequence.
  • the chimeric antigen receptor further comprises a hinge region. In some embodiments, the hinge region is a CD8a hinge.
  • vectors comprising any one of the nucleic acids described herein.
  • the vector further comprises a promoter operationally linked to the nucleic acid.
  • the promoter is a constitutive promoter.
  • the promoter is an inducible promoter.
  • the vector is a viral vector.
  • the viral vector is a lentiviral vector.
  • an engineered immune cell comprising: introducing into an immune cell any one of the nucleic acids described herein or any one of the vectors described herein, thereby producing the engineered immune cell.
  • the method further comprises, after the introducing step, culturing the engineered immune cell.
  • the immune cell is a T cell.
  • the immune cell is a NK cell.
  • the method further comprises, before the introducing step, obtaining the immune cell from a subject.
  • the method further comprises administering the engineered immune cell to the subject.
  • the subject has been diagnosed or identified as having a cancer.
  • engineered immune cells produced by any one of the methods described herein.
  • compositions comprising any one of the engineered immune cells described herein and a pharmaceutically acceptable carrier.
  • the cancer is an anti-glypican-3-associated cancer, an anti-CD 19-associated cancer, or an anti-MVR-associated cancer.
  • the cancer is carcinoma, lymphoma (e.g., Hodgkin’s and non- Hodgkin’s lymphomas), blastoma, sarcoma, leukemia, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, squamous cell carcinoma of the lung, peritoneal cancer, hepatocellular carcinoma, gastric cancer, pancreatic cancer, glioma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary carcinoma, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver carcinoma, other lymphoproliferative disorders, and various types of head and neck cancer.
  • lymphoma e.g., Hodgkin’s and non- Hodgkin’s lymphomas
  • blastoma e.g., sarcoma
  • leukemia squamous cell carcinoma
  • the subject has previously been administered one or more additional anticancer therapies selected from the group consisting of: ionizing radiation, a chemotherapeutic agent, a therapeutic antibody, and a checkpoint inhibitor.
  • additional anticancer therapies selected from the group consisting of: ionizing radiation, a chemotherapeutic agent, a therapeutic antibody, and a checkpoint inhibitor.
  • the subject has been identified or diagnosed as having the cancer.
  • FIG. 1 shows a schematic of an exemplary MVR CAR construct.
  • FIG. 2 shows exemplary enzyme mapping results after MVRL2H2-4-1BB cloning.
  • FIG. 3 shows restriction enzyme digestion results of huGC33(VH-VL)-euBBz, wherein the expected size is marked on the DNA ladders and the results are shown in gel electrophoresis images.
  • FIG. 4 shows restriction enzyme digestion results of huGC33(VH-VL)-BBz, wherein the expected size is marked on the DNA ladder and the result is shown in gel electrophoresis image.
  • FIG. 5A is a graph showing total fold expansion of the CAR-T cells over a l l day period in vitro.
  • FIG. 5B is a graph comparing fold expansion of the CAR-T cells in vitro.
  • FIG. 5C is a graph showing cell viability of the CAR-T cells in vitro.
  • FIG. 6 shows analyses of T cells transduced with huGC33(VH-VL)-euBBz and huGC33(VH- VL)-BBz for CAR expression.
  • FIG. 7A is a graph showing LDH-based cytotoxicity assays with Target cells from Huh-7 cell line.
  • FIG. 7B is a graph showing LDH-based cytotoxicity assays with Target cells from PLC/PRF/5 cell line.
  • FIG. 8 is a set of graphs comparing in vivo efficacy of huGC33(VH-VL)-euBBz and
  • FIG. 9 A is a graph showing the CAR-T cell count from the mouse model, 5 weeks post injection of huGC33(VH-VL)-euBBz and huGC33(VH-VL)-BBz CAR-T cells.
  • FIG. 9B is a set of graphs comparing the CAR-T cell count from the mouse model, 5 weeks post injection of huGC33(VH-VL)-euBBz and huGC33(VH-VL)-BBz CAR-T cells.
  • FIG. 10 show analyses of CAR-T cells in mouse blood, bone marrow, spleen, and liver, 5 weeks post injection of huGC33(VH-VL)-euBBz and huGC33(VH-VL)-BBz CAR-T cells using FACS staining.
  • FIG. 11A shows CAR expression in T cells transduced with CD19-BBz and CD19-euBBz.
  • FIG. 1 IB is a graph from Luciferase-based cytotoxicity assay showing killing activity in T cells transduced with CD19-BBz and CD19-euBBz.
  • FIG. 12 shows results of IVIS imaging of the effects of CD19-BBz CAR-T and CD19-euBBz CAR-T cells using an animal model.
  • FIG. 13 are graphs showing photon values of the cancer cells in the animal model post injection of CD19-BBz CAR-T and CD19-euBBz CAR-T cells.
  • FIG. 14A is a set of graphs showing percentage of total CD 19 CAR-T cells present in the blood using FACS after performing orbital blood collection in the mouse at 3-4 day intervals.
  • FIG. 14B is a set of graphs showing percentage of CD4/CD8 CAR-T cells present in the blood using FACS after performing orbital blood collection in the mouse at 3-4 day intervals.
  • FIG. 14C is a graph showing the number of total CD 19 CAR-T present in the blood using FACS after performing orbital blood collection in the mouse at 3-4 day intervals.
  • FIG. 15A shows a schematic of an exemplary GPC3 CAR construct.
  • FIG. 15B shows a schematic of an exemplary GPC3 CAR construct.
  • This disclosure describes chimeric antigen receptors (CARs) that include a 4- IBB costimulatory endodomain, as well as methods of making and using the same.
  • CARs chimeric antigen receptors
  • administration typically refers to the administration of a composition to a subject or system to achieve delivery of an agent that is, or is included in, the composition.
  • agents that is, or is included in, the composition.
  • routes may, in appropriate circumstances, be utilized for administration to a subject, for example a human.
  • administration may be ocular, oral, parenteral, topical, etc.
  • administration may be bronchial (e.g., by bronchial instillation), buccal, dermal (which may be or comprise, for example, one or more of topical to the dermis, intradermal, interdermal, transdermal, etc.), enteral, intra-arterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, within a specific organ (e.g. intrahepatic), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., by intratracheal instillation), vaginal, vitreal, etc.
  • bronchial e.g., by bronchial instillation
  • buccal which may be or comprise, for example, one or more of topical to the dermis, intradermal, interdermal, transdermal, etc.
  • enteral intra-arterial, intradermal, intragastric
  • administration may involve a single dose, multiple doses, or a fixed number of doses.
  • administration may involve dosing that is intermittent (e.g., a plurality of doses separated in time) and/or periodic (e.g., individual doses separated by a common period of time) dosing.
  • administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time.
  • affinity is a measure of the strength a particular ligand binds to its partner. Affinity can be measured in different ways. In some embodiments, affinity is measured by a quantitative assay. In some such embodiments, binding partner concentration may be fixed to be in excess of ligand concentration so as to mimic physiological conditions. Alternatively or additionally, in some embodiments, binding partner concentration and/or ligand concentration may be varied. In some such embodiments, affinity may be compared to a reference under comparable conditions (e.g., concentrations).
  • Antibody agent can refer to an agent that specifically binds to a particular antigen.
  • the term encompasses any polypeptide or polypeptide complex that includes immunoglobulin structural elements sufficient to confer specific binding.
  • Exemplary antibody agents include, but are not limited to monoclonal antibodies, polyclonal antibodies, and fragments thereof.
  • an antibody agent may include one or more sequence elements are humanized, primatized, chimeric, etc., as is known in the art.
  • the term“antibody agent” is used to refer to one or more of the art-known or developed constructs or formats for utilizing antibody structural and functional features in alternative presentation.
  • an antibody agent utilized in accordance with the present invention is in a format selected from, but not limited to, intact IgA, IgG, IgE, or IgM antibodies; bi- or multi- specific antibodies (e.g., Zybodies®, etc.); antibody fragments such as Fab fragments, Fab’ fragments, F(ab’)2 fragments, Fd’ fragments, Fd fragments, and isolated CDRs or sets thereof; single chain Fvs; polypeptide- Fc fusions; single domain antibodies (e.g., shark single domain antibodies such as IgNAR or fragments thereof); cameloid antibodies; masked antibodies (e.g., Probodies®); Small Modular ImmunoPharmaceuticals (“SMIPsTM ); single chain or Tandem diabodies (TandAb®); VHHs; Anticalins®; Nanobodies® minibodies; BiTE®s; ankyrin repeat proteins or DARPINs®;
  • SMIPsTM Small Modular ImmunoPharmaceutic
  • an antibody agent may lack a covalent modification (e.g., attachment of a glycan) that it would have if produced naturally.
  • an antibody agent may contain a covalent modification (e.g., attachment of a glycan, a payload [e.g., a detectable moiety, a therapeutic moiety, a catalytic moiety, etc.], or other pendant group [e.g., poly-ethylene glycol, etc.].
  • an antibody agent is or comprises a polypeptide whose amino acid sequence includes one or more structural elements recognized by those skilled in the art as a complementarity determining region (CDR).
  • CDR complementarity determining region
  • an antibody agent is or comprises a polypeptide whose amino acid sequence includes at least one CDR (e.g., at least one heavy chain CDR and/or at least one light chain CDR) that is substantially identical to one found in a reference antibody.
  • an included CDR is substantially identical to a reference CDR in that it is either identical in sequence or contains between 1-5 amino acid substitutions as compared with the reference CDR.
  • an included CDR is substantially identical to a reference CDR in that it shows at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the reference CDR.
  • an included CDR is substantially identical to a reference CDR in that it shows at least 96%, 96%, 97%, 98%, 99%, or 100% sequence identity with the reference CDR.
  • an included CDR is substantially identical to a reference CDR in that at least one amino acid within the included CDR is deleted, added, or substituted as compared with the reference CDR but the included CDR has an amino acid sequence that is otherwise identical with that of the reference CDR.
  • an included CDR is substantially identical to a reference CDR in that 1-5 amino acids within the included CDR are deleted, added, or substituted as compared with the reference CDR but the included CDR has an amino acid sequence that is otherwise identical to the reference CDR.
  • an included CDR is substantially identical to a reference CDR in that at least one amino acid within the included CDR is substituted as compared with the reference CDR but the included CDR has an amino acid sequence that is otherwise identical with that of the reference CDR.
  • an included CDR is substantially identical to a reference CDR in that 1-5 amino acids within the included CDR are deleted, added, or substituted as compared with the reference CDR but the included CDR has an amino acid sequence that is otherwise identical to the reference CDR.
  • an antibody agent is or comprises a polypeptide whose amino acid sequence includes structural elements recognized by those skilled in the art as an immunoglobulin variable domain.
  • an antibody agent is a polypeptide protein having a binding domain which is homologous or largely homologous to an immunoglobulin-binding domain. In some embodiments, an antibody agent is or comprises at least a portion of a chimeric antigen receptor (CAR).
  • CAR chimeric antigen receptor
  • an antigen can refer to an agent that binds to an antibody agent.
  • an antigen binds to an antibody agent and may or may not induce a particular physiological response in an organism.
  • an antigen may be or include any chemical entity such as, for example, a small molecule, a nucleic acid, a polypeptide, a carbohydrate, a lipid, a polymer (including biologic polymers [e.g., nucleic acid and/or amino acid polymers] and polymers other than biologic polymers [e.g., other than a nucleic acid or amino acid polymer]), etc.
  • an antigen is or comprises a polypeptide.
  • an antigen is or comprises a glycan.
  • an antigen may be provided in isolated or pure form, or alternatively may be provided in crude form (e.g., together with other materials, for example in an extract such as a cellular extract or other relatively crude preparation of an antigen-containing source).
  • an antigen is present in a cellular context (e.g., an antigen is expressed on the surface of a cell or expressed in a cell). In some embodiments, an antigen is a recombinant antigen.
  • Antigen binding domain can refer to an antibody agent or portion thereof that specifically binds to a target moiety or entity.
  • an antigen binding domain typically, the interaction between an antigen binding domain and its target is non-covalent.
  • a target moiety or entity can be of any chemical class including, for example, a carbohydrate, a lipid, a nucleic acid, a metal, a polypeptide, or a small molecule.
  • an antigen binding domain may be or comprise a polypeptide (or complex thereof).
  • an antigen binding domain is part of a fusion polypeptide.
  • an antigen binding domain is part of a chimeric antigen receptor (CAR).
  • Two events or entities are“associated” with one another, as that term is used herein, if the presence, level, and/or form of one is correlated with that of the other.
  • a particular entity e.g., polypeptide, genetic signature, metabolite, microbe, etc.
  • two or more entities are physically“associated” with one another if they interact, directly or indirectly, so that they are and/or remain in physical proximity with one another.
  • two or more entities that are physically associated with one another are covalently linked to one another.
  • two or more entities that are physically associated with one another are not covalently linked to one another but are non-covalently associated, for example by means of hydrogen bonds, van der Waals interaction, hydrophobic interactions, magnetism, and combinations thereof.
  • Binding typically refers to a non-covalent association between or among two or more entities. “Direct” binding involves physical contact between entities or moieties. Indirect binding involves physical interaction by way of physical contact with one or more intermediate entities. Binding between two or more entities can typically be assessed in any of a variety of contexts - including where interacting entities or moieties are studied in isolation or in the context of more complex systems (e.g., while covalently or otherwise associated with a carrier entity and/or in a biological system or cell).
  • a tumor may be or comprise cells that are precancerous (e.g., benign), malignant, pre-metastatic, metastatic, and/or non-metastatic.
  • precancerous e.g., benign
  • malignant pre-metastatic
  • metastatic metastatic
  • non-metastatic e.g., metastatic
  • present disclosure specifically identifies certain cancers to which its teachings may be particularly relevant.
  • a relevant cancer may be characterized by a solid tumor.
  • a relevant cancer may be characterized by a hematologic tumor.
  • examples of different types of cancers known in the art include, for example, hematopoietic cancers including leukemias, lymphomas (Hodgkin’s and non-Hodgkin’s), myelomas and myeloproliferative disorders; sarcomas, melanomas, adenomas, carcinomas of solid tissue, squamous cell carcinomas of the mouth, throat, larynx, and lung, liver cancer, genitourinary cancers such as prostate, cervical, bladder, uterine, and endometrial cancer and renal cell carcinomas, bone cancer, pancreatic cancer, skin cancer, cutaneous or intraocular melanoma, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, head and neck cancers, breast cancer, gastro- intestinal cancers and nervous system cancers, benign lesions such as papillomas, and the like.
  • hematopoietic cancers including leukemias, lymphomas (Hodgkin’
  • CDR can refer to a complementarity determining region within a variable region of an antibody agent. There are three CDRs in each of the variable regions of the heavy chain and the light chain, which are designated CDR1, CDR2 and CDR3, for each of the variable regions.
  • A“ set of CDRs” or“ CDR set” refers to a group of three or six CDRs that occur in either a single variable region capable of binding the antigen or the CDRs of cognate heavy and light chain variable regions capable of binding the antigen.
  • Chemotherapeutic Agent has used herein has its art-understood meaning referring to one or more pro-apoptotic, cytostatic and/or cytotoxic agents, for example specifically including agents utilized and/or recommended for use in treating one or more diseases, disorders or conditions associated with undesirable cell proliferation.
  • chemotherapeutic agents are useful in the treatment of cancer.
  • a chemotherapeutic agent may be or comprise one or more alkylating agents, one or more anthracy clines, one or more cytoskeletal disruptors (e.g.
  • microtubule targeting agents such as taxanes, maytansine and analogs thereof), one or more epothilones, one or more histone deacetylase inhibitors HDACs), one or more topoisomerase inhibitors (e.g., inhibitors of topoisomerase I and/or topoisomerase II), one or more kinase inhibitors, one or more nucleotide analogs or nucleotide precursor analogs, one or more peptide antibiotics, one or more platinum- based agents, one or more retinoids, one or more vinca alkaloids, and/or one or more analogs of one or more of the following (i.e., that share a relevant anti-proliferative activity).
  • a chemotherapeutic agent may be or comprise one or more of
  • Actinomycin All-trans retinoic acid, an Auiristatin, Azacitidine, Azathioprine, Bleomycin, Bortezomib, Carboplatin, Capecitabine, Cisplatin, Chlorambucil, Cyclophosphamide, Curcumin, Cytarabine, Daunorubicin, Docetaxel, Doxifluridine, Doxorubicin, Epirubicin, Epothilone, Etoposide, Fluorouracil, Gemcitabine, Hydroxyurea, Idarubicin, Imatinib, Irinotecan,
  • Maytansine and/or analogs thereof e.g. DM1 Mechlorethamine, Mercaptopurine, Methotrexate, Mitoxantrone, a Maytansinoid, Oxaliplatin, Paclitaxel, Pemetrexed, Teniposide, Tioguanine, Topotecan, Valrubicin, Vinblastine, Vincristine, Vindesine, Vinorelbine, and combinations thereof.
  • a chemotherapeutic agent may be utilized in the context of an antibody-drug conjugate.
  • a chemotherapeutic agent is one found in an antibody-drug conjugate selected from the group consisting of: hLLl -doxorubicin, hRS7-SN-38, hMN-14-SN-38, hLL2-SN-38, hA20-SN-38, hPAM4-SN-38, hLLl-SN-38, hRS7-Pro-2-P-Dox, hMN-14-Pro-2-P-Dox, hLL2-Pro-2-P-Dox, hA20-Pro-2-P-Dox, hPAM4-Pro-2-P-Dox, hLLl- Pro-2-P-Dox, P4/D 10-doxorubicin, gemtuzumab ozogamicin, brentuximab vedotin, trastuzumab emtansine, inotuzumab ozogamicin, glembatumomab vedotin
  • an engineered polypeptide can refer to the aspect of having been manipulated by the hand of man.
  • a polypeptide is considered to be“engineered” when the polypeptide sequence manipulated by the hand of man.
  • an engineered polypeptide comprises a sequence that includes one or more amino acid mutations, deletions and/or insertions that have been introduced by the hand of man into a reference polypeptide sequence.
  • an engineered polypeptide includes a polypeptide that has been fused (i.e., covalently linked) to one or more additional polypeptides by the hand of man, to form a fusion polypeptide that would not naturally occur in vivo.
  • a cell or organism is considered to be“engineered” if it has been manipulated so that its genetic information is altered (e.g ., new genetic material not previously present has been introduced, for example by transformation, mating, somatic hybridization, transfection, transduction, or other mechanism, or previously present genetic material is altered or removed, for example by substitution or deletion mutation, or by mating protocols).
  • new genetic material not previously present has been introduced, for example by transformation, mating, somatic hybridization, transfection, transduction, or other mechanism, or previously present genetic material is altered or removed, for example by substitution or deletion mutation, or by mating protocols.
  • derivatives and/or progeny of an engineered polypeptide or cell are typically still referred to as“engineered” even though the actual manipulation was performed on a prior entity.
  • Host cell can refer to a cell of an organism that is selected, modified, transformed, grown, use or manipulated in any way, for the production of material by the cell, for example the expression by the cell of a gene, a DNA or RNA sequence, a protein or an enzyme.
  • Host cells can include immune cells, including but not limited to lymphocytes (e.g., T cells, B cells, and NK cells), neutrophils, and monocytes/macrophages.
  • in vitro refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi cellular organism.
  • in vivo refers to events that occur within a multi cellular organism, such as a human and a non-human animal. In the context of cell-based systems, the term may be used to refer to events that occur within a living cell (as opposed to, for example, in vitro systems).
  • Isolated can refer to a substance and/or entity that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and/or in an experimental setting), and/or (2) designed, produced, prepared, and/or manufactured by the hand of man. Isolated substances and/or entities may be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which they were initially associated.
  • isolated agents are about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure.
  • a substance is “pure” if it is substantially free of other components.
  • a substance may still be considered“isolated ,, or even “pure”, after having been combined with certain other components such as, for example, one or more carriers or excipients (e.g., buffer, solvent, water, etc.); in such embodiments, percent isolation or purity of the substance is calculated without including such carriers or excipients.
  • a biological polymer such as a polypeptide or polynucleotide that occurs in nature is considered to be“Ao/a/e ⁇ i” when, a) by virtue of its origin or source of derivation is not associated with some or all of the components that accompany it in its native state in nature; b) it is substantially free of other polypeptides or nucleic acids of the same species from the species that produces it in nature; c) is expressed by or is otherwise in association with components from a cell or other expression system that is not of the species that produces it in nature.
  • a polypeptide that is chemically synthesized or is synthesized in a cellular system different from that which produces it in nature is considered to be an“isolated” polypeptide.
  • an“isolated” polypeptide is considered to be an“isolated” polypeptide.
  • a polypeptide that has been subjected to one or more purification techniques may be considered to be an“isolated" polypeptide to the extent that it has been separated from other components a) with which it is associated in nature; and/or b) with which it was associated when initially produced.
  • control element“operably linked” to a functional element is associated in such a way that expression and/or activity of the functional element is achieved under conditions compatible with the control element.
  • “operably linkecT control elements are contiguous (e.g., covalently linked) with the coding elements of interest.
  • control elements act in trans to or otherwise at a from the functional element of interest.
  • composition refers to a composition in which an active agent is formulated together with one or more pharmaceutically acceptable carriers.
  • the composition is suitable for administration to a human or animal subject.
  • the active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population.
  • polypeptide generally refers to its art- recognized meaning of a polymer of at least three amino acids.
  • polypeptide is intended to be sufficiently general as to encompass not only polypeptides having a complete sequence recited herein, but also to encompass polypeptides that represent functional fragments (i.e., fragments retaining at least one activity) of such complete polypeptides.
  • protein sequences generally tolerate some substitution without destroying activity.
  • Polypeptides may contain L-amino acids, D-amino acids, or both and may contain any of a variety of amino acid modifications or analogs known in the art.
  • proteins may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof.
  • the term“peptide” is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids.
  • proteins are antibody agents, antibody fragments, biologically active portions thereof, and/or characteristic portions thereof.
  • Prevent or prevention when used in connection with the occurrence of a disease, disorder, and/or condition, can refer to reducing the risk of developing the disease, disorder and/or condition and/or to delaying onset and/or severity of one or more characteristics or symptoms of the disease, disorder or condition. In some embodiments, prevention is assessed on a population basis such that an agent is considered to“prevent” a particular disease, disorder or condition if a statistically significant decrease in the development, frequency, and/or intensity of one or more symptoms of the disease, disorder, or condition is observed in a population susceptible to the disease, disorder, or condition.
  • Recombinant can refer to polypeptides that are designed, engineered, prepared, expressed, created, manufactured, and/or or isolated by recombinant means, such as polypeptides expressed using a recombinant expression vector transfected into a host cell; polypeptides isolated from a recombinant, combinatorial human polypeptide library; polypeptides isolated from an animal (e.g., a mouse, rabbit, sheep, fish, etc.) that are transgenic for or otherwise has been manipulated to express a gene or genes, or gene components that encode and/or direct expression of the polypeptide or one or more
  • an animal e.g., a mouse, rabbit, sheep, fish, etc.
  • polypeptides prepared, expressed, created or isolated by any other means that involves splicing or ligating selected nucleic acid sequence elements to one another, chemically synthesizing selected sequence elements, and/or otherwise generating a nucleic acid that encodes and/or directs expression of the polypeptide or one or more component(s), portion(s), element(s), or domain(s) thereof.
  • one or more of such selected sequence elements is found in nature.
  • one or more of such selected sequence elements is designed in silico.
  • one or more such selected sequence elements results from mutagenesis (e.g., in vivo or in vitro) of a known sequence element, e.g., from a natural or synthetic source such as, for example, in the germline of a source organism of interest (e.g., of a human, a mouse, etc.).
  • Specific binding can refer to an ability to discriminate between possible binding partners in the environment in which binding can occur.
  • a binding agent that interacts with one particular target when other potential targets are present is said to“bind specifically” to the target with which it interacts.
  • specific binding is assessed by detecting or determining degree of association between the binding agent and its partner.
  • specific binding is assessed by detecting or determining degree of dissociation of a binding agent-partner complex; in some embodiments, specific binding is assessed by detecting or determining ability of the binding agent to compete an alternative interaction between its partner and another entity.
  • specific binding is assessed by performing such detections or determinations across a range of concentrations.
  • a subject refers an organism, typically a mammal (e.g., a human, in some embodiments including prenatal human forms).
  • a subject is suffering from a relevant disease, disorder or condition.
  • a subject is susceptible to a disease, disorder, or condition.
  • a subject displays one or more symptoms or characteristics of a disease, disorder or condition.
  • a subject does not display any symptom or characteristic of a disease, disorder, or condition.
  • a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition.
  • a subject is a patient.
  • a subject is an individual to whom diagnosis and/or therapy is and/or has been administered.
  • therapeutic agent in general refers to any agent that elicits a desired pharmacological effect when administered to an organism.
  • an agent is considered to be a therapeutic agent if it demonstrates a statistically significant effect across an appropriate population.
  • the appropriate population may be a population of model organisms.
  • an appropriate population may be defined by various criteria, such as a certain age group, gender, genetic background, preexisting clinical conditions, etc.
  • a therapeutic agent is a substance that can be used to alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and/or reduce incidence of one or more symptoms or features of a disease, disorder, and/or condition.
  • a“therapeutic agent” is an agent that has been or is required to be approved by a government agency before it can be marketed for
  • a“therapeutic agent” is an agent for which a medical prescription is required for administration to humans.
  • therapeutically effective amount means an amount that is sufficient, when administered to a population suffering from or susceptible to a disease, disorder, and/or condition in accordance with a therapeutic dosing regimen, to treat the disease, disorder, and/or condition.
  • a therapeutically effective amount is one that reduces the incidence and/or severity of, stabilizes one or more characteristics of, and/or delays onset of, one or more symptoms of the disease, disorder, and/or condition.
  • a therapeutically effective amount does not in fact require successful treatment be achieved in a particular individual. Rather, a therapeutically effective amount may be that amount that provides a particular desired pharmacological response in a significant number of subjects when
  • term “therapeutically effective amount”, refers to an amount which, when administered to an individual in need thereof in the context of inventive therapy, will block, stabilize, attenuate, or reverse a cancer-supportive process occurring in said individual, or will enhance or increase a cancer-suppressive process in said individual.
  • “therapeutically effective amount” is an amount which, when administered to an individual diagnosed with a cancer, will prevent, stabilize, inhibit, or reduce the further development of cancer in the individual.
  • a particularly preferred“therapeutically effective amount” of a composition described herein reverses (in a therapeutic treatment) the development of a malignancy, such as a pancreatic carcinoma, or helps achieve or prolong remission of a malignancy.
  • a therapeutically effective amount administered to an individual to treat a cancer in that individual may be the same or different from a therapeutically effective amount
  • the therapeutic methods described herein are not to be interpreted as, restricted to, or otherwise limited to a“cure” for cancer; rather the methods of treatment are directed to the use of the described compositions to“treat” a cancer, i.e., to effect a desirable or beneficial change in the health of an individual who has cancer.
  • Such benefits are recognized by skilled healthcare providers in the field of oncology and include, but are not limited to, a stabilization of patient condition, a decrease in tumor size (tumor regression), an improvement in vital functions (e.g., improved function of cancerous tissues or organs), a decrease or inhibition of further metastasis, a decrease in opportunistic infections, an increased survivability, a decrease in pain, improved motor function, improved cognitive function, improved feeling of energy (vitality, decreased malaise), improved feeling of well-being, restoration of normal appetite, restoration of healthy weight gain, and combinations thereof.
  • a stabilization of patient condition e.g., a decrease in tumor size (tumor regression), an improvement in vital functions (e.g., improved function of cancerous tissues or organs), a decrease or inhibition of further metastasis, a decrease in opportunistic infections, an increased survivability, a decrease in pain, improved motor function, improved cognitive function, improved feeling of energy (vitality, decreased malaise), improved feeling of well-being,
  • regression of a particular tumor in an individual may also be assessed by taking samples of cancer cells from the site of a tumor such as a pancreatic adenocarcinoma (e.g., over the course of treatment) and testing the cancer cells for the level of metabolic and signaling markers to monitor the status of the cancer cells to verify at the molecular level the regression of the cancer cells to a less malignant phenotype.
  • a tumor such as a pancreatic adenocarcinoma
  • a therapeutically effective amount may be formulated and/or administered in a single dose.
  • a therapeutically effective amount may be formulated and/or administered in a plurality of doses, for example, as part of a dosing regimen.
  • Transfection can refer to the introduction of a foreign nucleic acid into a cell using recombinant DNA technology.
  • transformation as used herein can refer to the introduction of a foreign gene, DNA, or RNA sequence to a host cell, so that the host cell will express the introduced gene or sequence to produce the encoded protein or enzyme.
  • Transduction can refer to the introduction of a foreign nucleic acid into a cell using a viral vector.
  • Variant can refer to a molecule that shows significant structural identity with a reference molecule but differs structurally from the reference molecule, e.g., in the presence or absence or in the level of one or more chemical moieties as compared to the reference entity. In some embodiments, a variant also differs functionally from its reference molecule. In general, whether a particular molecule is properly considered to be a“variant” of a reference molecule is based on its degree of structural identity with the reference molecule. As will be appreciated by those skilled in the art, any biological or chemical reference molecule has certain characteristic structural elements.
  • a variant by definition, is a distinct molecule that shares one or more such characteristic structural elements but differs in at least one aspect from the reference molecule.
  • a polypeptide may have a characteristic sequence element comprised of a plurality of amino acids having designated positions relative to one another in linear or three-dimensional space and/or contributing to a particular structural motif and/or biological function;
  • a nucleic acid may have a characteristic sequence element comprised of a plurality of nucleotide residues having designated positions relative to on another in linear or three-dimensional space.
  • a variant polypeptide or nucleic acid may differ from a reference polypeptide or nucleic acid as a result of one or more differences in amino acid or nucleotide sequence.
  • a variant polypeptide or nucleic acid shows an overall sequence identity with a reference polypeptide or nucleic acid that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%.
  • a variant polypeptide or nucleic acid does not share at least one characteristic sequence element with a reference polypeptide or nucleic acid.
  • a reference polypeptide or nucleic acid has one or more biological activities.
  • a variant polypeptide or nucleic acid shares one or more of the biological activities of the reference polypeptide or nucleic acid.
  • Vector can refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • Vectors can encompass both non-viral and viral carriers for introducing nucleic acids into cells in vitro, ex vivo, or in vivo.
  • a vector may be a replicon with another DNA fragment attached to amplify the attached fragment.
  • the term“replicon” refers to any genetic element (e.g., a plasmid, phage, cosmid, chromosome, or virus) that is able to act as an autonomous unit of in vivo DNA replication.
  • vectors known in the art may be used to engineer nucleic acids, incorporate response elements and promoters into genes, and the like.
  • Preferred vectors include, but are not limited to, plasmids (e.g., PBR322 or pUC plasmid derivatives), modified viruses (e.g., adenoviruses, retroviruses, adeno-associated viruses, or herpes viruses), or Bluescript vectors.
  • plasmids e.g., PBR322 or pUC plasmid derivatives
  • modified viruses e.g., adenoviruses, retroviruses, adeno-associated viruses, or herpes viruses
  • Bluescript vectors e.g., DNA fragments corresponding to reaction elements and promoters may be inserted into appropriate vectors by combining the appropriate DNA fragments with selected vectors having complementary cohesive termini.
  • the termini of the DNA molecules may be enzymatically modified, or any site may be generated by binding the nucleotide sequence with the DNA ends via a linker.
  • vectors may be manipulated to contain a selection marker gene for screening cells that have incorporated the marker into the cell genome. Such markers make it possible to identify and/or screen host cells expressing the protein encoded by the marker.
  • vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked.
  • Non-limiting examples of expression vectors and packaging constructs that can be used to deliver the chimeric antigen receptors described herein include retroviral vectors (e.g., SFG, pMX, pSAMEN, pMP71, pLXSN, pMSCV, pMSGV), lentiviral vectors (e.g., epHIW, pLenO, pSIN,pSIEW, pELPS, pELNS, pHR), packaging constructs (psPAX2, pRDF, pEQ-PAM3(-E), pVSVg, pCL, pMEVSVg, pMD2G, pMDLg/p.RRE, pRSV.REV, pTSV.rev, pCHGP, pCMV-g, pCMV-Rev2, pCMVdR8.91, pGALY).
  • retroviral vectors e.g., SFG, pMX,
  • a vector provides the necessary regulatory sequences (e.g., transcriptional and translational elements) to regulate the expression of the fusion protein in the appropriate host cell.
  • Regulatory sequences may comprise promoter regions, enhancer regions, transcription termination sites, ribosomal binding sites, initiation codons, splice signals, introns, polyadenylation signals, Shine/Dalgarno translation sequences and Kozak consensus sequences.
  • a regulatory sequence is selected in view of the host cell in which the fusion protein will be produced.
  • suitable bacterial promoters include, but are not limited to, bacteriophage pL or pR, T6, T7, T7/lacO, lac, recA, gal, trp, ara, hut and trp-lac.
  • suitable eukaryotic promoters include, but are not limited to, PRBI, GAPDH, metallothionein, thymidine kinase, viral LTR, cytomegalovirus, SV40, or tissue-specific or tumor- specific promoters such as a-fetal protein, amylase, cathepsin E, Ml muscarinic receptor or g-glutamyl transferase.
  • additional vectors include lipoplexes (cationic liposome-DNA complexes), polyplexes (cationic polymer-DNA complexes) and protein-DNA complexes.
  • the vector may also comprise one or more regulatory regions and/or selectable markers useful for selecting, measuring, and monitoring the outcomes of nucleic acid delivery (e.g., delivery to a certain tissue, or duration of expression).
  • Vectors may be introduced into a desired host cell by methods known in the art, such as injection, transfection, electroporation, micro injection, transduction, cell fusion, lipofection, calcium phosphate precipitation (Graham, F.L. et al, Virology, 52: 456 (1973), Chen and Okayama, Mol. Cell. Biol. 7: 2745-2752 (1987)), liposome-mediated textured salt method (Wong, T.K. et al., Gene, 10:87 (1980), Nicolau and Sene, Biochim.
  • viral vectors have been used in a wide range of gene transfer applications in cells as well as in live animal subjects.
  • Viral vectors that may be used include, but are not limited to, adenovirus, retrovirus, vaccinia virus, poxvirus, adeno-associated virus, herpes simplex virus, lentivirus, baculovirus, sendai virus, measles virus, simian virus 40, and Epstein- Barr virus vectors.
  • Non-viral vectors include plasmids, lipoplexes (cationic liposome-DNA complexes), polyplexes (cationic polymer-DNA complexes) and protein-DNA complexes.
  • the vector may comprise one or more regulatory regions and/or selection markers useful for screening, measuring, and monitoring nucleic acid delivery outcomes (e.g., delivery to tissue, or persistence of expression).
  • polynucleotides may be introduced in vivo by lipofection.
  • liposomes for encapsulating and transfecting nucleic acids in vitro has increased.
  • synthetic cationic lipids designed to limit the difficulties and risks encountered by liposome-mediated transfection may be used to prepare liposomes for in vivo transfection of genes (Feigner et al, Proc. Natl. Acad. Sci. USA. 84:7413 (1987), Mackey et al., Proc. Natl. Acad. Sci. USA 85:8027 (1988), Ulmer et al., Science 259: 1745 (1993)).
  • cationic lipids may promote encapsulation of negatively charged nucleic acids and may also promote fusion with negatively charged cell membranes (Feigner et al., Science 337:387 (1989)). Particularly useful lipid compounds and compositions for the delivery of nucleic acids are described in W095/18863, W096/17823, and U.S. 5,459,127, which are herein incorporated by reference in their entirety. In some embodiments, direct transfection to specific cell types will clearly be particularly desirable for tissues with cellular heterogeneity such as the pancreas, liver, kidney and brain. In some embodiments, lipids may chemically bind to other molecules for targeting (Mackey et al, 1988). In some embodiments, targeted peptides such as hormones or neurotransmitters, and proteins such as antibodies, or non-peptidic molecules may be chemically bound to liposomes.
  • Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection).
  • Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein.
  • the foregoing techniques and procedures may be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See e.g., Sambrook et al., Molecular Cloning: A
  • immune cells refer to cells of the immune system which can be categorized as lymphocytes (e.g., T cells, B cells, and NK cells), neutrophils, and
  • the immune cell is a T cell. In some embodiments, the immune cell is an NK cell. In some embodiments, the immune cell is a Macrophage. In some embodiments, an immune cell is an engineered immune cell, meaning the immune cell has been genetically modified to express a non-naturally occurring protein (e.g., a chimeric antigen receptor) or to include an exogenous nucleic acid.
  • a non-naturally occurring protein e.g., a chimeric antigen receptor
  • the immune cells may be modified in one or more than one manner.
  • Immune cells may express at least one non-natural molecule that is a receptor for an antigen that is present on the surface of one or more types of cells.
  • immune cells include immune cells (e.g., T cells) that are not found in nature because they are engineered to comprise or express at least one synthetic molecule that is not found in nature.
  • the immune cells are engineered to express at least one chimeric antigen receptor (CAR), including a CAR that targets a specific tumor antigen, such as glypican-3 (GPC3), malignancy variant receptor (MVR), HLA-DR (Human Leukocyte Antigen- D Related), or CD19.
  • CAR chimeric antigen receptor
  • the immune cell can be a T cell, e.g., a CD4 + T cell, a CD8 + T cell, a Treg cell, a Thl T cell, a Th2 T cell, a Thl7 T cell, an unspecific T cell, or a population of T cells that comprises a combination of any of the foregoing.
  • Immune cells e.g., T cells
  • CAR T cells chimeric antigen receptors
  • immune cells expressing CAR(s) for an antigen expressed on a tumor cell can target and kill the tumor cell.
  • CD19-targeted CAR-transduced T cell CD 19-CAR T cell
  • CAR T is attributed, at least in part, to the fusion structure of the CAR, which is made by artificially combining a high-affinity antigen- binding domain with multiple signaling domains (Maus, M. V. et al. (2014) Blood 123: 2625- 2635; van der Stegen, S. J. et al. (2015) Nat. Rev. Drug Discov. 14: 499-509).
  • CARs comprise an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain.
  • the extracellular antigen-binding domain comprises a single chain variable fragment (scFv) that is capable of recognizing a tumor- associated antigen
  • the transmembrane domain employs the transmembrane domain from molecules such as CD8 and CD28
  • the intracellular signaling domain employs an immunoreceptor tyrosine-based activation motif (e.g., CD3 z) and the intracellular signaling domain of co-stimulatory signaling molecule (e.g., CD28 and CD 137 (4- IBB)).
  • single chain variable fragment refers to a fragment of antibody defined as a recombinant protein comprising a heavy chain variable domain (VH) and a light chain variable domain (VL) connected by a linker, which brings the two domains together into association such that an antigen-binding site is formed.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • the transmembrane domain is a transmembrane domain from a protein selected from 4-1BB/CD137, an activating NK cell receptor, an immunoglobulin protein, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD100 (SEMA4D), CD103, CD160 (BY55),
  • the intracellular signaling domain comprises an intracellular signaling domain from a protein selected from 4-1BB/CD137, an activating NK cell receptor, an immunoglobulin protein, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD100 (SEMA4D), CD103, CD 160 (BY55), CD18, CD19, CD19a,CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 delta, CD3epsilon, CD3gamma, CD3zeta, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8,CD8alpha, CD8beta, CD96 (Tactile), CDl la, CDl lb, CDl lc, CD1 Id, CDS, CEACAM1 , CRT AM, a cytokine receptor, DAP- 10, DNAM1 (CD226), Fc gamma receptor
  • the chimeric antigen receptor further comprises an additional antigen-binding domain.
  • the chimeric antigen receptor is a bi-specific CAR (i.e., targeting two antigen binding domains).
  • the chimeric antigen receptor is multivalent (i.e., targeting multiple antigen binding domains).
  • the additional antigen-binding domain is a scFv.
  • the immune cells can come from any source known in the art.
  • immune (e.g., T) cells can be differentiated in vitro from a hematopoietic stem cell population, or immune (e.g., T) cells can be obtained from a subject.
  • T cells can be obtained from peripheral blood mononuclear cells (PBMCs), bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, or tumors.
  • PBMCs peripheral blood mononuclear cells
  • immune (e.g., T) cells can be derived from one or more immune cell lines available in the art.
  • T cells can be obtained from blood collected from a subject using any number of techniques known to the skilled artisan, such as FICOLLTM separation and/or apheresis. Additional methods of isolating T cells for a T cell therapy are disclosed in U.S. Patent Publication No. 2013/0287748. Other non-limiting examples can be found in International Application No. PCT/US2015/014520 (published as WO2015/120096) and in International Application No. PCT/US2016/057983 (published as WO2017/070395), each of which is herein incorporated by reference in its entirety.
  • the immune cells are autologous T cells. In some embodiments, the immune cells are obtained from a subject that is not the patient. In some embodiments, T cells for using in a therapeutic method are syngeneic (the donor and the recipients are different but are identical twins). In some embodiments, T cells for using in a therapeutic method are allogenic (from the same species but different donor) as the recipient subject. In some embodiments, the T cells are autologous stem cells (for autologous stem cell therapy or ASCT). In some embodiments, the immune cells are non-autologous T-cells. In some embodiments, the immune cells are obtained from a healthy donor. In some embodiments, the immune cells are obtained from a patient afflicted with a cancer or a tumor.
  • T cells can be engineered to express, for example, chimeric antigen receptors (CARs).
  • CAR-T cells can be engineered to express an extracellular single chain variable fragment (scFv).
  • scFv extracellular single chain variable fragment
  • the CAR is engineered such that the costimulatory domain is expressed as a separate polypeptide chain.
  • chimeric antigen receptor (CAR) polypeptides refers to a receptor not present in nature and is capable of providing an immune effector cell with a specificity to a particular antigen.
  • a CAR refers to a receptor used for delivering the specificity of a monoclonal antibody agent to a T cell.
  • a CAR comprises an extracellular binding domain (ectodomain), a transmembrane domain, and an intracellular signaling domain
  • costimulatory signals can be provided by incorporating intracellular signaling domains from immune (e.g., T cell) cell costimulatory molecules into the CAR construct.
  • immune e.g., T cell
  • the selection and positioning of co- stimulatory domains within a CAR construct can influence immune (e.g., CAR-T) cell function and fate, and have differential impacts on immune (e.g., CAR-T) cell kinetics, cytotoxic function and potentially safety profile.
  • costimulatory molecules include CD28, ICOS, CD27, 4-1BB/CD137, 0X40, and CD40L.
  • 4-1BB/CD137 is an activation-induced T cell costimulatory molecule, expressed on a subset of resting CD8+ T cells and is upregulated on both CD4+ and CD8+ T cells following activation.
  • T cells expressing CARs that incorporate 4- 1BB/CD137 domains can express granzyme B, IFN-g, TNF-a, GM-CSF and the anti-apoptotic protein Bcl-XL (Zhong et al., Mol. Ther. 2010; 18: 413-420), wherein CARs incorporating a 4- 1BB/CD137 costimulatory domain can show longer CAR-T cell persistence (Zhao et al., Cancer Cell 2015; 28: 415-428).
  • intracellular domain of the chimeric receptors described herein include a 4- IBB signaling domain followed by a five amino acid sequence, which may be further combined with any other desired extracellular, transmembrane, and/or intracellular domain(s) useful in the context of the chimeric receptor.
  • a CAR includes: (a) extracellular domain comprising an antigen binding domain; (b) a transmembrane domain; and (c) an intracellular domain comprising a costimulatory endodomain, wherein the costimulatory endodomain comprises an intracellular signaling domain from 4-1BB/CD137 and five additional amino acids.
  • the CAR construct can include an extracellular domain directed to any desired antigen-binding domain.
  • the costimulatory endodomain includes an intracellular signaling domain from 4-1BB/CD137 and five additional amino acids, wherein the five additional amino acids are encoded by SEQ ID NO: 1.
  • the costimulatory endodomain comprises SEQ ID NO: 2.
  • the co-stimulatory endodomain includes a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2 or 4.
  • an extracellular binding domain of a CAR comprises an antigen binding domain.
  • the antigen-binding domain specifically binds an antigen associated with a disease.
  • the antigen-binding domain specifically binds a tumor antigen.
  • the antigen-binding domain specifically binds to any number of targets, including surface antigens, cytoplasmic, or nuclear antigens.
  • the antigen binding domain can bind to BCMA, CD2, CD3, CD4, CD8, CD10, CD19, CD20, CD22, CD23, CD33, CD38, CD44, CD52, CD70, CD99, CD138, CD123, CD274, ⁇ M- 3, members of the epidermal growth factor receptor family (erbl, erb2, erb3, erb4 and mutants thereof), members of the ephrin receptor family (EphAl-10, EphBl-6), prostate specific antigens (e.g., prostate stem cell antigen PSCA, prostate specific membrane antigen PSMA), embryonic antigens (e.g.
  • CEA carcinoembryonic antigen
  • fetal acethylcholine receptor members of the vascular endotheba growth factor family (VEGFR 1-3), epithelia cell adhesion molecule EpCAM, alphafetoprotein AFP, members of the mucin protein family (e.g. MUC1, MUC16), follicle stimulating hormone receptor (FSHR), the human high molecular weight-melanoma- associated antigen (HMW-MAA), folate binding protein FBP, a-Folate receptor, ligands of the NKG2D receptor, members of the epithelia glycoprotein family (e.g. EGP-2, EGP-4), diasialogangliosides (e.g.
  • the antigen-binding domain can bind to antibodies or fragments thereof that binds to cytoplasmic or nuclear antigens like the La/SSB antigen, members of the Rho family of GTPases, members of the high mobility group proteins and others.
  • the antigen binding domain can bind to the alpha and beta or the gamma and delta chains of a T cell receptor (TCR) or fragments thereof.
  • the antigen binding domain can bind to peptides presented by human leukocyte antigen class (HLA) I and II protein complexes.
  • HLA human leukocyte antigen class
  • examples are, but are not limited to, TCRs specific for peptides derived from proteins like the EGFR family, survivin, srylike high motility group box (SOX) protein family, melanoma-associated antigens (e.g.
  • the antigen binding domain can bind to cytokine receptors (e.g., IL-13 receptor, IL-22 receptor), NKG2D receptors (e.g., ULBP1, ULBP2), EGFR family members, or auto-reactive TCRs.
  • cytokine receptors e.g., IL-13 receptor, IL-22 receptor
  • NKG2D receptors e.g., ULBP1, ULBP2
  • EGFR family members e.g., EGFR family members
  • auto-reactive TCRs e.g., IL-13 receptor, IL-22 receptor
  • the antigen-binding domain can bind to cytokine receptors (e.g., IL-13 receptor, IL-22 receptor), NKG2D receptors (e.g., ULBP1, ULBP2), EGFR family members, or auto-reactive TCRs.
  • the antigen-binding domain bind to cytokine receptors (e.g., IL-13 receptor,
  • an antigen-binding domain is or comprises an antibody agent.
  • an antigen-binding domain is or comprises an antibody agent that specifically binds to GPC3, MVR, HLA-DR, or CD19.
  • the transmembrane domain is a transmembrane domain from a protein selected from 4-1BB/CD137, an activating NK cell receptor, an immunoglobulin protein, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD100 (SEMA4D), CD103, CD160 (BY55),
  • ITGAE ITGAL, ITGAMJTGAX, ITGB2, ITGB7, ITGB1, KIRDS2, LAT, LFA-1, a ligand that specifically binds with CD83, LIGHT, LTBR, Ly9 (CD229), lymphocyte function-associated antigen- 1 (LFA-1), an MHC class 1 molecule, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRFl), OX-40, PAG/Cbp, programmed death-1 (PD-1), PSGL1, SELPLG (CD 162), a Signaling Lymphocytic Activation Molecule (a SLAM protein), SLAM (SLAMFl), SLAMF4 (CD244), SLAMF6 (NTB-A), SLAMF7, SLP-76, a TNF receptor protein, TNFR2, TNFSF14, a Toll ligand receptor, TRANCE/RANKL, VLA1, and VLA-6.
  • the transmembrane domain is a transmembrane domain from CD8a. In some embodiments, the transmembrane domain comprises SEQ ID NO: 5. In some embodiments, the transmembrane domain includes a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 5.
  • the intracellular domain further comprises an intracellular domain from O ⁇ 3z.
  • the intracellular domain comprises SEQ ID NO: 6.
  • the intracellular domain includes a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 6.
  • AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACAAGCAGGGCCAG AACC AGCT CT AT AACGAGCT C AAT CT AGGACGAAGAGAGGAGT ACGATGTTTT GGA CAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCT C AGGAAGGCCT GT AC AATGAACT GC AGAA AGAT AAGAT GGCGGAGGCCT AC AGT GA GATTGGGATGAAAGGCGAGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAG GGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCC
  • the CAR further comprises a T2A self-cleaving peptide. In some embodiments, the CAR further comprises a signal peptide or leader sequence. In some embodiments, the CAR further comprises a CD8a leader sequence. In some embodiments, the CAR further comprises a flag-tag sequence. In some embodiments, the CAR further comprises a hinge region. In some embodiments, the hinge region is a CD8a hinge. In some embodiments, the CAR further comprises SEQ ID NO: 7. In some embodiments, the CAR further comprises SEQ ID NO: 8.
  • the extracellular domain includes a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 7 or 8.
  • Glypican-3 is a cell surface protein encoded by the GPC3 gene in humans and an oncofetal antigen re-expressed in a high frequency of neoplastic hepatocytes (Vidali, et al, 2008, J hepatol 48:399-406).
  • GPC3 is highly expressed in fetal liver and not expressed in normal adult liver tissue, but its expression is reactivated in hepatocellular carcinoma, and has close association with the development of liver cancer, where the detection rate of GPC3 expression is relatively high during early stage of liver cancer and increases along with the development of liver cancer.
  • GPC3 is also expressed in tumors such as melanoma, ovarian clear cell carcinoma, yolk sac tumor, neuroblastoma and other tumors. Considering its specifically high expression in hepatocellular carcinoma, melanoma and other tumors, GPC3 has emerged as a useful immunohistochemical diagnostic test (Anatelli, et al., 2008, Am J Clin Path 130:219-223) and potential biomarker (Aburatani, 2005, J Gastroenterol 40. SI 6: 1-6).
  • GPC3 is a member of the proteoglycan family that functions as extracellular matrix in cell adhesion in organogenesis or as a receptor of a cell growth factor.
  • the protein core of GPC3 comprises two subunits, and N-terminal subunit and a C-terminal subunit.
  • a glycosyl phosphatidylinositol (GPI) anchor is added to serine at position 560 located on the carboxyl (C)- terminal side of GPC3.
  • GPI anchor plays a role in localizing GPC3 on cell surface through covalent binding to cell membrane lipid.
  • HS chain heparan sulfate chain
  • Wnt signal a heparan sulfate chain
  • FGF signal a growth signal transduction pathway
  • BMP signal transduction pathways a growth signal transduction pathway involved is known to differ among the types of cancers. For example, in hepatocellular carcinoma (HCC), cells grow by the stimulation of the Wnt signal pathway.
  • HCC hepatocellular carcinoma
  • an extracellular binding domain of a GPC3 CAR comprises an antigen binding domain.
  • an antigen binding domain is or comprises an antibody agent.
  • an antigen binding domain is or comprises an antibody agent that specifically binds to GPC3.
  • the chimeric antigen receptor (CAR) polypeptide includes: i) an extracellular antigen-binding domain comprising a light chain variable domain comprising a light chain CDR1 comprising SEQ ID NO: 9; a light chain CDR2 comprising SEQ ID NO: 10; and a light chain CDR3 comprising SEQ ID NO: 11 ; and a heavy chain variable domain comprising a heavy chain CDR1 comprising SEQ ID NO: 12; a heavy chain CDR2 comprising SEQ ID NO: 13; and a heavy chain CDR3 comprising SEQ ID NO: 14; ii) a transmembrane domain; and iii) an intracellular signaling domain, which leads to T cell activation when an antigen binds to the antibody agent.
  • an extracellular antigen-binding domain comprising a light chain variable domain comprising a light chain CDR1 comprising SEQ ID NO: 9; a light chain CDR2 comprising SEQ ID NO: 10; and a light chain CDR3 comprising
  • the CAR polypeptide includes: i) an extracellular antigen-binding domain comprising a light chain variable domain comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 15 and a heavy chain variable domain comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 16; ii) a transmembrane domain; and iii) an intracellular signaling domain, which leads to T cell activation when an antigen binds to the antibody agent.
  • the CAR polypeptide includes: i) an extracellular antigen-binding domain comprising a light chain variable domain comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 17 and a heavy chain variable domain comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 18; ii) a transmembrane domain; and iii) an intracellular signaling domain, which leads to T cell activation when an antigen binds to the antibody agent.
  • the CAR polypeptide includes: i) an extracellular antigen-binding domain comprising a light chain variable domain comprising SEQ ID NO: 15 and a heavy chain variable domain comprising SEQ ID NO: 16; ii) a transmembrane domain; and iii) an intracellular signaling domain, which leads to T cell activation when an antigen binds to the antibody agent.
  • HLA-DR Human Leukocyte Antigen-DR
  • TCR T cell receptor
  • HLA-DR The primary function of HLA-DR is to present peptide antigens, potentially foreign in origin, to the immune system for the purpose of eliciting or suppressing T-(helper)-cell responses that eventually lead to the production of antibodies against the same peptide antigen.
  • HLA-DR is an ab heterodimer, cell surface receptor, each subunit of which contains two extracellular domains, a membrane-spanning domain and a cytoplasmic tail. Both a and b chains are anchored in the membrane.
  • the N-terminal domain of the mature protein forms an alpha-helix that constitutes the exposed part of the binding groove, the C-terminal cytoplasmic region interact with the other chain forming a beta-sheet under the binding groove spanning to the cell membrane.
  • the majority of the peptide contact positions are in the first 80 residues of each chain.
  • HLA-DR has restricted expression on antigen presenting cells, e.g., dendritic cells, macrophages, monocytes, and B cells. Increased abundance of HLA-DR‘antigen’ on the cell surface is often in response to stimulation, and, therefore, HLA-DR is also a marker for immune stimulation. Due to the high expression level of HLA-DR in B cell malignancies and the limited expression spectrum on normal cells, antibodies against HLA-DR have been developed and tested for B cell malignancies in preclinical and clinical studies. (Nagy, Z. A., et al. (2002) Nat. Med. 8: 801-807; DeNardo, G.L., et al. (2005) Clin. Cancer Res.
  • the malignancy variant receptor (MVR) antibody agent recognizes a polymorphic region of HLA-DR (described in U.S. Patent Application Publication No. US 2016- 0257762, which is herein incorporated by reference in its entirety).
  • the present disclosure provides, at least in part, MVR CAR polypeptides.
  • a schematic of exemplary MVR CAR constructs in accordance with the present disclosure is shown in FIG. 1.
  • an extracellular domain of a CAR comprises an antigen-binding domain.
  • an antigen-binding domain is or comprises an antibody agent.
  • an antigen binding domain is or comprises an antibody agent that specifically binds to HLA-DR.
  • the CAR polypeptide includes a single-chain variable fragment (scFv) form of an anti-MVR antibody agent.
  • the CAR polypeptide comprises SEQ ID NO: 19.
  • the CAR includes a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 19.
  • the CAR polypeptide includes a single-chain variable fragment (scFv) form of an anti-MVR antibody agent.
  • the CAR polypeptide comprises SEQ ID NO: 20.
  • the CAR includes a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 20.
  • CD 19 is a biomarker for normal and neoplastic B cells, as well as follicular dendritic cells. CD 19 is critically involved in establishing intrinsic B cell signaling thresholds through modulating both B cell receptor-dependent and independent signaling. Furthermore, CD 19 functions as the dominant signaling component of a multimolecular complex on the surface of mature B cells, alongside complement receptor CD21, and the tetraspanin membrane protein CD81 (TAPA-1), as well as CD225, wherein CD19 also plays a critical role in maintaining the balance between humoral, antigen-induced response and tolerance induction.
  • TAPA-1 tetraspanin membrane protein CD81
  • an extracellular domain of a CAR comprises an antigen-binding domain.
  • an antigen-binding domain is or comprises an antibody agent.
  • an antigen-binding domain is or comprises an antibody agent that specifically binds to CD 19.
  • the CAR polypeptide includes a single-chain variable fragment (scFv) form of an anti-CD 19 antibody agent.
  • the CAR polypeptide comprises SEQ ID NO: 21.
  • the CAR includes a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 21.
  • the CAR polypeptide includes a single-chain variable fragment (scFv) form of an anti-CD 19 antibody agent.
  • the CAR polypeptide comprises SEQ ID NO: 22.
  • the CAR includes a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 22.
  • nucleic acid is used to include any compound and/or substance that comprises polynucleotides.
  • exemplary nucleic acids or polynucleotides can include, but are not limited to, ribonucleic acids (RNAs) and/or deoxyribonucleic acids (DNAs).
  • nucleic acid constructs include regions that encode a CAR, wherein the CAR comprises: (a) an extracellular domain comprising an antigen-binding domain; (b) a transmembrane domain; and (c) an intracellular domain comprising an intracellular signaling domain from 4-1BB/CD137 and five additional amino acids.
  • nucleic acid constructs may be inserted into an expression vector or viral vector by methods known to the art, and nucleic acid molecules may be operably linked to an expression control sequence.
  • Non-limiting examples of expression vectors include plasmid vectors, transposon vectors, cosmid vectors, and viral derived vectors (e.g., any adenoviral derived vectors (AV), cytomegaloviral derived (CMV) vectors, simian viral derived (SV40) vectors, adeno-associated virus (AAV) vectors, lentivirus vectors, and retroviral vectors).
  • the expression vector is a viral vector.
  • the viral vector is a lentiviral vector.
  • the expression vector further comprises a promoter operationally linked to the nucleic acid. In some embodiments, the promoter is a constitutive promoter.
  • the promoter is an inducible promoter.
  • the expression vector comprises SEQ ID NO: 23, 24, 25, 26, 27, and/or 28.
  • the expression vector includes a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 23, 24, 25, 26, 27, and/or 28.
  • a lentiviral vector is derived from a lentivirus.
  • Lentiviral vectors are based on the single- stranded RNA lentiviruses, which are a subclass of retrovirus. They combine the advantages of midrange cloning capacity with stable gene expression, wherein they are able to transduce dividing and non-dividing cells, including neurons.
  • the lentiviral genome Upon infection, the lentiviral genome integrates transgenes into the host genome and promotes long-term gene expression.
  • Lentiviral vectors, such as HIV-based vectors are exemplary of retroviral vectors used for gene delivery. Unlike other retroviruses, HIV-based vectors are known to incorporate their passenger genes into non-dividing cells and, therefore, can be of use in treating persistent forms of disease.
  • Additional sequences can be added to such cloning and/or expression sequences to optimize their function in cloning and/or expression, to aid in isolation of the polynucleotide, or to improve the introduction of the polynucleotide into a cell.
  • Use of cloning vectors, expression vectors, adapters, and linkers is well known in the art.
  • nucleic acid molecules are inserted into a vector that is able to express a CAR of the present disclosure when introduced into an engineered immune cell.
  • an engineered immune cell is a T cell.
  • the immune cell where a CAR is introduced therein is a human immune cell.
  • the immune cell is an autologous human immune cell.
  • the immune cell is an allogeneic human immune cell.
  • the immune cell is a CD4 + T cell (helper T cell, TH cell), a CD8 + T cell (cytotoxic T cell, CTL), a memory T cell, a regulatory T cell (Treg cell), an apoptotic T cell, but is not limited thereto.
  • the immune cell is an NK cell.
  • viral infection of an immune cell can comprise transfecting a host cell (e.g., 293T cell, PBMC, Plat-GP cell, or PA317) with the CAR expression vector and a packaging plasmid to prepare recombinant viruses and infecting the immune cell with the recombinant viruses.
  • the viral infection method may be performed by any method known in the art.
  • transfer of the CAR expression vector to the immune cell can be confirmed by examining the expression of the CAR by flow cytometry, Northern blotting, Southern blotting, PCR (e.g, RT-PCR), ELISA, or Western blotting, or examining the expression of a marker gene inserted in the vector.
  • the present disclosure provides methods of producing an engineered immune cell, comprising: introducing into an immune cell (i) a nucleic acid encoding a CAR, wherein the CAR comprises (a) an extracellular domain comprising an antigen-binding domain; (b) a transmembrane domain; and (c) an intracellular domain comprising a
  • costimulatory endodomain wherein the costimulatory endodomain comprises an intracellular signaling domain from 4-1BB/CD137 and five additional amino acids
  • a vector comprising the nucleic acid encoding a CAR, wherein the CAR comprises (a) an extracellular domain comprising an antigen-binding domain; (b) a transmembrane domain; and (c) an intracellular domain comprising a costimulatory endodomain, wherein the costimulatory endodomain comprises an intracellular signaling domain from 4-1BB/CD137 and five additional amino acids.
  • the completed construct comprises an antigen-binding domain, which is an scFv; an EFl-a promoter; a hinge region and a transmembrane domain of human CD8; and an intracellular signaling domain.
  • the intracellular signaling domain comprises a stimulatory domain and a costimulatory signaling domain.
  • the transmembrane domain can include the alpha, beta or zeta chain of the T cell receptor, or one or more of CD28, CD45, CD4, CD5, CD8, CD9, CD 16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 or CD154, but it is not limited thereto.
  • the transmembrane domain includes CD8.
  • intracellular signaling domains include the costimulatory signaling domains in the CD3zeta primary signaling domain, selected from among CD28, 0X40, CD27, ICAM-1, ICOS (CD278), and 4-1BB/CD137.
  • the costimulatory domain comprises 4-1BB to which 5 consecutive amino acids were added.
  • the costimulatory domain is linked to CD3zeta.
  • a method of producing an engineered immune cell of the present disclosure further comprises culturing the engineered immune cell in vitro for at least 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, or 12 days.
  • the method of producing an engineered immune cell further comprises, after the introducing step, culturing the engineered immune cell.
  • the method of producing an engineered immune cell further comprises, before the introducing step, obtaining the immune cell from a subject.
  • Any method known in the art for expressing a CAR in immune cells can be used in the context of the present disclosure.
  • nucleic acid vectors for expression such as linear polynucleotides, polynucleotides to which an ionic or amphiphilic compound is bound, plasmids, or viral vectors, though the present disclosure is not limited thereto.
  • a vector for expression of a CAR in immune cells may be or include an autonomously replicating plasmid or virus or derivative thereof.
  • Viral vectors can include, but are not limited to adenovirus vector, adeno-associated viral vector, retrovirus vector, etc.
  • a lentivirus vector which is a retroviral vector, can be used.
  • a vector is a non-plasmid and a non-viral compound, such as, for example, a liposome.
  • CAR-T cells generated by the methods described herein may be therapeutically useful (e.g., for the treatment of cancer).
  • the method comprises administering to a subject a composition that comprises or delivers an immune cell comprising a CAR.
  • the cancer is an anti- glypican-3 -associated cancer.
  • the cancer is an anti-CD 19-associated cancer.
  • the cancer is an anti-MVR-associated cancer.
  • Cancer can refer to a broad group of diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream. Cancer or cancer tissue may include a tumor.
  • An“anti-glypican-3 -associated cancer” is a cancer that is characterized by a cancer cell having glypican-3 present on its surface.
  • GPC3 a membrane-bound heparan sulfate
  • proteoglycan is overexpressed in approximately 70% to 80% of hepatocellular carcinomas, but is not expressed commonly in healthy tissues.
  • GPC3 overexpression is found in several tumors, such as but not limited to hepatocellular carcinomas, hepatoblastoma, germ cell tumors (e.g., yolk sac tumors, choriocarcionomas), Wilms tumor, gastric carcinoma, non-small lung cancer, and thyroid cancer.
  • An“anti-CD 19-associated cancer” is a cancer that is characterized by CD 19 expression, wherein CD 19 shows an essential role in B cell development and maturation. CD 19 expression is highly conserved on most B cell tumors. It is expressed in most acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL) and B cell lymphomas.
  • ALL acute lymphoblastic leukemia
  • CLL chronic lymphocytic leukemia
  • An“anti-MVR-associated cancer” is characterized by cancer cells with increased expression of HLA-DR antigen relative to a non-cancer cell from a subject.
  • a cancer with higher expression of HLA-DR antigen can include, but are not limited to, bladder cancer, breast cancer, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, fallopian tube cancer, gall bladder cancer, gastrointestinal cancer, head and neck cancer, hematological cancer, laryngeal cancer, liver cancer, lung cancer, lymphoma, melanoma, mesothelioma, ovarian cancer, primary peritoneal cancer, salivary gland cancer, sarcoma, stomach cancer, thyroid cancer, pancreatic cancer, and prostate cancer.
  • diseases associated with HLA-DR expression include, but are not limited to, atypical and/or non-classical cancers, malignancies, precancerous conditions or proliferative diseases expressing HLA-DR, or any combination thereof.
  • a cancer for treatment by a method of the present disclosure can include, but is not limited to, carcinoma, lymphoma (e.g., Hodgkin’s and non-Hodgkin’s lymphomas), blastoma, sarcoma, and leukemia.
  • cancer may include squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung
  • adenocarcinoma squamous cell carcinoma of the lung, peritoneal cancer, hepatocellular carcinoma, gastric cancer, pancreatic cancer, glioma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatocellular carcinoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary carcinoma, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver carcinoma, leukemia and other lymphoproliferative disorders, and various types of head and neck cancer.
  • a cancer suitable for treatment by methods of the present disclosure is a hematologic cancer.
  • a hematologic cancer is a leukemia.
  • a cancer is selected from the group consisting of one or more acute leukemias including but not limited to B-cell acute lymphoid leukemia (“BALL”), T-cell acute lymphoid leukemia (“TALL”), acute lymphoid leukemia (ALL); one or more chronic leukemias including but not limited to chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL); additional hematologic cancers or hematologic conditions including, but not limited to B cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm,
  • Burkitt's lymphoma diffuse large B cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell- or a large cell-follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma, mantle cell lymphoma, Marginal zone lymphoma, multiple myeloma,
  • myelodysplasia and myelodysplastic syndrome myelodysplasia and myelodysplastic syndrome, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom macroglobulinemia, and “preleukemia” which are a diverse collection of hematological conditions united by ineffective production (or dysplasia) of myeloid blood cells.
  • a cancer for treatment by methods of the present disclosure is a B cell lymphoma (i.e., a malignant lymphoma of B cell origin).
  • B cell lymphomas include
  • Hodgkin's lymphoma and non-Hodgkin's lymphoma diffuse large B cell lymphoma (DLBCL), follicular lymphoma, mucosa-associated lymphatic tissue lymphoma (MALT), chronic lymphocytic leukemia, mantle cell lymphoma (MCL), burkitt lymphoma, mediastinal large B cell lymphoma, Waldenstrom macroglobulinemia, nodal marginal zone B cell lymphoma (NMZL), splenic marginal zone lymphoma (SMZL), intravascular large B-cell lymphoma, primary effusion lymphoma, lymphomatoid granulomatosis, and AIDS-related lymphoma, but is not particularly limited thereto as long as it is lymphoma of B cell origin.
  • DLBCL diffuse large B cell lymphoma
  • MALT mucosa-associated lymphatic tissue lymphoma
  • MALT mucosa-associated lymphatic tissue lymphoma
  • the immune cells may be administered at a therapeutically effective amount to a patient in need thereof.
  • a therapeutically effective amount of the immune cells e.g. CAR-T cells
  • a therapeutically effective amount of T cells is about 10 4 cells, about 10 5 cells, about 10 6 cells, about 10 7 cells, or about 10 8 cells.
  • the therapeutically effective amount of the T cells is between about 0.4 10 s and about 2 10 s T cells.
  • the therapeutically effective amount of the T cells is about 0.4/ 10 8 , about 0.5/ 10 8 , about 0.6/10 8 , about 0.7x l0 8 , about 0.8xl0 8 , about 0.9x l0 8 , about l.OxlO 8 , about l. l x lO 8 , about 1.2xl0 8 , about 1.3x l0 8 , about 1.4xl0 8 , about 1.5x l0 8 , about 1.6xl0 8 , about 1.7x l0 8 , about 1.8xl0 8 , about 1.9x l0 8 , or about 2.0x l0 8 T cells.
  • a therapeutically effective amount of the CAR T cells is about 2xl0 6 cells/kg, about 3x l0 6 cells/kg, about 4xl0 6 cells/kg, about 5xl0 6 cells/kg, about 6 c 10 6 cells/kg, about 7 / 10 6 cells/kg, about 8 x 10 6 cells/kg, about 9/ 10 6 cells/kg, about
  • a therapeutically effective amount of immune cells is between about 1 x 10 6 and about 2x 10 6 T cells per kg body weight up to a maximum dose of about l x lO 8 T cells.
  • the therapeutically effective amount of the T cells is about 1 x 10 6 or about 2x 10 6 T cells per kg body weight up to a maximum dose of about l x lO 8 T cells.
  • a population of T cells comprising a CAR will contain greater than 10%, greater than 15%, greater than 20%, greater than 25%, greater than 30%, or greater than 35% of such cells. In some embodiments, a population of T cells comprising a CAR will contain 10% to 50%, 15% to 45%, 20% to 40%, 25% to 35%, or 20% to 30% of such T cells. In some embodiments, a population of T cells for administration is in a volume of a liter or less. In some embodiments, T cells for administration are in a volume of less than 500 ml, less than 250 ml, or 100 ml or less.
  • a density of the desired T cells is typically greater than 10 6 cells/ml and generally is greater than 10 7 cells/ml, generally 10 8 cells/ml or greater.
  • a clinically relevant number of immune cells can be apportioned into multiple infusions that cumulatively equal or exceed 10 7 cells, 10 8 cells, 10 9 cells, 10 10 cells, 10 11 cells, or 10 12 cells.
  • a composition may be administered to a patient parenterally.
  • a composition that comprises or delivers a T cell comprising a CAR may be parenterally administered to a patient in one or multiple administrations.
  • a composition that comprises or delivers a T cell comprising a CAR may be parenterally administered to a patient once every day, once every 2 to 7 days, once every week, once every two weeks, once every month, once every three months, or once every 6 months.
  • the present disclosure provides methods of treating a cancer in a subject in need thereof, the method comprising administering to the subject an engineered immune cell comprising a CAR, wherein the CAR comprises (a) an extracellular domain comprising an antigen-binding domain; (b) a transmembrane domain; and (c) an intracellular domain comprising a costimulatory endodomain, wherein the costimulatory endodomain comprises an intracellular signaling domain from 4-1BB/CD137 and five additional amino acids.
  • the subject has previously been administered one or more additional anticancer therapies selected from the group consisting of: ionizing radiation, a chemotherapeutic agent, a therapeutic antibody, and a checkpoint inhibitor.
  • additional anticancer therapies selected from the group consisting of: ionizing radiation, a chemotherapeutic agent, a therapeutic antibody, and a checkpoint inhibitor.
  • the subject has been identified or diagnosed as having a cancer.
  • compositions that include a T cell comprising a CAR, wherein the CAR comprises (a) an extracellular domain comprising an antigen-binding domain; (b) a transmembrane domain; and (c) an intracellular domain comprising a costimulatory endodomain, wherein the costimulatory endodomain comprises an intracellular signaling domain from 4-1BB/CD137 and five additional amino acids, and a pharmaceutically acceptable carrier.
  • a T cell comprising the CAR is an autologous T cell.
  • a pharmaceutical composition can include a buffer, a diluent, solubilizer, emulsifier, preservative, adjuvant, an excipient, or any combination thereof.
  • a composition if desired, can also contain one or more additional therapeutically active substances.
  • T cells of the present disclosure are formulated by first harvesting them from their culture medium, and then washing and concentrating the cells in a medium and container system suitable for administration (a“pharmaceutically acceptable” carrier) in a treatment-effective amount.
  • Suitable infusion medium can be any isotonic medium formulation, typically normal saline, Normosol R (Abbott) or Plasma-Lyte A (Baxter), but also 5% dextrose in water or Ringer’s lactate can be utilized.
  • the infusion medium can be supplemented with human serum albumin.
  • compositions are formulated for parenteral administration.
  • a pharmaceutical composition provided herein may be provided in a sterile injectable form (e.g., a form that is suitable for subcutaneous injection or intravenous infusion).
  • a pharmaceutical composition is provided in a liquid dosage form that is suitable for injection.
  • a pharmaceutical composition is provided as powders (e.g., lyophilized and/or sterilized), optionally under vacuum, which can be reconstituted with an aqueous diluent (e.g., water, buffer, salt solution, etc.) prior to injection.
  • an aqueous diluent e.g., water, buffer, salt solution, etc.
  • a pharmaceutical composition is diluted and/or reconstituted in water, sodium chloride solution, sodium acetate solution, benzyl alcohol solution, phosphate buffered saline, etc.
  • a powder should be mixed gently with the aqueous diluent (e.g., not shaken).
  • a T cell comprising the CAR and/or a nucleic acid encoding the CAR of the present disclosure is formulated with a pharmaceutically acceptable parenteral vehicle.
  • a pharmaceutically acceptable parenteral vehicle examples include water, saline, Ringer’s solution, dextrose solution, and 1- 10% human serum albumin. Liposomes and nonaqueous vehicles such as fixed oils can also be used.
  • a vehicle or lyophilized powder can contain additives that maintain isotonicity (e.g., sodium chloride, mannitol) and chemical stability (e.g., buffers and preservatives).
  • a formulation is sterilized by known or suitable techniques.
  • a pharmaceutical composition may additionally comprise a pharmaceutically acceptable excipient, which, as used herein, includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired.
  • a pharmaceutically acceptable excipient includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired.
  • Remington s The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006) discloses various excipients used in formulating pharmaceutical compositions and known
  • a composition including a population of T cells comprising the CAR and/or a nucleic acid encoding the CAR of the present disclosure is stably formulated.
  • a stable formulation of a population of T cells comprising the CAR and/or a nucleic acid encoding the CAR of the present disclosure may comprise a phosphate buffer with saline or a chosen salt, as well as preserved solutions and formulations containing a preservative as well as multi-use preserved formulations suitable for pharmaceutical or veterinary use.
  • Preserved formulations contain at least one known preservative or optionally selected from the group consisting of at least one phenol, m-cresol, pcresol, o-cresol, chlorocresol, benzyl alcohol, phenylmercuric nitrite, phenoxyethanol, formaldehyde, chlorobutanol, magnesium chloride (e.g., hexahydrate), alkylparaben (methyl, ethyl, propyl, butyl and the like), benzalkonium chloride, benzethonium chloride, sodium dehydroacetate and thimerosal, or mixtures thereof in an aqueous diluent. Any suitable concentration or mixture can be used as known in the art, such as 0.001-5%, or any range or value therein, such as, but not limited to 0.001, 0.003, 0.005, 0.009,
  • Non-limiting examples include, no preservative, 0.1-2% m-cresol (e.g., 0.2, 0.3.
  • benzyl alcohol e.g., 0.5, 0.9, 1.1, 1.5, 1.9, 2.0, 2.5%), 0.001-0.5% thimerosal (e.g., 0.005, 0.01), 0.001-2.0% phenol (e.g., 0.05, 0.25, 0.28, 0.5, 0.9, 1.0%), 0.0005-1.0% alkylparaben(s) (e.g., 0.00075, 0.0009,
  • a pharmaceutical composition is provided in a form that can be refrigerated and/or frozen. In some embodiments, a pharmaceutical composition is provided in a form that cannot be refrigerated and/or frozen.
  • reconstituted solutions and/or liquid dosage forms may be stored for a certain period of time after reconstitution (e.g., 2 hours, 12 hours, 24 hours, 2 days, 5 days, 7 days, 10 days, 2 weeks, a month, two months, or longer). In some embodiments, storage of compositions including an antibody agent for longer than the specified time results in degradation of the antibody agent.
  • Liquid dosage forms and/or reconstituted solutions may comprise particulate matter and/or discoloration prior to
  • a solution should not be used if discolored or cloudy and/or if particulate matter remains after filtration.
  • General considerations in the formulation and/or manufacture of pharmaceutical agents may be found, for example, in Remington: The Science and Practice of Pharmacy 21 st ed., Lippincott Williams & Wilkins, 2005.
  • a pharmaceutical composition including a T cell comprising the CAR and/or a nucleic acid encoding the CAR of the present disclosure can be included in a container for storage or administration, for example, an vial, a syringe (e.g., an IV syringe), or a bag (e.g., an IV bag).
  • a pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses.
  • a“unit dose” is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient.
  • the amount of the active ingredient is generally equal to the dosage of the active ingredient that would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
  • kits comprising one or more containers filled with at least one CAR and/or a nucleic acid encoding a CAR as described herein.
  • Kits may be used in any applicable method, including, for example, therapeutic methods, diagnostic methods, cell proliferation and/or isolation methods, etc.
  • Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects (a) approval by the agency of manufacture, use or sale for human administration, (b) directions for use, or both.
  • a kit may include one or more reagents for detection (e.g., detection of a CAR and/or a nucleic acid encoding a CAR.
  • a kit may include a CAR and/or a nucleic acid encoding a CAR in a detectable form (e.g., covalently associated with detectable moiety or entity).
  • one or more CARs and/or nucleic acids encoding a CAR as provided herein may be included in a kit used for treatment of subjects.
  • a CAR and/or a nucleic acid encoding a CAR as provided herein may be included in a kit used for preparing an autologous T cell expressing the CAR.
  • a kit may provide one, two, three, four or more antigen specific antibody agents, where each is suitable for cloning into a CAR construct.
  • a kit may provide other reagents for assaying binding affinity of an antibody agent and/or CAR and/or a CAR T cell for a T cell identified or isolated from a subject.
  • a kit may provide other reagents for assaying functional avidity of an antibody agent and/or CAR and/or a CAR T cell for a T cell of a subject.
  • a DNA construct encoding a single-chain variable fragment (scFv) form (FIG. 2) of a humanized anti-GC33 antibody agent was generated by connecting the VH and VL regions, using standard DNA cloning techniques known to the art.
  • the lentiviral transfer plasmid used herein is shown in Table 1.
  • the huGC33 VH-VL-scFv was cloned into a lentiviral vector, pELPS4-MVRL2H2- euBBz, wherein pELPS4-MVRL2H2-euBBz is a lentiviral vector including a costimulatory domain 4-1BB with five additional amino acids.
  • the lentivirus vector construct, pELPS4- huGC33 VH-VL was digested with restriction enzymes, wherein restriction enzyme digestion results are shown in FIG. 3.
  • the huGC33 VH-VL-scFv was cloned into a lentiviral vector, pELPS2- CD19-BBz, wherein pELPS2-CD19-BBz is a lentiviral vector including a costimulatory domain 4-1BB without five additional amino acids.
  • the lentivirus vector construct, huGC33(VH-VL)- BBz was digested with restriction enzymes, wherein restriction enzyme digestion results are shown in FIG. 4.
  • PBMCs were thawed and activated by placing the PBMC cryovials (5x10 7 cells/1 mL/vial) in a water bath for 2-3 minutes. 10 mL CAR-T cell culture media and 1 mL PBMC was placed in a 50 mL conical tube and centrifuged at 1500 rpm for 5 minutes. The supernatant was removed and the CAR-T cells were counted after resuspending the cells in 5 mL in fresh media. Fresh cell media was added to adjust the cell density to be lxlO 6 cells/mL. 10 pL of T cell activation bead was added for every lxlO 6 cells and IL-2 was supplemented to the media. The cell culture medium was cultured in a T75 flask at CO2 5% and 37°C in an incubator.
  • CAR-T cells were then generated by spinoculation of activated T cells with CAR- encoding lentivirus.
  • Activated PBMCs were counted from the cell culture and the cells were seeded in a 24 well plate in the presence of 500 pL cell media with lentivirus.
  • the transduced cells from 1 well were cultured in cell culture media supplemented with IL-2.
  • the cultured CAR-T cells were counted every 2-3 days, and fresh culture media and IL-2 was added after each counting (FIG. 5). On day 12, the cultured CAR-T cells were harvested and stored at -80° C in a freezing container.
  • Target cells GPC3 positive cell line
  • Effector cells CAR-T cells
  • Target cell ratios 10: 1, 3: 1, 1 : 1, 0.3: 1 and incubated for 24 hours at 37°C. After incubation, CytoTox96 Reagent was added to each well, and cytotoxicity was quantified by measuring absorbance at 490 nm (FIG. 7).
  • Huh-7_Luf-GFP cells (2 x 10 6 cells/200pL/head) were injected into NSG mice (6-8 weeks old, male) and after 35 days post injection, the mice with a tumor size of about 200mm 3 were separated into 5 groups, each group of 4 mice.
  • the control group received injections of 5% HSA and other groups received injections with the CAR-T cells. Growth of the tumor was observed by measuring tumor size twice a week, using TM900 (FIG.
  • Counting beads 25 pL, CD45 0.5 pL, CD8 0.5 pL, CD45RO 1.0 pL, CD62L 1.0 pL, PD-1 1.0 pL, Tim-3 1.0 pL, CD4 0.5 pL, CD69 0.5 pL, and Flag 0.0125 pL were added to FACS buffer 100 pL and stained at room temperature for 30 minutes. After 30 minutes, IX RBC lysis buffer was added and reacted at room temperature for 5 minutes. After centrifugation for 4 minutes at 2,000 rpm, all supernatant was discarded. 2 mL of FACS buffer was added to the tubes and centrifugation was performed for 4 minutes at 2,000 rpm, and analysis was performed using FACSCelesta (FIG. 9).
  • mice spleen, liver and bone marrow were harvested to evaluate the ratio of huGC33(VH-VL)-BBz CAR-T cells and huGC33(VH-VL)-euBBz CAR-T cells.
  • Tissue samples were processed and filtered through a 40 pm cell strainer, then centrifuged at 2,000 rpm for 5 minutes and all supernatant was discarded.
  • 5 pL IX ACK buffer was added and reacted for 10 minutes.
  • 10 mL DPBS was added and centrifuged at 2,000 rpm for 5 minutes. FACS staining was performed as described above (FIG. 10).
  • the completed construct comprises an anti-CD 19, which is an scFv, including the EF1 alpha promoter, a hinge region and a transmembrane domain of human CD8, and an intracellular signaling domain.
  • the intracellular signaling domain consists of a stimulatory domain and a co stimulatory signaling domain.
  • the intracellular signaling domain is 4- IBB, a co-stimulatory signal domain to which 5 consecutive amino acids were added, to which CD3 zeta was linked.
  • the CAR gene fragment ultimately produced was conjugated to ELPS lentiviral expression vectors cleaved with BamH I and Sal I. In addition, cloning was performed using BarnH I / Nhe I restriction enzyme to replace only the scFv part.
  • the 293 T cell culture used for the production of recombinant lentiviruses contains medium comprising 10% FBS (Millipore, TMS-013-BKR) and 1 x P/S (Gibco, 15140-122) in high glucose DMEM (Welgene, LM001-05).
  • 293T cells were incubated in DMEM medium comprising 10% FBS for 24 hours prior to transduction in a 37°C 5% C02 incubator. The next day, for transfection, the transfection reagent and lentiviral plasmids were mixed at an appropriate proportion and incubated for 48 hours. The supernatant containing the lentivirus was then collected and centrifuged at 400 x g for 10 minutes.
  • the supernatant was filtered with a 0.45 pm syringe filter using a 50 mL syringe.
  • the obtained supernatant was mixed 3: 1 with a lentiviral enrichment kit (Clontech, 631231), and reacted at 4°C for 24 to 48 hours. This was followed by centrifugation for 2 hours at 4°C and 4,000 rpm to obtain a virus, which was resuspended in 0.5 mL RPMI (Welgene, LMOOl-Ol) not comprising FBS to produce a lentivirus.
  • Transformation Units were measured by analyzing the particle count of the actual transduction-capable lentiviruses using Jurkat cells. CAR expression can be assayed by FACS. On the first day, Jurkat cells were seeded in 96-well plates at 1 x 10 5 cells/100 pL per well. On the second day, the lentivirus was serially diluted by 1/3 in 96-well plates, and the lentiviral transduction was performed on the already seeded Jurkat cells. At this time, by introducing polybrene (Millipore) into RPMI medium (10% FBS and lx P/S), transduction of lentivirus was further increased.
  • polybrene Millipore
  • the cells were incubated for 3 hours in a 37°C 5% CO2 incubator, and only 100 pL of RPMI only was added per well.
  • the flag of the lentivirus infected into the cell was stained with anti-Flag-DYKDDDDK (Biolegend, Cat No. 637310) to analyze the percentage of cells transduced with a flow cytometer.
  • the titer was calculated as described in Follenzi and Naldini, 2002 (Follenzi and Naldini, 2002).
  • FACS staining was performed to confirm the production proportion of the two species of CAR-T cells after 14 days of incubation.
  • 2 x 10 5 cells were collected in FACS tubes (FALCON, Cat. No. 352052), and then 2 mL of FACS buffer was added and centrifugation was performed for 5 minutes at 2,000 rpm using a centrifuge (Thermo, ST16). After discarding the supernatant, 0.5 pL/tube anti-CD8 APC (SKI, Biolegend, Cat.No. 344722), 0.5 pL/tube anti-CD4 BV650 (RPA-T4, Biolegend, Cat. No.
  • CD4+/CAR+ 29.3% for CD8+/CAR+, and 72.0% for total CAR-T. Accordingly, it was confirmed that CD19-euBBz CAR-T cells had 8.2% higher expression of CAR than CD19-BBz CAR-T cells, and the CD8+/CAR+ cell was 21.5%, or about 2 times as many.
  • FIG. 11A shows that
  • CAR-T (E): LCL (T) proportion was brought to 30: 1, 10: 1, 3: 1, and 1 : 1 in 96-well white plates (Corning, Cat. No. 3917).
  • CAR-T cells were placed in wells at 6 x 10 5 cells / 50 pL, 2 x 10 5 cells / 50 pL, 9 x 10 4 cells / 50 pL, and 2 x 10 4 cells / 50 pL, respectively.
  • the target cell line namely the CBK LCL-Luc cell line
  • the target cell line was added to 2 x 10 4 cells/50 pL in a 37°C CO2 incubator (Mammert, INC0153med) and reacted for 4 hours.
  • 100 pL of Bright- GloTM (Promega, Cat. No. E2620) was added to each well, and 5 minutes later, the relative light unit (RLU) value was measured using Luminometer (Thermo, Fluoroskan FL).
  • Example 7 Induction of subcutaneous animal models and validation of CAR-T through automatic caliper and IVIS imaging
  • NSG NOD-scid IL2rypLl mice
  • CBK LCL-Luc cell lines were prepared at 2 x 10 6 cells/100 pL DPBS/head and injected subcutaneously in 6-week-old female mice to induce a subcutaneous animal model.
  • cancer size and photon values were measured using automatic calipers and IVIS imaging equipment (PerkinElmer, Luna III), at 3 and 4-day intervals after CAR-T administration (FIG. 12, 13).
  • TM900 the cancer size was determined after placing the equipment at the cancer site.
  • 150 mg/kg XenoLightTM D-luciferin PerkinElmer, Cat. No. 122799 was first administered intraperitoneally in mice. After 15 minutes, inhalation anesthesia was induced using isoflurane, and 5 minutes later, IVIS was used for imaging the presence of cancer cells.
  • CAR-T cell administration in a subcutaneous animal model to verify the potency of the improved-construct CAR-T cells the presence of CAR-T was confirmed from mouse blood. More specifically, orbital blood collection was performed from mice at 3 and 4-day intervals after CAR-T administration. At a time of each blood collection, 70 pL of blood was collected and 60 pL of the blood was used to confirm the proportion of the CAR-T cells and the cell count. 60 pL blood was placed in a 5 mL FACS tube, and live/dead cell staining was performed using Zombie Aqua BV510 (Biolegend, Cat. No. 423101).
  • anti-CD8 BV786 (SK-1, Biolegend, Cat. No. 344740), anti-CD4 BV650 and anti-flag PE were added and stained at room temperature for 30 minutes.
  • Each antibody was mixed in at 0.5 pL/100 pL FACS buffer/tube, and 25 pL of counting beads were added thereto.
  • 2 mL of IX RBC lysis buffer (Biolegend, Cat. No. 422401) was added and reacted at room temperature for 5 minutes. After centrifugation for 5 minutes at 2,000 rpm using a centrifuge, all supernatant was discarded. 2 mL of FACS wash buffer was added to this tube and centrifugation was performed for 5 min at 2,000 rpm. This process was repeated one more time, and then 50 pL of FACS buffer was added and analyzed using FACS.
  • CD19-euBBz CAR-T treatment group approximately 20% CD19-euBBz CAR-T cells were confirmed in the blood in both the 2xl0 6 cells/100 pL DPBS/head and 6 10 6 cells/100 pL DPBS/head groups; but in the CD19-BBz CAR-T-administered group, when 6 x 10 6 cells/100 pL DPBS/head was administered only 5% CD 19 CAR-T was confirmed. 3 days later, the number and proportion of CAR-T cells in the mouse body reached a maximum and decreased.
  • CD19-BBz CAR-T the proportion and number of CAR-T cells reached a maximum at 2 weeks, and the CAR-T proportion was about 25% with cancer cells proliferating relatively well.
  • the CD19-euBBz CAR-T was more stable in quantity than the CD19-BBz CAR-T, after the CAR-T proportion initially increased and later decreased.
  • the proportion of CAR-T cells increased and decreased at a later time, and consequently it took longer for the tumor to disappear in the mouse body.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hematology (AREA)
  • Toxicology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Developmental Biology & Embryology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/IB2020/056097 2019-06-27 2020-06-26 Chimeric antigen receptor with 4-1bb costimulatory domain Ceased WO2020261231A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
JP2021576820A JP7829911B2 (ja) 2019-06-27 2020-06-26 4-1bb共刺激性ドメインを有するキメラ抗原受容体
AU2020307673A AU2020307673A1 (en) 2019-06-27 2020-06-26 Chimeric antigen receptor with 4-1BB costimulatory domain
US17/622,503 US20220249565A1 (en) 2019-06-27 2020-06-26 Chimeric antigen receptor with 4-ibb costimulatory domain
KR1020227001944A KR102957801B1 (ko) 2019-06-27 2020-06-26 4-1bb 공동자극 도메인을 갖는 키메라 항원 수용체
CA3144875A CA3144875A1 (en) 2019-06-27 2020-06-26 Chimeric antigen receptor with 4-1bb costimulatory domain
EP20831651.3A EP3990626A4 (en) 2019-06-27 2020-06-26 CHIMERIC ANTIGEN RECEPTOR WITH A 4-1BB COSTIMULATION DOMAIN
CN202080047355.XA CN114080452B (zh) 2019-06-27 2020-06-26 具有4-1bb共刺激结构域的嵌合抗原受体
CN202411914064.2A CN119955732A (zh) 2019-06-27 2020-06-26 具有4-1bb共刺激结构域的嵌合抗原受体
BR112021026406A BR112021026406A2 (pt) 2019-06-27 2020-06-26 Receptor de antígeno quimérico com domínio coes-tumulatório 4-1bb
MX2021015967A MX2021015967A (es) 2019-06-27 2020-06-26 Receptor de antigeno quimerico con dominio coestimulador 4-1bb.
JP2025076601A JP2025118764A (ja) 2019-06-27 2025-05-02 4-1bb共刺激性ドメインを有するキメラ抗原受容体

Applications Claiming Priority (12)

Application Number Priority Date Filing Date Title
US201962867503P 2019-06-27 2019-06-27
US62/867,503 2019-06-27
PCT/KR2019/010244 WO2020032784A1 (ko) 2018-08-10 2019-08-12 Hla-dr에 결합하는 키메라 항원 수용체 및 car-t 세포
KRPCT/KR2019/010244 2019-08-12
US16/715,462 US11013765B2 (en) 2018-08-10 2019-12-16 Chimeric antigen receptor that binds HLA-DR and CAR-T cell
US16/715,462 2019-12-16
US202062991493P 2020-03-18 2020-03-18
US62/991,493 2020-03-18
US202063004827P 2020-04-03 2020-04-03
US63/004,827 2020-04-03
US202063043237P 2020-06-24 2020-06-24
US63/043,237 2020-06-24

Publications (1)

Publication Number Publication Date
WO2020261231A1 true WO2020261231A1 (en) 2020-12-30

Family

ID=74061779

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2020/056097 Ceased WO2020261231A1 (en) 2019-06-27 2020-06-26 Chimeric antigen receptor with 4-1bb costimulatory domain

Country Status (8)

Country Link
EP (1) EP3990626A4 (cg-RX-API-DMAC7.html)
JP (2) JP7829911B2 (cg-RX-API-DMAC7.html)
CN (2) CN114080452B (cg-RX-API-DMAC7.html)
AU (1) AU2020307673A1 (cg-RX-API-DMAC7.html)
BR (1) BR112021026406A2 (cg-RX-API-DMAC7.html)
CA (1) CA3144875A1 (cg-RX-API-DMAC7.html)
MX (1) MX2021015967A (cg-RX-API-DMAC7.html)
WO (1) WO2020261231A1 (cg-RX-API-DMAC7.html)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3835320A4 (en) * 2018-08-10 2022-06-01 Eutilex Co., Ltd. Chimeric antigen receptor binding to hla-dr, and car-t cell
WO2022186682A1 (ko) * 2021-03-03 2022-09-09 주식회사 이뮤노로지컬디자이닝랩 Rank 리간드(rank ligand)에 특이적으로 결합하는 키메릭 항원 수용체 및 이의 용도
US12005081B2 (en) 2019-04-30 2024-06-11 Senti Biosciences, Inc. Chimeric receptors and methods of use thereof
WO2025103439A1 (zh) * 2023-11-16 2025-05-22 广州瑞风生物科技有限公司 一种嵌合抗原受体及其应用
EP4493201A4 (en) * 2022-03-15 2026-03-11 New York Genome Center Inc PROCESSES AND COMPOSITIONS COMPRISING FUSION PROTEINS FOR ENHANCED IMMUNOTHERAPIES

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005044996A2 (en) * 2003-11-05 2005-05-19 St Jude Children's Research Hospital Chimeric receptors with 4-1bb stimulatory signaling domain
WO2017062820A1 (en) * 2015-10-09 2017-04-13 Miltenyi Biotec Technology, Inc. Chimeric antigen receptors and methods of use
US10150816B2 (en) * 2012-12-20 2018-12-11 Celgene Corporation Chimeric antigen receptors
US20180355052A1 (en) * 2017-07-31 2018-12-13 Lentigen Technology, Inc. Compositions and methods for treating cancer with anti-cd19/cd20 immunotherapy
US10195272B2 (en) * 2015-03-02 2019-02-05 The Nemours Foundation Adoptive t-cell therapy using FcεRI-based chimeric antigen receptors for treating IgE-mediated allergic diseases

Family Cites Families (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4331227B2 (ja) * 2004-07-09 2009-09-16 中外製薬株式会社 抗グリピカン3抗体
US9790282B2 (en) 2013-03-25 2017-10-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-CD276 polypeptides, proteins, and chimeric antigen receptors
WO2015069922A2 (en) * 2013-11-06 2015-05-14 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Alk antibodies, conjugates, and chimeric antigen receptors, and their use
KR101605421B1 (ko) * 2014-03-05 2016-03-23 국립암센터 B 세포 림프종 세포를 특이적으로 인지하는 단일클론항체 및 이의 용도
ES2836743T3 (es) * 2014-06-02 2021-06-28 Us Health Receptores de antígeno quiméricos que seleccionan como diana CD-19
WO2016197064A1 (en) * 2015-06-04 2016-12-08 Epstein Alan L Lym-1 and lym-2 targeted car cell immunotherapy
CN105906720A (zh) 2016-05-16 2016-08-31 武汉汉密顿生物科技股份有限公司 靶向性嵌合抗原受体修饰的免疫细胞及其制备方法和应用
CN106279438B (zh) * 2016-08-24 2019-10-22 北京领柯生物科技有限公司 新型嵌合抗原受体及其用途
CN108165568B (zh) * 2016-12-07 2020-12-08 上海恒润达生生物科技有限公司 一种培养CD19CAR-iNKT细胞方法及用途
WO2018106993A1 (en) * 2016-12-09 2018-06-14 H. Lee Moffitt Cancer Center And Research Institute Inc. Tlr9-binding chimeric antigen receptors
CA3048648A1 (en) 2017-01-10 2018-07-19 The General Hospital Corporation T cells expressing a chimeric antigen receptor
WO2018154386A1 (en) * 2017-02-21 2018-08-30 Eutilex Co., Ltd. Hla-dr car-t compositions and methods of making and using the same
US12083148B2 (en) * 2017-02-22 2024-09-10 H. Lee Moffitt Cancer Center And Research Institute, Inc. IL13Ra2-binding chimeric antigen receptors
CN108728459B (zh) 2017-04-24 2023-08-04 上海恒润达生生物科技股份有限公司 靶向cd19的嵌合抗原受体并联合表达il-15的方法和用途
WO2018236909A1 (en) * 2017-06-20 2018-12-27 La Jolla Institute For Allergy And Immunology Engineered t-cell receptors and methods of their use in modulating inflammatory responses and treating atherosclerosis
CN108715859B (zh) * 2018-05-31 2021-08-03 中国医学科学院血液病医院(中国医学科学院血液学研究所) 靶向cd22的嵌合抗原受体及其应用
WO2020017479A1 (ja) 2018-07-17 2020-01-23 ノイルイミューン・バイオテック株式会社 抗gpc3一本鎖抗体を含むcar

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005044996A2 (en) * 2003-11-05 2005-05-19 St Jude Children's Research Hospital Chimeric receptors with 4-1bb stimulatory signaling domain
US10150816B2 (en) * 2012-12-20 2018-12-11 Celgene Corporation Chimeric antigen receptors
US10195272B2 (en) * 2015-03-02 2019-02-05 The Nemours Foundation Adoptive t-cell therapy using FcεRI-based chimeric antigen receptors for treating IgE-mediated allergic diseases
WO2017062820A1 (en) * 2015-10-09 2017-04-13 Miltenyi Biotec Technology, Inc. Chimeric antigen receptors and methods of use
US20180355052A1 (en) * 2017-07-31 2018-12-13 Lentigen Technology, Inc. Compositions and methods for treating cancer with anti-cd19/cd20 immunotherapy

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NCBI, GenBank Accession No. U03397.1, `Human receptor protein 4-1BB mRNA, complete cds`, 1994.11.27 the whole document *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3835320A4 (en) * 2018-08-10 2022-06-01 Eutilex Co., Ltd. Chimeric antigen receptor binding to hla-dr, and car-t cell
US12005081B2 (en) 2019-04-30 2024-06-11 Senti Biosciences, Inc. Chimeric receptors and methods of use thereof
WO2022186682A1 (ko) * 2021-03-03 2022-09-09 주식회사 이뮤노로지컬디자이닝랩 Rank 리간드(rank ligand)에 특이적으로 결합하는 키메릭 항원 수용체 및 이의 용도
EP4493201A4 (en) * 2022-03-15 2026-03-11 New York Genome Center Inc PROCESSES AND COMPOSITIONS COMPRISING FUSION PROTEINS FOR ENHANCED IMMUNOTHERAPIES
WO2025103439A1 (zh) * 2023-11-16 2025-05-22 广州瑞风生物科技有限公司 一种嵌合抗原受体及其应用

Also Published As

Publication number Publication date
CN114080452B (zh) 2025-06-03
MX2021015967A (es) 2022-04-06
EP3990626A1 (en) 2022-05-04
CA3144875A1 (en) 2020-12-30
JP2025118764A (ja) 2025-08-13
KR20220030248A (ko) 2022-03-10
CN114080452A (zh) 2022-02-22
CN119955732A (zh) 2025-05-09
JP7829911B2 (ja) 2026-03-16
EP3990626A4 (en) 2023-09-20
JP2022538425A (ja) 2022-09-02
BR112021026406A2 (pt) 2022-04-12
AU2020307673A1 (en) 2022-01-20

Similar Documents

Publication Publication Date Title
CN114080452B (zh) 具有4-1bb共刺激结构域的嵌合抗原受体
IL296411A (en) Novel antigen binding domains and synthetic antigen receptors incorporating them
JP2020513839A (ja) Tim−1を標的とするキメラ抗原受容体
CN110267677A (zh) 使用与原m2巨噬细胞分子抑制剂组合的嵌合抗原受体治疗癌症
EP3558348A1 (en) Engineered t cells for the treatment of cancer
US20230146706A1 (en) Gpc3 car- t cell compositions and methods of making and using the same
TW202432833A (zh) 新穎cd19結合體、包含彼之car—t構築體及其使用方法
EP4502159A1 (en) Engineered immune cell with ciita gene knock-out and use thereof
US20250319184A1 (en) Chimeric, transmembrane proteins with bidirectional signalling activity
TW202340474A (zh) 樹突細胞腫瘤疫苗和其用途
US20240131068A1 (en) Car-t constructs comprising a novel cd19 binder combined with il18 and methods of using the same
JP7778081B2 (ja) Il-18を分泌するgpc3 car-t細胞、並びにそれを作製する方法及び使用する方法
US20260014199A1 (en) Modified immune cells
US20220249565A1 (en) Chimeric antigen receptor with 4-ibb costimulatory domain
KR102957801B1 (ko) 4-1bb 공동자극 도메인을 갖는 키메라 항원 수용체
RU2830540C2 (ru) Химерный антигенный рецептор с костимулирующим доменом 4-1bb
HK40122793A (zh) 具有4-1bb共刺激结构域的嵌合抗原受体
KR102957804B1 (ko) Gpc3 car-t 세포 조성물 및 이의 제조 및 사용 방법
HK40066497B (zh) 具有4-1bb共刺激结构域的嵌合抗原受体
HK40066497A (zh) 具有4-1bb共刺激结构域的嵌合抗原受体

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20831651

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3144875

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021576820

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112021026406

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 20227001944

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020307673

Country of ref document: AU

Date of ref document: 20200626

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020831651

Country of ref document: EP

Effective date: 20220127

ENP Entry into the national phase

Ref document number: 112021026406

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20211224

WWG Wipo information: grant in national office

Ref document number: 202080047355.X

Country of ref document: CN

WWR Wipo information: refused in national office

Ref document number: 1020227001944

Country of ref document: KR

WWR Wipo information: refused in national office

Ref document number: 1020227001944

Country of ref document: KR

WWC Wipo information: continuation of processing after refusal or withdrawal

Ref document number: 1020227001944

Country of ref document: KR