WO2020256380A1 - 카르본 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물 - Google Patents
카르본 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물 Download PDFInfo
- Publication number
- WO2020256380A1 WO2020256380A1 PCT/KR2020/007779 KR2020007779W WO2020256380A1 WO 2020256380 A1 WO2020256380 A1 WO 2020256380A1 KR 2020007779 W KR2020007779 W KR 2020007779W WO 2020256380 A1 WO2020256380 A1 WO 2020256380A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- composition
- active ingredient
- carvone
- skin
- present
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/12—Ketones
- A61K31/122—Ketones having the oxygen directly attached to a ring, e.g. quinones, vitamin K1, anthralin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/02—Cosmetics or similar toiletry preparations characterised by special physical form
- A61K8/0216—Solid or semisolid forms
- A61K8/022—Powders; Compacted Powders
- A61K8/0225—Granulated powders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/02—Cosmetics or similar toiletry preparations characterised by special physical form
- A61K8/11—Encapsulated compositions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/33—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
- A61K8/35—Ketones, e.g. benzophenone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
- A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
- A23V2200/00—Function of food ingredients
- A23V2200/30—Foods, ingredients or supplements having a functional effect on health
- A23V2200/318—Foods, ingredients or supplements having a functional effect on health having an effect on skin health and hair or coat
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
- A23V2250/00—Food ingredients
- A23V2250/30—Other Organic compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/74—Biological properties of particular ingredients
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/74—Biological properties of particular ingredients
- A61K2800/78—Enzyme modulators, e.g. Enzyme agonists
- A61K2800/782—Enzyme inhibitors; Enzyme antagonists
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/80—Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
- A61K2800/92—Oral administration
Definitions
- the present invention relates to a skin whitening composition
- a skin whitening composition comprising carbon (carvone) or a salt thereof as an active ingredient, and more particularly, by including carvone or a salt thereof as an active ingredient, excellent melanin production inhibitory effect can be implemented. It relates to a composition for skin whitening.
- melanin Human skin color is determined by the amount of melanin, carotene and hemoglobin, among which melanin acts as a major factor in determining skin color. It is known that melanin is produced in melanocytes existing in the epidermis of the skin and then migrates to surrounding keratinocytes to show skin color. In addition, melanin protects the skin by preventing skin damage caused by ultraviolet rays and removing reactive oxygen species (ROS). However, it is known that chronic UV exposure promotes the production of melanin in melanocytes and causes pigmentation.
- ROS reactive oxygen species
- ⁇ -MSH melanocortin 1 receptor
- M1R melanocortin 1 receptor
- MITF microphthalmia transcription factor
- the present inventors as a result of conducting research on a substance having excellent skin whitening effect, confirmed that the effect of inhibiting melanogenesis of carvone or a salt thereof was excellent, and completed the present invention.
- Patent Literature Korean Patent Publication No. 10-2018-0117252
- Another object of the present invention relates to a health functional food composition for skin whitening, comprising as an active ingredient carvone or a food pharmaceutically acceptable salt thereof.
- Another object of the present invention relates to a pharmaceutical composition for the prevention or treatment of skin pigmentation comprising as an active ingredient carvone or a pharmaceutically acceptable salt thereof.
- Another object of the present invention relates to a quasi-drug composition for preventing or improving skin pigmentation, including carvone or a pharmaceutically acceptable salt thereof as an active ingredient.
- the present invention provides a cosmetic composition for skin whitening comprising, as an active ingredient, carvone or a cosmetically acceptable salt thereof.
- the active ingredient may inhibit the expression of microphthalmia transcription factor (MITF) or tyrosinase.
- MITF microphthalmia transcription factor
- tyrosinase tyrosinase
- the active ingredient may inhibit melanin production induced by melanocyte-Stimulating Hormone ( ⁇ -MSH).
- ⁇ -MSH melanocyte-Stimulating Hormone
- the composition is skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, essence, pack, mask pack, mask sheet, dead skin cell remover, It can be prepared in any one formulation selected from the group consisting of soap, shampoo, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, emulsion, press powder, loose powder, and eye shadow.
- the active ingredient may be included in 0.0001 to 20% by weight based on the total weight of the cosmetic composition.
- the present invention provides a health functional food composition for skin whitening comprising carvone or a food pharmaceutically acceptable salt thereof as an active ingredient.
- composition may be prepared in any one formulation selected from the group consisting of tablets, granules, powders, capsules, liquid solutions, and pills.
- the present invention provides a pharmaceutical composition for preventing or treating skin pigmentation comprising carvone or a pharmaceutically acceptable salt thereof as an active ingredient.
- the present invention provides a quasi-drug composition for preventing or improving skin pigmentation, including carvone or a pharmaceutically acceptable salt thereof as an active ingredient.
- the present invention provides a method for preventing or treating skin pigmentation comprising administering or taking a composition comprising carvone or a pharmaceutically acceptable salt thereof as an active ingredient to an individual.
- the present invention provides a use of a composition comprising carvone or a pharmaceutically acceptable salt thereof as an active ingredient to prevent or treat skin pigmentation.
- a composition comprising carvone or a salt thereof as an active ingredient has excellent inhibitory effect on melanogenesis induced by melanocyte-stimulating hormone ( ⁇ MSH), and is safe for human body and side effects Because of this, it can be used in a variety of materials such as cosmetics, health functional foods, pharmaceuticals or quasi-drugs.
- ⁇ MSH melanocyte-stimulating hormone
- Figure 2 is a graph showing the change in the amount of melanin production of B6F10 melanocytes treated with carbon (each value is the mean ⁇ SEM of three times) [one-way analysis of variance (one-way ANOVA)].
- FIG. 3 is a graph showing changes in gene expression of B6F10 melanocytes treated with carbon (each value is the mean ⁇ SEM of three times; the letters on the bar indicate a statistically significant difference at P ⁇ 0.05) [One-way variance Analysis (one-way ANOVA)].
- the present inventors confirmed that carvone or a salt thereof exhibits a remarkably excellent whitening effect, and completed the present invention.
- the present invention provides a composition for skin whitening comprising carbon (carvone) or a salt thereof as an active ingredient.
- the active ingredient may inhibit the expression of microphthalmia transcription factor (MITF) or tyrosinase.
- the active ingredient may inhibit the production of melanin induced by melanocyte-stimulating hormone ( ⁇ MSH).
- MITF microphthalmia transcription factor
- ⁇ MSH melanocyte-stimulating hormone
- Carvone is a volatile terpenoid-based compound.
- the structural formula of carbon is C 10 H 14 O and the molecular weight is 150.2 g/mol, and the structure is as shown in [Chemical Formula 1] (molecular structure of carvone).
- Carbon is a pale yellow liquid with a spearmint scent belonging to the peculiar peppermint genus, colorless, and soluble in water and ethanol.
- Carbon is mainly used as a flavoring ingredient, such as flavoring, fragrance, detergent, detergent, etc., and is listed as a substance that can be used as a flavoring agent in the Food and Drug Administration (FDA) food additive database.
- FDA Food and Drug Administration
- the carbon of the present invention may have the structure of [Chemical Formula 1], and more preferably may have a structure such as the following [Chemical Formula 1-1].
- the method of obtaining carvone of the present invention is not particularly limited, and may be separated from natural products, chemically synthesized using a known manufacturing method, or commercially available.
- the carvone may include a carvone hydrate, a carvone derivative, and the like within a range having the same efficacy, and may include a solvate or stereoisomer thereof. .
- skin whitening refers to not only clearing skin tone by inhibiting the synthesis of melanin pigment, but also improving skin hyperpigmentation such as spots and freckles caused by ultraviolet rays, hormones, or genetics.
- the term “cosmetically acceptable salt”, “food pharmaceutically acceptable salt”, “pharmaceutically acceptable salt” or “salt thereof” is in the form of a salt in which carvone is combined with another substance. As such, it may mean a material that can exhibit similar activity to carbon.
- the “cosmetically acceptable salt”, “food pharmaceutically acceptable salt”, “pharmaceutically acceptable salt” or “salt thereof” may be an acid addition salt formed by a free acid.
- the acid addition salt can be prepared by a conventional method, for example, dissolving the compound in an excess aqueous acid solution, and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile.
- the same molar amount of the compound and an acid or alcohol (eg glycol monomethyl ether) in water may be heated, and then the mixture may be evaporated to dryness, or the precipitated salt may be suction filtered.
- an inorganic acid or an organic acid may be used as the free acid.
- the inorganic acid may be hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, and the like, which may be used alone or in combination of two or more.
- the organic acid include methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid (propionic acid).
- the carbon (carvone) can be made cosmetically or food acceptable metal salt using a base.
- the alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating and drying the filtrate.
- the metal salt it is particularly preferable to prepare a sodium, potassium or calcium salt, but is not limited thereto.
- the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with an appropriate silver salt (eg, silver nitrate).
- the salt of the carboxylic may include all salts of acidic or basic groups that may be present in the compound of the carboxylic.
- the carboxylic salt may include sodium, calcium and potassium salts of the hydroxy group, and other cosmetically acceptable salts of the amino group include hard bromide, sulfate, hydrogen sulfate, phosphate, hydrogen phosphate. , Dihydrogen phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate (mesylate) and p-toluenesulfonate (tosylate) salts, and the like, and salts known in the art It can be manufactured through a manufacturing method.
- the present invention provides a cosmetic composition for skin whitening comprising, as an active ingredient, carvone or a cosmetically acceptable salt thereof.
- the effective content of the active ingredient in the cosmetic composition of the present invention is not particularly limited, and may be included in an amount of 0.0001 to 20% by weight based on the total weight of the composition.
- the amount of the active ingredient is small, so there may be no expected whitening improvement effect, and when it exceeds 20% by weight, the effect may be insignificant or may exhibit known toxicity.
- cosmetic composition used in the present invention is a composition including the compound, and the formulation may be in any form.
- cosmetics prepared using the above composition include creams such as nutrition cream, eye cream, massage cream, cleansing cream, packs, lotions such as nutritional lotion, essences, softening lotion, lotion such as nutritional lotion.
- lotions such as nutritional lotion, essences, softening lotion
- lotion such as nutritional lotion.
- Types, powders, foundations, makeup bases, and the like and can be manufactured and commercialized in any of these formulations to achieve the object of the present invention, and are not limited to the above examples.
- the cosmetic composition according to the present invention can be formulated by a conventional cosmetic preparation method.
- the cosmetics of the present invention are skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, essence, pack, mask pack, mask sheet , Exfoliating agent, soap, shampoo, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, emulsion, press powder, loose powder, and eye shadow.It can be prepared in any one formulation selected from the group consisting of.
- the cosmetic composition of the present invention may include other additives such as excipients, carriers, etc. in addition to the active ingredient (carbon or salt thereof), and it is possible to apply and mix as many common ingredients as necessary.
- the cosmetic composition of the present invention may further include a transdermal penetration enhancer.
- a transdermal penetration enhancer is a composition that allows a desired component to penetrate into blood vessel cells of the skin at a high absorption rate.
- phospholipid components, liposome components, and the like used in lecithin cosmetics are included, but are not limited thereto.
- an oil that can be mainly used as an oily component at least one selected from vegetable oils, mineral oils, silicone oils, and synthetic oils may be used. More specifically, mineral oil, cyclomethicone, squalane, octyldodecyl myristate, olive oil, Vitis vinifera seed oil, macadamia nut oil, glyceryl octanoate, castor oil, ethylhexyl isononanoate, dime Chicon, cyclopentasiloxane, and sunflower seed oil can be used.
- a surfactant a higher alcohol, etc.
- conventional surfactants such as nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, phospholipids, etc.
- sorbitansquinoleate polysorbate 60
- Glyceryl stearate lipophilic glyceryl stearate
- sorbitan oleate sorbitan stearate
- DIA-cetylphosphate sorbitan stearate/sucrosecoate
- glyceryl stearate/polyethylene glycol-100 Stearate ceteareth-6 olivate
- arachidyl alcohol/behenyl alcohol/arachidyl glucoside polypropylene glycol-26-butes-26/polyethylene glycol-40 hydrogenated castor oil, etc.
- an alcohol having 12 to 20 carbon atoms such as cetyl alcohol, stearyl alcohol, octyldodecanol, isostearyl alcohol, and the like may be used alone or in combination of one or more.
- the aqueous phase component may further add 0.001 to 5% by weight of one or more thickeners such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate, etc. to adjust the viscosity or hardness of the aqueous phase.
- thickeners such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate, etc.
- the cosmetic composition of the present invention includes medicinal ingredients such as higher fatty acids and vitamins, sunscreen, and antioxidants (butylhydroxyanisole, propyl gallic acid, lysorbic acid, tocopheryl acetate, butylated hydroxy) as needed.
- medicinal ingredients such as higher fatty acids and vitamins, sunscreen, and antioxidants (butylhydroxyanisole, propyl gallic acid, lysorbic acid, tocopheryl acetate, butylated hydroxy) as needed.
- preservatives methylparaben, butylparaben, propylparaben, phenoxyethanol, imidazolidinylurea, chlorphenesin, etc.
- colorants pH adjusters (triethanolamine, citric acid, citric acid, sodium citrate, malic acid, etc.) Sodium Malate, Pmalic Acid, Sodium Fmalate, Succinic Acid, Sodium Succinate, Sodium Hydroxide, Sodium Monohydrogen Phosphate, etc.), Moisturizing Agents (Glycerin, Sorbitol, Propylene Glycol, Butylene Glycol, Hexylene Glycol, Diglycerin , Betaine, glyceres-26, methylgluces-20, etc.), lubricants and the like can be added.
- the cosmetic composition of the present invention further includes a substance capable of auxiliaryly providing essential nutrients to the skin, preferably, it may contain a natural scent, a cosmetic scent, or an auxiliary agent including, but not limited to, herbal medicines. have.
- the present invention provides a composition for external application for skin whitening comprising carvone or a salt thereof as an active ingredient.
- external skin preparation of the present invention is a concept encompassing all substances generally used for external application of the skin, and non-limiting examples of the external preparation for skin include warning agents (PLASTERS), lotions (LOTIONS), and liner. (LINIMENTS), LIQUIDS AND SOLUTIONS, AEROSOLS, EXTRACTS, Ointments (OINTMENTS), FLUIDEXTRACTS, EMULSIONS, SUSPESIONS, CAPSULES , Creams (CREAMS), soft, hard gelatin capsules, patches, or sustained-release preparations.
- the external preparation for skin may be a parenteral administration formulation formulated in a solid, semi-solid or liquid form by adding a commercially available inorganic or organic carrier, excipient, and diluent.
- the preparation for parenteral administration may be a transdermal dosage form selected from the group consisting of drops, ointments, lotions, gels, creams, patches, sprays, suspensions, and emulsions, but is not limited thereto.
- Carriers, excipients and diluents that may be included in the external preparation include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oils.
- the content of the carbon or salt thereof of the present invention is preferably 0.0001 to 20% by weight, respectively, based on the total weight of the composition for external application for skin. If it exceeds 20% by weight, stability, etc. may be deteriorated during preparation of the composition, and if it is less than 0.0001%, the effect is insignificant.
- composition for external application for skin according to each formulation, other ingredients other than the composition of the present invention described above can be appropriately selected and blended by a person skilled in the art without difficulty depending on the formulation or purpose of use of the other external preparation for skin. If so, synergistic effects can occur.
- the present invention provides a health functional food composition for skin whitening comprising, as an active ingredient, carvone or a food acceptable salt thereof.
- the term "health functional food” refers to a food manufactured and processed in the form of tablets, capsules, powders, granules, liquids and pills using raw materials or ingredients having useful functions for the human body.
- “functionality” means obtaining useful effects for health purposes such as controlling nutrients or physiological effects on the structure and function of the human body.
- the health functional food of the present invention can be prepared by a method commonly used in the art, and at the time of production, it can be prepared by adding raw materials and ingredients commonly added in the art.
- the formulation of the health functional food may be prepared without limitation as long as it is a formulation recognized as a health functional food.
- the health functional food composition of the present invention has the advantage of having no side effects that may occur during long-term use of the drug, unlike general drugs, and it is excellent in portability and can be consumed as an adjuvant to enhance the skin whitening effect. It is possible.
- the health functional food composition of the present invention may be prepared in any one formulation selected from the group consisting of tablets, granules, powders, capsules, liquid solutions, and pills.
- the health functional food composition according to the present invention may be formulated in the form of powders, liquids, tablets, soft capsules, granules, tea bags, instant teas or drinks by including carvone or a salt thereof as an active ingredient. have.
- the content of carbon or a salt thereof as an active ingredient may be appropriately determined according to the purpose of use (for prevention or improvement).
- the amount of the active ingredient (carbon or salt thereof) contained in the health functional food composition may be added in 0.1 to 20% by weight of the total food weight. However, in the case of long-term intake for the purpose of health and hygiene or for the purpose of health control, the amount may be less than the above range.
- the health functional food composition according to the present invention preferably has other ingredients that can give a synergistic effect to the main effect within a range that does not impair the main effect aimed by the present invention other than the active ingredient, such as vitamin C. It is also okay to contain natural products such as whitening improving compounds such as green tea extract, mulberry extract, licorice extract, serrata extract, betel nut extract, golden extract, and wild ginseng extract.
- natural products such as whitening improving compounds such as green tea extract, mulberry extract, licorice extract, serrata extract, betel nut extract, golden extract, and wild ginseng extract.
- the health functional food composition formulated in the above form may be added to food as it is or may be used with other foods or food ingredients, and may be appropriately used according to a conventional method.
- foods include drinks, meat, sausages, bread, biscuits, rice cakes, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, alcoholic beverages and vitamin complexes. , Dairy products and dairy products, and all health functional foods in the usual sense are included.
- the health functional food composition of the present invention is a drink agent, it contains carbon or a salt thereof as an essential ingredient in the indicated ratio, and there is no particular limitation on other ingredients used for the purpose of manufacturing other drink preparations.
- Eggplant flavors or natural carbohydrates, etc. may be contained as additional ingredients.
- the above natural carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, and the like; And polysaccharides, for example, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
- natural flavoring agents and synthetic flavoring agents can be used as The proportion of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.
- the health functional food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavors and natural flavoring agents, coloring agents and heavy ingredients (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid. And salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
- the food composition of the present invention of the present invention may contain flesh for the production of natural fruit juice and fruit juice beverage and vegetable beverage. These components may be used independently or in combination. Although the proportion of these additives is not so important, it is generally selected from 0.1 to about 20 parts by weight per 100 parts by weight of the active ingredient (carbon or salt thereof) of the present invention.
- the present invention provides a pharmaceutical composition for preventing or treating skin pigmentation, comprising as an active ingredient carvone or a pharmaceutically acceptable salt thereof.
- the content of the carbon or salt thereof of the present invention is preferably 0.0001 to 20% by weight, respectively, based on the total weight of the composition. If it exceeds 20% by weight, the change in effect may be insignificant or known toxicity may be exhibited, and if it is less than 0.0001%, the effect is insignificant.
- the carboxylic acid (carvone) of the present invention or a pharmaceutically acceptable salt thereof may further contain one or more active ingredients exhibiting the same or similar functions.
- it may include a known whitening component.
- the additional whitening component is included, the skin whitening effect of the composition of the present invention may be further enhanced.
- the pharmaceutical composition may further include vitamin C as a whitening component known in the art.
- the additional whitening improving component may be included in an amount of 0.0001 to 10% by weight based on the total weight of the composition, and the content range includes the effect of inhibiting the activity of tyrosinase, skin safety, and ease of formulation of the compound of Formula 1, etc. It can be adjusted according to your requirements.
- composition for preventing or treating skin pigmentation of the present invention may further include a pharmaceutically acceptable carrier.
- the pharmaceutically acceptable carrier may contain various components such as a buffer solution, sterile water for injection, general saline or phosphate buffered saline, sucrose, histidine, salt, and polysorbate.
- the pharmaceutical composition of the present invention can be administered orally or parenterally, and can be administered in the form of a general pharmaceutical formulation, for example, in various oral and parenteral formulations when administered clinically.
- a general pharmaceutical formulation for example, in various oral and parenteral formulations when administered clinically.
- generally used fillers Extenders, binders, wetting agents, disintegrants, and may be prepared using diluents or excipients such as surfactants.
- Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient in the pharmaceutical composition of the present invention, such as starch, calcium carbonate, It can be prepared by mixing sucrose or lactose, gelatin, and the like.
- lubricants such as magnesium stearate and talc are also used.
- Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc.
- various excipients such as wetting agents, sweetening agents, fragrances, and preservatives may be included. .
- Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories.
- non-aqueous solvent and the suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used.
- injectable ester such as ethyl oleate
- a base for suppositories witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like may be used.
- the pharmaceutical composition of the present invention can provide desirable prevention or treatment of skin pigmentation when it contains an effective amount of carvone or a pharmaceutically acceptable salt thereof.
- the term "effective amount” means an amount of a compound capable of inhibiting or inhibiting the formation of skin pigmentation, or mitigating the pigmentation already produced.
- the effective amount of carvone or a pharmaceutically acceptable salt thereof contained in the composition of the present invention may vary depending on the form in which the composition is commercialized, the method in which the compound is applied to the skin, and the time to stay in the skin.
- composition when the composition is commercialized as a pharmaceutical for dermatological treatment due to pigmentation of the skin, it is allowed to be carvone or its pharmaceutically at a higher concentration than when it is commercialized as a cosmetic that is routinely applied to the skin. It may include possible salts.
- the preferred dosage of the pharmaceutical composition according to the present invention varies depending on the patient's condition, weight, degree of disease, drug form, route of administration and duration, but may be appropriately selected by those skilled in the art. However, for a desirable effect, it may be administered at 0.0001 to 2,000 mg/kg per day, preferably 0.001 to 2,000 mg/kg. Administration may be administered once a day, or may be divided several times. However, the scope of the present invention is not limited by the dosage.
- the present invention provides a quasi-drug composition for preventing or improving skin pigmentation comprising carvone or a pharmaceutically acceptable salt thereof as an active ingredient.
- quasi-drug refers to items that are less effective than medicines among items used for the purpose of diagnosing, treating, improving, alleviating, treating or preventing diseases of humans or animals. According to this, quasi-drugs exclude items used for pharmaceutical purposes, and include products used for the treatment or prevention of diseases of humans and animals, and products that have mild or no direct action on the human body.
- the quasi-drug composition of the present invention is used for the purpose of preventing or improving skin pigmentation, and is not particularly limited in its formulation, for example, softening lotion, nutritional lotion, massage cream, nutrition cream, pack, mask pack , May be a cosmetic composition having a formulation of a mask sheet, gel or skin adhesive type cosmetic, and may also be a transdermal dosage form such as a lotion, ointment, gel, cream, patch or spray.
- the quasi-drug composition may be arbitrarily selected and blended according to the formulation or purpose of use of other quasi-drugs.
- the mixing amount of the active ingredient may be appropriately determined depending on the purpose of use (inhibition or mitigation).
- thickeners, stabilizers, solubilizers, conventional adjuvants such as vitamins, pigments and flavors, and carriers may be included.
- the content of the carbon or salt thereof of the present invention is preferably 0.0001 to 20% by weight, respectively, based on the total weight of the quasi-drug composition. If it exceeds 20% by weight, color and stability may be deteriorated during the preparation of the composition, and if it is less than 0.0001%, the effect is negligible.
- components other than the essential components described above may be appropriately selected and blended by a person skilled in the art without difficulty depending on the formulation or purpose of use.
- ⁇ -MSH alpha-melanocyte stimulating hormone
- carvone used in this experiment were all purchased from Sigma Aldrich (St Louis, MO, USA).
- B16F10 melanocytes were purchased and used from ATCC (Manassas, VA, USA), and the purchased cells were 37 using DMEM (Dulbecco's Modified Eagle's Media) medium containing 10% FBS (fetal bovin serum). °C, 5% CO 2 Incubated in an incubator.
- B6F10 melanocytes were cultured in DMEM medium containing 10% FBS at 37° C. and 5% CO 2 , and then distributed to a 6-well plate at 1 ⁇ 10 5 cells/well to attach the cells. Normal cells were not treated with ⁇ -MSH, which induces melanogenesis, and control cells were set as cells treated with ⁇ -MSH (100 nM). Cells cultured under the above conditions were treated with ⁇ -MSH (100 nM) and carbon (100 ⁇ M) and cultured for 48 hours.
- the cells were recovered. The recovered cells were centrifuged at 1,000 rpm for 5 minutes, and then the color of the pellet was observed visually. Thereafter, the cell pellet was dissolved by adding 200 ⁇ L of a 1N NaOH solution to which 10% DMSO was added, and the absorbance was measured at 400 nm with a microplate reader.
- PBS phosphate buffered saline
- Melanin is synthesized in melanosomes, an organelle within melanocytes, and is produced through a series of enzymatic reactions as melanocytes are activated when exposed to ultraviolet rays.
- Tyrosinase is well known to regulate the rate of melanin synthesis by acting in the early stages of melanin synthesis in melanocytes, and MITF binds to E-box (CATGTG) present in the gene promotor of tyrosinase. It is known to induce enzyme expression.
- CAGTG E-box
- PCR analysis was performed in B6F10 melanocytes to determine whether the inhibitory effect of carbonyl on melanogenesis was related to the inhibition of the expression of enzymes such as tyrosinase and the regulation of the expression of MITF, a transcription factor.
- enzymes such as tyrosinase and the regulation of the expression of MITF, a transcription factor.
- MITF a transcription factor
- the expression of MITF and tyrosinase was significantly increased in the control cells treated with ⁇ -MSH compared to the normal cells (basal).
- the control cells were In comparison, it was confirmed that the expression of MITF and tyrosinase was significantly reduced by 36% and 31%, respectively (FIG. 3).
- compositions of Preparation Examples 1 to 3 were prepared according to a conventional method according to the following compositional components and composition ratios.
- Example 2-1 Carbon 1000 mg Vitamin mixture Appropriate amount Vitamin A acetate 1.0 mg Vitamin E 0.13 mg Vitamin B1 0.15 mg Vitamin B2 0.5 mg Vitamin B6 0.2 ⁇ g Vitamin B12 10 mg Vitamin C 10 ⁇ g Biotin 1.7 mg Nicotinic acid amide 50 ⁇ g Folic acid 0.5 mg Calcium pantothenate Appropriate amount Mineral mixture Appropriate amount Ferrous sulfate 1.75 mg Zinc oxide 0.82 mg Magnesium carbonate 25.3 mg Potassium Phosphate Monobasic 15 mg Dibasic potassium phosphate 55 mg Potassium citrate 90 mg Calcium carbonate 100 mg Magnesium chloride 24.8 mg
- composition ratio of the vitamin and mineral mixture ingredients suitable for a health functional food are mixed and formulated in a preferred embodiment, but the mixing ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional health functional food manufacturing method.
- granules are prepared and can be used to prepare a health functional food composition according to a conventional method.
- the resulting solution is stirred and heated at 85 for about 1 hour, filtered, obtained in 21 sterilized containers, sealed and sterilized, and then stored in a refrigerator. Used in the manufacture of beverage compositions.
- the composition ratio is composed of ingredients suitable for a relatively preferred beverage in a preferred embodiment, but the mixing ratio may be arbitrarily modified according to regional and ethnic preferences, such as the demand class, the country of demand, and the purpose of use.
- tablets containing carbon were prepared by tableting according to a conventional tablet preparation method.
- a gelatin capsule was filled according to a conventional capsule preparation method to prepare a capsule containing carbon.
- a ring was prepared to be 4 g per ring according to a conventional ring production method.
- composition of Table 12 below 100 mg of 30% ethanol was added and dried at 60 degrees Celsius to form granules, and then filled into a cloth to prepare granules.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Epidemiology (AREA)
- Birds (AREA)
- Dermatology (AREA)
- Chemical & Material Sciences (AREA)
- Emergency Medicine (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Nutrition Science (AREA)
- Mycology (AREA)
- Food Science & Technology (AREA)
- Polymers & Plastics (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cosmetics (AREA)
Abstract
본 발명은 카르본(carvone) 또는 이의 염을 유효성분으로 포함하는 피부 미백 조성물에 관한 것으로, 보다 상세하게는 카르본(carvone) 또는 이의 염을 유효성분으로 포함함으로써 우수한 멜라닌 생성 억제 효과를 구현할 수 있는 피부 미백용 조성물에 관한 것이다. 본 발명에 따른 조성물은 멜라닌 세포 자극 호르몬 (Melanocyte-Stimulating Hormone, αMSH)에 의해 유도되는 멜라닌 생성 억제 효과가 우수하고, 인체에 안전하며 부작용이 적어 화장품, 건강기능식품, 의약품 또는 의약외품 등의 소재로 다양하게 사용될 수 있다.
Description
본 출원은 2019년 6월 17일 출원된 대한민국 특허출원 제10-2019-0071589호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
본 발명은 카르본(carvone) 또는 이의 염을 유효성분으로 포함하는 피부 미백 조성물에 관한 것으로, 보다 상세하게는 카르본(carvone) 또는 이의 염을 유효성분으로 포함함으로써 우수한 멜라닌 생성 억제 효과를 구현할 수 있는 피부 미백용 조성물에 관한 것이다.
사람의 피부색은 멜라닌, 카로틴 및 헤모글로빈의 양에 따라 결정되는데 이중에서도 멜라닌이 피부색을 결정하는 주요인자로 작용한다. 멜라닌은 피부 표피층(epidermis)에 존재하는 멜라닌세포(melanocyte)에서 생성된 후 주변의 각질형성 세포(keratinocyte)로 전이(migration)되어 피부색을 나타내는 것으로 알려져 있다. 이외에도 멜라닌은 자외선에 의한 피부 손상을 막고 활성산소(reactive oxygen species, ROS)를 제거하여 피부를 보호하는 역할을 한다. 그러나 만성적인 자외선 노출은 멜라닌세포(melanocyte)에서 멜라닌 생성을 촉진시켜 색소침착(pigmentation)을 유발하는 것으로 알려져 있다.
멜라닌 생성은 멜라닌세포 내의 멜라노좀(melanosome)에서 개시된다. 피부가 자외선과 같은 외부 스트레스에 노출되면 멜라닌세포에서 α-MSH(α-melanocyte stimulating hormone)의 생성량이 증가하고, α-MSH는 멜라닌세포에서만 발현되는 막 수용체인 MC1R(melanocortin 1 receptor)과 결합하여 아데닐일 사이클라제(adenylyl cyclase)를 활성화시켜 세포 내 cAMP(cyclic adenosine monophosphate)를 증폭시키는 것으로 알려져 있다. 세포 내 cAMP 수준이 증가하면 PKA(protein kinase A)가 활성화됨에 따라 CREB(cAMP response element binding protein)가 인산화되고, 결과적으로 MITF (microphthalmia transcription factor)의 발현이 증가된다. MITF는 멜라닌 합성과정의 중요 전사인자로서 멜라닌 합성의 주요 효소인 티로시나아제의 수준을 증가시키며, 티로시나아제는 멜라닌 합성의 초기단계에 작용하여 멜라닌 합성의 속도를 조절하는 것으로 잘 알려져 있다. 이러한 경로로 멜라닌 세포에서의 멜라닌 합성은 MITF, 티로시나아제 등의 효소가 관여하는 복잡한 과정을 통해 이루어진다.
본 발명자는, 피부 미백 효과가 우수한 물질에 대한 연구을 진행한 결과, 카르본(carvone) 또는 이의 염의 멜라닌 생성 억제 효과가 우수하다는 것을 확인하고 본 발명을 완성하였다.
선행기술문헌
특허문헌 대한민국 공개특허 제10-2018-0117252호
본 발명의 목적은 카르본(carvone) 또는 이의 화장품학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 미백용 화장료 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 카르본(carvone) 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 미백용 건강기능식품 조성물에 관한 것이다.
본 발명의 또 다른 목적은 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 색소 침착의 예방 또는 치료용 약학적 조성물에 관한 것이다.
본 발명의 또 다른 목적은 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 색소 침착의 예방 또는 개선용 의약외품 조성물에 관한 것이다.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
본 발명은, 카르본(carvone) 또는 이의 화장품학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 미백용 화장료 조성물을 제공한다.
상기 유효성분은 MITF(microphthalmia transcription factor) 또는 티로시나아제의 발현을 억제할 수 있다.
상기 유효성분은 멜라닌 세포 자극 호르몬 (Melanocyte-Stimulating Hormone, α-MSH)에 의해 유도되는 멜라닌 생성을 억제할 수 있다.
상기 조성물은 스킨로션, 스킨 소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스처 로션, 영양로션, 맛사지 크림, 영양크림, 모이스처 크림, 핸드크림, 에센스, 팩, 마스크팩, 마스크시트, 각질제거제, 비누, 샴푸, 클렌징 폼, 클렌징로션, 클렌징크림, 바디로션, 바디클렌저, 유액, 프레스파우더, 루스파우더 및 아이섀도로 이루어진 군에서 선택되는 어느 하나의 제형으로 제조될 수 있다.
상기 유효성분은 화장료 조성물 전체 중량에 대하여 0.0001 내지 20 중량%로 포함될 수 있다.
또한, 본 발명은 카르본(carvone) 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 미백용 건강기능식품 조성물을 제공한다.
상기 조성물은 정제, 과립, 분말, 캅셀, 액상의 용액 및 환으로 이루어진 군에서 선택되는 어느 하나의 제형으로 제조될 수 있다.
또한, 본 발명은 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 색소 침착의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은, 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 색소 침착의 예방 또는 개선용 의약외품 조성물을 제공한다.
또한, 본 발명은, 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 조성물을 개체에 투여 또는 복용시키는 단계를 포함하는 피부 색소 침착의 예방 또는 치료방법을 제공한다.
또한, 본 발명은, 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 조성물의 피부 색소 침착의 예방 또는 치료 용도를 제공한다.
본 발명에 따른, 카르본(carvone) 또는 이의 염을 유효성분으로 포함하는 조성물은 멜라닌 세포 자극 호르몬 (Melanocyte-Stimulating Hormone, αMSH)에 의해 유도되는 멜라닌 생성 억제 효과가 우수하고, 인체에 안전하며 부작용이 적어 화장품, 건강기능식품, 의약품 또는 의약외품 등의 소재로 다양하게 사용될 수 있다.
도 1은 카르본을 처리한 B6F10 멜라닌세포의 펠릿(pellet)색 변화를 분석한 결과를 나타내는 것이다.
도 2는 카르본을 처리한 B6F10 멜라닌세포의 멜라닌 생성량 변화를 나타내는 그래프이다 (각 값은 3 회의 평균 ± SEM 임)[일원분산분석(one-way ANOVA)].
도 3은 카르본을 처리한 B6F10 멜라닌세포의 유전자 발현 변화를 나타내는 그래프이다(각 값은3 회의 평균 ± SEM 임; 막대 위의 글자는 P<0.05에서 통계적 유의적 차이를 나타낸 것임)[일원분산분석(one-way ANOVA)].
본 발명자는 카르본(carvone) 또는 이의 염이 현저하게 우수한 미백 효과를 나타내는 것을 확인하고, 본 발명을 완성하였다.
이하 본 발명을 상세히 설명한다.
본 발명은 카르본(carvone) 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물을 제공한다.
상기 유효성분은 MITF(microphthalmia transcription factor) 또는 티로시나아제의 발현을 억제할 수 있다. 또한 상기 유효성분은 멜라닌 세포 자극 호르몬 (Melanocyte-Stimulating Hormone, αMSH)에 의해 유도되는 멜라닌 생성을 억제할 수 있다.
카르본(carvone)은 휘발성의 테르페노이드(Terpenoid)계 화합물이다. 카르본의 구조식은 C10H14O이고 분자량은 150.2 g/mol이며, 구조는 아래 [화학식 1](카르본(carvone)의 분자 구조)과 같다. 카본은 특유의 박하속에 속하는 스피어민트(minty spearmint)향기가 나며 무색에 가까운 옅은 노란색의 액체이고, 물과 에탄올에 잘 용해된다. 카르본은 주로 향료로서 착향료, 방향제, 세정제, 세제등의 성분으로 이용되고, FDA(Food and Drug Administration) 식품첨가물 데이터베이스에 착향료로 사용가능한 물질로 등재되어 있으며, FEMA (Flavor and Extract Manufacturers Association)와 JECFA (Joint FAO/WHO Expert Committe on Food Additives)에 각각 착향료와 식품첨가물로 안전하다고 승인되어 상업적으로 향을 내는 목적으로 사용되고 있다. 그러나 현재까지 카본의 미백 효능은 알려진 바 없다. 랫트를 대상으로 한 경구독성 실험에서는 LD50 값은 1,640 mg/kg으로 보고되었고, 경피독성 실험에서 LD50 값은 4,000 mg/kg 이상으로 보고되었다.
[화학식 1]
본 발명의 카르본은 상기 [화학식 1]의 구조일 수 있으며, 더욱 바람직하게는 하기 [화학식 1-1]과 같은 구조일 수 있다.
[화학식 1-1]
본 발명의 카르본(carvone)의 수득 방법은 특별히 한정되지 않으며, 천연물에서 분리하거나, 공지된 제법을 사용하여 화학적으로 합성하거나, 시판되는 것을 사용할 수 있다.
본 발명에서, 상기 카르본(carvone)은 이와 동일한 효능을 갖는 범위 내에서 카르본(carvone) 수화물, 카르본(carvone) 유도체 등을 포함할 수 있으며, 이의 용매화합물이나 입체 이성질체를 포함할 수 있다.
본 발명에서, 용어 "피부 미백"은 멜라닌 색소의 합성을 저해함으로써 피부 톤을 맑게 할 뿐만 아니라, 자외선, 호르몬 또는 유전에 기인한 기미나 주근깨 등의 피부 과색소 침착을 개선하는 것을 의미한다.
본 발명에서, 용어 "화장품학적으로 허용 가능한 염", "식품학적으로 허용 가능한 염", "약학적으로 허용 가능한 염" 또는 "이의 염"은 카르본(carvone)이 다른 물질과 결합한 염의 형태인 것으로, 카르본과 유사한 활성을 나타낼 수 있는 물질을 의미할 수 있다. 상기 "화장품학적으로 허용 가능한 염", "식품학적으로 허용 가능한 염", "약학적으로 허용 가능한 염" 또는 "이의 염"은 유리산(free acid)에 의해 형성된 산 부가염일 수 있다. 산 부가염은 통상의 방법, 예를 들어 화합물을 과량의 산 수용액에 용해시키고, 이 염을 수혼화성 유기 용매, 예를 들어 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜서 제조할 수 있다. 또한, 동 몰량의 화합물 및 물 중의 산 또는 알코올 (예를 들어, 글리콜 모노메틸 에테르)을 가열하고, 이어서 상기 혼합물을 증발시켜 건조시키거나, 또는 석출된 염을 흡인 여과시킬 수 있다.
상기 유리산으로는 무기산 또는 유기산을 사용할 수 있다. 상기 무기산의 비제한적인 예로는 염산, 인산, 황산, 질산, 주석산 등을 사용할 수 있으며, 이들은 단독으로 사용되거나 2 종 이상을 혼합하여 사용될 수 있다. 상기 유기산의 비제한적인 예로는 메탄술폰산, p-톨루엔술폰산, 아세트산, 트리플루오로아세트산, 말레인산 (maleic acid), 숙신산, 옥살산, 벤조산, 타르타르산, 푸마르산 (fumaric acid), 만데르산, 프로피온산 (propionic acid), 구연산 (citric acid), 젖산 (lactic acid), 글리콜산 (glycollic acid), 글루콘산 (gluconic acid), 갈락투론산 (galacturonic acid), 글루탐산, 글루타르산 (glutaric acid), 글루쿠론산 (glucuronic acid), 아스파르트산, 아스코르브산, 카본산, 바닐릭산, 하이드로아이오딕산 등을 사용할 수 있다. 이들은 단독으로 사용되거나 2 종 이상을 혼합하여 사용될 수 있다.
또한, 상기 카르본(carvone)은 염기를 사용하여 화장품학적으로 또는 식품학적으로 허용 가능한 금속염을 만들 수 있다. 알칼리 금속 또는 알칼리 토금속 염은, 예를 들어 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해시키고, 비용해 화합물 염을 여과한 후 여액을 증발, 건조시켜 얻을 수 있다. 상기 금속염으로는 특히 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 바람직하나 이들에 제한되는 것은 아니다. 또한, 이에 대응하는 은염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 은염 (예를 들어, 질산은)과 반응시켜 얻을 수 있다.
상기 카르본의 염은, 달리 지시되지 않는 한, 상기 카르본의 화합물에 존재할 수 있는 산성 또는 염기성 기의 염을 모두 포함할 수 있다. 예를 들어 상기 카르본의 염으로는 하이드록시기의 나트륨, 칼슘 및 칼륨염 등이 포함될 수 있고, 아미노기의 기타 화장품학적으로 허용 가능한 염으로는 하드로브로마이드, 황산염, 수소 황산염, 인산염, 수소 인산염, 이수소 인산염, 아세테이트, 숙시네이트, 시트레이트, 타르트레이트, 락테이트, 만델레이트, 메탄술포네이트 (메실레이트) 및 p-톨루엔술포네이트 (토실레이트)염 등을 들 수 있으며 당업계에서 알려진 염의 제조 방법을 통하여 제조될 수 있다.
본 발명은, 카르본(carvone) 또는 이의 화장품학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 미백용 화장료 조성물을 제공한다.
본 발명의 화장료 조성물에서 상기 유효성분의 유효 함량은 특별히 제한되지 않으며, 조성물 전체 중량에 대하여 0.0001 내지 20 중량%로 포함되는 것일 수 있다. 상기 유효성분이 화장료 조성물 내에 0.0001 중량% 미만인 경우에는 그 용량이 소량이어서 기대하는 미백 개선 효과가 없을 수 있으며, 20 중량%를 초과하는 경우 효과의 변화가 미미하거나 기존에 알려진 독성을 나타낼 가능성이 있다.
본 발명에서 사용되는 용어, "화장료 조성물"은 상기 화합물을 포함하는 조성물로서 그 제형은 어떠한 형태라도 가능하다. 이러한 제형의 예를 들면 상기 조성물을 이용하여 제조된 화장료는 영양크림, 아이크림, 마사지크림, 클렌징 크림과 같은 크림류, 팩류, 영양로션과 같은 로션류, 에센스류, 유연화장수, 영양 화장수와 같은 화장수류, 파우더류, 파운데이션류 및 메이크업 베이스류 등이고, 본 발명의 목적을 달성하기 위하여 이러한 제형 중 어떠한 형태로도 제조되어 상용화될 수 있으며, 상기 예들에 한정되지 않는다. 또한, 본 발명에 따른 화장료 조성물에는 통상의 화장료 제조 방법으로 제형화할 수 있다.
구체적으로 본 발명의 화장료는 스킨로션, 스킨 소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스처 로션, 영양로션, 맛사지 크림, 영양크림, 모이스처 크림, 핸드크림, 에센스, 팩, 마스크팩, 마스크시트, 각질제거제, 비누, 샴푸, 클렌징 폼, 클렌징로션, 클렌징크림, 바디로션, 바디클렌저, 유액, 프레스파우더, 루스파우더 및 아이섀도로 이루어진 군에서 선택되는 어느 하나의 제형으로 제조될 수 있다.
본 발명의 화장료 조성물은 상기 유효성분(카르본 또는 이의 염)에 더하여 부형제, 담체 등 기타 첨가제를 포함할 수 있으며, 일반 피부 화장료에 배합되는 보통의 성분을 필요한 만큼 적용 배합하는 것이 가능하다.
구체적으로, 본 발명의 화장료 조성물은 경피 침투 강화제를 추가로 포함할 수 있다. 본 발명에서 사용되는 용어, 경피 침투 강화제란 피부의 혈관세포 내로 원하는 성분이 높은 흡수율로 침투할 수 있게 해주는 조성물이다. 바람직하게는 레시틴 화장품에 사용되는 다른 인지질 성분, 리포좀 성분 등이 포함되지만 이에 국한되지는 않는다.
또한, 유상 성분으로서 주로 사용될 수 있는 오일로는 식물성 오일, 광물성 오일, 실리콘유 및 합성유 중에서 선택된 하나 이상을 사용할 수 있다. 보다 구체적으로, 미네랄오일, 사이크로메치콘, 스쿠알란, 옥틸도데실 미리스테이트, 올리브 오일, 비티스 비니페라 씨드 오일, 마카다미아너트오일, 글리세릴옥타노에이트, 캐스터 오일, 에칠헥실 이소노나노에이트, 디메치콘, 사이크로펜타실록산 및 선플라워 씨드 오일 등을 사용할 수 있다.
또한, 유화 능력을 보강하기 위하여 계면활성제, 고급 알콜 등을 0.1 내지 5 중량% 첨가할 수 있다. 이러한 계면 활성제로는 비이온 계면활성제, 음이온성 계면 활성제, 양이온성 계면 활성제, 양성 계면 활성제, 인지질 등과 같은 통상적인 계면활성제를 사용할 수 있으며, 구체적으로, 소르비탄세스퀴놀리에이트, 폴리솔베이트 60, 글리세릴 스테아레이트, 친유형 글리세릴스테아레이트, 소르비탄 올리에이트, 소르비탄 스테아레이트, 디이에이-세틸포스페이트, 소르비탄스테아레이트/슈크로스코코에이트, 글리세릴스테아레이트/폴리에틸렌글라이콜-100 스테아레이트, 세테아레스-6 올리베이트, 아라키딜알코올/베헤닐알코올/아라키딜 글루코사이드, 폴리프로필렌글라이콜-26-부테스-26/폴리에틸렌글라이콜-40 하이드로제네이티드 캐스터오일 등을 사용할 수 있다. 고급 알콜로는 탄소수가 12 내지 20인 알코올, 예컨대 세틸알코올, 스테아릴 알코올, 옥틸도데칸올, 이소스테아릴 알코올 등을 단독으로 또는 1종 이상 혼합하여 사용할 수 있다.
수상 성분은 수상의 점도 또는 경도를 조절하기 위하여 카보머, 잔탄검, 벤토나이트, 마그네슘알루미늄실리케이트, 셀룰로오스검, 덱스트린 팔미테이트 등과 같은 1종 이상의 점증제를 0.001 내지 5 중량% 더 첨가할 수 있다.
또한, 본 발명의 화장료 조성물에는 필요에 따라 고급 지방산, 비타민 등의 약효 성분과 자외선 차단제, 산화 방지제(부틸히드록시아니솔, 갈릭산프로필, 엘리소르빈산, 토코페릴아세테이드, 부틸레이티드하이드록시톨루엔 등), 방부제(메칠파라벤, 부틸파라벤, 프로필파라벤, 페녹시에탄올, 이미다졸리디닐우레아, 클로르페네신 등), 착색제, pH 조절제(트리에탄올아민, 씨트릭애씨드, 시트르산, 시트르산나트륨, 말산, 말산나트륨, 프말산, 프말산나트륨, 숙신산, 숙신산나트륨, 수산화나트륨, 인산일수소나트륨 등), 보습제(글리세린, 솔비톨, 프로필렌 글라이콜, 부틸렌 글라이콜, 헥실렌 글라이콜, 디글리세린, 베타인, 글리세레스-26, 메칠글루세스-20 등), 윤활제 등의 성분을 더 첨가할 수 있다.
또한, 본 발명의 화장료 조성물은 피부에 필수 영양소를 보조적으로 제공할 수 있는 물질을 추가로 포함하는데, 바람직하게는 천연향, 화장품향, 또는 한약재가 포함되지만 이들에 국한되지 않는 보조제를 함유할 수 있다.
또한 본 발명은, 카르본(carvone) 또는 이의 염을 유효성분으로 포함하는 피부 미백용 피부 외용제 조성물을 제공한다.
본 발명의 용어 "피부 외용제"는 일반적으로 피부 외용에 사용하는 물질 전반을 포함하는 포괄하는 개념으로, 피부 외용제 제형의 비제한적인 예로는 경고제(PLASTERS), 로션제(LOTIONS), 리니멘트제(LINIMENTS), 액제(LIQUIDS AND SOLUTIONS), 에어로솔제(AEROSOLS), 엑스제(EXTRACTS), 연고제(OINTMENTS), 유동엑스제(FLUIDEXTRACTS), 유제(EMULSIONS), 현탁제(SUSPESIONS), 캅셀제(CAPSULES), 크림제(CREAMS), 연질, 경질 젤라틴 캅셀, 첩부제, 또는 서방화 제제 등이 있다.
본 발명에 따른 피부 외용제는 상용되는 무기 또는 유기의 담체, 부형제 및 희석제를 가하여 고체, 반고체 또는 액상의 형태로 제제화된 비경구 투여제일 수 있다. 상기 비경구 투여를 위한 제재로는 점적제, 연고, 로션, 겔, 크림, 패취, 스프레이, 현탁제 및 유제로 이루어진 군에서 선택되는 경피 투여형 제형일 수 있으나, 이에 제한되지 않는다.
상기 외용제에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
본 발명의 카르본 또는 이의 염의 함량은 피부 외용제 조성물의 총 중량을 기준으로 각각 0.0001 내지 20 중량% 인 것이 바람직하다. 20 중량%를 초과하는 경우에는 조성물 제조 시 안정성 등이 떨어질 수 있고, 0.0001% 미만의 경우에는 그 작용효과가 미미하다.
각 제형에 의한 피부 외용제 조성물에 있어서, 상기한 본 발명의 조성물 이외의 다른 성분들을 기타 피부 외용제의 제형 또는 사용 목적 등에 따라 당업자가 어려움 없이 적의 선정하여 배합할 수 있으며, 이 경우 다른 원료와 동시에 적용할 경우 상승효과가 일어날 수 있다.
또한 본 발명은, 카르본(carvone) 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 미백용 건강기능식품 조성물을 제공한다.
본 발명에서 용어 "건강기능식품"은 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 정제, 캅셀, 분말, 과립, 액상 및 환 등의 형태로 제조 및 가공한 식품을 말한다. 여기서 '기능성'이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻는 것을 의미한다. 본 발명의 건강기능식품은 당 업계에서 통상적으로 사용되는 방법에 의하여 제조가능하며, 상기 제조 시에는 당 업계에서 통상적으로 첨가하는 원료 및 성분을 첨가하여 제조할 수 있다. 또한 상기 건강기능식품의 제형 또한 건강기능식품으로 인정되는 제형이면 제한 없이 제조될 수 있다. 본 발명의 건강기능식품 조성물은 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용 시 발생할 수 있는 부작용 등이 없는 장점이 있고, 휴대성이 뛰어나, 피부 미백 효과를 증진시키기 위한 보조제로 섭취가 가능하다.
본 발명의 건강기능식품 조성물은 정제, 과립, 분말, 캅셀, 액상의 용액 및 환으로 이루어진 군으로부터 선택된 어느 하나의 제형으로 제조된 것일 수 있다.
본 발명에 따른 건강기능식품 조성물은 카르본(carvone) 또는 이의 염을 유효성분으로 포함시켜 분말제, 액제, 정제, 연질캅셀제, 과립제, 티백차, 인스턴트 차 또는 드링크제 등의 형태로 제형화될 수 있다. 유효성분으로서의 카르본 또는 이의 염의 함량은 그 사용 목적(예방 또는 개선용)에 따라 적합하게 결정될 수 있다. 일반적으로, 건강기능식품 조성물 중에 포함되는 상기 유효성분(카르본 또는 이의 염)의 양은 전체 식품 중량의 0.1 내지 20 중량%로 가할 수 있다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있다. 또한, 본 발명에 따른 건강기능식품 조성물은 상기 유효성분 이외에 본 발명이 목적으로 하는 주효과를 손상시키지 않는 범위 내에서 바람직하게는 주효과에 상승효과를 줄 수 있는 다른 성분 예를 들면, 비타민 C와 같은 미백 개선용 화합물 또는 녹차 추출물, 닥나무 추출물, 감초추출물, 상백피 추출물, 빈랑자 추출물, 황금 추출물, 산삼 추출물 등의 천연물을 함유하는 것도 무방하다.
상기와 같은 형태로 제형화된 건강기능식품 조성물은 식품에 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 식품의 예로는 드링크제, 육류, 소시지, 빵, 비스킷, 떡, 초콜릿, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 알코올 음료 및 비타민 복합제, 유제품 및 유가공 제품 등이 있으며, 통상적인 의미에서의 건강기능식품은 모두 포함한다.
본 발명의 건강기능식품 조성물이 드링크제인 경우는 지시된 비율로 필수성분으로서 카르본 또는 이의 염을 함유하며, 그 밖의 드링크제 제조를 목적으로 사용되는 다른 성분에는 특별한 제한이 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상기한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 상술한 것 이외의 향미제로서 천연 향미제 및 합성 향미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 ㎖당 일반적으로 약 1 내지 20 g, 바람직하게는 약 5 내지 12 g이다.
또한 본 발명의 건강기능식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에도 본 발명의 본 발명의 식품 조성물은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 유효성분(카르본 또는 이의 염) 100 중량부 당 0.1 내지 약 20 중량부의 범위에서 선택되는 것이 일반적이다.
또한 본 발명은, 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 색소 침착의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 카르본 또는 이의 염의 함량은 조성물의 총 중량을 기준으로 각각 0.0001 내지 20 중량% 인 것이 바람직하다. 20 중량%를 초과하는 경우에는 효과의 변화가 미미하거나 기존에 알려진 독성을 나타낼 수 있고, 0.0001% 미만의 경우에는 그 작용효과가 미미하다.
본 발명의 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 의약품으로 사용하는 경우, 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 함유할 수 있다. 예컨대, 공지의 미백 성분을 포함할 수 있을 것이다. 추가적인 미백 성분을 포함하게 되면 본 발명의 조성물의 피부 미백 효과는 더욱 증진될 수 있다. 상기 성분 추가 시에는 복합 사용에 따른 피부 안전성, 제형화의 용이성, 유효성분들의 안정성을 고려할 수 있다. 본 발명의 일실시예에서, 상기 의약품 조성물은 당업계에 공지된 미백 성분으로서, 비타민 C 등을 추가로 포함할 수 있다. 추가의 미백 개선 성분은 전체 조성물 중량에 대하여 0.0001 내지 10 중량%로 포함될 수 있을 것이며, 상기 함량 범위는 티로시나아제의 활성 억제 효과, 피부 안전성, 상기 화학식 1의 화합물의 제형화 시의 용이성 등의 요건에 따라 조절될 수 있을 것이다.
또한, 본 발명의 피부 색소 침착의 예방 또는 치료용 약학적 조성물은 약학적으로 허용 가능한 담체를 더 포함할 수 있다.
약학적으로 허용되는 담체는 완충액, 주사용 멸균수, 일반 식염수 또는 인산염 완충 식염수, 슈크로스, 히스티딘, 염 및 폴리솔베이트 등과 같은 여러 성분을 함유할 수 있다.
본 발명의 약학적 조성물은 경구 또는 비경구로 투여할 수 있으며, 일반 의약품 제제의 형태, 예를 들어, 임상투여 시 경구 및 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다.
경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 약학적 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(Calcium carbonate), 수크로스(Sucrose) 또는 락토오스(Lactose), 젤라틴 등을 섞어 조제될 수 있다.
단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌 글리콜(Propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 약학적 조성물은 유효량의 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 포함할 때 바람직한 피부 색소 침착의 예방 또는 치료를 제공할 수 있다. 본 발명에 있어서, '유효량'이라 함은 피부 색소 침착이 생성되는 것을 억제 또는 저해하거나, 이미 생성된 색소를 완화시킬 수 있는 화합물의 양을 의미한다. 본 발명의 조성물에 포함되는 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염의 유효량은 조성물이 제품화되는 형태, 상기 화합물이 피부에 적용되는 방법 및 피부에 머무르는 시간 등에 따라 달라질 수 있다. 예컨대, 상기 조성물이 피부의 색소 침착 등에 따른 피부과적 치료를 위한 의약품으로 제품화되는 경우에는 일상적으로 피부에 적용하게 되는 화장품으로 제품화되는 경우에 비해 높은 농도로 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 포함할 수 있을 것이다.
본 발명에 따른 약학적 조성물의 바람직한 투여량은 환자의 상태, 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나, 바람직한 효과를 위해서는 1일 0.0001 내지 2,000 mg/kg으로, 바람직하게는 0.001 내지 2,000 mg/kg으로 투여할 수 있다. 투여는 하루에 한 번 투여할 수도 있고, 수회 나누어서 투여할 수도 있다. 다만, 상기 투여량에 의해서 본 발명의 범위를 한정하는 것은 아니다.
또한 본 발명은, 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 색소 침착의 예방 또는 개선용 의약외품 조성물을 제공한다.
본 발명에서 사용되는 용어 "의약외품"은 사람이나 동물의 질병을 진단, 치료, 개선, 경감, 처치 또는 예방할 목적으로 사용되는 물품들 중 의약품보다 작용이 경미한 물품들을 의미하는 것으로, 예를 들어 약사법에 따르면 의약외품이란 의약품의 용도로 사용되는 물품을 제외한 것으로, 사람ㆍ동물의 질병 치료나 예방에 쓰이는 제품, 인체에 대한 작용이 경미하거나 직접 작용하지 않는 제품 등이 포함된다.
본 발명의 의약외품 조성물은 피부 색소 침착의 예방 또는 개선을 목적으로 사용되는 것으로, 그 제형에 있어서 특별히 한정되는 바가 없으며, 예를 들면, 유연화장수, 영양화장수, 마사지크림, 영양크림, 팩, 마스크팩, 마스크시트, 젤 또는 피부 점착타입 화장료의 제형을 갖는 화장료 조성물일 수 있으며, 또한, 로션, 연고, 겔, 크림, 패취 또는 분무제와 같은 경피투여형 제형일 수 있다.
또한, 각 제형에 있어서 의약외품 조성물은 다른 성분들을 기타 의약외품의 제형 또는 사용목적 등에 따라 임의로 선정하여 배합할 수 있다. 유효 성분의 혼합양은 사용 목적(억제 또는 완화)에 따라 적합하게 결정될 수 있다. 예를 들어, 점증제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제, 및 담체 등을 포함할 수 있다.
본 발명의 카르본 또는 이의 염의 함량은 의약외품 조성물의 총 중량을 기준으로 각각 0.0001 내지 20 중량%인 것이 바람직하다. 20 중량%를 초과하는 경우에는 조성물 제조 시 색상 및 안정성이 떨어질 수 있고, 0.0001% 미만의 경우에는 그 작용효과가 미미하다.
또한, 각 제형의 의약외품 조성물에 있어서, 상기한 필수 성분 이외의 다른 성분들은 제형 또는 사용목적 등에 따라 당업자가 어려움 없이 적의 선정하여 배합할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세하게 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예: B6F10 멜라닌세포(B6F10 melanocyte)를 이용한 카르본의 멜라닌 생성 억제 효능 평가
1-1. 실험방법
1) 실험재료 및 세포배양
본 실험에서 사용된 α-MSH (alpha-melanocyte stimulating hormone) 및 카르본(carvone)은 모두 Sigma Aldrich(St Louis, MO, USA) 사에서 구입하였다. B16F10 멜라닌세포(B16F10 melanocyte)는 ATCC사(Manassas, VA, USA)에서 구입하여 사용하였으며, 구입한 세포는 10 % FBS(fetal bovin serum)가 포함된 DMEM(Dulbecco's Modified Eagle's Media) 배지를 이용하여 37℃, 5% CO2 인큐베이터에서 배양하였다.
2) 세포 내 멜라닌 생성량 측정
B6F10 멜라닌세포를 10% FBS가 포함된 DMEM배지에서 37℃, 5% CO2 조건에서 배양 후 6 웰 플레이트에 1×105 cells/well로 분주하여 세포를 부착시켰다. 정상세포는 멜라닌 생성을 유도하는 α-MSH를 처리하지 않은 세포로, 대조세포는 α-MSH(100 nM)를 처리한 세포로 설정하였다. 상기 조건으로 배양한 세포에 α-MSH(100 nM)와 함께 카르본(100 μM)을 처리하고 48 시간 동안 배양하였다.
이후 PBS(phosphate buffered saline)로 2회 세척 후 세포를 회수하였다. 회수한 세포는 1,000 rpm으로 5 분간 원심분리 후 육안으로 펠릿(pellet) 색을 관찰하였다. 이후 세포 펠릿은 10% DMSO가 첨가된 1N NaOH 용액 200 μL을 넣어 용해시킨 다음 마이크로플레이트 판독기(microplate reader)로 400 nm에서 흡광도를 측정하였다.
3) RNA 추출 및 PCR 분석
총 RNA는 트리졸(Trizol)을 이용하여 세포에서 추출하였으며, 추출된 RNA 시료를 대상으로 dT 프라이머(oligo dT primer)와 역전사 효소(superscript reverse transcriptase, GIBCO BRL, Gaithersburg, MD, USA)를 이용하여 역전사(reverse transcription)를 수행하여 cDNA를 합성하였다. 역전사(reverse transcription)를 통해 얻은 cDNA를 주형(template)으로 하고 증폭하고자 하는 유전자 cDNA의 5'과 3'플랭킹 서열(flanking sequence)을 프라이머로 하며, iQ SYBR green supermix (Bio-Rad)와 CFX Connect™ Real-Time PCR Detection System (Bio-Rad)을 사용하여 정량적 PCR을 수행하였다. 이때 사용된 프라이머 서열(primer sequence)은 [표 1]에 나타내었다.
| Gene description | 프라이머 | 서열 (5’→3') | 어닐링 온도(℃) | PCR 산물 (bp) |
| Tyrosinase | F | CTCTGGGCTTAGCAGTAGGC(서열번호 1) | 55 | 164 |
| R | GCAAGCTGTGGTAGTCGTCT(서열번호 2) | |||
| MITF (microphthalmia transcription factor) | F | AGCGTGTATTTTCCCCACAG(서열번호 3) | 55 | 103 |
| R | TAGCTCCTTAATGCGGTCGT (서열번호 4) | |||
| GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) | F | CAAAATGGTGAAGGTCGGTG(서열번호 5) | 55 | 104 |
| R | TTTGCCGTGAGTGGAGTCAT(서열번호 6) |
1-2. 실험결과
1) B6F10 멜라닌세포(B16F10 melanocyte)에서 카르본의 멜라닌 생성 억제 효과
멜라닌은 멜라닌 세포 내 세포 소기관인 멜라노좀에서 합성이 개시되며 자외선에 노출되면 멜라닌 세포가 활성화되면서 일련의 효소반응을 거쳐 생성된다.
B6F10 멜라닌세포의 펠릿(pellet) 색을 육안적으로 관찰한 결과, α-MSH를 처리한 대조세포의 펠릿은 α-MSH를 처리하지 않은 정상세포의 펠릿에 비해 검은색으로 변한 것을 확인하였다. α-MSH와 함께 카르본을 처리한 세포 펠릿의 색은 α-MSH만 처리한 대조세포에 비해 현저히 옅어진 것을 확인할 수 있었다(도 1). 이를 녹여서 색을 정량한 결과, α-MSH를 처리한 대조세포의 멜라닌 함량은 α-MSH를 처리하지 않은 정상세포에 비해 136% 유의적으로 증가하였다. 한편, α-MSH와 함께 카르본을 처리한 세포에서 멜라닌 함량은 대조세포에 비해 29% 유의적으로 감소한 것을 확인하였다(도 2). 따라서, 카르본의 멜라닌 생성 저해 효과가 우수함을 알 수 있다.
2) B6F10 멜라닌세포에서 유전자 발현변화를 통한 멜라닌 생성 억제 확인
티로시나아제는 멜라닌세포 내 멜라닌 합성의 초기단계에 작용하여 멜라닌 합성 속도를 조절하는 것으로 잘 알려져 있으며, MITF는 티로시나아제의 유전자 프로모터(gene promotor)에 존재하는 E-box (CATGTG)에 결합하여 효소 발현을 유도하는 것으로 알려져 있다.
카르본의 멜라닌 생성 억제 효과가 티로시나아제와 같은 효소 발현 억제와 전사 인자(transcription factor)인 MITF 발현 조절과 관련되었는지 확인하고자 B6F10 멜라닌세포에서 PCR 분석을 수행하였다. 그 결과, 정상세포(basal)에 비해 α-MSH를 처리한 대조세포에서 MITF 및 티로시나아제의 발현이 유의적으로 증가한 것을 확인하였으며, α-MSH와 함께 카르본을 처리한 세포에서는 대조세포에 비해 MITF 및 티로시나아제의 발현이 각각 36%, 31% 유의적으로 감소한 것을 확인하였다(도 3).
이하, 본 발명에 따른 상기 카르본을 유효성분으로 함유하는 의약품, 식품 또는 화장품의 제조예를 설명하나, 본 발명은 이를 한정하고자 함이 아닌 단지 구체적으로 설명하고자 함이다. 하기와 같은 조성성분 및 조성비에 따라 제조예 1 내지 3의 의약품, 식품 또는 화장료 조성물을 통상적인 방법에 따라서 제조하였다.
[제조예 1] 화장품의 제조
1-1. 유연 화장수의 제조
하기 표 2의 조성으로, 카르본을 함유하는 유연 화장수를 제조하였다.
| 조성 | 제조예 1-1(중량%) |
| 카르본 | 0.1 |
| 에탄올 | 10.0 |
| 폴리라우린산 폴리옥시에틸렌 소르비탄 | 1.0 |
| 파라옥시안식향산메칠 | 0.2 |
| 글리세린 | 5.0 |
| 1,3-부틸렌글리콜 | 6.0 |
| 향 | 적량 |
| 색소 | 적량 |
1-2. 영양 화장수의 제조
하기 표 3의 조성으로, 카르본을 함유하는 영양 화장수를 제조하였다.
| 조성 | 제조예 1-2(중량%) |
| 카르본 | 0.05 |
| 와셀린 | 2.0 |
| 세스퀴올레인산소르비탄 | 0.8 |
| 폴리옥시에틸렌올레일에틸 | 1.2 |
| 파라옥시안식향산메칠 | 적량 |
| 프로필렌글리콜 | 5.0 |
| 에탄올 | 3.2 |
| 카르복시비닐폴리머 | 18.0 |
| 수산화칼륨 | 0.1 |
| 색소 | 적량 |
| 향 | 적량 |
1-3. 영양 크림의 제조
하기 표 4의 조성으로, 카르본을 함유하는 영양 크림을 제조하였다.
| 조성 | 제조예 1-3(중량%) |
| 카르본 | 0.2 |
| 스테아린산 | 15.0 |
| 세탄올 | 1.0 |
| 수산화칼륨 | 0.7 |
| 글리세린 | 5.0 |
| 프로필렌글리콜 | 3.0 |
| 방부제 | 적량 |
| 향 | 적량 |
| 정제수 | to 100 |
1-4. 팩의 제조
하기 표 5의 조성으로, 카르본을 함유하는 팩을 제조하였다.
| 조성 | 제조예 1-4(중량%) |
| 카르본 | 0.05 |
| 글리세린 | 5.0 |
| 프로필렌글리콜 | 4.0 |
| 폴리비닐알코올 | 15.0 |
| 에탄올 | 8.0 |
| 폴리옥시에틸렌올레일에칠 | 1.0 |
| 파라옥시안식향산메칠 | 0.2 |
| 색소 | 적량 |
| 향 | 적량 |
1-5. 에센스의 제조
하기 표 6의 조성으로, 카르본을 함유하는 에센스를 제조하였다.
| 조성 | 제조예 1-5(중량%) |
| 카르본 | 0.2 |
| 프로필렌글리콜 | 10.0 |
| 글리세린 | 10.0 |
| 히아루론산나트륨수용액(1%) | 5.0 |
| 에탄올 | 5.0 |
| 폴리옥시에틸렌경화피마자유 | 1.0 |
| 파라옥시안식향산메칠 | 0.1 |
| 향 | 적량 |
| 정제수 | to 100 |
[제조예 2] 건강기능식품의 제조
2-1. 건강기능식품의 제조
하기 표 7의 조성으로, 카르본을 함유하는 건강기능식품을 제조하였다.
| 조성 | 제조예 2-1 |
| 카르본 | 1000 ㎎ |
| 비타민 혼합물 | 적량 |
| 비타민 A 아세테이트 | 1.0 ㎎ |
| 비타민 E | 0.13 ㎎ |
| 비타민 B1 | 0.15 ㎎ |
| 비타민 B2 | 0.5 ㎎ |
| 비타민 B6 | 0.2 ㎍ |
| 비타민 B12 | 10 ㎎ |
| 비타민 C | 10 ㎍ |
| 비오틴 | 1.7 ㎎ |
| 니코틴산아미드 | 50 ㎍ |
| 엽산 | 0.5 ㎎ |
| 판토텐산 칼슘 | 적량 |
| 무기질 혼합물 | 적량 |
| 황산제1철 | 1.75 ㎎ |
| 산화아연 | 0.82 ㎎ |
| 탄산마그네슘 | 25.3 ㎎ |
| 제1인산칼륨 | 15 ㎎ |
| 제2인산칼륨 | 55 ㎎ |
| 구연산칼륨 | 90 ㎎ |
| 탄산칼슘 | 100 ㎎ |
| 염화마그네슘 | 24.8 ㎎ |
상기 비타민 및 미네랄 혼합물의 조성비는 비교적 건강기능식품에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만, 그 배합비를 임의로 변형 실시하여도 무방하며, 통상의 건강기능식품 제조방법에 따라 상기의 성분을 혼합한 다음, 과립을 제조하고, 통상의 방법에 따라 건강기능식품 조성물 제조에 사용할 수 있다.
2-2. 건강 음료의 제조
하기 표 8의 조성으로, 카르본을 함유하는 건강 음료를 제조하였다.
| 조성 | 제조예 2-2(mg) |
| 카르본 | 1000 ㎎ |
| 구연산 | 1000 ㎎ |
| 올리고당 | 100 g |
| 매실농축액 | 2 g |
| 타우린 | 1 g |
| 정제수 | 적량 |
통상의 건강 음료 제조방법에 따라 상기의 성분을 혼합한 다음, 약 1시간 동안 85 에서 교반 가열한 후 만들어진 용액을 여과하여 멸균된 21 용기에 취득하여 밀봉 멸균한 뒤 냉장 보관한 다음 볼 발명의 건강 음료 조성물의 제조에 사용한다. 상기 조성비는 비교적 기호음료에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만, 수요계층, 수요국가, 사용용도 등 지역적, 민족적 기호도에 따라서 그 배합비를 임의로 변형 실시하여도 무방하다.
2-3. 정제의 제조
하기 표 9의 조성으로, 통상의 정제 제조방법에 따라 타정하여 카르본을 함유하는 정제를 제조하였다.
| 조성 | 제조예 2-3(mg) |
| 카르본 | 100 ㎎ |
| 옥수수 전분 | 100 ㎎ |
| 유당 | 100 ㎎ |
| 스테아린산 마그네슘 | 2 ㎎ |
2-4. 캡슐제의 제조
하기 표 10의 조성으로, 통상의 캡슐제 제조방법에 따라 젤라틴 캡슐에 충전하여 카르본을 함유하는 캡슐제를 제조하였다.
| 조성 | 제조예 2-4(mg) |
| 카르본 | 100 ㎎ |
| 옥수수 전분 | 100 ㎎ |
| 유당 | 100 ㎎ |
| 스테아린산 마그네슘 | 2 ㎎ |
2-5. 환의 제조
하기 표 11 조성으로, 통상의 환 제조 방법에 따라 1환 당 4 g이 되도록 환을 제조하였다.
| 조성 | 제조예 2-5(mg) |
| 카르본 | 1 g |
| 유당 | 1.5 g |
| 글리세린 | 1 g |
| 자일리톨 | 0.5 g |
2-6. 과립의 제조
하기 표 12의 조성으로, 30% 에탄올 100 ㎎을 첨가하여 섭씨 60도에서 건조하여 과립을 형성한 후 포에 충진하여 과립을 제조하였다.
| 조성 | 제조예 2-6(mg) |
| 카르본 | 150 ㎎ |
| 대두추출물 | 50 ㎎ |
| 포도당 | 200 ㎎ |
| 전분 | 600 ㎎ |
[제조예 3]
피부 외용 연고의 제조
하기 표 13의 조성으로, 카르본을 함유하는 피부 외용 연고를 제조하였다.
| 조성 | 제조예 3(중량%) |
| 카르본 | 0.5 |
| 디에틸 세바케이트 | 8.0 |
| 경납 | 5.0 |
| 폴리옥시에틸렌올레일에테르 포스페이트 | 6.0 |
| 벤조산 나트륨 | 적량 |
Claims (9)
- 카르본(carvone) 또는 이의 화장품학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 미백용 화장료 조성물.
- 청구항 1에 있어서,상기 유효성분은 MITF(microphthalmia transcription factor) 또는 티로시나아제의 발현을 억제하는 것을 특징으로 하는 피부 미백용 화장료 조성물.
- 청구항 1에 있어서,상기 유효성분은 멜라닌 세포 자극 호르몬 (Melanocyte-Stimulating Hormone, α-MSH)에 의해 유도되는 멜라닌 생성을 억제하는 것을 특징으로 하는 화장료 조성물.
- 카르본(carvone) 또는 이의 식품학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 미백용 건강기능식품 조성물.
- 청구항 4에 있어서,상기 조성물은 정제, 과립, 분말, 캅셀, 액상의 용액 및 환으로 이루어진 군에서 선택되는 어느 하나의 제형으로 제조된 것을 특징으로 하는 건강기능식품 조성물.
- 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 색소 침착의 예방 또는 치료용 약학적 조성물.
- 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 피부 색소 침착의 예방 또는 개선용 의약외품 조성물.
- 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 조성물을 개체에 투여 또는 복용시키는 단계를 포함하는 피부 색소 침착의 예방 또는 치료 방법.
- 카르본(carvone) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 조성물의 피부 색소 침착의 예방 또는 치료 용도.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17/619,641 US20220370317A1 (en) | 2019-06-17 | 2020-06-16 | Composition for skin whitening, comprising carvone or salt thereof as active ingredient |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020190071589A KR102076933B1 (ko) | 2019-06-17 | 2019-06-17 | 카르본 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물 |
| KR10-2019-0071589 | 2019-06-17 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020256380A1 true WO2020256380A1 (ko) | 2020-12-24 |
Family
ID=69569873
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2020/007779 Ceased WO2020256380A1 (ko) | 2019-06-17 | 2020-06-16 | 카르본 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물 |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US20220370317A1 (ko) |
| KR (1) | KR102076933B1 (ko) |
| WO (1) | WO2020256380A1 (ko) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102076933B1 (ko) * | 2019-06-17 | 2020-02-12 | 연세대학교 산학협력단 | 카르본 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물 |
| WO2025187455A1 (ja) * | 2024-03-08 | 2025-09-12 | 株式会社 資生堂 | メラノサイトに対する紫外線の影響の抑制剤 |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2003176221A (ja) * | 2001-09-28 | 2003-06-24 | Lion Corp | 皮膚外用剤 |
| US20100305214A1 (en) * | 2007-09-26 | 2010-12-02 | Aisa Therapeutics | Use of a Monoterpene to Increase Tissue Repair |
| KR20150139688A (ko) * | 2014-06-03 | 2015-12-14 | 조정희 | 미백 활성을 갖는 당유자 추출물 및 이를 유효성분으로 포함하는 화장료 조성물 |
| KR20180117252A (ko) * | 2017-04-18 | 2018-10-29 | 한국 한의학 연구원 | 스피노신을 포함하는 피부 미백용 조성물 |
| KR20180117253A (ko) * | 2017-04-18 | 2018-10-29 | 한국 한의학 연구원 | 스워티아자포닌을 포함하는 피부 미백용 조성물 |
| KR102076933B1 (ko) * | 2019-06-17 | 2020-02-12 | 연세대학교 산학협력단 | 카르본 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물 |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11123279B2 (en) * | 2016-01-19 | 2021-09-21 | Achromaz Pte. Ltd. | Cosmetic composition and the use thereof for regulating skin quality |
-
2019
- 2019-06-17 KR KR1020190071589A patent/KR102076933B1/ko active Active
-
2020
- 2020-06-16 WO PCT/KR2020/007779 patent/WO2020256380A1/ko not_active Ceased
- 2020-06-16 US US17/619,641 patent/US20220370317A1/en not_active Abandoned
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2003176221A (ja) * | 2001-09-28 | 2003-06-24 | Lion Corp | 皮膚外用剤 |
| US20100305214A1 (en) * | 2007-09-26 | 2010-12-02 | Aisa Therapeutics | Use of a Monoterpene to Increase Tissue Repair |
| KR20150139688A (ko) * | 2014-06-03 | 2015-12-14 | 조정희 | 미백 활성을 갖는 당유자 추출물 및 이를 유효성분으로 포함하는 화장료 조성물 |
| KR20180117252A (ko) * | 2017-04-18 | 2018-10-29 | 한국 한의학 연구원 | 스피노신을 포함하는 피부 미백용 조성물 |
| KR20180117253A (ko) * | 2017-04-18 | 2018-10-29 | 한국 한의학 연구원 | 스워티아자포닌을 포함하는 피부 미백용 조성물 |
| KR102076933B1 (ko) * | 2019-06-17 | 2020-02-12 | 연세대학교 산학협력단 | 카르본 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물 |
Also Published As
| Publication number | Publication date |
|---|---|
| US20220370317A1 (en) | 2022-11-24 |
| KR102076933B1 (ko) | 2020-02-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2020060060A1 (ko) | 병풀 부정근 추출물을 유효성분으로 함유하는 피부 미백 및 주름개선용 화장료 조성물 | |
| KR20210108911A (ko) | 로즈마리 이온성 액체 추출물을 포함하는 항산화 또는 미백용 조성물 | |
| WO2021080129A1 (ko) | 하이드란제놀 또는 필로둘신을 유효성분으로 하는 피부장벽 강화 및 아토피 피부염 개선용 조성물 | |
| WO2021215882A1 (ko) | 동백나무 과피 추출물을 유효성분으로 포함하는 탈모 방지 또는 발모 촉진용 조성물 | |
| WO2016117762A1 (ko) | 구스베리 추출물 또는 글루타티온을 포함하는 조성물 | |
| KR102094949B1 (ko) | 흑무 추출물, 이의 분획물, 또는 이로부터 분리된 화합물을 포함하는 미백용 조성물 | |
| WO2023022540A1 (ko) | 밀크씨슬 꽃 추출물을 유효성분으로 포함하는 탈모 방지 또는 발모 촉진용 조성물 | |
| KR102076933B1 (ko) | 카르본 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물 | |
| JP4115656B2 (ja) | エルゴステロール誘導体からなるメラニン生成抑制剤及び美白剤 | |
| WO2020256381A1 (ko) | 옥타데센 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물 | |
| KR20100028202A (ko) | 밀몽화 추출물을 포함하는 피부미백 활성을 갖는 조성물 | |
| KR102201305B1 (ko) | 눈빛승마 추출물 또는 이의 분획물을 포함하는 피부 미백용 조성물 | |
| WO2020197255A1 (en) | Composition for skin whitening comprising guaiacol, phytol and carvacrol as active ingredients | |
| US20220040122A1 (en) | Composition for allergy prevention, atopic dermatitis alleviation or skin regeneration, containing, as active ingredient, undecane or undecanal | |
| KR102012366B1 (ko) | 아슈와간다 캘러스 추출물을 포함하는 미백용 조성물 | |
| KR100755742B1 (ko) | 아크릴레이트계 화합물을 포함하는 피부 미백용 조성물 | |
| KR101827374B1 (ko) | 노화 및 노화 관련 질환의 예방, 개선 또는 치료용 조성물 | |
| WO2021167269A1 (ko) | 자두 씨 추출물을 유효성분으로 함유하는 미백용 조성물 | |
| US12285512B2 (en) | Composition comprising allulose as active ingredient for skin whitening | |
| KR102810314B1 (ko) | 큰세잎쥐손이 및 흰꽃나도사프란의 혼합추출물을 유효성분으로 포함하는 피부 미백용 화장료 조성물 및 멜라닌 색소 과다 침착 질환의 예방 또는 치료용 약제학적 조성물 | |
| KR101526435B1 (ko) | 머루근 추출물을 포함하는 미백용 조성물 | |
| KR102482196B1 (ko) | 천심련 추출물 또는 안드로그라폴라이드를 유효성분으로 포함하는 일주기 리듬 장애 예방 또는 개선을 위한 조성물 | |
| WO2019070087A1 (ko) | 푸사리세틴 화합물을 포함하는 피부 미백용 조성물 | |
| WO2019078662A2 (ko) | 데스모디움 스컥스 용매 추출물 또는 이의 분획물의 티로시나아제 저해 및 미백활성 | |
| WO2015152552A1 (ko) | 알파인 웜우드 추출물을 포함하는 조성물 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20827027 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 20827027 Country of ref document: EP Kind code of ref document: A1 |

