WO2020223762A1 - Methods for treating muscular dystrophy using inhibitory oligonucleotides to cd49d - Google Patents
Methods for treating muscular dystrophy using inhibitory oligonucleotides to cd49d Download PDFInfo
- Publication number
- WO2020223762A1 WO2020223762A1 PCT/AU2020/050445 AU2020050445W WO2020223762A1 WO 2020223762 A1 WO2020223762 A1 WO 2020223762A1 AU 2020050445 W AU2020050445 W AU 2020050445W WO 2020223762 A1 WO2020223762 A1 WO 2020223762A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- muscle
- cd49d
- subject
- oligonucleotide
- dose
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7115—Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
- A61K31/57—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
- A61K31/573—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
- A61K31/58—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
Definitions
- compositions and methods for modifying muscle performance enable compositions and methods for modifying muscle performance.
- Muscular Dystrophy is a group of disorders characterized by progressive weakness and wasting of specific muscle tissue (myonecrosis) and replacement of skeletal muscles with fibrous, bony or fatty tissue.
- muscle tissue myonecrosis
- MD Duchene muscular dystrophy
- LGMD limb girdle muscular dystrophy
- BMD Becker muscular dystrophy
- CMD congenital muscular dystrophy
- Almost all types of MD arise from single-gene mutations.
- DMD and BMD involve a defect in the dystrophin gene on the X-chromosome.
- the dystrophin protein serves to link the contractile machinery (actin filaments) of the muscle cell (sarcomeres) and the cytoskeleton with the extracellular matrix (ECM) where collagens transmit the muscle force (Grounds MD, 2008).
- the ECM is known to play a complex role in muscle function and muscle regeneration.
- Dystrophic myofibres are associated with necrosis, inflammation and fibrosis. The precise sequence of events leading to progressive disease as a result of dystrophin deficiency is not understood at the molecular level.
- DMD is a devastating condition which affects mainly boys with an incidence of about 1:3,500 live births. Boys may lose their ability to walk at an early age and become wheelchair bound typically post-pubescence. Death, often from cardiopulmonary compromise, frequently occurs in the 3 rd decade of life. BMD is similar to DMD but much milder.
- Corticosteroids have an acute anti-inflammatory effect which can be short term and their mechanism of action is not understood. They are less than optimal because side effects severely limit their use, and they may also cause muscle atrophy.
- Prednisolone at 0.75mg/kg/day and Deflazacort 0.9mg/kg/day are standard therapies for ambulant DMD patients but when boys become non-ambulant there is no consensus as to the benefits of corticosteroids (CS), and boys may stay on treatment, sometimes the fixed dose they were on when they lost ambulation, which is a reduced mg/kg/day dose or they may come off CS treatment.
- Edasalonexent in as an anti-inflammatory NF-kappa B drug undergoing development as a monotherapy in young ambulant boys with DMD.
- Oligonucleotide therapy for DMD by inducing targeted exon skipping of dystrophin gene has been assessed with mixed results.
- Eteplirsen a morpholino oligonucleotide has progressed to a confirmatory study in the 13% of DMD children with a genetic stop codon mutation in exon 51 amenable to exon 51 skipping whilst Drisapersen, a 2’-O- methyl phosphorothioate oligonucleotide for exon 51 skipping failed to achieve activity and FDA approval.
- Corticosteroid treatment is usually associated with a loss in limb performance (e.g., a reduced PUL 1 or PUL2 performance) in DMD.
- composition includes a single composition, as well as two or more compositions; reference to “an agent” includes one agent, as well as two or more agents; reference to “the disclosure” includes single and multiple aspects of the disclosure and so forth.
- the present disclosure enables a method of modifying muscle or limb performance in a subject.
- Reference herein to "modifying" muscle or limb performance includes improving muscle or limb performance and delaying progression of or maintaining or stabilising reduced muscle or limb performance.
- the subject has or is at risk of a condition associated with muscle atrophy, muscle fatty tissue, or pseudo hypertrophy or a muscular dystrophy.
- the disclosure is illustrated with a MD, however embodiments of the invention extend to conditions associated with muscle fatty tissue, muscle atrophy or hypertrophy.
- the method comprises periodically administering to the subject a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of an inhibitory oligonucleotide to CD49d (the alpha 4 chain of VLA-4) for a time and under conditions sufficient to modify one or more markers, signs or parameters of muscle fat, muscle performance or function, or limb performance or function in such a subject.
- the method comprises periodically administering to the subject a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of an inhibitory oligonucleotide to CD49d (the alpha 4 chain of VLA-4) for a time and under conditions sufficient to improve muscle fat, muscle or limb performance or function in such a subject suffering from a muscular dystrophy.
- the oligonucleotide is an RNA-DNA hybrid.
- oligonucleotide comprises the structure:
- each of the 19 intemucleotide linkages of the oligonucleotide is an O,O- linked phosphorothioate diester
- nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides
- nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- cytosines are 5-methylcytosines ( Me C)
- the subject has a muscular dystrophy and the method improves one or more markers, signs or symptoms of muscular dystrophy or delays progression (stabilises) of muscular dystrophy in the subject.
- the Performance of the Upper Limb (PUL) 2.0 or the earlier 1.2 scale are a functional scale designed to measure or assess the proximal to distal progression of muscle weakness and loss of limb function in subjects in a way that reflects real life loss of performance that affects day to day living and informs clinical treatment choices.
- the upper limb function tests were designed for non-ambulant MD subjects but apply to ambulant subjects. Equivalent measures of lower limb function follow the same principles for ambulant subjects experiencing loss of lower limb performance.
- the subject has elevated levels of CD49d+ T-cells prior to treatment.
- the method of treatment improves muscle or limb performance or delays decline in (stabilises) muscle or limb performance when the inhibitory oligonucleotide is administered as a monotherapy or in conjunction with corticosteroid treatment.
- the method improves muscle fatty tissue levels, muscle performance or delays decline in (stabilises) muscle fat, muscle performance wherein one or more markers, signs or parameters of muscle fat or muscle performance include strength, power, endurance, length in the subject with a condition associated with muscle pseudo hypertrophy, atrophy, or dystrophy.
- modified or enhanced/improved performance is enhanced or increased ability to conduct eccentric muscle contractions as described in the examples. This effects, for example, the ability to walk safely downstairs.
- the inventor has characterised a population of MD subjects that are more responsive to inhibitory oligonucleotide treatment and show improved or stable muscle or limb performance and improvements in muscle fatty tissue levels. These subjects are characterised by exhibiting an improved PUL2.0 score by dosing completion as described herein, and by exhibiting a post-dosing completion rebound or stability (maintenance) in the level of CD4+CD49d+ T-cells compared to control levels such as the level of CD4+CD49d+ T-cells during or by the end of the treatment course.
- rebound is meant the level of CD4+ CD49d+ T cells in the blood taken at or within approximately one week of the last dose is higher than or exceeds a control level such as the level of CD4+CD49d+ T-cells in blood prior to the end of dosing, when inhibitory oligonucleotide is still being administered.
- a control level such as the level of CD4+CD49d+ T-cells in blood prior to the end of dosing, when inhibitory oligonucleotide is still being administered.
- the presence of or extent of any rebound can be determined by comparing the post-dosing completion rebound level of CD49d+ T-cells or are marker thereof (such as a label intensity) with pre-determined control indicative of responder or non-responder status.
- the inventor has characterised a population of individual subjects that are less than optimally or poorly responsive to inhibitory oligonucleotide treatment, as exemplified with an antisense oligonucleotide to CD49d as a monotherapy or in conjunction with low dose corticosteroid, and show no improved muscle or limb performance as a result of the treatment with inhibitory oligonucleotide.
- These subjects are characterised by exhibiting substantially a no improved PUL2.0 score by dosing completion as described herein, or by exhibiting no post-dosing completion rebound in the level of CD4+ CD49d+ T-cells.
- rebound is meant the level of CD4+ CD49+ T- cells in the blood taken at or within approximately one week of the last dose is higher than or exceeds a control level such as the level of CD49d+ T-cells in blood prior to the end of dosing, when inhibitory oligonucleotide is still being administered.
- a control level such as the level of CD49d+ T-cells in blood prior to the end of dosing, when inhibitory oligonucleotide is still being administered.
- the presence of or extent of any rebound can be determined by comparing the post-dosing completion rebound level of CD49d+ T-cells or are marker thereof (such as a label intensity) with a pre-determined control indicative of responder or non responder status.
- non-responding subjects are characterised by exhibiting a post dosing period completion reduction in blood levels of CD4+CD49d+ T cells and associated with a sub optimal level of limb performance and/or loss of limb performance in response to/during inhibitory oligonucleotide therapy.
- one marker of modified muscle performance or function, or limb performance or function in an individual subject is the level of CD4+CD49d+ T cells wherein a post-dosing period completion rebound and/or stability (maintenance) in blood levels of CD4+CD49d+ T cells is associated with improved and/or stable limb performance, and a post-dosing period completion reduction in blood levels of CD4+CD49d+ T cells is associated with a sub optimal level of limb performance and/or loss of limb performance in response to/during inhibitory oligonucleotide therapy.
- improved limb performance is measured in a patient with DMD using a PUL score or clinically equivalent measure of upper limb performance
- the level of CD4+CD49d+ T cells is measured before the end of the dosing period and within one week of the previous dose during the dosing period.
- the subject is non-ambulatory due to MD.
- the subject is non-ambulatory due to DMD.
- the method further comprises measuring for the presence or absence of a post-dosing completion rebound and/or stability in blood levels of CD4+CD49d+ T cells in the subject, wherein the presence of the rebound and/or stability is associated with improved muscle and/or stable limb performance and the post dosing reduction in blood levels of CD4+CD49d+ cells, is associated with a sub optimal level of and/or loss of limb performance in response to antisense oligonucleotide therapy.
- the inhibitory oligonucleotide reduces the level of CD4+ CD49d+ T cells in a subject with DMD when administered at a low dose for 12 to 24 weeks and improves and/or stabilizes limb function as determined by PUL2.0 or a clinically acceptable equivalent in subjects that have a post-dosing completion rebound or stabilization in blood levels of CD4+CD49d+ within one week of completion of the previous dose.
- Such methods are useful as a step in a method of treatment, in methods of screening therapeutics, in methods of determining the responsiveness of a subject or population to a particular treatment or a particular agent, combination of agents or dosing regimen, or treatment at a particular dose or regimen, stratifying subjects or populations to optimise dose, agent, combinations of agents, dosing period and the like.
- the specification enables a method for assessing whether a subject is likely to respond to treatment with antisense oligonucleotide to CD49d by exhibiting improved muscle or limb function according to an improved PUL 1/2 score.
- the specification enables a method for assessing whether a subject is likely to respond to monotherapy treatment with antisense oligonucleotide to CD49d by exhibiting improved muscle or limb function according to an improved PUL1/2 score.
- the specification enables a method for assessing whether a subject is likely to respond to monotherapy treatment with low antisense oligonucleotide to CD49d by exhibiting improved muscle or limb function according to an improved PUL 1/2 score.
- the specification enables a method for assessing whether a subject is not likely to respond to treatment with antisense oligonucleotide to CD49d by exhibiting improved muscle or limb function as determined by or equivalent to an improved PUL1/2 score.
- a theranostic method for assessing whether an individual subject is likely or not to respond to a treatment with antisense oligonucleotide to CD49d by exhibiting improved muscle or limb function according to an improved PUL score or clinically equivalent score, the
- step (ii) administering a course of antisense oligonucleotide and repeating step (i) at least once towards the end of the dosing period;
- the course of antisense oligonucleotide is adjusted and the method is repeated, or wherein if the subject has displayed a post-dose completion rebound the same course of antisense oligonucleotide may be repeated.
- the course is adjusted by increasing the dose of inhibitory oligonucleotide administered.
- the inhibitory oligonucleotide is administered at between about 75mg to 300mg per week.
- the inhibitory oligonucleotide is administered or initially administered at a low dose of about 25-50mg/week for the course.
- administration or initial administration is a monotherapy or in combination with standard or low dose corticosteroid treatment.
- the method further comprises assessing baseline, and end of treatment, muscle or limb function by PUL or a clinically acceptable equivalent.
- the present disclosure provides inhibitory oligonucleotides or pharmaceutical compositions as described or claimed herein for use, or in the manufacture or preparation of a medicament or theranostic agent for use, in the therapeutic methods or theranostic methods described or claimed herein.
- the present disclosure enables the use of the inhibitory oligonucleotides as described or claimed herein in the manufacture or preparation of a medicament for use in the therapeutic methods or theranostic methods described or claimed herein.
- Figure 1A and 1B are a graphical representation of data illustrating the Grip strength at baseline and over the 6 weeks of treatment (mean and SEM) for test and control mice.
- Figure 2A and 2B are a graphical representation of data illustrating no observed difference between MDX high dose antisense drug treatment and other MDX or control treatments in muscle fatigue recovery. Each set of four columns in Figure 2B illustrates force production over time for, from left to right: MDX-saline; MDX-scrambled;
- MDX-high and MDX-low.
- Figure 3 is a graphical representation of data illustrating eccentric muscle contractions compared to wild type controls +/- SEM. High dose inhibitory oligonucleotide treatment delays muscle damage during eccentric contraction.
- Figure 4 is a graphical representation of data illustrating eccentric muscle contractions compared to MDX-saline treated mice.
- the high dose inhibitory oligonucleotide group showed significantly higher force producing capacity and drug delayed muscle damage compared to the MDX control group.
- Figure 5 is a graphical representation of data illustrating eccentric muscle contractions compared to MDX scrambled controls.
- High dose inhibitory oligonucleotide specifically delayed muscle damage and produced a greater muscle force following eccentric contraction compared to the scrambled negative control at the same dose.
- Figure 6 is a graphical representation of data illustrating the force produced after eccentric muscle contraction. While MDX controls generated about 50% less force that the initial force produced, mice injected with high dose inhibitory oligonucleotide generated significantly more force, i.e., about 70% of the initial force produced.
- Figure 7 is a graphical representation of data showing creatine kinase levels in the blood of WT and MDX-saline, scrambles and treated (High and Low dose) mice. A significant increase was seen in all MDX mice compared to wild type controls.
- Figure 8 is a tabulated and graphical representation of data illustrating a CD4+
- SEQ ID NO: 1 human a.4 integrin antisense compound (ATL1102)
- SEQ ID NO: 2 murine a.4 integrin antisense compound (ISIS348574)
- SEQ ID NO: 3 negative control for SEQ ID NO:2 (ISIS 358342)
- subject includes a human subject or individual diagnosed with MD or a clinical study model animal.
- subject includes human or non-human animal.
- the present disclosure provides methods for treatment of muscular dystrophy in a subject comprising administering an inhibitory oligonucleotide to human CD49d ((the alpha 4 chain of VLA-4).
- exemplary inhibitory oligonucleotides include isolated or synthetic antisense RNA or DNA, iRNA, siRNA or siDNA, miRNA, miRNA mimics, shRNA or DNA and antisense DNA or RNA or DNA:RNA hybrids.
- the present disclosure provides method of modifying muscle performance in a subject in need thereof, the method comprising periodically administering to the subject a pharmaceutical composition comprising a
- each of the 19 intemucleotide linkages of the oligonucleotide is an O,O- linked phosphorothioate diester
- nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides
- nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- cytosines are 5-methylcytosines ( Me C)
- administration is for a time and under conditions sufficient to improve one or more markers, signs or symptoms of muscular dystrophy or to delay progression of muscular dystrophy in a subject.
- administration is for a time and under conditions sufficient to improve one or more markers, signs or parameters of muscle performance or function, or limb performance or function in the subject.
- Reference herein to muscle performance includes motor performance and includes attributes such as strength, power, endurance and length in a condition associated with muscle atrophy, or pseudo hypertrophy or a muscular dystrophy.
- the specification enables a method for improving muscle performance or delaying decline in muscle performance in a subject with or at risk of a condition associated with muscle atrophy/pseudo hypertrophy or dystrophy the method comprising periodically administering to the subject a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of an oligonucleotide.
- the specification provides a method of treating or preventing muscular dystrophy or a condition associated with muscle atrophy/pseudo hypertrophy or dystrophy in a subject in need thereof, the method comprising periodically administering to the subject a therapeutically effective amount of an inhibitory oligonucleotide to human CD49d to improve muscle performance including one or two of muscle strength/force and limb function or to delay progression of decline in one or two of muscle strength/force and limb function in a subject with muscular dystrophy or a condition associated with muscle atrophy, pseudo hypertrophy or dystrophy or a subject at risk of developing a condition associated with muscle atrophy, pseudo hypertrophy or dystrophy.
- the pseudohypertrophy, atrophy, or dystrophy is immune mediated. In one embodiment the pseudohypertrophy, atrophy or dystrophy is inflammatory mediated. In one embodiment the condition may but may be a neural or other disease.
- administration is for a time and under conditions sufficient to improve one or more markers, signs or parameters of muscle fat or muscle
- muscle fat or muscle performance including strength, power, endurance, length in the subject with a condition associated with pseudohypertrophy, atrophy, or dystrophy.
- the improvements in muscle fat, muscle performance or function, or limb performance or function happens quickly within 6 to 8 or 6 to 12 weeks of initiating a monotherapy or combination treatment.
- administration is in combination with standard corticosteroid treatment.
- corticosteroid is administered at a low dose.
- Reference to a low dose corticosteroid includes 2/3 rd , 1/2, 1/4, and a 1/3 rd of the standard dose.
- corticosteroid is administered at a low dose.
- Reference to a low dose corticosteroid includes 4/5 th , 3/4 th , 2/3 rd , 1/2, 1/3 rd , 1/4, and a 1/5* of the standard dose.
- the corticosteroid dose is 10, 20, 30, 40, 50, 60, 70mg/kg/day oral prednisolone, or 10, 20, 40, 40, 50, 60, 70 or 80mg of deflazacort.
- administration of inhibitory oligonucleotide is therapeutically effective in the presence of a standard or a low dose of corticosteroid.
- administration of antisense oligonucleotide is therapeutically effective in the absence of corticosteroid.
- administration of antisense oligonucleotide is therapeutically effective in the absence of corticosteroid and wherein the subject is ambulant.
- administration of antisense oligonucleotide is therapeutically effective in the absence of corticosteroid and wherein the subject is non-ambulant.
- the present disclosure provides methods for modifying muscle performance comprising contacting muscle cells or tissues with an inhibitory oligonucleotide to human CD49d ((the alpha 4 chain of VLA-4).
- Muscle cells or tissues may be contacted ex vivo , topically or in vivo.
- the contacting is by administration of inhibitory oligonucleotide to a subject in need thereof in order to increase muscle performance or delay or reduce the rate of progression of muscular dystrophy.
- the muscle performance modified includes increased muscle strength, and or increased muscle function.
- increased muscle strength is increased eccentric contraction.
- Eccentric contraction is contraction while lengthening muscle fibres which is critical in walking and the controlled and pain free movement of limbs.
- the oligonucleotide is an RNA-DNA hybrid.
- the subject is non-ambulatory due to MD.
- the subject is post-pubescent.
- the method includes monitoring for CD4+ and/or CD 8+ T cell levels. In one embodiment the method includes monitoring for reduced CD4+ and/or CD8+ T cell levels. In one embodiment, the method includes monitoring for Ml macrophages or HLADR + monocytes. In one embodiment, the method includes monitoring for reduced M1 macrophages or HLADR+ monocytes.
- the method comprises determining the level or presence of one or more markers of MD or dystrophic myofibres include the level or number of immune cells or immunomodulatory factors produced thereby, the level of inflammatory markers or the level of markers of fibrosis or the level of markers of muscle status.
- the one or more markers of MD or MD progression or dystrophic myofibres include the level or number of immune cells or immunomodulatory factors produced thereby, the level of inflammatory markers or the level of markers of fibrosis
- markers of muscle performance or the level of markers of muscle status include muscle strength, power, endurance, and length function.
- Markers of muscle status include without limitation markers of motor muscle function, markers indicative of muscle fibrosis or the absence thereof, markers indicative of muscle degeneration or regeneration, markers of cardiac function and markers of pulmonary function.
- the improving one or more signs of MD or dystrophic myofibres includes improved limb function, body muscle function, cardiac and/or lung function.
- the method comprises determining the level or presence of one or more signs of MD or dystrophic myofibres.
- Illustrative signs include limb function, body muscle function, cardiac and lung function.
- the one or more symptoms of MD or dystrophic myofibres include quality of life factors such as energy levels, happiness, perceived ease of walking, upper limb function activities etc.
- the subject in need thereof includes subjects with a genetic and/or clinical diagnosis of MD and relatively low levels of dystrophic myofibres and inflammatory markers.
- the subject displays normal or only slightly elevated levels of inflammatory cells.
- Inflammatory cells include T cells (CD4, CD8), B-cells (CD-19), granulocytes, (neutrophils, basophils, and eosinophils).
- the subject displays normal or only slightly elevated levels of CD49d cells.
- the subject displays normal or only slightly elevated levels of CD49d T cells.
- the subject displays normal or only slightly elevated levels of immune cell markers such as CD3, CD4, CD8, CD49d, CD29 and HLA-DR.
- immune cell markers such as CD3, CD4, CD8, CD49d, CD29 and HLA-DR.
- Suitable methods of marker including cell or protein/nucleic acid or lipid analysis include without limitation flow cytometry, bead technologies and ELISA-based methods, chromatographic and/or MS methods, hybridization or sequencing based methods.
- the subject diagnosed with MD displays significantly elevated or acute levels of severely dystrophic myofibres accompanied by severe muscle necrosis and inflammation.
- the subject displays significantly elevated levels of CD49d T-cells relative to normal healthy controls.
- the form of MD in a subject is selected from the group consisting of Duchene muscular dystrophy (DMD), limb girdle muscular dystrophy (LGMD), Becker muscular dystrophy (BMD), congenital muscular dystrophy (CMD including Fukuyama Type congenital MD and congenital MD with myosin deficiency), fascioscapulohumeral, oculophayngeal, Emery-Dreifuss, and distal muscular dystrophy.
- the subject has DMD or BMD and is non-ambulatory.
- the subject has DMD or BMD and is post-pubescent.
- embodiments are contemplated directed to; pharmaceutical compositions when used in the presently described methods or uses, uses of the herein described compositions in the manufacture of a medicament for the treatment or prevention of a muscular dystrophy in a subject, pharmaceutical compositions for use in the presently described methods.
- the present disclosure provides for the use of an oligonucleotide comprising the structure:
- each of the 19 intemucleotide linkages of the oligonucleotide is an O,O- linked phosphorothioate diester
- nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides
- nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- cytosines are 5-methylcytosines ( Me C)
- the present disclosure provides for the use of an oligonucleotide comprising the structure:
- each of the 19 intemucleotide linkages of the oligonucleotide is an O,O- linked phosphorothioate diester
- nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides
- nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- cytosines are 5-methylcytosines ( Me C)
- the present disclosure provides for the use of an oligonucleotide comprising the structure:
- each of the 19 intemucleotide linkages of the oligonucleotide is an O,O- linked phosphorothioate diester
- nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides
- nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- cytosines are 5-methylcytosines ( Me C)
- enhanced muscle performance is associated with improvements in muscle performance or function, or limb performance of function within 6 to 8 weeks of initiating a monotherapy or combination treatment.
- muscle performance is muscle function or measured using known estimators of muscle function. In one embodiment, muscle performance is muscle strength or measured using known estimators of muscle strength.
- modified or enhanced performance is enhanced or increased ability to conduct eccentric muscle contractions as described in the examples.
- oligonucleotide comprising the structure:
- each of the 19 intemucleotide linkages of the oligonucleotide is an O,O- linked phosphorothioate diester
- nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides
- nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- cytosines are 5-methylcytosines ( Me C)
- a pharmaceutically acceptable salt or stereoisomer thereof for use in the treatment or prevention or to delay progression of muscular dystrophy in a subject wherein the delay in progression is associated with improvements in muscle performance or function, or limb performance of function within 6 to 8 weeks of initiating a monotherapy or combination treatment.
- the improvements in muscle performance or function, or limb performance of function happens quickly within 6 to 8 weeks of initiating a
- the present disclosure enables a method of treating muscular dystrophy in a subject in need thereof, the method comprising periodically
- administering to the subject a therapeutically effective amount of an inhibitory oligonucleotide to human CD49d to improve one or more markers, signs or symptoms of muscular dystrophy or to delay progression of muscular dystrophy in a subject.
- administration of antisense oligonucleotide is in combination with or an adjunctive treatment with standard or low dose corticosteroid treatment.
- corticosteroid is administered at a low dose.
- administration of antisense oligonucleotide is effective in the absence of corticosteroid therapy.
- an inhibitory oligonucleotide to human CD49d in the preparation of a medicament for improving one or more markers, signs or symptoms of muscular dystrophy or to delay progression of muscular dystrophy in a subject with muscular dystrophy.
- the improvements in muscle performance or function, or limb performance of function happens quickly within 6 to 8 weeks of initiating a monotherapy or combination treatment.
- a pharmaceutical composition comprising an inhibitory oligonucleotide to human CD49d for use in treating muscular dystrophy or delaying the progression of muscular dystrophy in a subject.
- CD4+CD49d+ T cell numbers at the end of treatment showed a post treatment rebound (week 28). These observations were linked to all 6 patient improvements- stabilization on PUL2 in DMD at week 24. When week 24 to week 28 dosing showed no CD4+CD49d+ T cell rebound, this was linked to all 2 patients worsening on PUL2 in DMD.
- a diagnostic blood test using for example, a RAPID or a flow/chip cytometry marker, can be used to simply indicate whether or not a subject is or is able to respond to antisense oligonucleotide treatment with increased muscle performance, or a stabilisation or delayed decline in muscle performance.
- the dose regimen can be changed for example to enhance the treatment. Treatment may also be stopped, either fully or for a period of time.
- a subsequent modified dose of inhibitory oligonucleotide is administered in the absence of a CD49d T cell rebound post dosing.
- a subsequent modified dose of corticosteroid is administered.
- antisense oligonucleotide is administered for at least 6 to 10 weeks to see effects on T-cells and muscle performance (eg. PUL2 function). After dosing ceases there is a rebound of CD49d+ cells which is positively associated with improved muscle performance, which can be assessed within a week of ceasing dosing or for up to about 4 to about 5 weeks thereafter. No rebound is observed in subjects who do not respond to therapy with an improved PUL score.
- DMD for example is often clinically diagnosed when infant motor milestones are delayed at 18 months.
- Early features of muscle weakness include a wide based gait, toe walking hyperlordosis of the spine, frequent falls, hypertrophy of muscles, such as the calf, deltoid, quadricepts, tongue masseters, difficulty getting up, arm weakness.
- Loss of ambulation typically occurs between 7 and 13 years of age in DMD, while later ambulation is characteristic of BMD. Cardiopulmonary deficits may also be apparent. Fatigue and speech development may also be delayed. However, no upper motor neurone signs or muscle fasciculation is observed.
- Diagnosis of DMD may be confirmed by dystrophin immunofluorescence testing and/or immunoblot showing dystrophin deficiency, and a clinical picture consistent with typical DMD.
- gene deletions test positive (missing one or more exons) of the dystrophin gene, where reading frame can be predicted as 'out-of-frame', and a clinical picture consistent with typical DMD is indicative.
- complete dystrophin gene sequencing may show a point mutation, duplication, or other mutation resulting in a stop codon mutation that can be definitely associated with DMD.
- a positive family history of DMD confirmed by one of the criteria listed above in a sibling or maternal uncle is also useful. Also used are assessments of DMD characteristic clinical symptoms or signs (e.g., proximal muscle weakness, Gowers' manoeuvre, elevated serum creatinine kinase level).
- Suitable improved markers, signs and symptoms of MD or dystrophic myofibres/improved muscle function will be known to those of skill in the art.
- Suitable tests include those for increased motor, muscle, cardiac, blood flow, lung function over time during treatment.
- cardiac efficacy based on serum biomarker response may be determined. This may be achieved by determining the levels of one or more markers such as myostatin ratio, cardiac troponins, cardiac BNP etc. eGFR changes may also be monitored.
- Other cardiac functions may be assessed by telemetry or rhythm abnormalities assessed by continuous mobile telemetry monitoring.
- Further tests include testing for muscle oxygenation parameters and mitochondrial phenotype.
- Reduced fibrosis may be assessed by MRI. Reduced muscle fat, reduced cardiac fibrosis, increased pinch strength, grip strength, improved cardiac and lung function tests. Other assessments look for a slowing in the rate of decline of the above functions.
- Quality of life questionnaires are very useful in determining the effect of treatments.
- Clinical outcomes may involve, for example, determining the percent change in normalized upper extremity reachable surface area, the percent change in cardiac circumferential strain by MRI, cardiac lateral and posterior wall strain is assessed.
- Another useful test is to measure forced vital capacity, delayed loss of respiratory function, such as change in FVC 5p from baseline by spirometry measurements.
- Motor function tests include determining the mean change in 4 standard stairs climb test before and after treatment, time to rise form floor, magnetic resonance spectroscopy mean change in fat fraction of vastus lateralis muscle at MRS, muscle testing of quadriceps, knee extensor peak torque measurement, ultrasound muscle microvascular blood supply to forearm.
- Important clinical assessments include time to walk/run 6 or 10 meters, time to climb 4 stairs, time to descend 4 stairs, time to stand from supine position. Changes in weight, height, BMI may also be assessed.
- antisense compound refers to an oligomeric compound that hybridizes to a nucleic acid molecule encoding the a4 integrin chain of VLA-4 (a4b1) and/or a4b7 integrin.
- the a4 integrin chain in humans is CD49d.
- the antisense compound may interfere with expression of CD49d, b1 integrin and/or b7 integrin.
- nucleic acid molecule encoding alpha4 integrin encompasses DNA encoding the a4 integrin chain of VLA-4 or a4b7 integrin, RNA (including pre- mRNA and mRNA or portions thereof) transcribed from such DNA, and further, cDNA derived from such RNA.
- VLA-4" refers to a heterodimer of an a4 integrin and a b1 integrin.
- VLA-4 is expressed at substantial levels on normal peripheral blood B and T cells, thymocytes, monocytes, and other cells, as well as on hematopoietic stem and progenitor cells.
- VLA-4 is also expressed on mesenchymal and endothelial progenitor cells and mesenchymal stem cells and potentially endothelial stem cells.
- Ligands for VLA-4 include vascular cell adhesion molecule-1 (VCAM-1) and CS-1, an alternately spliced domain within the Hep II region of fibronectin.
- a4b7 integrin refers to a heterodimer of an a4 integrin and ab7 integrin.
- a4b7 integrin identifies a subset of memory T cells with a tropism for the intestinal tract.
- a4b7 integrin and is also expressed on a subset of mast, lymphocyte and NK progenitor cells.
- a4b7 integrin is expressed on some stem and progenitor cells.
- Ligands for a4b7 integrin include MAdCam-1 and VCAM-1.
- nucleic acids include DNA (e.g., complementary DNA (cDNA), genomic DNA (gDNA)), RNA (e.g., message RNA (mRNA), short hairpin RNA (shRNA), iRNA, short inhibitory RNA (siRNA), ribosomal RNA (rRNA), tRNA, microRNA, DNA or RNA analogues (e.g., containing base analogues, sugar analogues and/or a non-native backbone and the like), RNA/DNA hybrids and polyamide nucleic acids (PNAs), all of which can be in single- or double-stranded form.
- DNA e.g., complementary DNA (cDNA), genomic DNA (gDNA)
- RNA e.g., message RNA (mRNA), short hairpin RNA (shRNA), iRNA, short inhibitory RNA (siRNA), ribosomal RNA (rRNA), tRNA, microRNA
- DNA or RNA analogues e.g.,
- the nucleic acid is isolated.
- isolated nucleic acid means a nucleic acid that is altered or removed from the natural state through human intervention.
- oligonucleotide broadly means a short nucleic acid molecule. Oligonucleotides readily bind, in a sequence- specific manner, to their respective complementary oligonucleotides, DNA, or RNA to form duplexes.
- oligonucleotides are five, six, seven, eight, nine, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides or more in length.
- oligonucleotides of the present disclosure are inhibitory oligonucleotides.
- the term "inhibitory oligonucleotide” refers to any oligonucleotide that reduces the production, expression or biological activity of one or more proteins.
- an inhibitory oligonucleotide can interfere with translation of mRNA into protein in a ribosome.
- an inhibitory oligonucleotide can be sufficiently complementary to either a gene or a mRNA encoding one or more proteins to bind to (hybridize with) a targeted gene(s) or mRNA thereby reducing expression or biological activity of the target protein.
- an inhibitory oligonucleotide inhibits the biological activity of an intracellular nucleic acid that does not code for a protein.
- an inhibitory oligonucleotide can inhibit the biological activity of a non-coding RNA.
- antisense means a sequence of nucleotides complementary to and therefore capable of binding to a coding sequence, which may be either that of the strand of a DNA double helix that undergoes transcription, or that of a messenger RNA molecule.
- Antisense DNA is the non-coding strand complementary to the coding strand in double-stranded DNA.
- short hairpin RNA or “shRNA” refer to an RNA structure having a duplex region and a loop region.
- small interfering RNA is a class of double-stranded or single stranded RNA molecules, about 19-25 base pairs in length.
- a siRNA that inhibits or prevents translation to a particular protein is indicated by the protein name coupled with the term siRNA.
- a siRNA in various embodiments is a double-stranded or single stranded nucleic acid molecule having about 19 to about 28 nucleotides (i.e. about 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides).
- iRNA refers to an agent that contains RNA and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway.
- RISC RNA-induced silencing complex
- double-stranded RNA or "dsRNA,” as used herein, includes an iRNA that includes an RNA molecule or complex of molecules having a hybridized duplex region that comprises two anti-parallel and substantially complementary nucleic acid strands, which will be referred to as having "sense” and “antisense” orientations with respect to a target RNA.
- the duplex region can be of any length that permits specific degradation of a desired target RNA through a RISC pathway, but will typically range from 9 to 36 base pairs in length, e.g., 15-30 base pairs in length.
- the duplex can be any length in this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 and any sub-range therein between, including, but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs,
- 19-21 base pairs 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs,
- dsRNAs generated in the cell by processing with Dicer and similar enzymes are generally in the range of 19-22 base pairs in length.
- One strand of the duplex region of a dsDNA comprises a sequence that is substantially complementary to a region of a target RNA.
- the two strands forming the duplex structure can be from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules.
- the molecule can have a duplex region separated by a single stranded chain of nucleotides (herein referred to as a "hairpin loop") between the 3 '-end of one strand and the 5'-end of the respective other strand forming the duplex structure.
- the hairpin loop can comprise at least one unpaired nucleotide; in some embodiments the hairpin loop can comprise at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides.
- RNA molecules are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than a hairpin loop, the connecting structure is referred to as a "linker.”
- linker The term “siRNA” is also used herein to refer to a dsRNA as described above.
- RNA molecule or “ribonucleic acid molecule” encompasses not only RNA molecules as expressed or found in nature, but also analogs and derivatives of RNA comprising one or more ribonucleotide/ribonucleoside analogs or derivatives as described herein or as known in the art.
- a "ribonucleoside” includes a nucleoside base and a ribose sugar
- a “ribonucleotide” is a ribonucleoside with one, two or three phosphate moieties.
- the terms “ribonucleoside” and “ribonucleotide” can be considered to be equivalent as used herein.
- the RNA can be modified in the nucleobase structure or in the ribose-phosphate backbone structure, e.g., as described herein below.
- the molecules comprising ribonucleoside analogs or derivatives must retain the ability to form a duplex.
- an RNA molecule can also include at least one modified ribonucleoside including but not limited to a 2'-O-methyl modified nucleoside, a nucleoside comprising a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a 2'-amino-modified nucleoside, 2'-alkyl-modified nucleoside, morpholino nucleoside, a phosphoramidate or a non-natural base comprising nucleoside, or any combination thereof.
- a 2'-O-methyl modified nucleoside a nucleoside comprising a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdec
- an RNA molecule can comprise at least two modified ribonucleosides, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20 or more, up to the entire length of the dsRNA molecule.
- the modifications need not be the same for each of such a plurality of modified ribonucleosides in an RNA molecule.
- modified RNAs contemplated for use in methods and compositions described herein are peptide nucleic acids (PNAs) that have the ability to form the required duplex structure and that permit or mediate the specific degradation of a target RNA via a RISC pathway.
- PNAs peptide nucleic acids
- miRNA is a small non-coding RNA molecule (containing about 22 nucleotides) found in plants, animals and some viruses, that functions in RNA silencing and post-transcriptional regulation of gene expression.
- miR The prefix “miR” is followed by a dash and a number, the latter often indicating order of naming.
- miRNAs with nearly identical sequences except for one or two nucleotides are annotated with an additional lower case letter.
- Numerous miRNAs are known in the art (miRBase V.21 nomenclature; see Kozomara et al. 2013; Griffiths- Jones, S. 2004). Sequences of these miRNAs are well known in the art and may be found, for example, on the world wide web at mirbase dot org.
- inhibitory oligonucleotides mimic the activity of one or more miRNA.
- miRNA mimic refers to small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA mimics can be obtained from various suppliers such as Sigma Aldrich and Thermo Fisher Scientific.
- inhibitory oligonucleotides inhibit the activity of one or more miRNA.
- miRNA species are suitable for this purpose. Examples include, without limitation, antagomirs, interfering RNA, ribozymes, miRNA sponges and miR-masks.
- antisense oligonucleotides that bind to a target miRNA and inhibit miRNA function by preventing binding of the miRNA to its cognate gene target.
- Antagomirs can include any base modification known in the art. In an example, the above referenced miRNA species are about 10 to 50 nucleotides in length.
- antagomirs can have antisense portions of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.
- the miRNA species are chimeric oligonucleotides that contain two or more chemically distinct regions, each made up of at least one nucleotide. These oligonucleotides typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
- beneficial properties such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target
- nucleic acids encompassed by the present disclosure are synthetic.
- synthetic nucleic acid means that the nucleic acid does not have a chemical structure or sequence of a naturally occurring nucleic acid.
- Synthetic nucleotides include an engineered nucleic acid molecule.
- the nucleic acid structure can also be modified into a locked nucleic acid (LNA) with a methylene bridge between the 2' Oxygen and the 4' carbon to lock the ribose in the 3'-endo (North) conformation in the A- type conformation of nucleic acids (Lennox et al 2011; Bader et al 2011). In the context of miRNAs, this modification can significantly increase both target specificity and hybridization properties of the molecule.
- LNA locked nucleic acid
- this modification can significantly increase both target specificity and hybridization properties of the molecule.
- Nucleic acids for use in the methods disclosed herein can be designed using routine methods as required.
- target segments of 5, 6, 7, 8, 9, 10 or more nucleotides in length comprising a stretch of at least five (5) consecutive nucleotides within the seed sequence, or immediately adjacent thereto, are considered to be suitable for targeting a gene.
- Exemplary target segments can include sequences that comprise at least the 5 consecutive nucleotides from the 5'- terminus of one of the seed sequence (the remaining nucleotides being a consecutive stretch of the same RNA beginning immediately upstream of the 5'-terminus of the seed sequence and continuing until the nucleic acid contains about 5 to about 30 nucleotides).
- target segments are represented by RNA sequences that comprise at least the 5 consecutive nucleotides from the 3'-terminus of one of the seed sequence (the remaining nucleotides being a consecutive stretch of the same RNA beginning immediately downstream of the 3 '-terminus of the target segment and continuing until the nucleic acid contains about 5 to about 30 nucleotides).
- seed sequence is used in the context of the present disclosure to refer to a 6-8 nucleotide (nt) long substring within the first 8 nt at the 5 -end of the miRNA (i.e., seed sequence) that is an important determinant of target specificity.
- inhibitory nucleic acid compounds are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient specificity (i.e., do not substantially bind to other non-target nucleic acid sequences), to give the desired effect.
- the methods of the present disclosure rely on the use of an antisense compound to a4 integrin.
- antisense compounds are targeted to nucleic acids encoding the a4 integrin chain of VLA-4 (a4b1) or a4b7 integrin.
- the antisense compound is an oligonucleotide.
- other oligomeric antisense compounds including but not limited to oligonucleotide mimetics are contemplated.
- Hybridization of an antisense compound with its target nucleic acid is generally referred to as "antisense”. Hybridization of the antisense compound with its target nucleic acid inhibits the function of the target nucleic acid. Such “antisense inhibition” is typically based upon hydrogen bonding-based hybridization of the antisense compound to the target nucleic acid such that the target nucleic acid is cleaved, degraded, or otherwise rendered inoperable.
- the functions of target DNA to be interfered with can include replication and transcription. Replication and transcription, for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise.
- RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA.
- Hybridization as used herein means pairing of complementary bases of the oligonucleotide and target nucleic acid.
- Base pairing typically involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases).
- Guanine (G) and cytosine (C) are examples of complementary nucleobases which pair through the formation of 3 hydrogen bonds.
- Adenine (A) and thymine (T) are examples of complementary nucleobases which pair through the formation of 2 hydrogen bonds. Hybridization can occur under varying circumstances.
- nucleoside is a base-sugar combination.
- the base portion of the nucleoside is normally a heterocyclic base.
- the two most common classes of such heterocyclic bases are the purines and the pyrimidines.
- Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar.
- Specifically hybridizable and “complementary” are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between the antisense compound and target nucleic acid. It is understood that the antisense compound need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable. An antisense compound is specifically hybridizable when binding of the antisense compound to the target nucleic acid interferes with the normal function of the target molecule to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non- target sequences under conditions in which specific binding is desired, for example, under physiological conditions in the case of therapeutic treatment.
- the antisense compound may hybridize over one or more segments, such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). In one embodiment, the antisense compound comprises at least 70% sequence complementarity to a target region within the target nucleic acid.
- an antisense compound in which 18 of 20 nucleobases are complementary to a target region within the target nucleic acid, and would therefore specifically hybridize would represent 90% complementarity.
- the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other, or to complementary nucleobases.
- an antisense compound which is 18 nucleobases in length having 4 non- complementary nucleobases which are flanked by 2 regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus, fall within the scope of the present disclosure.
- Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., 1990; Zhang and Madden, 1997).
- the present disclosure provides inter alia antisense oligonucleotides for inhibiting expression of a4 integrin, and/or VLA-4 and/or a4b7 integrin.
- antisense oligonucleotides are targeted to nucleic acids encoding the a4 integrin chain of VLA-4 or a4b7 integrin.
- inhibitors as used herein means any measurable decrease (e.g., 10%, 20%, 50%, 90%, or 100%) in VLA-4 or a4b7integrin expression.
- inhibitory nucleotide means herein an oligonucleotide as described herein which induces any measurable decrease (e.g., 10%, 20%, 50%, 90%, or 100%) in VLA-4 or a4b7integrin expression
- oligonucleotide refers to an oligomer or polymer of RNA or DNA or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent intemucleoside (backbone) linkages, as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for the target nucleic acid and increased stability in the presence of nucleases.
- the oligonucleotides may contain chiral (asymmetric) centers or the molecule as a whole may be chiral.
- the individual stereoisomers (enantiomers and diastereoisomers) and mixtures of these are within the scope of the present disclosure.
- ASO reference may be made to Scoles et al Antisesne Oligonucleotides Neurology Genetics April 2019; 5 (2) DOI: doi.org/10.1212/NXG.000000000000032.
- phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
- the respective ends of this linear polymeric compound can be further joined to form a circular compound; however, linear compounds are generally preferred.
- linear compounds may have internal nucleobase complementarity and may therefore fold in a manner so as to produce a fully or partially double-stranded compound.
- the phosphate groups are commonly referred to as forming the intemucleoside backbone of the oligonucleotide.
- the normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
- Antisense oligonucleotides of the disclosure include, for example, ribozymes, siRNA, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligonucleotides which hybridize to at least a portion of the target nucleic acid.
- Antisense oligonucleotides of the disclosure may be administered in the form of single stranded, double-stranded, circular or hairpin and may contain structural elements such as internal or terminal bulges or loops. Once administered, the antisense oligonucleotides may elicit the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid.
- RNAse H a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single- stranded antisense compounds which are "DNA-like" elicit RNAse H. Activation of RNase H therefore results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases, such as those in the RNase III and ribonuclease L family of enzymes.
- dsRNA double-stranded RNA
- RNA interference The posttranscriptional antisense mechanism defined in Caenorhabditis elegans resulting from exposure to double-stranded RNA (dsRNA) has since been designated RNA interference (RNAi).
- RNAi RNA interference
- This term has been generalized to mean antisense-mediated gene silencing involving the introduction of dsRNA leading to the sequence- specific reduction of endogenous targeted mRNA levels (Fire et al., 1998). Recently, it has been shown that it is, in fact, the single -stranded RNA oligomers of antisense polarity of the dsRNAs which are the potent inducers of RNAi (Tijsterman et al., 2002).
- Antisense compounds of the present disclosure include oligonucleotides having modified backbones or non-natural internucleoside linkages. Oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
- Modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates, and boranophosphates having normal 3'- 5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more intemucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2
- Oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most intemucleotide linkage, that is, a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof).
- Various salts, mixed salts and free acid forms are also included.
- Modified oligonucleotide backbones that do not include a phosphorus atom therein include, for example, backbones formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages.
- morpholino linkages formed in part from the sugar portion of a nucleoside
- siloxane backbones sulfide, sulfoxide and sulfone backbones
- formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
- riboacetyl backbones alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
- phosphorodiamidate morpholino PMO
- PO phosphodiester
- nonionic phosphorodiamidate linkages leading to resistance to PO.
- Other ASO types have PS modifications that result in resistance to a broad spectrum of nucleases, support RNase H activity, and increase protein binding, which also improves tissue uptake.
- Morpholinos are aldo oligonucleotides with unique modifications to the ribose sugar that lead to greater target affinity and facilitate nuclease avoidance.
- Phosphorothiote (PS) ASOs are usually stereorandom with regard to chiral PS centers, each of which has 2 distinct stereochemical configurations, making two stereoisoforms (Rp and Sp) possible for a 20mer ASO with 19 linkages.
- the oligonucleotide is a Rp sterioisoform.
- the oligonucleotide is a Sp sterioisoform.
- Antisense compounds of the present disclosure include oligonucleotide mimetics where both the sugar and the internucleoside linkage (i.e. the backbone), of the nucleotide units are replaced with novel groups.
- the nucleobase units are maintained for hybridization with the target nucleic acid.
- PNA peptide nucleic acid
- the sugar- backbone of an oligonucleotide is replaced with an amide containing backbone, in particular, an aminoethylglycine backbone.
- the nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
- Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, US 5,539,082, US 5,714,331, and US 5,719,262. Further teaching of PNA compounds can be found in Nielsen et al., 1991.
- the antisense compounds of the present disclosure also include oligonucleotides with phosphorothioate backbones and oligonucleotides with heteroatom backbones, for example, -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2- [known as a methylene (methylimino) or MMI backbone], -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)- CH2- and -O-N(CH3)-CH2-CH2- [wherein the native phosphodiester backbone is represented as -O-P-O-CH2-] of US 5,489,677, and the amide backbones of US 5,602,240.
- the antisense compounds of the present disclosure also include oligonucleotides having morpholino backbone structures of US 5,034,506. Modified sugars
- Antisense compounds of the present disclosure include oligonucleotides having one or more substituted sugar moieties.
- Examples include oligonucleotides comprising one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl.
- the oligonucleotide comprises one of the following at the 2' position: O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10.
- modified oligonucleotides include oligonucleotides comprising one of the following at the 2' position: C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, poly alky lamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
- the modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3 (also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., 1995), that is, an alkoxyalkoxy group.
- the modification includes 2'- dimethylaminooxyethoxy, that is, a O(CH2)2ON(CH3)2 group (also known as 2'- DMAOE), or 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl- amino-ethoxy-ethyl or 2'-DMAEOE), that is, 2'-O-CH2-O-CH2-N(CH3)2.
- 2'- dimethylaminooxyethoxy that is, a O(CH2)2ON(CH3)2 group (also known as 2'- DMAOE), or 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl- amino-ethoxy-ethyl or 2'-DMAEOE), that is, 2'-O-CH2-O-CH2-N(CH3)2.
- the 2'-modification may be in the arabino (up) position or ribo (down) position.
- a 2'-arabino modification is 2'-F.
- Oligonucleotides may also have sugar mimetics, such as cyclobutyl moieties in place of the pentofuranosyl sugar.
- Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, US 4,981,957, US 5,118,800, US 5,319,080, US 5,359,044, US 5,393,878, US 5,446,137, US 5,466,786, US 5,514,785, US 5,519,134, US 5,567,811, US 5,576,427, US 5,591,722, US 5,597,909, US 5,610,300, US 5,627,053, US 5,639,873, US 5,646,265, US 5,658,873, US 5,670,633, US 5,792,747, and US 5,700,920.
- a further modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety.
- the linkage is a methylene (-CH2-)n group bridging the 2' oxygen atom and the 4' carbon atom, wherein n is 1 or 2.
- LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226.
- nucleobase modifications or substitutions include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
- Modified nucleobases include other synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-CC-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
- nucleobases include tricyclic pyrimidines, such as phenoxazine cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H- pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as, for example, a substituted phenoxazine cytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4- b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
- Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7 -deaza- adenine, 7-deazaguanosine, 2- aminopyridine and 2-pyridone.
- Further nucleobases include those disclosed in US 3,687,808, those disclosed in J.I. Kroschwitz (editor), The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, John Wiley and Sons (1990), those disclosed by Englisch et al. (1991), and those disclosed by Y.S. Sanghvi, Chapter 15: Antisense Research and Applications, pages 289-302, S.T. Crooke, B. Lebleu (editors), CRC Press, 1993.
- nucleobases are particularly useful for increasing the binding affinity of the oligonucleotide.
- These include 5-substituted pyrimidines, 6-azapyrimidines and N- 2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
- 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 ⁇ C.
- these nucleobase substitutions are combined with 2'-O-methoxyethyl sugar modifications.
- Oligonucleotide compounds of the present disclosure may be conjugated to one or more moieties or groups which enhance the activity, cellular distribution or cellular uptake of the antisense compound.
- moieties or groups may be covalently bound to functional groups such as primary or secondary hydroxyl groups.
- moieties or groups include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
- Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins and dyes.
- Moieties or groups that enhance the pharmacodynamic properties include those that improve uptake, enhance resistance to degradation, and/or strengthen sequence- specific hybridization with the target nucleic acid. Moieties or groups that enhance the pharmacokinetic properties include those that improve uptake, distribution, metabolism or excretion of the compounds of the present disclosure. Representative moieties or groups are disclosed in PCT/US 92/09196 and US 6,287,860.
- Moieties or groups include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, for example, hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, for example, dodecandiol or undecyl residues, a phospholipid, for example, di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O- hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino- carbonyl-oxycholesterol moiety.
- lipid moieties such as a cholesterol moiety, cholic acid, a thioether, for example, hexyl-
- oligonucleotide As would be appreciated by those skilled in the art, it is not necessary for all positions in a given compound to be uniformly modified and in fact, more than one of the aforementioned modifications may be incorporated in a single oligonucleotide or even at a single nucleoside within an oligonucleotide.
- Compounds of the disclosure include chimeric oligonucleotides. "Chimeric oligonucleotides" contain two or more chemically distinct regions, each made up of at least one monomer unit, that is, a nucleotide in the case of an oligonucleotide compound.
- oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, increased stability and/or increased binding affinity for the target nucleic acid.
- An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
- RNAse H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex.
- RNA target Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression.
- the cleavage of RNA:RNA hybrids can, in like fashion, be accomplished through the actions of endoribonucleases, such as RNAseL which cleaves both cellular and viral RNA. Cleavage of the RNA target can be routinely detected by gel electrophoresis and if necessary, associated nucleic acid hybridization techniques known in the art.
- Chimeric antisense compounds of the disclosure may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, and/or oligonucleotide mimetics. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, US 5,013,830, US 5,149,797, US 5,220,007, US 5,256,775, US 5,366,878, US 5,403,711, US 5,491,133, US 5,565,350, US 5,623,065, US 5,652,355, US 5,652,356, and US 5,700,922.
- Illustrative antisense platforms known in the art include without limitation, morpholino, lgen oligos, 2 nd gen oligo's, gapmer, siRNA, LNA, BNA, or oligo mimetics like Peptide Nucleic acids.
- Oligonucleotides may be naked or formulated in liposomes. Oligonucleotides may be linked to a delivery means to cells or not. Oligonucleotides may use an endosome release agent or not.
- the antisense compound is a second generation phosphorothioate backbone 2'-MOE-modified chimeric oligonucleotide gapmer designed to hybridize to the 3 '-untranslated region of VLA-4 mRNA.
- the oligonucleotide selectively inhibits VLA-4 expression in both primary human cells and in several human cell lines by hybridizing to RNA encoding CD49, which is the a4 integrin subunit of VLA-4 and a4b7 integrin.
- the oligonucleotide is the 19-sodium salt of a 3' 5' phosphorothioate oligonucleotide 20mer also referred as a 3-9-8 MOE gapmer having a molecular weight of 7230 Daltons, in which the nucleotides at positions 1 to 3 from the 5' end are 2'-O-(2-methoxyethyl) (2'MOE) modified ribonucleosides (2'-O-(2- methoxyethyl ribose); the nucleotides at positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides of which all cytosines are 5-methylcytosines; the nucleotides at positions 13 to 20 from the 5' end are 2'-O-(2-methoxyethyl) modified ribonucleosides.
- sequence of the oligonucleotide is (SEQ ID NO: l):
- Antisense oligonucleotide ATL1102 has previously been shown to be effective in central nervous system disorder, MS and at significantly higher doses than proposed herein (Limmroth et al).
- the ability of antisense oligonucleotide to CD49d alpha chain of VLA- 4 to selectively inhibit VLA-4 in immune cells prevents significant safety events such as PML which have characterised administration of antibodies and small molecule inhibitors of VLA-4 which are pan VLA-4 inhibitors affecting all cells which express VLA-4.
- all uracils are 5-methyluracils (MeU).
- the oligonucleotide is synthesized using 2-methoxyethyl modified thymidines not 5- methyluracils.
- all pyrimidines are C5 methylated (i.e., U, T, C are C5 methylated).
- sequence of the oligonucleotide may be named by accepted oligonucleotide nomenclature, showing each O-O linked phosphorothioate intemucleotide linkage:
- the oligonucleotide may be synthesized by a multi-step process that may be divided into two distinct operations: solid-phase synthesis and downstream processing.
- solid-phase synthesis the nucleotide sequence of the oligonucleotide is assembled through a computer-controlled solid-phase synthesizer.
- downstream processing includes deprotection steps, preparative reversed-phase chromatographic purification, isolation and drying to yield the oligonucleotide drug substance.
- the chemical synthesis of the oligonucelotide utilizes phosphoramidite coupling chemistry followed by oxidative sulfurization and involves sequential coupling of activated monomers to an elongating oligomer, the 3'-terminus of which is covalently attached to the solid support.
- Detritylation ( reaction a) - Each cycle of the solid -phase synthesis commences with removal of the acid-labile 5'-O-4, 4'-dimethoxytrityl (DMT) protecting group of the 5' terminal nucleoside of the support bound oligonucleotide. This is accomplished by treatment with an acid solution (for example dichloroacetic acid (DCA) in toluene). Following detritylation, excess reagent is removed from the support by washing with acetonitrile in preparation for the next reaction.
- DMT acid-labile 5'-O-4, 4'-dimethoxytrityl
- Coupling ( reaction b) - Chain elongation is achieved by reaction of the 5'-hydroxyl group of the support-bound oligonucleotide with a solution of the phosphoramidite corresponding to that particular base position (e.g., for base2: MOE-MeC amidite) in the presence of an activator (e.g., 1H-tetrazole). This results in the formation of a phosphite triester linkage between the incoming nucleotide synthon and the support-bound oligonucleotide chain. After the coupling reaction, excess reagent is removed from the support by washing with acetonitrile in preparation for the next reaction.
- an activator e.g., 1H-tetrazole
- reaction c Sulfurization ( reaction c) -
- the newly formed phosphite triester linkage is converted to the corresponding [O, O, O)-trialkyl phosphorothioate triester by treatment with a solution of a sulfur transfer reagent (e.g., phenylacetyl disulfide).
- a sulfur transfer reagent e.g., phenylacetyl disulfide
- reaction f Cleavage from support and base deprotection
- reaction f Deprotection of the exocyclic amino groups and cleavage of the crude product from the support is achieved by incubation with aqueous ammonium hydroxide (reaction f).
- Purification of the crude, 5'- O-DMT-protected product is accomplished by reversed phase HPLC.
- the reversed phase HPLC step removes DMT-off failure sequences.
- the elution profile is monitored by UV absorption spectroscopy. Fractions containing DMT-on oligonucleotide product are collected and analyzed.
- Acidic deprotection ( reaction g) - Reversed phase HPLC fractions containing 5'-O- DMT -protected oligonucleotide are pooled and transferred to a precipitation tank.
- the products obtained from the purification of several syntheses are combined at this stage of the process.
- Purified DMT-on oligonucleotide is treated with acid (e.g., acetic acid) to remove the DMT group attached to the 5' terminus. After acid exposure for the prescribed time and neutralization, the oligonucleotide drug substance is isolated and dried.
- acid e.g., acetic acid
- the solution is neutralized by addition of aqueous sodium hydroxide and the oligonucleotide drug substance is precipitated from solution by adding ethanol.
- the precipitated material is allowed to settle at the bottom of the reaction vessel and the ethanolic supernatant decanted.
- the precipitated material is redissolved in purified water and the solution pH adjusted to between pH 7.2 and 7.3.
- the precipitation step is repeated.
- the precipitated material is dissolved in water and the solution filtered through a 0.45 micron filter and transferred into disposable polypropylene trays that are then loaded into a lyophilizer.
- the solution is cooled to - 50°C. Primary drying is carried out at 25°C for 37 hours. The temperature is increased to 30°C and a secondary drying step performed for 5.5 hours.
- the drug substance is transferred to high density polyethylene bottles and stored at -200°C.
- Suitable further antisense compounds targeting CD49d/VLA-4 are described in US Patent no. 6,258,790 assigned to Isis pharmaceuticals, Inc. and US2009/0029931 assigned to Antisense Therapeutics Ltd incorporated herein by reference in their entirety.
- Further antisense oligomers that target ITGA4 gene transcripts to modify pre-mRNA splicing in the ITGA4 genes are disclosed for example in International application no PCT/AU2016/000158 for Murdoch University incorporated herein by reference in its entirety.
- Targeting an antisense compound to a particular nucleic acid can be a multistep process.
- the process usually begins with the identification of a target nucleic acid whose function is to be modulated.
- the target nucleic acid encodes the alpha4 integrin chain of VLA-4 or a4b7 integrin.
- the targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect, for example, inhibition of expression, will result.
- region as used herein is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Within regions of the target nucleic acids are segments. "Segments” are defined as smaller or sub-portions of regions within a target nucleic acid. "Sites" as used herein, means positions within the target nucleic acid.
- the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon", the “start codon” or the “AUG start codon”.
- a minority of genes have a translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG, or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo.
- translation initiation codon and “start codon” can encompass many codon sequences even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions.
- start codon and “translation initiation codon” as used herein refer to the codon or codons that are used in vivo to initiate translation of an mRNA transcribed from a gene encoding, for example, a4 integrin chain of VLA-4 or a4b7 integrin, regardless of the sequence(s) of such codons.
- a “translation termination codon” also referred to a “stop codon” may have one of three RNA sequences: 5'-UAA, 5'-UAG and 5'-UGA (5'-TAA, 5'-TAG and 5'-TGA, respectively in the corresponding DNA molecule).
- the terms "translation termination codon” and “stop codon” as used herein refer to the codon or codons that are used in vivo to terminate translation of an mRNA transcribed from a gene encoding the a4 integrin chain of VLA-4 or a4b7 integrin, regardless of the sequence(s) of such codons.
- start codon region and “translation initiation codon region” refer to a portion of the mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from the translation initiation codon.
- stop codon region and “translation termination codon region” refer to a portion of the mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from the translation termination codon. Consequently, the "start codon region” or “translation initiation codon region” and the “stop codon region” or “translation termination codon region” are all regions which may be targeted effectively with the antisense compounds of the present disclosure.
- ORF open reading frame
- coding region which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively.
- the intragenic region encompassing the translation initiation or termination codon of the ORF of a gene is targeted.
- target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of the mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of the mRNA (or corresponding nucleotides on the gene), and the 3' untranslated region (3'UTR), known in the art to refer to the portion of the mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of the mRNA (or corresponding nucleotides on the gene).
- 5'UTR 5' untranslated region
- 3'UTR 3' untranslated region
- the 5' cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage.
- the 5' cap region of an mRNA is considered to include the 5' cap structure itself, as well as the first 50 nucleotides adjacent to the cap site. In one embodiment, the 5' cap region is targeted.
- RNA transcripts Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns," which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as “exons” and are spliced together to form a continuous mRNA sequence. mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as "fusion transcripts". In one embodiment, introns, or splice sites, that is, intron- exon junctions or exon-intron junctions, or aberrant fusion junctions due to rearrangements or deletions are targeted. Alternative RNA transcripts can be produced from the same genomic region of DNA.
- Pre-mRNA variants are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence. Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller "mRNA variants". Consequently, mRNA variants are processed pre-mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as "alternative splice variants". If no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant.
- Variants can be produced through the use of alternative signals to start or stop transcription, that is through use of an alternative start codon or stop codon.
- Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as "alternative start variants" of that pre-mRNA or mRNA.
- Those transcripts that use an alternative stop codon are known as “alternative stop variants” of that pre-mRNA or mRNA.
- One specific type of alternative stop variant is the "polyA variant” in which the multiple transcripts produced result from the alternative selection of one of the "polyA stop signals" by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites.
- the pre-mRNA or mRNA variants are targeted.
- target segment The location on the target nucleic acid to which the antisense compound hybridizes is referred to as the "target segment".
- target segment is defined as at least an 8-nucleobase portion of a target region to which an antisense compound is targeted. While not wishing to be bound by theory, it is presently believed that these target segments represent portions of the target nucleic acid which are accessible for hybridization.
- antisense compounds are chosen which are sufficiently complementary to a target segment, that is, antisense compounds that hybridize sufficiently well and with sufficient specificity, to give the desired effect.
- the target segment may also be combined with its respective complementary antisense compound to form stabilized double-stranded (duplexed) oligonucleotides.
- double stranded oligonucleotide moieties have been shown in the art to modulate target expression and regulate translation, as well as RNA processing via an antisense mechanism.
- the double-stranded moieties may be subject to chemical modifications (Fire et al., 1998; Timmons and Fire, 1998; Timmons et al., 2001; Tabara et al., 1998; Montgomery et al., 1998; Tuschl et al., 1999; Elbashir et al., 2001a; Elbashir et al., 2001b).
- double-stranded moieties have been shown to inhibit the target by the classical hybridization of antisense strand of the duplex to the target, thereby triggering enzymatic degradation of the target (Tijsterman et al., 2002).
- Compounds of the disclosure may be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, resulting in, for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
- Representative United States patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, US 5,108,921, US 5,354,844, US 5,416,016, US 5,459,127, US 5,521,291, US 5,543,158, US 5,547,932, US 5,583,020, US 5,591,721, US 4,426,330, US 4,534,899, US 5,013,556, US
- compositions of the disclosure may be administered in a pharmaceutically acceptable carrier.
- pharmaceutically acceptable carrier refers to molecular entities that do not produce an allergic, toxic or otherwise adverse reaction when administered to a subject, particularly a mammal, and more particularly a human.
- the pharmaceutically acceptable carrier may be solid or liquid.
- compositions include, but are not limited to, diluents, solvents, surfactants, excipients, suspending agents, buffering agents, lubricating agents, adjuvants, vehicles, emulsifiers, absorbants, dispersion media, coatings, stabilizers, protective colloids, adhesives, thickeners, thixotropic agents, penetration agents, sequestering agents, isotonic and absorption delaying agents that do not affect the activity of the active agents of the disclosure.
- the pharmaceutical carrier is water for injection (WFI) and the pharmaceutical composition is adjusted to pH 7.4, 7.2-7.6.
- the salt is a sodium or potassium salt.
- the oligonucleotides may contain chiral (asymmetric) centers or the molecule as a whole may be chiral.
- the individual stereoisomers (enantiomers and diastereoisomers) and mixtures of these are within the scope of the present disclosure.
- Compounds of the disclosure may be pharmaceutically acceptable salts, esters, or salts of the esters, sterioisomers, or any other compounds which, upon administration are capable of providing (directly or indirectly) the biologically active metabolite.
- pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds that retain the desired biological activities of the parent compounds and do not impart undesired toxicological effects upon administration. Examples of pharmaceutically acceptable salts and their uses are further described in US 6,287,860.
- Oligonucleotide compounds of the disclosure may be prodrugs, sterioisomers, or pharmaceutically acceptable salts of the prodrugs, or other bioequivalents.
- prodrugs refers to therapeutic agents that are prepared in an inactive form that is converted to an active form (i.e., drug) upon administration by the action of endogenous enzymes or other chemicals and/or conditions.
- prodrug forms of the antisense compounds of the disclosure are prepared as SATE [(S acetyl-2- thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510, WO 94/26764 and US 5,770,713.
- a prodrug may, for example, be converted within the body, e. g. by hydrolysis in the blood, into its active form that has medical effects.
- Pharmaceutical acceptable prodrugs are described in T. Higuchi and V. Stella, Prodmgs as Novel Delivery Systems, Vol. 14 of the A. C. S. Symposium Series (1976); "Design of Prodmgs” ed. H. Bundgaard, Elsevier, 1985; and in Edward B. Roche, ed., Bioreversible Carriers in Dmg Design, American Pharmaceutical Association and Pergamon Press, 1987, which are incorporated herein by reference.
- Corticosteroid therapy is the mainstay of DMD treatment in ambulatory patients.
- Corticosteroid refers to any one of several synthetic or naturally occurring substances with the general chemical structure of steroids that mimic or augment the effects of the naturally occurring corticosteroids.
- Examples of synthetic corticosteroids include prednisone, prednisolone (including prednisone a precursor to prednisolone, methylprednisolone), dexamethasone triamcinolone, budesonide, and betamethasone.
- the treatment of the present invention for MD in a human subject with MD comprises administering to the subject an effective amount of a therapeutic agent, such as the antisense oligonucleotide to CD49d (alpha chain of VLA-4), and further comprising administering to the subject an effective amount of a second medicament, that is a corticosteroid.
- a therapeutic agent such as the antisense oligonucleotide to CD49d (alpha chain of VLA-4)
- a second medicament that is a corticosteroid.
- the corticosteroid is prednisone (or a prednisone equivalent), deflazacort (a derivative or prednisolone).
- Other corticosteroids are known in the art as mentioned above.
- Combined administration herein includes co-administration, using separate formulations (or a single pharmaceutical formulation), and consecutive administration in either order, wherein generally there is a time period while both (or all) active agents simultaneously exert their biological activities.
- Corticosteroid treatment at standard doses is used in DMD patients while they are ambulatory as it has been shown to have some effect in maintaining ambulation in some patients.
- Prolonged treatment at standard doses (0.75mg/kg/day prednisone or 0.9mg/kg/day deflazacort) however can result in muscle atrophy and/or has other side effects.
- antisense treatment to CD49d in conjunction with corticosteroid treatment including reduced levels of corticosteroid treatment, in non-ambulatory subjects reduced or delayed progression of muscle function. It is unclear if the CS treatment was providing any benefit in such subject, so this supports ATL1102 monotherapy or treatment of combinations.
- the term "combination" in the context of the administration of a therapy refers to the use of more than one therapy or therapeutic agent. The use of the term “in combination” does not restrict the order in which the therapies or therapeutic agents are administered to a subject. A therapy or therapeutic agent can be administered prior to, concomitantly with, or subsequent to the administration of a second therapy or therapeutic agent to a subject.
- the antisense compound of the disclosure is administered systemically.
- systemic administration is a route of administration that is either enteral or parenteral.
- enteral refers to a form of administration that involves any part of the gastrointestinal tract and includes oral administration of, for example, the antisense oligonucleotide in tablet, capsule or drop form; gastric feeding tube, duodenal feeding tube, or gastrostomy; and rectal administration of, for example, the antisense compound in suppository or enema form.
- parenteral includes administration by injection or infusion. Examples include, intravenous (into a vein), intraarterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), subcutaneous (under the skin), intraosseous infusion (into the bone marrow), intradermal, (into the skin itself), intrathecal (into the spinal canal), intraperitoneal (infusion or injection into the peritoneum), intravesical (infusion into the urinary bladder) transdermal (diffusion through the intact skin), transmucosal (diffusion through a mucous membrane), inhalational.
- administration of the pharmaceutical composition is subcutaneous.
- the antisense compound may be administered as single dose or as repeated doses on a period basis, for example, daily, once every two days, three, four, five, six seven, eight, nine, ten, eleven, twelve, thirteen or fourteen days, once weekly, twice weekly, three times weekly, or every two weeks, or every three weeks.
- administration is 1 to 3 times per week, or once every week, two weeks, three weeks, four weeks, or once every two months. In one embodiment, administration is once weekly.
- a low dose administered for 3 to 6 months such as about 25- 50mg/week for at least three to six months and then up to 12 months and chronically.
- Illustrative doses are between about 10 to 300mg. Illustrative doses include 25, 50, 100, 150, 200mg. Illustrative doses include 0.1mg/kg, 0.4mg/kg, 0.5mg/kg, lmg/kg 1.5mg/kg (about 50 to 100mg) and 3mg/kg (100-200mg) and 4.5mg/kg (150-300mg). In one embodiment doses are administered once per week. Thus in one embodiment, a low dose of approximately 10 to 30, or 20 to 40, or 20 to 28mg may be administered to subjects typically weighing between about 25 and 65kg.
- the antisense oligonucleotide is administered at a dose of less than 50mg, or less than 30mg, or about 25mg per dose to produce a therapeutic effect. In one embodiment the antisense oligonucleotide, ATL1102 is administered at a dose of less than 50mg, or less than 30mg, or about 25mg per dose to produce a therapeutic effect.
- a therapeutic effect such as a delay in progression is seen within about three months after administration of the first dose.
- therapeutically effective amount refers to a dose of the antisense compound sufficient for example to improve one or more markers, signs or symptoms of muscular dystrophy or to delay progression of muscular dystrophy in a subject, or to improve one or more markers, signs or symptoms of dystrophic myofibres or to delay progression of muscular dystrophy in a subject under the conditions of administration.
- the administration is effective to provide a Cmax of the oligonucleotide in the plasma of the human subject upwards of 2890ng/mL and in one embodiment, about 10,000-11,000 ng/mL.
- the administration is effective to provide a Cmin or Ctrough of the oligonucleotide in the plasma of the human subject of at least 2.5 ng/mL, in one embodiment at least 20 ng/mL, or at least 45ng/mL.
- dose regimen or course of therapy include factors such as loading and/or maintenance doses, dose frequency, dose duration, dose adjustments for special populations and for co-administration with other therapeutic compositions.
- factors such as loading and/or maintenance doses, dose frequency, dose duration, dose adjustments for special populations and for co-administration with other therapeutic compositions.
- antisense oligonucleotide subjects are identified herein who show diminished levels of CD4+CD49d+ T cell both during and after therapy. These subjects fail to respond the therapy and this can be detected or monitored by assessing in a blood sample a failure to undergo a post-dose completion rebound in CD49d+ T cell within approximately 7 days of the last dose. Instead, these subjects show no change or an even further reduction in CD4+CD49d+ T cell levels post treatment. And they show diminished muscle performance as can be assessed by PUL2.0 quite rapidly. These subjects may have their dose regimen adjusted such as by increasing or decreasing the dose of antisense oligonucleotide for monotherapy, and/or by increasing or decreasing the dose of corticosteroid or
- VLA-4 integrin which reduces the level of T cell VLA-4 in the blood or muscle of human subjects.
- Reduction in the level of VLA-4 may be detected in subsets of T cells in one or more organ including blood, muscle or lung.
- Assessing level of CD4+CD49d+ T cells - Cells may be assessed by flow cytometry or one of many techniques known in the art. Immunochromatographic and microfluidic based approaches are widely used for point of care. Cytometry includes chip cytometry and cartridge technology (see WOl 1128893) is also available.
- the level CD4+CD49d+ T cells may be measured directly or indirectly to assess the concentration of CD4+CD49d+ cells in a sample from the subject. Direct and methods of assessing cell numbers are known in the art and include quantifying the amount of CD49d marker/s in the sample and quantifying the number of CD4+ and/or CD8+ T-cells by various technologies. The mean expression level, intracellular as well as intracellular levels of marker may be assessed.
- the methods comprise contacting the biological sample from the subject with a reagent that binds specifically to CD49d in the obtained biological sample.
- the reagent is a monoclonal antibody, or binding fragment thereof, aptamer, or antibody mimic.
- W013036620 describes detecting target cells in a sample.
- WO 06058816 describes kits for automated performance of an integrated software-fluorescent microbeads standards system, said kit comprising: monoclonal antibodies labeled with one or more fluorochromes; microbeads comprising the same one or more fluorochromes used for labeling the antibodies; and a computer readable non- transitory medium containing a software program for implementation on a computer.
- the software program is matched to specific lots of microbead standards and fluorescent-labeled mixtures of monoclonal antibodies and includes information on the fluorescence intensity of each population of microbeads.
- the software program takes information on a suspension of the microbeads and the fluorescent labeled antibodies bound to cells from a flow cytometer and analyzes data, smooth curves, calculates new parameters, provides quality control measures and indicates the expiration of the microbeads and fluorescent labeled antibodies; the software program alerts the operator and further interrogates the users to verify the assay lot in use and the type of flow cytometric instrument employed as part of the specimen analysis; the software program records results in a cumulative file history to provide comprehensive documentation of an instrument's performance.
- the software program can normalise the bias or difference in fluorescent expression between different production lots by a factor determined by regression analysis between lots and changes in the fluorescent value assigned to the microbeads within the software program; the software program monitors comparisons of data of different microbead production lots and fluorescent labeled antibody production lots on different biologic samples to determine whether the microbeads are within the required range of fluorescence intensity to insure that levels of imprecision between lots is less than 5 percent; and if desired, determines the actual amount of fluorescent antibody bound by the specimen cells through the use of external standards.
- WO 17062646 describes techniques for detecting the biomarker-morphological profile of a cell in which cells are contacted with functionalized nanoparticle species, each functionalized nanoparticle species comprising a biomarker-binding moiety, and forming nanoparticle-cell complexes through binding of the functionalized nanoparticle species comprising a biomarker-binding moiety to its respective biomarker.
- the complexes are immobilised and illuminated with epi- illumination or evanescent light and the resonant light scattering from each observed complexed functionalized nanoparticle is gathered to obtain a biomarker signature of each imaged cell. Further staining allows for the morphological profile of a cell to be assessed.
- a randomized double-blind placebo-controlled study is conducted in non-ambulant DMD patients 10 to 18 years of age, above 25 kg in weight. Participants are randomized into 4 groups with approximately 25 patients per group, 3 groups to receive ATL1102 at 25 mg once weekly, 50mg once weekly, or 100mg once weekly respectively, and the last group to receive placebo for 52 weeks. ATL1102 or placebo are administered once weekly for 52 weeks on top of any existing treatment with corticosteroids (CS), prednisolone or deflazacort.
- CS corticosteroids
- All participants of the study are to be offered to enter an open label extension for 6 months (26 weeks).
- Patients who continue in the open label study who showed responsiveness based on PUL2.0 score (or equivalent clinical score) at 52 weeks compared to baseline can remain on their treatments of ATL1102 and CS.
- Patients who show non-responsiveness to ATL1102 +/- CS treatment at 52 weeks compared to baseline, with a PUL2.0 score of e.g -2., -3 or lower, vs baseline, can be placed on a different dose of ATL1102, either a higher dose or a lower dose for the 6 months (26 weeks) open label study.
- patients’ PUL2.0 at 78 weeks will be compared to PUL2.0 at week 52 for PUL2.0 responsiveness.
- the number of circulating CD4+CD49d+ T cells at 78 weeks will be compared to the number at 82 weeks, 4 weeks post the PUL2.0 result as outlined above (before any dose of CS).
- Patients who show a non-responsiveness to ATL1102 with a PUL2.0 score of -2, -3, or lower, will have the option to change the ATL1102 dose, or to have their CS dose adjusted for instance to two thirds the standard does or one third the standard dose as exemplified, with further monitoring of PUL2.0 responsiveness in further follow up.
- Other secondary endpoints for clinical assessments include measures of safety and measures of efficacy such as muscle strength as measured by myogrip and myopinch, respiratory markers, EK, EK2, quality of life, and MRI assessment of muscle fibrosis, fat inflammation-oedema and atrophy. Any one or more of these measures can be considered before adjusting the ATL1102 dose or the CS dose based on PUL2.0 responsiveness and CD4+CD49d+ changes post PUL2.0 assessment.
- Dosing regimen may be modified in accordance with the present disclosure, for example, dosing for 3 months, 6 months, 1 year or more than 1 year before assessing PUL2.0 versus baseline and circulating CD4+CD49d+ cells changes post PUL2.0 and adjusting ATL1102 dose accordingly are encompassed as envisaged by those of skill in the art.
- Other modifications include assessing circulating CD4+ CD49d+ cells, 1, 2, 3 or 4 weeks or more weeks post the last dose at which PUL2.0 was assessed, measuring them by means of flow cytometry on a chip
- a method of treating muscular dystrophy in a subject in need thereof comprising periodically administering to the subject a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of an inhibitory oligonucleotide comprising the structure:
- each of the 19 intemucleotide linkages of the oligonucleotide is an O,O- linked phosphorothioate diester
- nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides
- nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- cytosines are 5-methylcytosines ( Me C)
- a method for improving muscle function such as limb function or delaying decline in muscle function such as limb function in a subject with muscular dystrophy comprising periodically administering to the subject a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of an oligonucleotide comprising the structure:
- each of the 19 intemucleotide linkages of the oligonucleotide is an O,O- linked phosphorothioate diester; b) the nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides;
- nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides
- nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- cytosines are 5-methylcytosines ( Me C)
- a method for improving muscle performance such as muscle or limb strength or delaying decline in muscle performance such as muscle or limb strength in a subject with muscular dystrophy comprising periodically administering to the subject a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of an oligonucleotide comprising the structure:
- each of the 19 internucleotide linkages of the oligonucleotide is an O,O- linked phosphorothioate diester
- nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides
- nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides
- cytosines are 5-methylcytosines ( Me C)
- muscle performance such as muscle (e.g, limb) strength or delay decline in muscle performance such as muscle (e.g. limb) strength.
- the method of claim 1 or 2 or 3 wherein the therapeutically effective amount is 10mg to 300mg.
- the therapeutically effective amount is selected from the group consisting of 25mg to 50mg, 50mg to 100mg, 100mg to 200mg and 150mg to 300mg.
- the MD is selected from the group consisting of Duchene muscular dystrophy (DMD), limb girdle muscular dystrophy (LGMD), Becker muscular dystrophy (BMD), congenital muscular dystrophy (CMD including Fukuyama Type congenital MD and congenital MD with myosin deficiency), fascioscapulohumeral, oculopharyngeal, Emery-Dreifuss, and distal muscular dystrophy.
- DMD Duchene muscular dystrophy
- LGMD limb girdle muscular dystrophy
- BMD Becker muscular dystrophy
- CMD congenital muscular dystrophy
- fascioscapulohumeral oculopharyngeal
- Emery-Dreifuss Emery-Dreifuss
- ATL1102 is administered to non- ambulant juvenile (or pubescent) boys 10 years or older with DMD weekly at about 1.5mg/kg (about 50 to 100mg) and 3 mg/kg (100-200mg) and 4.5mg/kg (150-300mg) for up to 12 weeks.
- the effects of the administered oligonucleotide for example on motor/muscle function and inflammatory markers are measured. Markers for muscle degeneration-regeneration and fibrosis are also assessed. Markers may be detected in situ or samples such as in plasma, urine, or muscle biopsy. Inspiratory and expiratory pressures, peak cough flow, FVC are assessed to evaluate change in respiratory performance.
- Percent change in normalized upper extremity reachable surface area percent change in Performance of the Upper Limb Assessment score, percent change in Person-Reported Outcome Measure Upper Limb (PROM-UL) functional capacity score are used to assess muscle function. Quality of life questionnaires are useful in determining the effect of treatments.
- Corticosteroid may be dosed daily, or less frequently.
- Prednisolone may be dosed at 0.75mg/kg/day and Deflazacort 0.9mg/kg/day as standard therapies for ambulant DMD patients, at two thirds standard doses, half the dose, or a third the dose.
- ATL1102 is administered to ambulant paediatric boys 4-11 years old with DMD weekly at about 1.5mg/kg (about 10 to 100mg) and 3mg/kg (20-200mg) and 4.5mg/kg (30-300mg) for up to 12 weeks.
- the effects of the administered oligonucleotide for example on motor/muscle function and inflammatory markers are determined.
- Ambulant paediatric boys may be good walkers or poor walkers. Maintenance or reducing the loss of walking capacity may be assessed by the methods known to those skilled in the art.
- 10 non-ambulant DMD patients 12 to 18 years of age receive ATL1102 at a starting dose of 3mg/kg once weekly for 4 weeks.
- the first 5 patients continue dosing at 3mg/kg/week for a further 4 weeks and the remaining 5 patients dose escalate to 4.5mg/kg/week (twice weekly 2.25mg/kg) for 4 weeks.
- a 4 week monitoring period is performed. In the treatment and monitoring period, assessments are at baseline, 2 weeks, 4 weeks, 6 weeks, 8 weeks, and 10 and 12 weeks.
- the primary activity outcome is to assess the number of circulating lymphocytes, CD4+ and CD8+ T cells, and hi CD49d T cells at 4 and 8 weeks of treatment vs baseline and safety including injection sites reactions, platelet changes, liver enzyme GGT- bilimbin, CRP and albumin, A/G ratio changes.
- Secondary endpoints clinical assessments are measures of strength, in upper limb function, and functional capacity, quality of life, and respiratory markers and MRI assessment of muscle fibrosis, fat inflammation-oedema and atrophy and pharmacokinetics.
- Exploratory outcome measures will include serum / plasma biomarker response such as those related to muscle inflammation muscle fibrosis, muscle apoptosis/degeneration, and muscle regeneration including cytokines, and proteomics and mononuclear cell RNA array and exosome RNA.
- 9 non-ambulant DMD patients 10 to 18 years of age, 25 to 65kg in weight receive ATL1102 at a starting dose of 25 mg once weekly for 24 weeks. After 24 weeks of treatment an 8 week monitoring period is performed. In the treatment and monitoring period, assessments are at baseline, and every 2 weeks during the treatment period, and every 4 weeks in the post-treatment monitoring period. The primary activity outcome is to assess the number of circulating lymphocytes, CD4+ and CD8+ T cells, and hi CD49d T cells at 4 and 8 weeks of treatment vs baseline and safety including injection sites reactions, platelet changes, liver enzyme GGT-bilimbin, CRP and albumin, A/G ratio changes.
- Secondary endpoints for clinical assessments are measures of muscle strength, and upper limb function, strength as measured by myoset, and limb functional capacity as measured by PUL-2 (performance of upper limb module for DMD 2.0), quality of life, and respiratory markers and MRI assessment of muscle fibrosis, fat inflammation-oedema and atrophy and pharmacokinetics.
- Exploratory outcome measures will include serum / plasma biomarker response such as those related to muscle inflammation muscle fibrosis, muscle apoptosis/degeneration, and muscle regeneration including cytokines one or more of which may be markers of muscle injury, and proteomics and mononuclear cell RNA array and potentially exosome RNA.
- a low dose of 25mg/week of ATL1102 was administered for 12 weeks to a 13yr old non- ambulent subject of 62kg weight, on a 30mg daily dose of corticosteroid (CS) Deflazacort (0.48mg/kg/day).
- CS corticosteroid
- ATL1102 was effective in reducing the number of cells per microlitre of circulating CD8+ cells and CD8+ cells expressing high levels of CD49d observed in this patient at baseline (week 1) prior to his daily dose of CS, reducing markers of muscle injury as measured by biochemistry exploratory markers, muscle strength as measured by myoset, and importantly muscle function as measured by PUL- 2.0.
- This subject had lost ambulation approximately 2.5 years ago and was on 54% ( ⁇ 50%) of the standard of care 0.90 mg/kg/day dose of Deflazacort use to treat subjects with DMD when ambulant.
- the equivalent prednisolone dose used as standard of care is 0.75mg/kg/day in DMD when ambulant.
- the ATL1102 effects on immune cells were measured by flow cytometry and hematology at baseline (week 1), week 5 (3 days past the ATL1102 dose), and weeks 8 and 12 (7 days past the week 8 and week 12 doses).
- the ATL1102 effects on CD8+ cells was relatively selective compare to prior experiences at higher ATL1102 doses used in multiple sclerosis (MS) (Limmroth et al 2014).
- the effects were also more prolonged than 3 days post dosing as previously measured in the MS study, with effects shown for the first time 7 days post ATL1102 dosing.
- Certain immune cells were not affected at this dose and time of assessment indicated the ATL1102 effect are relatively more specific at this low 25mg dose, of 0.4mg/kg/week. For instance there were no significant reductions on neutrophils or platelets as observed at higher doses with ATL1102 in the MS study (Limmroth et al).
- Myoset preliminary data from this subject 1 suggests after 12 weeks of dosing compared to baseline he has had loss of strength in the dominant hand as measured by myogrip, but no loss of strength in the thumb as measured by myopinch, nor loss in finger strength as determined by moviplate with the number of taps being the same after 12 weeks versus baseline.
- the data in the other hand suggests no loss of strength in the hand, or fingers and a numerically more strength in the thumb at week 12 compared to baseline.
- Ricotti et al (2016) looked at 15 patients (14 treated with CS) treated for 12 weeks and longer with CS and myoset and observed a mean trend reduction of 0.22 kg in the myogrip, and reduction of 0.1kg in the myopinch compared to baseline, and increase in moviplate.
- PUL-2 for DMD is an updated version of PUL-1 used to measure upper limb function.
- PUL-2 measures higher level shoulder function with a maximum score out of 12, mid level elbow function with a maximum score of 17, and distal wrist and hand function with a maximum score of 13.
- An entry score of 3 to 6 means (6 being the highest, and zero the lowest) indicates a subject can be assessed for shoulder function.
- Subject 1 gained function in the mid-level elbow with a score of 14 at week 12 vs 13 at baseline, and has gained function in the distal wrist and hand dimension with a score of 12 at week 12 vs 10 at baseline.
- the PUL-2.0 total function score was 34 compared to 31.
- the patient entry level score also increased from level 5 at baseline to level 6 consistent with the PUL-2 results recorded.
- ATL1102 add on therapy may help retain muscle strength as measured by myoset, and appears to maintain function as measured by PUL-2 if not improve function in this subject. ATL1102 therapy may thus slow progression of disease.
- muscle performance is strength which is the greatest force and which is conveniently measured in myogrip and myopinch tests. Also, endurance/fatigability, which is the ability to sustain forces repeatedly e.g tested for example with repeat measurements of myogrip and myopinch., Also, power which is force /unit time like a six minute walk test.
- Motor performance is the movement of action of muscle such as gross motor skills and fine motor skills in wrist hands fingers, feet and toes. It would be understood by the skilled artisan, that motor performance includes every day life activities related to the upper limb, or lower limbs, or in animals front and hind limbs. In non-ambulant children with DMD modules are available to measure such upper limb performance like PUL 1.0, PUL 1.2, PUL2.0, and these can also be used for ambulant children with DMD and other muscle atrophy conditions.
- muscle strength may be a measure of upper limb or lower limb strength, and in the upper limb muscle strength is used for shoulder flexion, elbow extension, and wrist extension as measured in grams, or pounds, using a hand held myometer.
- the myoset measures strength and fatigability of the upper limb, as these are repeated measures, (data for fatigability is not shown), the results mostly provide the strength maximum result of three or more repeated valid results. Sometimes the largest result is the second or third test.
- Creatine kinase (CK), Aspartate aminotransferase (AST), and Lactate dehydrogenase (LDH) are measures of muscle injury in boys with DMD primarily related to low levels of dystrophin or no dystrophin and injury to muscle upon contraction, and secondarily related to inflammatory and other downstream damage to muscle. Creatine kinase (CK), Aspartate aminotransferase (AST), and Lactate dehydrogenase (LDH) are measures of muscle injury in young ambulant patients with DMD, who have more muscle mass and inflammation than non-ambulant patients.
- CK, ALT, AST, LDH were reduced at week 8 and 12 compared to baseline and week 5.
- the baseline/week 5 levels in units/litre for CK, ALT, AST, LDH respectively were in 5860/6881, 304/404, untested/184, and 632/681 compared to week 8/12 levels of 4606/5358, 265/250, 116/134, and 564/498.
- the LDH levels were reduced from what is considered high to within the normal range. This suggests signs of muscular injury, related to dystrophin loss or inflammation or other damage has been reduced in this non-ambulant patient.
- Myoset myogrip and myopinchmuscle strength data
- Myogrip and myopinch data is generated with the dominant arm and the non-dominant arm, and grip and pinch test done several times at each time point. This allows one to obtain valid results and to determine the muscle strength and endurance.
- Myogrip data from the 4 DMD patients after 12 weeks of dosing compared to baseline was assessed in the dominant arm used by the patient as recommended by the myoset suppliers.
- the myogrip strength in the dominant hand showed a mean gain of 0.09 kg and a 10.52% gain of strength from baseline.
- Ricotti et al (2016) looked at 15 patients (14 treated with CS) treated for 12 weeks and observed in the 10 patients analysed for myogrip at 12 weeks a trend mean loss of 0.22kg and a 3.28% loss of myogrip strength compared to baseline.
- Myogrip data from the 2 DMD patients after 24 weeks of dosing compared to baseline was assessed in the dominant arm used by the patient.
- the myogrip strength in the dominant hand showed a mean loss of only 0.42 kg and a mean 1.24% loss of strength from baseline.
- Ricotti et al (2016) in the 9 patients analysed for strength at 24 weeks showed a significant mean loss of 0.50kg and 10.45% loss of myogrip strength compared to baseline.
- Myopinch data from the 4 DMD patients after 12 weeks of dosing compared to baseline was assessed in the dominant arm used by the patient as recommended by the myoset suppliers.
- the myopinch strength in the dominant hand showed a mean gain of 0.169 kg and a 5.31% gain of strength from baseline.
- Ricotti et al (2016) observed in the 10 patients analysed for myopinch at 12 weeks a mean trend loss of 0.1kg in the and 4% loss of myopinch strength compared to baseline.
- Myopinch data from the 2 DMD patients after 24 weeks of dosing compared to baseline was assessed in the dominant used arm used by the patient.
- the myopinch strength in the dominant hand showed a mean gain of 0.034 kg and a minus 2.58% loss of strength from baseline.
- Ricotti et al (2016) in the 9 patients analysed for myopinch at 24 weeks showed a significant mean loss of 0.38kg and 15.2% loss in the myopinch compared to baseline.
- Moviplate data from the 4 DMD patients after 12 weeks of dosing compared to baseline was assessed in the dominant arm used by the patient as recommended by the myoset suppliers.
- the moviplate in the dominant hand showed a mean tap rate in 30 seconds of 63.5, with an increase in the mean number of taps by 4 versus baseline.
- Ricotti et al (2016) observed in the 10 patients analysed for Moviplate at 12 weeks a mean increase of 2.3 taps compared to baseline.
- PUL 2.0 data from the 4 DMD patients after 12 weeks of dosing compared to baseline was assessed.
- the PUL 2.0 total function score showed a mean gain of 3.66 points, and a mean gain of 9.6% from baseline.
- Three patients had a gain of +3 points, and one patient a gain of +2 points from baseline.
- PUL 2.0 data from the 2 DMD patients after 24 weeks of dosing compared to baseline was assessed.
- the PUL 2.0 total function score showed mean gain of 2 points, and a gain of 9.9% from baseline. Both patients had a gain of +2 in the total function score.
- Pane et al (2018) observed in 90 non-ambulant patients with DMD, the PUL 2.0 function data at baseline, 12 months and 24 months. Fifty two of 90 patients, i.e 58%, were on CS. Results were linear over this 24 period and showed significant loss over a 12 and 24 month time period. Interpolations suggest an estimated mean total function score loss of 1, and an estimated mean loss of 5.4% in the PUL 2.0 total function score compared to baseline.
- PUL-2 measures higher level shoulder function with a maximum score out of 12, mid level elbow function with a maximum score of 17, and distal wrist and hand function with a maximum score of 13.
- patients 1,2,3, and 4 had a score difference of zero, zero, +2 and +3 vs baseline and at week 24, of zero and zero.
- the function in the mid-level elbow at week 12 vs baseline was +1, _2, +1, and -1 respectively, with a +1 and + 2 at week 24.
- the function in the distal wrist and hand dimension at week 12 vs baseline was +2, zero, zero, and +1, and at 24 weeks +1 and +0.
- ATL1102 the antisense inhibitor to human CD49d has been investigated as described herein as a treatment to reduce inflammatory, immune mediated muscle fibre damage in DMD patients.
- ATL1102 effects on muscle strength and muscle function are outlined in examples 5, 6 and 7 and are the first to show the effects of any inhibitor to CD49d, or VLA-4 in the treatment of DMD.
- corticosteroids CS
- corticosteroids have a range of serious side effects when used for a prolonged period, as required in DMD, therefore, it would be preferred to use lower doses of CS, such as tested in the human study, and also to avoid the use of CS. That is not always possible in humans, so this was tested in mice.
- the following animal study is the first to test the effects of an antisense inhibitor to CD49d, the alpha chain of VLA-4, as a monotherapy in a muscular dystrophy. It is also the first to test the effects of any inhibitor of CD49d or VLA-4 in muscular dystrophy. Moreover, this is the first to test any anti-inflammatory, immune mediated treatment post initiation of the muscle injury in muscular dystrophy mouse model, as other treatments have been done prophylactically during the initial phase of muscular injury.
- the antisense inhibitor to human CD49d is not homologous to mouse CD49d RNA, so ISIS 348574, an antisense oligonucleotide inhibitor of mouse and human CD49d was used in a mouse study.
- MDX n 12 (High dose scrambled mismatch control ISIS 358342, 20mg/kg s.c)
- MDX n 12 (placebo control, saline s.c)
- the controls for this study include a saline control for both WT, MDX as well as a scrambled oligonucleotide control at the high dose only.
- the scrambled mixed up nucleotide sequence that does not bind to the CD49d RNA has the same nucleotide composition as the oligonucleotide to CD49d.
- a high dose (20mg/kg) and low dose (5mg/kg) of ISIS 348574 was selected as doses in mice correspond, based on exposure levels, to approximately five times lower mg/kg doses in the clinic i.e., lmg/kg and 4mg/kg per week in the clinic.
- a 4mg/kg per week dose is below the three and twice weekly 200mg dose of ATL1102 in MS patients administered in the acute 8-week study (Limmroth et al, 2014).
- a 4 mg/kg and 1 mg/kg per week dose however, includes higher doses than those given of ATL1102 to the DMD patients in examples 5, 6 and 7 on a mg/kg per week basis, although the latter is a chronic 24 week study.
- Patients in the clinic can be provided antisense at these concentrations with a suitable volume injected in the clinic.
- ISIS 348574 (ATATTTTTCCACCTGTGCCC: SEQ ID NO: 2), a 5-10-5 MOE gapmer with a phosphorothioate backbone and 5-methylcystosine for every C that is fully complementary to mouse and rat integrin a4.
- ISIS 348574 An 8 base pair-mismatch oligonucleotide for ISIS 348574 was also run. This was ISIS 358342 (ACAGTGTACCTCCTTTTCTC: SEQ ID NO: 3), a 5-10-5 MOE gapmer with a phosphorothioate backbone.
- n 12 MDX mice per treatment group were used to ensure enough animals were treated as per protocol to power up the study.
- the MDX mice and WT controls were acclimatized, and treatment began at 9 weeks of age (after initiation of the first round of muscle damage thought to occur between weeks 2 to 5 weeks of age).
- Treatment was for 6 weeks by subcutaneous injections with either saline, scrambled oligonucleotide or two doses of antisense to CD49d (20mg/kg (high) and 5mg/kg (low)) once weekly.
- mice were tested for grip strength, and by in situ muscle physiology looking at fatigue, isometric contractions (absolute and specific force), and eccentric contraction induced muscle damage. Tissues were connected to the blood and nerve supply. Skeletal muscles, diaphragm, heart, spleen and blood were collected and stored for future biochemical and molecular analyses. Reference may be made to the following publications for the techniques employed: Hogarth et al. Nature Communications 8: 14143, 2017 (eccentric contractions), Garton et al. The American Journal of Human Genetics 102, 845-857, 2018 (force frequency and fatigue).
- mice Prior to the first injection mice underwent a baseline grip strength test to examine forelimb strength. Once completed all mice were injected with a maximum volume of 150 microliters once per week for 6 weeks using the above concentrations of antisense oligonucleotide to CD49d, saline or scrambled oligonucleotide. Mice then underwent grip strength assessments as outlined below every second week (total of 4 tests) until the completion of the 6 week treatment period.
- the PROCEDURE for Grip strength was as follows:
- mice Return mice to the home cage and place sunflower seeds in the bottom as a food reward.
- PROCEDURE for Muscle Physiology was as follows:
- mice After the mice have been anesthetized adequately, expose the tendon at the foot by making a ⁇ 2mm incision in the skin.
- step 8 Using the suture from step 4, tie the tendon of the muscle to the lever arm of the dual mode servomotor.
- the muscle can be subjected to different protocols to determine power of shortening, muscle fatigue, or susceptibility to contraction induced damage.
- mice are anesthetized for the duration of the procedure and culled immediately post the procedure without recovery.
- Figure 4 shows eccentric muscle contractions compared to mdx-saline +/-SEM.
- Figure 5 shows the eccentric muscle contractions compared to MDX-scrambled control + SEM.
- mice After 5 minutes of recovery the MDX mice produced significantly less force compared to WT. While WT mice generated a similar amount of force which represents a lack of muscle damage.
- Figure 6 shows the eccentric muscle contraction force produced as a % of initial contraction +/- SEM.
- the MDX saline, scrambled and low dose antisense oligonucleotide generated -50% less force than the initial force produced.
- Mice injected with high dose antisense oligonucleotide generated -70% of the initial force produced. This is significantly less than a WT but significantly more than the saline, scrambled and low dose treated MDX mice.
- FIG. 7 shows the creatine kinase (CK) levels in the blood of WT and MDX-saline, scrambled and treated (High and Low) mice.
- the muscle CK levels (U/L) were measured in the blood of WT and MDX mice after 6 weeks of treatment.
- CK is a circulating protein that can be used as an indirect marker to assess muscle damage. A significant increase in circulating CK was observed in all MDX samples compared to WT, however no differences between treatments in the MDX groups were observed (Figure 7).
- Immune cells in the spleen reduction in T cells that express CD49d cell surface marker Oligonucleotide drugs administered to mice rapidly distribute from the blood to the tissues including to the primary and secondary lymphoid organs which contain white blood cells.
- Various cell surface markers including the antisense oligonucleotide target cell surface molecule CD49d alpha chain of VLA-4 levels were assessed using fluorescently labelled antibodies that are excited by a laser to emit light at varying wavelengths.
- CD49d positive T cell count was reduced in the spleen of mice treated with a high dose of antisense oligonucleotide to CD49d, ISIS 348574 (20mg/kg s.c.) compared to saline-control (data not shown).
- PUL2.0 Performance of the Upper Limb Module
- the matched control data is consistent with data from Pane et al showing declines in PUL2.0 over one and two years in non-ambulant patients.
- ATL1102 treated patients showed a significant mean improvement in PUL2.0 and a greater frequency of patients with improvement or maintenance of their PUL2.0 relative to the matched control group.
- MRI was used to assess the % fat fraction across the forearm Dorsal group of six muscles, the Volar group of four muscles and the ECRLB-Br muscles in a Central slice, and across the total muscle compartment in a Central, Proximal and Distal slice as six measurements for which there was six month data as reported by Ricotti et al 2016 in Table 2 incorporated herein in its entirety.
- the nine ATL1102 treated patients demonstrated a mean reduction in the % fat, indicating an improvement in the skeletal muscles fat content compared to baseline across all six of these muscle fat measurements. This is in contrast to the increases in the % fat, indicating worsening muscle fat content reported by Ricotti et al, 2016.
- Atrophy in the ATL1102 treated patients was assessed as 0, ,2, and 3. Atrophy appears to have been reduced at week 12 in the Volar and Dorsal muscle Distal orientation in more patients that at baseline, but such distal data was not available at week 24. A similar % of patients were ranked in each quadrant at week 24 compared to baseline suggesting stability. This is in contrast to prolonged treatment at standard doses (0.75mg/kg/day prednisone or 0.9mg/kg/day deflazacort) that can result in muscle atrophy.
- PUL 2.0 data from the 8 DMD patients on ATL1102 and corticosteroid after 24 weeks of dosing compared to baseline was assessed.
- the PUL 2.0 total function score showed a mean gain of 1 point from baseline.
- CD4+CD49d+ T cell alteration post 24 week dosing was associated with PUL2.0 responsiveness in improved or stable disease outcome compared to Pul2.0 non-responsiveness or reduction in disease outcome post ATL1102 treatment.
- Efficacy in PUL2.0 tended to be indicated with increase in CD4CD49d T- cells post dosing or a no-change and non-effectiveness or the least effectiveness outcome indicated with a decrease in CD4+CD49d+ T cells.
- CD4+CD49d+ T cell may be an independent predictor for total PUL 2.0 treatment efficacy with ATL1102.
- a randomized double-blind placebo-controlled study is conducted in 100 non-ambulant DMD patients 10 to 18 years of age, above 25 kg in weight.
- Participants are randomized into 4 groups with approximately 25 patients per group, 3 groups to receive ATL1102 at 25 mg once weekly, 50mg once weekly, or 100mg once weekly respectively, and the last group to receive placebo for 52 weeks.
- ATL1102 or placebo are administered once weekly for 52 weeks on top of any existing treatment with corticosteroids (CS), prednisolone or deflazacort.
- CS corticosteroids
- the primary efficacy outcome is to assess the change in upper limb functional capacity as measured by PUL-2.0 (performance of upper limb module for DMD 2.0) at 52 weeks across the different dose groups compared to placebo.
- Secondary efficacy outcomes include the change in PUL2.0 at baseline, week 24 and week 52, and the secondary activity outcome is the change in the number of circulating CD4+CD49d+ T cells at (i) week 24 versus week 25 of treatment, being one week past the week 24 dose, and before administration of the daily dose of CS if the patient is on CS, and the week 25 dose of ATL1102, and (ii) again at week 52 versus week 53.
- All participants of the study are to be offered to enter an open label extension for 6 months (26 weeks).
- Patients who continue in the open label study who showed responsiveness based on PUL2.0 score at 52 weeks compared to baseline can remain on their treatments of ATL1102 and CS.
- Patients who show non-responsiveness to ATL1102 +/- CS treatment at 52 weeks compared to baseline, with a PUL2.0 score of e.g -2., -3 or lower, vs baseline, can be placed on a different dose of ATL1102, either a higher dose or a lower dose for the 6 months (26 weeks) open label study.
- the patients’ PUL2.0 at 78 weeks will be compared to PUL2.0 at week 52 for PUL2.0 responsiveness.
- the number of circulating CD4+CD49d+ T cells at 78 weeks will be compared to the number at 82 weeks, 4 weeks post the PUL2.0 result as outlined above (before any dose of CS).
- Patients who show a non-responsiveness to ATL1102 with a PUL2.0 score of -2, -3, or lower, will have the option to change the ATL1102 dose, or to have their CS dose adjusted for instance to two thirds the standard does or one third the standard dose as exemplified, with further monitoring of PUL2.0 responsiveness in further follow up.
- Other secondary endpoints for clinical assessments include measures of safety and measures of efficacy such as muscle strength as measured by myogrip and myopinch, respiratory markers, EK, EK2, quality of life, and MRI assessment of muscle fibrosis, fat inflammation-oedema and atrophy. Any one or more of these measures can be considered before adjusting the ATL1102 dose or the CS dose based on PUL2.0 responsiveness and CD4+CD49d+ changes post PUL2.0 assessment.
- Dosing regimen may be modified in accordance with the present disclosure, for example, dosing for 3 months, 6 months, 1 year or more than 1 year before assessing PUL2.0 versus baseline and circulating CD4+CD49d+ cells changes post PUL2.0 and adjusting ATL1102 dose accordingly are encompassed as envisaged by those of skill in the art.
- Other modifications include assessing circulating CD4+ CD49d+ cells, 1, 2, 3 or 4 weeks or more weeks post the last dose at which PUL2.0 was assessed, measuring them by means of flow cytometry on a chip.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Neurology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR112021022208A BR112021022208A2 (pt) | 2019-05-06 | 2020-05-06 | Métodos para tratamento de distrofia muscular usando oligonucleotídeos inibidores para cd49d |
| EP20801736.8A EP3965778A4 (en) | 2019-05-06 | 2020-05-06 | METHOD OF TREATMENT OF MUSCULAR DYSTROPHY USING INHIBITORY OLIGONUCLEOTIDES AGAINST CD49D |
| AU2020269078A AU2020269078A1 (en) | 2019-05-06 | 2020-05-06 | Methods for treating muscular dystrophy using inhibitory oligonucleotides to CD49d |
| JP2021566041A JP2022532098A (ja) | 2019-05-06 | 2020-05-06 | CD49dに対する阻害オリゴヌクレオチドを使用して筋ジストロフィーを治療する方法 |
| CN202080049373.1A CN114555095A (zh) | 2019-05-06 | 2020-05-06 | 使用针对CD49d的抑制性寡核苷酸治疗肌营养不良症的方法 |
| KR1020217039906A KR20220061915A (ko) | 2019-05-06 | 2020-05-06 | Cd49d에 대한 억제성 올리고뉴클레오티드를 사용하는 근이영양증의 치료 방법 |
| CA3138945A CA3138945A1 (en) | 2019-05-06 | 2020-05-06 | Methods for treating muscular dystrophy using inhibitory oligonucleotides to cd49d |
| US17/609,334 US20220296631A1 (en) | 2019-05-06 | 2020-05-06 | Methods for treating muscular dystrophy using inhibitory oligonucleotides to cd49d |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2019901540A AU2019901540A0 (en) | 2019-05-06 | Therapeutic uses and methods | |
| AU2019901540 | 2019-05-06 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020223762A1 true WO2020223762A1 (en) | 2020-11-12 |
Family
ID=73050454
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2020/050445 Ceased WO2020223762A1 (en) | 2019-05-06 | 2020-05-06 | Methods for treating muscular dystrophy using inhibitory oligonucleotides to cd49d |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US20220296631A1 (https=) |
| EP (1) | EP3965778A4 (https=) |
| JP (1) | JP2022532098A (https=) |
| KR (1) | KR20220061915A (https=) |
| CN (1) | CN114555095A (https=) |
| AU (1) | AU2020269078A1 (https=) |
| BR (1) | BR112021022208A2 (https=) |
| CA (1) | CA3138945A1 (https=) |
| WO (1) | WO2020223762A1 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2024521740A (ja) * | 2021-06-01 | 2024-06-04 | ドンぺ ファルマチェウティチ エス.ピー.エー. | 2型ヨードチロニンデヨージナーゼ(d2)阻害剤の新しい治療的使用 |
| WO2024159266A1 (en) * | 2023-02-01 | 2024-08-08 | Antisense Therapeutics Ltd | Combination compositions and methods for treatment of muscular dystrophy |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN119113214B (zh) * | 2024-11-14 | 2025-02-11 | 四川大学 | 一种肌肉修复材料及其制备方法和用途 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011020874A1 (en) * | 2009-08-20 | 2011-02-24 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Vla-4 as a biomarker for prognosis and target for therapy in duchenne muscular dystrophy |
| WO2018227254A1 (en) * | 2017-06-16 | 2018-12-20 | Antisense Therapeutics Ltd | Methods for treating multiple sclerosis using antisense oligonucleotides |
| WO2019210347A1 (en) * | 2018-05-04 | 2019-11-07 | Antisense Therapeutics Ltd | Therapeutic uses and methods |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2318424B1 (en) * | 2008-06-23 | 2015-02-25 | Antisense Therapeutics Ltd | Methods for treating multiple sclerosis using antisense oligonucleotides |
| JP5931720B2 (ja) * | 2009-05-08 | 2016-06-08 | クルナ・インコーポレーテッド | Dmdファミリーに対する天然アンチセンス転写物の抑制によるジストロフィンファミリー関連疾患の治療 |
| EP3858993A1 (en) * | 2015-10-09 | 2021-08-04 | Sarepta Therapeutics, Inc. | Compositions and methods for treating duchenne muscular dystrophy and related disorders |
-
2020
- 2020-05-06 BR BR112021022208A patent/BR112021022208A2/pt unknown
- 2020-05-06 JP JP2021566041A patent/JP2022532098A/ja not_active Ceased
- 2020-05-06 CA CA3138945A patent/CA3138945A1/en active Pending
- 2020-05-06 CN CN202080049373.1A patent/CN114555095A/zh active Pending
- 2020-05-06 KR KR1020217039906A patent/KR20220061915A/ko not_active Ceased
- 2020-05-06 AU AU2020269078A patent/AU2020269078A1/en active Pending
- 2020-05-06 EP EP20801736.8A patent/EP3965778A4/en not_active Withdrawn
- 2020-05-06 WO PCT/AU2020/050445 patent/WO2020223762A1/en not_active Ceased
- 2020-05-06 US US17/609,334 patent/US20220296631A1/en not_active Abandoned
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011020874A1 (en) * | 2009-08-20 | 2011-02-24 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Vla-4 as a biomarker for prognosis and target for therapy in duchenne muscular dystrophy |
| WO2018227254A1 (en) * | 2017-06-16 | 2018-12-20 | Antisense Therapeutics Ltd | Methods for treating multiple sclerosis using antisense oligonucleotides |
| WO2019210347A1 (en) * | 2018-05-04 | 2019-11-07 | Antisense Therapeutics Ltd | Therapeutic uses and methods |
Non-Patent Citations (3)
| Title |
|---|
| FERNANDA PINTO-MARIZ; LUCIANA RODRIGUES CARVALHO; ALEXANDRA PRUFER DE QUEIROZ CAMPOS ARAUJO; WALLACE DE MELLO; MÁRCIA GONÇALVES RI: "CD 49d is a disease progression biomarker and a potential target for immunotherapy in Duchenne muscular dystrophy", SKELETAL MUSCLE, vol. 5, no. 45, 2015, pages 1 - 10, XP055650015 * |
| SAVINO, W. ET AL.: "Flow Cytometry-Defined CD 49d Expression in Circulating TLymphocytes Is a Biomarker for Disease Progression in Duchenne Muscular Dystrophy", DUCHENNE MUSCULAR DYSTROPHY. METHODS IN MOLECULAR BIOLOGY, vol. 1687, 2018, New York, NY., pages 219 - 227, XP009524465, DOI: 10.1007/978-1-4939-7374-3_16 * |
| See also references of EP3965778A4 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2024521740A (ja) * | 2021-06-01 | 2024-06-04 | ドンぺ ファルマチェウティチ エス.ピー.エー. | 2型ヨードチロニンデヨージナーゼ(d2)阻害剤の新しい治療的使用 |
| WO2024159266A1 (en) * | 2023-02-01 | 2024-08-08 | Antisense Therapeutics Ltd | Combination compositions and methods for treatment of muscular dystrophy |
Also Published As
| Publication number | Publication date |
|---|---|
| BR112021022208A2 (pt) | 2022-01-11 |
| EP3965778A1 (en) | 2022-03-16 |
| KR20220061915A (ko) | 2022-05-13 |
| AU2020269078A1 (en) | 2022-01-06 |
| CN114555095A (zh) | 2022-05-27 |
| JP2022532098A (ja) | 2022-07-13 |
| US20220296631A1 (en) | 2022-09-22 |
| EP3965778A4 (en) | 2023-05-31 |
| CA3138945A1 (en) | 2020-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2566724C9 (ru) | Композиции и способы модуляции smn2 сплайсинга у субъекта | |
| CN112423792B (zh) | Apol1表达的调节剂 | |
| WO2020041348A1 (en) | Antisense oligonucleotides targeting scn2a for the treatment of scn1a encephalopathies | |
| JP7667074B2 (ja) | Dux4の発現を調節するための化合物、方法及び医薬組成物 | |
| JP2022518929A (ja) | Appの発現を低減するための化合物及び方法 | |
| JP7239597B2 (ja) | Irf4発現の調節因子 | |
| US20240392301A1 (en) | Therapeutic uses and methods | |
| JP7696466B2 (ja) | Smn2を調節するための化合物及び方法 | |
| JP2016523548A (ja) | 成長ホルモン受容体のモジュレータ | |
| US20220296631A1 (en) | Methods for treating muscular dystrophy using inhibitory oligonucleotides to cd49d | |
| HK40072484A (en) | Methods for treating muscular dystrophy using inhibitory oligonucleotides to cd49d | |
| WO2024159266A1 (en) | Combination compositions and methods for treatment of muscular dystrophy | |
| WO2026044345A1 (en) | Methods and compositions for treatment of epilepsy | |
| EA053154B1 (ru) | Антисмысловые олигонуклеотиды, нацеленные на scn2a, для лечения энцефалопатии scn1a | |
| EA044295B1 (ru) | Модуляторы экспрессии apol1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20801736 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3138945 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021566041 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112021022208 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2020801736 Country of ref document: EP Effective date: 20211206 |
|
| ENP | Entry into the national phase |
Ref document number: 2020269078 Country of ref document: AU Date of ref document: 20200506 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 112021022208 Country of ref document: BR Kind code of ref document: A2 Effective date: 20211105 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2020801736 Country of ref document: EP |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 783064 Country of ref document: NZ |