WO2020175898A1 - Tut4/7 발현 조절인자를 포함하는 암 예방 또는 치료용 약학적 조성물 - Google Patents

Tut4/7 발현 조절인자를 포함하는 암 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2020175898A1
WO2020175898A1 PCT/KR2020/002709 KR2020002709W WO2020175898A1 WO 2020175898 A1 WO2020175898 A1 WO 2020175898A1 KR 2020002709 W KR2020002709 W KR 2020002709W WO 2020175898 A1 WO2020175898 A1 WO 2020175898A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
mir
seq
kit
tut4
Prior art date
Application number
PCT/KR2020/002709
Other languages
English (en)
French (fr)
Inventor
김빛내리
김해동
김지미
Original Assignee
서울대학교 산학협력단
기초과학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교 산학협력단, 기초과학연구원 filed Critical 서울대학교 산학협력단
Priority to EP20763447.8A priority Critical patent/EP3904518A4/en
Priority to CN202080016505.0A priority patent/CN113498437B/zh
Priority to JP2021549466A priority patent/JP2022522660A/ja
Publication of WO2020175898A1 publication Critical patent/WO2020175898A1/ko
Priority to US17/385,277 priority patent/US20210363527A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1282—RNA uridylyltransferase (2.7.7.52)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07052—RNA uridylyltransferase (2.7.7.52)

Definitions

  • composition for preventing or treating cancer containing 11114/7 expression regulator Pharmaceutical composition for preventing or treating cancer containing 11114/7 expression regulator
  • the present invention comprises a TUT4/7 expression modulator for cancer prevention or treatment
  • composition for the prevention or treatment of cancer containing a nucleic acid sequence that regulates TUT4/7 expression.
  • the present invention was made under the support of the Ministry of Health and Welfare of the Republic of Korea under task number 1 1079098.
  • the research management institution for the above project is the Research Institute of Basic Science
  • the name of the research project is "Support for research operation expenses of the Research Institute of Basic Science”
  • the name of the research project is " Research on the regulation of cell fate by RNA”
  • the main institution is the Research Institute of Basic Science
  • the research period is January 1st, 2018 ⁇ December 31st, 2018.
  • micro RNA micro RNA
  • the process of cutting by Dicer involves the creation of double-stranded RNA, and the process of selecting one of the two strands (5p and 3p) that constitutes it.
  • the two strands have distinctly different sequences, so they have different genes from each other.
  • the process of strand selection, which determines which strand is selected, is biologically important, since the expression of these can be controlled.
  • alternative processing selection or “arm switching”.
  • Alternative strand selection consists of tissue differentiation and cancer. It can affect development, but its molecular mechanisms and physiological importance, such as how these alternative strand choices are regulated, remain ambiguous.
  • the present inventors developed three microRNAs (5p and two 3p variants) with different functions by regulating the dicer cleavage value of pre-mir-324 by the liberalization of TUT4 and TUT7 (TUT4/7). It is confirmed that it is produced, and by inhibiting the function of TUT4/7, it can prevent cell division and inhibit cancer development, increase the amount of miR-324-5p, and suppress the function of miR-324-3p.l to produce the same effect.
  • the present invention
  • the object of the present invention is a microcomputer comprising the base sequence of SEQ ID NO: 1 and 2 2020/175898 1»(:1 ⁇ 1 ⁇ 2020/002709
  • RNA micro RNA; miRNA
  • nucleic acid consisting of the base sequence of SEQ ID NO: 4
  • small interfering RNA siRNA comprising one or more base sequences selected from the group consisting of SEQ ID NOs: 5 to 20; It is to provide a pharmaceutical composition for preventing or treating cancer.
  • Another object of the present invention is a microcomputer comprising a base sequence of SEQ ID NO: 1 and 2
  • RNA micro RNA; miRNA
  • nucleic acid consisting of the base sequence of SEQ ID NO: 4
  • small interfering RNA siRNA comprising at least one base sequence selected from the group consisting of SEQ ID NOs: 5 to 20; It is to provide cancer treatment methods.
  • micro RNA comprising the base sequences of SEQ ID NOs: 1 and 2; Nucleic acid consisting of the base sequences of SEQ ID NO: 4; And from the group consisting of SEQ ID NOs: 5 to 20 It is to provide the use of cancer treatment of short interfering RNA (siRNA) comprising at least one selected base sequence.
  • siRNA short interfering RNA
  • Another object of this invention is the expression of miR-324-5p or miR-324-3p.l miRNA
  • composition for diagnosis of cancer that includes a preparation that measures the level.
  • Another object of the present invention is the expression of miR-324-5p or miR-324-3p.l miRNA
  • kit for diagnosis of cancer that includes a formulation to measure the level.
  • TUT4 Terminal uridylyl transferases 4
  • composition for cancer diagnosis comprising a preparation for measuring the level of the gene mRNA of TUT7 (Terminal uridylyl transferases 7) or its protein.
  • Another object of the present invention is the gene mRNA of TUT4 or TUT7 or its
  • the present inventors developed three microRNAs (5p and two 3p variants) with different functions by regulating the dicer cleavage value of pre-mir-324 by the liberalization of TUT4 and TUT7 (TUT4/7). It is confirmed that it is produced, and by inhibiting the function of TUT4/7, it can prevent cell division and inhibit cancer development, increase the amount of miR-324-5p, and suppress the function of miR-324-3p.l to produce the same effect. Found that there is.
  • One aspect of the present invention is a microcomputer comprising the base sequence of SEQ ID NO: 1 and 2
  • RNA micro RNA
  • miRNA miRNA
  • Small interfering RNA comprising at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 5 to 20;
  • a pharmaceutical composition for cancer prevention or treatment comprising at least one selected from the group consisting of It is about. 2020/175898 1»(:1 ⁇ 1 ⁇ 2020/002709
  • cancers are brain tumors, colon cancer, colon cancer, lung cancer, liver cancer, gastric cancer, esophageal cancer, pancreatic cancer, gallbladder cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, cervical cancer, endometrial cancer, chorionic cancer, ovarian cancer, breast cancer, May be thyroid cancer, brain cancer, head and neck cancer, and/or malignant melanoma, but
  • the micro RNA of the present invention may include a base sequence of SEQ ID NO: 1 and 2.
  • Micro 1 (111 ⁇ -324-51) containing the nucleotide sequence and micro 1 ⁇ 111 ⁇ -324-31) containing the nucleotide sequence of SEQ ID NO: 2. 2) A complex in which each other is bonded to each other. It can be 113 ⁇ 4 ⁇ .
  • Phosphate ( ⁇ 08 ⁇ £ ) (5 ⁇ 08) may be located at the 5'end of the base sequence of SEQ ID NOs: 1 and 2.
  • nucleic acid is arbitrary On the sample
  • chromosomes include present chromosomes, mitochondria, viruses and/or bacterial nucleic acids, including one or both strands of a double-stranded nucleic acid molecule, and any fragment or part of an intact nucleic acid molecule.
  • the nucleic acid of the present invention contains chemically modified DNA or RNA.
  • RNA fragment with a size of 18 to 23 nucleotides that is cleaved and produced by specifically binding to mRNA having a complementary sequence, thereby inhibiting the expression of the protein.
  • siRNA of the present invention is used to prevent rapid degradation by nucleolytic enzymes in vivo.
  • composition of this invention can be introduced intracellularly together with a known nucleic acid carrier to enhance the efficiency of introduction into cells.
  • the short interfering RNA of the present invention may be one containing a base sequence of SEQ ID NO: 5 to 20.
  • the short interfering 1 ⁇ 4 11714 is a short interfering RNA containing any one base sequence out of SEQ ID NOs: 5 to 8 and any of the sequence numbers 9 to 12. 2020/175898 1»(:1 ⁇ 1 ⁇ 2020/002709 It may be a complex in which short interfering RNAs containing one nucleotide sequence are bound to each other.
  • the short interfering RNA is a short interfering RNA comprising any one nucleotide sequence of SEQ ID NOs: 13 to 16 and SEQ ID NOs: 17 to 17
  • It may be a complex in which short interfering RNAs containing any one of the 20 nucleotide sequences are bound to each other.
  • the therapeutically effective amount of miRNA, nucleic acid and/or siRNA refers to the amount required for administration to expect a cancer treatment effect. Therefore, the type of disease, severity of the disease, and nucleic acid to be administered It can be adjusted according to a variety of factors including the type of medicine, formulation, patient's age, weight, general health status, sex, diet, administration time, administration route and duration of treatment, and drugs such as chemical anticancer drugs used at the same time.
  • composition of the present invention may be administered through various routes including oral, transdermal, subcutaneous, intravenous or muscle, and for this purpose, other additives may be added in addition to the miRNA, nucleic acid and/or siRNA of the present invention. .
  • the formulation of the composition according to the present invention may be in the form of tablets, pills, powders, sachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols, capsules, sterilizing injections, sterilizing powders, etc., preferably It is formulated as an intravenous injection, subcutaneous injection, endothelial injection, and intramuscular injection.
  • the pharmaceutical composition of the present invention is formulated in a unit dosage form using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily implemented by a person with ordinary knowledge in the technical field to which the present invention belongs.
  • the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of extracts, powders, suppositories, powders, granules, tablets or capsules, or a dispersant or It may additionally contain stabilizers.
  • Pharmaceutically acceptable carriers that can be included in the pharmaceutical composition of the present invention are those that are commonly used during formulation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, know Nate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. However, it is not limited thereto.
  • the pharmaceutical composition of the present invention may additionally contain lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc., in addition to the above ingredients.
  • lubricants wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.
  • suitable pharmaceutically acceptable carriers and Formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
  • the pharmaceutical composition of the present invention can be administered orally and parenterally, such as intravenous injection, subcutaneous injection, muscle injection, intraperitoneal injection, topical administration, intranasal administration, intrapulmonary administration, rectal administration, intrathecal administration, It can be administered by eye, skin, and transdermal administration.
  • intravenous injection subcutaneous injection, muscle injection, intraperitoneal injection
  • topical administration intranasal administration
  • intrapulmonary administration rectal administration
  • intrathecal administration It can be administered by eye, skin, and transdermal administration.
  • the appropriate dosage of the pharmaceutical composition of the present invention depends on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, route of administration, excretion rate and response sensitivity. It varies, and usually a trained doctor can easily determine and prescribe a dosage that is effective for the desired treatment or prevention.
  • composition for cancer diagnosis comprising a preparation for measuring the expression level of at least one miRNA selected from the group consisting of miR-324-5p and miR-324-3p.l.
  • the micro RNA (miR-324-5p) may contain the nucleotide sequence of SEQ ID NO: 1, and the micro RNA (miR-324-3p.l) is the sequence number.
  • micro RNA (miR-324-3p. l) is of SEQ ID NO: 3
  • micro RNA is in the MIR324 gene (GenBank Number: 442898)
  • diagnosis refers to a specific disease or condition.
  • To determine susceptibility to determine whether an individual currently has a specific disease or condition, to determine the prognosis of an individual with a specific disease or condition, or therametrics (e.g., treatment Monitoring the condition of an individual to provide information on efficacy).
  • the term ⁇ object'', ⁇ subject'' or ⁇ patient'' means any single entity requiring treatment, including humans, cattle, dogs, guinea pigs, rabbits, chickens, and insects.
  • subjects who participated in a clinical study trial that did not show any clinical findings of a disease, or who participated in an epidemiological study, or used as a control group, are included.
  • Measurement of expression level of miRNA means to detect the target to be detected in the sample.
  • the target to be detected is the corresponding miRNA in the sample. That is, by detecting the miRNA, the onset of the cancer can be confirmed.
  • the expression level of the miRNA is
  • the present invention significantly reduces the expression level of miR-324-5p in vivo compared to the case where cancer is not, and the expression level of miR-324-3p.l is significantly reduced.
  • miR-324-5p and miR-324-3p.l are 2020/175898 1»(:1 ⁇ 1 ⁇ 2020/002709 Used as a diagnostic marker for outbreaks.
  • the formulation of the present invention for measuring the expression level of miRNA is by checking the expression level of miRNA, a marker that decreases the expression level in a sample of a biological sample, and miRNA, a marker that increases the expression level additionally, in the case of cancer.
  • miRNA a marker that increases the expression level additionally, in the case of cancer.
  • a marker that can be used to detect a marker refers to a molecule that can be used to detect a marker.
  • the agent for measuring the expression level of the miRNA may be a primer or probe that specifically binds to the miRNA.
  • the detection of nucleic acids can be performed by an amplification reaction using a nucleic acid molecule that encodes a gene or one or more oligonucleotide primers that hybridize to the complement of the nucleic acid molecule.
  • detection of miRNA using a primer is performed by an amplification method such as PCR.
  • a primer is a nucleic acid sequence with a short free 3'hydroxyl group, capable of forming a complementary template and base pair, and serving as a starting point for template strand copying. It means a short nucleic acid sequence.
  • Primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature.
  • a reagent for polymerization i.e., DNA polymerase or reverse transcriptase
  • the presence or absence of cancer can be diagnosed by performing PCR amplification using sense and antisense primers that specifically bind to one or more of the above miRNAs to check the expression level.
  • the feeding conditions, the lengths of the sense and antisense primers are known in the art. It can be transformed based on what has been done.
  • Probes are labeled and mean a fragment of a nucleic acid, such as RNA or DNA, corresponding to a short number of bases to a few dozen bases.
  • Oligonucleotide probes single stranded DNA probes, double stranded DNA probes, RNA probes, etc.
  • probes that are complementary to one or more miRNAs are used. It is possible to diagnose the presence of cancer by carrying out hybridization using the method and confirming the expression level. The selection of an appropriate probe and the hybridization conditions can be modified based on those known in the art.
  • Such primers or probes can be appropriately designed by a person skilled in the art based on a known sequence.
  • primers or probes can be chemically synthesized using the phosphoramidite solid support method, or other widely known methods.
  • Such nucleic acid sequences can also be modified using many means known in the art. have. Non-limiting examples of such modifications include methylation, “encapsulation”, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, eg, uncharged. 2020/175898 1»(:1/10 ⁇ 020/002709
  • Non-linking body eg methylphosphonate, phosphotriester, phosphoroamidate, carbamate, etc.
  • charged linking body eg phosphorothioate
  • Reverse transcriptase polymerase reaction (Competitive RT-PCR), real-time reverse transcriptase
  • Another aspect of the present invention relates to a cancer diagnosis kit comprising the composition for cancer diagnosis.
  • the kit may include not only a preparation for measuring the expression level of the miRNA, but also tools and reagents generally used in the art to be suitable for use as a diagnostic kit for cancer.
  • Examples of the above tools or reagents include, but are not limited to, suitable carriers, labeling substances capable of generating detectable signals, chromophores, dissolving agents, detergents, buffers, stabilizers, etc.
  • the labeling substances are enzymes.
  • a substrate capable of measuring enzyme activity and a reaction stopping agent may be included.
  • the carrier includes a soluble carrier, an insoluble carrier, and an example of a soluble carrier includes a physiologically acceptable buffer solution known in the art, such as PBS.
  • examples of insoluble carriers include polymers such as polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluorine resin, cross-linked dextran, polysaccharide, and latex-plated magnetic fine particles,
  • Others May be paper, glass, metal, agarose, and combinations thereof.
  • the diagnostic kit of the present invention may be a kit containing essential elements necessary to perform RT-PCR.
  • the RT-PCR kit includes test tubes or other suitable containers, reaction buffers (various pH and magnesium concentrations), deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase. It may contain the same enzyme, DNase, RNAse inhibitor, DEPC-water, sterilized water, etc.
  • kit of the present invention includes the above-described composition as a constitution, duplicate contents are omitted in order to avoid excessive complexity of the present specification.
  • TUT4 Terminal uridylyl transferases 4
  • TUT7 Terminal uridylyl transferases 7
  • composition for diagnosis of cancer comprising a preparation for measuring the level of one or more gene mRNAs or proteins thereof selected from the group consisting of.
  • the nucleotide sequence of the TUT4 gene is shown in SEQ ID NO: 21, and the TUT7 2020/175898 1»(:1 ⁇ 1 ⁇ 2020/002709
  • the nucleotide sequence of the gene is shown in SEQ ID NO: 22.
  • diagnosis refers to the susceptibility of an individual to a specific disease or condition.
  • object means any single object requiring treatment, including humans, cattle, dogs, guinea pigs, rabbits, chickens, insects, etc.
  • subjects who participated in clinical research trials that do not show any clinical findings of any disease subjects who participated in epidemiological studies, or subjects used as controls are included.
  • the expression "measurement of the level of gene mRNA or protein thereof" used in this specification means to detect the target to be detected in the sample.
  • the target to be detected is the mRNA of the gene or its protein in the sample. That is, by detecting the mRNA or its protein, the onset of the cancer can be confirmed.
  • the level of the mRNA or protein thereof is
  • gene refers to a protein encoding or transcriptional or other gene.
  • a gene may consist of all the nucleic acids encoding the functional protein or only a part of the nucleic acid encoding or expressing the protein.
  • the nucleic acid sequence is an exon, an intron, or a portion thereof. Genetic abnormalities may be included within the initiating or ending region, promoter sequence, other regulatory sequence, or a distinct sequence adjacent to the gene.
  • the agent for measuring the expression level of the gene mRNA of the present invention is in case of cancer
  • It may be a primer or probe that specifically binds.
  • compositions for cancer diagnostics containing formulations that measure the level of ⁇ cancer diagnostic composition'' and overlapping content are omitted in order to avoid excessive complexity in this specification.
  • protein is also intended to include fragments, analogs and derivatives of a protein that possess essentially the same biological activity or function as the reference protein.
  • the preparation for measuring the protein level of the present invention is 2020/175898 1»(:1 ⁇ 1 ⁇ 2020/002709 Refers to a molecule that can be used for the detection of a marker by checking the expression level of a protein, a marker whose level increases in the sample of the sample.
  • the preparation for measuring the level of the protein may be an antibody that specifically binds to the protein.
  • antibody is used in the broadest sense, and is specifically intact.
  • Monoclonal (monoclonal) antibodies Monoclonal (monoclonal) antibodies, polyclonal antibodies, bispecific antibodies (e.g., bispecific antibodies) formed from at least two intact antibodies, and antibody fragments exhibiting the desired biological activity.
  • bispecific antibodies e.g., bispecific antibodies
  • Another aspect of the present invention relates to a cancer diagnosis kit comprising the composition for cancer diagnosis.
  • the kit includes measuring the level of the gene mRNA or protein thereof.
  • the present invention is a pharmaceutical agent for preventing or treating cancer comprising a TUT4/7 expression modulator.
  • the pharmaceutical composition of the present invention has the function of TUT4/7.
  • Fig. 1 is a result of mir-324 arm switching
  • Fig. la is a scatter plot of the median absolute deviation of the 5p ratio for miRNA (rich and everywhere miRNA (amount
  • degrees lb is the IsomiR profile of the miR-324 in the HEK293T measured by AQ-seq (RPM normalized read counts are left, 5p, and Reference sequence in 3p is indicated by gray shades)
  • Figure lc is the strand ratio of mir-324 (5p/3p.l) to the indicated panel of mouse tissue measured by AQ-seq
  • Figure Id is in mammals. Represents the conservation of 5'-isomiR of miR-324.
  • Fig. 2 is a result of mir-324 arm switching controlled by TUT4/7
  • Fig. 2a is a liberalization frequency of miR-324-3p and 5p/ of mir-324 in 9 human cell lines and 15 mouse tissues.
  • Speech correlation between the 3p.l ratios (linear regression is indicated by a dotted line Spearman correlation coefficient)
  • Fig.2b shows the relative TUT4/7 levels in the indicated panel of the mouse tissue and 5p of mir-324 /3p.l ratio (TUT4/7 mRNA level and 5p/3p.l ratio were quantified by RT-qPCR and AQ-seq, respectively.
  • Figure 2c shows AQ-seq results after knockdown of TUT4/7 in HEK293T (left and middle: free dinization generation frequency and 5p ratio distribution of miRNA) .
  • Figure 2d shows northern blots of miR-324-5p and miR-324-3p in HEK293T (synthetic mir -324 double complex (duplex) is used as a size standard)
  • Figure 2e shows the results of sRNA-seq after double knockout of Tut4/7 in mice (left: due to TUT4/7 degradation in the bone marrow)
  • Figure 3 is an alternative dicer cleavage result of pre-mir-324 induced by uridylation
  • Figure 3a is an unmodified, mono- of pre-mir-324 by immunopurification.
  • die-uridinated form in vitro ( ⁇ vzYro) processing synthetic miR-324-5p (23nt) marked in blue is used as a size standard; major cut products and corresponding cuts are indicated by arrowheads.
  • Figure 4 is a double-stranded RNA-binding domain (double stranded RNA-binding domain
  • Figure 4a shows the unmodified, mono-or die of the wild-type or no-bulge mutant pre-mir-324 by an immunopurified dicer.
  • Figures 4b and 4c show immunopurified pocket dicer mutant (4b) or dsRBD-deletion
  • Figure 5 is a result of arm switching induced by alternative dicer cutting
  • Figure 5a is a schematic diagram of the strand selection of the mir-324 double composite fabricated from unmodified and freed pre-mir-324
  • Figure 5b shows the luciferase reporter analysis using two mir-324 duplexes (left: miR-324-5p or three 8mer target sites of 3p.l) and Fig. 5b.
  • Figure 6 is a result of cell cycle progression controlled by mir-324 arm switching
  • Figure 6a is
  • FIG. 6d is a Western blot and cell cycle of the indicated cyclin protein after overexpressing the synthetic 5p double complex (long duplex) or 3p.l double complex (short duplex) of mir-324 in A172 cells.
  • Profile, Figure 6e is a Western blot and cell cycle profile of the indicated cyclin protein after inhibition of miR-324 by locked nucleic acid antisense oligonucleotides in A172 cells, and Figure 6f is in A172 cells.
  • FIG. 7 is a schematic diagram of the mir-324 arm switching mechanism model.
  • solid/solid is (weight/weight)%
  • solid/liquid is (weight/volume)%
  • liquid/liquid is (volume/volume)%.
  • the AQ-seq (bias-minimized sRNA-seq) library was constructed using total RNA from 15 mouse tissues as described in a previous study (Kim et al., 2019).
  • RNA ⁇ ig was mixed with 30 equimolar spikes-in RNA 10 fmoles (miRNA-like non-human/mouse/frog/fish RNA used for bias evaluation). Small RNA was concentrated by size fractionation using 15% urea-polyacrylamide gel electrophoresis, and sequentially ligated to randomized amapters at the 3'and 5'ends. The ligated RNA was Superscript III reverse transcriptase (Invitrogen).
  • the amapter was clipped.
  • the 4-nt denatured sequence was removed at a stock price using the FNTX-Toolkit (http://hannonlab.cshl.edu/fastx toolkit/')#.
  • FASTX-Toolkit is used to filter short, low-quality artificial readouts, then sort the AQ-seq data first to the spike-in sequence, map the unsorted readouts to the next genome, and the other sRNA-seq data BWA was used to map to the genome (Li and Durbin, 2010). Next, the alignment result with the best alignment score that only allowed 3'end mismatch was selected. miRNA annotation is
  • BEDTools (Cozomara and Griffiths-Jones, 2014; Quinlan and Hall, 2010) was searched using miRBase release 21 as a crossover tool.
  • 5'-isomiR was identified. The ratio between the top 5'-isomiR from 5p and 3p was then calculated for all cell lines or tissues. In miRBase release 21, a bi-stranded non-repeat miRNA gene was included in this analysis.
  • RNA sequence was mapped to the mouse genome (mm10). Annotation was searched using GENCODE release M19 as a crossover tool of BEDTools.
  • a supplemental file of data was used.
  • the target gene of miR-324-3p was subdivided according to the 5'end of the miR-324-3p sequence.
  • RNA-binding domain (dsRBD)-deletion Dicer the coding region except for the sequence corresponding to the V1849-S1922 amino acid was amplified and the pCK-FLAG vector using the same method It was cloned inside.
  • A172 and U87MG were imported from Korea Cell Line Bank. HEK293T, A172 and
  • U87MG was maintained in DMEM (WELGENE) supplemented with 10% fetal bovine serum (WELGENE).
  • Primary tumor cells derived from glioblastoma patients (TS13-64) were Yonsei University College of Medicine (4-2012-0212). , 4-2014-0649), and was established from fresh glioblastoma tissue specimens as approved by the Institutional Review Committee.
  • TS 13-64 cells were transferred to IX B-27 (Thermo).
  • Lipofectamine 3000 (Thermo Scientific) was used to treat cells with 20 to 22 nM siRNA twice.
  • pCK-FLAG-DICER was transfected into HEK293T cells using Lipofectamine 3000, and harvested 2 days after transfection.
  • a 20 nM synthetic miRNA duplex or an 80 nM LNA miRNA inhibitor was transfected into cells using Lipofectamine 3000, and harvested 2 days after transfection.
  • Control siRNA (AccuTarget negative control siRNA), siRNA, control miRNA and synthetic mir-324 duplex were obtained from the pipe.
  • Control miRNA inhibitor miRCURY LNA miRNA inhibitor negative control A
  • miR-324 inhibitor hsa-miR -324-5p and hsa-miR-324-3p miRCURY LNA miRNA inhibitors
  • the sequences of the synthetic siRNA and miRNA are shown in Table 2 below.
  • the 5'end of the antisense probe was radiolabeled as [-32P] ATP by T4 polynucleotide (Takara), and was performed using Performa Spin column (Edge BioSystems).
  • the membrane was incubated with the denatured UltraPure Salmon Sperm DNA solution (Thermo Scientific) in PerfectHyb Plus hybridization buffer, hybridized with an antisense probe, washed with mild washing buffer (0.05% SDS and 2X SSC), and stringent washing. Washed with buffer (0.1% SDS and 0.1X SSC). Radioactive signals were detected by Typhoon FLA 7000 (GE Healthcare) and analyzed using Multi Gauge software (FujiFilm).
  • miR-324-3p was detected first, and after the probe was removed, miR-324-5p was
  • RNA from Mouse Total RNA Master Panel was reverse transcribed using the RevertAid First Strand cDNA synthesis kit (Thermo Scientific) and then transferred to Power SYBR Green PCR Master Mix (Thermo Scientific). Quantitative real-time PCR was performed in the StepOnePlus Real-Time PCR system (Thermo Scientific). GAPDH was used for internal control, and the qPCR primer sequences are shown in Table 4 below.
  • Biosystems performed quantitative real-time PCR in the StepOnePlus Real-Time PCR system. U6 snRNA was used for internal control.
  • pre-mir-324 and its variants are [-32P] ATP by the T4 polynucleotide.
  • HEK293T cells overexpressing Dicer protein were dissolved in a lysis buffer (500 mM NaCl, 20 mM Tris (pH 8.0), 1 mM EDTA, 1% Triton X-100). Using Bioruptor Standard (Diagenode)
  • Immunopurifying DNA is in vitro (zVz vitro) in total volume 3 (VL (2mM MgCl 2 , ImM DTT, SUPERase In RNase Inhibitor (Thermo Scientific) 60 unit, including 5'-radiolabeled pre-mir-324))
  • VL 2mM MgCl 2
  • ImM DTT SUPERase In RNase Inhibitor 60 unit, including 5'-radiolabeled pre-mir-324
  • RNA was used as a phenolic compound or Oligo Clean &
  • Synthetic miR-324-5p and Decade Markers System were used as size markers.
  • Synthetic pre-mir-324 fragment was obtained from IDT.
  • Synthetic miR-324-5p was obtained from Bioneer.
  • Synthetic pre-mir-324 fragment and The sequence of miR-324-5p is shown in Table 5 below.
  • [15 is 10. Gene expression analysis of patient data of glioblastoma
  • RRID AB_11042627, Invitrogen
  • BD Accuri C6 Plus flow cytometry It was detected using an analyzer. The cell cycle was analyzed by the BD Accuri C6 system software.
  • the miRNA strand ratio ( ⁇ 79%, median variance less than 3%) did not change; however, several cases were identified that clearly show the change, such as mir-324, mir-362, mir-193a, and mir-140.
  • TUT4 also known as ZCCHC11 and TENT3A
  • TUT7 ZCCHC6
  • TENT3B Also known as TENT3B is known to catalyze the liberalization of various RNA species, including a specific set of pre-miRNAs (e.g., the let-7 precursor).
  • TUT4 and TUT7 (TUT4/7) operate redundantly on most substrates.
  • TUT4/ 7 was depleted in HEK293T cells and sRNA-seq (AQ-seq) was performed.
  • TUT4/7 knockdown includes miR-324-3p
  • TUT4/7 is known to modify pre-miRNA rather than mature miRNA. Therefore, to determine how TUT4/7 regulates mir-324 strand selection, the effect of freedination on pre-miRNA cleavage by performing an in vitro Dicer cleavage analysis with synthetic pre-mir-324. was confirmed.
  • Fig. 3a when pre-mir-324 has one or two extra free din residues at the 3'end, the dicer cut site is moved by 3-nt (Fig. 3a). Move from position A to position B). Unmodified pre-mir-324 emits longer double-complexes (black arrows) mainly containing 5p and 3p.2, while vitrified pre-mir-324 is replaced. Location (cracked in witch blood to produce shorter duplex complexes consisting of shorter 5p and 3p.l) (white arrows). Thus, TUT4/7-mediated liberating in pre-mir-324 leads to alternative dicer cleavage. And it was found.
  • the sequencing data from cells is 3p isomiRs (3p.l vs. The relative abundance of 3p.2) changes according to the TUT4/7 knockdown (Fig. 3b) and knockout (Fig. 3c), thus supporting the conclusion that liberalization changes the dicer cutting site selection.
  • Alternative dicer cleavage is a double-stranded RNA-binding domain.
  • miR-324 isomiRs have the opposite function against GBM cell proliferation.
  • TUT4/7 a terminal free dinase, is pre-mir-324.
  • the present invention relates to a pharmaceutical composition for preventing or treating cancer comprising a 1X114/7 expression modulator, and more particularly, to a pharmaceutical composition for preventing or treating cancer comprising a nucleic acid sequence regulating 1X714/7 expression. It's about.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • General Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Virology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hematology (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)

Abstract

본 발명은 TUT4/7 발현 조절인자를 포함하는 암 예방 또는 치료용 약학적 조성물에 관한 것으로서, 본 발명의 약학 조성물은 TUT4/7의 기능을 억제시킴으로써 세포 분열을 막고 암 발달을 저해시킬 수 있으며, miR-324-5p의 양을 늘리고 miR-324-3p.1의 기능을 억제시킬 수 있으므로, 이를 효과적으로 암 예방, 치료 또는 진단에 이용할 수 있다.

Description

2020/175898 1»（：1^1{2020/002709 명세서
발명의명칭 : 11114/7발현조절인자를포함하는암예방또는 치료용약학적조성물
기술분야
[1] 본발명은 TUT4/7발현조절인자를포함하는암예방또는치료용약학적
조성물에관한것으로,더욱상세하게는 TUT4/7발현을조절하는핵산서열을 포함하는암예방또는치료용약학적조성물에관한것이다.
[2] 본발명은대한민국보건복지부의지원하에서과제번호 1기 1079098에의해 이루어진것으로서,상기과제의연구관리전문기관은기초과학연구원, 연구사업명은 "기초과학연구원연구운영비지원”,연구과제명은” RNA에의한 세포운명조절연구”,주관기관은기초과학연구원,연구기간은 2018.01.01. ~ 2018.12.31.이다.
[3] 본특허출원은 2019년 2월 26일에대한민국특허청에제출된대한민국
특허출원제 10-2019-0022551호에대하여우선권을주장하며,상기특허출원의 개시사항은본명세서에참조로서삽입된다.
배경기술
[4] 마이크로 RNA(micro RNA; miRNA)의생성과정은드로셔 (Drosha)와
다이서 (Dicer)에의한절단과정을통해이중나선 RNA를만들고,이를구성하는 두개의가닥 (5p와 3p)중에한가닥을선택하는과정을수반한다.두가닥은 엄연히다른서열을가지고있어서로다른유전자들의발현을조절할수있기 때문에어떤가닥이선택되는지를결정하는가닥선택 (strand selection)과정은 생물학적으로중요하다.
[5] 한편,세포유형에따라서주로선택되는 miRNA가닥이바뀔수있는데,이를 대안적가닥 (alternative processing)선택 (또는 "암스위칭 (arm switching)”)이라 부른다.대안적가닥선택은조직분화와암발달에영향을미칠수있다.하지만, 이러한대안적가닥선택이어떻게조절을받는지등그의분자메커니즘및 생리적중요성은애매하게남아있다.
발명의상세한설명
기술적과제
[6] 본발명자들은 TUT4및 TUT7(TUT4/7)에의한유리딘화현상이 pre-mir-324의 다이서절단위치를조절함으로써기능이서로다른 3가지마이크로 RNA(5p및 두 3p이형체 )를생성함을확인하고, TUT4/7의기능을억제시켜세포분열을 막고암발달을저해시킬수있으며, miR-324-5p의양을늘리고 miR-324-3p.l의 기능을억제시켜동일한효과를나타낼수있음을규명하고,본발명을
완성하였다.
[刀 따라서,본발명의목적은서열번호 1및 2의염기서열을포함하는마이크로 2020/175898 1»（：1^1{2020/002709
RNA(micro RNA; miRNA);서열번호 4의염기서열로이루어진핵산;및서열번호 5내지 20으로이루어진군으로부터선택된 1개이상의염기서열을포함하는 짧은간섭 RNA(small interfering RNA; siRNA);를포함하는암예방또는치료용 약학적조성물을제공하는것이다.
[8] 본발명의다른목적은서열번호 1및 2의염기서열을포함하는마이크로
RNA(micro RNA; miRNA);서열번호 4의염기서열로이루어진핵산;및서열번호 5내지 20으로이루어진군으로부터선택된 1개이상의염기서열을포함하는 짧은간섭 RNA(small interfering RNA; siRNA);를이용한암치료방법을 제공하는것이다.
[9] 본발명의또다른목적은서열번호 1및 2의염기서열을포함하는마이크로 RNA(micro RNA; miRNA);서열번호 4의염기서열로이루어진핵산;및서열번호 5내지 20으로이루어진군으로부터선택된 1개이상의염기서열을포함하는 짧은간섭 RNA(small interfering RNA; siRNA);의암치료용도를제공하는 것이다.
[1이 본발명의또다른목적은 miR-324-5p또는 miR-324-3p.l의 miRNA의발현
수준을측정하는제제를포함하는암진단용조성물을제공하는것이다.
[11] 본발명의또다른목적은 miR-324-5p또는 miR-324-3p.l의 miRNA의발현
수준을측정하는제제를포함하는암진단용키트를제공하는것이다.
[12] 본발명의또다른목적은 TUT4(Terminal uridylyl transferases 4)또는
TUT7 (Terminal uridylyl transferases 7)의유전자 mRNA또는이의단백질의 수준을측정하는제제를포함하는암진단용조성물을제공하는것이다.
[13] 본발명의또다른목적은 TUT4또는 TUT7의유전자 mRNA또는이의
단백질의수준을측정하는제제를포함하는암진단용키트를제공하는것이다. 과제해결수단
[14] 본발명자들은 TUT4및 TUT7(TUT4/7)에의한유리딘화현상이 pre-mir-324의 다이서절단위치를조절함으로써기능이서로다른 3가지마이크로 RNA(5p및 두 3p이형체 )를생성함을확인하고, TUT4/7의기능을억제시켜세포분열을 막고암발달을저해시킬수있으며, miR-324-5p의양을늘리고 miR-324-3p.l의 기능을억제시켜동일한효과를나타낼수있음을규명하였다.
[15] 이하,본발명을더욱자세히설명하고자한다.
[16]
[17] 본발명의일양태는서열번호 1및 2의염기서열을포함하는마이크로
RNA(micro RNA; miRNA);
[18] 서열번호 4의염기서열로이루어진핵산;및
[19] 서열번호 5내지 20으로이루어진군으로부터선택된 1개이상의염기서열을 포함하는짧은간섭 RNA(small interfering RNA; siRNA);로이루어진군으로부터 선택된 1종이상을포함하는암예방또는치료용약학적조성물에관한것이다. 2020/175898 1»（：1^1{2020/002709
[2이 상기암은뇌종양,결장암,대장암,폐암,간암,위암,식도암,췌장암,담낭암, 신장암,방광암,전립선암,고환암,자궁경부암,자궁내막암,융모암,난소암, 유방암,갑상선암,뇌암,두경부암및/또는악성흑색종일수있으나,이에
Figure imgf000005_0001
부위와의염기결합을통해전사후억제자역할을하는대략 22 의비번역 RNA로유전자발현을조절하는역할을한다.
[22] 본발명의상기마이크로 RNA는서열번호 1및 2의염기서열을포함하는것일 수있다.
[23] 구체적으로,상기마이크로
Figure imgf000005_0002
열번호 1의
염기서열을포함하는마이크로 1 （111溫-324-51））및상기서열번호 2의 염기서열을포함하는마이크로 1^ 111溫-324-31）.2）가서로결합을이루고있는 하나의복합체（ 11¾^幻일수있다.
[24] 상기서열번호 1및 2의염기서열의 5’말단에는인산염（如08如 £）（5如08）이 위치할수있다.
[25] 본발명에서,”핵산”은임의의
Figure imgf000005_0003
샘플에
존재하는염색체,미토콘드리아,바이러스및/또는세균핵산을포함하는 의미이다.이중가닥핵산분자의하나또는두개모두의가닥을포함하고, 무손상핵산분자의임의의단편또는일부를포함한다.
[26] 본발명의핵산은화학적으로변형된 DNA또는 RNA를포함하는것으로
해석된다.당업자는당해기술분야에공지된방법을이용하여원하는방식대로 상기핵산을합성하고변형시킬수있다.
Figure imgf000005_0004
의해절단되어생성되는 18~23뉴클레오티드크기의작은 RNA조각으로 상보적인서열을갖는 mRNA에특이적으로결합하여당해단백질의발현을 억제하는역할을한다.
[29] 본발명의 siRNA는생체내핵산분해효소에의한빠른분해를막기위해
화학적으로변형된 SiRNA를포함하는것으로해석된다.당업자는당해기술 분야에공지된방법을이용하여원하는방식대로상기 1 ^4를합성하고 변형시킬수있다.
[3이 본발명의조성물은세포내로의도입효율을증강시키기위해공지의핵산 전달체와함께세포내로도입될수있다.
[31] 본발명의상기짧은간섭 RNA는서열번호 5내지 20의염기서열을포함하는 것일수있다.
[32] 구체적으로,상기짧은간섭 1^사 11714）는상기서열번호 5내지 8중어느 하나의염기서열을포함하는짧은간섭 RNA및상기서열번호 9내지 12중어느 2020/175898 1»（：1^1{2020/002709 하나의 염기서열을포함하는짧은간섭 RNA가서로결합을이루고있는하나의 복합체일수있다.
[33] 또한,구체적으로,상기짧은간섭 RNA(siTUT7)는상기서열번호 13내지 16중 어느하나의 염기서열을포함하는짧은간섭 RNA및상기서열번호 17내지
20중어느하나의 염기서열을포함하는짧은간섭 RNA가서로결합을이루고 있는하나의복합체일수있다.
[34] 본발명에 있어서 ,상기 miRNA,핵산및/또는 siRNA의치료상유효량은암 치료효과를기대하기 위하여투여에요구되는양을의미한다.따라서 ,질환의 종류,질환의중증도,투여되는핵산의종류,제형,환자의 연령,체중,일반건강 상태，성별,식이 ,투여시간,투여경로및치료기간,동시에사용되는화학항암제 등의 약물을포함하는다양한인자에 따라조절될수있다.
[35] 본발명의조성물은경구,경피 ,피하,정맥또는근육을포함한여러 경로를 통해투여될수있으며，이를위하여본발명에 의한 miRNA,핵산및/또는 siRNA에추가적으로다른첨가제를추가로포함할수있다.
[36] 본발명에 의한조성물의 제형은정제 ,환제 ,산제 ,새세이 ,엘릭서제 ,현탁제 , 유제，액제,시럽제 ,에어로졸,캅셀제 ,멸균주사제 ,멸균산제등의 형태일수 있으며 ,바람직하게는정맥주사,피하주사,내피주사,근육주사등의주사제로 제제화된다.
[37] 본발명의 약학적조성물은당해발명이속하는기술분야에서통상의지식을 가진자가용이하게실시할수있는방법에 따라,약제학적으로허용되는담체 및/또는부형제를이용하여 제제화함으로써 단위용량형태로제조되거나또는 다용량용기내에 내입시켜제조될수있다.이때제형은오일또는수성 매질중의용액,현탁액또는유화액형태이거나엑스제,산제,좌제,분말제, 과립제,정제또는캅셀제 형태일수도있으며,분산제또는안정화제를 추가적으로포함할수있다.
[38] 본발명의 약학적조성물에포함될수있는약제학적으로허용되는담체는 제제시에통상적으로이용되는것으로서,락토스,덱스트로스,수크로스, 솔비톨,만니톨,전분,아카시아고무,인산칼슘,알기네이트,젤라틴,규산칼슘, 미세결정성 셀룰로스,폴리비닐피롤리돈,셀룰로스,물,시럽,메틸셀룰로스, 메틸히드록시벤조에이트,프로필히드록시벤조에이트,활석,스테아르산 마그네슘및미네랄오일등을포함하나,이에 한정되는것은아니다.본발명의 약제학적조성물은상기성분들이외에윤활제 ,습윤제 ,감미제 ,향미제 ,유화제 , 현탁제,보존제등을추가로포함할수있다.적합한약제학적으로허용되는 담체 및제제는 Remington’s Pharmaceutical Sciences( 19th ed., 1995)에상세히 기재되어 있다
[39] 본발명의 약학적조성물은경구및비경구로투여할수있고,예컨대정맥내 주입,피하주입,근육주입,복강주입,국소투여,비강내투여,폐내투여, 직장내투여,경막내투여,안구투여,피부투여 및경피투여등으로투여할수 2020/175898 1»（：1^1{2020/002709 있다.
[4이 본발명의 약학적조성물의 적합한투여량은제제화방법 ,투여 방식 ,환자의 연령,체중,성,병적상태,음식,투여시간,투여 경로,배설속도및반응 감응성과같은요인들에 의해다양하며,보통으로숙련된의사는소망하는치료 또는예방에효과적인투여량을용이하게결정 및처방할수있다.
[41]
[42] 본발명의다른일양태는 miR-324-5p및 miR-324-3p.l로이루어진군으로부터 선택된 1종이상의 miRNA의 발현수준을측정하는제제를포함하는암진단용 조성물에 관한것이다.
[43] 상기마이크로 RNA(miR-324-5p)는서열번호 1의 염기서열을포함하는것일수 있고,상기마이크로 RNA(miR-324-3p.l)는서열번호
3(ACUGCCCCAGGUGCUGCUGG)의 염기서열을포함하는것일수있다.
[44] 구체적으로,상기마이크로 RNA(miR-324-3p. l)는상기서열번호 3의
염기서열을포함하되 3’말단에 1개또는그이상의우라실 (U)이추가로
포함되는것일수있다.
[45] 또한,상기마이크로 RNA는 MIR324유전자 (GenBank Number: 442898)에서
만들어진하나의 전사체 (transcript)로부터드로셔 및다이서에의해절단되어 만들어진것일수있다.
[46] 본명세서에서 "진단”은특정 질병또는질환에 대한한개체의
감수성 (susceptibility；^판정하는것,한개체가특정질병또는질환을현재 가지고있는지 여부를판정하는것,특정 질병또는질환에걸린한개체의 예후 (prognosis)를판정하는것,또는테라메트릭스 (therametrics) (예컨대,치료 효능에 대한정보를제공하기위하여 개체의상태를모니터링하는것)를 포함한다.
[47] 본명세서에서 ’’개체 ",’’대상”또는’’환자’’는인간,소,개 ,기니아피그,토끼 ,닭, 곤충등을포함하여치료가요구되는임의의단일개체를의미한다.또한, 임의의 질병 임상소견을보이지 않는임상연구시험에 참여한임의의 대상 또는역학연구에 참여한대상또는대조군으로사용된대상이 대상에포함된다.
[48] 본명세서에서특별한언급이 없는한,본명세서에서사용되는표현
” miRNA의발현수준측정”은해당시료내에서 검출하고자하는대상을 검출하는것을의미한다.
[49] 본발명에서 검출하고자하는대상은시료내해당 miRNA이다.즉, miRNA를 검출함으로써상기 암의 발병 여부를확인할수있다.
[5이 예를들어 ,상기 miRNA의발현수준은암이 의심되는환자의 생물학적
시료로부터측정할수있다.
[51] 본발명은암인경우가그렇지 않은경우에비해 생체내 miR-324-5p의 발현 수준이유의적으로감소하고, miR-324-3p.l의 발현수준이유의적으로
증가한다는점을확인한것에기초하여, miR-324-5p및 miR-324-3p.l는암의 2020/175898 1»（：1^1{2020/002709 발병여부에대한진단마커로사용된다.
[52] 본발명의 miRNA의발현수준을측정하는제제는암이발병한경우대상의 생물학적시료의검체에서발현수준이감소되는마커인 miRNA및추가적으로 발현수준이증가되는마커인 miRNA의발현수준을확인함으로써마커의 검출에사용될수있는분자를의미한다.
[53] 구체적으로,상기 miRNA의발현수준을측정하는제제는상기 miRNA에 특이적으로결합하는프라이머또는프로브일수있다.
[54] 즉,핵산의검출은유전자를암호화하는핵산분자또는상기핵산분자의 상보물에하이브리드화되는하나이상의올리고뉴클레오타이드프라이머를 사용하는증폭반응에의해수행될수있다.
[55] 예컨대,프라이머를이용한 miRNA의검출은 PCR과같은증폭방법을
사용하여유전자서열을증폭한다음당분야에공지된방법으로유전자의증폭 여부를확인함으로써수행될수있다.
[56] 프라이머는짧은자유 3말단수산화기 (free 3' hydroxyl group)를갖는핵산 서열로상보적인템늘레이트 (template)와염기쌍 (base pair)을형성할수있고 템플레이트가닥복사를위한시작지점으로기능을하는짧은핵산서열을 의미한다.프라이머는적절한완충용액및온도에서중합반응 (즉, DNA 폴리머레이즈또는역전사효소)을위한시약및상이한 4가지뉴클레오사이드 트리포스페이트의존재하에서 DNA합성이개시될수있다.본발명에서는위 하나이상의 miRNA에특이적으로결합하는센스및안티센스프라이머를 이용하여 PCR증폭을실시하여발현수준을확인함으로써암발병여부를 진단할수있다.모이조건,센스및안티센스프라이머의길이는당업계에 공지된것을기초로변형할수있다.
[57] 프로브는짧게는수염기내지길게는수십염기에해당하는 RNA또는 DNA 등의핵산단편을의미하며라벨링되어 있다.프로브는
올리고뉴클로타이드 (oligonucleotide)프로브,단쇄 DNA(single stranded DNA) 프로브,이중쇄 DNA(double stranded DNA)프로브, RNA프로브등의형태로 제작될수있다.본발명에서는위하나이상의 miRNA와상보적인프로브를 이용하여혼성화를실시하여발현수준을확인함으로써암발병여부를진단할 수있다.적당한프로브의선택및혼성화조건은당업계에공지된것을기초로 변형할수있다.
[58] 이러한프라이머또는프로브는공지된서열을바탕으로당업자가적절히 디자인할수있다.
[59] 예컨대,프라이머또는프로브는포스포르아미다이트고체지지체방법,또는 기타널리공지된방법을사용하여화학적으로합성할수있다.이러한핵산 서열은또한당해분야에공지된많은수단을이용하여변형시킬수있다. 이러한변형의비-제한적인예로는메틸화,”캡화”,천연뉴클레오타이드하나 이상의동족체로의치환,및뉴클레오타이드간의변형,예를들면,하전되지 2020/175898 1»（：1/10公020/002709 않은연결체 (예:메틸포스포네이트,포스포트리에스테르,포스포로아미데이트, 카바메이트등)또는하전된연결체 (예:포스포로티오에이트,
포스포로디티오에이트등)로의 변형이 있다.
miRNA의발현수준은바이오키트분야에서통상사용되는방법에따라 측정될수있는데,예컨대 역전사효소중합효소반응 (RT-PCR),경쟁적
역전사효소중합효소반응 (Competitive RT-PCR),실시간역전사효소
중합효소반응 (Real-time RT-PCR), RNase보호분석법 (RPA; RNase protection assay),노던블롯팅 (Northern blotting)또는유전자칩등이포함되며 이들로 제한되는것은아니다.
[6
본발명의또다른일양태는상기 암진단용조성물을포함하는암진단용 키트에 관한것이다.
상기키트에는상기 miRNA의 발현수준을측정하는제제뿐만아니라,암의 진단키트로사용되기에 적합하도록사용되는당분야에서 일반적으로 사용되는도구,시약등이포함될수있다.
64] 상기도구또는시약의 일예로,적합한담체,검출가능한신호를생성할수 있는표지물질,발색단 (chromophores),용해제,세정제,완중제,안정화제등이 포함되나이에제한되지 않는다.표지물질이효소인경우에는효소활성을 측정할수있는기질및반응정지제를포함할수있다.담체는가용성 담체, 불용성 담체가있고,가용성 담체의 일 예로당분야에서공지된생리학적으로 허용되는완충액,예를들어 PBS가있고,불용성 담체의 일 예로폴리스틸렌, 폴리에틸렌,폴리프로필렌,폴리에스테르,폴리아크릴로니트릴,불소수지 ,가교 덱스트란,폴리사카라이드,라텍스에금속을도금한자성미립자와같은고분자,
] ] 기타종이,유리,금속,아가로오스및 이들의조합일수있다.
23
666 6051 예컨대본발명의진단키트는 RT-PCR을수행하기위해필요한필수요소를 포함하는키트일수있다. RT-PCR키트는마커 miRNA에 대한특이적인각각의 프라이머쌍외에도테스트튜브또는다른적절한컨테이너 ,반응완충액 (pH및 마그네슘농도는다양),데옥시뉴클레오타이드 (dNTPs), Taq-폴리머라아제 및 역전사효소와같은효소, DNase, RNAse억제제， DEPC-수 (DEPC-water),멸균수 등을포함할수있다.
[66] 본발명의 키트는상술한조성물을구성으로포함하므로,중복된내용은본 명세서의과도한복잡성을피하기위하여그기재를생략한다.
[67]
[68] 본발명의또다른일양태는 TUT4(Terminal uridylyl transferases 4) (GenBank Number: 23318)및 TUT7 (Terminal uridylyl transferases 7)(GenBank Number:
79670)로이루어진군으로부터선택된 1종이상의유전자 mRNA또는이의 단백질의수준을측정하는제제를포함하는암진단용조성물에관한것이다.
[69] 상기 TUT4유전자의 염기서열은서열번호 21에 나타내었으며,상기 TUT7 2020/175898 1»（：1^1{2020/002709 유전자의 염기서열은서열번호 22에나타내었다.
이 본명세서에서 "진단”은특정 질병또는질환에 대한한개체의감수성을
판정하는것,한개체가특정질병또는질환을현재가지고있는지 여부를 판정하는것,특정질병또는질환에 걸린한개체의 예후를판정하는것,또는 테라메트릭스（예컨대,치료효능에 대한정보를제공하기 위하여 개체의상태를 모니터링하는것）를포함한다.
[71] 본명세서에서 "개체’’, "대상’’또는 "환자’’는인간,소,개,기니아피그,토끼,닭, 곤충등을포함하여치료가요구되는임의의단일개체를의미한다.또한, 임의의 질병 임상소견을보이지 않는임상연구시험에 참여한임의의 대상 또는역학연구에 참여한대상또는대조군으로사용된대상이 대상에포함된다.
[72] 본명세서에서특별한언급이 없는한,본명세서에서사용되는표현 "유전자 mRNA또는이의단백질의수준측정 "은해당시료내에서 검출하고자하는 대상을검출하는것을의미한다.
3] 본발명에서 검출하고자하는대상은시료내해당유전자 mRNA또는이의 단백질이다.즉, mRNA또는이의단백질을검출함으로써상기 암의발병 여부를 확인할수있다.
4] 예를들어,상기 mRNA또는이의 단백질의수준은암이의심되는환자의
생물학적시료로부터측정할수있다.
[75] 본발명은암인경우가그렇지 않은경우에비해 생체내 1X114및 1X117의발현 수준이유의적으로증가한다는점을확인한것에기초하여, 1X114및 1X117은 암의 발병 여부에 대한진단마커로사용된다.
[76] 본명세서에서 "유전자”는단백질코딩또는전사시에또는다른유전자
발현의조절시에기능적 역할을갖는임의의 핵산서열또는그의 일부를 의미한다.유전자는기능적단백질을코딩하는모든핵산또는단백질을코딩 또는발현하는핵산의 일부만으로이루어질수있다.핵산서열은엑손,인트론, 개시또는종료영역,프로모터서열,다른조절서열또는유전자에 인접한 특유한서열내에유전자이상을포함할수있다.
7] 본발명의유전자 mRNA의발현수준을측정하는제제는암이 발병한경우
대상의 생물학적시료의 검체에서발현수준이증가되는마커인 mRNA의발현 수준을확인함으로써마커의 검출에사용될수있는분자를의미한다.
8] 구체적으로,상기 1111여쇼의발현수준을
Figure imgf000010_0001
특이적으로결합하는프라이머또는프로브일수있다.
[79] 상술한
Figure imgf000010_0002
수준을측정하는제제를 포함하는암진단용조성물’’과중복된내용은본명세서의과도한복잡성을 피하기 위하여그기재를생략한다.
[8이 본명세서에서 "단백질”은또한기준단백질과본질적으로동일한생물활성 또는기능을보유하는,단백질의 단편,유사체및유도체를포함하는것이다.
[81] 본발명의 단백질수준을측정하는제제는암이발병한경우대상의 생물학적 2020/175898 1»（：1^1{2020/002709 시료의검체에서수준이증가되는마커인단백질의발현수준을확인함으로써 마커의검출에사용될수있는분자를의미한다.
[82] 구체적으로,상기단백질의수준을측정하는제제는상기단백질에특이적으로 결합하는항체일수있다.
[83] 본발명에서 "항체 "는가장넓은의미로사용되고,구체적으로무손상
모노클로날 (단일클론)항체,폴리클로날항체,적어도 2개의무손상항체로부터 형성된다중특이적항체 (예를들어이중특이적항체)및목적하는생물학적 활성을보이는항체단편을포함한다.
[84]
[85] 본발명의또다른일양태는상기암진단용조성물을포함하는암진단용 키트에관한것이다.
[86] 상기키트에는상기유전자 mRNA또는이의단백질의수준을측정하는
제제뿐만아니라,암의진단키트로사용되기에적합하도록사용되는당 분야에서일반적으로사용되는도구,시약등이포함될수있다.
[87] 상술한 "miR-324-5p및 miR-324-3p.l의 miRNA의발현수준을측정하는제제를 포함하는암진단용조성물;을포함하는암진단용키트’’와중복된내용은본 명세서의과도한복잡성을피하기위하여그기재를생략한다.
발명의효과
[88] 본발명은 TUT4/7발현조절인자를포함하는암예방또는치료용약학적
조성물에관한것으로서，본발명의약학조성물은 TUT4/7의기능을
억제시킴으로써세포분열을막고암발달을저해시킬수있으며, miR-324-5p의 양을늘리고 miR-324-3p.l의기능을억제시킬수있으므로,이를효과적으로암 예방,치료또는진단에이용할수있다.
도면의간단한설명
[89] 도 1은 mir-324암스위칭 (Arm switching)결과로,도 la는 miRNA에대한 5p 비율의중간절대편차의산점도 (풍부하고어디에나있는 miRNA (양
데이터세트에서 >100 median RPM,모든샘플에서 >0 RPM)가분석에포함),도 lb는 AQ-seq에의해측정된 HEK293T에서의 miR-324의 IsomiR프로파일 (RPM 정규화읽기횟수는왼쪽, 5p및 3p의참조시퀀스는회색음영으로표시),도 lc는 AQ-seq에의해측정된마우스조직의지시된패널에대한 mir-324의가닥 비 (5p/3p.l),및도 Id는포유동물에서 miR-324의 5’-isomiR의보존을나타낸다.
[9이 도 2는 TUT4/7에의해조절되는 mir-324암스위칭결과로,도 2a는 9개의인간 세포주및 15개의마우스조직에서 miR-324-3p의유리딘화프리퀀시와 mir-324의 5p/3p.l비 (ratio)사이의음성연관성 (선형회귀는점선으로표시 스피어만상관계수 (Spearman correlation coefficient)),도 2b는마우스조직의 지시된패널에서의상대 TUT4/7수준및 mir-324의 5p/3p.l비 (ratio)(TUT4/7 mRNA수준및 5p/3p.l비는각각 RT-qPCR및 AQ-seq에의해정량화. rs: 2020/175898 1»（：1^1{2020/002709 스피어만상관계수),도 2c는 HEK293T에서 TUT4/7의녹다운후 AQ-seq 결과 (왼쪽및중간:유리딘화생성빈도및 miRNA의 5p비율산포도.
siNC-형질주입된샘플에서풍부한 miRNA(> 100 RPM)가분석에포함.오른쪽:
3개의 5’-isomiR의상대적풍부도및 mir-324의 log2 -변형된 5p/3p.l비),도 2d는 HEK293T에서 miR-324-5p및 miR-324-3p의노던블롯 (합성 mir-324이중 복합체 (duplex)를크기기준으로사용),및도 2e는마우스에서 Tut4/7의이중 녹아웃후 sRNA-seq결과 (왼쪽:골수에서 TUT4/7열화 (depetion)에의한
5’-isomiR의풍부도변화.대조군샘플에서 10초과의 RPM을갖는 5’-isomiR가 분석에포함. two-sided Student's t test에의한 P-값.오른쪽: mir-324의 log2 -변형된 5p/3p.1비.막대는평균 ±s.d..골수 n=2;배아섬유아세포 n=2;배아줄기세포 n=3;간에서의대조군및 Tut4/7 dKO각각 n=4및 3. two-sided Student's t test에 의한 *p<0.05, ***p<0.001 RPM. RPM: reads per million)를나타낸다.
[91] 도 3은유리딘화 (Uridylation)에의해유도된 pre-mir-324의대안적다이서절단 결과로,도 3a는면역정제된다이서에의한 pre-mir-324의변형되지않은,모노- 또는다이-유리딘화된형태의시험관내 (切 vzYro)절단 (processing) (청색으로 표시된합성 miR-324-5p(23nt)를크기기준으로사용.주요절단산물및해당 절단부위는화살촉으로표시 . * :방사성표지된 5’포스페이트),도 3b는
HEK293T에서 miR-324-3p의 5’-isomiR조성물,및도 3c는마우스에서
miR-324-3p의 5'-isomiR조성물 (막대는평균.골수 n=2;배아섬유아세포 n=2; 배아줄기세포 n=3;간에서의대조군및 Tut4/7 dKO각각 n=4및 3)을나타낸다.
[92] 도 4는이중가닥 RNA결합도메인 (double stranded RNA-binding domain;
dsRBD)에의해촉진된대안적다이서절단의결과로,도 4a는면역정제된 다이서에의한야생형또는벌지가없는 (no-bulge)돌연변이체 pre-mir-324의 변형되지않은,모노-또는다이-유리딘화된형태의시험관내 (切 Wiro)절단,도 4b및 4c는면역정제된포켓다이서돌연변이체 (4b)또는 dsRBD-삭제
돌연변이체 (4c)에의한 pre-mir-324의변형되지않은,모노-또는
다이-유리딘화된형태의시험관내 (in wYro)절단 (주요절단산물및해당절단 부위는화살촉으로표시 . *:방사성표지된 5’포스페이트.쩔: 3p위치 nicked 산물),및도 4d는 pre-mir-324의유리딘화-매개대안적다이서절단을위한 제안된모델을나타낸다.
[93] 도 5는대안적다이서절단에의해유도된암스위칭결과로,도 5a는변형되지 않은및유리딘화된 pre-mir-324로부터제조된 mir-324이중복합체의가닥 선택의개략도 (점선사각형은각이중복합체의가닥선택을지시하는끝을 나타냄)및,도 5b는 2개의 mir-324이중복합체를사용한루시퍼라제리포터 분석 (왼쪽: miR-324-5p또는 3p.l의 3개의 8mer표적부위가있는
파이어플라이 (firefly)리포터 mRNA의그림.오른쪽: HEK293T에서 2개의 mir-324이중복합체에대한파이어플라이루시퍼라제의상대리포터활성. 레닐라 (renilla)루시퍼라제의리포터활성을대조군으로사용.막대는 2020/175898 1»（：1^1{2020/002709 평균土 s.d..（n=2, biological replicates） two-sided Student's t test에의한 **p<0.01）을 나타낸다.
[94] 도 6은 mir-324암스위칭에의해조절되는세포주기진행결과로,도 6a는
교모세포종（glioblastoma）및정상뇌조직에서 miR-324-3p의 5'-isomiR조성물의 비율（정상뇌 n=3;교모세포종 n=6）,도 6b는 Oncopression데이터베이스의정상, 저등급교종（glioma）및교모세포종조직에서 TUT4/7의발현수준（정상 n=723; 1 등급 n=74; 2등급 n=133; 3등급 n=132;교모세포종 n=865.다중비교를위한 one-way ANOVA with Tukey's post hoc test에의한 ***p<0.001）,도 6c는
교모세포종（검은색）과일치하는정상뇌조직（흰색）에서 TUT4/7발현수준과 miR-324-5p/3p비간의음의상관관계（선형회귀는점선으로표시. rs:스피어만 상관계수）,도 6d는 A172세포에서 mir-324의합성 5p이중복합체（긴듀플렉스） 또는 3p.l이중복합체（짧은듀플렉스）를과발현한후표시된사이클린단백질의 웨스턴블롯및세포주기프로파일,도 6e는 A172세포에서 locked핵산 안티센스올리고뉴클레오타이드에의해 miR-324를억제한후지시된사이클린 단백질의웨스턴블롯및세포주기프로파일,및도 6f는 A172세포에서
TUT4/7을녹다운한후지시된단백질의웨스턴블롯및세포주기프로파일（ 교차반응밴드. PI:요오드화프로피디움. BrdU:브로모데옥시유리딘）을 나타낸다.
[95] 도 7은 mir-324암스위칭메커니즘모델을모식화한도이다.
발명의실시를위한형태
[96] 이하,본발명을하기의실시예에의하여더욱상세히설명한다.그러나이들 실시예는본발명을예시하기위한것일뿐이며,본발명의범위가이들 실시예에의하여한정되는것은아니다.
[97] 본명세서전체에걸쳐,특정물질의농도를나타내기위하여사용되는
Figure imgf000013_0001
별도의언급이없는경우,고체/고체는（중량/중량）%,고체/액체는（중량/부피）%, 그리고액체/액체는（부피/부피）%이다.
[98]
[99] [준비예]
[100] l. AQ-seq라이브러리
[101] AQ-seq（바이어스가최소화된 sRNA-seq）라이브러리는이전연구（Kim et al., 2019）에설명된대로 15개의마우스조직의전체 RNA를사용하여구성되었다.
[102] 구체적으로,총 RNA ^ig를 30개의등몰스파이크-인 RNA 10 fmole（바이어스 평가에사용되는 miRNA-유사비-인간/마우스/개구리/피쉬 RNA）과혼합하였다. Small RNA는 15%우레아-폴리아크릴아마이드겔전기영동을이용한크기 분별에의해농축되었고 , 3’및 5’말단에서무작위화된어맵터에순차적으로 연결되었다.결찰된 RNA는 Superscript III역전사효소（Invitrogen）를사용하여 역전사되고, Phusion High-Fidelity DNA쓸리머라제（Thermo Scientific）를 2020/175898 1»（：1^1{2020/002709 사용하여증폭되었으며, MiSeq플랫폼 (Illumina)에서대용량
시퀀싱 (high-throughput sequencing; HTS)되었다.
[103]
[104] 2. miRNA의대용량시퀀싱 (high-throughput sequencing)분석
[105] 마우스에서의 sRNA-seq결과의판독값이마우스게놈 (mmlO)에매핑된것을 제외하고는,이전연구 (Kim et al., 2019)에설명된대로데이터를처리하였다.
[106] 구체적으로, cutadapt(Martin, 2011)를사용하여판독값 (reads)으로부터 3'
어맵터를클리핑하였다. AQ-seq데이터의경우 4-nt변성서열을 FNTX-Toolkit( http://hannonlab.cshl.edu/fastx toolkit/')#이용하여주가로제거하였다.
FASTX-Toolkit을사용하여짧고품질이낮은인공판독값을필터링한후, AQ-seq데이터를먼저스파이크-인시퀀스에정렬하고,정렬되지않은판독값을 다음게놈에맵핑하고,다른 sRNA-seq데이터는 BWA를사용하여게놈에 맵핑하였다 (Li and Durbin, 2010).그다음, 3’말단불일치만허용하는최상의 정렬점수를갖는정렬결과를선택하였다. miRNA annotation은
BEDTools(Cozomara and Griffiths-Jones, 2014; Quinlan and Hall, 2010)의교차 도구로 miRBase release 21을사용하여검색하였다.
[107] miRNA가닥비율 (strand ratio)의정량분석을위하여 ,먼저가장풍부하게
발현된세포주또는조직에서주어진성숙 miRNA에대해가장풍부한
5’-isomiR을확인하였다.그다음,모든세포주또는조직에대해 5p및 3p로부터 top 5'-isomiR사이의비를계산하였다. miRBase release 21에서양쪽가닥이주석 처리된비 -반복 miRNA유전자가이분석에포함되었다.
[108]
[109] 3. Targetome분석
[110] 수정된버전의 AGO CLIP-seq(CLEAR-CLIP및 CLASH)의결과를분석하여 , miR-324표적 (target)을식별하였다 (Helwak et al., 2013; Moore et al., 2015).
[111] 먼저 CLEAR-CLIP의분석을위하여 , cutadapt를사용하여 3’및 5’어맵터를
클리핑한후 miR-324서열을포함하는판독값을추출하였다.그다음,표적 RNA 서열을마우스게놈 (mmlO)에맵핑하였다. Annotation은 BEDTools의교차 도구로 GENCODE release M19를사용하여검색하였다.
[112] 다음으로 CLASH의분석을위하여 ,프로토콜 E4에의해생성된 CLASH
데이터의보충파일이사용되었다. miR-324-3p의표적유전자는 miR-324-3p 서열의 5’말단에따라세분되었다.
[113]
[114] 4.플라스미드구축
[115] 야생형 (wild type), 5’포켓다이서돌연변이체및 3’포켓다이서돌연변이체의 발현을위한플라스미드를구축하기위하여 ,인간다이서레퍼런스 (RefSeq NM_030621)의코딩서열을이전연구에서도입된돌연변이의존재또는 부재하에증폭시켰다 (Park et al. 2011).증폭된 DNA를 In-Fusion HD Cloning 2020/175898 1»（：1^1{2020/002709
Kit(Clontech)를사용하여 BamHI및 Xhol부위에서 pCK-FLAG벡터 (CMV 프로모터-구동벡터)로서브클로닝하였다.
[116] 이중가닥 RNA결합도메인 (double stranded RNA-binding domain; dsRBD)-삭제 다이서의경우, V1849-S1922아미노산에상응하는서열을제외한코딩영역을 증폭시키고,동일한방식을이용하여 pCK-FLAG벡터내로서브클로닝하였다.
[117] TRBP의경우,인간 TRBP레퍼런스 (RefSeq NM_134323)의코딩서열을
증폭시키고, BamHI및 Xhol부위에서 pcDNA3-cMyc벡터 (Invitrogen)로서브 클로닝하였다.
[118] 끝으로,루시퍼라제 (luciferase)분석을위한플라스미드를구축하기위하여, miR-l-3p, miR-324-5p또는 miR-324-3p.l의 3개의 8mer표적부위를포함하는 합성 DNA올리고를증폭시키고, Xhol및 Xbal부위에서 pmirGLO(Promega)에 삽입하였다.합성 DNA올리고및 PCR프라이머의서열은하기표 1에 나타내었다.
[119] [표 1]
Figure imgf000015_0001
2020/175898 1»（：1^1{2020/002709
[12이
[121] 5.세포배양및형질주입 (transfection)
[122] A172및 U87MG는한국세포주은행에서입수하였다. HEK293T, A172및
U87MG를 10%소태아혈청 (WELGENE)이보충된 DMEM(WELGENE)에서 유지시켰다.교모세포종 (glioblastoma)환자 (TS13-64)로부터유래된 1차종양 세포는연세대학교의과대학 (4-2012-0212, 4-2014-0649)의기관검토위원회에 의해승인된바와같이,신선한교모세포종조직표본으로부터확립되었다.
[123] 종양구 (tumorsphere)배양을위하여 , TS 13-64세포를 IX B-27(Thermo
Scientific), 20ng/mL의 bFGF(R&D Systems)및 20ng/mL의 EGF(Sigma- Aldrich) 7]- 보충된 DMEM(WELGENE)에서성장시켰다 (Sigma- Aldrich)(Kong et al„ 2013).
[124] TUT4/7을녹다운시키기위하여 ,리포펙타민 (Lipofectamine) 3000(Thermo Scientific)을사용하여 20내지 22nM siRNA로두번에걸쳐세포에
형질주입시키고,제 1형질주입 4일후에수확하였다.
[125] 다이서의과발현을위하여,리포펙타민 3000을사용하여 HEK293T세포에 pCK-FLAG-DICER를형질주입시키고,형질주입 2일후에수확하였다.
[126] 합성 miRNA또는억제제를전달하기위하여 ,리포펙타민 3000을사용하여 20 nM의합성 miRNA듀플렉스또는 80 nM의 LNA miRNA억제제를세포에 형질주입시키고,형질주입 2일후에수확하였다.
[127] 대조군 siRNA(AccuTarget음성대조군 siRNA), siRNA,대조군 miRNA및합성 mir-324이중체는파이프로부터입수하였다.대조군 miRNA억제제 (miRCURY LNA miRNA억제제음성대조군 A)및 miR-324억제제 (hsa-miR-324-5p및 hsa-miR-324-3p miRCURY LNA miRNA억제제 )를 QIAGEN으로부터
수득하였다.합성 siRNA및 miRNA의서열은하기표 2에나타내었다.
2020/175898 1»(：1/10公020/002709
[128] [표 2]
Figure imgf000017_0001
2020/175898 1»(：1^1{2020/002709
Figure imgf000018_0001
[129]
[13이 6.노던블롯 (Northern blot)
[131] TRIzol(Invitrogen)을사용하여종 RNA를분리하고, mirVana miRNA Isolation Kit(Ambion)로 small RNA(<200nt)를농축하였다.그다음, RNA를 15% 우레아-폴리아크릴아마이드겔에서분석하였다.합성 mir-324이중복합체및 Decade Markers System(Ambion)을크기마커로사용하였다. RNA를 Hybond-NX 막 (Amersham)으로옮기고,
1-에틸- 3-(3 -다이메틸아미노프로필)카보다이이미드로막에가교시켰다.
안티센스프로브 5’말단은 T4폴리뉴클레오타이드 (Takara)에의해 [-32P] ATP로 방사성표지되었고, Performa Spin컬럼 (Edge BioSystems)을사용하여
정제되었다.막을 PerfectHyb Plus하이브리드화버퍼에서변성된 UltraPure Salmon Sperm DNA용액 (Thermo Scientific)과함께배양하고,안티센스프로브와 하이브리드화한후, mild세척버퍼 (0.05% SDS및 2X SSC)로세척하고 stringent 세척버퍼 (0.1% SDS및 0.1X SSC)로세척하였다.방사능신호는 Typhoon FLA 7000(GE Healthcare)에의해감지되었으며 , Multi Gauge소프트웨어 (FujiFilm)를 사용하여분석되었다.
[132] miR-324-3p가먼저검출되었고,프로브를벗겨낸다음에 miR-324-5p가
검출되었다.블롯으로부터프로브를제거하기위하여,막을미리끓인 0.5% SDMI 15분동안침지시켰다.합성 mir-324이중복합체 (AccuTarget)는
Bioneer로부터입수하였다.프로브의서열은하기표 3에나타내었다.
[133] [표 3]
Figure imgf000018_0002
[134] 2020/175898 1»(：1^1{2020/002709
[135] 7.정략적실시간 PCR (RT-qPCR)
[136] 마우스조직에서 mRNA수준을측정하기위하여 , RevertAid First Strand cDNA 합성키트 (Thermo Scientific)를사용하여 Mouse Total RNA Master Panel (Takara)의 RNA를역전사하고 Power SYBR Green PCR Master Mix(Thermo Scientific)로 StepOnePlus Real-Time PCR시스템 (Thermo Scientific)에서정량적 실시간 PCR을수행하였다.내부제어에는 GAPDH가사용되었으며 , qPCR 프라이머의서열은하기표 4에나타내었다.
[137] [표 4]
Figure imgf000019_0001
[138]
[139] miR-324-5p/3p가닥비를정량화하기위하여 ,총 RNA를 TRIzol을사용하여 분리하였다.그다음, TaqMan miRNA역전사키트 (Applied Biosystems)를 사용하여 cDNA를합성하고 TaqMan유전자발현분석키트 (Applied
Biosystems)로 StepOnePlus Real-Time PCR시스템에서정량적실시간 PCR을 수행하였다.내부제어에는 U6 snRNA가사용되었다.
[14이
[141] 8.시험관내 (切 vitro)다이서절단분석
[142] pre-mir-324및그변이체는 T4폴리뉴클레오타이드에의해 [-32P] ATP로
방사성표지되었고,제조사의지시에따라 Oligo Clean & Concentrator(Zymo Research)를사용하여정제되었다.
[143] FLAG-DICER의면역침전을위하여,다이서단백질을과발현하는 HEK293T 세포를용해버퍼 (500 mM NaCl, 20 mM Tris(pH 8.0), 1 mM EDTA, 1 % Triton X-100)로용해시키고 Bioruptor Standard(Diagenode)를사용하여
초음파처리하였다.원심분리후,상층액을 1(VL의 ANTI-FLAG M2 Affinity Gel(Sigma-Aldrich)과함께배양하였다.비즈 (beads)를용해버퍼로 2회,고염 2020/175898 1»(：1^1{2020/002709 버퍼 (800mM NaCl및 50mM트리스 (pH 8.0))로 4회 ,버퍼 D(200mM KC1, 20mM 트리스 (pH 8.0), 0.2mM EDTA)로 4회세척하였다.
[144] 면역정제된다이서는총부피 3(VL(2mM MgCl2, ImM DTT, SUPERase In RNase Inhibitor(Thermo Scientific) 60unit, 5'-방사성표지된 pre-mir-324포함)에서시험관 내 (zVz vitro)반응을거쳤다. RNA를페놀주줄물또는 Oligo Clean &
Concentrator로정제하고 15%우레아-폴리-아크릴아마이드겔에서분석하였다. 합성 miR-324-5p및 Decade Markers System을크기마커로사용하였다.합성 pre-mir-324단편은 IDT로부터수득되었다.합성 miR-324-5p는 Bioneer로부터 입수하였다.합성 pre-mir-324단편및 miR-324-5p의서열은하기표 5에 나타내었다.
[145] [표 5]
Figure imgf000020_0001
[146]
[147] 9.듀얼루시퍼라제리포터분석
[148] miR-l-3p, miR-324-5p또는 miR-324-3p.l의 3개의 8mer표적부위를함유하는 pmirGLO를대조 miRNA또는 mir-324이중복합체와함께리포펙타민 3000을 사용하여 HEK293T세포에공동형질주입 (co-transfected)되었다.형질주입 2일 후세포를수확하고리포터분석을수행하였다.리포터활성은제조사의 지시 (Promega)에따라 Spark microplate reader(TEC AN)에서 Dual-Lucif erase Reporter Assay System을사용하여즉정되었다. miR-l-3p가 HEK293T에서거의 발현되지않았음을감안할때 (AQ-seq에서 ~8 RPM), miR-l-3p의 3개의 8mer표적 부위를갖는 pmirGLO가플라스미드대조군으로사용되었다.추가표준화를 위해대조군 miRNA가사용되었다.
[149]
[15이 10.교모세포종 (glioblastoma)환자데이터의유전자발현분석
[151] Oncopression(http:/八) ncopression.com)에서마이크로어레이를사용하여 2020/175898 1»（：1^1{2020/002709 전처리된유전자발현데이터를검색하였다 (Lee and Choi, 2017). REMBRANDT 유전자발현데이터세트 (E-MTAB-3073)는 ArrayExpress(Madhavan et al.,
2009)로부터입수하였다.
[152] mRNA및 miRNA의동시프로파일링을분석하기위하여 (Gulluoglu et al., 2018), 가공전마이크로어레이데이터를요의 limma패키지를사용하여 RMA(robust multi-array average)으로정규화한다음,유전자발현분석에사용하였다.
[153]
[154] 11.생존분석 (Survival analysis)
[155] TCGA교모세포종환자에대한 level 3 miRNA유전자정량화데이터및임상 데이터는각각 GDC legacy archive및 GDC데이터포털로부터획득하였다.
환자들은 miR-324-5p/3p비에따라계층화되었으며,상위및하위 40%가분석에 포함되었다.환자의생존은 Kaplan-Meier방법으로추정하고, R의생존패키지를 사용하여 two-sided log-rank test로테스트하였다.
[156]
[157] 12.웨스턴블롯 (Western blot)
[158] 세포를 PBS로세척하고,프로테아제억제제칵테일세트 III(Merck Millipore) 및포스파타아제억제제칵테일 II(AG Scientific)가보충된 RIPA버퍼 (Thermo Scientific)에용해시켰다. BCA단백질분석키트 (Pierce Biotechnology)로단백질 농도를측정하고,동일한양의단백질을 4-12%트리스-글라이신겔 (Thermo Scientific)에서분리하여 Immobilon-P PVDF막 (Merck Millipore)으로옮겼다. 막을 5%탈지유가포함된 PBS-T(PBS(Amresco) + 0.1%트윈 20(Anatrace))와함께 배양한후일차항체로처리하였다. PBS-T로 3회세척한후,막을 HRP-접합이차 항체와함께배양하였다.단백질밴드는 SuperSignal West Pico PLUS
Chemiluminescent Substrate(Thermo Scientific)에의해검줄되었고, ChemiDoc XRS+시스템 (Bio-Rad)에의해스캔되었다.
[159] TUT4(18980-1-AP, RRID:AB_10598327, 1:500)및 TUT7(25196-1-AP, 1:500)에 대한래빗다클론항체는 Proteintech에서입수하였다. Cyclin E(sc-247,
RRID:AB_627357, 1:1, 000)에대한마우스단일클론항체및 Cyclin A(sc-751, RRID:AB_631329, 1:1,000), Cyclin Bl(sc-752, RRID:AB_2072134, 1:1,000)및 Cyclin Dl(sc-753, RRID:AB_2070433, 1:1, 000)에대한토끼다클론항체는 Santa Cruz Biotechnology에서입수하였다. HSP90(4874, RRID:AB_2121214, 1:1, 000)에 대한토끼다클론항체는 Cell Signaling에서입수하였다.토끼 IgG(m_035-144, RRID:AB_2307391, 1:10,000)및마우스 IgG(l 15-035-146, RRID:AB_2307392,
1 : W,000)에대한 HRP-접합염소다클론항체는 Jackson ImmunoResearch에서 입수하였다.
[16이
[161] 13.유세포분석 (Flow cytometry)
[162] 세포를 3-8시간동안 IO^IM BrdU와함께배양한후, ice-cold 70%에탄올로 2020/175898 1»（：1^1{2020/002709 고정하였다.고정된세포를 FITC-접합항- BrdU항체 (11-50기-42,
RRID:AB_11042627, Invitrogen)와함께배양하고, 10[xg/mL RNase A(Thermo Scientific)의존재하에 20[xg/mL요오드화프로피디움 (Sigma-Aldrich)으로주가 염색하였다.그다음, BD Accuri C6 Plus유세포분석기를사용하여검출하였다. 세포주기는 BD Accuri C6시스템소프트웨어에의해분석되었다.
[163]
[164] [실시예]
[165] 1. mir-324의대안적가닥선택 (또는암스위칭 (Arm switching))
[166] 먼저,가닥비율 (strand ratio)에큰변화를나타내는 miRNA를검색하였다.가닥 비율의정확한정량을위하여, AQ-seq라이브러리프로토콜을사용하였다.가닥 선택 (strand selection)의변이 (variation)는 15개의상이한마우스조직/발달단계에 따라추정되었다 (도 la x축).또한,인간의가닥사용을비교하기위하여, 9개의 인간세포주에서얻은 sRNA-seq데이터세트를사용하였다.
[167] 도 la에서확인할수있듯이,인간및마우스데이터세트모두대부분의
miRNA가가닥비율 (~79%, 3%미만의중간분산)이변하지는않았다.그러나, mir-324, mir-362, mir-193a및 mir-140과같이변화를명확하게보여주는몇가지 사례를확인하였다.
[168] 특히, mir-324의암스위칭이세포운명결정에실질적인영향을미칠수있을 것으로보아, mir-324의가닥변화에집중하였다.
[169] 도 lb내지 Id에서확인할수있듯이,단일 MIR324유전자좌에서생성된
5'-isomiRs(5p, 3p.l및 3p.2)의 3가지그룹이검출되었다 (도 lb). 5p가닥은마우스 배아및신경조직에서우세한반면,주요 (major) 3p이형체인 3p.l은간및 위에서우세하게나타났다 (도 lc).또한, 5'-isomiR그룹은포유류에서
발견되었으며,이는대안적가닥선택메커니즘이진화적으로보존된다는것을 암시한다 (도 Id).
[17이
[171] 2. mir-324암스위칭은 TUT4및 TUT7에의해조절된다.
[172] 3p의유리딘화빈도 (uridylation frequency)는 5p/3p.l비 (ratio)와음의상관
관계가있음을확인하였다 (도 2a).이에따라,유리딘화가암스위칭에관여할수 있다는가설을세웠다.
[173] 한편,터미널유리딜릴트랜스퍼라제 (Terminal uridylyl transferases) ¾
TUT4(ZCCHC11및 TENT3A로도알려져있음)및 TUT7(ZCCHC6및
TENT3B로도알려져있음)은 pre-miRNA의특정세트 (예를들어, let-7전구체)를 포함하는다양한 RNA종의유리딘화를촉매하는것으로알려져있다. TUT4및 TUT7(TUT4/7)은대부분의기질에서중복적으로작동한다.
[174] 상기와같은사실에기초하여 ,마우스조직에서 TUT4/7수준을
정량화 (RT-qPCR)한결과, TUT4및 TUT7수준이비교적낮은세포유형에서 5p/3p.l비율이더높다는것을알수있었다 (도 2b). 2020/175898 1»（：1^1{2020/002709
[175] mir-324성숙（maturation）에서 TUT4/7의관여를확인하기위하여 , HEK293T 세포에서 TUT4/7을열화시키고（depleted） sRNA-seq（AQ-seq）를수행하였다.
[176] 도 2c에서확인할수있듯이, TUT4/7녹다운은 miR-324-3p를포함하여
miRNA의유리딘화를감소시켰다（왼쪽위패널）.또한, TUT4/7녹다운은 3p.l의 감소,및 5p및보조（minor）이형체 3p.2의증가등 miR-324의이형체조성의 변화를초래하으며,결과적으로,주요이형체사이（5p/3p.l）의비가
증가하였다（오른쪽위및아래패널）.
[177] 이러한시퀀싱데이터는노던블롯결과（도 2d）와도일치하였고,이는 TUT4/7 녹다운시 miR-324이형체의양에변화가나타남을의미한다.
[178] 또한,도 2e에서확인할수있듯이, TUT4/7이중녹아웃마우스로부터공개된 sRNA-seq데이터의재분석결과, TUT4/7녹아웃시 3p.l수준은감소하는반면 5p수준은증가하였다（왼쪽패널）.결과적으로,검사된모든조직/세포 유형（골수,배아섬유아세포,배아줄기세포및간）에서 TUT4/7이중녹아웃에 의한가닥비율의변화가관찰되었다（오른쪽패널）.
[179]
[18이 3.유리딘화는 pre-mir-324의대안적다이서절단을유도한다.
[181] TUT4/7은성숙 miRNA보다는 pre-miRNA를변형시키는것으로알려져있다. 이에, TUT4/7이 mir-324가닥선택을어떻게조절하는지확인하기위하여,합성 pre-mir-324로시험관내（/n vitro）다이서절단분석을수행함으로써 pre-miRNA 절단에대한유리딘화의영향을확인하였다.
[182] 도 3a에서확인할수있듯이, pre-mir-324가 3’말단에 1개또는 2개의여분의 유리딘잔기를보유할때,다이서절단부위는 3-nt만큼이동되었다（도 3a의위치 A에서위치 B로이동）.변형되지않은 pre-mir-324는주로 5p및 3p.2를포함하는 더긴이중복합체（검은색화살표）를방출하는반면,유리딘화된 pre-mir-324는 대체위치（위치피에서쪼개져더짧은 5p및 3p.l로구성된더짧은이중 복합체를생성하였다（흰색화살표）.따라서, pre-mir-324의 TUT4/7 -매개 유리딘화는대안적다이서절단으로이어짐을알수있었다.
[183] 또한,도 3b및 3c에서확인할수있듯이, TUT4/7 -열화된인간및마우스
세포로부터의시퀀싱데이터는 3p isomiRs（3p.l vs. 3p.2）의상대적풍부도가 TUT4/7녹다운（도 3b）및녹아웃（도 3c）에따라변하고,이에따라유리딘화가 다이서절단부위선택을변경시킨다는결론을뒷받침한다.
[184]
[185] 4.대안적다이서절단은이중가닥 RNA결합도메인（double stranded
RNA-binding domain）에의해촉진된다.
[186] 먼저, 3-nt이동을담당하는결정요인을확인하기위하여, pre-mir-324에서 U 벌지（bulge）를제거하였다.
[187] 도 4a에서확인할수있듯이, "U벌지가없는（no-bulge）”돌연변이체의경우, 다이서의절단부위가유리딘화에의해더이상위치 B로갑작스럽게이동하지 2020/175898 1»（：1^1{2020/002709 않고,유리딘개수에따라점차적으로이동하였다（레인 10-12） .따라서, II벌지는 위치쇼와 6사이부위에서의절단에대한반- 111 1;）이고, 이에의해다이서의대안적절단을담당하는
Figure imgf000024_0001
요소로서 작용함을확인하였다.
[188] 다음으로, 5'-및 3’-카운팅규칙이 - 111뇨-324절단과어떠한관련이있는지
확인하기위하여, 5’또는 3’포켓에서의다이서돌연변이체를활용하였다.
[189] 도 에서확인할수있듯이, 5’포켓다이서돌연변이체는위치쇼에서
!）^-111뇨-324를절단하지못했으며 , 3’포켓돌연변이체는절단부위선택에 영향을미치지않으면서절단효율에약간영향을미쳤다.이러한결과는,위치 쇼에서의절단에대한 5’포켓의중요성을시사한다.
[19이 나아가,다이서에서다른도메인의기여도를조사하였다.시험관내（切 때
다이서（뇨1내0의역할을확인하기위하여,（ 에）-결실돌연변이체를
생성하였다.
[191] 도 에서확인할수있듯이,
Figure imgf000024_0002
결실은절단패턴에상당한변화를가져 왔다.즉,（ 에）가없으면다이서는주로위치쇼를절단하며,이는（뇨1내0가 위치： 8에서의절단을담당한다는것을시사한다.
[192] 종합해보면,도 4（1에서확인할수있듯이,변형되지않은 - 111^-324는
다이서의플랫폼영역에존재하는 5’포켓에의존하여위치쇼가절단됨을알수 있다（왼쪽패널）.그러나,유리딘화되면,플랫폼/모쇼 도메인에단단히고정되지 않기때문에최종구조（3-4 1113’돌출부）는（뇨1出0의도움으로 !） - 111뇨-324가 다이서에서재배치되어，위치： 8에서대안적절단이가능해짐을알수
있다（오른쪽패널）.
[193]
[194] 5.대안적다이서절단은암스위칭을유도한다.
[195] 상기실시예들의결과에따르면,도 에서확인할수있듯이, !） - 111뇨-324가
2가지대안적형태의이중복합체,즉긴이중복합체（위치 5?/3?.2）및짧은 이중복합체（위치 B, 를생성할수있음을알수있다.
[196] 이에,세포에서의가닥선택을확인하기위하여, 111 -324-5?또는
111溫-324-31）.1에상보적인
Figure imgf000024_0003
함유하는리포터를구성하고（도 ¾왼쪽 패널）,합성이중복합체（ !^!^）또는 ））를리포터와공동
형질주입（¥ - 1 £（此（1）시켰다.그결과,긴이중복합체는 3!）.1부위가아닌 5? 보완부위（¥1111）161116111 ）/ 가있는리포터를선택적으로억제하였다.반면, 짧은이중복합체는 3p.l리포터를하향조절하였으나, 5?리포터는하향 조절하지않았다（도 오른쪽패널）.
[197] 이러한결과는, 5?및 3 1이실제로는긴이중복합체및짧은이중
복합체로부터각각다르게생성됨을시사한다.즉,긴이중복합체의경우 5!）의 5’ 말단이 3 2의 5’말단에비해열역학적으로불안정하기때문에 5?가닥이 선택되는반면（도 ，청색점선사각형）,짧은이중복합체의경우 3 1은쇼（30에 2020/175898 1»（：1^1{2020/002709 의해선호되는 5’아데노신으로시작함을알수있었다 (도 5a,빨간색점선 사각형).
[198] 종합해보면,대안적다이서절단으로인해 mir-324의암스위칭이발생함을알 수있다.
[199]
[200] 6. mir-324암스위칭은세포주기진행을조절한다.
[201] 인간교모세포종 (GBM)에서 miR-324-3p의 5’말단변화가보고된바있으며,도 6a에서도확인할수있듯이,정상적인뇌조직 (Normal brain)보다종양 (GBM)에서 3p.l의비율이실질적으로더높게나타났다.
[202] 이에 , TUT4/7 -매개 mir-324성숙이 GBM에서다르게조절될가능성을
조사하기위하여, Oncopression을이용하여전사체데이터세트를분석하였다.
[203] 도 6b에서확인할수있듯이, TUT4및 TUT7모두 GBM에서크게상향
조절되었다.
[204] 추가적으로, mRNA와 miRNA를모두프로파일링하는독립적인데이터세트를 사용하여정상샘플과비교하였을때, GBM에서 TUT4/7양이상향조절되고, miR-324-5p/3p비가감소함을확인하였다.
[205] 도 6c에서확인할수있듯이, TUT4/7레벨은 5p/3p비율과음의상관관계가 있음을알수있었다.이러한결과는, GBM에서 TUT4/7 -매개 mir-324조절이 생리학적으로관련될수있음을시사한다.
[206]
[207] 상기결과를기초로, mir-324암스위칭의기능을이해하기위하여 , GBM
세포주에서 mir-324대안적가닥선택에의해유도되는분자및세포표현형을 조사하였다.
[208] 도 6d및 6e에서확인할수있듯이,합성긴이중복합체 (”5p duplex")또는 3p에 대한안티센스올리고 (” 3p inhibitor”)의형질주입은사이클린 D및 E의축적및 사이클린 A및 B의감소를초래하였다 (왼쪽패널).또한,세포주기
프로파일링에따르면,세포가이단계에서정지되었음을알수있었다 (우측 패널).
[209] 도 6f에서확인할수있듯이, TUT4/7녹다운도마찬가지로사이클린조절이상 및 G1정지를야기하였다.
[210] 종합해보면, miR-324 isomiRs는 GBM세포증식에대해반대기능을가지고 있음을알수있다.
[211]
[212] [소결]
[213] 도 7에서확인할수있듯이,말단유리딘화효소인 TUT4/7은 pre-mir-324를
유리딘화함으로써 mir-324대안적가닥선택에주요플레이어로서기능한다.즉, TUT4/7은 pre-mir-324를유리딘화시키고,유리딘화현상이 pre-mir-324의다이서 절단위치를조절함으로써기능이서로다른 3가지마이크로 RNA(5p및두 3p 2020/175898 1»（：1^1{2020/002709 이형체）간의비율을변화시킨다.따라서,유리딘화에의한 11-324조절을 저해시키면세포분열관련유전자들의발현을억제할수있고,교모세포종의 성장을억제할수있다.
[214] 본발명에따르면, 1X114/7에의한마이크로 1^쇼（111溫-324）의대안적가닥 선택을조절할수있으므로,이를효과적으로암（뇌종양）의예방,치료에이용할 수있다.
산업상이용가능성
[215] 본발명은 1X114/7발현조절인자를포함하는암예방또는치료용약학적 조성물에관한것으로,더욱상세하게는 1X714/7발현을조절하는핵산서열을 포함하는암예방또는치료용약학적조성물에관한것이다.

Claims

2020/175898 1»（：1^1{2020/002709 청구범위
[청구항 1] 서열번호 1및 2의 염기서열을포함하는마이크로 RNA(micro RNA;
miRNA);
서열번호 4의 염기서열로이루어진핵산;및
서열번호 5내지 20으로이루어진군으로부터선택된 1개 이상의 염기서열을포함하는짧은간섭 RNA(small interfering RNA; siRNA); 로이루어진군으로부터선택된 1종이상을포함하는암예방또는 치료용약학적조성물.
[청구항 2] 제 1항에 있어서,상기마이크로 RNA는상기서열번호 1의 염기서열을 포함하는마이크로 RNA및상기서열번호 2의 염기서열을포함하는 마이크로 RNA가서로결합된복합체 (duplex)형태인,암예방또는 치료용약학적조성물.
[청구항 3] 제 1항에 있어서,상기짧은간섭 RNA는서열번호 5내지 8중어느
하나의 염기서열을포함하는짧은간섭 RNA및상기서열번호 9내지 12 중어느하나의 염기서열을포함하는짧은간섭 RNA가서로결합된 복합체 형태;또는서열번호 13내지 16중어느하나의 염기서열을 포함하는짧은간섭 RNA및상기서열번호 17내지 20중어느하나의 염기서열을포함하는짧은간섭 RNA가서로결합된복합체 형태인,암 예방또는치료용약학적조성물.
[청구항 4] 제 1항에 있어서,상기 암은뇌종양,결장암,대장암,폐암,간암,위암, 식도암,췌장암,담낭암,신장암,방광암,전립선암,고환암,자궁경부암, 자궁내막암,융모암,난소암,유방암,갑상선암,뇌암,두경부암및 악성흑색종으로이루어진군에서선택되는것인,암예방또는치료용 약학적조성물.
[청구항 5] 제 1항에 있어서,상기 암은뇌종양인,암예방또는치료용약학적
조성물.
[청구항 6] miR-324-5p및 miR-324-3p.l로이루어진군으로부터선택된 1종이상의 miRNA의 발현수준을측정하는제제를포함하는암진단용조성물.
[청구항 7] 제 6항에 있어서,상기제제는상기하나이상의 miRNA에특이적으로 결합하는프라이머또는프로브를포함하는것인,암진단용조성물.
[청구항 8] 제 6항및제 7항중어느한항의조성물을포함하는암진단용키트. [청구항 9] 제 8항에 있어서,상기키트는 RT-PCR,실시간 RT-PCR,노던블롯팅,
RNA보호분석법또는마이크로어레이 칩용인,암진단용키트.
[청구항 ] TUT4(Terminal uridylyl transferases 4)및 TUT7 (Terminal uridylyl
transferases 7)로이루어진군으로부터선택된 1종이상의유전자 mRNA 또는이의단백질의수준을측정하는제제를포함하는암진단용조성물.
[청구항 11] 제 10항에 있어서,상기유전자 mRNA의수준을측정하는제제는상기 2020/175898 1»（：1^1{2020/002709
1X114및 1X117중하나이상의 1111^쇼에특이적으로결합하는프라이머 또는프로브를포함하는것인,암진단용조성물.
[청구항 12] 제 10항에 있어서 ,상기단백질의수준을측정하는제제는상기 1X114및
1X117중하나이상의단백질에특이적으로결합하는항체를포함하는 것인,암진단용조성물.
[청구항 13] 제 10항내지제 12항중어느한항의조성물을포함하는암진단용 키트.
[청구항 14] 제 13항에 있어서 ,상기키트는요 中 요키트, DNA칩키트또는단백질 칩용인,암진단용키트.
PCT/KR2020/002709 2019-02-26 2020-02-25 Tut4/7 발현 조절인자를 포함하는 암 예방 또는 치료용 약학적 조성물 WO2020175898A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP20763447.8A EP3904518A4 (en) 2019-02-26 2020-02-25 PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING CANCER CONTAINING TUT4/7 EXPRESSION MODULATOR
CN202080016505.0A CN113498437B (zh) 2019-02-26 2020-02-25 包含末端尿苷酰基转移酶4/7表达调控因子的用于预防或治疗癌症的药学组合物
JP2021549466A JP2022522660A (ja) 2019-02-26 2020-02-25 Ｔｕｔ４／７発現調節因子を含む癌予防又は治療用薬学的組成物
US17/385,277 US20210363527A1 (en) 2019-02-26 2021-07-26 PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING CANCER, COMPRISING MIR-324 and TUT4/7 EXPRESSION MODULATORS

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0022551 2019-02-26
KR20190022551 2019-02-26

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/385,277 Continuation-In-Part US20210363527A1 (en) 2019-02-26 2021-07-26 PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING CANCER, COMPRISING MIR-324 and TUT4/7 EXPRESSION MODULATORS

Publications (1)

Publication Number Publication Date
WO2020175898A1 true WO2020175898A1 (ko) 2020-09-03

Family

ID=72238925

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/002709 WO2020175898A1 (ko) 2019-02-26 2020-02-25 Tut4/7 발현 조절인자를 포함하는 암 예방 또는 치료용 약학적 조성물

Country Status (6)

Country Link
US (1) US20210363527A1 (ko)
EP (1) EP3904518A4 (ko)
JP (2) JP2022522660A (ko)
KR (5) KR102424454B1 (ko)
CN (1) CN113498437B (ko)
WO (1) WO2020175898A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024005575A1 (ko) * 2022-06-29 2024-01-04 서울대학교산학협력단 Rna 안정성 또는 mrna 번역 증가용 신규 조절 엘리먼트, 이와 상호작용하는 zcchc2, 및 이들의 용도

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11236337B2 (en) 2016-11-01 2022-02-01 The Research Foundation For The State University Of New York 5-halouracil-modified microRNAs and their use in the treatment of cancer

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150226744A1 (en) * 2012-09-17 2015-08-13 Ait Austrian Institute Of Technology Gmbh Colon Cancer Diagnostic Method and Means
KR20170050484A (ko) * 2015-10-30 2017-05-11 가톨릭대학교 산학협력단 두경부암 예후 예측용 바이오마커 마이크로 rna
KR20190022551A (ko) 2016-06-28 2019-03-06 도레이 카부시키가이샤 에폭시 수지 조성물, 프리프레그 및 섬유 강화 복합 재료

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100004320A1 (en) * 2006-04-03 2010-01-07 Santaris Pharma A/S Pharmaceutical Composition
WO2009147525A1 (en) * 2008-06-04 2009-12-10 Karolinska Institutet Innovations Ab Skin cancer associated micrornas
US20100179213A1 (en) * 2008-11-11 2010-07-15 Mirna Therapeutics, Inc. Methods and Compositions Involving miRNAs In Cancer Stem Cells
WO2011157294A1 (en) * 2010-06-16 2011-12-22 Universita' Degli Studi Di Padova Compositions for use in treating or preventing cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto
WO2012135081A2 (en) * 2011-03-25 2012-10-04 Children's Medical Center Corporation Lin28-mediated control of let-7 biogenesis
WO2013106766A2 (en) * 2012-01-13 2013-07-18 The Research Foundation Of State University Of New York THERAPEUTIC INDICATIONS OF miR-1291
CN109852695B (zh) * 2013-03-15 2023-11-21 得克萨斯州大学系统董事会 用于诊断和疗法的外来体中的miRNA生物发生
EP3176269B1 (en) * 2014-07-29 2020-12-02 Wellmarker Bio Co., Ltd. Inhibitors of met and igsf1 for treating cancer
US10563201B2 (en) * 2015-02-10 2020-02-18 Public University Corporation Nagoya City University Method for treatment of subjects with TUG1 gene expressing brain tumor
WO2017214330A1 (en) * 2016-06-07 2017-12-14 Children's Medical Center Corporation A novel role for terminal rna uridylation and rna turnover in oncogenesis
KR101913693B1 (ko) 2016-12-14 2018-10-31 사회복지법인 삼성생명공익재단 SS18-SSX 융합 유전자 특이적 siRNA 및 이를 포함하는 암 예방 또는 치료용 약학적 조성물
KR101980902B1 (ko) * 2017-04-06 2019-05-21 이화여자대학교 산학협력단 암의 진단 및 치료를 위한 인간 쓴맛 수용체 tas2r8의 용도

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150226744A1 (en) * 2012-09-17 2015-08-13 Ait Austrian Institute Of Technology Gmbh Colon Cancer Diagnostic Method and Means
KR20170050484A (ko) * 2015-10-30 2017-05-11 가톨릭대학교 산학협력단 두경부암 예후 예측용 바이오마커 마이크로 rna
KR20190022551A (ko) 2016-06-28 2019-03-06 도레이 카부시키가이샤 에폭시 수지 조성물, 프리프레그 및 섬유 강화 복합 재료

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
"Operation Management and Support for Institute of Basic Science", 1 January 2018, INSTITUTE OF BASIC SCIENCE
"Remington's Pharmaceutical Sciences", 1995
DATABASE Nucleotide 11 November 2018 (2018-11-11), "Homo sapiens terminal uridylyl transferase 7 (TUT7), transcript variant 2, mRNA", XP055735732, retrieved from NCBI Database accession no. NM_001185059.1 *
DATABASE Nucleotide 23 January 2019 (2019-01-23), "PREDICTED: Falco cherrug terminal uridylyl transferase 4 (TUT4), transcript variant X2, mRNA", XP055735734, retrieved from NCBI Database accession no. XM_027806943.1 *
DATABASE Nucleotide 4 November 2018 (2018-11-04), "Homo sapiens microRNA 324 (MIR324), microRNA", XP055735735, retrieved from NCBI Database accession no. NR_029896.1. *
KUO, W.-T. ET AL.: "MicroRNA-324 in human cancer: miR-324-5p and miR-324-3p have distinct biological functions in human cancer", ANTICANCER RESEARCH, vol. 36, no. 10, 2016, pages 5189 - 5196, XP055735741, DOI: 10.21873/anticanres.11089 *
LIN, S. ET AL.: "Identification of small molecule inhibitors of Zcchcll TUTase activity", RNA BIOLOGY, vol. 12, no. 8, 2015, pages 792 - 800, XP055446835, DOI: 10.1080/15476286.2015.1058478 *
See also references of EP3904518A4

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024005575A1 (ko) * 2022-06-29 2024-01-04 서울대학교산학협력단 Rna 안정성 또는 mrna 번역 증가용 신규 조절 엘리먼트, 이와 상호작용하는 zcchc2, 및 이들의 용도

Also Published As

Publication number Publication date
KR102336745B1 (ko) 2021-12-08
CN113498437A (zh) 2021-10-12
KR102547432B1 (ko) 2023-06-23
KR102424454B1 (ko) 2022-07-22
EP3904518A4 (en) 2023-10-11
KR20200104249A (ko) 2020-09-03
KR20220124112A (ko) 2022-09-13
KR20210042291A (ko) 2021-04-19
KR20210042292A (ko) 2021-04-19
US20210363527A1 (en) 2021-11-25
KR102336743B1 (ko) 2021-12-08
JP2022522660A (ja) 2022-04-20
KR20210042290A (ko) 2021-04-19
CN113498437B (zh) 2024-06-04
KR102336744B1 (ko) 2021-12-08
EP3904518A1 (en) 2021-11-03
JP2023098926A (ja) 2023-07-11

Similar Documents

Publication Publication Date Title
Zhuo et al. Long noncoding RNA GMAN, up-regulated in gastric cancer tissues, is associated with metastasis in patients and promotes translation of ephrin A1 by competitively binding GMAN-AS
US20110152357A1 (en) Micro-RNA-Based Compositions and Methods for the Diagnosis, Prognosis and Treatment of Multiple Myeloma
KR102547432B1 (ko) Tut4/7 발현 조절인자를 포함하는 암 예방 또는 치료용 약학적 조성물
JP2010529857A (ja) Ｄｒｏｓｈａ媒介性のマイクロｒｎａプロセッシングを標的するための癌原性ａｌｌ−１融合タンパク質
US20160160217A1 (en) Compositions and methods for characterizing and treating muscular dystrophy
TWI816712B (zh) 癌促進因子表現抑制劑的有效成分之篩選用試藥及其篩選方法、癌之預防或治療劑的有效成分之篩選用試藥及其篩選方法、癌促進因子表現抑制劑及癌之預防或治療劑
WO2010094155A1 (en) Methods and compositions diagnosing lung cancer, determining prognosis, and improving patient survival
Chen et al. miR-548d-3p inhibits osteosarcoma by downregulating KRAS
US20110250608A1 (en) Use of ultraconserved rna in detection and treatment of cancer
EP3597739A1 (en) Composition for regulating cancer cell division or differentiation comprising setdb1 or a setdb1 inhibitor
CN109593843B (zh) 生物标志物klhl35在阿尔茨海默诊治中的应用
JP5812491B2 (ja) 腫瘍治療剤
US11510911B2 (en) Method for prediction of susceptibility to sorafenib treatment by using SULF2 gene, and composition for treatment of cancer comprising SULF2 inhibitor
US20220135979A1 (en) Diagnosis and treatment of medulloblastoma
WO2015161189A1 (en) Neat1 as a prognostic marker and therapeutic target for prostate cancer
WO2010084668A1 (ja) ネフローゼ症候群の検査方法、並びにネフローゼ症候群の予防又は治療薬およびそのスクリーニング方法
KR102293777B1 (ko) 신규한 UQCRB-관련 순환 miRNA 바이오 마커 및 이를 이용한 대장암의 진단 방법
WO2024110458A1 (en) Lnc-znf30-3 as cancer biomarker and therapeutic target
WO2023211366A2 (en) Method of prognosing and treating glioma
KR20230165956A (ko) Rnps1 억제제를 포함하는 대장암의 예방 또는 치료용 약제학적 조성물
CN117940565A (zh) 用Wnt家族成员5B(WNT5B)抑制剂治疗骨矿物质密度降低
WO2024062445A1 (en) Treatment and method for predicting disease incidence, progression, and prognosis of glioma
EP4363581A1 (en) Treatment of hypertension with solute carrier family 9 isoform a3 regulatory factor 2 (slc9a3r2) inhibitors
WO2010067307A2 (en) In vitro methods and compositions for the diagnosis and/or treatment of adenocarcinoma
US20150216893A1 (en) Methods and compositions for inhibiting a multi-cancer mesenchymal transition mechanism

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20763447

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021549466

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020763447

Country of ref document: EP

Effective date: 20210730

NENP Non-entry into the national phase

Ref country code: DE