WO2020159298A2 - 로리오라이드 생산성이 높은 신규 미세조류 - Google Patents
로리오라이드 생산성이 높은 신규 미세조류 Download PDFInfo
- Publication number
- WO2020159298A2 WO2020159298A2 PCT/KR2020/001510 KR2020001510W WO2020159298A2 WO 2020159298 A2 WO2020159298 A2 WO 2020159298A2 KR 2020001510 W KR2020001510 W KR 2020001510W WO 2020159298 A2 WO2020159298 A2 WO 2020159298A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- genus
- skin aging
- extract
- composition
- preventing
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9706—Algae
- A61K8/9722—Chlorophycota or Chlorophyta [green algae], e.g. Chlorella
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/04—Oxygen as only ring hetero atoms containing a five-membered hetero ring, e.g. griseofulvin, vitamin C
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/49—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds
- A61K8/4973—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with oxygen as the only hetero atom
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9706—Algae
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/08—Anti-ageing preparations
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/12—Unicellular algae; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/12—Unicellular algae; Culture media therefor
- C12N1/125—Unicellular algae isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/08—Oxygen as only ring hetero atoms containing a hetero ring of at least seven ring members, e.g. zearalenone, macrolide aglycons
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/89—Algae ; Processes using algae
Definitions
- the present invention relates to a microalgae of the genus Senedes characterized by excellent growth rate and high loriolide content.
- the skin Since the skin is the outermost organ in the human body, it has no choice but to be continuously affected by various air pollutants or physical stimuli, especially sunlight containing ultraviolet rays, and is exposed to external stimuli compared to other organs. It is a fragile organ. Cells constituting the skin by such external stimulation may cause cell aging such as cell growth is inhibited and necrosis caused by various causes, and fiber proteins present in the skin cells are destroyed or the synthetic amount is reduced. It can cause wrinkles on the skin.
- the aging phenomenon of the skin is chronological aging (intrinsic aging), which is a natural aging that occurs over time according to biological processes, and degenerative changes occurring in areas exposed to sunlight, and photoaging (combination aging) in which the aging is complex. Aging).
- intrinsic aging is a natural aging that occurs over time according to biological processes, and degenerative changes occurring in areas exposed to sunlight
- photoaging combination aging
- the aging is complex. Aging
- photoaging of skin cells may proceed by light having a wavelength of 280 nm to 400 nm included in sunlight.
- damage to skin or fibers may be caused by irradiation of ultraviolet rays such as UVB having a wavelength in the range of 280 nm to 320 nm, and a soot phenomenon in which the skin burns black may occur.
- UVB When UVB is irradiated, the accumulation of ROS and free radicals in the skin cells is promoted, and the intracellular signaling system is stimulated by the radicals to cause oxidative stress on biomolecules such as DNA, proteins, and lipids. Damage may occur.
- the cellular aging effect caused by the irradiation of ultraviolet rays contained in sunlight may not only cause cosmetic problems due to skin damage, but also cause DNA damage to cells to cause cancer or skin diseases. Therefore, serious health problems may occur, so a solution is needed.
- loliolide is known as a substance synthesized mainly from plants or macroalgae , and is found in a fox bead ( Phyllanthus urinaria ) and is known to have activity to inhibit the penetration of hepatitis C virus (HCV). , It has been reported as a substance having antioxidant activity in the marine giant algae, Sargassum ringgoldianum . However, in freshwater microalgae, it is known only that the extract contains lorioride, and there have been no reports on attempts to synthesize large amounts of lorioride with high efficiency using such freshwater microalgae.
- the genus Scenedesmus is classified as a green algae, and as a classification system, it belongs to the family Chlorophyta, Chlorophyceae, and 4 to 8 unit cells are attached.
- Senedesmus is evenly distributed in fresh water around the world, and is known to have 20 to 30% of lipid content in the body. It has been studied to convert lipids derived from Senedesmus into biodiesel and use them, but further research is needed on the use of them as raw materials for medicines and cosmetics related to skin beauty and skin health.
- the present invention is a novel microalgae excellent in productivity that can increase the synthesis of fibrous proteins in skin cells by increasing the synthesis of fiber proteins in skin cells compared to the known microalgae known in the past, which can produce loriolide with improved effect with higher efficiency. It is aimed at providing.
- an object of the present invention is to provide a pharmaceutical composition for preventing and improving skin aging using the novel microalgae extract as described above.
- an object of the present invention is to provide a cosmetic composition for preventing and improving skin aging using the novel microalgae extract as described above.
- an aspect of the present invention provides a genera of Scenedesmus sp. HS4 ( Senedesmus sp. HS4) deposited with accession number KCTC 13784BP.
- Another aspect of the present invention provides a pharmaceutical composition for preventing and improving skin aging, comprising as an active ingredient an extract or a fraction thereof of the genera HS4 deposited with accession number KCTC 13784BP.
- Another aspect of the present invention provides a cosmetic composition for preventing and improving skin aging, comprising as an active ingredient an extract or a fraction thereof of the genus Sendesmus deposited with accession number KCTC 13784BP.
- compositions for preventing skin aging comprising a loriride produced from HS4 of the genus Senedesmus deposited with accession number KCTC 13784BP.
- HS4 of the genus Senedesmus accumulates a high content of loriolide in cells compared to other microalgae previously published, and has excellent characteristics of organic carbon catabolism, even under conditions where no light is given. It is possible to grow and cultivate at a rapid growth rate, thereby ensuring high biomass productivity and loriolide productivity.
- the high productivity of lorioride provides a possibility of lowering the production cost of lorioride by culturing the microalgae of the present invention in a large amount, and thus it can be used in various medicines, cosmetics, etc. having antioxidant and anti-aging effects. Is expected.
- FIG. 1 shows the genus HS4 ( Scenedesmus sp. HS4) of the present invention.
- Figure 2 is a diagram showing the principle of the adaptive evolution induction process for improving HS4 microalgae of the genus Senedus of the present invention. As the microalgae are cultivated, the amount of light irradiation is gradually decreased and the concentration of organic carbon in the medium is increased to cultivate the culture.
- FIG. 3 shows the photoincubation conditions ('Photo' in FIG. 3), the subculture conditions ('Hetero' in FIG. 3), and the mixed culture conditions ('Mixo' in FIG. 3), respectively. It shows the graph of the growth curve cultured for 7 days, and a photograph of the culture medium.
- 4A to 4E show the results of NMR spectroscopy to identify the chemical structure of the active ingredient in the extract of HS4 microalgae of the genus Senedesmus of the present invention, each in order 1 H NMR, 13 C NMR, 1 H- 1 H COSY, HMQC and HMBC spectrum measurements.
- Figure 5a shows the results of the ESI-mass spectrum measurement for measuring the molecular weight of the active ingredient in the HS4 microalgae extract of the genus Senedesmus of the present invention.
- Figure 5b is the chemical structure of the active ingredient in the genus HS4 microalgae extract of the genus Nedes of the present invention identified on the basis of the results of Figures 4a to 4e, 5a.
- FIG. 6A is a result of LC analysis of purified lorioride and a quantitative line produced using the same
- FIG. 6B is a result of LC analysis of the HS4 microalgae extract of the genus seneides of the present invention using the quantitative line of FIG. 6A .
- Figure 7 compares the biomass production of JD052 microalgae of light-cultured genomes and heterogeneous, mixed-culture (Mixo) genus HS4 microalgae of the present invention, and extracts of the microalgae It is a graph showing a comparison of the content of lorioride.
- FIG. 8 is a graph showing the cell viability of the cells treated with concentrations of human dermal fibroblasts treated with purified lorioride separated from HS4 microalgae of the genus Senedus mousse.
- Figure 9 is a graph comparing the cell viability of the cells by measuring the cell viability of the cells treated with purified lorioride separated from HS4 microalgae of the genus Senedus in human dermal fibroblasts irradiated with ultraviolet light (UVB).
- the control group was targeted to human dermal fibroblasts that were not irradiated with ultraviolet rays and were not treated with loriride.
- Figure 10 is treated with purified loriride separated from HS4 microalgae of the genus Senedus in human dermal fibroblasts irradiated with ultraviolet (UVB) by concentration, qRT-PCR for the expression level of the Col1A1 gene expressed in the cells. It is a graph measured through.
- the control group was targeted to human dermal fibroblasts that were not irradiated with ultraviolet rays and were not treated with loriride.
- FIG. 11 shows qRT-PCR for the expression level of the MMP1 gene expressed in the cells by treating the human dermal fibroblasts irradiated with ultraviolet rays (UVB) by separating the purified lorioride from HS4 microalgae of the genus Senedus by concentration. It is a graph measured through.
- the control group was targeted to human dermal fibroblasts that were not irradiated with ultraviolet rays and were not treated with loriride.
- New algae genus microalgae and composition comprising the same
- the present invention provides a microalgae in a new microalgae.
- the new microalgae of the present invention is Scenedesmus sp. HS4 of the genus Senedes deposited with accession number KCTC 13784BP.
- the genus HS4 in the genus Senedesmus is a microalgae Scenedesmus sp. deposited with deposit number KCTC 1899P in 18s rRNA sequence analysis. It has the same base sequence as JD052, and considering the morphological characteristics of the cells, it was classified as belonging to the genus Senedus, and was specifically named HS4.
- the HS4 in the genus Senedesmus can be cultured even in culture conditions where no light is given. Even when culturing under heterotrophic culture conditions that exclude only light and only organic carbon is given, it can grow at a growth rate similar to that of culturing under mixed culture conditions that provide both light and organic carbon. There is a characteristic.
- the genus HS4 in the genus Senedesmus can produce a very high content of lorioride, a microalgae Scenedesmus sp. deposited with deposit number KCTC 1899P, which can produce conventional lorioride. Even when compared to JD052, the loriolide productivity of HS4 of the genus Senedus is better.
- the JD052 microalgae of the genus Senedesmus is known to have a higher productivity of loriolide than other types of microalgae, and the Senedesmus genus HS4 microalgae of the present invention are known different types of microalgae and Compared to all of JD052 microalgae, the productivity of biomass and loriolide is significantly improved. Therefore, by producing the lorioride using the genus HS4 genus of the present invention, it is possible to replace the process or system previously used for the production of lorioride.
- the HS4 genus of Senedusmus is cultured under heterotrophic culture conditions where only organic carbon (glucose) is provided and light is not given, and mixed culture providing both organic carbon and light (mixotrophic) culture), and cultured under a photoautotrophic culture condition that is commonly used when cultivating microalgae.
- heterotrophic culture conditions where only organic carbon (glucose) is provided and light is not given
- mixed culture providing both organic carbon and light (mixotrophic) culture
- a photoautotrophic culture condition that is commonly used when cultivating microalgae.
- the cell concentration is 5.9 g as the HS4 microalgae of the genus Senedesmus contain 10 g/L of glucose as an organic carbon source under light-free conditions, and are cultured in a medium containing 1 g/L of yeast extract for 7 days. It can grow up to the level of /L and biomass productivity can reach about 0.81 g/L/day.
- the cell concentration is about 5.65 g/L and the bio Compared to the mass productivity of about 0.91 g/L/day, it has the characteristic of being able to grow at a level similar to that in which the light is cultured under a given condition even in the absence of light.
- Another aspect of the present invention provides a composition comprising the microalgae of the new genus Senedesmus.
- the microalgae is Scenedesmus sp. HS4 of the genus Senedesmus deposited with accession number KCTC 13784BP.
- the active ingredient included in the composition is not only HS4 of the genus Senedes deposited with accession number KCTC 13784BP, but also the culture medium of the microalgae, the dried product of the culture medium, the extract of the culture medium, the extract of the microalgae, or the extract It can be a fraction.
- composition comprising HS4 of the genus Senedesmus of the present invention is formulated by using a carrier, excipient and/or additive according to a method that can be easily carried out by a person skilled in the art to which the present invention pertains. It can be manufactured in a dosage form or can be made by incorporating it into a multi-dose container. At this time, the form of the composition may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of an ex-agent, powder, granule, tablet, capsule, gel (eg hydrogel) or lyophilisate.
- a quasi-acid, a stabilizer, or a cryoprotectant may be used.
- the composition containing HS4 of the genus Senedus is in the form of a lyophilisate
- the composition includes lyophilizing the microalgae together with a cryoprotectant to use in the form of a powder
- the cryoprotectant is a natural sugar (natural sugar).
- sugar natural sugar
- skim milk powder maltodextrin, dextrin, trehalose, maltose, lactose, mannitol, cyclodextrin, glycerol and/or honey, but is not limited thereto.
- a storage carrier adsorbed, dried, and solidified to be used.
- the storage carrier may be diatomaceous earth, activated carbon, and/or degreased steel.
- composition comprising HS4 in the genus Senedesmus is in the group consisting of the microalgae, the culture medium of the microalgae, the concentrate of the culture medium, the dried matter of the culture medium, the extract of the culture medium, the extract of the microalgae and the fraction of the extract. It may be prepared through the step of mixing one or more selected one or more of the carrier, excipient or additive.
- the composition containing HS4 in the genus Senedesmus mixes the microalgae and a cryoprotectant, undergoes a process of freezing the mixture at -90 °C to -0 °C, and then drying it. It may be prepared by grinding in powder form.
- the freezing process may be a process of vacuum freezing for 65 to 75 hours at a temperature condition of -45°C to -30°C, a pressure condition of 5 to 50 mTorr, and the drying process of 30°C to 40°C. It may be dried under temperature conditions.
- the present invention provides a pharmaceutical composition for preventing and improving skin aging.
- the pharmaceutical composition for preventing and improving skin aging includes an extract of Scenedesmus sp. HS4 of the genus Senedesmus deposited with the accession number KCTC 13784BP or a fraction thereof as an active ingredient.
- the pharmaceutical composition for preventing and improving skin aging includes lorioride as an active ingredient, in particular, the lorioride is genus HS4 ( Scenedesmus) in the genus of seneides deposited with the accession number KCTC 13784BP sp.HS4).
- lorioride is genus HS4 ( Scenedesmus) in the genus of seneides deposited with the accession number KCTC 13784BP sp.HS4).
- the extract of the genus Senedesmus HS4 may exhibit an effective effect in preventing and improving skin aging.
- the skin aging may be natural aging or photoaging of the skin cells, reducing wrinkles, fine lines, skin elasticity and/or tension of the skin that may be caused by skin aging, creasing, thinning, reducing gloss and gloss, etc. It may be physiological and/or actinic aging, and it may be an external change of skin due to aging, such as internal skin degradation, especially of collagen fiber, which becomes thinner when exposed to ultraviolet rays.
- the extract of HS4 microalgae of the genus Senedesmus has an effect of suppressing aging of skin cells, so it can improve the wrinkles of the skin and increase the elasticity of the skin to maintain a good skin condition in terms of beauty or skin health. It can protect skin cells from ultraviolet rays and suppress negative effects on skin caused by ultraviolet rays.
- the extract of HS4 microalgae of the genus Senedesmus contains lorioride as an active ingredient.
- the loriolide is a substance having an antioxidant activity and preventing or improving aging of skin cells.
- lorioride acts on the skin cells, and promotes the expression of collagen synthesis genes, such as the Col1A1 gene, which is a type of fiber protein constituting skin cells, and suppresses the expression of collagenase genes, such as the MMP1 gene, that break down collagen. It increases the amount of collagen, thereby improving the wrinkles of the skin.
- lorioride improves the phenomenon of reduction in the skin cell viability caused by ultraviolet rays or the decrease in the amount of collagen as described above, thereby increasing the cell survival rate and increasing the amount of collagen, thereby restoring the negative effects of skin cells caused by ultraviolet light.
- the loriolide may be included in the composition at a concentration of 1 ⁇ g/ml to 25 ⁇ g/ml. Specifically, the loriolide is 2 ⁇ g/ml to 23 ⁇ g/ml, 3 ⁇ g/ml to 20 ⁇ g/ml, 5 ⁇ g/ml to 18 ⁇ g/ml, 5 ⁇ g/ml to 15 ⁇ g/ml in the composition, Or 5 ⁇ g/ml to 10 ⁇ g/ml.
- the loriolide is included in a concentration within the above range based on the total composition, the composition does not show toxicity to the treated cells and suppresses a decrease in the viability of the cells by ultraviolet rays and effectively expresses collagen-related genes. There is an effect that can increase the amount of collagen production by controlling.
- the chemical structure of the active ingredient in the extract of HS4 microalgae of the genus Senedesmus is 1 H NMR, 13 C NMR, 1 H- 1 H COSY, HMQC and HMBC spectrum including NMR spectroscopy
- the molecular weight of the active ingredient was measured through the ESI-mass spectrum and compared with an existing database to confirm that the extract of the present invention contained loriolide as the active ingredient.
- lorioride does not show cytotoxicity to human dermal fibroblasts to a concentration of 20 ⁇ g/ml, and restores the cell viability of the human dermal fibroblasts reduced by irradiation with ultraviolet light again. It was confirmed that there is activity. In addition, it was confirmed that the expression of the collagen gene ( Col1A1 ) is promoted and the activity of inhibiting the expression of the collagenase gene ( MMP1 ) is suppressed according to the treatment of the loriolide .
- the extract is culturing HS4 of the genus Senedesmus; Drying the culture of the cultured genus HS4 in HS4 to obtain a dried product; And adding and extracting an organic solvent into the obtained dried product.
- the step of culturing the genus HS4 in the genus Senedesmus is a medium of a composition consisting of a temperature condition of 20°C to 30°C, 5 g/L to 15 g/L of glucose, and 0.5 g/L to 1.5 g/L of enzyme extract, It may be performed under conditions that are not irradiated. In addition, in addition to the above conditions, it may be performed under conditions in which light is irradiated with a light intensity of 30 ⁇ mol ⁇ m ⁇ 2 ⁇ s -1 to 100 ⁇ mol ⁇ m -2 ⁇ s -1 .
- the growth rate of HS4 in the genus Senedus may be significantly reduced, so that the biomass obtained may decrease, and antioxidant and skin anti-aging effects
- a substance for example, loriolide
- the anti-aging and improvement effect of skin cells may be significantly lower.
- a solvent extraction method a reflux extraction method may be used as the extraction method, and for example, conventionally known conventional extraction methods such as ultrasonic extraction method and filtration method may be used.
- the extraction process may be repeated several times, after which it may be further subjected to steps such as concentration or lyophilization. Specifically, the obtained extract may be concentrated under reduced pressure to obtain a concentrated solution, and the concentrated solution may be lyophilized and then a high concentration of extracted powder may be prepared using a grinder.
- the extraction process may be repeated several times, and thereafter, a method such as concentration or freeze drying may be additionally performed. Specifically, the obtained extract was concentrated under reduced pressure to obtain a concentrated solution, and the concentrated solution was lyophilized, and then a high-concentration extract powder could be prepared using a grinder.
- the solvent When extracting the extract, the solvent may be water, an organic solvent, or a mixture thereof.
- the organic solvent may be ethyl acetate, for example, alcohol, hexane (n-hexane), ether, glycerol, propylene glycol, butylene glycol, methyl acetate, dichloromethane, chloroform, or benzene, but is not limited thereto. no.
- the extract of HS4 in the genus Senedesmus may be further fractionated, and the fraction obtained as above may also be used as an active ingredient in the pharmaceutical composition for preventing and improving skin aging of the present invention.
- the extract of HS4 in the genus Senedesmus can be fractionated to obtain a fraction of HS4 in the genus Senedusmus.
- the solvent that can be used in preparing the fraction may be an organic solvent such as ethyl acetate, acetone, acetonitrile, chloroform, dichloromethane, ethyl ether, xylene, hexane and combinations thereof, but is not limited thereto.
- the fraction of the present invention may be to obtain a fraction by further performing a conventional fractionation process in order to concentrate the content of the lorioride.
- a fraction obtained by passing the extract of HS4 of the genus Senedus according to the present invention through an ultrafiltration membrane having a constant molecular weight cut-off value, various chromatography (prepared for separation according to size, charge, hydrophobicity or affinity) are also included in the fractions of the present invention.
- the active fraction is obtained by separating a fraction having a higher loloriide content from the fraction, and is also referred to as an active fraction or an effective fraction.
- concentration is separated according to the properties of the active ingredient through column chromatography, etc., thereby producing a specific active fraction having a higher lorilide content. can do.
- the column chromatography was performed by column chromatography using a filler selected from the group consisting of silica gel, Sephadex, LH-20, ODS gel, RP-18, polyamide, Toyopearl and XAD resin to separate the active fraction.
- column chromatography can be carried out several times by selecting an appropriate filler as needed, but is not limited thereto.
- the elution solvent, elution rate, and elution time may be applied to a solvent, rate, or time generally used in the art.
- the pharmaceutical composition comprising the extract or a fraction thereof as an active ingredient of the present invention according to a method that can be easily carried out by those skilled in the art to which the present invention pertains, a pharmaceutically acceptable carrier and / Or can be prepared in unit dose form by formulating with excipients or by incorporating into a multidose container.
- the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an ex-agent, powder, granule, tablet, capsule or gel (eg, hydrogel), and may additionally include a dispersant or stabilizer. have.
- the extract or fractions thereof contained in the pharmaceutical composition may be carried in a pharmaceutically acceptable carrier such as colloidal suspension, powder, saline, lipid, liposome, microspheres, or nano spherical particles.
- a pharmaceutically acceptable carrier such as colloidal suspension, powder, saline, lipid, liposome, microspheres, or nano spherical particles.
- These can be complexed or associated with transport vehicles, and can be used in the art, such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation reagents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancing substances or fatty acids. It can be transported in vivo using known transport systems.
- pharmaceutically acceptable carriers are lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia, rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, Polyvinyl pyridone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil, and the like, but is not limited thereto.
- lubricants, wetting agents, sweetening agents, flavoring agents, emulsifying agents, suspending agents, preservatives, etc. may be further included in addition to the above components.
- the pharmaceutical composition according to the present invention can be administered orally or parenterally during clinical administration, and may be used in the form of a general pharmaceutical preparation. That is, the pharmaceutical composition of the present invention may be administered in various dosage forms, oral and parenteral, during actual clinical administration.
- diluents such as fillers, bulking agents, binders, wetting agents, disintegrating agents, surfactants, etc. Or it is prepared using an excipient.
- Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc.These solid preparations include at least one excipient in herbal extracts or herbal fermentations, such as starch, calcium carbonate, sucrose or It is prepared by mixing lactose and gelatin.
- Liquid preparations for oral administration include suspending agents, intravenous solutions, emulsions, syrups, etc.
- various excipients such as wetting agents, sweeteners, fragrances, and preservatives, can be included.
- Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories.
- non-aqueous solvent and a suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used.
- injectable ester such as ethyl oleate
- Witepsol Witepsol, Macrogol, Tween 61, cacao butter, laurin, glycerol, gelatin, etc. may be used.
- Effective doses of the extract of HS4 of the genus Senedus mousse or fractions thereof are factors such as the formulation method, administration method, patient's age, weight, sex, morbidity, food, administration time, route of administration, rate of excretion and response sensitivity. Although it may vary by field, it is generally 1 to 20 mg/day per kg of adult patient weight, preferably 5 to 10 mg/day, several times a day at regular time intervals at the discretion of the doctor or pharmacist , Preferably it can be divided into 2 to 3 times a day.
- the present invention is a Scenedesmus sp. HS4 of the genus Senedesmus deposited with accession number KCTC 13784BP, a culture medium of the Senedesmus genus HS4, a concentrate of the culture medium, a dried material of the culture medium, an extract of the culture medium and a fraction of the extract It provides a method for preventing, improving or treating skin aging, comprising administering to a subject a composition comprising one or more selected from the group consisting of.
- the individual may be a human or an animal other than a human.
- the composition may be administered to the individual to prevent skin aging of the individual.
- the skin aging of the individual may be improved or treated by administering the pharmaceutical composition to the subject.
- the prevention means reducing the risk of a disease or disorder, and it is easy to be exposed to a disease or to develop a disease, but to prevent one or more clinical symptoms of the disease from progressing in a subject who does not yet have a disease or show symptoms of the disease It means all actions that suppress or delay the onset of disease.
- the treatment refers to alleviating a disease or disorder, and all actions to improve or beneficially alter the symptoms of the disease by preventing or reducing the progression of the disease or one or more clinical symptoms thereof.
- the improvement refers to all actions that improve or benefit the symptoms of a disease or disorder.
- composition its formulation, administration method, dosage, concentration of the active ingredient contained in the composition and description of skin aging are the same as described above.
- the present invention provides a cosmetic composition for preventing and improving skin aging.
- the cosmetic composition for preventing and improving skin aging includes an extract of Scenedesmus sp. HS4 of the genus Senedesmus deposited with the accession number KCTC 13784BP or a fraction thereof.
- the cosmetic composition for preventing and improving skin aging includes lorioride as an active ingredient, and in particular, the lorioride is Scenedesmus sp in genus Senedesmus deposited with the accession number KCTC 13784BP HS4).
- the loriolide may be included in the composition at a concentration of 1 ⁇ g/ml to 25 ⁇ g/ml. Specifically, the loriolide is 2 ⁇ g/ml to 23 ⁇ g/ml, 3 ⁇ g/ml to 20 ⁇ g/ml, 5 ⁇ g/ml to 18 ⁇ g/ml, 5 ⁇ g/ml to 15 ⁇ g/ml in the composition, Or 5 ⁇ g/ml to 10 ⁇ g/ml.
- the loriolide is included in a concentration within the above range based on the total composition, the composition does not show toxicity to the treated cells and suppresses a decrease in the viability of the cells by ultraviolet rays and effectively expresses collagen-related genes. There is an effect that can increase the amount of collagen production by controlling.
- the method of manufacturing the extract or fraction of the genus HS4 ( Scenedesmus sp. HS4) was described in the method of "2. Pharmaceutical composition for preventing and improving skin aging", and thus the description is omitted.
- the cosmetic composition of the present invention may include a cosmetically effective amount and a cosmetically acceptable carrier of the extract or fraction, and the cosmetically effective amount is used to achieve the aforementioned skin anti-aging and improvement efficacy. It means enough.
- the cosmetic composition of the present invention further contains other ingredients having characteristics that can have a synergistic effect on the activity of the extract or fraction within a range not affecting the anti-aging and improving activity of the extract or fraction of the skin can do.
- fatty substances organic solvents, solubilizers, thickeners and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic emulsifiers
- Cosmetics such as fillers, metal ion blockers and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, fragrances, hydrophilic or lipophilic actives, lipid vesicles or any other ingredients commonly used in cosmetics, etc.
- it may contain an adjuvant commonly used in the field of skin science, and the ingredients may be contained in an amount generally used in the field of cosmetics or skin science.
- the cosmetic composition of the present invention may be prepared in any formulation conventionally prepared in the art, for example, solution, suspension, emulsion, gel, lotion, essence, cream, powder, soap, shampoo, rinse, It can be formulated with cosmetic products such as pack mask, surfactant-containing cleansing, cleansing foam, cleansing water, oil, liquid foundation, cream foundation or spray.
- cosmetic products such as pack mask, surfactant-containing cleansing, cleansing foam, cleansing water, oil, liquid foundation, cream foundation or spray.
- a solvent, solubilizing agent or emulsifying agent may be used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 Fatty acid esters of ,3-butylglycol oil, glycerol aliphatic esters, polyethylene glycol or sorbitan can be used.
- liquid diluents such as water, ethanol or propylene glycol as carrier components, ethoxylated isostearyl alcohol, suspensions such as polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, aluminum metahydroxy Seeds, microcrystalline cellulose, bentonite, agar or trakant, etc.
- suspensions such as polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, aluminum metahydroxy Seeds, microcrystalline cellulose, bentonite, agar or trakant, etc.
- the formulation is a cream or a gel
- wax, paraffin, trakant, animal oil, starch, cellulose derivative, silicone, bentonite, polyethylene glycol, silica, zinc oxide or talc may be used as a carrier component.
- a carrier component may include a propellant such as silica, talc, aluminum hydroxy group, lactose, calcium silicate, chlorofluorohydrocarbon, propane/butane or dimethyl ether.
- a propellant such as silica, talc, aluminum hydroxy group, lactose, calcium silicate, chlorofluorohydrocarbon, propane/butane or dimethyl ether.
- the formulation is a surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, imidazolinium derivative, isethionate, methyltaurate, sarcosinate, fatty acid amide ether sulfate as carrier component , Aliphatic alcohols, alkylamidobetaines, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters.
- the present invention provides a composition for preventing and improving skin aging.
- composition for preventing and improving skin aging includes a lorioride produced from Scenedesmus sp. HS4 of the genus Senedes deposited with accession number KCTC 13784BP.
- the lorioride is culturing HS4 of the genus Senedus; Drying the culture of the cultured genus HS4 in HS4 to obtain a dried product; Adding and extracting an organic solvent into the obtained dried product; And separating the loriolide from the extract.
- Description of the culture, drying, extraction step, etc. is the same as described in the "2. Skin aging prevention and improvement pharmaceutical composition", the description is omitted.
- the loriolide may be included in the composition at a concentration of 1 ⁇ g/ml to 25 ⁇ g/ml. Specifically, the loriolide is 2 ⁇ g/ml to 23 ⁇ g/ml, 3 ⁇ g/ml to 20 ⁇ g/ml, 5 ⁇ g/ml to 18 ⁇ g/ml, 5 ⁇ g/ml to 15 ⁇ g/ml in the composition, Or 5 ⁇ g/ml to 10 ⁇ g/ml.
- the loriolide is included in a concentration within the above range based on the total composition, the composition does not show toxicity to the treated cells and suppresses a decrease in the viability of the cells by ultraviolet rays and effectively expresses collagen-related genes. There is an effect that can increase the amount of collagen production by controlling.
- lorioride does not show cytotoxicity to human dermal fibroblasts to a concentration of 20 ⁇ g/ml, and restores the cell viability of the human dermal fibroblasts reduced by irradiation with ultraviolet light again. It was confirmed that there is activity. In addition, it was confirmed that the expression of the collagen gene ( Col1A1 ) is promoted and the activity of inhibiting the expression of the collagenase gene ( MMP1 ) is suppressed according to the treatment of the loriolide .
- the lorioride may have an effective effect in preventing and improving skin aging.
- the skin aging may be natural aging or photoaging of the skin cells, reducing wrinkles, fine lines, skin elasticity and/or tension of the skin that may be caused by skin aging, creasing, thinning, reducing gloss and gloss, etc. It may be physiological and/or actinic aging, and it may be an external change of skin due to aging, such as internal skin degradation, especially of collagen fiber, which becomes thinner when exposed to ultraviolet rays.
- the lorioride Since the lorioride has an effect of suppressing aging of skin cells, it can improve skin wrinkles and increase skin elasticity, thereby maintaining a good skin condition in terms of cosmetic or skin health, and protecting skin cells from ultraviolet rays. It protects and can suppress negative effects on skin caused by UV rays.
- the composition may be used as a pharmaceutical composition or a cosmetic composition, the description of which is the same as described in "2. Skin aging prevention and improvement pharmaceutical composition” and “3. Skin aging prevention and improvement cosmetic composition” Therefore, the description is omitted.
- the senedesmus HS4 ( Scenedesmus sp. HS4) deposited with the accession number KCTC 13784BP, the culture medium of the senedesmus HS4, the concentrate of the culture medium, the dried matter of the culture medium, the extract of the microalgae, and the culture medium Provides one or more skin aging prevention, improvement or treatment uses selected from the group consisting of extracts and fractions of the extracts.
- the present invention is for use in the prevention, improvement or treatment of skin aging, Scenenesmus sp. HS4 deposited with accession number KCTC 13784BP, Scenedesmus sp. HS4, culture medium of the genus HS4, concentration of the culture medium, the It provides a dried product of the culture medium, an extract of the microalgae, an extract of the culture medium, or a fraction of the extract.
- the senedesmus HS4 Scenedesmus sp. HS4
- the culture medium of the senedesmus HS4 the concentrate of the culture medium, the dried matter of the culture medium, the extract of the microalgae, and the culture medium It provides a use for preparing a drug for preventing, improving or treating one or more skin aging selected from the group consisting of an extract and a fraction of the extract.
- HS4 microalgae of the genus Senedesmus pharmaceutical composition comprising the same, cosmetic composition, skin aging, prevention, improvement, treatment, etc. is the same as described above.
- JD052 microalgae of the genus Senedesmus (Accession No. KCTC 1899P), one of the microalgae capable of producing loriolide, was used. What was used was used.
- the JD052 microalgae of the genus Senedesmus were cultured by changing the concentration to provide organic carbon and changing the light irradiation amount.
- microalgae In order to develop a microalgae capable of growing under light-free conditions, the microalgae were cultured in a conventional microalgal culture medium, but the concentration of glucose in the medium was increased and the light irradiation was gradually reduced to adaptive evolution. (See Figure 2).
- JD052 of the genus Senedesmus was cultured in a medium composed of the composition of Table 1 below to remove bacteria.
- the medium was used by increasing the content of K 2 HPO 4 in BG11 medium from existing 0.04 g to 0.2 g.
- the initial dose of light is 50 ⁇ mol ⁇ m -2 ⁇ s -1 and the concentration of glucose starts at the first 0 g/L and cultured for 1 month.
- the dose of light is 30 ⁇ mol ⁇ m -2 ⁇ s -1 and the concentration of glucose is Incubated for 1 month under the condition of 0.1 g/L, the light irradiation amount was 15 ⁇ mol ⁇ m -2 ⁇ s -1, and the glucose concentration was cultured for 1 month under the condition of 1 g/L, and the light irradiation amount was 5 ⁇ mol ⁇ m -2 Cultured for 1 month under conditions of s -1 and glucose concentration of 5 g/L, and finally cultured for 1 month under conditions of light irradiation of 0 ⁇ mol ⁇ m -2 s -1 and glucose concentration of 10 g/L. .
- heterotrophic culture targeting the HS4 genus genus (heterotrophic culture, culture conditions given organic carbon)
- the microalgae were cultured with different culture conditions for photoculture (photoautotrophic culture, culture conditions where light is given) and mixed culture (mixotrophic culture, culture conditions for both organic carbon and light).
- a culture medium having 10 g/L of glucose and 1 g/L of yeast extract added to a medium (pH 7.1) composed of the composition of Table 1, which is sterilized is 25 in a 1 L flask.
- the genus HS4 of the genus senesmus of the present invention was cultured for 7 days.
- the initial dose of HS4 was 0.2 g/L.
- the other conditions are the same as the dependent culture conditions, but a medium other than glucose and yeast extract was used and cultured by irradiating light with a light amount of 50 ⁇ mol ⁇ m ⁇ 2 ⁇ s -1 .
- both light and organic carbon showed the fastest growth rate in a given mixed culture condition, and even when cultured in a dependent culture condition, they grew to a similar level, although they were slower than the mixed culture. It showed a significantly higher growth rate than the case.
- the final cell weight was 2.01 g/L in the case of photoculture, 5.9 g/L in case of subculture, and 6.65 g/L in case of mixed culture, and the calculated average daily biomass productivity was photocultured.
- the HS4 microalgae of the genus Senedesmus of the present invention Unlike other conventional microalgae or JD052 microalgae, which was an improved parent strain, it was confirmed that cultivation is possible by showing high growth even in subculture conditions where no light is given and only organic carbon is provided, and the growth rate compared to light culture conditions. It was confirmed that it was fast enough to produce a large amount of biomass (FIG. 3).
- the extract sample was dissolved in a solvent to perform silica gel column chromatography (silica gel column chromatography) and high performance liquid chromatography (HPLC, high performance liquid chromatography) to divide the fraction, the fraction showing activity among the fractions was concentrated to preparative ODS MPLC Purified through.
- the chemical structure of the compound present in the extract was determined by dissolving the purified sample in CD 3 OD and measuring the 1 H NMR, 13 C NMR, 1 H- 1 H COSY, HMQC and HMBC spectra.
- the molecular weight of the ingredient was measured by the ESI-mass spectrum.
- the extract of HS4 of the genus Senedus of the present invention contains a loriolide.However, when the genus of the genus Senedus HS4 is compared with other microalgae, how much more of the Lorioride is produced To see if you can. First, using the extract of purified lorioride, mixed with methanol to a concentration of 200 ppm, and diluted again to make a quantitative line of lorioride (FIG. 6A).
- the HS4 extract of the genus Senedesmus of the present invention contains a similar level of content compared to the conventional JD052 microalgae extract.
- the JD052 in the genus Senedesmus corresponds to a microalgae having a very low catabolism efficiency of organic carbon, so 350 ml of a culture solution (pH 7.1) composed of the composition of Table 1 in sterilized conditions is 25° C. in a 1 L flask and the light intensity is 50. Cultured for 7 days by irradiating light of ⁇ mol ⁇ m -2 ⁇ s -1 , and the initial inoculation amount of the JD052 was 0.2 g/L.
- the HS4 microalgae of the present invention were cultured under the conditions of heterotrophic culture given only organic carbon, excluding mixed culture and light providing both light and organic carbon.
- biomass productivity was confirmed by measuring the weight per volume of biomass of each microalgae cultured as described above, and the lory of each microalgae was used by using the value of the loriolide content in the microalgae extract analyzed in Example 5 above. Oride productivity was confirmed.
- the other conditions are the same as the culture conditions of JD052, but a culture medium having a composition in which glucose 10 g/L and yeast extract 1 g/L was added was used, and light was not irradiated.
- a culture medium having a composition in which glucose 10 g/L and yeast extract 1 g/L was added was used, and light was not irradiated.
- mixed culture conditions in addition to the same conditions as in the case of the dependent culture conditions, light was cultured by irradiating light having a light intensity of 50 ⁇ mol ⁇ m ⁇ 2 ⁇ s -1 .
- the initial dose of HS4 was 0.2 g/L.
- the biomass productivity was 0.26 g/L/day, and it was confirmed that the loriolide productivity was 11.9 ng/L/day.
- the biomass productivity was confirmed to be 0.81 g/L/day, and the loriolide productivity was 28 ng/L/day, and for the mixed cultured HS4, the biomass productivity was Was 0.92 g/L/day, and it was confirmed that the loriolide productivity was 43 ng/L/day (FIG. 7 ).
- the HS4 microalgae of the genus Senedus of the present invention have improved biomass productivity by about 3 times and 3.4 times, respectively, when subjected to subculture and mixed culture, compared to the conventional JD052 microalgae. It was confirmed that the productivity of the lorioride was improved by about 2.4 times and 3.6 times, respectively. Therefore, the novel genus HS4 microalgae of the present invention has a characteristic that the productivity of biomass and loriolide is significantly increased because the growth rate is excellent even in culture conditions where light is not given compared to the conventional microalgae. Confirmed.
- the produced lorioride is purified and treated to human dermal fibroblasts (HDFs). The effect was confirmed.
- lorioride Purification of the lorioride was carried out in the same manner as in Example 3, and an extract using ethyl acetate was obtained from the lyophilized culture medium of the HS4 microalgae of the genus senemus of the present invention, followed by a fraction/concentration process to perform a lorioride.
- Don medium Dulbecco's modified Eagle's medium, L0103-500, Biowest, France
- FBS fetal bovine serum, S1480, Biowest, France
- Lonza Human dermal fibroblasts purchased from S. (Basel, Switzerland) were cultured in a 5% CO 2 cell incubator at 37°C.
- the loriolide has cytotoxicity against human dermal fibroblasts.
- the lorioride purified from HS4 microalgae of Senedesmus is 0, 2, respectively. , 5, 10, and 20 ⁇ g/ml.
- the solution was treated with the medium using a WST-1 assay kit (EZ-cytox cell viability kit, Itshio, Korea), and then a microplate reader (iMark microplate reader, Bio- Rad, USA), and absorbance was measured at a wavelength of 450 nm.
- Cells including human dermal fibroblasts, have a reduced survival rate when irradiated with ultraviolet light such as UVB. Thus, it was confirmed whether the cell viability was changed when the purified lorioride was treated with human dermal fibroblasts and irradiated with UVB.
- the human dermal fibroblasts cultured through the same method as in Example 6 above were dispensed into 96-well plates as much as 4 ⁇ 10 3 cells/well, and lorioride was 6 at a concentration of 2, 5, 10, and 20 ⁇ g/ml. Treated for hours. Then, the culture medium was further irradiated with UVB at 10 mJ/cm 2 for 24 hours, and WST-1 assay was performed in the same manner as in Example 6 to measure cell viability.
- the loriolide has an excellent effect of restoring and increasing the survival rate of human dermal fibroblasts reduced by UVB, and the cell viability is significantly higher than that of the control group with only 2 ⁇ g/ml treatment.
- Collagen is one of the major proteins constituting the skin, and may decrease skin elasticity and moisturize by reducing collagen.
- ColA1 a gene related to the synthesis of collagen as described above, can be suppressed by irradiation with ultraviolet rays such as UVB, and collagenase gene MMP1 , a protein that degrades collagen, can be increased by UVB irradiation. In the end, it is possible to induce a decrease in collagen production. Accordingly, changes in expression levels of the genes were measured when treated with purified lorioride separated from HS4 of the genus Senedus.
- human dermal fibroblasts cultured through the same method as in Example 6 were dispensed into 96-well plates by 4 ⁇ 10 3 cells/well, and UVB was irradiated to the medium at 10 mJ/cm 2.
- the culture medium of the human dermal fibroblasts irradiated with ultraviolet rays was treated with loriolide at a concentration of 5, 10 ⁇ g/ml, which had the best cell viability recovery effect as in the results of Example 7, and cultured for 24 hours.
- changes in expression levels of the ColA1 gene and the MMP1 gene were measured through qRT-PCR (quantitative real time-PCR).
- a fluorescent material SYBR green I (SYBR green I, Invitrogen) was used. Specifically, 0.2 ⁇ M of the primer prepared in the sequence shown in Table 3 below was added to the PCR tube, 50 mM KCl, 20 mM Tris/HCl (pH 8.4), 0.8 mM dNTP, 0.5 U DNA polymerase (Extaq DNA polymerase), A reaction solution was prepared by mixing 3 mM MgCl 2 and 1 ⁇ SYBR Green I.
- PCR was performed using a PCR instrument (Linegene K, BioER, China) (PCR conditions: primary denaturation for 3 minutes, denaturation for 30 seconds at 94°C, annealing for 30 seconds at 58°C, polymerization at 72°C). 30 seconds, total 40 cycles) Fluorescence intensity was measured every cycle.
- the expression of the ColA1 gene is reduced by 70% in the case of control cells irradiated with UVB without treatment with loriolide.
- the expression of ColA1 gene was 55% for cells treated with loriolide at a concentration of 5 ⁇ g/ml, and the expression of ColA1 gene was 65% for cells treated with 10 ⁇ g/ml. The expression level, which was reduced by irradiation with UVB, was recovered.
- the expression level of the MMP1 gene is 2.4 times in the case of the control cells irradiated with UVB without treatment with loriolide, based on the expression level of the cells without any treatment.
- MMP1 gene expression was measured at 25% for cells treated with loriolide at a concentration of 5 ⁇ g/ml, and MMP1 gene expression was measured at 46% for cells treated at a concentration of 10 ⁇ g/ml. The quantity was reduced.
- loriolide restores and increases the expression level of ColA1 gene in human dermal fibroblasts, which is reduced by irradiation of UVB, and decreases the expression level of MMP1 gene. It has the effect of increasing the amount of collagen produced in, and accordingly, the lorioride purified from HS4 of the genus seneides of the present application helps recovery and improvement of skin damaged by light, and elasticity of the skin And it was confirmed that it can help to keep moisturizing.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Epidemiology (AREA)
- Birds (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Gerontology & Geriatric Medicine (AREA)
- Dermatology (AREA)
- Cosmetics (AREA)
- Medicines Containing Plant Substances (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
본 발명은 로리오라이드 생산성이 높은 신규 미세조류에 관한 것으로, 본 발명의 세네데스무스 속 HS4(Scenedesmus sp. HS4)는 바이오매스 생산성이 높고, 로리오라이드의 함량이 높으므로, 로리오라이드를 생산할 수 있는 생물자원으로 이용될 수 있으며, 세네데스무스 속 HS4 유래의 로리오라이드를 필요로 하는 약학적 조성물 또는 화장료 조성물에 사용할 수 있다.
Description
본 발명은 성장률이 우수하고, 높은 로리오라이드 함량을 특징으로 하는 세네데스무스 속 미세조류에 관한 것이다.
피부는 인체에서 가장 바깥쪽에 존재하는 기관이므로, 각종 대기 오염물질이나 물리적 자극, 특히 자외선이 포함된 햇빛 등에 의해 직접적인 영향을 지속적으로 받을 수 밖에 없으며, 다른 기관들에 비해 외부 자극에 노출되어 있는바 손상되기 쉬운 기관이다. 이와 같은 외부 자극에 의하여 피부를 구성하는 세포는 다양한 원인에 의하여 세포의 성장이 저해되고 괴사가 일어나는 등의 세포 노화 현상이 발생할 수 있고, 피부 세포 내부에 존재하는 섬유 단백질들이 파괴되거나 합성량이 감소하여 피부의 주름을 유발할 수 있다.
피부의 노화 현상은 생물학적 과정에 따라 시간이 경과하며 나타나는 자연적인 노화인 연대학적 노화(내인적 노화)와 햇빛에 노출되는 부위에서 발생하는 퇴행성 변화와 상기 연대학적 노화가 복합적으로 나타나는 광노화(광인성 노화)로 구분될 수 있다. 세포의 성장과 관련된 각종 인자들의 발현 또는 활성이 저해되는 경우 자연적인 세포의 노화가 발생할 수 있으며, 햇빛에 포함된 280 nm 내지 400 nm 파장의 빛에 의하여 피부 세포의 광노화가 진행될 수 있다. 그 중에서도 특히 280 nm 내지 320 nm 범위의 파장을 갖는 UVB와 같은 자외선의 조사에 의하여 피부나 섬유의 손상이 발생할 수 있으며 피부가 까맣게 타는 그을음 현상이 발생할 수 있다. UVB가 조사되면 피부 세포 내의 ROS 및 자유 라디칼의 축적이 촉진되며, 라디칼에 의해 세포 내 신호전달 체계를 자극하여 DNA, 단백질, 지질과 같은 생체 분자에 산화적 스트레스를 유발할 수 있고, 이로 인하여 피부 조직의 손상이 발생될 수 있다.
피부 세포의 산화적 스트레스가 증가하면, 표피의 각질세포나 진피의 섬유아세포에 자극이 발생하고 일련의 세포 내 신호 전달 과정을 거쳐 콜라겐 분해효소인 MMP(matrix metalloproteinase)와 같은 유전자의 발현이 증가될 수 있고, 피부의 주요 구성성분으로 진피의 90%를 차지하며 피부에 강도, 장력을 부여해 외부 자극이나 힘으로부터 피부를 보호하는 역할을 하는 콜라겐(collagen)의 감소가 유발되어, 이에 따라 피부의 노화나 주름이 형성될 수 있다. 따라서, 상기 콜라겐과 같은 섬유 단백질들의 합성이나 분해에 관련된 유전자의 발현 조절을 통해 피부 세포의 노화를 방지하고 주름의 개선 효과를 기대할 수 있다.
햇빛에 포함된 자외선의 조사에 따른 세포 노화 작용은, 단지 피부의 손상에 의하여 미용적인 측면에서의 문제를 발생시키는 것뿐만 아니라, 세포의 DNA 손상을 유발하여 암을 발생시키거나 피부 질환을 유발할 수 있어 심각한 건강 상의 문제도 발생될 수 있는바, 이에 대한 해결책이 필요한 실정이다.
상기와 같은 문제점과 관련하여, 소비자들의 생활 수준이 향상됨에 따라 피부 노화 문제나 건강에 대한 소비자들의 관심도 함께 높아지고 있어 피부 노화를 방지하고 개선하기 위한 의약품이나 화장품을 개발하고자 하는 연구가 활발해지고 있으며, 주로 식물과 같은 천연 소재로부터 추출한 추출물을 이용하여 피부 노화나 주름을 개선하고자 하는 시도들이 있으며, 레티놀(비타민 A), AHA(a-hydroxy acid), 아데노신 등이 섬유 단백질인 콜라겐의 합성을 증가시키고 표피의 각화 과정을 정상화시킴으로써 피부 재생에 기여하는 물질로 많이 사용되고 있으나 상기와 같은 물질들은 빛과 열에 불안정하고 피부에 자극이 있는 문제점이 있는 것으로 알려져 있다.
한편, 로리오라이드(loliolide)는 주로 식물이나 거대조류에서 합성되는 물질로 알려져 있으며, 여우구슬(Phyllanthus urinaria)에서 발견되어 C형 간염 바이러스(HCV)의 침투를 억제하는 활성이 있는 물질로 알려져 있고, 해양 거대조류인 큰잎모자반(Sargassum ringgoldianum)에서 항산화 활성을 갖는 물질로 보고된 바 있다. 하지만 담수 미세조류에서는 추출물에 로리오라이드가 함유된 것이 있다는 점에 대해서만 알려져 있으며, 상기와 같은 담수 미세조류를 이용하여 높은 효율로 대량의 로리오라이드를 합성하고자 하는 시도에 대해서는 보고된 바가 없다.
아울러, 세네데스무스(Scenedesmus) 속은 녹조류로 분류되며, 분류체계로는 Chlorophyta 목, Chlorophyceae 과에 속하고, 4~8개의 단위세포가 붙어서 존재한다. 세네데스무스는 전세계의 담수에 고르게 분포하고 있으며, 체내 지질의 함량이 20~30%로 존재하는 것으로 알려져 있다. 세네데스무스 유래의 지질을 바이오디젤로 전환하여 이용하는 것은 연구되어 왔지만, 피부 미용이나 피부 건강과 관련된 의약품이나 화장품의 원료로서 사용하는 것에 대해서는 연구가 더 필요한 실정이다.
본 발명은 기존에 알려져 있는 미세조류와 비교하여, 피부 세포에서 섬유 단백질의 합성을 증가시켜 피부 노화 방지 및 개선 효과가 있는 로리오라이드를 더 높은 효율로 생산할 수 있는 생산성이 우수한 신규한 미세조류를 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기와 같은 신규한 미세조류의 추출물을 이용하여 피부 노화 방지 및 개선용 약학적 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기와 같은 신규한 미세조류의 추출물을 이용하여 피부 노화 방지 및 개선용 화장료 조성물을 제공하는 것을 목적으로 한다.
상기의 목적을 달성하기 위하여, 본 발명의 일 측면은 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4)를 제공한다.
본 발명의 다른 측면은 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4의 추출물 또는 이의 분획물을 유효성분으로 포함하는, 피부 노화 방지 및 개선용 약학적 조성물을 제공한다.
본 발명의 다른 측면은 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4의 추출물 또는 이의 분획물을 유효성분으로 포함하는, 피부 노화 방지 및 개선용 화장료 조성물을 제공한다.
본 발명의 다른 측면은 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4로부터 생산한 로리오라이드를 포함하는, 피부 노화 방지용 조성물을 제공한다.
본 발명에서 새롭게 개량된 세네데스무스 속 HS4는 기존에 발표된 다른 미세조류와 비교하여 높은 함량의 로리오라이드를 세포 내에 축적하고, 유기탄소 이화효율이 우수한 특징이 있어 빛이 주어지지 않는 조건에서도 생장이 가능하며 빠른 성장 속도로 배양이 가능하여 높은 바이오매스 생산성 및 로리오라이드 생산성을 확보할 수 있다. 이러한 높은 로리오라이드 생산성은 본 발명의 미세조류를 대량으로 배양함으로써 로리오라이드의 생산 단가를 낮출 수 있는 가능성을 제공하는바, 항산화 및 항노화 효능이 있는 의약품이나 화장품 등에 다양하게 사용이 가능할 것으로 예상된다.
다만, 본 발명의 효과는 상기에서 언급한 효과로 제한되지 아니하며, 언급되지 않은 또 다른 효과들은 하기의 기재로부터 당업자에게 명확히 이해될 수 있을 것이다.
도 1은 본 발명의 세네데스무스 속 HS4(Scenedesmus sp. HS4)를 나타낸 것이다.
도 2는 본 발명의 세네데스무스 속 HS4 미세조류를 개량하기 위한 적응진화 유도 과정의 원리를 나타낸 그림이다. 미세조류를 배양함에 따라 점차 광 조사량은 감소시키고 배지 내 유기탄소의 농도는 증가시켜 배양하는 방법에 대한 것이다.
도 3은 본 발명의 세네데스무스 속 HS4 미세조류를 각각 광배양 조건(도 3의 'Photo'), 종속배양 조건(도 3의 'Hetero'), 혼합배양 조건(도 3의 'Mixo')으로 7일간 배양한 성장 곡선 그래프와, 배양액의 사진을 나타낸 것이다.
도 4a 내지 도 4e는 본 발명의 세네데스무스 속 HS4 미세조류 추출물 내 활성 성분의 화학구조를 규명하기 위한 NMR 분광분석 결과를 나타낸 것으로, 각각 순서대로 1H NMR, 13C NMR, 1H-1H COSY, HMQC 및 HMBC 스펙트럼 측정 결과이다.
도 5a는 본 발명의 세네데스무스 속 HS4 미세조류 추출물 내 활성 성분의 분자량을 측정하기 위한 ESI-mass 스펙트럼 측정 결과를 나태낸 것이다.
도 5b는 도 4a 내지 도 4e, 도 5a의 결과를 바탕으로 규명한 본 발명의 세네데스무스 속 HS4 미세조류 추출물 내 활성 성분인 로리오라이드의 화학 구조이다.
도 6a는 정제된 로리오라이드에 대한 LC 분석 결과 및 이를 이용하여 제작한 정량선이며, 도 6b는 도 6a의 정량선을 이용하여 본 발명의 세네데스무스 속 HS4 미세조류 추출물의 LC 분석 결과이다.
도 7은 광배양한 세네데스무스 속 JD052 미세조류와 종속배양(Hetero), 혼합배양(Mixo)한 본 발명의 세네데스무스 속 HS4 미세조류의 바이오매스 생산량을 비교하고, 상기 미세조류들의 추출물 내 로리오라이드의 함량을 비교하여 나타낸 그래프이다.
도 8은 세네데스무스 속 HS4 미세조류로부터 분리하여 정제한 로리오라이드를 인간진피섬유아세포에 농도 별로 처리하여, 상기 세포의 세포 생존력을 측정해 비교한 그래프이다.
도 9는 자외선(UVB)를 조사한 인간진피섬유아세포에 세네데스무스 속 HS4 미세조류로부터 분리하여 정제한 로리오라이드를 농도 별로 처리하여, 상기 세포의 세포 생존력을 측정해 비교한 그래프이다. 대조군은 자외선을 조사하지 않고 로리오라이드를 처리하지 않은 인간진피섬유아세포를 대상으로 하였다.
도 10은 자외선(UVB)를 조사한 인간진피섬유아세포에 세네데스무스 속 HS4 미세조류로부터 분리하여 정제한 로리오라이드를 농도 별로 처리하여, 상기 세포에서 발현되는 Col1A1 유전자의 발현량을 qRT-PCR을 통해 측정한 그래프이다. 대조군은 자외선을 조사하지 않고 로리오라이드를 처리하지 않은 인간진피섬유아세포를 대상으로 하였다.
도 11은 자외선(UVB)를 조사한 인간진피섬유아세포에 세네데스무스 속 HS4 미세조류로부터 분리하여 정제한 로리오라이드를 농도 별로 처리하여, 상기 세포에서 발현되는 MMP1 유전자의 발현량을 qRT-PCR을 통해 측정한 그래프이다. 대조군은 자외선을 조사하지 않고 로리오라이드를 처리하지 않은 인간진피섬유아세포를 대상으로 하였다.
이하, 본 발명을 상세히 설명한다.
1. 신규 세네데스무스 속 미세조류 및 이를 포함하는 조성물
본 발명은 신규 미세조류 속 미세조류를 제공한다.
본 발명의 상기 신규 미세조류는 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4)이다.
상기 세네데스무스 속 HS4는 18s rRNA 염기서열 분석상 기탁번호 KCTC 1899P로 기탁된 미세조류 Scenedesmus sp. JD052와 염기서열이 동일하며, 세포의 형태적 특징을 고려하여, 세네데스무스 속에 속하는 것으로 분류하였고, 이를 특별히 HS4로 명명하였다.
상기 세네데스무스 속 HS4는 유기탄소를 이용한 이화작용의 효율이 극대화되어 있어, 포도당을 함유한 배양 배지에서 상기 세네데스무스 속 HS4를 배양할 때, 미세조류의 일반적인 배양 방법인 광배양(photoautotrophic culture) 방법과 비교하여 높은 세포 생장률을 보여 바이오매스 생산성이 우수하다.
상기 세네데스무스 속 HS4는 빛이 주어지지 않는 배양 조건에서도 배양이 가능하다. 빛을 배제하고 유기탄소만 주어진 종속배양(heterotrophic culture) 조건으로 배양하는 경우에도, 빛과 유기탄소를 모두 제공하는 혼합배양(mixotrophic culture) 조건으로 배양하는 경우와 유사한 수준의 성장 속도로 생장할 수 있는 특징이 있다.
특히, 상기 세네데스무스 속 HS4는 로리오라이드를 매우 높은 함량으로 생산해 낼 수 있는데, 종래 로리오라이드를 생산할 수 있는 기탁번호 KCTC 1899P로 기탁된 미세조류 Scenedesmus sp. JD052와 대비하더라도, 상기 세네데스무스 속 HS4의 로리오라이드 생산성이 더 우수하다. 상기 세네데스무스 속 JD052 미세조류는 다른 종류의 미세조류들에 비해 로리오라이드의 생산성이 더 좋은 것으로 알려진 것인바, 본 발명의 세네데스무스 속 HS4 미세조류는 종래 알려진 다른 종류의 미세조류들 및 JD052 미세조류 모두에 비해, 바이오매스 및 로리오라이드의 생산성이 현저하게 향상된 것이다. 따라서 본 발명의 상기 세네데스무스 속 HS4를 이용하여 로리오라이드를 생산함으로써, 기존에 로리오라이드 생산용으로 사용되었던 공정이나 시스템을 대체할 수 있다.
본 발명의 구체적인 실시예에서는, 세네데스무스 속 HS4를 유기탄소(포도당)만 제공하고 빛은 주어지지 않는 종속배양(heterotrophic culture) 조건으로 배양하고, 유기탄소와 빛을 모두 제공하는 혼합배양(mixotrophic culture) 조건으로 배양하고, 미세조류 배양시 일반적으로 사용되는 광배양(photoautotrophic culture) 조건으로 배양한 결과, 혼합배양 조건에서 가장 성장 속도가 빠르고 종속배양 조건에서도 높은 성장 속도를 나타냄을 확인하였으며, 일반적인 미세조류와는 달리 빛이 없는 조건에서도 성장이 가능한 특징이 있음을 확인하였다. 구체적으로, 상기 세네데스무스 속 HS4 미세조류를 빛이 없는 조건에서 유기탄소원으로 포도당을 10 g/L 포함하고, 효모 추출물 1 g/L를 포함하는 배지에서 7일간 배양함에 따라 세포 농도가 5.9 g/L인 수준까지 생장할 수 있고 바이오매스 생산성이 약 0.81 g/L/day에 이를 수 있다. 따라서 광량 50 μmol·m-2·s-1의 빛을 함께 조사하여 상기와 동일한 양의 포도당, 효모 추출물을 포함하는 배지에서 7일간 배양한 경우의, 세포의 농도가 약 5.65 g/L이고 바이오매스 생산성이 약 0.91 g/L/day인 것과 비교할 때 빛이 없는 조건에서도 빛이 주어진 조건으로 배양한 경우와 유사한 수준으로 생장할 수 있는 특징이 있다.
또한, 본 발명의 구체적인 실시예에 따르면, 세네데스무스 속 HS4 미세조류 및 세네데스무스 속 JD052 미세조류를 상기와 같은 배양 조건으로 각각 배양한 결과, 광배양한 JD052 미세조류에 비해 종속배양 및 혼합배양한 HS4의 성장 속도가 훨씬 더 우수하여 바이오매스의 생산성이 높음을 확인하였고, 이에 따른 로리오라이드의 함량을 확인한 결과 종래의 JD052 미세조류에 비해 로리오라이드의 생산성 역시 약 2배 내지 4배 정도 높은 것을 확인하였다.
본 발명의 또 다른 측면은 상기 신규 세네데스무스 속 미세조류를 포함하는 조성물을 제공한다.
상기 미세조류는 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4)이다.
상기 조성물에 포함되는 유효성분은 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4 일뿐만 아니라, 상기 미세조류의 배양액, 상기 배양액의 건조물, 상기 배양액의 추출물, 상기 미세조류의 추출물, 또는 상기 추출물의 분획물일 수 있다.
본 발명의 상기 세네데스무스 속 HS4를 포함하는 조성물은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 담체, 부형제 및/또는 첨가제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때, 상기 조성물의 형태는 오일 또는 수성 매질 중의 용액, 현탁액 또는 유화액 형태이거나, 엑스제, 분말제, 과립제, 정제, 캅셀제, 젤(예컨대, 하이드로젤) 또는 동결건조물의 형태일 수 있다. 상기 첨가제로는 준산제, 안정화제 또는 동결보호제를 이용할 수 있다.
상기 세네데스무스 속 HS4를 포함하는 조성물이 동결건조물의 형태일 경우, 상기 조성물은 상기 미세조류를 동결보호제와 함께 동결건조하여 분말의 형태로 사용하는 것을 포함하며, 상기 동결보호제는 천연 당(natural sugar), 탈지분유, 말토덱스트린, 덱스트린, 트레할로스, 말토오스, 유당, 만니톨, 사이클로덱스트린, 글리세롤 및/또는 꿀일 수 있으나 이에 제한되는 것은 아니다. 또한, 보존 담체와 혼합하여 흡착시킨 후 건조시켜 고체화하여 사용하는 것을 포함하며, 상기 보존 담체는 규조토, 활성탄 및/또는 탈지강일 수 있다.
상기 세네데스무스 속 HS4를 포함하는 조성물은 상기 미세조류, 상기 미세조류의 배양액, 상기 배양액의 농축액, 상기 배양액의 건조물, 상기 배양액의 추출물, 상기 미세조류의 추출물 및 상기 추출물의 분획물로 이루어지는 군에서 선택된 1종 이상을 상기 담체, 부형제 또는 첨가제 중 어느 하나와 혼합하는 단계를 거쳐 제조될 수 있다.
상기 균주, 담체, 부형제 및 첨가제에 대한 설명은 전술한 바와 같다. 상기 첨가제로 동결보호제를 이용하는 경우, 상기 세네데스무스 속 HS4를 포함하는 조성물은 상기 미세조류와 동결보호제를 혼합하고, 상기 혼합물을 -90 ℃ 내지 -0 ℃에서 동결하는 과정을 거친 후, 건조하여 분쇄하여 분말 형태로 제조되는 것일 수 있다. 구체적으로, 상기 동결하는 과정은 -45 ℃ 내지 -30 ℃의 온도 조건, 5 내지 50 mTorr의 압력 조건에서 65 내지 75 시간 동안 진공동결하는 과정일 수 있으며, 상기 건조 과정은 30 ℃ 내지 40 ℃의 온도 조건에서 건조하는 것일 수 있다.
2. 피부 노화 방지 및 개선용 약학적 조성물
본 발명은 피부 노화 방지 및 개선용 약학적 조성물을 제공한다.
본 발명의 일 측면에 따른 상기 피부 노화 방지 및 개선용 약학적 조성물은 상기 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4)의 추출물 또는 이의 분획물을 유효성분으로 포함한다.
또한, 본 발명의 다른 측면에 따른 상기 피부 노화 방지 및 개선용 약학적 조성물은 로리오라이드를 유효성분으로 포함하고, 특히 상기 로리오라이드는 상기 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4)에서 생산된 것일 수 있다.
상기 세네데스무스 속 HS4(Scenedesmus sp. HS4, KCTC 13784BP)의 추출물은 피부 노화를 방지하고 개선하는데 유효한 효과를 나타낼 수 있다. 상기 피부 노화는 피부 세포의 자연적인 노화 또는 광노화일 수 있으며, 피부 노화에 의해 발생할 수 있는 피부의 주름, 미세선, 피부 탄성 및/또는 긴장의 감소, 쪼글거림, 얇아짐, 윤기와 광택 감소 등 생리학적 및/또는 화학선적 노화일 수 있고, 자외선에 노출되어 진피가 얇아지는 내부 피부 열화(internal skin degradation), 특히 콜라겐 섬유의 열화 등 노화로 인한 피부의 외형적인 변화일 수 있다.
상기 세네데스무스 속 HS4 미세조류의 추출물은 피부 세포의 노화를 억제하는 효과가 있으므로, 특히 피부의 주름을 개선하고 피부의 탄력을 증가시켜 미용적인 측면이나 피부 건강의 측면에서 양호한 피부 상태를 유지할 수 있으며, 자외선으로부터 피부 세포를 보호하며 자외선에 의해 발생하는 피부에 대한 부정적인 효과를 억제할 수 있다.
상기 세네데스무스 속 HS4 미세조류의 추출물은 활성 성분으로 로리오라이드를 포함한다. 상기 로리오라이드는 항산화 활성이 있어 피부 세포의 노화를 방지하거나 개선하는 효과가 있는 물질이다. 구체적으로, 로리오라이드는 피부 세포에 작용하여, 피부 세포를 구성하는 섬유 단백질의 일종인 콜라겐 합성 유전자, 예컨대 Col1A1 유전자의 발현을 촉진시키고 콜라겐을 분해하는 콜라게나아제 유전자, 예컨대 MMP1 유전자의 발현을 억제시켜 콜라겐의 양을 증가시킴에 따라 피부의 주름을 개선하는 활성이 있다. 또한, 로리오라이드는 자외선에 의해 발생하는 피부 세포의 생존율 감소나 상기와 같은 콜라겐의 양 감소 현상을 개선하여 세포 생존율을 높이고 콜라겐의 양을 증가시킴에 따라 자외선에 의한 피부 세포의 부정적인 효과를 복구할 수 있다.
상기 로리오라이드는 상기 조성물 내에 1 ㎍/㎖ 내지 25 ㎍/㎖의 농도로 포함될 수 있다. 구체적으로, 상기 로리오라이드는 상기 조성물 내에 2 ㎍/㎖ 내지 23 ㎍/㎖, 3 ㎍/㎖ 내지 20 ㎍/㎖, 5 ㎍/㎖ 내지 18 ㎍/㎖, 5 ㎍/㎖ 내지 15 ㎍/㎖, 또는 5 ㎍/㎖ 내지 10 ㎍/㎖의 농도로 포함될 수 있다. 로리오라이드가 전체 조성물을 기준으로 상기와 같은 범위 내의 농도로 포함될 경우, 상기 조성물이 처리되는 세포에 대해 독성을 나타내지 않으면서도 자외선에 의한 세포의 생존력 감소를 억제하고, 콜라겐 관련 유전자의 발현을 효과적으로 조절하여 콜라겐 생성량을 증가시킬 수 있는 효과가 있다.
본 발명의 구체적인 실시예에서는, 상기 세네데스무스 속 HS4 미세조류의 추출물 내 활성 성분의 화학구조를 1H NMR, 13C NMR, 1H-1H COSY, HMQC 및 HMBC 스펙트럼을 비롯한 NMR 분광분석법을 통해 분석하고, ESI-mass 스펙트럼을 통해 상기 활성 성분의 분자량을 측정하여 기존의 데이터베이스와 비교함으로써 본 발명의 추출물에 로리오라이드가 활성 성분으로 함유되어 있음을 확인하였다.
본 발명의 구체적인 실시예에서는, 로리오라이드가 20 ㎍/㎖의 농도까지 인간진피섬유아세포에 대해 세포 독성을 나타내지 않고, 자외선의 조사에 따라 감소된 상기 인간진피섬유아세포의 세포 생존력을 다시 회복시키는 활성이 있음을 확인하였다. 또한, 로리오라이드의 처리에 따라 콜라겐 유전자(Col1A1)의 발현은 촉진되고 콜라게나아제 유전자(MMP1)의 발현을 억제하는 활성이 있음을 확인하였다.
상기 추출물은 상기 세네데스무스 속 HS4를 배양하는 단계; 상기 배양된 세네데스무스 속 HS4의 배양물을 건조하여 건조물을 수득하는 단계; 및 수득한 건조물에 유기용매를 넣고 추출하는 단계;를 포함하는 방법에 의하여 얻어질 수 있다.
상기 세네데스무스 속 HS4를 배양하는 단계는 20 ℃내지 30 ℃의 온도 조건, 포도당 5 g/L 내지 15 g/L 및 효소 추출물 0.5 g/L 내지 1.5 g/L로 구성된 조성의 배지, 빛이 조사되지 않는 조건에서 수행되는 것일 수 있다. 또한 상기 조건에 더하여 30 μmol·m-2·s-1 내지 100 μmol·m-2·s-1의 광도로 빛이 조사되는 조건에서 수행되는 것일 수 있다. 상기 온도 범위 밖에서 배양되거나 상기 배지에 포함된 포도당 농도보다 더 낮은 범위에서 배양될 경우에는 세네데스무스 속 HS4의 성장속도가 현저하게 감소하므로 수득되는 생물량이 감소할 수 있으며, 항산화 및 피부 항노화 효과를 나타내는 물질(예컨대, 로리오라이드) 또한 생성이 감소할 수 있으므로 상기 배양물을 추출하더라도 피부 세포의 노화 방지 및 개선 효과가 현저히 낮을 수 있는 문제점이 있다.
상기 추출물을 원료로부터 추출하여 수득할 때, 추출 방법으로는 용매 추출법, 환류 추출법을 이용할 수 있으며, 예컨대, 초음파 추출법 및 여과법 등 종래 알려진 통상적인 추출 방법을 모두 사용할 수 있다. 상기 추출 과정은 수회 반복할 수 있으며, 이후에 농축 또는 동결건조 등의 단계를 추가적으로 거칠 수 있다. 구체적으로, 수득한 추출물을 감압농축하여 농축액을 얻고, 상기 농축액을 동결건조시킨 후 분쇄기를 이용하여 고농도의 추출 분말을 제조할 수 있다.
상기 추출물을 원료로부터 추출하여 수득하는 경우 상기 추출 과정은 수회 반복할 수 있으며, 이후에 농축 또는 동결건조 등의 방법을 추가적으로 거칠 수 있다. 구체적으로, 수득한 추출물을 감압 농축하여 농축액을 얻고, 상기 농축액을 동결건조시킨 후 분쇄기를 이용하여 고농도의 추출 분말을 제조할 수 있다.
상기 추출물 추출시 용매는 물, 유기 용매 또는 이들의 혼합물일 수 있다. 상기 유기용매는 에틸아세테이트일 수 있고, 예컨대, 알코올, 헥산(n-헥산), 에테르, 글리세롤, 프로필렌글리콜, 부틸렌글리콜, 메틸아세테이트, 디클로로메탄, 클로로포름, 또는 벤젠일 수 있으나, 이에 제한되는 것은 아니다.
상기 세네데스무스 속 HS4의 추출물은 추가로 분획될 수 있고, 상기와 같이 얻어지는 분획물 또한 본 발명의 피부 노화 방지 및 개선용 약학적 조성물의 유효성분으로 이용될 수 있다.
로리오라이드의 함량을 높이기 위해서 상기 세네데스무스 속 HS4의 추출물을 분획하여 세네데스무스 속 HS4의 분획물을 수득할 수 있다. 분획물 제조시 사용될 수 있는 용매는 에틸아세테이트, 아세톤, 아세토니트릴, 클로로포름, 디클로로메탄, 에틸에테르, 크실렌, 헥산 및 이들의 조합 등과 같은 유기용매일 수 있으나, 이에 제한되는 것은 아니다.
또한 본 발명의 분획물은 로리오라이드 함량을 농축시키기 위해서 추가로 통상의 분획 공정을 수행하여 분획물을 수득한 것일 수도 있다. 예를 들면, 본 발명에 따른 세네데스무스 속 HS4의 추출물을 일정한 분자량 컷-오프 값을 갖는 한외 여과막을 통과시켜 얻은 분획물, 다양한 크로마토그래피(크기, 전하, 소수성 또는 친화성에 따른 분리를 위해 제작된 것)에 의한 분리 등으로 추가적으로 실시된 다양한 정제 방법을 통해 얻어진 활성 분획물도 본 발명의 분획물에 포함된다.
상기 활성 분획물은 분획물로부터 보다 높은 로리오라이드 함량을 가지는 분획을 분리한 것으로, 활성 분획 또는 유효 분획물이라고도 한다. 계통분획과 같은 통상의 분획 과정을 통해 수득한 여러 성분이 혼합되어 있는 분획물 가운데 농도구배 컬럼 크로마토그래피 등을 통하여 활성 성분의 성질에 따라 분리해냄으로써 보다 높은 로리오라이드 함량을 갖는 특정 활성 분획물을 제조할 수 있다. 상기 컬럼 크로마토그래피는 실리카겔, 세파덱스, LH-20, ODS 겔, RP-18, 폴리아미드, 도요펄(Toyopearl) 및 XAD 수지로 이루어진 군으로부터 선택된 충진제를 이용하는 컬럼 크로마토그래피를 수행하여 활성 분획물을 분리 및 정제할 수 있고, 컬럼 크로마토그래피는 필요에 따라 적절한 충진제를 선택하여 수차례 실시할 수 있으나, 이에 제한되는 것은 아니다. 상기 크로마토그래피를 사용함에 있어 용출 용매, 용출 속도 및 용출 시간은 당업계에서 일반적으로 사용하는 용매, 속도 또는 시간을 적용할 수 있다.
한편, 본 발명의 상기 추출물 또는 이의 분획물을 유효성분으로 포함하는 약학적 조성물은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기내에 내입시켜 제조될 수 있다. 이때, 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제, 캅셀제 또는 젤(예컨대, 하이드로젤) 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
또한, 상기 약학적 조성물이 포함하는 상기 추출물 또는 이의 분획물은 콜로이드 현탁액, 분말, 식염수, 지질, 리포좀, 미소구체(microspheres), 또는 나노 구형입자와 같은 약학적으로 허용될 수 있는 담체에 운반될 수 있다. 이들은 운반 수단과 복합체를 형성하거나 관련될 수 있고, 지질, 리포좀, 미세입자, 금, 나노입자, 폴리머, 축합 반응제, 다당류, 폴리아미노산, 덴드리머, 사포닌, 흡착 증진 물질 또는 지방산과 같은 당업계에 공지된 운반 시스템을 사용하여 생체 내 운반될 수 있다.
이 외에도, 약학적으로 허용되는 담체는 제제시 통상적으로 이용되는 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아, 고무, 인산칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세 결정성 셀룰로스, 폴리비닐 피로리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필 히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 또한, 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.
본 발명에 따른 약학적 조성물은 임상 투여시에 경구 또는 비경구로 투여가 가능하며 일반적인 의약품 제제의 형태로 사용될 수 있다. 즉, 본 발명의 약학적 조성물은 실제 임상 투여시에 경구 및 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구 투여를 위한 고형 제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형 제제는 생약 추출물 또는 생약 발효물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한, 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구 투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔, 마크로골, 트윈 61, 카카오지, 라우린지, 글리세롤, 젤라틴 등이 사용될 수 있다.
본 발명의 세네데스무스 속 HS4의 추출물 또는 이의 분획물의 유효투입량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양화될 수 있지만, 일반적으로 성인 환자 체중 1 kg 당 1 내지 20 ㎎/일이고, 바람직하게는 5 내지 10 ㎎/일이며, 의사 또는 약사의 판단에 따라 일정 시간 간격으로 1 일 수회, 바람직하게는 하루 2 회 내지 3 회 분할 투여될 수 있다.
본 발명은 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4), 상기 세네데스무스 속 HS4의 배양액, 상기 배양액의 농축액, 상기 배양액의 건조물, 상기 배양액의 추출물 및 상기 추출물의 분획물로 이루어진 군으로부터 선택되는 하나 이상을 포함하는 조성물을 개체에 투여하는 단계를 포함하는, 피부 노화 예방, 개선 또는 치료 방법을 제공한다.
상기 개체는 사람 또는 사람을 제외한 동물일 수 있다. 상기 개체가 양호한 피부 상태를 보유하고 있는 경우, 상기 조성물을 개체에게 투여함으로써 상기 개체의 피부 노화를 예방할 수 있다. 상기 개체의 피부 노화가 발생한 상태인 경우, 상기 약학적 조성물을 대상체에게 투여함으로써 상기 개체의 피부 노화를 개선 또는 치료할 수 있다.
상기 예방은 질환 또는 장애에 걸릴 위험을 감소시키는 것을 의미하며, 질환에 노출되거나 질환에 걸리기는 쉽지만 아직 질환에 걸리거나 질환의 증후를 나타내지 않는 대상에서 질병의 1종 이상의 임상적 증후가 진행되지 않도록 하여 질환의 발병을 억제하거나 지연시키는 모든 행위를 의미한다.
상기 치료는 질환 또는 장애를 경감시키는 것을 의미하며, 질환 또는 이의 1종 이상의 임상적 증후의 진행을 저지 또는 감소시켜 질환의 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다.
상기 개선은 질환 또는 장애의 증세가 호전되도록 하거나 이롭게 되도록 하는 모든 행위를 의미한다.
상기 조성물, 이의 제형, 투여 방법, 투여량, 조성물에 함유되는 유효성분의 농도 및 피부 노화에 관한 설명은 전술한 바와 동일하다.
3. 피부 노화 방지 및 개선용 화장료 조성물
본 발명은 피부 노화 방지 및 개선용 화장료 조성물을 제공한다.
본 발명의 일 측면에 따른 상기 피부 노화 방지 및 개선용 화장료 조성물은 상기 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4)의 추출물 또는 이의 분획물을 유효성분으로 포함한다.
또한, 본 발명의 다른 측면에 따른 상기 피부 노화 방지 및 개선용 화장료 조성물은 로리오라이드를 유효성분으로 포함하고, 특히 상기 로리오라이드는 상기 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4)에서 생산된 것일 수 있다.
상기 로리오라이드는 상기 조성물 내에 1 ㎍/㎖ 내지 25 ㎍/㎖의 농도로 포함될 수 있다. 구체적으로, 상기 로리오라이드는 상기 조성물 내에 2 ㎍/㎖ 내지 23 ㎍/㎖, 3 ㎍/㎖ 내지 20 ㎍/㎖, 5 ㎍/㎖ 내지 18 ㎍/㎖, 5 ㎍/㎖ 내지 15 ㎍/㎖, 또는 5 ㎍/㎖ 내지 10 ㎍/㎖의 농도로 포함될 수 있다. 로리오라이드가 전체 조성물을 기준으로 상기와 같은 범위 내의 농도로 포함될 경우, 상기 조성물이 처리되는 세포에 대해 독성을 나타내지 않으면서도 자외선에 의한 세포의 생존력 감소를 억제하고, 콜라겐 관련 유전자의 발현을 효과적으로 조절하여 콜라겐 생성량을 증가시킬 수 있는 효과가 있다.
상기 세네데스무스 속 HS4(Scenedesmus sp. HS4)의 추출물 또는 분획물의 제조 방법은 "2. 피부 노화 방지 및 개선용 약학적 조성물 "의 방법에 기재하였으므로 기재를 생략한다.
본 발명의 상기 화장료 조성물은 상기 추출물 또는 분획물의 화장품학적 유효량(cosmetically effective amount) 및 화장품학적으로 허용되는 담체를 포함할 수 있으며, 상기 화장품학적 유효량이란 전술한 피부 노화 방지 및 개선 효능을 달성하는 데 충분한 양을 의미한다.
본 발명의 상기 화장료 조성물은 상기 추출물 또는 분획물의 피부 노화 방지 및 개선 활성에 영향을 미치지 않는 범위 내에서, 예컨대 상기 추출물 또는 분획물의 활성에 상승 효과를 줄 수 있는 특징이 있는 다른 성분을 추가로 함유할 수 있다. 예를 들어, 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속이온 봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 향료, 친수성 또는 친유성 활성제, 지질 소낭 또는 화장품에 통상적으로 사용되는 임의의 다른 성분 등과 같이 화장품이나 피부 과학 분야에서 통상적으로 사용되는 보조제를 함유할 수 있으며, 상기 성분들은 화장품이나 피부 과학 분야에서 일반적으로 사용되는 양으로 함유될 수 있다.
본 발명의 상기 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 겔, 로션, 에센스, 크림, 파우더, 비누, 샴푸, 린스, 팩마스크, 계면활성제-함유 클렌징, 클렌징 폼, 클렌징 워터, 오일, 리퀴드 파운데이션, 크림 파운데이션 또는 스프레이 등의 화장료로 제형화 될 수 있다.
상기 제형이 용액 또는 유탁액인 경우에는 담체 성분으로 용매, 용해화제 또는 유탁화제가 이용될 수 있고, 예컨대 물, 에탄올, 이소프로판올, 에틸카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 이용될 수 있다. 상기 제형이 현탁액인 경우에는 담체 성분으로 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 알루미늄 메타히드록시드, 미소결정성 셀룰로오스, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다. 상기 제형이 크림 또는 겔인 경우에는 담체 성분으로서 왁스, 파라핀, 트라칸트, 동물성유, 전분, 셀룰로오스 유도체, 실리콘, 벤토나이트, 폴리에틸렌 글리콜, 실리카, 산화아연 또는 탈크 등이 이용될 수 있다. 상기 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 실리카, 탈크, 알루미늄 히드록시기, 락토스, 칼슘 실리케이트, 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다. 상기 제형이 계면활성제-함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르설페이트, 설포숙신산 모노에스테르, 이미다졸리늄 유도체, 이세티오네이트, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 지방족 알코올, 알킬아미도베타인, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
4. 피부 노화 방지 및 개선용 조성물
본 발명은 피부 노화 방지 및 개선용 조성물을 제공한다.
본 발명의 일 측면에 따른 상기 피부 노화 방지 및 개선용 조성물은 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4)로부터 생산한 로리오라이드를 포함한다.
상기 세네데스무스 속 HS4(Scenedesmus sp. HS4)에 관한 설명은 "1. 신규 세네데스무스 속 미세조류"에 기재된 것과 동일하므로 기재를 생략한다.
상기 로리오라이드는 상기 세네데스무스 속 HS4를 배양하는 단계; 상기 배양된 세네데스무스 속 HS4의 배양물을 건조하여 건조물을 수득하는 단계; 수득한 건조물에 유기용매를 넣고 추출하는 단계; 및 상기 추출물로부터 로리오라이드를 분리하는 단계;를 포함하는 방법에 의하여 얻어질 수 있다. 상기 배양, 건조, 추출 단계 등에 관한 설명은 상기 "2. 피부 노화 방지 및 개선용 약학적 조성물"에 기재된 것과 동일하므로 기재를 생략한다.
상기 로리오라이드는 상기 조성물 내에 1 ㎍/㎖ 내지 25 ㎍/㎖의 농도로 포함될 수 있다. 구체적으로, 상기 로리오라이드는 상기 조성물 내에 2 ㎍/㎖ 내지 23 ㎍/㎖, 3 ㎍/㎖ 내지 20 ㎍/㎖, 5 ㎍/㎖ 내지 18 ㎍/㎖, 5 ㎍/㎖ 내지 15 ㎍/㎖, 또는 5 ㎍/㎖ 내지 10 ㎍/㎖의 농도로 포함될 수 있다. 로리오라이드가 전체 조성물을 기준으로 상기와 같은 범위 내의 농도로 포함될 경우, 상기 조성물이 처리되는 세포에 대해 독성을 나타내지 않으면서도 자외선에 의한 세포의 생존력 감소를 억제하고, 콜라겐 관련 유전자의 발현을 효과적으로 조절하여 콜라겐 생성량을 증가시킬 수 있는 효과가 있다.
본 발명의 구체적인 실시예에서는, 로리오라이드가 20 ㎍/㎖의 농도까지 인간진피섬유아세포에 대해 세포 독성을 나타내지 않고, 자외선의 조사에 따라 감소된 상기 인간진피섬유아세포의 세포 생존력을 다시 회복시키는 활성이 있음을 확인하였다. 또한, 로리오라이드의 처리에 따라 콜라겐 유전자(Col1A1)의 발현은 촉진되고 콜라게나아제 유전자(MMP1)의 발현을 억제하는 활성이 있음을 확인하였다.
상기 로리오라이드는 피부 노화를 방지하고 개선하는데 유효한 효과를 나타낼 수 있다. 상기 피부 노화는 피부 세포의 자연적인 노화 또는 광노화일 수 있으며, 피부 노화에 의해 발생할 수 있는 피부의 주름, 미세선, 피부 탄성 및/또는 긴장의 감소, 쪼글거림, 얇아짐, 윤기와 광택 감소 등 생리학적 및/또는 화학선적 노화일 수 있고, 자외선에 노출되어 진피가 얇아지는 내부 피부 열화(internal skin degradation), 특히 콜라겐 섬유의 열화 등 노화로 인한 피부의 외형적인 변화일 수 있다.
상기 로리오라이드는 피부 세포의 노화를 억제하는 효과가 있으므로, 특히 피부의 주름을 개선하고 피부의 탄력을 증가시켜 미용적인 측면이나 피부 건강의 측면에서 양호한 피부 상태를 유지할 수 있으며, 자외선으로부터 피부 세포를 보호하며 자외선에 의해 발생하는 피부에 대한 부정적인 효과를 억제할 수 있다.
상기 조성물은 약학적 조성물 또는 화장료 조성물로 이용될 수 있으며, 이와 관련된 설명은 상기 "2. 피부 노화 방지 및 개선용 약학적 조성물" 및 "3. 피부 노화 방지 및 개선용 화장료 조성물"에 기재된 것과 동일하므로 기재를 생략한다.
본 발명은 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4), 상기 세네데스무스 속 HS4의 배양액, 상기 배양액의 농축액, 상기 배양액의 건조물, 상기 미세조류의 추출물, 상기 배양액의 추출물 및 상기 추출물의 분획물로 이루어진 군으로부터 선택되는 하나 이상의 피부 노화 예방, 개선 또는 치료 용도를 제공한다.
본 발명은 피부 노화의 예방, 개선 또는 치료를 위한 용도의, 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4), 상기 세네데스무스 속 HS4의 배양액, 상기 배양액의 농축액, 상기 배양액의 건조물, 상기 미세조류의 추출물, 상기 배양액의 추출물 또는 상기 추출물의 분획물을 제공한다.
본 발명은 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4), 상기 세네데스무스 속 HS4의 배양액, 상기 배양액의 농축액, 상기 배양액의 건조물, 상기 미세조류의 추출물, 상기 배양액의 추출물 및 상기 추출물의 분획물로 이루어진 군으로부터 선택되는 하나 이상의 피부 노화 예방, 개선 또는 치료하기 위한 약물을 제조하기 위한 용도를 제공한다.
상기 세네데스무스 속 HS4 미세조류, 이를 포함하는 약학적 조성물, 화장료 조성물, 피부 노화, 예방, 개선, 치료 등에 관한 설명은 전술한 바와 동일하다.
이하, 본 발명을 실시예에 의하여 상세히 설명한다.
단, 하기 실시예는 본 발명을 구체적으로 예시하는 것이며, 본 발명의 내용이 하기 실시예에 의해 한정되지 아니한다.
[실시예 1] 세네데스무스 속 HS4 미세조류의 개량
빛에 의존적이지 않으면서 유기탄소에 대한 이화작용 효율이 높은 신규한 미세조류를 만들기 위하여, 광원 및 유기탄소에 대한 적응진화(adaptive evolution)를 유도하여 개량된 세네데스무스 속 HS4 미세조류를 만들었다. 개량을 위한 모균주로 로리오라이드를 생산할 수 있는 미세조류 중 하나인 세네데스무스 속 JD052 미세조류(기탁번호 KCTC 1899P)를 이용하였으며, 상기 세네데스무스 속 JD052는 전라도 일대 청정지역의 수계에서 분리된 것을 이용하였다. 상기 세네데스무스 속 JD052 미세조류를 대상으로 농도를 변화시켜 가며 유기탄소를 제공하고 광 조사량을 변화시켜 배양하였다. 빛이 없는 조건에서도 생장이 가능한 미세조류를 개발하고자 기존의 미세조류의 광배양 배지에서 상기 미세조류를 배양하되, 배지 내 포도당의 농도는 증가시키고 광 조사량은 점차 감소시키는 방법으로 적응진화를 유도하였다(도 2 참고).
구체적으로, 세네데스무스 속 JD052를 세균을 제거한 하기 표 1의 조성으로 구성된 배지에서 배양하였다. 상기 배지는 BG11 배지에서 K2HPO4의 함량을 기존 0.04 g에서 0.2 g으로 증가시켜 사용한 것이다. 최초 광 조사량을 50 μmol·m-2·s-1으로 하고 포도당의 농도는 최초 0 g/L로 시작하여 1개월간 배양하고, 광 조사량이 30 μmol·m-2·s-1이고 포도당 농도는 0.1 g/L인 조건으로 1개월간 배양하고, 광 조사량이 15 μmol·m-2·s-1이고 포도당 농도는 1 g/L인 조건으로 1개월간 배양하고, 광 조사량이 5 μmol·m-2·s-1이고 포도당 농도는 5 g/L인 조건으로 1개월간 배양하고, 최종적으로 광 조사량이 0 μmol·m-2·s-1이고 포도당 농도는 10 g/L인 조건으로 1개월간 배양하였다. 25 ℃온도 조건에서 배양하였으며, 상기 각 조건의 1개월마다 agar plate 상에서 가장 콜로니의 생성 속도가 빠른 콜로니를 선별하여, 그 다음 조건의 plate에 다시 계대 배양하는 방법을 통해, 빛이 없는 조건에서도 생장이 가능하며 유기탄소 이화효율이 우수한 신규한 미세조류를 확보하였다.
상기와 같은 방법을 통해 확보한 미세조류는 염기서열 분석 결과, 모균주로 이용한 세네데스무스 속 JD052와 18s rRNA 염기서열은 동일하였으나, 빛이 없는 조건에서도 유기탄소만으로 생장이 가능하여 전혀 다른 특성을 보였으므로, 신규한 세네데스무스 속 HS4로 명명하였다.
BG11 modified 배지의 조성 성분 | 함량(g/L) | |
NaNO3 | 1.5 | |
K2HPO4 | 0.2 | |
MgSO4·7H2O | 0.075 | |
CaCl2·2H2O | 0.036 | |
구연산(Citric acid) | 0.006 | |
구연산철암모늄(Ferric ammonium citrate) | 0.006 | |
EDTA (disodium salt) | 0.001 | |
Na2CO3 | 0.02 | |
NaNO3 | 1.5 | |
Agar | 10.0 | |
미량 성분 | H3BO3 | 0.00286 |
MnCl2·4H2O | 0.00181 | |
ZnSO4·7H2O | 0.000222 | |
NaMoO4·2H2O | 0.00039 | |
CuSO4·5H2O | 0.000079 | |
Co(NO3)2·6H2O | 0.0000494 |
[실시예 2] 배양 조건에 따른 성장곡선 확인
상기 실시예 1을 통해 확보한 개량된 세네데스무스 속 HS4 미세조류의 배양 조건에 따른 성장 양상을 확인하기 위하여, 세네데스무스 속 HS4를 대상으로 종속배양(heterotrophic culture, 유기탄소가 주어지는 배양 조건), 광배양(photoautotrophic culture, 빛이 주어지는 배양 조건) 및 혼합배양(mixotrophic culture, 유기탄소와 빛이 모두 주어지는 배양 조건)으로 각각 배양 조건을 달리 하여 상기 미세조류를 배양하였다.
구체적으로, 먼저 종속배양 조건의 경우, 멸균한 상기 표 1의 조성으로 구성된 배지(pH 7.1)에 포도당 10 g/L, 효모 추출물 1 g/L을 추가한 조성의 배양액 350 ㎖을 1L 플라스크에서 25 ℃조건으로, 본 발명의 세네데스무스 속 HS4를 7일간 배양하였다. 상기 HS4의 최초 접종량은 0.2 g/L로 하였다. 광배양 조건의 경우, 다른 조건은 상기 종속배양 조건과 동일하나, 포도당 및 효모 추출물은 제외한 배지를 이용하였고 광량 50 μmol·m-2·s-1의 빛을 조사하여 배양하였다. 혼합배양 조건의 경우 상기 종속배양 조건의 경우와 동일한 조건에 더하여 광량 50 μmol·m-2·s-1의 빛을 조사하여 배양하였다. 배양 과정에서 매일 각 조건의 미세조류의 세포 중량을 측정하였다.
그 결과, 하기 표 2와 같이, 빛과 유기탄소가 모두 주어진 혼합배양 조건에서 가장 성장속도가 빨랐고, 종속배양 조건에서 배양한 경우에도 혼합배양보다 느리기는 하나 비슷한 수준으로 성장하였으며, 광배양 조건의 경우보다 현저하게 높은 성장 속도를 보였다. 7일간 배양한 후 최종 세포 중량은 광배양한 경우 2.01 g/L, 종속배양한 경우 5.9 g/L, 혼합배양한 경우 6.65 g/L이었고, 이에 따라 계산한 하루 평균 바이오매스 생산성은 광배양한 경우 약 0.26 g/L/day, 종속배양한 경우 약 0.81 g/L/day, 혼합배양한 경우 약 0.92 g/L/day인 것으로 확인되었다, 따라서, 본 발명의 세네데스무스 속 HS4 미세조류는 종래의 다른 미세조류들이나 개량의 모균주였던 JD052 미세조류와는 달리, 빛은 주어지지 않고 유기탄소만 제공되는 종속배양 조건에서도 높은 생장을 보여 배양이 가능함을 확인하였고, 광배양 조건에 비해서 성장 속도가 빨라 많은 양의 바이오매스를 생산할 수 있는 것을 확인하였다(도 3).
초기 | 1일 | 2일 | 3일 | 4일 | 5일 | 6일 | 7일 | |
광배양 | 0.2 | 0.21 | 0.29 | 0.78 | 1.32 | 1.74 | 1.89 | 2.01 |
종속배양 | 0.2 | 0.34 | 0.99 | 1.56 | 2.21 | 3.56 | 5.32 | 5.9 |
혼합배양 | 0.2 | 0.56 | 1.21 | 2.03 | 2.98 | 4.12 | 5.89 | 6.65 |
[실시예 3] 활성 성분의 종류 분석
본 발명의 세네데스무스 속 HS4로부터 생산되는 활성 성분이 무엇인지 확인하기 위하여, 상기 미세조류의 배양액 1,000 g으로부터 추출물 55 g을 얻어 그 성분을 분석하였다. 배양된 상기 미세조류를 원심분리하는 과정을 거쳐 상층액인 배양액 부분은 제거하고 미세조류 세포만을 얻어 이를 -70 ℃에서 동결건조하여 수분을 제거하였다. 그리고 에틸 아세테이트(ethyl acetate)를 이용하여 동결건조된 바이오매스로부터 세포 추출을 진행하였고, 세포 추출 후 회전감압농축기(rotary vacuum evaporator)를 이용하여 유기용매를 증류한 후 추출물을 얻었다. 상기 추출물 시료는 용매에 녹여 실리카겔 컬럼 크로마토그래피(silica gel column chromatography)와 고성능 액체 크로마토그래피(HPLC, high performance liquid chromatography)를 수행하여 분획을 나누었고, 분획물 중에서 활성을 보이는 분획물은 농축 하여 preparative ODS MPLC를 통해 정제하였다. 상기 정제된 시료를 CD3OD에 녹이고, 1H NMR, 13C NMR, 1H-1H COSY, HMQC 및 HMBC 스펙트럼을 측정함으로써 상기 추출물 내에 존재하는 화합물의 화학 구조를 규명하였다.
그 결과, 상기 세네데스무스 속 HS4 추출물 시료에 포함되어 있는 물질의 화학 구조는 로리오라이드(loliolide)인 것으로 규명하였고, 문헌(Journal of the Korean Chemical Society, Vol. 48, No 4, 394-398, 2004)에서 보고된 로리오라이드의 NMR 데이터와 비교한 결과, 본 발명의 미세조류로부터 추출한 추출물에 포함된 활성 성분은 (-)-로리오라이드인 것임을 결정할 수 있었다(도 4a 내지 도 4e).
아울러, 상기와 같이 규명한 활성 성분의 화학 구조에 대한 추가적인 확인을 위하여, ESI-mass 스펙트럼으로 상기 성분의 분자량을 측정하였다.
그 결과, [M+H]+가 m/z 197.2, [2M+H]+가 m/z 393.2, [2M+Na]++가 m/z 415.2에서 피크가 관찰되어 분자량이 196임을 확인할 수 있었고, 따라서 상기 NMR 분광분석 결과에 의해 해석했던 화학구조가 로리오라이드임을 다시 한번 확인하였다(도 5a 및 도 5b).
[실시예 4] 로리오라이드의 함량 분석
상기 실시예 3에서 규명한 것과 같이 본 발명의 세네데스무스 속 HS4의 추출물에는 로리오라이드가 함유되어 있는바, 상기 세네데스무스 속 HS4가 다른 미세조류와 비교할 때 로리오라이드를 얼마나 더 많이 생산할 수 있는지 확인하였다. 먼저, 정제한 로리오라이드의 추출물을 이용하여 메탄올과 혼합하여 200 ppm의 농도로 만들고 이를 다시 희석하여 로리오라이드의 정량선을 만들었다(도 6a). 그런 다음, 상기 실시예 3과 동일한 방법을 통해 추출하여 얻은 본 발명의 세네데스무스 속 HS4 추출물, 및 동일한 방법으로 추출한 세네데스무스 속 JD052의 추출물을 대상으로 LC 분석을 수행하여, 상기에서 만든 정량선을 통해 상기 두 미세조류 추출물 내 로리오라이드의 함량을 분석하였다(도 6b).
그 결과, 혼합배양(mixotrophic culture)을 통해 배양한 본 발명의 세네데스무스 속 HS4의 에틸아세테이트 추출물 10,000 ppm에는 로리오라이드가 18.7 ppm, 종속배양(heterotrophic culture)을 통해 배양한 HS4의 추출물 10,000 ppm에는 로리오라이드가 14.3 ppm 포함되어 있음을 확인할 수 있었다. 이와 비교하여, 세네데스무스 속 JD052의 에틸아세테이트 추출물 10,000 ppm에는 로리오라이드가 17.6 ppm 포함되어 있음을 확인하였다.
상기와 같은 결과로 볼 때, 동일한 농도의 추출물을 기준으로, 본 발명의 세네데스무스 속 HS4 추출물 내에는 종래 JD052 미세조류 추출물과 비교하여 유사한 수준의 함량이 포함되어 있음을 확인하였다.
[실시예 5] 세네데스무스 속 HS4의 로리오라이드 생산성 향상 효과 확인
본 발명의 세네데스무스 속 HS4 미세조류의 로리오라이드 생산성이 종래의 미세조류에 비해 더 향상된 것인지 확인하기 위하여, 세네데스무스 속 JD052와 HS4 미세조류를 대상으로 바이오매스 생산성 및 이에 함유된 로리오라이드를 비교하였다.
먼저, 상기 세네데스무스 속 JD052는 유기탄소의 이화효율이 매우 낮은 미세조류에 해당하므로, 멸균한 상기 표 1의 조성으로 구성된 배양액(pH 7.1) 350 ㎖을 1L 플라스크에서 25 ℃조건으로, 광량 50 μmol·m-2·s-1의 빛을 조사하여 7일간 배양하였고, 상기 JD052의 최초 접종량은 0.2 g/L로 하였다. 본 발명의 HS4 미세조류는 빛과 유기탄소를 모두 제공하는 혼합배양과 빛은 배제하고 유기탄소만 주어진 종속배양의 조건으로 각각 배양하였다. 구체적으로, 상기와 같이 배양된 각 미세조류의 바이오매스 부피당 무게를 측정함으로써 바이오매스 생산성을 확인하였고, 상기 실시예 5에서 분석한 미세조류 추출물 내 로리오라이드 함량 수치를 이용하여 각 미세조류의 로리오라이드 생산성을 확인하였다.
구체적으로, 먼저 종속배양 조건의 경우, 다른 조건은 상기 JD052의 배양 조건과 동일하나, 포도당 10 g/L, 효모 추출물 1 g/L을 추가한 조성의 배양액을 이용하였고 빛을 조사하지 않았다. 혼합배양 조건의 경우, 상기 종속배양 조건의 경우와 동일한 조건에 더하여 광량 50 μmol·m-2·s-1의 빛을 조사하여 배양하였다. 상기 HS4의 최초 접종량은 0.2 g/L로 하였다.
그 결과, 광배양한 세네데스무스 속 JD052의 경우, 바이오매스 생산성은 0.26 g/L/day로 나타났고, 로리오라이드 생산성은 11.9 ng/L/day인 것을 확인할 수 있었다. 종속배양한 본 발명의 세네데스무스 속 HS4의 경우, 바이오매스 생산성은 0.81 g/L/day, 로리오라이드 생산성은 28 ng/L/day로 확인되었으며, 혼합배양한 HS4의 경우, 바이오매스 생산성은 0.92 g/L/day이고, 로리오라이드 생산성은 43 ng/L/day인 것을 확인할 수 있었다(도 7).
상기와 같은 결과로 볼 때, 본 발명의 세네데스무스 속 HS4 미세조류는 종래의 JD052 미세조류에 비하여, 바이오매스 생산성은 종속배양한 경우와 혼합배양한 경우 각각 약 3배, 3.4배 향상되었고, 로리오라이드 생산성은 각각 약 2.4배, 3.6배 향상된 효과를 가짐을 확인하였다. 따라서 본 발명의 신규한 세네데스무스 속 HS4 미세조류는 종래의 미세조류에 비하여 빛이 주어지지 않는 배양 조건에서도 성장속도가 우수하여 바이오매스 및 로리오라이드의 생산성이 현저하게 증가된 특징을 가진 것임을 확인하였다.
[실시예 6] 세네데스무스 속 HS4로부터 생산되어 정제된 로리오라이드의 인간진피섬유아세포에 대한 세포 독성 확인
본 발명의 세네데스무스 속 HS4로부터 생산되는 활성 성분인 로리오라이드가 피부에 미치는 영향을 확인하기 위하여, 생산된 로리오라이드를 정제하여 인간진피섬유아세포(human dermal fibroblasts, HDFs)에 처리하고 이에 의한 효과를 확인하였다.
로리오라이드의 정제는 상기 실시예 3과 동일한 방법으로 수행하였으며, 본 발명의 세네데스무스 속 HS4 미세조류의 동결건조된 배양액으로부터 에틸 아세테이트를 이용하여 추출물을 얻어 분획/농축 과정을 거쳐 로리오라이드를 정제하였다. 인간진피세포의 배양의 경우, DMEM 배지(Dulbecco's modified Eagle's medium, L0103-500, Biowest, France)에 10%의 FBS(fetal bovine serum, S1480, Biowest, France)가 더 포함된 배지를 이용하여, Lonza사(Basel, Switzerland)에서 구입한 인간진피섬유아세포를 37 ℃의 조건으로 5% CO2 세포배양기에서 배양하였다.
먼저, 로리오라이드가 인간진피섬유아세포에 대하여 세포 독성을 가지는지 여부를 WST-1 어세이(WST-1 assay)를 통해 확인하였다. 상기와 같이 배양된 인간진피섬유아세포를 4×103 cells/well 만큼 96-well 플레이트에 분주하여 24시간 동안 배양한 후, 세네데스무스 속 HS4 미세조류로부터 정제한 로리오라이드를 각각 0, 2, 5, 10, 20 ㎍/㎖의 농도로 처리하였다. 로리오라이드 처리 후 24시간 경과한 뒤에 WST-1 어세이 키트(EZ-cytox cell viability kit, Itshio, Korea)를 이용하여 용액을 상기 배지에 처리한 다음, 마이크로플레이트 리더(iMark microplate reader, Bio-Rad, USA)로 450 ㎚의 파장에서 흡광도를 측정하였다.
그 결과, 도 8에서 볼 수 있듯이 로리오라이드를 20 ㎍/㎖ 농도까지 처리하여 주었음에도, 로리오라이드를 처리하지 않은 대조군과 비교할 때 세포의 상대적 생존력이 감소하지 않았다. 따라서, 본 발명의 세네데스무스 속 HS4로부터 생산되는 로리오라이드의 농도가 20 ㎍/㎖까지는 인간진피섬유아세포에 대해 독성이 없는 것을 확인할 수 있었다.
[실시예 7] 자외선 조사에 의해 세포 생존력이 감소된 인간진피섬유아세포에 대한, 로리오라이드의 세포 생존력 회복 효과 확인
인간진피섬유아세포를 비롯하여 세포들은 UVB와 같은 자외선이 조사되었을 때 생존율이 감소하게 된다. 이에, 상기와 같이 정제한 로리오라이드를 인간진피섬유아세포에 처리하고 UVB를 조사하였을 때 세포 생존력이 어떻게 변화하는지 여부를 확인하였다.
상기 실시예 6과 동일한 방법을 통해 배양한 인간진피섬유아세포를 4×103 cells/well 만큼 96-well 플레이트에 분주하고, 로리오라이드를 2, 5, 10, 20 ㎍/㎖의 농도로 6시간 동안 처리하였다. 그리고, 상기 배지에 UVB를 10 mJ/㎠로 조사하여 24시간 더 배양하고, 상기 실시예 6과 동일한 방법으로 WST-1 어세이를 수행하여 세포 생존력을 측정하였다.
그 결과, 도 9에서 볼 수 있듯이 아무 처리를 하지 않은 세포의 생존율을 기준으로 할 때, 로리오라이드를 처리하지 않고 UVB만 조사한 대조군 세포의 경우 세포 생존력이 35% 감소하여 65%에 그친 것과는 달리, 로리오라이드를 각각의 농도로 처리한 세포들의 경우 세포 생존력이 더 높게 측정되어 UVB 조사에 의해 감소되었던 세포 생존력이 회복되었다. 가장 세포 생존력의 회복 효과가 높게 나타난 것은 로리오라이드를 5 ㎍/㎖ 또는 10 ㎍/㎖의 농도로 처리한 세포였으며, 이 때 세포 생존력은 88% ~ 89%의 수준으로 나타났다.
상기와 같은 결과로 볼 때, 로리오라이드는 UVB에 의해 감소되는 인간진피섬유아세포의 생존율을 회복시켜 다시 높여주는 효과가 우수하며, 2 ㎍/㎖의 처리 만으로도 대조군에 비해 세포의 생존력이 현저하게 높아지는 것을 확인하였는바, 본 출원의 세네데스무스 속 HS4로부터 분리하여 정제한 로리오라이드는 빛에 의해 손상된 피부의 회복 및 개선에 도움을 줄 수 있는 것임을 확인할 수 있었다.
[실시예 8] 로리오라이드에 의한 콜라겐 유전자(Col1A1)의 발현 촉진 효과, 및 콜라게나아제 유전자(MMP1)의 발현 억제 효과 확인
콜라겐은 피부를 구성하는 주요한 단백질 중 하나로 콜라겐의 감소에 의해 피부의 탄력, 보습 등에 악영향을 줄 수 있다. 상기와 같은 콜라겐의 합성과 관련된 유전자인 ColA1은 UVB와 같은 자외선의 조사에 의해 그 발현이 억제될 수 있고, 콜라겐을 분해하는 단백질인 콜라게나아제 유전자 MMP1은 UVB 조사에 의해 발현이 증가될 수 있어, 결국에는 콜라겐의 생성량 감소를 유도할 수 있다. 이에, 세네데스무스 속 HS4로부터 분리하여 정제한 로리오라이드를 처리하였을 때의 상기 유전자들의 발현량 변화를 측정하였다.
먼저, 상기 실시예 6과 동일한 방법을 통해 배양한 인간진피섬유아세포를 4×103 cells/well 만큼 96-well 플레이트에 분주하고, 상기 배지에 UVB를 10 mJ/㎠로 조사하였다. 그리고, 자외선이 조사된 상기 인간진피섬유아세포의 배지에 상기 실시예 7의 결과에서처럼 세포 생존력 회복 효과가 가장 우수했던 5, 10 ㎍/㎖의 농도로 로리오라이드를 처리하여, 24시간 배양하였다. 이후, ColA1 유전자 및 MMP1 유전자의 발현량 변화는 qRT-PCR(quantitative real time-PCR)을 통해 측정하였다. 이 과정에서 PCR에 의해 증폭되는 DNA 산물의 양을 실시간으로 확인하기 위하여 형광물질인 SYBR 그린 I(SYBR green I, Invitrogen사)을 사용하였다. 구체적으로, PCR 튜브에 하기 표 3과 같은 서열로 제작된 프라이머를 0.2 μM 넣고, 50 mM KCl, 20 mM Tris/HCl(pH 8.4), 0.8 mM dNTP, 0.5U DNA 중합효소(Extaq DNA polymerase), 3 mM MgCl2 및 1ХSYBR 그린 I을 혼합하여 반응액을 제조하였다. 그리고, PCR 기기(Linegene K, BioER, China)를 이용하여 PCR을 수행하였고(PCR 조건: primary denaturation은 3분, denaturation은 94 ℃에서 30초, annealing은 58 ℃에서 30초, polymerization은 72 ℃에서 30초, 총 40 cycle) 매 cycle마다 형광강도를 측정하였다.
서열번호 | 서열 명칭 | 염기서열(5'-> 3') |
1 | COL1A1 forward primer | AGGGCCAAGACGAAGACATC |
2 | COL1A1 reverse primer | AGATCACGTCATCGCACAACA |
3 | MMP1 forward primer | TCTGACGTTGATCCCAGAGAGCAG |
4 | MMP1 reverse primer | CAGGGTGACACCAGTGACTGCAC |
5 | β-actin forward primer | GGATTCCTATGTGGGCGACGA |
6 | β-actin reverse primer | CGCTCGGTGAGGATCTTCATG |
ColA1 유전자 발현량의 측정 결과, 도 10에서 볼 수 있듯이 아무 처리를 하지 않은 세포의 발현량을 기준으로 할 때, 로리오라이드를 처리하지 않고 UVB만 조사한 대조군 세포의 경우 ColA1 유전자 발현량이 70% 감소하여 30%에 그친 것과는 달리, 로리오라이드를 5 ㎍/㎖의 농도로 처리한 세포의 경우 ColA1 유전자 발현량이 55%로, 10 ㎍/㎖의 농도로 처리한 세포의 경우 ColA1 유전자 발현량이 65%로 측정되어 UVB 조사에 의해 감소되었던 발현량이 회복되었다.
MMP1 유전자의 발현량의 측정 결과, 도 11에서 볼 수 있듯이 아무 처리를 하지 않은 세포의 발현량을 기준으로 할 때, 로리오라이드를 처리하지 않고 UVB만 조사한 대조군 세포의 경우 MMP1 유전자 발현량이 2.4배 증가한 것과는 달리, 로리오라이드를 5 ㎍/㎖의 농도로 처리한 세포의 경우 MMP1 유전자 발현량이 25%로, 10 ㎍/㎖의 농도로 처리한 세포의 경우 MMP1 유전자 발현량이 46%로 측정되어 발현량이 감소되었다.
상기와 같은 결과로 볼 때, 로리오라이드는 UVB의 조사에 의해 감소되는 인간진피섬유아세포 내 ColA1 유전자 발현량을 회복시켜 다시 높여주고, MMP1 유전자 발현량은 감소시키는 효과가 있는바, 인간진피섬유아세포에서 생성되는 콜라겐의 생성량을 증가시킬 수 있는 효과가 있고, 이에 따라 본 출원의 세네데스무스 속 HS4로부터 분리하여 정제한 로리오라이드는 빛에 의해 손상된 피부의 회복 및 개선에 도움을 주고, 피부의 탄력과 보습 유지에 도움을 줄 수 있는 것임을 확인할 수 있었다.
이상에서 본 발명은 기재된 실시예에 대해서만 상세히 설명되었지만 본 발명의 기술사상 범위 내에서 다양한 변형 및 수정이 가능함은 당업자에게 있어서 명백한 것이며, 이러한 변형 및 수정이 첨부된 청구범위에 속함은 당연한 것이다.
(수탁번호)
기탁기관명 : 한국생명공학연구원
수탁번호 : KCTC13784BP
수탁일자 : 20190104
Claims (16)
- 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4).
- 청구항 1에 있어서,상기 세네데스무스 속 HS4는 로리오라이드를 생산할 수 있는, 세네데스무스 속 HS4.
- 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4의 추출물 또는 이의 분획물을 유효성분으로 포함하는, 피부 노화 방지 및 개선용 약학적 조성물.
- 청구항 3에 있어서,상기 세네데스무스 속 HS4의 추출물은 탄소수 1 내지 5의 저급 알코올, 아세톤, 아세토니트릴, 에틸아세테이트, 클로로포름, 디클로로메탄, 에틸에테르, 크실렌 및 헥산으로 이루어지는 군으로부터 선택되는 적어도 하나의 유기용매, 물 또는 이들의 혼합물로 추출되는 것인, 피부 노화 방지 및 개선용 약학적 조성물.
- 청구항 4에 있어서,상기 세네데스무스 속 HS4의 추출물은 에틸아세테이트로 추출되는 것인, 피부 노화 방지 및 개선용 약학적 조성물.
- 청구항 3에 있어서,상기 피부 노화는 자외선에 의해 유발되는 것인, 피부 노화 방지 및 개선용 약학적 조성물.
- 청구항 3에 있어서,상기 피부 노화 개선은 피부 주름 개선인 것인, 피부 노화 방지 및 개선용 약학적 조성물.
- 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4의 추출물 또는 이의 분획물을 유효성분으로 포함하는, 피부 노화 방지 및 개선용 화장료 조성물.
- 청구항 8에 있어서,상기 피부 노화 개선은 피부 주름 개선인 것인, 피부 노화 방지 및 개선용 화장료 조성물.
- 청구항 8에 있어서,상기 화장료 조성물은 용액, 현탁액, 유탁액, 겔, 로션, 에센스, 크림, 파우더, 비누, 샴푸, 린스, 팩마스크, 계면활성제-함유 클렌징, 클렌징 폼, 클렌징 워터, 오일, 리퀴드 파운데이션, 크림 파운데이션, 스프레이로 이루어진 군으로부터 선택되는 어느 하나의 제형을 갖는 것인, 피부 노화 방지 및 개선용 화장료 조성물.
- 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4로부터 생산한 로리오라이드를 포함하는, 피부 노화 방지 및 개선용 조성물.
- 청구항 11에 있어서,상기 로리오라이드는 상기 조성물 내에 1 ㎍/㎖ 내지 25 ㎍/㎖의 농도로 포함되는 것인, 피부 노화 방지 및 개선용 조성물.
- 청구항 11에 있어서,상기 피부 노화 개선은 피부 주름 개선인 것인, 피부 노화 방지 및 개선용 조성물.
- 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4) 및 첨가제를 포함하는, 조성물.
- 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4), 상기 세네데스무스 속 HS4의 배양액, 상기 배양액의 농축액, 상기 배양액의 건조물, 상기 배양액의 추출물 및 상기 추출물의 분획물로 이루어진 군으로부터 선택되는 하나 이상을 포함하는 조성물을 개체에 투여하는 단계를 포함하는, 피부 노화의 예방, 개선 또는 치료 방법.
- 피부 노화의 예방, 개선 또는 치료를 위한 용도의, 기탁번호 KCTC 13784BP로 기탁된 세네데스무스 속 HS4(Scenedesmus sp. HS4), 상기 세네데스무스 속 HS4의 배양액, 상기 배양액의 농축액, 상기 배양액의 건조물, 상기 배양액의 추출물 또는 상기 추출물의 분획물.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202080012038.4A CN113396213A (zh) | 2019-01-31 | 2020-01-31 | 黑麦草内酯生产性高的新型微藻类 |
US17/427,069 US20220387295A1 (en) | 2019-01-31 | 2020-01-31 | Novel microalgae having high loliolide productivity |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR20190013108 | 2019-01-31 | ||
KR10-2019-0013108 | 2019-01-31 | ||
KR1020190168315A KR102286636B1 (ko) | 2019-01-31 | 2019-12-16 | 로리오라이드 생산성이 높은 신규 미세조류 |
KR10-2019-0168315 | 2019-12-16 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2020159298A2 true WO2020159298A2 (ko) | 2020-08-06 |
WO2020159298A3 WO2020159298A3 (ko) | 2020-12-17 |
Family
ID=71840100
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2020/001510 WO2020159298A2 (ko) | 2019-01-31 | 2020-01-31 | 로리오라이드 생산성이 높은 신규 미세조류 |
Country Status (2)
Country | Link |
---|---|
US (1) | US20220387295A1 (ko) |
WO (1) | WO2020159298A2 (ko) |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101246723B1 (ko) * | 2011-05-13 | 2013-03-26 | 한국원자력연구원 | 방사선 조사에 의해 지질 함량이 증가된 세네데스무스 디모르푸스 6g, 이의 생산방법 및 상기 세네데스무스 디모르푸스 6g를 이용한 바이오 디젤의 제조방법 |
US20130164322A1 (en) * | 2011-12-22 | 2013-06-27 | Department Of Veterans Affairs | Cultured extremophilic algae species native to new mexico |
KR101552010B1 (ko) * | 2013-07-11 | 2015-09-10 | 주식회사 바이오에프디엔씨 | 미세 조류 추출물 유래 펩타이드 유도체를 함유하는 자외선 차단용 피부 외용제 조성물 |
KR101805899B1 (ko) * | 2016-10-07 | 2018-01-10 | 한국생명공학연구원 | 신규 세네데스무스속 조류 및 이의 추출물 |
-
2020
- 2020-01-31 US US17/427,069 patent/US20220387295A1/en active Pending
- 2020-01-31 WO PCT/KR2020/001510 patent/WO2020159298A2/ko active Application Filing
Also Published As
Publication number | Publication date |
---|---|
WO2020159298A3 (ko) | 2020-12-17 |
US20220387295A1 (en) | 2022-12-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR20050114677A (ko) | I형 콜라겐 및/또는 엘라스틴 생산 촉진용 조성물 | |
KR101716106B1 (ko) | 항염, 항알러지 및 아토피 피부 개선 효과를 가지는 해조류 혼합 발효물, 이의 제조방법 및 이의 화장료 조성물 | |
WO2011059292A2 (ko) | 피부세포증식 촉진, 항산화 및 항알러지 효과가 우수한 알로에 베라 새순 농축물 또는 추출물 | |
WO2019103329A1 (ko) | 갈색거저리 발효 추출물을 유효성분으로 포함하는 항산화용 조성물 | |
KR102222877B1 (ko) | 불멸화 줄기세포 유래 엑소좀 풍부 배양액 및 장미꽃봉오리 추출물을 유효성분으로 포함하는 기능성 조성물 | |
WO2017135556A1 (ko) | Gdf11을 포함하는 조성물 및 그의 용도 | |
WO2022050559A1 (ko) | 데이노잔틴 발효추출물의 제조방법 및 데이노잔틴 발효추출물을 포함하는 화장료 조성물 | |
WO2019143055A1 (ko) | 아스페르길루스 크리스타투스 균주로 발효시킨 발효 콩의 추출물을 포함하는 피부미용 개선용 조성물 | |
WO2017061769A1 (ko) | 세리포리아 락세라타에 의해 생산되는 세포외다당체를 유효성분으로 함유하는 탈모방지 또는 발모촉진용 조성물 | |
WO2018056676A1 (ko) | 퍼플콘 추출물을 함유하는 피부 질환의 예방 또는 치료용 약제학적 조성물 | |
WO2018111042A2 (ko) | 한약재 추출물을 유효성분으로 포함하는 화장료 조성물 | |
KR20140136763A (ko) | 홍경천 추출물을 함유하는 항스트레스용 조성물 | |
WO2020159298A2 (ko) | 로리오라이드 생산성이 높은 신규 미세조류 | |
KR20170000068A (ko) | 감귤류 과피 추출물을 포함하는 피부 보습용 조성물 | |
WO2018066916A1 (ko) | 신규 세네데스무스속 조류 및 이의 추출물 | |
KR101191724B1 (ko) | 대청엽 추출물을 함유하는 미백 및 주름개선용 조성물 | |
WO2016056780A1 (ko) | 알피나 골무꽃 추출물을 포함하는 탈모 방지 또는 육모 촉진용 조성물 | |
WO2017090970A1 (ko) | 세리포리아 락세라타에 의해 생산되는 세포외다당체를 유효성분으로 함유하는 자외선에 대한 피부 보호용 조성물 | |
KR102286636B1 (ko) | 로리오라이드 생산성이 높은 신규 미세조류 | |
WO2020166868A1 (ko) | 로치아 속 세균 유래 나노소포 및 이의 용도 | |
WO2018155933A1 (ko) | 아쿠아포린-3의 발현을 증가시키는 6,7-디메톡시-2,2-디메틸-2h-크로멘 및 이의 용도 | |
KR101825683B1 (ko) | 항염증성 자외선 손상 보호용 화장료 조성물 | |
KR101244101B1 (ko) | 파프리카 발효물을 유효 성분으로 포함하는 피부 염증 개선용 화장료 조성물 | |
WO2019164090A1 (ko) | 앉은 부채 추출물 또는 이의 분획물을 유효성분으로 포함하는 주름 개선용 조성물 | |
WO2019132217A1 (ko) | 회화나무열매 발효액 또는 이의 추출액을 유효성분으로 함유하는 피부 주름개선용 화장료 조성물 및 그의 제조방법 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20749479 Country of ref document: EP Kind code of ref document: A2 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 20749479 Country of ref document: EP Kind code of ref document: A2 |