WO2020139010A1 - 피퍼롱구민을 함유하는 담도폐쇄증 치료 또는 예방용 의약 조성물 - Google Patents

피퍼롱구민을 함유하는 담도폐쇄증 치료 또는 예방용 의약 조성물 Download PDF

Info

Publication number
WO2020139010A1
WO2020139010A1 PCT/KR2019/018590 KR2019018590W WO2020139010A1 WO 2020139010 A1 WO2020139010 A1 WO 2020139010A1 KR 2019018590 W KR2019018590 W KR 2019018590W WO 2020139010 A1 WO2020139010 A1 WO 2020139010A1
Authority
WO
WIPO (PCT)
Prior art keywords
pharmaceutical composition
liver
expression
piperongmin
biliary atresia
Prior art date
Application number
PCT/KR2019/018590
Other languages
English (en)
French (fr)
Inventor
이제원
손도현
이성은
김용득
전황주
Original Assignee
주식회사 티에스디라이프사이언스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 티에스디라이프사이언스 filed Critical 주식회사 티에스디라이프사이언스
Publication of WO2020139010A1 publication Critical patent/WO2020139010A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4412—Non condensed pyridines; Hydrogenated derivatives thereof having oxo groups directly attached to the heterocyclic ring
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics

Definitions

  • the present invention relates to a pharmaceutical composition for the treatment or prevention of biliary atresia containing piperongmin.
  • Bile is a digestive fluid that is produced in the liver and is stored in the gallbladder and then discharged from the common bile duct into the duodenum.
  • Biliary atresia (biliary atresia) is a refractory rare disease in which bile passages (ie, biliary ducts) connected from the liver to the duodenum are blocked, so that bile does not drain from the liver into the digestive tract and accumulates, thereby causing liver damage or inflammation. .
  • Biliary atresia may be acquired, but the problem in particular is the case of newborns who are congenital. In the United States, it is reported that 1 in 10,000 to 15,000 people occurs in the United States on a newborn basis, and 1 in every 5,000 people in East Asia.
  • the present invention is to provide a pharmaceutical composition for treating or preventing biliary atresia.
  • the present invention provides a pharmaceutical composition for the treatment or prevention of biliary atresia containing piperlongum.
  • the present invention relates to a pharmaceutical composition for the treatment or prevention of biliary atresia, which contains piperlongum.
  • Piperlongumin is a component extracted from Indian pepper (scientific name Piper Longum L.) and has the structure of Formula 1 below.
  • Piperongmin is known to have anti-cancer effects (see Korean Patent Publication No. 2012-0104165). However, there has been no report on the effect of piperongmin treatment for biliary atresia.
  • the pharmaceutical composition containing pipergumin according to the present invention is suitable as needed, such as a formulation for oral administration (for example, a solid preparation such as a tablet or a dispersant or liquid), or a formulation for parenteral administration (for example, an injection). It can be formulated in the form.
  • Pipperonggumin the active ingredient of the present invention, may be administered to a patient, for example, at a dose of about 0.0001 mg to 10 g/kg per day, however, considering the patient's gender, weight, age, severity of symptoms, etc. It can be decided accordingly.
  • the pharmaceutical composition containing piperlongum according to the present invention can be used as a pharmaceutical composition for treating or preventing biliary atresia by inhibiting bile production.
  • the composition of the present invention can be used as a pharmaceutical composition for treating or preventing inflammation of the liver.
  • 1 is a graph showing the results of measuring the expression level of gene expression related to bile acid production according to the treatment time of piper longgumin in a mouse liver cell line.
  • FIG. 2 is a graph showing the results of measuring the expression level of gene expression related to bile acid production according to the treatment concentration of piperongumin in a mouse liver cell line.
  • Figure 3 is a graph showing the experimental results of measuring the effect of piperongumin on the expression of genes involved in bile acid production in hepatocytes of mice treated with 2-AG.
  • Figure 4 is a graph showing the experimental results of measuring the effect of the high fat diet on the cholesterol and triglyceride levels in the serum and liver of mice.
  • Figure 5 is a graph showing the experimental results of measuring the effect of the peppermingumin on the total amount of bile acids in the serum of the mouse high fat diet.
  • Figure 6 is a graph showing the experimental results of measuring the effect of piperongumin on the expression of inflammation-causing cytokines in a mouse liver cell line.
  • FIG. 7 is a graph showing the experimental results of measuring the effect of piperongumin on the expression of inflammation-causing cytokines in the mouse liver cell line induced inflammation.
  • FIG. 9 is a graph showing the experimental results of measuring the effect of high-fat diet on the serum- and liver-inducing cytokine levels of mice in the pepperonigumin.
  • the present invention relates to a pharmaceutical composition for the treatment or prevention of biliary atresia, which contains piper longines.
  • the present invention relates to a pharmaceutical composition for treating or preventing inflammation of the liver (especially inflammation caused by biliary atresia).
  • Example 1 Efficacy in inhibiting bile acid production
  • Mouse liver cell line (liver cell line) AML-12 was used for pre-sale from the American Type Culture Collection (ATCC).
  • fetal bovine serum FBS: Corning, NY, USA
  • insulin-transferrin-selenium ITS: Gibco-BRL, Grand Island, NY, USA
  • dexamethasone 40 ng/ml , Sigma-Aldrich, St. Louis, MO, USA
  • the mouse hepatocyte cell line AML-12 was replaced with medium containing 0.5% FBS 12 hours before sample treatment. Subsequently, the piperonggumin was treated at a concentration of 6 ⁇ M and cultured according to time-dependent conditions (0, 1, 3, 6, 12 hours).
  • Primer sequences used for real-time PCR analysis gene Primer sequence (5'-3') CYP27A1 F (forward): CCTCACCTATGGGATCTTCATC R (reverse direction): TTTAAGGCATCCGTGTAGAGC HNF-4 ⁇ F: GCCAAGATTGACAACCTGCT R: CCCATGTGTTCTTGCATCAG LRH-1 F: TTGAGTGGGCCAGGAGTAGT R: TCGGTAAATGTGATCGAGAATC GAPDH F: GGTTGTCTCCTGCGACTTCA R: TGGTCCAGGGTTTCTTACTCC
  • Proteins HNF-4 ⁇ and LRH-1 are known transcription factors that activate the expression of the CYP7A1 gene involved in bile acid production. As a result of the experiment, it was confirmed that the expression levels of HNF-4 ⁇ and LRH-1 are also reduced by the treatment with piperlongum (see FIG. 1 ).
  • the mouse liver cell line AML-12 was replaced with a medium containing 0.5% FBS 12 hours before sample treatment. Subsequently, the piperonggumin was treated at a concentration of 0 ⁇ M, 3 ⁇ M, or 6 ⁇ M and cultured for 6 hours.
  • Primer sequences used for real-time PCR analysis gene Primer sequence (5'-3') CB1R F: AAGTCGATCTTAGACGGCCTT R: TCCTAATTTGGATGCCATGTCTC
  • the mouse liver cell line AML-12 was simultaneously treated with 10 nM of 2-AG and 0 ⁇ M, 3 ⁇ M or 6 ⁇ M of piperongmin.
  • mice 25 C57BL/6 male mice, 8 weeks of age, were divided into three groups to conduct the experiment.
  • one group was fed a normal diet as a normal group (five animals), and the other two groups (each 10 animals) were fed a high-fat diet to establish a diet-induced obesity model.
  • Rodent Diet with 60% kcal fat was supplied as a high-fat diet.
  • control group controls the high-fat diet
  • PL group experimental group
  • mice After 4 weeks, blood and liver tissues were collected from mice in all groups, and cholesterol and triglyceride levels in serum and liver tissues were measured.
  • Cholesterol was measured using the Abcam Cholesterol Assay Kit (Abcam), and triglycerides were measured using the Abcam Triglyceride Assay Kit (Abcam, Cambridge, UK). The total amount of protein in liver tissue was quantified using the Pierce BCA Protein Assay Kit (Pierce, Rockford, IL, USA).
  • the cholesterol and triglyceride levels increased in the plasma and liver of the control group as compared to the normal group, and the cholesterol and triglyceride levels decreased compared to the control group in the experimental group fed with piperongmin (PL) (see FIG. 4 ). .
  • Blood was collected from the mice of ⁇ Experimental Example 1-E>, and the total amount of bile acids in serum was measured.
  • the total amount of bile acids was measured using a Biovision Total bile Acids (TBA) Assay Kit (Biovision, Milpitas, CA, USA).
  • piperongmin has an effect of inhibiting the production of bile acids. Therefore, it is possible to treat or prevent the symptoms of biliary obstruction.
  • Example 2 Efficacy of suppressing inflammation in the liver
  • the mouse liver cell line AML-12 was used for pre-sale from the American Type Culture Collection (ATCC).
  • ATCC American Type Culture Collection
  • fetal bovine serum FBS: Corning, NY, USA
  • insulin-transferrin-selenium ITS: Gibco-BRL, Grand Island, NY, USA
  • dexamethasone 40 ng/ml, Sigma-Aldrich , St. Louis, MO, USA
  • the mouse liver cell line AML-12 was replaced with medium containing 0.5% FBS 12 hours before sample treatment. Subsequently, the piperonggumin was treated with concentrations of 0 ⁇ M, 3 ⁇ M, and 6 ⁇ M.
  • the sequence of the PCR primers of GAPDH used in this Experimental Example is the same as in ⁇ Example 1-B>, and the sequences of the PCR primers of IL-6, TNF- ⁇ , NF-kB and TLR4 are shown in Table 3 below.
  • Primer sequences used for real-time PCR analysis gene Primer sequence (5'-3') IL-6 F: CACATGTTCTCTGGGAAATCG R: TTGTATCTCTGGAAGTTTCAGATTGTT TNF- ⁇ F: CCTGTAGCCCACGTCGTAG R: GGGAGTAGACAAGGTACAACC NF-Kb F: GGGGCCTGCAAAGGTTATC R: TGCTGTTACGGTGCATACCC TLR4 F: ATGGCATGGCTTACACCACC R: GAGGCCAATTTTGTCTCCACA
  • the purpose of this study was to measure the inhibitory effect of piperongumin on liver inflammation in mouse hepatocytes in which inflammation was induced by lipopolysaccharide (LPS).
  • LPS lipopolysaccharide
  • the mouse hepatocyte cell line AML-12 (ATCC) was simultaneously treated with 1 ⁇ g/mL LPS and 0 ⁇ M, 3 ⁇ M or 6 ⁇ M piperongumin.
  • Example 2-B> The same sequence as ⁇ Example 2-B> was used for the sequence of the PCR primer used in this experimental example.
  • mice 25 C57BL/6 male mice, 8 weeks of age, were divided into three groups to conduct the experiment.
  • one group was fed a normal diet as a normal group (5 animals), and 2 groups (10 animals each) were fed a high-fat diet to establish a diet-induced obesity model.
  • High-fat diet was supplied with Rodent Diet with 60% kcal fat (Research Diet, New Brunswick, NJ, USA).
  • control group controls the high-fat diet
  • PL group experimental group
  • AST aspartate aminotransferase
  • ALT aslanine aminotransferase
  • IL-6 interleukin-6
  • TNF- ⁇ tumor necrosis factor-alpha
  • IL-6 and TNF- ⁇ levels were increased in the serum and liver tissues of the control group compared to the normal group, and IL-6 and TNF- ⁇ levels were decreased in the experimental group that fed piperongumin compared to the control group ( See Figure 9).
  • the composition of the present invention can be used as a pharmaceutical composition for the treatment or prevention of inflammation of the liver, and in particular, can treat or prevent inflammation of the liver that is caused by biliary obstruction.
  • composition of the present invention may be used as a pharmaceutical composition for treating or preventing biliary atresia.
  • the composition of the present invention can be used as a pharmaceutical composition for treating or preventing inflammation of the liver.

Landscapes

  • Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

피퍼롱구민 함유 담도폐쇄증 치료제를 개시한다.

Description

피퍼롱구민을 함유하는 담도폐쇄증 치료 또는 예방용 의약 조성물
본 발명은 피퍼롱구민을 함유하는 담도폐쇄증 치료 또는 예방용 의약 조성물에 관한 것이다.
담즙은 간에서 생성되어 담낭 내에 저류되어 있다가 총담관으로부터 십이지장으로 배출되는 소화액이다. 담도폐쇄증(biliary atresia)은 간에서 십이지장으로 연결되어 있는 담즙 통로(즉, 담도)가 막혀서 담즙이 간으로부터 소화관으로 배출되지 못하고 쌓이게 되며, 이에 따라 간에 손상이 일어나거나 염증이 유발되는 난치성 희귀 질환이다.
담도폐쇄증이 발병하게 되면 담즙이 소화관으로 배출되지 못하기 때문에 변이 회백색을 띠게 된다.
담도폐쇄증은 후천적으로 나타날 수도 있으나, 특히 문제되는 것은 선천적으로 나타나는 신생아의 경우이다. 신생아 기준으로 미국에서는 10,000 ~ 15,000 명 당 1명 발생하는 것으로 보고되어 있고, 동아시아에서는 이보다 더 빈도가 높아서 5,000 명 당 1명 발생하는 것으로 보고되어 있다.
현재 담도폐쇄증을 외과적으로 치료하기 위한 수술법 등이 개발되었으나, 발병 후 바로 수술하지 못하는 경우 생명에 커다란 위협이 될 수 있으므로, 담도폐쇄증 치료제가 절실히 요구된다.
본 발명은 담도폐쇄증을 치료 또는 예방하기 위한 의약 조성물을 제공하기 위한 것이다.
상기 과제를 해결하기 위하여, 본 발명은 피퍼롱구민을 함유하는 담도폐쇄증 치료 또는 예방용 의약 조성물을 제공한다.
따라서, 본 발명은 피퍼롱구민을 함유하는 담도폐쇄증의 치료 또는 예방용 의약 조성물에 관한 것이다.
피퍼롱구민(piperlongumin)은 인도산 후추(학명 Piper Longum L.)로부터 추출된 성분으로서 하기 화학식 1의 구조를 갖는다.
Figure PCTKR2019018590-appb-C000001
피퍼롱구민은 항암 효과가 있는 것으로 알려져 있다(한국 공개특허공보 제2012-0104165호 참조). 그러나, 피퍼롱구민의 담도폐쇄증 치료 효과에 대해서는 전혀 보고된 바 없다.
본 발명에 따른 피퍼롱구민 함유 의약 조성물은 경구투여용 제형(예를 들어, 정제와 같은 고형 제제나 분산제 또는 액제 등) 또는 비경구투여용 제형(예를 들어, 주사제) 등과 같이 필요에 따라 적합한 형태로 제제화할 수 있다.
본 발명의 활성성분인 피퍼롱구민은 환자에게 예를 들어 1일 약 0.0001mg 내지 10g/kg 의 용량으로 투여될 수 있으나, 환자의 성별, 체중, 연령, 증상의 정도 등을 고려하여 필요에 따라 적절히 정해질 수 있다.
본 발명에 따른 피퍼롱구민 함유 의약 조성물은 담즙 생성을 억제하여 담도폐쇄증 치료용 또는 예방용 의약 조성물로 사용될 수 있다. 또한, 본 발명의 조성물은 간의 염증 치료 또는 예방용 의약 조성물로 사용될 수 있다.
도 1은 마우스 간세포주에서 피퍼롱구민의 처리 시간에 따른 담즙산 생성 관련 유전자 발현 정도를 측정한 결과를 그래프로 도시한 것이다.
도 2는 마우스 간세포주에서 피퍼롱구민의 처리 농도에 따른 담즙산 생성 관련 유전자 발현 정도를 측정한 결과를 그래프로 도시한 것이다.
도 3은 2-AG가 처리된 마우스의 간세포에서 피퍼롱구민이 담즙산 생성에 관련된 유전자의 발현에 미치는 효과를 측정한 실험 결과를 그래프로 도시한 것이다.
도 4는 피퍼롱구민이 고지방식이 마우스의 혈청 및 간 내 콜레스테롤과 중성지방수치에 미치는 효과를 측정한 실험 결과를 그래프로 도시한 것이다.
도 5는 피퍼롱구민이 고지방식이 마우스의 혈청 내 담즙산 총량에 미치는 효과를 측정한 실험 결과를 그래프로 도시한 것이다.
도 6은 마우스 간세포주에서 피퍼롱구민이 염증 유발 사이토카인의 발현에 미치는 효과를 측정한 실험 결과를 그래프로 도시한 것이다.
도 7은 염증이 유도된 마우스 간세포주에서 피퍼롱구민이 염증 유발 사이토카인의 발현에 미치는 효과를 측정한 실험 결과를 그래프로 도시한 것이다.
도 8은 피퍼롱구민이 고지방식이 마우스의 간 기능 지표에 미치는 효과를 측정한 실험 결과를 그래프로 도시한 것이다.
도 9는 피퍼롱구민이 고지방식이 마우스의 혈청 및 간 내 염증 유발 사이토카인 수치에 미치는 효과를 측정한 실험 결과를 그래프로 도시한 것이다.
본 발명은 피퍼롱구민을 함유하는, 담도폐쇄증 치료용 또는 예방용 의약 조성물에 관한 것이다.
또한, 본 발명은 간의 염증(특히, 담도폐쇄증에 의하여 나타나는 염증)을 치료 또는 예방하기 위한 의약 조성물에 관한 것이다.
이하에서는 본 발명을 실시예에 의거하여 상세하게 설명하고자 한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이에 한정되는 것은 아니다.
실시예 1: 담즙산 생성 억제 효능
가. 마우스 간세포주 배양
마우스 간세포주 (liver cell line) AML-12를 ATCC(American Type Culture Collection)로부터 분양받아 사용하였다.
10% 소 태아 혈청(fetal bovine serum, FBS: Corning, NY, USA), 인슐린-트랜스페린-셀레늄(insulin-transferrin-selenium, ITS: Gibco-BRL, Grand Island, NY, USA), 덱사메타손(40ng/ml, Sigma-Aldrich, St. Louis, MO, USA), 페니실린-스트렙토마이신(Gibco)가 함유된 DMEM/F-12 (Corning) 배지를 이용하여 37°C의 5% CO2 배양기에서 배양하였다.
나. 마우스 간세포주에서 피퍼롱구민 처리 시간에 따른 담즙산 생성 관련 유전자 발현 양상 측정
본 실험예에서는 피퍼롱구민의 처리 시간에 따른 담즙산 생성 관련 유전자의 발현 변화를 알아보기 위하여 정량적 실시간-PCR을 수행하였다.
마우스 간세포주인 AML-12에 시료 처리 12시간 전에 0.5% FBS가 함유된 배지로 교체하였다. 이후 피퍼롱구민을 6μM 농도로 처리하여 시간 의존적 조건(0, 1, 3, 6, 12시간)에 따라 배양하였다.
시료(피퍼롱구민) 처리 시간 경과 후, Trizol 시약(Ambion, CA, USA)을 이용하여 배양된 세포로부터 total RNA를 추출하였다. Maxima first strand cDNA synthesis kit(Fermentas, Vilnius, Lituania)을 이용하여 추출한 RNA로부터 cDNA를 합성하였다. SYBR master mix(Qiagen, Venlo, Netherlands)와 Rotor-Gene Q(Qiagen)를 이용하여 정량적 실시간-PCR을 수행하였다. 확인하고자 하는 유전자 발현양은 GAPDH 유전자의 발현양으로 표준화(normalization)하여 정량하였다.
본 실험예에 사용된 PCR 프라이머의 서열은 하기 표 1과 같다.
실시간-PCR 분석에 사용된 프라이머 서열
유전자 프라이머 서열(5'-3')
CYP27A1 F(정방향) : CCTCACCTATGGGATCTTCATC
R(역방향) : TTTAAGGCATCCGTGTAGAGC
HNF-4α F : GCCAAGATTGACAACCTGCT
R : CCCATGTGTTCTTGCATCAG
LRH-1 F : TTGAGTGGGCCAGGAGTAGT
R : TCGGTAAATGTGATCGAGAATC
GAPDH F : GGTTGTCTCCTGCGACTTCA
R : TGGTCCAGGGTTTCTTACTCC
실험 결과, 담즙산 생성에 관여하는 것으로 알려진 CYP27A1 은 피퍼롱구민의 처리 시간에 의존적으로 발현양이 감소하는 것을 확인하였다(도 1 참조).
단백질 HNF-4α 및 LRH-1은 담즙산 생성에 관여하는 CYP7A1 유전자의 발현을 활성화하는 전사인자로 알려져 있다. 실험 결과, HNF-4α 및 LRH-1도 피퍼롱구민의 처리에 의하여 그 발현양이 감소하는 것을 확인하였다(도 1 참조).
다. 마우스 간세포주에서 피퍼롱구민(piperlongumine)의 처리 농도에 따른 담즙산 생성 관련 유전자의 발현 양상 측정
본 실험예에서는 피퍼롱구민의 처리 농도에 따른 담즙산 생성 관련 유전자의 발현 변화를 알아보고자 하였다.
마우스 간 세포주인 AML-12에 시료 처리 12시간 전 0.5% FBS가 함유된 배지로 교체하였다. 이후 피퍼롱구민을 0μM, 3μM 또는 6μM 농도로 처리하여 6시간 동안 배양하였다.
시료 처리 6시간 경과 후, Trizol 시약(Ambion)을 이용하여 배양된 세포로부터 total RNA를 추출하였다. Maxima first strand cDNA synthesis kit(Fermentas, Vilnius, Lituania)을 이용하여 추출한 RNA로부터 cDNA를 합성하였다. SYBR master mix(Qiagen, Venlo, Netherlands)와 Rotor-Gene Q(Qiagen)를 이용하여 정량적 실시간-PCR을 수행하였다. 확인하고자 하는 유전자 발현양은 GAPDH 유전자의 발현양으로 표준화하여 정량하였다.
본 실험예에 사용된 CYP27A1, HNF-4α, LRH-1 및 GAPDH의 PCR 프라이머의 서열은 상기 <실시예 1-나>와 동일하며 CB1R(담즙산 생성에 관여하는 CYP7A1 및 CYP27A1의 전사(transcription)을 촉진하는 단백질)의 PCR 프라이머의 서열은 하기 표 2와 같다.
실시간-PCR 분석에 사용된 프라이머 서열
유전자 프라이머 서열(5'-3')
CB1R F : AAGTCGATCTTAGACGGCCTT
R : TCCTAATTTGGATGCCATGTCTC
실험 결과, CYP27A1, LRH-1, CB1R의 경우 피퍼롱구민의 처리 농도에 의존적으로 발현양이 감소하는 것을 확인하였다. HNF-4α의 경우도 피퍼롱구민에 의해 발현양이 감소하는 것을 확인하였다(도 2 참조).
라. 2-AG(2-Arachidonoylglycerol)가 처리된 마우스의 간세포에서 피퍼롱구민이 담즙산 생성에 관련된 유전자의 발현에 미치는 효과 측정
본 실험예에서는 2-AG에 의해 CB1R가 활성화된 마우스의 간세포에서 피퍼롱구민이 담즙산 생성에 관련된 유전자의 발현에 미치는 효과를 측정하고자 하였다.
마우스 간 세포주인 AML-12에 10nM의 2-AG와 0μM, 3μM 또는 6μM의 피퍼롱구민을 동시에 처리하였다.
시료 처리 6시간 경과 후, Trizol 시약(Ambion)을 이용하여 배양된 세포로부터 total RNA를 추출하였다. Maxima first strand cDNA synthesis kit(Fermentas)을 이용하여 추출한 RNA로부터 cDNA를 합성하였다. SYBR master mix (Qiagen)와 Rotor-Gene Q(Qiagen)를 이용하여 정량적 실시간-PCR을 수행하였다. 확인하고자 하는 유전자 발현양은 GAPDH 유전자의 발현양으로 표준화하여 정량하였다.
본 실험예에 사용된 PCR 프라이머의 서열은 상기 <실시예 1-다>와 동일한 서열을 사용하였다.
실험 결과, 2-AG에 의해 CYP27A1, HNF-4α, LRH-1, CB1R의 발현양이 증가된 것을 확인하였고, 피퍼롱구민을 처리한 군에서는 해당 4개의 담즙 생성 관련 유전자의 발현양이 감소함을 확인하였다(도 3 참조).
마. 피퍼롱구민이 고지방식이 마우스의 혈청 및 간 내 콜레스테롤(cholesterol)과 중성지방(triglyceride)수치에 미치는 효과 측정
8주령의 C57BL/6 수컷 마우스 25마리를 총 3개의 군으로 나누어 실험을 진행하였다.
5주 동안 1개의 군은 정상군(normal group, 5마리)으로 하여 일반식이를 공급하였고, 나머지 2개의 군(각 10마리)은 식이유도 비만모델(diet-induced obesity)을 확립하기 위하여 고지방식이(High-fat diet)로 Rodent Diet with 60% kcal fat(Research Diet, New Brunswick, NJ, USA)을 공급하였다.
5주 후, 2개의 고지방식이군은 고지방식이만 섭식하는 대조군(control group)과 고지방식이와 피퍼롱구민(30mg/kg/day)을 섭식하는 실험군(PL group)으로 나누어 4주간 사육하였다. 이때, 정상군은 일반식이를 4주간 유지하였다.
4주 후, 모든 군의 마우스로부터 혈액과 간조직을 채취하여, 혈청 및 간 조직의 콜레스테롤과 중성지방 수치를 측정하였다.
콜레스테롤은 Abcam Cholesterol Assay Kit(Abcam)을 사용하여 측정하였고, 중성지방은 Abcam Triglyceride Assay Kit(Abcam, Cambridge, UK)을 사용하여 측정하였다. 간 조직 내 총 단백질량은 Pierce BCA Protein Assay Kit(Pierce, Rockford, IL, USA)을 사용하여 정량하였다.
측정 결과, 정상군 대비 대조군의 혈장과 간에서 콜레스테롤과 중성지방의 수치가 증가하였으며, 피퍼롱구민(PL)을 함께 섭식한 실험군은 대조군 대비 콜레스테롤과 중성지방의 수치가 감소하였다(도 4 참조).
바. 피퍼롱구민이 고지방식이 마우스의 혈청 내 담즙산 총량(total bile acid)에 미치는 효과 측정
상기 <실험예 1-마>의 마우스들로부터 혈액을 채취하여, 혈청 내 담즙산 총량을 측정하였다. 담즙산 총량은 Biovision Total bile Acids (TBA) Assay Kit (Biovision, Milpitas, CA, USA)을 사용하여 측정하였다.
측정 결과, 대조군 대비 피퍼롱구민을 함께 섭식한 실험군에서 혈청 내 담즙산 총량이 감소한 것을 확인하였다(도 5 참조).
상기 실험 결과로부터, 피퍼롱구민은 담즙산의 생성을 억제하는 효과가 있음을 확인하였다. 따라서, 담도폐쇄에 의하여 나타나는 제 증상을 치료하거나 예방할 수 있다.
실시예 2: 간에서의 염증 생성 억제 효능
가. 마우스 간세포주 배양
<실시예 1-가>에서와 마찬가지로, 마우스 간세포주 (liver cell line) AML-12를 ATCC(American Type Culture Collection)로부터 분양받아 사용하였다.
10% 소 태아 혈청(FBS: Corning, NY, USA), 인슐린-트랜스페린-셀레늄(insulin-transferrin-selenium, ITS: Gibco-BRL, Grand Island, NY, USA), 덱사메타손(40ng/ml, Sigma-Aldrich, St. Louis, MO, USA), 페니실린-스트렙토마이신(Gibco)가 함유된 DMEM/F-12 (Corning) 배지를 이용하여 37°C의 5% CO2 배양기에서 배양하였다.
나. 마우스 간세포주에서 피퍼롱구민이 염증 유발 사이토카인의 발현에 미치는 효과 측정
본 실험예에서는 간세포 내 염증 유발 사이토카인의 발현에 대해 피퍼롱구민이 미치는 영향을 알아보기 위하여 정량적 실시간-PCR을 수행하였다.
마우스 간세포주인 AML-12를 시료 처리 12시간 전 0.5% FBS가 함유된 배지로 교체하였다. 이후 피퍼롱구민을 0μM, 3μM, 6μM 농도로 처리하였다.
시료 처리 6시간 경과 후, Trizol 시약(Ambion, CA, USA)을 이용하여 배양된 세포로부터 total RNA를 추출하였다. Maxima first strand cDNA synthesis kit (Fermentas)을 이용하여 추출한 RNA로부터 cDNA를 합성하였다. SYBR master mix (Qiagen, Venlo, Netherlands)와 Rotor-Gene Q (Qiagen)를 이용하여 정량적 실시간-PCR을 수행하였다.확인하고자 하는 유전자 발현양은 GAPDH 유전자의 발현양으로 표준화하여 정량하였다.
본 실험예에 사용된 GAPDH의 PCR 프라이머의 서열은 상기 <실시예 1-나>와 동일하며 IL-6, TNF-α, NF-kB 및 TLR4의 PCR 프라이머의 서열은 하기 표 3과 같다.
실시간-PCR 분석에 사용된 프라이머 서열
유전자 프라이머 서열(5'-3')
IL-6 F : CACATGTTCTCTGGGAAATCG
R : TTGTATCTCTGGAAGTTTCAGATTGTT
TNF-α F : CCTGTAGCCCACGTCGTAG
R : GGGAGTAGACAAGGTACAACC
NF-Kb F : GGGGCCTGCAAAGGTTATC
R : TGCTGTTACGGTGCATACCC
TLR4 F : ATGGCATGGCTTACACCACC
R : GAGGCCAATTTTGTCTCCACA
실험 결과, 염증 유발 사이토카인인 IL-6, TNF-α, NF-kB, TLR4의 발현양이 피퍼롱구민의 농도에 의존적으로 감소함을 확인하였다(도 6 참조).
다. 염증이 유도된 마우스 간세포주에서 피퍼롱구민이 염증 유발 사이토카인의 발현에 미치는 효과 측정
본 실험예에서는 리포 다당류(LPS: Lipopolysaccharide)에 의해 염증이 유도된 마우스 간세포 내에서 피퍼롱구민의 간 염증 억제 효과를 측정하고자 하였다.
마우스 간세포주인 AML-12(ATCC)에 1μg/mL의 LPS와 0μM, 3μM 또는 6μM의 피퍼롱구민을 동시에 처리하였다.
시료 처리 6시간 경과 후, Trizol 시약(Ambion)을 이용하여 배양된 세포로부터 total RNA를 추출하였다. Maxima first strand cDNA synthesis kit(Fermentas)을 이용하여 추출한 RNA로부터 cDNA를 합성하였다. SYBR master mix(Qiagen)와 Rotor-Gene Q(Qiagen)를 이용하여 정량적 실시간-PCR을 수행하였다. 확인하고자 하는 유전자 발현양은 GAPDH 유전자의 발현양으로 표준화하여 정량하였다.
본 실험예에 사용된 PCR 프라이머의 서열은 상기 <실시예 2-나>와 동일한 서열을 사용하였다.
실험 결과, LPS에 의해 증가된 염증 유발 사이토카인인 IL-6, TNF-α, NF-kB, TLR4의 발현양이 피퍼롱구민에 의하여 감소함을 확인하였다(도 7 참조).
라. 피퍼롱구민이 고지방식이 마우스의 간 기능 지표에 미치는 효과 측정
8주령의 C57BL/6 수컷 마우스 25마리를 총 3개의 군으로 나누어 실험을 진행하였다.
5주 동안 1개의 군은 정상군(normal group, 5마리)으로 하여 일반식이를 공급하였고, 2개의 군(각 10마리)은 식이유도 비만모델(diet-induced obesity)을 확립하기 위하여 고지방식이(High-fat diet)로 Rodent Diet with 60% kcal fat(Research Diet, New Brunswick, NJ, USA)을 공급하였다.
5주 후, 2개의 고지방식이군은 고지방식이만 섭식하는 대조군(control group)과 고지방식이와 피퍼롱구민(30mg/kg/day)을 섭식하는 실험군(PL group)으로 나누어 4주간 사육하였다. 이때, 정상군은 일반식이를 4주간 유지하였다.
4주 후, 모든 군의 마우스로부터 혈액을 채취하고 혈장을 분리하였다. 분리한 혈장에서 간 기능의 지표인 AST(aspartate aminotransferase)와 ALT(alanine aminotransferase)의 수치를 혈청분석기(Acute, Toshiba, Tokyo, Japan)를 사용하여 측정하였다.
측정 결과, 정상군 대비 대조군에서 AST와 ALT의 수치가 증가하였으며, 대조군 대비 피퍼롱구민을 함께 섭식한 실험군에서 정상군의 수치에 가깝게 AST와 ALT의 수치가 감소하였다(도 8 참조).
마. 피퍼롱구민이 고지방식이 마우스의 혈청 및 간 내 염증 유발 사이토카인 수치에 미치는 효과 측정
상기 <실험예 2-라>의 모든 군의 마우스로부터 혈액과 간조직을 채취하여, 혈청 및 간 조직의 IL-6(interleukin-6)와 TNF-α(tumor necrosis factor-alpha)를 측정하였다. IL-6는 FINETEST Mouse IL-6 ELISA Kit(FineTest, Wuhan, China)를 사용하여 측정하였고, TNF-α는 FINETEST Mouse TNF-α ELISA KIT(FineTest)를 사용하여 측정하였다.
측정 결과, 정상군 대비 대조군의 혈청과 간 조직에서 IL-6, TNF-α의 수치가 증가하였으며, 대조군 대비 피퍼롱구민을 함께 섭식한 실험군에서 IL-6, TNF-α의 수치가 감소하였다(도 9 참조).
상기 실험 결과로부터, 피퍼롱구민은 간에서 나타나는 염증을 치료 또는 예방하는 효과가 있음을 알 수 있다. 따라서, 본 발명의 조성물은 간의 염증의 치료 또는 예방용 의약 조성물로 사용될 수 있으며, 특히 담도폐쇄에 의하여 나타나는 간의 염증을 치료 또는 예방할 수 있다.
본 발명의 조성물은 담도폐쇄증 치료 또는 예방용 의약 조성물로 사용될 수 있다. 또한, 본 발명의 조성물은 간의 염증 치료 또는 예방용 의약 조성물로 사용될 수 있다.

Claims (4)

  1. 피퍼롱구민을 함유하는 담도폐쇄증 치료 또는 예방용 약제학적 조성물.
  2. 제1항에 있어서, 간의 염증을 치료 또는 예방하기 위한 약제학적 조성물.
  3. 피퍼롱구민을 함유하는, 간의 염증을 치료 또는 예방하기 위한 약제학적 조성물.
  4. 제3항에 있어서, 상기 간의 염증은 담도폐쇄증에 의하여 발생되는 것을 특징으로 하는 약제학적 조성물.
PCT/KR2019/018590 2018-12-27 2019-12-27 피퍼롱구민을 함유하는 담도폐쇄증 치료 또는 예방용 의약 조성물 WO2020139010A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2018-0171251 2018-12-27
KR1020180171251A KR20200081633A (ko) 2018-12-27 2018-12-27 피퍼롱구민을 함유하는 담도폐쇄증 치료 또는 예방용 의약 조성물

Publications (1)

Publication Number Publication Date
WO2020139010A1 true WO2020139010A1 (ko) 2020-07-02

Family

ID=71126654

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/018590 WO2020139010A1 (ko) 2018-12-27 2019-12-27 피퍼롱구민을 함유하는 담도폐쇄증 치료 또는 예방용 의약 조성물

Country Status (2)

Country Link
KR (1) KR20200081633A (ko)
WO (1) WO2020139010A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101352487A (zh) * 2008-08-04 2009-01-28 北京宝泰宁堂医药科技有限公司 荜茇提取物、其制备方法、其药物组合物及其应用
KR20160007724A (ko) * 2014-06-25 2016-01-21 서울대학교산학협력단 피퍼롱구민을 유효성분으로 함유하는 지방간 예방용 식품 조성물, 지방간 치료용 약학 조성물, 지방간 치료용 동물 의약품 및 사료 조성물
KR20160026462A (ko) * 2014-09-01 2016-03-09 한림대학교 산학협력단 피페론구민과 그 유도체 및 그 합성방법
KR20180109105A (ko) * 2017-03-27 2018-10-08 충북대학교 산학협력단 파이퍼롱구민을 유효성분으로 포함하는 다발성 경화증의 예방 또는 치료용 조성물

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102625805A (zh) 2009-09-02 2012-08-01 堪瑟拉治疗有限公司 治疗癌症的化合物和组分

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101352487A (zh) * 2008-08-04 2009-01-28 北京宝泰宁堂医药科技有限公司 荜茇提取物、其制备方法、其药物组合物及其应用
KR20160007724A (ko) * 2014-06-25 2016-01-21 서울대학교산학협력단 피퍼롱구민을 유효성분으로 함유하는 지방간 예방용 식품 조성물, 지방간 치료용 약학 조성물, 지방간 치료용 동물 의약품 및 사료 조성물
KR20160026462A (ko) * 2014-09-01 2016-03-09 한림대학교 산학협력단 피페론구민과 그 유도체 및 그 합성방법
KR20180109105A (ko) * 2017-03-27 2018-10-08 충북대학교 산학협력단 파이퍼롱구민을 유효성분으로 포함하는 다발성 경화증의 예방 또는 치료용 조성물

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JIA GANG HAN, SUBASH C. GUPTA, SAHDEO PRASAD AND BHARAT B. AGGARWAL: "Piperlongumine chemosensitizes tumor cells through interaction with cysteine 179 of IkappaBalpha. kinase, leading to suppression of NP-kappa B-regulated gene products", MOLECULAR CANCER THERAPEUTICS, vol. 13, no. 10, 31 July 2014 (2014-07-31), XP055722596, ISSN: 1535-7163, DOI: 10.1158/1535-7163.MCT-14-0171 *
LAN-DI SUN , FU WANG ,FANG DAI ,YI-HUA WANG ,DONG LIN ,BO ZHOU: "Development and mechanism investigation of a new piperlongumine derivative as a potent anti-inflammatory agent", BIOCHEMICAL PHARMACOLOGY, vol. 95, no. 3, 4 April 2015 (2015-04-04), pages 156 - 169, XP055722599, ISSN: 0006-2952, DOI: 10.1016/j.bcp.2015.03.014 *

Also Published As

Publication number Publication date
KR20200081633A (ko) 2020-07-08

Similar Documents

Publication Publication Date Title
WO2021040371A1 (ko) 항염증용 조성물
WO2011118976A2 (en) Pharmaceutical composition for the prevention or the treatment of non-alcoholic fatty liver disease and the method for prevention or treatment of non-alcoholic fatty liver disease using the same
WO2022131428A1 (ko) 오를리스타트 및 아커만시아 뮤시니필라 eb-amdk19 균주를 포함하는 조성물
WO2017146309A1 (ko) 유파틸린의 상피간엽이행 억제 활성을 이용한 섬유증 예방 및 치료용 약제학적 조성물로서의 새로운 용도
WO2016137164A2 (ko) 바실러스 속 세균 유래 세포밖 소포체를 포함하는 임신관련 질환 치료용 조성물
Liu et al. Chitooligosaccharides alleviate hepatic fibrosis by regulating the polarization of M1 and M2 macrophages
Chen et al. Melatonin induces anti-inflammatory effects via endoplasmic reticulum stress in RAW264. 7 macrophages
WO2020139010A1 (ko) 피퍼롱구민을 함유하는 담도폐쇄증 치료 또는 예방용 의약 조성물
WO2013051765A1 (ko) 항염증 효과를 갖는 1-(5-브로모-2-하이드록시-4-메톡시페닐)에타논 및 이를 함유하는 약학 조성물
WO2023085741A1 (ko) 3&#39;-시알릴락토오스, 6&#39;-시알릴락토오스 또는 이의 염을 유효성분으로 포함하는 감염에 의한 다발성 장기부전의 예방 또는 치료용 조성물
Bai et al. NEOBAVAISOFLAVONE IMPROVES MEDIAL COLLATERAL LIGAMENT-INDUCED OSTEOARTHRITIS THROUGH REPRESSING THE NUCLEAR FACTOR-κB/HYPOXIA-INDUCIBLE FACTOR-2a AXIS.
WO2022139489A1 (ko) 알코올성 및 비알코올성 지방간의 예방 또는 치료용 약학 조성물
WO2022114881A1 (ko) 벤즈브로마론을 포함하는 상처 또는 흉터의 예방 또는 치료용 약학 조성물
WO2013032096A1 (ko) 파골세포 형성 억제 효과가 있는 카프르산 및 이를 포함하는 약학적 조성물
WO2014051338A2 (ko) 말초혈액 단핵세포를 유효성분으로 포함하는 예방 또는 치료용 약제학적 조성물
WO2021182913A1 (ko) 태반 추출물을 포함하는 간 질환 예방 또는 치료용 및 간 기능 개선용 조성물
WO2019039620A1 (ko) 목향 추출물 및 코스튜놀리드를 유효성분으로 포함하는 전립선 비대증 치료용 조성물 및 건강 기능 식품
WO2020138560A1 (ko) 백내장 예방 또는 치료용 약학적 조성물 및 건강기능식품
WO2022145512A1 (ko) 지방간염 예방 또는 치료용 약학 조성물
WO2024136627A1 (ko) 나트륨 포도당 운반체-2 저해제 및 안지오텐신 ⅱ 수용체 차단제를 함유하는 비알코올성 지방간 질환 예방 또는 치료용 약학적 조성물
WO2015030504A1 (ko) 비소세포폐암 치료제를 유효성분으로 포함하는 톡소포자충감염증의 예방 또는 치료용 약학 조성물
US8668908B2 (en) Method for alleviating chemotherapy side effects using extract of Dioscorea sp
WO2023043297A1 (ko) 골관절염 예방 또는 치료용 약학 조성물 및 건강기능식품
WO2021225349A1 (ko) 두부외상의 예방 또는 치료용 조성물
WO2010058936A2 (en) Skin external composition for inhibiting epidermal hyperproliferation and alleviating inflammatory skin diseases containing ortho-dihydroxyisoflavone derivatives

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19906509

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 16.11.2021)

122 Ep: pct application non-entry in european phase

Ref document number: 19906509

Country of ref document: EP

Kind code of ref document: A1