WO2020085879A1 - 아세틴 화합물의 생물학적 제조 방법 - Google Patents
아세틴 화합물의 생물학적 제조 방법 Download PDFInfo
- Publication number
- WO2020085879A1 WO2020085879A1 PCT/KR2019/014256 KR2019014256W WO2020085879A1 WO 2020085879 A1 WO2020085879 A1 WO 2020085879A1 KR 2019014256 W KR2019014256 W KR 2019014256W WO 2020085879 A1 WO2020085879 A1 WO 2020085879A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- amino acid
- acetyl transferase
- position corresponding
- seq
- glycerol
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
- C12P7/26—Ketones
- C12P7/28—Acetone-containing products
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12N9/1033—Chloramphenicol O-acetyltransferase (2.3.1.28)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/62—Carboxylic acid esters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01008—Glycerol-3-phosphate dehydrogenase (NAD+) (1.1.1.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01079—Maltose O-acetyltransferase (2.3.1.79)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
- C12Y301/03021—Glycerol-1-phosphatase (3.1.3.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/185—Escherichia
- C12R2001/19—Escherichia coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01028—Chloramphenicol O-acetyltransferase (2.3.1.28)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/01—Carboxylic ester hydrolases (3.1.1)
- C12Y301/01006—Acetylesterase (3.1.1.6)
Definitions
- the present invention relates to a method for producing an acetin compound and a composition for preparing acetin.
- Acetin is a substance in which an acetyl group is ester-linked to a hydroxyl group (-OH) of glycerol, and monoacetin with one attached according to the number of acetic acid groups ( monoacetin), diacetin with two sticks, and triacetin with three sticks.
- Triacetin is also known as glycerin triacetate or triglyceride 1,2,3-triacetoxypropane.
- Acetin is used as a food additive, such as fragrance solvents and wetting agents, and is used as a moisturizer, plasticizer, and solvent in the pharmaceutical industry. Triacetin can also be used as an antiknock agent to reduce engine knocking of gasoline and as a fuel additive to improve the low temperature and viscosity properties of biodiesel.
- triacetin is one of the tobacco additives and is also used as a plasticizer in the tobacco filter manufacturing process. In addition, it is used as an important material in supplying more than half of the energy required to astronauts in artificial space food of astronauts performing long space flight missions.
- the U.S. Food and Drug Administration (FDA) recognizes it as a Generally Recognized as Safe (GRAS).
- the acetin material is a viscous, colorless, odorless liquid.
- the existing acetin material is an artificial chemical synthetic material in which acetic acid or acetic anhydride is combined with glycerol through a chemical reaction.
- acetin compounds can be produced in a biological way by enzymes that bind acetic acid groups through glycerol or derivatives of glycerol through an esterification reaction, and intestinal bacteria (entero) using glycerol as a carbon source in nature It has also been found that trace amounts of monoacetin are produced in some parts of the genus Bacteria (Enterobacteriaceae).
- the present inventors made a recombinant microorganism capable of producing monoacetin, diacetin, and triacetin based on glycerol or glucose as a starting substrate, and thus have completed the present invention (FIGS. 1 and 2).
- An object of the present invention is to provide a method for biological production of an acetin compound and a composition for preparing an acetin compound.
- a method for producing acetin comprising: reacting acetyl-CoA with glycerol in the presence of a first O-acetyl transferase to obtain monoacetin or diacetin.
- the amino acid at the position corresponding to position 70 of the amino acid sequence of SEQ ID NO: 5 is aspartic acid (ASP), and the amino acid at the position corresponding to position 84 is asparagine ( ASN), the amino acid at the position corresponding to position 114 is histidine (HIS), and the amino acid at the position corresponding to position 126 is glutamic acid (GLU).
- the first O-acetyl transferase is the amino acid at the position corresponding to position 15 of the amino acid sequence of SEQ ID NO: 5 is tyrosine (TYR) or phenylalanine (PHE), and at the position corresponding to position 26
- the amino acid is arginine (ARG) or glutamine (GLN)
- the amino acid at the position corresponding to position 30 is arginine (ARG) or lysine (LYS)
- the amino acid at the position corresponding to position 71 is tyrosine (TYR)
- position 82 A method for producing acetin, wherein the amino acid at the corresponding position is phenylalanine (PHE) or tyrosine (TYR).
- the amino acid is phenylalanine (PHE) or isoleucine (ILE), the amino acid at the position corresponding to position 143 is phenylalanine (PHE) or tyrosine (TYR), and the amino acid at the position corresponding to position 166 is phenylalanine (PHE) or tyrosine (TYR) ),
- the amino acid at the position corresponding to position 170 is valine (VAL), isoleucine (ILE), or leucine (LEU)
- the amino acid at the position corresponding to position 193 is histidine (HIS).
- a method for producing acetin comprising culturing a microorganism expressing a gene encoding a first O-acetyl transferase in a medium containing glycerol.
- the amino acid at the position corresponding to position 70 of the amino acid sequence of SEQ ID NO: 5 is aspartic acid (ASP), and the amino acid at the position corresponding to position 84 is asparagine ( ASN), the amino acid at the position corresponding to position 114 is histidine (HIS), and the amino acid at the position corresponding to position 126 is glutamic acid (GLU).
- the amino acid at the position corresponding to position 15 of the amino acid sequence of SEQ ID NO: 5 is tyrosine (TYR) or phenylalanine (PHE), and at the position corresponding to position 26
- the amino acid is arginine (ARG) or glutamine (GLN)
- the amino acid at the position corresponding to position 30 is arginine (ARG) or lysine (LYS)
- the amino acid at the position corresponding to position 71 is tyrosine (TYR)
- position 82 A method for producing acetin, wherein the amino acid at the corresponding position is phenylalanine (PHE) or tyrosine (TYR).
- microorganism further expresses a gene encoding a second O-acetyl transferase that transfers an acetyl group to diacetin.
- the amino acid is phenylalanine (PHE) or isoleucine (ILE), the amino acid at the position corresponding to position 143 is phenylalanine (PHE) or tyrosine (TYR), and the amino acid at the position corresponding to position 166 is phenylalanine (PHE) or tyrosine (TYR) ),
- the amino acid at the position corresponding to position 170 is valine (VAL), isoleucine (ILE), or leucine (LEU), and the amino acid at the position corresponding to position 193 is histidine (HIS).
- microorganism is an attenuated or deleted gene encoding acetylesterase.
- the microorganism further expresses a gene encoding glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate (DL-glycerol-3-phosphatase),
- the medium comprises glucose, a method for producing acetin.
- composition for producing acetin comprising a microorganism expressing a gene encoding a first O-acetyl transferase.
- composition of claim 19, wherein the first O-acetyl transferase is maltose O-acetyl transferase.
- the amino acid at the position corresponding to position 70 of the amino acid sequence of SEQ ID NO: 5 is aspartic acid (ASP), and the amino acid at the position corresponding to position 84 is asparagine ( ASN), the amino acid at the position corresponding to position 114 is histidine (HIS), and the amino acid at the position corresponding to position 126 is glutamic acid (GLU).
- the amino acid at the position corresponding to position 15 of the amino acid sequence of SEQ ID NO: 5 is tyrosine (TYR) or phenylalanine (PHE), and at the position corresponding to position 26
- the amino acid is arginine (ARG) or glutamine (GLN)
- the amino acid at the position corresponding to position 30 is arginine (ARG) or lysine (LYS)
- the amino acid at the position corresponding to position 71 is tyrosine (TYR)
- position 82 Acetine composition wherein the amino acid at the corresponding position is phenylalanine (PHE) or tyrosine (TYR).
- composition according to the above 19, wherein the gene encoding the first O-acetyl transferase is composed of any one of SEQ ID NOs: 16 to 21.
- the microorganism further expresses a gene encoding a second O-acetyl transferase that transfers an acetyl group to diacetin, a composition for preparing acetin.
- the amino acid at the position corresponding to position 31 of the amino acid sequence of SEQ ID NO: 7 is cysteine (CYS) or leucine (LEU), and at the position corresponding to position 102.
- the amino acid is phenylalanine (PHE) or isoleucine (ILE), the amino acid at the position corresponding to position 143 is phenylalanine (PHE) or tyrosine (TYR), and the amino acid at the position corresponding to position 166 is phenylalanine (PHE) or tyrosine (TYR) ),
- the amino acid at the position corresponding to position 170 is valine (VAL), isoleucine (ILE), or leucine (LEU), and the amino acid at the position corresponding to position 193 is histidine (HIS).
- composition of 24, wherein the gene encoding the second O-acetyl transferase is composed of any one of SEQ ID NOs: 24 to 27.
- the microorganism further expresses a gene encoding glycerol 3-phosphate dehydrogenase and glycerol 3-phosphatase (DL-glycerol-3-phosphatase). , Acetin production composition.
- a method for producing a safe and better quality acetin material is provided that is sustainable and does not cause environmental pollution by preparing the acetin material through a biological method.
- 1 shows a pathway in which glycerol introduced into cells is converted to monoacetin, diacetin, and triacetin.
- FIG. 2 shows a pathway in which glucose introduced into cells is converted to monoacetin, diacetin, and triacetin.
- FIG. 3 (A) shows the plasmids pMD1-pMD8 produced by selecting candidate genes for O-acetyltransferases in E. coli capable of transferring acetyl groups to glycerol to produce monoacetin and diacetin, and cloning each gene into the pTrc99A expression vector.
- Structural drawing, (B) is a diagram comparing the productivity of monoacetin and diacetin in recombinant E. coli DH-MD1-DH-MD8 transformed with plasmids of (A) (DH-MD0 is an empty vector pTrc99A (C) represents the recombinant E. coli transformed with E.
- coli maltose O-acetyltransferase (Maa) based on the structure and amino acid sequence, selects candidate genes derived from other microorganisms that are believed to transfer acetyl groups to glycerol.
- Structural diagram of the plasmids pMD9-pMD13 made by cloning genes into the pTrc99A expression vector, (D) is a recombinant strain transformed with these plasmids This is a comparison of monoacetin and diacetin productivity in Escherichia coli DH-MD9-DH-MD13.
- FIG. 4 (A) is a structural diagram of plasmids pMD13, pMD14, and pMDT1 made by cloning the Maa gene ( Bs-maa ) of B. subtilis , which had the best monoacetin and diacetin productivity, into pTrc99A, pET28a, and pSTV28 expression vectors
- (B) is a diagram comparing the productivity of monoacetin, diacetin, and triacetin in recombinant E. coli DH-MD13, DH-MD14, DH-MDT1 transformed with the plasmids
- Figure 5 is a mixture of monoacetin (1), diacetin (2), and triacetin (3) mixed standard compounds (STD) and cultures of recombinant E. coli DH-MD06, DH-MD8, DH-MDT1 It is a gas chromatogram diagram analyzed by GC after extraction with acetate, and (B) compares the mass spectrometry of monoacetin, diacetin, and triacetin obtained in each sample by GC-MS with that of standard compounds (STD). It is a drawing.
- FIG. 6 (A) is a structural diagram of the plasmid pMDT2 produced by cloning the chloramphenicol-O-acetyltransferase gene ( cat ) and B. subtilis Maa gene ( Bs-maa ) that convert diacetin to triacetin into the pTrc99A expression vector.
- (B) and (C) is a diagram comparing the productivity and composition of the acetin complex of the recombinant E. coli DH-MDT2 transformed with the plasmid with the control DH-MDT1, (D) in the recombinant E. coli DH-MDT2 It is a diagram showing the production change with the culture time of the acetin complex.
- FIG. 7A shows candidate genes presumed to transfer acetyl groups to diacetin based on the structure and amino acid sequence of Chloramphenicol O-acetyltransferase, found in various microorganisms and cloned into plasmid pMD13 to construct plasmids pMDT2-pMDT7.
- Figure, (B) is a diagram comparing the production amount of the acetin complex of the recombinant strain DH-MDT2-DH-MDT7 transformed with the plasmid
- (C) is a diagram comparing the cell growth of the recombinant strains.
- Figure 8 is a comparison of the productivity of the acetin complex according to E. coli species and glycerol concentration
- (B) was a comparison of the cell proliferation of the recombinant E.
- (C) was a culture of the recombinant strain MG-MDT2 It shows the productivity of the acetin complex according to the glycerol concentration
- (D) is to compare the growth of cells according to the glycerol concentration of the strain.
- FIG. 9 shows changes in the acetin compound through amplification and deletion of the acetylesterase gene ( aes ) in E. coli BW25113
- (A) and (B) are recombinant strains BW- transformed with pTrc99A and pTAes in E. coli BW25113, respectively.
- Empty and BW-Aes were inoculated in 2YT medium to which 15 g / L of triacetin standard compound was added, and the degradation pattern of triacetin was observed
- (C) shows the strains of JW0465 lacking BW25113 and aes gene as plasmid pMDT2.
- the transformed recombinant strains BW-MDT2 and BW-MDT2 ( Daes) were cultured in 2YT medium containing 10% (v / v) glycerol to compare the productivity of acetin complex, and (D) was the cells of the recombinant strains. Comparison of proliferation.
- FIG 10 is a structural diagram of the plasmid pMDT8 made by cloning the glycerol production genes Sc-gpd1 and Sc-gpp2 from Saccharomyces cerevisiae to the pMDT2 plasmid for the production of acetin complex from glucose,
- B Is the production of acetin complex from glucose of recombinant E. coli DH-MDT8 transformed with the plasmid
- C is the cell proliferation of the E. coli
- D is the pH change of the culture medium.
- FIG. 11 shows the structure of the substrate binding site of BsMAA maltose acetyltransferase.
- the key residues of the glycerol acetylation reaction are aspartic acid (ASP) at position 70 of the amino acid sequence, asparagine at position 84 (ASN), histidine at position 114 (HIS), glutamic acid at position 126 (GLU).
- Figure 13 shows the structure of the substrate binding site of CAT chloramphenicol-O-acetyltransferase (Chloramphenicol-O-acetyltransferase).
- the key residues of the diacetin acetylation reaction are phenylalanine at position 102 of the amino acid sequence (PHE), phenylalanine at position 143 (PHE), and histidine at position 193 (HIS).
- Residues at positions 102 and 143 of the sequence may be replaced with amino acids of similar properties, isoleucine (ILE) and tyrosine (TYR), respectively. This can be seen in Figure 14 comparing the amino acid sequence alignment of the second O-acetyl transferases.
- ILE isoleucine
- TMR tyrosine
- the present invention relates to a process for the production of acetin, comprising: reacting acetyl-CoA with glycerol in the presence of a first O-acetyl transferase to obtain monoacetin or diacetin.
- the first O-acetyl transferase may transfer O-acetyl to glycerol in the acetyl-CoA, but may be, for example, maltose O-acetyl transferase, but is not limited thereto.
- the first O-acetyl transferase may be derived from an organism or may be synthesized.
- the first O-acetyl transferase may be expressed in a microorganism having a gene encoding the first O-acetyl transferase, and the gene encoding the first O-acetyl transferase in the microorganism may be transferred to the corresponding microorganism. It may be inherent, may be introduced into the microorganism from the outside by genetic engineering technology, in this case, glycerol and acetyl-CoA may be reacted in the microorganism, but is not limited thereto.
- the acetin may include monoacetin, diacetin, or triacetin, or a combination thereof.
- the first O-acetyl transferase acts as a catalyst in the reaction of glycerol and acetyl-CoA to generate monoacetin, and the monoacetin is further reacted with acetyl-CoA in the presence of the first O-acetyl transferase.
- Diacetin can be produced by reaction, but is not limited thereto.
- the amino acid at the position corresponding to position 70 of the amino acid sequence of SEQ ID NO: 5 is aspartic acid (ASP)
- the amino acid at the position corresponding to position 84 is asparagine (ASN)
- ASN asparagine
- the amino acid at the corresponding position is histidine (HIS)
- the amino acid at the position corresponding to position 126 may be glutamic acid (GLU), but is not limited thereto.
- the amino acid at the position corresponding to position 15 of the amino acid sequence of SEQ ID NO: 5 is tyrosine (TYR) or phenylalanine (PHE)
- the amino acid at the position corresponding to position 26 is arginine (ARG ) Or glutamine (GLN)
- the amino acid at the position corresponding to position 30 is arginine (ARG) or lysine (LYS)
- the amino acid at the position corresponding to position 71 is tyrosine (TYR)
- the amino acid may be phenylalanine (PHE) or tyrosine (TYR), but is not limited thereto.
- tyrosine (TYR) is a residue that forms a substrate binding pocket, and is relatively well-preserved and corresponds to an amino acid residue that plays an important role in producing acetin.
- amino acid aspartic acid at the position corresponding to position 70 of the amino acid sequence of SEQ ID NO: 5 of the first O-acetyl transferase, the asparagine (ASN) at position 84 and amino acid position 126 Glutamic acid (GLU), an amino acid at position, is an amino acid residue that stabilizes glycerol, is relatively well-preserved, and corresponds to an amino acid residue that plays an important role in producing acetin.
- the histidine (HIS), an amino acid at the position corresponding to position 114 of the amino acid sequence of SEQ ID NO: 5 of the first O-acetyl transferase, is a residue that acts as a catalyst, is relatively well preserved, and produces acetin. Corresponds to amino acid residues that play an important role.
- the amino acid sequence may be 50% or more homologous to the amino acid sequence of SEQ ID NO: 5.
- the maltose O-acetyl transferase is, for example, maltose O-acetyl transferase of Escherichia coli (SEQ ID NO: 1), maltose O-acetyl transferase of Staphylococcus carnosus ( Staphylococcus carnosus ) SEQ ID NO: 2), Maltose O-acetyl transferase of Halalkalicoccus jeotgali (SEQ ID NO: 3), maltose O-acetyl transferase of Lactobacillus brevis (SEQ ID NO: 4), Bacillus subtilis Maltose O-acetyl transferase (SEQ ID NO: 5) or Pseudomonas putida ( Pseudomonas putida ) may be a maltose O-acetyl transferase (SEQ ID NO: 6), preferably, Bacillus subtilis ( Bacillus subtilis
- the amino acid sequence of Maltose O-acetyl transferase (SEQ ID NO: 1) of Escherichia coli is homologous to the amino acid sequence of Maltose O-acetyl transferase (SEQ ID NO: 5) of Bacillus subtilis 65 %, And the amino acid sequence of maltose O-acetyl transferase (SEQ ID NO: 2) of Staphylococcus carnosus and the amino acid sequence of maltose O-acetyl transferase (SEQ ID NO: 5) of Bacillus subtilis The homology of 58%, the amino acid sequence of maltose O-acetyl transferase of Halalkalicoccus jeotgali (SEQ ID NO: 3), and the amino acid sequence of Bacillus subtilis (SEQ ID NO: 5) ) and amino acid sequence homology is 53%, Lactobacillus brevis of maltose O- acetyl transferase (Lactobacill
- the method for preparing acetin of the present invention may further include a step of reacting the reaction product diacetin with acetyl-CoA in the presence of a second O-acetyl transferase.
- the amino acid at the position corresponding to position 31 of the amino acid sequence of SEQ ID NO: 7 is cysteine (CYS) or leucine (LEU)
- the amino acid at the position corresponding to position 102 is phenylalanine (PHE) or Isoleucine (ILE)
- the amino acid at the position corresponding to position 143 is phenylalanine (PHE) or tyrosine (TYR)
- the amino acid at the position corresponding to position 166 is phenylalanine (PHE) or tyrosine (TYR)
- the amino acid at the position is valine (VAL), isoleucine (ILE), or leucine (LEU)
- the amino acid at the position corresponding to position 193 may be histidine (HIS), but is not limited thereto.
- the second-acetyl transferase may generate triacetin by transferring an acetyl group to diacetin, but may be, for example, chloramphenicol-O-acetyltransferase, but is not limited thereto.
- Chloramphenicol-O-acetyl transferase may be, for example, consisting of the amino acid sequence of SEQ ID NO: 7, but is not limited thereto.
- the chloramphenicol-O-acetyl transferase of SEQ ID NO: 7 may be, for example, expressed in a pSTV28 vector having a chloramphenicol-resistant antibiotic marker, or may be expressed in a microorganism having a chloramphenicol-resistant antibiotic marker.
- pSTV28 vector may be expressed in a congenital or acquired microorganism, may be prepared synthetically, but is not limited thereto.
- the second O-acetyl transferase is chloramphenicol-O-acetyl transferase, or has a similar protein sequence and structure to transfer acetyl groups to diacetin to generate triacetin.
- the second O-acetyl transferase may be expressed in a microorganism having a gene encoding the second O-acetyl transferase, and the gene encoding the second O-acetyl transferase in the microorganism is inherent in the microorganism. It may be, it may be introduced into the microorganism from the outside by genetic engineering technology, in this case, glycerol and acetyl-CoA may be reacted in the microorganism, but is not limited thereto.
- the second O-acetyl transferase may be derived from an organism or may be synthesized.
- the amino acid at the position corresponding to position 31 of the amino acid sequence of SEQ ID NO: 7 is cysteine (CYS) or leucine (LEU), the threonine (THR) at the position corresponding to position 93, or Proline (PRO), amino acid phenylalanine (PHE) or isoleucine (ILE) at the position corresponding to position 102, phenylalanine (PHE) or tyrosine (TYR) at the position corresponding to position 143, at the position corresponding to position 166
- Either phenylalanine (PHE) or tyrosine (TYR) and amino acids at positions corresponding to position 170, valine (VAL), isoleucine (ILE), and leucine (LEU) form a substrate binding pocket.
- CYS cysteine
- LEU leucine
- TTR threonine
- PRO Proline
- PRO amino acid phenylalanine
- ILE isoleucine
- ILE phen
- the second O-acetyl transferase is histidine (HIS), an amino acid at the position corresponding to position 193 of the amino acid sequence of SEQ ID NO: 7, is a residue that acts as a catalyst, is relatively well preserved, and produces acetin. Corresponds to amino acid residues that play an important role.
- HIS histidine
- the amino acid sequence may have a homology to the amino acid sequence of SEQ ID NO: 7 of 32% or more.
- the second O-acetyl transferase is chloramphenicol-O-acetyl transferase of SEQ ID NO: 7, O-acetyl transferase of Bacillus cereus (SEQ ID NO: 8), Pseudomonas aeruginosa ) (SEQ ID NO: 9) or Clostridium acetobutylicum (O-acetyl transferase) (SEQ ID NO: 10), preferably Bacillus cereus ( Bacillus cereus ) It may be an O-acetyl transferase, but is not limited thereto.
- the amino acid sequence of O-acetyl transferase (SEQ ID NO: 8) of Bacillus cereus is 43% or more homologous to the amino acid sequence of chloramphenicol-O-acetyl transferase (SEQ ID NO: 7), and Pseudomonas aeruginosa ) has an amino acid sequence of 62% homology to the amino acid sequence of chloramphenicol-O-acetyl transferase (SEQ ID NO: 7), and that of Clostridium acetobutylicum .
- the amino acid sequence of O-acetyl transferase (SEQ ID NO: 10) has 32% homology to the amino acid sequence of chloramphenicol-O-acetyl transferase (SEQ ID NO: 7).
- the method for producing acetin according to the present invention sequentially reacts glucose with glycerol-3-phosphate dehydrogenase and glycerol 3-dephosphorylase (DL-glycerol-3-phosphatase) to produce the glycerol.
- the step of obtaining may further include.
- the glycerol in the case of the glycerol, it can be obtained through biosynthesis of reacting with an enzyme from glucose, and as a specific example thereof, glucose is glycerol-3-phosphate dehydrogenase (GPD1) and glycerol 3-dephosphate (DL- glycerol-3-phosphatase, GPP2) may be sequentially reacted to obtain the glycerol, but is not limited thereto.
- GPD1 glycerol-3-phosphate dehydrogenase
- GPP2 glycerol 3-dephosphate
- the glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate can be chemically synthesized.
- the glycerol 3-phosphate dehydrogenase and glycerol 3-phosphatase are glycerol-3-phosphate dehydrogenase and glycerol.
- 3-Dephosphorylase (DL-glycerol-3-phosphatase) may be expressed in a microorganism having a gene encoding the glycerol 3-phosphate dehydrogenase (glycerol-3-phosphate dehydrogenase) and glycerol 3-detal in the microorganism
- the gene encoding phosphatase (DL-glycerol-3-phosphatase) may be intrinsic to the microorganism, and may be introduced into the microorganism from outside through genetic engineering technology. In this case, obtaining glycerol from glucose is within the microorganism. It may be made, but is not limited thereto.
- the glycerol 3-phosphate dehydrogenase may have different amino acid sequences depending on the type of microorganism, and glycerol phosphate (DHAP), an intermediate metabolite of the pathway in the microorganism, is glycerol 3 -Anything that can be converted to phosphoric acid (glycerol-3-phosphate, G3P) is sufficient.
- DHAP glycerol phosphate
- G3P glycerol-3-phosphate
- Saccharomyces cerevisiae it may be glycerol-3-phosphate dehydrogenase (GPD1) of Saccharomyces cerevisiae of SEQ ID NO: 14.
- GPD1 glycerol-3-phosphate dehydrogenase
- the glycerol 3-dephosphorylase (DL-glycerol-3-phosphatase) may have a different amino acid sequence depending on the type of microorganism, glycerol 3-phosphate (glycerol-3-phosphate, an intermediate metabolite of the pathway in the microorganism) G3P) is sufficient as long as it can be converted to glycerol, for example, Saccharomyces cerevisiae in the case of Saccharomyces cerevisiae , glycerol 3 in Saccharomyces cerevisiae in SEQ ID NO: 15 -Dephosphorylase (DL-glycerol-3-phosphatase, GPP2) may be, but is not limited thereto.
- the glucose forms glycerone phosphate (DHAP), which is an intermediate metabolite, through the glycolytic pathway (Embden-Meyerhof pathway), and the glycerone phosphate reacts with glycerol 3-phosphate dehydrogenase to convert to glycerol 3-phosphate. It may be, the glycerol 3-phosphate (glycerol-3-phosphate, G3P) is reacted with glycerol 3-dephosphorylase, glycerol (glycerol) can be prepared, but is not limited thereto.
- the present invention relates to a method for producing acetin comprising; culturing a microorganism expressing a gene encoding a first O-acetyl transferase (O-acetyl transferase) in a medium containing glycerol.
- O-acetyl transferase O-acetyl transferase
- the amino acid at the position corresponding to position 70 of the amino acid sequence of SEQ ID NO: 5 is aspartic acid (ASP)
- the amino acid at the position corresponding to position 84 is asparagine (ASN)
- ASN asparagine
- the amino acid at the corresponding position is histidine (HIS)
- the amino acid at the position corresponding to position 126 may be glutamic acid (GLU), but is not limited thereto.
- the amino acid at the position corresponding to position 15 of the amino acid sequence of SEQ ID NO: 5 is tyrosine (TYR) or phenylalanine (PHE)
- the amino acid at the position corresponding to position 26 is arginine (ARG ) Or glutamine (GLN)
- the amino acid at the position corresponding to position 30 is arginine (ARG) or lysine (LYS)
- the amino acid at the position corresponding to position 71 is tyrosine (TYR)
- the amino acid may be phenylalanine (PHE) or tyrosine (TYR), but is not limited thereto.
- the amino acid sequence may be 50% or more homologous to the amino acid sequence of SEQ ID NO: 5.
- the gene encoding the first O-acetyl transferase may be, for example, a gene encoding maltose O-acetyl transferase, and the gene encoding the maltose O-acetyl transferase may be, for example, Escherichia Gene encoding maltose O-acetyl transferase of Escherichia coli ( maa , SEQ ID NO: 16), gene encoding maltose O-acetyl transferase of Staphylococcus carnosus ( Sc-maa , sequence) Number 17), Gene encoding maltose O-acetyl transferase of Halalkalicoccus jeotgali ( Hj-maa , SEQ ID NO: 18), gene encoding maltose O-acetyl transferase of Lactobacillus brevis ( Lb -maa , SEQ ID NO: 19), a gene encoding the malto
- the microorganism can be cultured in a medium to express a first O-acetyl transferase, and the first O-acetyl transferase can catalyze the reaction of glycerol and acetyl-CoA to produce monoacetin, Diacetin can be produced by catalyzing the reaction of monoacetin and acetyl-CoA once more.
- the microorganism may be used without limitation as long as it is a microorganism expressing the first O-acetyl transfer enzyme, and may be, for example, a prokaryotic cell, a eukaryotic cell, or an isolated animal cell that can be cultured in a liquid medium.
- the microorganism may be, for example, bacteria, fungi, or a combination thereof.
- the bacteria can be Gram positive bacteria, Gram negative bacteria, or combinations thereof.
- Gram-negative bacteria can be of the genus Escherichia .
- Gram-positive bacteria may be of the genus Bacillus, genus Corynebacterium, lactic acid bacteria, or the like, or a combination thereof.
- the fungus may be Sacaramyces cerevisiae, Kluberomyces, etc., or a combination thereof.
- the microorganism may be specifically E. coli ( E.coli ), more specifically DH5 ⁇ , DH5 ⁇ (DE3), AceCo, BW25113, W3110 or MG1655.
- the microorganism is preferably DH5 ⁇ (DE3), BW25113, W3110 or MG1655 in terms of productivity among E. coli, and more preferably MG1655, but is not limited thereto.
- the microorganism may be a microorganism that naturally possesses a gene encoding a first O-acetyl transferase, and a microorganism that naturally retains the gene by biotechnical techniques such as transformation and transduction. It may be, but is not limited thereto.
- the transformation may be performed by introducing a recombinant plasmid into the microorganism, and the recombinant plasmid may be a gene encoding the first O-acetyl transferase in a vector, but is not limited thereto. It does not work.
- the vector may be, for example, pTrc99A (SEQ ID NO: 78), pET28a (SEQ ID NO: 79) or pSTV28 (SEQ ID NO: 77), preferably pSTV28, but is not limited thereto.
- the vector and the gene may be cut by a restriction enzyme and linked with a ligase, and then cloned, but is not limited thereto.
- the medium is a substance designed to maintain a nutritional state similar to the natural environment in which microorganisms generally survive and reproduce for the purpose of propagation or cultivation of the microorganisms. It is a liquid and solid substance made by adding all the nutrients necessary to grow, as well as glycerol. However, it may be a medium containing acetyl-CoA, but is not limited thereto.
- microorganism of the present invention may further express a gene encoding a second O-acetyl transferase that transfers an acetyl group to diacetin.
- the amino acid at the position corresponding to position 31 of the amino acid sequence of SEQ ID NO: 7 is cysteine (CYS) or leucine (LEU)
- the amino acid at the position corresponding to position 102 is phenylalanine (PHE) or Isoleucine (ILE)
- the amino acid at the position corresponding to position 143 is phenylalanine (PHE) or tyrosine (TYR)
- the amino acid at the position corresponding to position 166 is phenylalanine (PHE) or tyrosine (TYR)
- the amino acid at the position is valine (VAL), isoleucine (ILE), or leucine (LEU)
- the amino acid at the position corresponding to position 193 may be histidine (HIS), but is not limited thereto.
- the microorganism is cultured in the medium, and in addition to the first O-acetyl transferase, chloramphenicol-O-acetyl transferase or 2 O-acetyl transferase can be further expressed.
- the gene encoding the chloramphenicol-O-acetyl transferase (SEQ ID NO: 7) ( cat , SEQ ID NO: 24) may be present in a vector having a chloramphenicol resistance antibiotic marker, and the vector may be, for example, a pSTV28 vector, corresponding If the vector is a microorganism, the chloramphenicol-O-acetyl transferase can be expressed from the microorganism by introducing it without limitation.
- the vector is introduced into E. coli to express the chloramphenicol-O-acetyl transferase from E. coli. It is not limited.
- the gene encoding the second O-acetyl transferase is, for example, a gene encoding chloramphenicol-O-acetyl transferase ( cat , SEQ ID NO: 24), O-acetyl transferase of Bacillus cereus .
- Gene encoding ( Bc-Oat , SEQ ID NO: 25), gene encoding O-acetyl transferase of Pseudomonas aeruginosa ( Pa-Oat , SEQ ID NO: 26) or Clostridium acetobutylicum ( Clostridium) acetobutylicum ) may be a gene encoding O-acetyl transferase ( Ca-Oat , SEQ ID NO: 27), preferably a gene encoding O-acetyl transferase of Bacillus cereus , It is not limited.
- the amino acid sequence may have a homology to the amino acid sequence of SEQ ID NO: 7 of 32% or more.
- microorganism of the present invention may be that the gene encoding acetylesterase is attenuated or deleted.
- ester compound acetin
- ester-binding enzymes ester-binding enzymes
- the ester-binding enzyme that degrades the acetin may be, for example, acetylesterase.
- the acetylesterase In the case of a microorganism in which the gene encoding the acetylesterase is attenuated or deleted, the acetylesterase is not expressed, so that the production amount of acetin may be increased.
- the acetylesterase may have a different sequence depending on the type of microorganism, and the gene encoding the same may also have a different sequence.
- the gene ( aes ) encoding the acetylesterase in the microorganism is attenuated or deleted. May be For example, in the case of E. coli, the gene of SEQ ID NO: 30 encoding the acetylesterase of SEQ ID NO: 13 may be attenuated or deleted, but is not limited thereto.
- microorganism can be used without limitation as long as it is a microorganism that expresses the first O-acetyl transfer enzyme, and may be a microorganism within the aforementioned range, but is not limited thereto.
- the concentration of glycerol contained in the medium may be 3% (v / v) to 13% (v / v).
- the concentration of glycerol may be 5% (v / v) to 11% (v / v), but is not limited thereto.
- acetin When the microorganism is cultured in the medium having the glycerol concentration at the concentration of the cells, a large amount of acetin may be generated.
- both cell proliferation and acetin production may be reduced due to excessive osmotic pressure increase, and when the concentration is less than 3% (v / v), the concentration of the substrate Because of the low production of acetin may be low.
- the microorganism of the present invention further expresses a gene encoding glycerol 3-phosphate dehydrogenase and glycerol 3-phosphatase, and the medium is It may include glucose, but is not limited thereto.
- the microorganism expresses glycerol 3-phosphate dehydrogenase and glycerol 3-dephosphate, and glucose can be converted to glycerol phosphate through a corresponding pathway and then converted to glycerol through the enzymes.
- the gene (Gpd1) encoding the glycerol 3-phosphate dehydrogenase may have a different nucleotide sequence according to the type of microorganism, and glycerone phosphate, an intermediate metabolite of the pathway in the microorganism. It is sufficient as long as it can convert phosphate, DHAP) to glycerol-3-phosphate (G3P).
- the gene (Gpp2) encoding the glycerol 3-dephosphorylase (DL-glycerol-3-phosphatase) may have a different nucleotide sequence according to the type of microorganism, and glycerol 3-phosphate, an intermediate metabolite of the pathway in the microorganism It is sufficient if it can convert (glycerol-3-phosphate, G3P) to glycerol.
- Saccharomyces cerevisiae encodes glycerol 3-dephosphatase (DL-glycerol-3-phosphatase) of Saccharomyces cerevisiae of SEQ ID NO: 32 Gene ( Sc-gpp2 ), but is not limited thereto.
- the glycerol may be converted into an acetin complex by the above-described first O-acetyl transferase and chloramphenicol-O-acetyl transferase or second O-acetyl transferase.
- the present invention relates to a composition for preparing acetin comprising a microorganism expressing a gene encoding a first O-acetyl transferase.
- acetin When the composition is in contact with glycerol, acetin may be prepared in the above-described range and method.
- the amino acid at the position corresponding to position 70 of the amino acid sequence of SEQ ID NO: 5 is aspartic acid (ASP)
- the amino acid at the position corresponding to position 84 is asparagine (ASN)
- ASN asparagine
- the amino acid at the corresponding position is histidine (HIS)
- the amino acid at the position corresponding to position 126 may be glutamic acid (GLU), but is not limited thereto.
- the amino acid at the position corresponding to position 15 of the amino acid sequence of SEQ ID NO: 5 is tyrosine (TYR) or phenylalanine (PHE)
- the amino acid at the position corresponding to position 26 is arginine (ARG ) Or glutamine (GLN)
- the amino acid at the position corresponding to position 30 is arginine (ARG) or lysine (LYS)
- the amino acid at the position corresponding to position 71 is tyrosine (TYR)
- the amino acid may be phenylalanine (PHE) or tyrosine (TYR), but is not limited thereto.
- the amino acid sequence may be 50% or more homologous to the amino acid sequence of SEQ ID NO: 5.
- the first O-acetyl transferase may be maltose O-acetyl transferase, more specifically, Escherichia coli , Staphylococcus carnosus , Halalkalicoccus jeotgali , Lactobacillus brevis , Bacillus subtilis or Pseudomonas putida may be maltose O-acetyl transferase, preferably Bacillus sub It may be maltose O-acetyl transferase of Tilis ( Bacillus subtilis ), but is not limited thereto.
- the gene encoding the first O-acetyl transferase may be, for example, a gene encoding maltose O-acetyl transferase, and the gene encoding the maltose O-acetyl transferase may be, for example, Escherichia Gene encoding maltose O-acetyl transferase of Escherichia coli ( maa , SEQ ID NO: 16), gene encoding maltose O-acetyl transferase of Staphylococcus carnosus ( Sc-maa , sequence) Number 17), Gene encoding maltose O-acetyl transferase of Halalkalicoccus jeotgali ( Hj-maa , SEQ ID NO: 18), gene encoding maltose O-acetyl transferase of Lactobacillus brevis ( Lb -maa , SEQ ID NO: 19), a gene encoding the malto
- microorganism may further express a gene encoding a second O-acetyl transferase that transfers an acetyl group to diacetin.
- the amino acid at the position corresponding to position 31 of the amino acid sequence of SEQ ID NO: 7 is cysteine (CYS) or leucine (LEU)
- the amino acid at the position corresponding to position 102 is phenylalanine (PHE) or Isoleucine (ILE)
- the amino acid at the position corresponding to position 143 is phenylalanine (PHE) or tyrosine (TYR)
- the amino acid at the position corresponding to position 166 is phenylalanine (PHE) or tyrosine (TYR)
- the amino acid at the position is valine (VAL), isoleucine (ILE), or leucine (LEU)
- the amino acid at the position corresponding to position 193 may be histidine (HIS), but is not limited thereto.
- the gene encoding the chloramphenicol-O-acetyl transferase may be present in a vector having a chloramphenicol resistant antibiotic marker, and may be, for example, a pSTV28 vector, but is not limited thereto.
- Genes encoding the second O-acetyl transferase include, for example, O-acetyl transfer of Bacillus cereus , Pseudomonas aeruginosa or Clostridium acetobutylicum . It may be a gene encoding an enzyme, preferably a gene encoding O-acetyl transferase of Bacillus cereus , but is not limited thereto.
- the amino acid sequence may have a homology to the amino acid sequence of SEQ ID NO: 7 of 32% or more.
- microorganism may be attenuated or deleted gene encoding acetylesterase.
- ester compound acetin
- ester-binding enzymes ester-binding enzymes
- the ester-binding enzyme that degrades the acetin may be, for example, acetylesterase.
- acetylesterase In the case of a microorganism in which the gene encoding the acetylesterase ( aes ) is attenuated or deleted, acetylesterase is not expressed, thereby increasing the production of acetin.
- the acetylesterase may have a different sequence depending on the type of microorganism, and the gene encoding the same may have a different sequence, and the gene encoding the acetylesterase in the microorganism may be attenuated or deleted.
- the gene of SEQ ID NO: 30 encoding the acetylesterase of SEQ ID NO: 13 may be attenuated or deleted, but is not limited thereto.
- the microorganism is the same as described above, but may be specifically E. coli , more specifically, DH5 ⁇ , DH5 ⁇ (DE3), AceCo, BW25113, W3110 or MG1655, preferably MG1655. However, it is not limited thereto.
- microorganism may further express a gene encoding glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate (DL-glycerol-3-phosphatase).
- the microorganism expresses glycerol 3-phosphate dehydrogenase and glycerol 3-dephosphate, and glucose can be converted to glycerol through a corresponding pathway and the enzymes.
- the gene (Gpd1) encoding the glycerol 3-phosphate dehydrogenase may have a different nucleotide sequence according to the type of microorganism, and glycerone phosphate, an intermediate metabolite of the pathway in the microorganism. It is sufficient as long as it can convert phosphate, DHAP) to glycerol-3-phosphate (G3P).
- the gene (Gpp2) encoding the glycerol 3-dephosphorylase (DL-glycerol-3-phosphatase) may have a different nucleotide sequence according to the type of microorganism, and glycerol 3-phosphate, an intermediate metabolite of the pathway in the microorganism It is sufficient if it can convert (glycerol-3-phosphate, G3P) to glycerol.
- Saccharomyces cerevisiae encodes glycerol 3-dephosphatase (DL-glycerol-3-phosphatase) of Saccharomyces cerevisiae of SEQ ID NO: 32 Gene ( Sc-gpp2 ), but is not limited thereto.
- the glycerol may be converted into an acetin complex by the aforementioned O-acetyl transferase and chloramphenicol-O-acetyl transferase.
- subtilis - pMDT3 pTrc99A vector containing oat from B. cereus and maa from B. subtilis - pMDT4 pTrc99A vector containing oat from P. aeruginosa and maa from B. subtilis - pMDT5 pTrc99A vector containing oat from C. acetobutylicum and maa from B. subtilis - pMDT6 pTrc99A vector containing oat from M. abscessus and maa from B. subtilis - pMDT7 pTrc99A vector containing oat from L. brevis and maa from B.
- subtilis - pMDT8 pMDT2 containing gpd1 and gpp2 from S. cerevisiae - Strains MG1655 E. coli K-12; F - lambda -, ilvG -, rfb-50, rph-1 ATCC700926 DH5 ⁇ E.
- Candidate genes include galAtoside O-acetyltransferase, maltose O-acetyltransferase (SEQ ID NO: 1), serine acetyltransferase, O-acetyltransferase WecH, and lacA (SEQ ID NO: 80) , maa (SEQ ID NO: 16) , cysE (which encodes arylamine N-acetyltransferase, respectively) .
- PCR primers used at this time were Ec-lacA-F (SEQ ID NO: 33) / Ec-lacA-R (SEQ ID NO: 34), Ec-maa-F (SEQ ID NO: 47) / Ec-maa-R (SEQ ID NO: 48), Ec-cysE-F (SEQ ID NO: 35) / Ec-cysE-R (SEQ ID NO: 36), Ec-wecH-F (SEQ ID NO: 44) / Ec-wecH-R (SEQ ID NO: 45), Ec-nhoA-F ( SEQ ID NO: 42) / Ec-nhoA-R (SEQ ID NO: 43), Ec-yjgm-F (SEQ ID NO: 37) / Ec-yjgM-R (SEQ ID NO: 38), Ec-yjaB-F (SEQ ID NO: 39) / Ec -yjaB-R (SEQ ID NO: 40), Ec-yiiD-F (SEQ ID NO: 41)
- the PCR reaction product was cloned into pTrc99A vector using BamHI and XbaI.
- E. coli DH5 ⁇ was transformed with the plasmids pDM1-pDM8 thus constructed to make recombinant strains DH-MD1 to DH-MD8, and monoacetin and diacetin production were analyzed (FIG. 3).
- the seed culture was shaken for about 12 hours at 37 ° C using LB complex medium (10 g tryptone, 5 g yeast extract and 10 g sodium chloride per liter).
- This culture includes M9 minimal medium (Na 2 HPO 4 ⁇ 7H 2 O, 12.8 g / L; KH 2 PO 4 , 3g / L; NaCl, 0.5 g / L; NH 4 Cl, 1 g / L; MgSO 4 , 1mM CaCl 2 , 100 mM), 5 g / L yeast extract and 2% (v / v) glycerol were added, and the mixture was cultured at 37 ° C. and shaking speed of 250 rpm for 48 hours.
- M9 minimal medium Na 2 HPO 4 ⁇ 7H 2 O, 12.8 g / L; KH 2 PO 4 , 3g / L; NaCl, 0.5 g / L; NH 4 Cl, 1 g / L; MgSO 4 , 1mM Ca
- acetin compounds were performed by GC (Agilent Technologies 7890A, USA) and GC-MS (GC-MS) equipped with HP-INNOVAX column (19091N-133, 30 m in length, 0.250 mm in internal diameter and 0.25 ⁇ m film thicknesses). -QP2010, SHIMADZU, Japan). Acetin standard compounds were purchased from Sigma (USA). The acetin complex produced in this culture was extracted from the culture solution using ethyl acetate solvent, and 1 ⁇ L of the extracted sample was injected into GC or GC-MS.
- the oven temperature of the GC starts at 50 ° C and reaches 90 ° C at a rate of 20 ° C / min, up to 150 ° C at a rate of 15 ° C / min, to 190 ° C at a rate of 20 ° C / min, and at a rate of 15 ° C / min Raise to 230 ° C and hold for 2 minutes.
- the temperature of the flame ion detector (FID) was maintained at 280 ° C. Analysis results according to the analysis method are shown in FIG. 5.
- the microorganism-derived genes were synthesized according to the availability of E. coli codons in GenScript (USA) to optimize expression in the host E. coli.
- the synthesized genes are Sc-maa-F (SEQ ID NO: 49) / Sc-maa-R (SEQ ID NO: 50), Hj-maa-F (SEQ ID NO: 51) / Hj-maa-R (SEQ ID NO: 52), Lb -maa-F (SEQ ID NO: 53) / Lb-maa-R (SEQ ID NO: 54), Pp-maa-F (SEQ ID NO: 55) / Pp-maa-R (SEQ ID NO: 56), Bs-maa-F (SEQ ID NO: Sc-maa (SEQ ID NO: 17), Hj-maa (SEQ ID NO: 18), Lb-maa (SEQ ID NO: 19) obtained by amplification using PCR primers of No.
- pTrc99A SEQ ID NO: 78
- pET28a SEQ ID NO: 79
- pSTV28 SEQ ID NO: 77
- the pMD13, pMD14, and pMDT1) plasmids were cloned into the vector to construct recombinant E. coli DH-MD13, DH-MD14, and DH-MDT1 transformed with the plasmids.
- coli DH5 ⁇ (DE3) was used as a transforming host strain of pMD14 having a T7 promoter.
- the DH5 ⁇ (DE3) strain was made from E. coli DH5 ⁇ using the ⁇ DE3 Lysogenization Kit from Novagen (USA).
- monoacetin and diacetin productivity were not only highest, but also triacetin production was observed (FIG. 4).
- CAT chloramphenicol-O-acetyltransferase
- CAT is known to transfer acetyl groups to various substrates due to its extensive substrate specificity.
- the pMDT2 plasmid introduced before the Bs-maa gene of the pMD13 plasmid to enhance the expression of the CAT enzyme gene ( cat , SEQ ID NO: 24) that produces triacetin through additional acetyl group transfer to monoacetin and diacetin It was constructed (Fig. 6).
- the cat gene was PCR amplified from pSTV28 using PCR primers of Cat-F (SEQ ID NO: 60) / Cat-R (SEQ ID NO: 61), cut with SacI and BamHI and introduced into the corresponding restriction enzyme site of pMD13.
- the combined production of monoacetin, diacetin, and triacetin and the ratio of triacetin of the DH-MDT2 production strain transformed with pMDT2 significantly increased compared to the DH-MDT1 strain.
- the culture method and the analysis method are the same as in Example 1.
- a BLAST search was performed using the amino acid sequence of the CAT enzyme.
- five highly homologous O-acetyltransferases (OAT, Bc-OAT (SEQ ID NO: 8), Pa-OAT (SEQ ID NO: 9), Ca-OAT (SEQ ID NO: 10), Ma-OAT (SEQ ID NO: 11), Lb-OAT (SEQ ID NO: 12)) derived from Bacillus cereus, Pseudomonas aeruginosa, Clostridium acetobutylicum, Mycobacterium abscessus, Lactobacillus brevis , and the use of E. coli from GenScript Company (USA) to optimize expression in the host E. coli Synthesis was made in accordance with.
- Bc-Oat SEQ ID NO: 25
- Pa-Oat SEQ ID NO: 26
- Ca-Oat SEQ ID NO: 27
- Ma-Oat SEQ ID NO: 28
- Lb-Oat SEQ ID NO: 29
- Bc.Oat-F SEQ ID NO: 64
- Bc.Oat-R SEQ ID NO: 65
- Pa.Oat-F SEQ ID NO: 72
- Pa.Oat-R SEQ ID NO: 73
- Oat-F (SEQ ID NO: 66) /Ca.Oat-R (SEQ ID NO: 67), Ma.Oat-F (SEQ ID NO: 70) /Ma.Oat-R (SEQ ID NO: 71), Lb.Oat-F (SEQ ID NO: 68) /Lb.Oat-R (SEQ ID NO: 69) was amplified using PCR primers.
- the fragments of each gene amplified in this way were connected to the pMD13-based plasmid skeleton and the HiFi DNA assembly method to construct plasmids pMDT3 to pMDT7 (FIG. 7).
- HiFi DNA assembly was used by HiNE DNA assembly kit from NEB company (USA), and the pMD13 based plasmid backbone was composed of pMD13 as a template, Trc-Bs.maa-F (SEQ ID NO: 62) and Trc-Bs.maa-R ( SEQ ID NO: 63) was obtained by performing PCR with PCR primers. The production amount of the acetin complex of the recombinant strains DH-MDT2 to DH-MDT7 transformed with pMDT3 to pMDT7 plasmids was compared (FIG. 7).
- E. coli DH5 ⁇ was used as a host in the previous examples.
- Recombinant Escherichia coli DH-MDT2, AC-MDT2, BW-MDT2, W3 transformed E. coli AceCo, BW25113, W3110, and MG1655 with plasmid pMDT2 as a host in order to compare the productivity of acetin compound according to the type of E. coli -MDT2 and MG-MDT2 were cultured to compare the productivity of the acetin complex (FIGS. 8A and 8B).
- the production amount of the acetin composite increased as the amount of glycerol as a starting substrate increased, but in the case of adding more than 15% of glycerol, both the growth of the cells and the production of acetin were decreased due to the effect of excessive osmotic pressure.
- ester compound acetin
- ester-binding enzymes SEQ ID NO: 13
- ae acetylesterase enzyme gene
- the Aes gene fragment was obtained by PCR amplification using Ec-aes-F (SEQ ID NO: 74) and Ec-aes-R (SEQ ID NO: 75) as primers for the chromosome of E. coli MG1655 as a template, and was added to pTrc99A with BamHI and SalI restriction enzymes. Plasmid pTAes were constructed by cloning. To observe the degradation of triacetin by the Aes enzyme, a recombinant strain BW-Empty and BW-Aes transformed with E.
- coli BW25113 with an empty vector pTrc99A and plasmid pTAes was prepared, and medium containing 15 g / L of triacetin standard compound was added. Were cultured in. The culture conditions were performed in the same manner as in the production conditions of the acetin complex used in the above examples (Fig. 9A, 9B).
- the gene aes is Defective JW0465 and wild-type strain BW25113 were transformed with pMDT2 to prepare recombinant strains BW-MDT2 and BW-MDT2 ( Daes), comparing acetin complex production and cell growth in these recombinant strains (FIG. 9C, 9D).
- the JW0465 strain is a strain in which the aes gene is deleted from the BW25113 strain, and is pre-sold by NBRP (NIG, Japan).
- the substrate was cultured in a 2YT composite medium (16 g tryptone, 10 g yeast extract, and 5 g sodium chloride per liter) containing 10% (v / v) of glycerol, and other culture and analysis conditions were the same as in the above examples. Was carried out.
- glycerone phosphate As shown in FIG. 2, glycerone phosphate (DHAP), an intermediate metabolite of the corresponding pathway (Embden-Meyerhof pathway), is glycerol-3-phosphate dehydrogenase and glycerol 3-dephosphoric acid. It can be converted to glycerol via glycerol 3-phosphate by an enzyme (DL-glycerol-3-phosphatase). Therefore, the production of an acetin complex based on glucose is also possible through the additional overexpression of glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate.
- DHAP glycerone phosphate
- Embden-Meyerhof pathway glycerol-3-phosphate dehydrogenase and glycerol 3-dephosphoric acid. It can be converted to glycerol via glycerol 3-phosphate by an enzyme (DL-glycerol-3-phosphatase). Therefore, the production of an
- Gpd1 SEQ ID NO: 14
- Gpp2 SEQ ID NO: 15
- FIG. 10 shows the structure of the plasmid pMDT8 produced by cloning the glycerol production genes Sc-gpd1 (SEQ ID NO: 31) and Sc-gpp2 (SEQ ID NO: 32) derived from Sacaramyces cerevisiae for production of the acetin complex from glucose into the pMDT2 plasmid.
- Sc-gpp2-F SEQ ID NO: 22
- Sc-gpp2-R SEQ ID NO: 23
- Plasmid pMDT8 was constructed by introducing into the corresponding restriction enzyme site. Cultivation was performed for 48 hours by inoculating the recombinant strains DH-MDT2 and DH-MDT8 in a 2YT complex medium to which glucose 1% (w / v) was added instead of glycerol. Other culture and analysis conditions were performed in the same manner as in the above example.
- the acetin complex was produced only in the DH-MDT8 strains in which the genes Sc-gpd1 and Sc-gpp2 were expressed, and the cell growth and the pH of the culture were similar.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
본 발명은 O-아세틸 전이효소를 이용해서 글리세롤에 아세틸기를 전이시켜서 모노아세틴, 다이아세틴, 트리아세틴을 생물학적으로 제조하는 방법에 관한 것으로서, 지속가능하고 환경오염을 유발하지 않으며 안전하고 더 좋은 품질의 아세틴을 얻을 수 있는 제조 방법 및 제조용 조성물에 관한 것이다.
Description
본 발명은 아세틴 화합물의 제조 방법 및 아세틴 제조용 조성물에 관한 것이다.
아세틴(acetins)은 글리세롤(glycerol)의 수산기(-OH)에 초산기(acetyl group)가 에스터(ester) 결합을 하고 있는 물질로, 결합된 초산기의 수에 따라서 1 개가 붙은 모노아세틴(monoacetin), 2 개가 붙은 다이아세틴(diacetin), 3 개가 붙은 트리아세틴(triacetin)으로 구분한다. 트리아세틴은 글리세린 트리아세테이트(glycerin triacetate) 또는 트리글리세라이드 1,2,3-트라아세톡시프로페인(triglyceride 1,2,3-triacetoxypropane)으로도 알려져 있다.
아세틴은 향료 용매와 습윤제 등의 식품첨가물로 사용되고, 제약산업에서 보습제, 가소제 및 용제로 사용된다. 트리아세틴은 또한 가솔린의 엔진 노킹(engine knocking)을 줄이는 항노크제(antiknock agent)와 바이오디젤의 저온 및 점도 특성을 개선 할 수 있는 연료 첨가제로 사용될 수 있다. 바이오디젤 생산공정에서 다량의 부산물로 발생하는 폐글리세롤을 이용해서 바이오디젤의 연료첨가제로 활용될 수 있는 아세틴을 만드는 것은 최근 바이오리파이너리 산업분야에서 화두가 되고 있는 폐기물 또는 부산물의 발생을 줄이거나 재활용을 하는 제로-웨이스트(Zero-Wastes)의 개념을 실현할 수 있는 기술을 제공하는 것이다. 5 대 담배 회사가 발표 한 1994년 보고서에서 따르면 트리아세틴은 담배 제조 첨가물의 하나로 담배필터 제조 공정의 가소제로도 사용된다. 또한 긴 우주비행 임무를 수행하는 우주비행사들의 인공 우주식품에서 비행사들에게 필요한 에너지의 절반 이상을 공급하는 중요한 재료로 활용되고 있다. 미국 식품의약국(FDA)은 매우 안전한 식품첨가물(Generally Recognized as Safe: GRAS)로 인정하고 있다.
한편, 아세틴 물질은 점성을 갖는 무색, 무취의 액체이다. 기존의 아세틴 물질은 글리세롤에 초산 또는 무수초산을 화학반응을 통해 결합시킨 인공 화학 합성 물질이다.
기존에 생물학적으로 아세틴을 제조하는 방식이 없었으나, 생물학적인 방법을 통해서 아세틴 물질을 생산함으로써 지속가능하고 환경오염을 유발하지 않으며 안전하고 더 좋은 품질의 아세틴 물질의 생산 방법에 대한 요구가 꾸준히 있었다.
본 발명자들은 아세틴 화합물들은 글리세롤 또는 글리세롤의 유도체들에 초산기를 에스테르화 반응을 통해서 결합시키는 효소들에 의해서 생물학적인 방식으로 제조될 수 있다는 것을 밝혀냈고, 자연계에 글리세롤을 탄소원으로 이용하는 장내세균(엔테로박테리아속, Enterobacteriaceae)의 일부에서 미량의 모노아세틴이 생성되는 것 또한 밝혀내었다.
이에 따라 본 발명자들은 글리세롤 또는 포도당을 출발기질로 해서 모노아세틴, 다이아세틴, 트리아세틴을 생산할 수 있는 재조합 미생물을 만들어서, 본 발명을 완성하기에 이르렀다(도 1, 도 2).
본 발명은 아세틴 화합물의 생물학적 제조 방법 및 아세틴 화합물의 제조용 조성물을 제공하는 것을 목적으로 한다.
1. 제1 O-아세틸 전이효소(O-acetyl transferase) 존재 하에 아세틸-CoA와 글리세롤을 반응시켜 모노아세틴 또는 다이아세틴을 얻는 단계;를 포함하는 아세틴의 제조 방법.
2. 위 1에 있어서, 상기 제1 O-아세틸 전이효소는 말토오스 O-아세틸 전이효소인, 아세틴의 제조 방법.
3. 위 1에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 70에 상응하는 위치의 아미노산이 아스파르트산(ASP)이고, 위치 84에 상응하는 위치의 아미노산이 아스파라긴(ASN)이고, 위치 114에 상응하는 위치의 아미노산이 히스티딘(HIS)이고, 위치 126에 상응하는 위치의 아미노산이 글루탐산(GLU)인, 아세틴의 제조 방법.
4. 위 3에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 15에 상응하는 위치의 아미노산이 티로신(TYR) 또는 페닐알라닌(PHE)이고, 위치 26에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 글루타민(GLN)이고, 위치 30에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 리신(LYS)이고, 위치 71에 상응하는 위치의 아미노산이 티로신(TYR)이고, 위치 82에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 티로신(TYR)인 아세틴의 제조 방법.
5. 위 1에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 1 내지 6 중 어느 하나의 서열로 이루어진 것인, 아세틴의 제조 방법.
6. 위 1에 있어서, 제2 O-아세틸 전이효소 존재 하에 상기 반응 생성물인 다이아세틴을 아세틸-CoA와 반응시켜 트리아세틴을 얻는 단계;를 더 포함하는, 아세틴의 제조 방법.
7. 위 6에 있어서, 상기 제2 O-아세틸 전이효소는 서열번호 7의 아미노산 서열의 위치 31에 상응하는 위치의 아미노산이 시스테인(CYS) 또는 류신(LEU)이고, 위치 102에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 이소류신(ILE)이고, 위치 143에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 166에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 170에 상응하는 위치의 아미노산이 발린(VAL), 이소류신(ILE), 또는 류신(LEU)이고, 위치 193에 상응하는 위치의 아미노산이 히스티딘(HIS)인 아세틴의 제조 방법.
8. 위 6에 있어서, 상기 제2 O-아세틸 전이효소는 서열번호 7 내지 10 중 어느 하나의 서열로 이루어진 것인, 아세틴의 제조 방법.
9. 제1 O-아세틸 전이효소(O-acetyl transferase)를 코딩하는 유전자를 발현하는 미생물을 글리세롤을 포함하는 배지 중에서 배양하는 단계;를 포함하는 아세틴의 제조 방법.
10. 위 9에 있어서, 상기 제1 O-아세틸 전이효소는 말토오스 O-아세틸 전이효소인, 아세틴의 제조 방법.
11. 위 9에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 70에 상응하는 위치의 아미노산이 아스파르트산(ASP)이고, 위치 84에 상응하는 위치의 아미노산이 아스파라긴(ASN)이고, 위치 114에 상응하는 위치의 아미노산이 히스티딘(HIS)이고, 위치 126에 상응하는 위치의 아미노산이 글루탐산(GLU)인, 아세틴의 제조 방법.
12. 위 9에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 15에 상응하는 위치의 아미노산이 티로신(TYR) 또는 페닐알라닌(PHE)이고, 위치 26에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 글루타민(GLN)이고, 위치 30에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 리신(LYS)이고, 위치 71에 상응하는 위치의 아미노산이 티로신(TYR)이고, 위치 82에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 티로신(TYR)인, 아세틴의 제조 방법.
13. 위 9에 있어서, 상기 제1 O-아세틸 전이효소를 코딩하는 유전자는 서열번호 16 내지 21의 서열 중 어느 하나의 서열로 이루어진 것인, 아세틴의 제조 방법.
14. 위 9에 있어서, 상기 미생물은 다이아세틴에 아세틸기를 전이하는 제2 O-아세틸 전이효소를 코딩하는 유전자를 더 발현하는 것인, 아세틴의 제조 방법.
15. 위 14에 있어서, 상기 제2 O-아세틸 전이효소는 서열번호 7의 아미노산 서열의 위치 31에 상응하는 위치의 아미노산이 시스테인(CYS) 또는 류신(LEU)이고, 위치 102에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 이소류신(ILE)이고, 위치 143에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 166에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 170에 상응하는 위치의 아미노산이 발린(VAL), 이소류신(ILE), 또는 류신(LEU)이고, 위치 193에 상응하는 위치의 아미노산이 히스티딘(HIS)인, 아세틴의 제조 방법.
16. 위 14에 있어서, 상기 제2 O-아세틸 전이효소를 코딩하는 유전자는 서열번호 24 내지 27 중 어느 하나의 서열로 이루어진 것인, 아세틴의 제조 방법.
17. 위 9에 있어서, 상기 미생물은 아세틸에스테라제(acetylesterase)를 코딩하는 유전자가 감쇄 또는 결실된 것인, 아세틴의 제조 방법.
18. 위 9에 있어서, 상기 미생물은 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)를 코딩하는 유전자를 더 발현하고, 상기 배지는 포도당을 포함하는 것인, 아세틴의 제조 방법.
19. 제1 O-아세틸 전이효소(O-acetyl transferase)를 코딩하는 유전자를 발현하는 미생물을 포함하는 아세틴 제조용 조성물.
20. 위 19에 있어서, 상기 제1 O-아세틸 전이효소는 말토오스 O-아세틸 전이효소인, 아세틴 제조용 조성물.
21. 위 19에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 70에 상응하는 위치의 아미노산이 아스파르트산(ASP)이고, 위치 84에 상응하는 위치의 아미노산이 아스파라긴(ASN)이고, 위치 114에 상응하는 위치의 아미노산이 히스티딘(HIS)이고, 위치 126에 상응하는 위치의 아미노산이 글루탐산(GLU)인, 아세틴 제조용 조성물.
22. 위 19에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 15에 상응하는 위치의 아미노산이 티로신(TYR) 또는 페닐알라닌(PHE)이고, 위치 26에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 글루타민(GLN)이고, 위치 30에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 리신(LYS)이고, 위치 71에 상응하는 위치의 아미노산이 티로신(TYR)이고, 위치 82에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 티로신(TYR)인, 아세틴 제조용 조성물.
23. 위 19에 있어서, 상기 제1 O-아세틸 전이효소를 코딩하는 유전자는 서열번호 16 내지 21 중 어느 하나의 서열로 이루어진 것인, 아세틴 제조용 조성물.
24. 위 19에 있어서, 상기 미생물은 다이아세틴에 아세틸기를 전이하는 제2 O-아세틸 전이효소를 코딩하는 유전자를 더 발현하는 것인, 아세틴 제조용 조성물.
25. 위 24에 있어서, 상기 제2 O-아세틸 전이효소는 서열번호 7의 아미노산 서열의 위치 31에 상응하는 위치의 아미노산이 시스테인(CYS) 또는 류신(LEU)이고, 위치 102에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 이소류신(ILE)이고, 위치 143에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 166에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 170에 상응하는 위치의 아미노산이 발린(VAL), 이소류신(ILE), 또는 류신(LEU)이고, 위치 193에 상응하는 위치의 아미노산이 히스티딘(HIS)인, 아세틴 제조용 조성물.
26. 위 24에 있어서, 상기 제2 O-아세틸 전이효소를 코딩하는 유전자는 서열번호 24 내지 27 중 어느 하나의 서열로 이루어진 것인, 아세틴 제조용 조성물.
27. 위 19에 있어서, 상기 미생물은 아세틸에스테라제(acetylesterase)를 코딩하는 유전자가 감쇄 또는 결실된 것인, 아세틴 제조용 조성물.
28. 위 19에 있어서, 상기 미생물은 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)를 코딩하는 유전자를 더 발현하는 것인, 아세틴 제조용 조성물.
본 발명에 따르면 생물학적인 방법을 통해서 아세틴 물질을 제조함으로써 지속가능하고 환경오염을 유발하지 않으며 안전하고 더 좋은 품질의 아세틴 물질을 제조하는 방법을 제공한다.
도 1은 세포 내로 유입된 글리세롤이 모노아세틴, 다이아세틴, 트리아세틴으로 전환되는 경로를 나타낸 것이다.
도 2는 세포 내로 유입된 포도당이 모노아세틴, 다이아세틴, 트리아세틴으로 전환되는 경로를 나타낸 것이다.
도 3의 (A)는 모노아세틴과 다이아세틴을 생산하기 위해서 글리세롤에 아세틸기를 전이할 수 있는 대장균 내의 O-acetyltransferases 후보 유전자들을 선별하고 각 유전자들을 pTrc99A 발현벡터에 클로닝해서 만들어진 플라스미드 pMD1 - pMD8의 구조 도면 이고, (B)는 (A)의 플라스미드들로 형질전환 된 재조합 대장균 DH-MD1 - DH-MD8에서의 모노아세틴과 다이아세틴 생산성을 비교한 도면이며(DH-MD0는 공벡터인 pTrc99A로 형질전환 된 재조합 대장균을 나타냄.), (C)는 대장균 maltose O-acetyltransferase (Maa)의 구조와 아미노산 서열을 근거로 글리세롤에 아세틸기를 전이할 것으로 추정되는 다른 미생물 유래의 후보 유전자들을 선별하고 각 유전자들을 pTrc99A 발현벡터에 클로닝해서 만들어진 플라스미드 pMD9 - pMD13의 구조 도면이고, (D)는 이 플라스미드들로 형질전환 된 재조합 대장균 DH-MD9 - DH-MD13에서의 모노아세틴과 다이아세틴 생산성을 비교한 도면이다.
도 4의 (A)는 모노아세틴과 다이아세틴 생산성이 가장 좋았던
B. subtilis의 Maa 유전자(
Bs-maa)를 pTrc99A, pET28a, pSTV28 발현벡터에 클로닝해서 만들어진 플라스미드 pMD13, pMD14, pMDT1의 구조 도면이고, (B)는 상기 플라스미드들로 형질전환 된 재조합 대장균 DH-MD13, DH-MD14, DH-MDT1에서의 모노아세틴, 다이아세틴, 트리아세틴 생산성을 비교한 도면이며, (C)는 각 재조합 대장균의 균체 증식을 비교한 도면이다.
도 5의 (A)는 모노아세틴(1), 다이아세틴(2), 트리아세틴(3)의 혼합 표준화합물(STD)과 재조합 대장균 DH-MD06, DH-MD8, DH-MDT1의 배양액을 에틸아세테이트로 추출한 후 GC로분석한 가스크로마토그램 도면이고, (B)는 GC-MS로 각 시료에서 얻어진 모노아세틴, 다이아세틴, 트리아세틴의 질량분석을 표준화합물(STD)의 질량분석과 비교한 도면이다.
도 6의 (A)는 다이아세틴을 트리아세틴으로 전환하는 chloramphenicol-O-acetyltransferase 유전자(
cat)와
B. subtilis의 Maa 유전자(
Bs-maa)를 pTrc99A 발현벡터에 클로닝해서 만들어진 플라스미드 pMDT2의 구조 도면이고, (B)와 (C)는 상기 플라스미드로 형질전환 된 재조합 대장균 DH-MDT2의 아세틴 복합물의 생산성과 조성을 대조구인 DH-MDT1와 비교한 도면이며, (D)는 재조합 대장균 DH-MDT2에서의 아세틴 복합물의 배양시간에 따른 생산 변화를 나타낸 도면이다.
도 7의 (A)는 Chloramphenicol O-acetyltransferase의 구조와 아미노산 서열을 근거로 다이아세틴에 아세틸기를 전이할 것으로 추정되는 후보 유전자들을 다양한 미생물들에서 발견하고 플라스미드 pMD13에 클로닝 해서 만들어진 플라스미드 pMDT2 - pMDT7의 구조 도면이고, (B)는 상기 플라스미드로 형질전환 된 재조합균주 DH-MDT2 - DH-MDT7의 아세틴 복합물 생산량 비교한 도면이며, (C)는 상기 재조합 균주들의 균체 증식을 비교한 도면이다.
도 8은 대장균 균종과 글리세롤 농도에 따른 아세틴 복합물의 생산성을 비교한 것으로서, (A)는 대장균 DH5α, AceCo, BW25113, W3110, MG1655를 플라스미드 pMDT2로 형질전환 한 재조합 대장균 DH-MDT2, AC-MDT2, BW-MDT2, W3-MDT2, MG-MDT2를 배양해서 아세틴 복합물 생산성을 비교한 것이며, (B)는 상기 재조합 대장균들의 균체 증식을 비교한 것이고, (C)는 재조합 균주 MG-MDT2의 배양에서 글리세롤 농도에 따른 아세틴 복합물 생산성을 나타낸 것이며, (D)는 상기 균주의 글리세롤 농도에 따른 균체 증식을 비교한 것이다.
도 9 는 대장균 BW25113에서 acetylesterase 유전자(
aes)의 증폭 및 결손을 통한 아세틴 화합물의 변화를 관찰한 것으로서, (A)와 (B)는 대장균 BW25113에 pTrc99A와 pTAes로 각각 형질전환 한 재조합균주 BW-Empty와 BW-Aes를 15 g/L의 트리아세틴 표준화합물이 첨가된 2YT 배지에 접종하고 트리아세틴의 분해 양상을 관찰한 것이며, (C)는 BW25113과
aes 유전자가 결손된 JW0465 균주를 플라스미드 pMDT2로 형질전환 시킨 재조합균주 BW-MDT2와 BW-MDT2
(Daes)를 10% (v/v) 글리세롤이 첨가된 2YT 배지에서 배양해서 아세틴 복합물 생산성을 비교한 것이며, (D)는 상기 재조합 균주들의 균체 증식을 비교한 것이다.
도 10의 (A)는 포도당으로부터 아세틴 복합물 생산을 위해서 사카라마이세스 세레비지애 유래 글리세롤 생산 유전자인
Sc-gpd1과
Sc-gpp2를 pMDT2 플라스미드에 클로닝해서 만들어진 플라스미드 pMDT8의 구조 도면이고, (B)는 상기 플라스미드로 형질전환 된 재조합 대장균 DH-MDT8의 포도당으로부터의 아세틴 복합물 생산, (C)는 상기 대장균들의 균체 증식, (D)는 배양액의 pH변화를 나타낸 것이다.
도 11은 BsMAA 말토오스 아세틸전이효소의 기질 결합 부위 구조를 도시한 것이다. 글리세롤 아세틸화 반응의 핵심잔기는 아미노산 서열의 위치 70의 아스파르트산(ASP), 위치 84의 아스파라긴(ASN), 위치 114의 히스티딘(HIS), 위치 126의 글루탐산(GLU) 이다.
도 12는 Bacillus subtilis MAA-like enzymes의 서열 정렬(alignment) 결과이다.
도 13은 CAT 클로람페니콜-O-아세틸 전이효소(Chloramphenicol-O-acetyltransferase)의 기질결합 부위 구조를 도시한 것이다. 다이아세틴 아세틸화 반응의 핵심잔기는 아미노산 서열의 위치 102의 페닐알라닌(PHE), 위치 143의 페닐알라닌(PHE), 위치 193의 히스티딘(HIS)이다. 서열의 위치 102와 143의 잔기는 유사한 성질의 아미노산인 이소류신(ILE)과 티로신(TYR)으로 각각 대체될 수 있다. 이것은 제2 O-아세틸 전이효소들의 아미노산 서열 정렬 비교 도면 14에서 알 수 있다.
도 14는 CAT-like enzymes의 서열 정렬 결과이다.
이하 본 발명을 상세히 설명한다.
본 발명은 제1 O-아세틸 전이효소(O-acetyl transferase) 존재 하에 아세틸-CoA와 글리세롤을 반응시켜 모노아세틴 또는 다이아세틴을 얻는 단계;를 포함하는 아세틴의 제조 방법에 관한 것이다.
상기 제1 O-아세틸 전이효소는 상기 아세틸-CoA에서 O-아세틸을 글리세롤로 전이시킬 수 있고, 예를 들면 말토오스 O-아세틸 전이효소일 수 있으나, 이에 제한되는 것은 아니다.
상기 제1 O-아세틸 전이효소는 생물로부터 유래된 것이거나, 합성된 것일 수 있다.
또한, 상기 제1 O-아세틸 전이효소는 제1 O-아세틸 전이효소를 코딩하는 유전자를 가진 미생물에서 발현되는 것일 수 있고, 상기 미생물 내 제1 O-아세틸 전이효소를 코딩하는 유전자는 해당 미생물에 내재된 것일 수 있고, 유전자공학기술로 외부에서 미생물 내로 도입된 것일 수 있으며, 이 경우 글리세롤과 아세틸-CoA는 미생물 내에서 반응되는 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 아세틴은 모노아세틴(monoacetin), 다이아세틴(diacetin) 또는 트리아세틴(triacetin)을 포함할 수 있고, 이들의 복합물일 수 있다.
상기 제1 O-아세틸 전이효소는 글리세롤과 아세틸-CoA의 반응에서 촉매로 작용하여 모노아세틴이 생성될 수 있고, 모노아세틴은 제1 O-아세틸 전이효소 존재 하에 아세틸-CoA와 한 번 더 반응하여 다이아세틴을 생성할 수 있으나, 이에 제한되는 것은 아니다.
상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 70에 상응하는 위치의 아미노산이 아스파르트산(ASP)이고, 위치 84에 상응하는 위치의 아미노산이 아스파라긴(ASN)이고, 위치 114에 상응하는 위치의 아미노산이 히스티딘(HIS)이고, 위치 126에 상응하는 위치의 아미노산이 글루탐산(GLU)일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 15에 상응하는 위치의 아미노산이 티로신(TYR) 또는 페닐알라닌(PHE)이고, 위치 26에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 글루타민(GLN)이고, 위치 30에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 리신(LYS)이고, 위치 71에 상응하는 위치의 아미노산이 티로신(TYR)이고, 위치 82에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 티로신(TYR)일 수 있으나, 이에 제한되는 것은 아니다.
상기 제1 O-아세틸 전이효소의 서열번호 5의 아미노산 서열의 위치 15에 상응하는 위치의 아미노산인 티로신(TYR) 또는 페닐알라닌(PHE), 위치 26에 상응하는 위치의 아미노산인 아르기닌(ARG) 또는 글루타민(GLN), 위치 30에 상응하는 위치의 아미노산인 아르기닌(ARG) 또는 리신(LYS), 위치 71에 상응하는 위치의 아미노산인 티로신(TYR) 및 위치 82에 상응하는 위치의 아미노산인 페닐알라닌(PHE) 또는 티로신(TYR)은 기질결합포켓(substrate binding pocket)을 형성하는 잔기로서, 상대적으로 보존이 잘 되어있으며, 아세틴을 제조하는 데 중요한 역할을 하는 아미노산 잔기에 해당한다.
상기 제1 O-아세틸 전이효소의 서열번호 5의 아미노산 서열의 위치 70에 상응하는 위치의 아미노산인 아스파르트산(ASP), 위치 84에 상응하는 위치의 아미노산인 아스파라긴(ASN) 및 위치 126에 상응하는 위치의 아미노산인 글루탐산(GLU)은 글리세롤을 안정화시키는 아미노산 잔기로서, 상대적으로 보존이 잘 되어있으며, 아세틴을 제조하는 데 중요한 역할을 하는 아미노산 잔기에 해당한다.
상기 제1 O-아세틸 전이효소의 서열번호 5의 아미노산 서열의 위치 114에 상응하는 위치의 아미노산인 히스티딘(HIS)은 촉매 역할을 하는 잔기로서, 상대적으로 보존이 잘 되어있으며, 아세틴을 제조하는 데 중요한 역할을 하는 아미노산 잔기에 해당한다.
또한, 상기 제1 O-아세틸 전이효소는 그 아미노산 서열이 서열번호 5의 아미노산 서열과 상동성이 50% 이상일 수 있다.
상기 말토오스 O-아세틸 전이효소는 예를 들어, 에셰리키아 콜라이(
Escherichia coli)의 말토오스 O-아세틸 전이효소(서열번호 1), 스타필로코커스 카노수스(
Staphylococcus carnosus)의 말토오스 O-아세틸 전이효소(서열번호 2),
할알칼리코커스 젓갈리(
Halalkalicoccus jeotgali)의 말토오스 O-아세틸 전이효소(서열번호 3), 락토바실러스 브레비스(
Lactobacillus brevis)의 말토오스 O-아세틸 전이효소(서열번호 4), 바실러스 서브틸리스(
Bacillus subtilis)의 말토오스 O-아세틸 전이효소(서열번호 5) 또는 슈도모나스 푸티다(
Pseudomonas putida)의 말토오스 O-아세틸 전이효소(서열번호 6)일 수 있고, 바람직하게는 바실러스 서브틸리스(
Bacillus subtilis)의 말토오스 O-아세틸 전이효소일 수 있으나, 이에 제한되는 것은 아니다.
에셰리키아 콜라이(
Escherichia coli)의 말토오스 O-아세틸 전이효소(서열번호 1) 아미노산 서열은 바실러스 서브틸리스(
Bacillus subtilis)의 말토오스 O-아세틸 전이효소(서열번호 5) 아미노산 서열과 상동성이 65%이고, 스타필로코커스 카노수스(
Staphylococcus carnosus)의 말토오스 O-아세틸 전이효소(서열번호 2) 아미노산 서열은 바실러스 서브틸리스(
Bacillus subtilis)의 말토오스 O-아세틸 전이효소(서열번호 5) 아미노산 서열과 상동성이 58%이고, 할알칼리코커스 젓갈리(
Halalkalicoccus jeotgali)의 말토오스 O-아세틸 전이효소(서열번호 3) 아미노산 서열은 바실러스 서브틸리스(
Bacillus subtilis)의 말토오스 O-아세틸 전이효소(서열번호 5) 아미노산 서열과 상동성이 53%이고, 락토바실러스 브레비스(
Lactobacillus brevis)의 말토오스 O-아세틸 전이효소(서열번호 4) 아미노산 서열은 바실러스 서브틸리스(
Bacillus subtilis)의 말토오스 O-아세틸 전이효소(서열번호 5) 아미노산 서열과 상동성이 55%이고, 슈도모나스 푸티다(
Pseudomonas putida)의 말토오스 O-아세틸 전이효소(서열번호 6) 아미노산 서열은 바실러스 서브틸리스(
Bacillus subtilis)의 말토오스 O-아세틸 전이효소(서열번호 5) 아미노산 서열과 상동성이 50%이다.
또한, 본 발명의 아세틴의 제조 방법은 제2 O-아세틸 전이효소 존재 하에 상기 반응 생성물인 다이아세틴을 아세틸-CoA와 반응시키는 단계;를 더 포함할 수 있다.
상기 제2 O-아세틸 전이효소는 서열번호 7의 아미노산 서열의 위치 31에 상응하는 위치의 아미노산이 시스테인(CYS) 또는 류신(LEU)이고, 위치 102에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 이소류신(ILE)이고, 위치 143에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 166에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 170에 상응하는 위치의 아미노산이 발린(VAL), 이소류신(ILE), 또는 류신(LEU)이고, 위치 193에 상응하는 위치의 아미노산이 히스티딘(HIS)일 수 있으나, 이에 제한되는 것은 아니다.
제2-아세틸 전이효소는 다이아세틴에 아세틸기를 전이해 트리아세틴을 생성할 수 있고, 예를 들면 클로람페니콜-O-아세틸 전이효소(Chloramphenicol-O-acetyltransferase)일 수 있으나, 이에 제한되는 것은 아니다.
클로람페니콜-O-아세틸 전이효소는 예를 들면 서열번호 7의 아미노산 서열로 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 서열번호 7의 클로람페니콜-O-아세틸 전이효소(서열번호 7)는 예를 들어, 클로람페니콜 저항성 항생제 마커를 갖는 pSTV28 벡터에서 발현되는 것일 수 있고, 클로람페니콜 저항성 항생제 마커를 갖는 미생물에서 발현되는 것일 수 있고, pSTV28 벡터를 선천적 또는 후천적으로 갖는 미생물에서 발현되는 것일 수 있고, 합성에 의해 제조될 수도 있으나, 이에 제한되는 것은 아니다.
상기 제1 O-아세틸 전이효소 및 상기 제2 O-아세틸 전이효소 존재 하에 상기 글리세롤과 아세틸-CoA가 반응하는 경우, 모노아세틴, 다이아세틴, 트리아세틴의 복합물이 생성될 수 있으나, 이에 제한되는 것은 아니다.
상기 제2 O-아세틸 전이효소는 클로람페니콜-O-아세틸 전이효소이거나, 그와 유사한 단백질 서열 및 구조를 가져, 다이아세틴에 아세틸기를 전이시켜 트리아세틴을 생성할 수 있다.
상기 제2 O-아세틸 전이효소는 제2 O-아세틸 전이효소를 코딩하는 유전자를 가진 미생물에서 발현되는 것일 수 있고, 상기 미생물 내 제2 O-아세틸 전이효소를 코딩하는 유전자는 해당 미생물에 내재된 것일 수 있고, 유전자공학기술로 외부에서 미생물 내로 도입된 것일 수 있으며, 이 경우 글리세롤과 아세틸-CoA는 미생물 내에서 반응되는 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 제2 O-아세틸 전이효소는 생물로부터 유래된 것이거나, 합성된 것일 수 있다.
상기 제2 O-아세틸 전이효소는 서열번호 7의 아미노산 서열의 위치 31에 상응하는 위치의 아미노산이 시스테인(CYS) 또는 류신(LEU)이고, 위치 93에 상응하는 위치의 아미노산인 트레오닌(THR) 또는 프롤린(PRO), 위치 102에 상응하는 위치의 아미노산인 페닐알라닌(PHE) 또는 이소류신(ILE), 위치 143에 상응하는 위치의 아미노산인 페닐알라닌(PHE) 또는 티로신(TYR) , 위치 166에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR) 및 위치 170에 상응하는 위치의 아미노산인 발린(VAL), 이소류신(ILE) 및 류신(LEU) 중 어느 하나는 기질결합포켓(substrate binding pocket)을 형성하는 잔기로서, 상대적으로 보존이 잘 되어있으며, 아세틴을 제조하는 데 중요한 역할을 하는 아미노산 잔기에 해당한다.
상기 제2 O-아세틸 전이효소는 서열번호 7의 아미노산 서열의 위치 193에 상응하는 위치의 아미노산인 히스티딘(HIS)은 촉매 역할을 하는 잔기로서, 상대적으로 보존이 잘 되어있으며, 아세틴을 제조하는 데 중요한 역할을 하는 아미노산 잔기에 해당한다.
또한, 상기 제2 O-아세틸 전이효소는 그 아미노산 서열이 서열번호 7의 아미노산 서열과 상동성이 32% 이상일 수 있다.
상기 제2 O-아세틸 전이효소는 구체적으로는, 서열번호 7의 클로람페니콜-O-아세틸 전이효소, 바실러스 세레우스(
Bacillus cereus)의 O-아세틸 전이효소(서열번호 8), 슈도모나스 애루기노사(
Pseudomonas aeruginosa)의 O-아세틸 전이효소(서열번호 9) 또는 클로스트리디움 아세토부틸리쿰(
Clostridium acetobutylicum)의 O-아세틸 전이효소(서열번호 10)일 수 있고, 바람직하게는 바실러스 세레우스(
Bacillus cereus)의 O-아세틸 전이효소일 수 있으나, 이에 제한되는 것은 아니다.
바실러스 세레우스(
Bacillus cereus)의 O-아세틸 전이효소(서열번호 8) 아미노산 서열은 클로람페니콜-O-아세틸 전이효소(서열번호 7) 아미노산 서열과 상동성이 43% 이상이고, 슈도모나스 애루기노사(
Pseudomonas aeruginosa)의 O-아세틸 전이효소(서열번호 9) 아미노산 서열은 클로람페니콜-O-아세틸 전이효소(서열번호 7) 아미노산 서열과 상동성이 62%이고, 클로스트리디움 아세토부틸리쿰(
Clostridium acetobutylicum)의 O-아세틸 전이효소(서열번호 10) 아미노산 서열은 클로람페니콜-O-아세틸 전이효소(서열번호 7) 아미노산 서열과 상동성이 32%이다.
또한, 본 발명의 아세틴의 제조 방법은 포도당을 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)와 순차적으로 반응시켜 상기 글리세롤을 얻는 단계;를 더 포함할 수 있다.
상기 글리세롤의 경우 포도당으로부터 효소와 반응시키는 생합성을 통해 얻을 수 있고, 이의 구체적인 예로서, 포도당을 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase, GPD1) 및 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase, GPP2)와 순차적으로 반응시켜 상기 글리세롤을 얻는 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)는 화학적으로 합성될 수 있다.
또한, 상기 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)는 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)를 코딩하는 유전자를 가진 미생물에서 발현되는 것일 수 있고, 상기 미생물 내 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)를 코딩하는 유전자는 해당 미생물에 내재된 것일 수 있고, 유전자공학기술로 외부에서 미생물 내로 도입된 것일 수 있으며, 이 경우 포도당으로부터 글리세롤을 얻는 것은 미생물 내에서 이루어지는 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase)는 미생물 종류에 따라 다른 아미노산 서열을 가질 수 있고, 해당 미생물에서 해당경로의 중간대사물질인 글리세론 인산(glycerone phosphate, DHAP)을 글리세롤 3-인산(glycerol-3-phosphate, G3P)으로 전환할 수 있는 것이면 족하다. 예를 들어, 사카라마이세스 세레비지애(
Saccharomyces cerevisiae)의 경우, 서열번호 14의 사카라마이세스 세레비지애(
Saccharomyces cerevisiae)의 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase, GPD1)일 수 있으나, 이에 제한되는 것은 아니다.
상기 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)는 미생물 종류에 따라 다른 아미노산 서열을 가질 수 있고, 해당 미생물에서 해당경로의 중간대사물질인 글리세롤 3-인산(glycerol-3-phosphate, G3P)을 글리세롤(glycerol)로 전환할 수 있는 것이면 족하며, 예를 들어, 사카라마이세스 세레비지애(
Saccharomyces cerevisiae)의 경우, 서열번호 15의 사카라마이세스 세레비지애(
Saccharomyces cerevisiae)의 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase, GPP2)일 수 있으나, 이에 제한되는 것은 아니다.
상기 포도당은 해당경로(Embden-Meyerhof pathway)를 통해 중간대사물질인 글리세론 인산(glycerone phosphate, DHAP)을 형성하고, 상기 글로세론 인산은 글리세롤 3-인산 탈수소효소와 반응하여 글리세롤 3-인산으로 전환될 수 있고, 상기 글리세롤 3-인산(glycerol-3-phosphate, G3P)은 글리세롤 3-탈인산효소와 반응하여 글리세롤(glycerol)이 제조될 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명은 제1 O-아세틸 전이효소(O-acetyl transferase)를 코딩하는 유전자를 발현하는 미생물을 글리세롤을 포함하는 배지 중에서 배양하는 단계;를 포함하는 아세틴의 제조 방법에 관한 것이다.
상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 70에 상응하는 위치의 아미노산이 아스파르트산(ASP)이고, 위치 84에 상응하는 위치의 아미노산이 아스파라긴(ASN)이고, 위치 114에 상응하는 위치의 아미노산이 히스티딘(HIS)이고, 위치 126에 상응하는 위치의 아미노산이 글루탐산(GLU)일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 15에 상응하는 위치의 아미노산이 티로신(TYR) 또는 페닐알라닌(PHE)이고, 위치 26에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 글루타민(GLN)이고, 위치 30에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 리신(LYS)이고, 위치 71에 상응하는 위치의 아미노산이 티로신(TYR)이고, 위치 82에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 티로신(TYR)일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 제1 O-아세틸 전이효소는 그 아미노산 서열이 서열번호 5의 아미노산 서열과 상동성이 50% 이상일 수 있다.
상기 제1 O-아세틸 전이효소를 코딩하는 유전자는 예를 들어, 말토오스 O-아세틸 전이효소를 코딩하는 유전자일 수 있고, 상기 말토오스 O-아세틸 전이효소를 코딩하는 유전자는 예를 들어, 에셰리키아 콜라이(
Escherichia coli)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자(
maa , 서열번호 16), 스타필로코커스 카노수스(
Staphylococcus carnosus)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자(
Sc-maa, 서열번호 17),
할알칼리코커스 젓갈리(
Halalkalicoccus jeotgali)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자(
Hj-maa, 서열번호 18), 락토바실러스 브레비스(
Lactobacillus brevis)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자(
Lb-maa, 서열번호 19), 바실러스 서브틸리스(
Bacillus subtilis)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자(
Bs-maa, 서열번호 20) 또는 슈도모나스 푸티다(
Pseudomonas putida)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자(
Pp-maa, 서열번호 21)일 수 있고, 바람직하게는 바실러스 서브틸리스(
Bacillus subtilis)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자일 수 있으나, 이에 제한되는 것은 아니다.
상기 미생물은 배지 내에서 배양되어 제1 O-아세틸 전이효소를 발현할 수 있고, 상기 제1 O-아세틸 전이효소가 글리세롤과 아세틸-CoA의 반응을 촉매하여 모노아세틴을 생성할 수 있고, 상기 모노아세틴과 아세틸-CoA의 반응을 한 번 더 촉매하여 다이아세틴을 생성할 수 있다.
상기 미생물은 제1 O-아세틸 전이 효소를 발현하는 미생물이라면 제한없이 사용가능하며, 예를 들어, 원핵 세포, 진핵 세포, 또는 분리된 동물세포로 액체 배지에서 배양될 수 있는 것일 수 있다. 상기 미생물은 예를 들면, 박테리아, 곰팡이, 또는 이들의 조합일 수 있다. 박테리아는 그람 양성 박테리아, 그람 음성 박테리아, 또는 이들의 조합일 수 있다. 그람 음성 박테리아는 에세리키아 (
Escherichia) 속일 수 있다. 그람 양성 박테리아는 바실러스 속, 코리네박테리움 속, 유산균 등 또는 이들의 조합일 수 있다. 곰팡이는 사카라마이세스 세레비지애, 클루베로마이세스 등 또는 이들의 조합일 수 있다. 상기 미생물은 구체적으로 대장균(
E.coli)일 수 있고, 보다 구체적으로 DH5α, DH5α(DE3), AceCo, BW25113, W3110 또는 MG1655일 수 있다. 상기 미생물은 대장균 중 생산성 측면에서 바람직하게는 DH5α(DE3), BW25113, W3110 또는 MG1655일 수 있고, 보다 바람직하게는 MG1655일 수 있으나, 이에 제한되는 것은 아니다.
상기 미생물은 제1 O-아세틸 전이효소(O-acetyl transferase)를 코딩하는 유전자를 선천적으로 보유하는 미생물일 수 있고, 형질전환, 형질도입 등의 생명공학적 기술 등에 의해 상기 유전자를 후천적으로 보유하는 미생물일 수 있으나, 이에 제한되는 것은 아니다.
상기 형질전환은 재조합 플라스미드를 상기 미생물 내부에 도입함으로써 이루어질 수 있고, 상기 재조합 플라스미드는 벡터에 상기 제1 O-아세틸 전이효소(O-acetyl transferase)를 코딩하는 유전자가 삽입된 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 벡터는 예를 들어, pTrc99A(서열번호 78), pET28a(서열번호 79) 또는 pSTV28(서열번호 77)일 수 있고, 바람직하게는 pSTV28일 수 있으나, 이에 제한되는 것은 아니다.
상기 유전자 삽입 시, 상기 벡터와 상기 유전자를 제한효소로 자르고 ligase로 연결되어 클로닝되는 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 배지는 상기 미생물의 증식, 또는 배양을 목적으로 미생물이 일반적으로 생존하고 번식하는 자연 환경과 유사한 영양 상태를 유지 하도록 고안된 물질로서 자라는데 필요한 모든 영양소를 첨가하여 만든 액체 및 고체의 물질로서, 글리세롤 뿐만 아니라 아세틸-CoA를 포함하는 배지일 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명의 상기 미생물은 다이아세틴에 아세틸기를 전이하는 제2 O-아세틸 전이효소를 코딩하는 유전자를 더 발현하는 것일 수 있다.
상기 제2 O-아세틸 전이효소는 서열번호 7의 아미노산 서열의 위치 31에 상응하는 위치의 아미노산이 시스테인(CYS) 또는 류신(LEU)이고, 위치 102에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 이소류신(ILE)이고, 위치 143에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 166에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 170에 상응하는 위치의 아미노산이 발린(VAL), 이소류신(ILE), 또는 류신(LEU)이고, 위치 193에 상응하는 위치의 아미노산이 히스티딘(HIS) 일 수 있으나, 이에 제한되는 것은 아니다.
상기 미생물은 배지 내 배양되며, 제1 O-아세틸 전이효소 외에 추가적으로 클로람페니콜-O-아세틸 전이효소 또는 2 O-아세틸 전이효소를 더 발현할 수 있다.
상기 클로람페니콜-O-아세틸 전이효소(서열번호 7)를 코딩하는 유전자(
cat, 서열번호 24)는 클로람페니콜 저항성 항생제 마커를 갖는 벡터에 존재할 수 있고, 상기 벡터는 예를 들어 pSTV28 벡터일 수 있고, 해당 벡터는 미생물이라면 제한없이 도입되어 해당 미생물로부터 클로람페니콜-O-아세틸 전이효소가 발현될 수 있고, 예를 들어 대장균에 상기 벡터가 도입되어 대장균으로부터 클로람페니콜-O-아세틸 전이효소가 발현될 수 있으나, 이에 제한되는 것은 아니다.
상기 제2 O-아세틸 전이효소를 코딩하는 유전자는 예를 들어, 클로람페니콜-O-아세틸 전이효소를 코딩하는 유전자(
cat, 서열번호 24), 바실러스 세레우스(
Bacillus cereus)의 O-아세틸 전이효소를 코딩하는 유전자(
Bc-Oat, 서열번호 25), 슈도모나스 애루기노사(
Pseudomonas aeruginosa)의 O-아세틸 전이효소를 코딩하는 유전자(
Pa-Oat, 서열번호 26) 또는 클로스트리디움 아세토부틸리쿰(
Clostridium acetobutylicum)의 O-아세틸 전이효소를 코딩하는 유전자(
Ca-Oat, 서열번호 27)일 수 있고, 바람직하게는 바실러스 세레우스(
Bacillus cereus)의 O-아세틸 전이효소를 코딩하는 유전자일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 제2 O-아세틸 전이효소는 그 아미노산 서열이 서열번호 7의 아미노산 서열과 상동성이 32% 이상일 수 있다.
또한, 본 발명의 상기 미생물은 아세틸에스테라제(acetylesterase)를 코딩하는 유전자가 감쇄 또는 결실된 것일 수 있다.
에스터 화합물인 아세틴은 에스터 결합 분해 효소(esterases)에 의해서 글리세롤과 아세테이트로 분해될 수 있고, 상기 아세틴을 분해하는 에스터 결합 분해 효소는 예를 들어 아세틸에스테라제일 수 있다.
상기 아세틸에스테라제를 코딩하는 유전자가 감쇄 또는 결실된 미생물의 경우 아세틸에스테라제를 발현하지 않아, 아세틴의 생산량이 증가될 수 있다.
상기 아세틸에스테라제는 미생물 종류에 따라 다른 서열을 가질 수 있고, 이를 코딩하는 유전자도 마찬가지로 다른 서열을 가질 수 있는 바, 해당 미생물에서 아세틸에스테라제를 코딩하는 유전자(
aes)가 감쇄 또는 결실된 것일 수 있다. 예를 들어, 대장균의 경우, 서열번호 13의 아세틸에스테라제를 코딩하는 서열번호 30의 유전자가 감쇄 또는 결실된 것일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 미생물은 제1 O-아세틸 전이 효소를 발현하는 미생물이라면 제한없이 사용가능하며, 전술한 범위 내의 미생물일 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명의 상기 미생물의 본 배양 시 초기 균체 농도가 OD
600nm에서 0.05 내지 0.15일 때, 상기 배지에 포함된 글리세롤의 농도는 3%(v/v) 내지 13%(v/v)일 수 있으며, 바람직하게는 초기 균체 농도가 OD
600nm에서 0.08 내지 0.12일 때, 글리세롤의 농도는 5%(v/v) 내지 11%(v/v)일 수 있으나, 이에 제한되는 것은 아니다.
상기 글리세롤 농도를 가지는 배지에서 상기 균체의 농도로 미생물을 배양할 경우, 아세틴이 다량 생성될 수 있다.
상기 글리세롤의 농도가 13%(v/v) 초과인 경우, 과도한 삼투압 증가의 영향으로 균체 증식과 아세틴 생산이 모두 감소할 수 있으며, 농도가 3%(v/v) 미만인 경우, 기질의 농도가 적어서 아세틴의 생산량이 적을 수 있다.
또한, 본 발명의 상기 미생물은 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)를 코딩하는 유전자를 더 발현하고, 상기 배지는 포도당을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
전술한 바와 같이 상기 미생물은 글리세롤 3-인산 탈수소효소 및 글리세롤 3-탈인산효소를 발현하며, 포도당은 해당경로를 통해 글리세론 인산으로 변환된 후 상기 효소들을 통해 글리세롤로 변환될 수 있다.
상기 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase)를 코딩하는 유전자(Gpd1)는 미생물 종류에 따라 다른 염기 서열을 가질 수 있고, 해당 미생물에서 해당경로의 중간대사물질인 글리세론 인산(glycerone phosphate, DHAP)을 글리세롤 3-인산(glycerol-3-phosphate, G3P)으로 전환할 수 있는 것이면 족하다. 예를 들어, 사카라마이세스 세레비지애(
Saccharomyces cerevisiae)의 경우, 서열번호 31의 사카라마이세스 세레비지애(
Saccharomyces cerevisiae)의 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase)를 코딩하는 유전자(
Sc-gpd1)일 수 있으나, 이에 제한되는 것은 아니다.
상기 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)를 코딩하는 유전자(Gpp2)는 미생물 종류에 따라 다른 염기 서열을 가질 수 있고, 해당 미생물에서 해당경로의 중간대사물질인 글리세롤 3-인산(glycerol-3-phosphate, G3P)을 글리세롤(glycerol)로 전환할 수 있는 것이면 족하다. 예를 들어, 사카라마이세스 세레비지애(
Saccharomyces cerevisiae)의 경우, 서열번호 32의 사카라마이세스 세레비지애(
Saccharomyces cerevisiae)의 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)를 코딩하는 유전자(
Sc-gpp2)일 수 있으나, 이에 제한되는 것은 아니다.
상기 글리세롤은 전술한 제1 O-아세틸 전이효소 및 클로람페니콜-O-아세틸 전이효소 또는 제2 O-아세틸 전이효소 등에 의해 아세틴 복합물로 변환될 수 있다.
또한, 본 발명은 제1 O-아세틸 전이효소(O-acetyl transferase)를 코딩하는 유전자를 발현하는 미생물을 포함하는 아세틴 제조용 조성물에 관한 것이다.
상기 조성물은 글리세롤과 접촉하는 경우 전술한 범위 및 방법으로 아세틴을 제조할 수 있다.
상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 70에 상응하는 위치의 아미노산이 아스파르트산(ASP)이고, 위치 84에 상응하는 위치의 아미노산이 아스파라긴(ASN)이고, 위치 114에 상응하는 위치의 아미노산이 히스티딘(HIS)이고, 위치 126에 상응하는 위치의 아미노산이 글루탐산(GLU)일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 15에 상응하는 위치의 아미노산이 티로신(TYR) 또는 페닐알라닌(PHE)이고, 위치 26에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 글루타민(GLN)이고, 위치 30에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 리신(LYS)이고, 위치 71에 상응하는 위치의 아미노산이 티로신(TYR)이고, 위치 82에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 티로신(TYR)일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 제1 O-아세틸 전이효소는 그 아미노산 서열이 서열번호 5의 아미노산 서열과 상동성이 50% 이상일 수 있다.
상기 제1 O-아세틸 전이효소는 말토오스 O-아세틸 전이효소일 수 있고, 보다 구체적으로는 에셰리키아 콜라이(
Escherichia coli), 스타필로코커스 카노수스(
Staphylococcus carnosus),
할알칼리코커스 젓갈리(
Halalkalicoccus jeotgali), 락토바실러스 브레비스(
Lactobacillus brevis), 바실러스 서브틸리스(
Bacillus subtilis) 또는 슈도모나스 푸티다(
Pseudomonas putida)의 말토오스 O-아세틸 전이효소일 수 있고, 바람직하게는 바실러스 서브틸리스(
Bacillus subtilis)의 말토오스 O-아세틸 전이효소일 수 있으나, 이에 제한되는 것은 아니다.
상기 제1 O-아세틸 전이효소를 코딩하는 유전자는 예를 들어, 말토오스 O-아세틸 전이효소를 코딩하는 유전자일 수 있고, 상기 말토오스 O-아세틸 전이효소를 코딩하는 유전자는 예를 들어, 에셰리키아 콜라이(
Escherichia coli)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자(
maa , 서열번호 16), 스타필로코커스 카노수스(
Staphylococcus carnosus)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자(
Sc-maa, 서열번호 17),
할알칼리코커스 젓갈리(
Halalkalicoccus jeotgali)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자(
Hj-maa, 서열번호 18), 락토바실러스 브레비스(
Lactobacillus brevis)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자(
Lb-maa, 서열번호 19), 바실러스 서브틸리스(
Bacillus subtilis)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자(
Bs-maa, 서열번호 20) 또는 슈도모나스 푸티다(
Pseudomonas putida)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자(
Pp-maa, 서열번호 21)일 수 있고, 바람직하게는 바실러스 서브틸리스(
Bacillus subtilis)의 말토오스 O-아세틸 전이효소를 코딩하는 유전자일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 미생물은 다이아세틴에 아세틸기를 전이하는 제2 O-아세틸 전이효소를 코딩하는 유전자를 더 발현하는 것일 수 있다.
상기 제2 O-아세틸 전이효소는 서열번호 7의 아미노산 서열의 위치 31에 상응하는 위치의 아미노산이 시스테인(CYS) 또는 류신(LEU)이고, 위치 102에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 이소류신(ILE)이고, 위치 143에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 166에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 170에 상응하는 위치의 아미노산이 발린(VAL), 이소류신(ILE), 또는 류신(LEU)이고, 위치 193에 상응하는 위치의 아미노산이 히스티딘(HIS)일 수 있으나, 이에 제한되는 것은 아니다.
상기 클로람페니콜-O-아세틸 전이효소를 코딩하는 유전자는 클로람페니콜 저항성 항생제 마커를 갖는 벡터에 존재할 수 있고, 예를 들어 pSTV28 벡터일 수 있으나, 이에 제한되는 것은 아니다.
상기 제2 O-아세틸 전이효소를 코딩하는 유전자는 예를 들어, 바실러스 세레우스(
Bacillus cereus), 슈도모나스 애루기노사(
Pseudomonas aeruginosa) 또는 클로스트리디움 아세토부틸리쿰(
Clostridium acetobutylicum)의 O-아세틸 전이효소를 코딩하는 유전자일 수 있고, 바람직하게는 바실러스 세레우스(
Bacillus cereus)의 O-아세틸 전이효소를 코딩하는 유전자일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 제2 O-아세틸 전이효소는 그 아미노산 서열이 서열번호 7의 아미노산 서열과 상동성이 32% 이상일 수 있다.
또한, 상기 미생물은 아세틸에스테라제(acetylesterase)를 코딩하는 유전자가 감쇄 또는 결실된 것일 수 있다.
에스터 화합물인 아세틴은 에스터 결합 분해 효소(esterases)에 의해서 글리세롤과 아세테이트로 분해될 수 있고, 상기 아세틴을 분해하는 에스터 결합 분해 효소는 예를 들어 아세틸에스테라제일 수 있다.
상기 아세틸에스테라제를 코딩하는 유전자(
aes)가 감쇄 또는 결실된 미생물의 경우 아세틸에스테라제를 발현하지 않아, 아세틴의 생산량을 증가시킬 수 있다.
상기 아세틸에스테라제는 미생물 종류에 따라 다른 서열을 가질 수 있고, 이를 코딩하는 유전자도 마찬가지로 다른 서열을 가질 수 있는 바, 해당 미생물에서 아세틸에스테라제를 코딩하는 유전자가 감쇄 또는 결실된 것일 수 있다. 예를 들어, 대장균의 경우, 서열번호 13의 아세틸에스테라제를 코딩하는 서열번호 30의 유전자가 감쇄 또는 결실된 것일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 미생물은 전술한 바와 같으나, 구체적으로 대장균(
E.coli)일 수 있고, 보다 구체적으로는 DH5α, DH5α(DE3), AceCo, BW25113, W3110 또는 MG1655일 수 있고, 바람직하게는 MG1655일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 미생물은 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)를 코딩하는 유전자를 더 발현하는 것일 수 있다.
전술한 바와 같이 상기 미생물은 글리세롤 3-인산 탈수소효소 및 글리세롤 3-탈인산효소를 발현하며, 포도당은 해당경로 및 상기 효소들을 통해 글리세롤로 변환될 수 있다.
상기 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase)를 코딩하는 유전자(Gpd1)는 미생물 종류에 따라 다른 염기 서열을 가질 수 있고, 해당 미생물에서 해당경로의 중간대사물질인 글리세론 인산(glycerone phosphate, DHAP)을 글리세롤 3-인산(glycerol-3-phosphate, G3P)으로 전환할 수 있는 것이면 족하다. 예를 들어, 사카라마이세스 세레비지애(
Saccharomyces cerevisiae)의 경우, 서열번호 31의 사카라마이세스 세레비지애(
Saccharomyces cerevisiae)의 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase)를 코딩하는 유전자(
Sc-gpd1)일 수 있으나, 이에 제한되는 것은 아니다.
상기 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)를 코딩하는 유전자(Gpp2)는 미생물 종류에 따라 다른 염기 서열을 가질 수 있고, 해당 미생물에서 해당경로의 중간대사물질인 글리세롤 3-인산(glycerol-3-phosphate, G3P)을 글리세롤(glycerol)로 전환할 수 있는 것이면 족하다. 예를 들어, 사카라마이세스 세레비지애(
Saccharomyces cerevisiae)의 경우, 서열번호 32의 사카라마이세스 세레비지애(
Saccharomyces cerevisiae)의 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)를 코딩하는 유전자(
Sc-gpp2)일 수 있으나, 이에 제한되는 것은 아니다.
상기 글리세롤은 전술한 O-아세틸 전이효소 및 클로람페니콜-O-아세틸 전이효소 등에 의해 아세틴 복합물로 변환될 수 있다.
이하, 본 발명을 구체적으로 설명하기 위해 실시예를 들어 상세하게 설명하기로 한다. 하기 실시예에 사용된 플라스미드와 균주는 표 1에, PCR primer들은 표 2에 정리하였다.
| Names | Descriptions | Sources |
| Plasmids | ||
| pSTV28 | P lac expression vector, pACYC184 origin, lacZα, Cm r | Takara Co., Ltd |
| pTrc99A | P trc expression vector, pBR322 origin, lacI q, Amp r | Amersham Bioscience |
| pET28a (+) | P T7 expression vector, pBR322 origin, lacI, and Kan r | Novagen |
| pMD1 | pTrc99A vector containing lacA from E. coli | - |
| pMD2 | pTrc99A vector containing cysE from E. coli | - |
| pMD3 | pTrc99A vector containing yjgM from E. coli | - |
| pMD4 | pTrc99A vector containing yjaB from E. coli | - |
| pMD5 | pTrc99A vector containing yiiD from E. coli | - |
| pMD6 | pTrc99A vector containing wecH from E. coli | - |
| pMD7 | pTrc99A vector containing nhoA from E. coli | - |
| pMD8 | pTrc99A vector containing maa from E. coli | - |
| pMD9 | pTrc99A vector containing maa from S. carnosus | - |
| pMD10 | pTrc99A vector containing maa from H. jeotgali | - |
| pMD11 | pTrc99A vector containing maa from L. brevis | - |
| pMD12 | pTrc99A vector containing maa from P. putida | - |
| pMD13 | pTrc99A vector containing maa from B. subtilis | - |
| pMD14 | pET28a vector containing maa from B. subtilis | - |
| pT-CAT | pTrc99A vector containing cat from pSTV28 | - |
| pMDT1 | pSTV28 vector containing maa from B. subtilis | - |
| pMDT2 | pTrc99A vector containing cat from pSTV28 and maa from B. subtilis | - |
| pMDT3 | pTrc99A vector containing oat from B. cereus and maa from B. subtilis | - |
| pMDT4 | pTrc99A vector containing oat from P. aeruginosa and maa from B. subtilis | - |
| pMDT5 | pTrc99A vector containing oat from C. acetobutylicum and maa from B. subtilis | - |
| pMDT6 | pTrc99A vector containing oat from M. abscessus and maa from B. subtilis | - |
| pMDT7 | pTrc99A vector containing oat from L. brevis and maa from B. subtilis | - |
| pMDT8 | pMDT2 containing gpd1 and gpp2 from S. cerevisiae | - |
| Strains | ||
| MG1655 | E. coli K-12; F - lambda -, ilvG -, rfb-50, rph-1 | ATCC700926 |
| DH5α | E. coli K-12; F -, Φ80lacZ△M15, △(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17(rK -, mK +) phoA, supE44, λ -, thi-1 | ATCC98040 |
| BW25113 | △(araD-araB)567, △lacZ4787(::rrnB-3), lambda -, rph-1, △(rhaD-rhaB)568, hsdR514 | NBRP, NIG |
| AceCo | MG1655 △ackA-pta, poxB, ldhA, dld, adhE, pps, atoDA | Ref. 1 |
| W3110 | E. coli K-12; F -, λ - IN (rrnD-rrnE)1 | ATCC27325 |
| DH5α (DE3) | E. coli K-12; F -, Φ80lacZ△M15, △(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17(rK -, mK +) phoA, supE44, λ -, thi-1, λ(DE3) | - |
| JW0465 | BW25113 △aes | NBRP, NIG |
| DH-MD0 | E. coli DH5α harboring pTrc99A | - |
| DH-MD1 | E. coli DH5α harboring pMD1 | - |
| DH-MD2 | E. coli DH5α harboring pMD2 | - |
| DH-MD3 | E. coli DH5α harboring pMD3 | - |
| DH-MD4 | E. coli DH5α harboring pMD4 | - |
| DH-MD5 | E. coli DH5α harboring pMD5 | - |
| DH-MD6 | E. coli DH5α harboring pMD6 | - |
| DH-MD7 | E. coli DH5α harboring pMD7 | - |
| DH-MD8 | E. coli DH5α harboring pMD8 | - |
| DH-MD9 | E. coli DH5α harboring pMD9 | - |
| DH-MD10 | E. coli DH5α harboring pMD10 | - |
| DH-MD11 | E. coli DH5α harboring pMD11 | - |
| DH-MD12 | E. coli DH5α harboring pMD12 | - |
| DH-MD13 | E. coli DH5α harboring pMD13 | - |
| DH-MD14 | E. coli DH5α(DE3) harboring pMD14 | - |
| DH-MDT1 | E. coli DH5α harboring pMDT1 | - |
| DH-EMPT | E. coli DH5α harboring pTrc99A | - |
| DH-CAT | E. coli DH5α harboring pT-CAT | - |
| DH-MDT2 | E. coli DH5α harboring pMDT2 | - |
| DH-MDT3 | E. coli DH5α harboring pMDT3 | - |
| DH-MDT4 | E. coli DH5α harboring pMDT4 | - |
| DH-MDT5 | E. coli DH5α harboring pMDT5 | - |
| DH-MDT6 | E. coli DH5α harboring pMDT6 | - |
| DH-MDT7 | E. coli DH5α harboring pMDT7 | - |
| AC-MDT2 | E. coli AceCo harboring pMDT2 | - |
| BW-MDT2 | E. coli BW25113 harboring pMDT2 | - |
| W3-MDT2 | E. coli W3110 harboring pMDT2 | - |
| MG-MDT2 | E. coli MG1655 harboring pMDT2 | - |
| BW-Empty | E. coli BW25113 harboring pTrc99A | - |
| BW-Aes | E. coli BW25113 harboring pT-Aes | - |
| BW-MDT2 (Daes) | E. coli JW0465 harboring pMDT2 | - |
| DH-MDT8 | E. coli DH5α harboring pMDT8 | - |
Ref. 1. Kim, J.-H. et al. Isoprene production by
Escherichia coli through the exogenous mevalonate pathway with reduced formation of fermentation byproducts.
Microbial Cell Factories 15, 214 (2016).
| Primers a, b, c | Descriptions (5'-> 3') | 서열번호 |
| Ec-lacA-F | CT GGATCC AGGAGGTAATAAAATGGAACATGCCAATGACCG | 33 |
| Ec-lacA-R | GTT TCTAGATTAAACTGACGATTCAACTTTATAATC | 34 |
| Ec-cysE-F | CT GGATCC AGGAGGTAATAAAATGTCGTGTGAAGAACTGGAAATTG | 35 |
| Ec-cysE-R | GTT TCTAGATTAGATCCCATCCCCATACTC | 36 |
| Ec-yjgm-F | CT GGATCC AGGAGGTAATAAAATGAATAACATTGCGCCGC | 37 |
| Ec-yjgM-R | GTT TCTAGATTAGAGTTCGCGCAACATCC | 38 |
| Ec-yjaB-F | CT GGATCC AGGAGGTAATAAAATGGTTATTAGTATTCGCCGCTC | 39 |
| Ec-yjaB-R | GTT TCTAGATTACGCCCCCACATACGC | 40 |
| Ec-yiiD-F | CT GGATCC AGGAGGTAATAAAATGAGCCAGCTTCCAGGG | 41 |
| Ec-nhoA-F | CT GGATCC AGGAGGTAATAAAATGACGCCCATTCTGAATCAC | 42 |
| Ec-nhoA-R | GTT TCTAGATTATTTTCCCGCCTCCGGG | 43 |
| Ec-wecH-F | CT GGATCC AGGAGGTAATAAAATGCAGCCCAAAATTTACTGG | 44 |
| Ec-WecH-R | GTT TCTAGATTAACTCACTAATCTGTTTCTGTCG | 45 |
| Ec-yiiD-R | GTT TCTAGATTACTCTTCTTCGTTCCCGC | 46 |
| Ec-maa-F | CT GGATCC AGGAGGTAATAAAATGAGCACAGAAAAAGAAAAGATG | 47 |
| Ec-maa-R | GTT TCTAGATTACAATTTTTTAATTATTCTGGCTG | 48 |
| Sc-maa-F | CT GGATCC AGGAGGTAATAAAATGACCACCGAGAAGGAAAAAATG | 49 |
| Sc-maa-R | GTT TCTAGATTAATCCAGCGGCACTTCAC | 50 |
| Hj-maa-F | CT GGATCC AGGAGGTAATAAAATGACCAGCGAGAAGGAACG | 51 |
| Hj-maa-R | GTT TCTAGATTAATCAACGTCCTTCAGCACA | 52 |
| Lb-maa-F | CT GGATCC AGGAGGTAATAAAATGGACAAGAGCGAGAAGG | 53 |
| Lb-maa-R | GTT TCTAGATTATTTCAGCGGCTTAATCAC | 54 |
| Pp-maa-F | CT GGATCC AGGAGGTAATAAAATGAGCCTGAGCGAGAAGCAC | 55 |
| Pp-maa-R | GTT TCTAGATTATTGACCCTGATCCGGCTG | 56 |
| Bs-maa-F | CT GGATCC AGGAGGTAATAAAATGCTGCGTACCGAGAAGG | 57 |
| Bs-maa-R | GTT TCTAGATTACAGTTGTTTCAGAATACGCGC | 58 |
| Cat-F | CTAG GAGCTC AGGAGAAATATAATGGAGAAAAAAATCACTGGATATAC | 60 |
| Cat-R | CT GGATCCTTACGCCCCGCCCTGCC | 61 |
| Trc-Bs.maa-F | AGATCTGAGTCGACAGTATCGGCGGG | 62 |
| Trc-Bs.maa-R | TATATTTCTCCTGAGGATCCCCGGGTACCG | 63 |
| Bc-Oat-F | CTCGGTACCCGG GGATCC TC AGGAGAAATATAATGGACTTCCACCAGATC | 64 |
| Bc-Oat-R | CCCGCCGATACT GTCGACAGATCTTACAGCCATTCCTCAAAG | 65 |
| Ca-Oat-F | CTCGGTACCCGG GGATCC TC AGGAGAAATATAATGAACAGCAACTTCCAC | 66 |
| Ca-Oat-R | CCCGCCGATACT GTCGACAGATCTTAACGAATCCACTCTTTC | 67 |
| Lb-Oat-F | CTCGGTACCCGG GGATCC TC AGGAGAAATATAATGACCGAGCTGAACACCC | 68 |
| Lb-Oat-R | CCCGCCGATACT GTCGACAGATCTTACGCGGTCAGCCACAG | 69 |
| Ma-Oat-F | CTCGGTACCCGG GGATCC TC AGGAGAAATATAATGCCGGCGGAGCACGCG | 70 |
| Ma-Oat-R | CCCGCCGATACT GTCGACAGATCTTAATCACGAACCCAATCCGGGTCCG | 71 |
| Pa-Oat-F | CTCGGTACCCGG GGATCC TC AGGAGAAATATAATGAGCTACACCCGTGTTG | 72 |
| Pa-Oat-R | CCCGCCGATACT GTCGACAGATCTTAGCCACCCGCTTCATC | 73 |
| Ec-aes-F | CTGGATCC GTCACCCAACCCTTTATGAAGCCGGAAAACAAACTACC | 74 |
| Ec-aes-R | TATC GTCGACTTAAAGCTGAGCGGTAAAGAACTG | 75 |
| Sc-gpd1-F | GC GGATCC AGGAGGTAATAAAATGTCTGCTGCTGCTGATAGATTAAAC | 76 |
| Sc-gpd1-R | AATG CTGCAGTTAATCTTCATGTAGATCTAATTCTTCAATC | 59 |
| Sc-gpp2-F | TG CTGCAG AGGAGGTAATTTATATGGGATTGACTACTAAACCTCTATC | 22 |
| Sc-gpp2-R | CCC AAGCTTACCATTTCAACAGATCGTCC | 23 |
aRestriction enzyme sites are underlined.
bRBS sequences are italic.
cThe overlapping sequences are bolded.
실시예
1. 대장균 유래 O-acetyltransferases 효소들을 이용한 모노아세틴과 다이아세틴 생산
모노아세틴과 다이아세틴을 생산하기 위해서 글리세롤에 아세틸기를 전이할 수 있는 대장균 내의 O-acetyltransferases 후보 유전자들을 8종 선별하고 각 유전자들을 pTrc99A 발현벡터(서열번호 78)에 클로닝해서 플라스미드 pMD1 - pMD8를 구축하였다. 후보 유전자들은 galactoside O-acetyltransferase, maltose O-acetyltransferase(서열번호 1), serine acetyltransferase, O-acetyltransferase WecH, arylamine N-acetyltransferase를 각각 코딩하는
lacA(서열번호 80)
, maa(서열번호 16)
, cysE(서열번호 81)
,
wecH(서열번호 82)
,
nhoA(서열번호 83)와 3종의 O-acetyltransferase 추정 유전자
yjgm(서열번호 84)
, yjaB(서열번호 85)
, yiiD(서열번호 86)를 대장균 MG1655의 염색체를 주형으로 해서 PCR 증폭을 통해서 얻었다. 이 때 사용한 PCR primer들은 Ec-lacA-F(서열번호 33)/Ec-lacA-R(서열번호 34), Ec-maa-F(서열번호 47)/Ec-maa-R(서열번호 48), Ec-cysE-F(서열번호 35)/Ec-cysE-R(서열번호 36), Ec-wecH-F(서열번호 44)/Ec-wecH-R(서열번호 45), Ec-nhoA-F(서열번호 42)/Ec-nhoA-R(서열번호 43), Ec-yjgm-F(서열번호 37)/Ec-yjgM-R(서열번호 38), Ec-yjaB-F(서열번호 39)/Ec-yjaB-R(서열번호 40), Ec-yiiD-F(서열번호 41)/Ec-yiiD-R(서열번호 46)이다. 상기 PCR 반응산물은 BamHI과 XbaI을 이용해서 pTrc99A 벡터에 클로닝 되었다. 이렇게 구축한 플라스미드 pDM1 - pDM8로 대장균 DH5α를 형질전환해서 재조합균주 DH-MD1 ~ DH-MD8을 만들고 모노아세틴 및 다이아세틴 생성을 분석하였다(도 3).
종 배양은 LB 복합배지(10 g tryptone, 5 g yeast extract and 10 g sodium chloride per liter)를 이용해서 37℃에서 약 12시간 진탕 배양을 했다. 본 배양은 M9 최소배지(Na
2HPO
4·7H
2O, 12.8 g/L; KH
2PO
4, 3g/L; NaCl, 0.5 g/L; NH
4Cl, 1 g/L; MgSO
4, 1mM; CaCl
2, 100 mM)에 5 g/L의 yeast extract와 2% (v/v)의 glycerol을 첨가하고, 배양온도 37℃와 진탕속도 250rpm에서 48시간 동안 진행했다. 재조합균주에 도입된 플라스미드의 항생제 마커에 따라서 100 mg/L ampicillin, 50 mg/L chloramphenicol, 또는 50 mg/L kanamycin 항생제를 첨가했다. 본 배양의 초기 균체 농도는 OD
600nm에서 0.1이 되게 하였고, 플라스미드에 도입한 유전자들의 발현을 위해서 0.5 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG)를 배양 초기에 첨가하였다.
아세틴 화합물의 분석은 HP-INNOVAX column (19091N-133, 30 m in length, 0.250 mm in internal diameter and 0.25 μm film thicknesses)이 장착된 GC (Agilent Technologies 7890A, 미국)와 GC-MS (GC-MS-QP2010, SHIMADZU, 일본)를 이용했다. 아세틴 표준화합물은 Sigma (미국)에서 구입하였다. 본 배양에서 생산된 아세틴 복합물은 ethyl acetate 용매를 이용해서 배양액으로부터 추출하고, 추출 시료의 1 μL를 GC 또는 GC-MS에 주입하였다. GC의 오븐 온도는 50℃에서 시작해서 20℃/min의 속도로 90℃까지, 15℃/min의 속도로 150℃까지, 20℃/min의 속도로 190℃까지, 15℃/min의 속도로 230℃까지 올리고, 2 분간 유지하였다. 불꽃 이온 검출기(FID)의 온도는 280℃로 유지했다. 상기 분석방법에 따른 분석결과는 도 5에 나타내었다.
도 3의 재조합균주 DH-MD1 ~ DH-MD8의 배양결과에 따르면 pMD8 플라스미드로 형질전환된 DH-MD8 균주에서만 모노아세틴과 다이아세틴이 생산되었다. 이것은 대장균 유래 8종의 O-acetyltransferases 후보 유전자들 중에서 maltose O-acetyltransferase 유전자(
maa)만이 글리세롤에 아세틸기를 전이할 수 있는 능력이 있다는 것이다.
2. 대장균 Maa 유사 효소들을 이용한 모노아세틴 생산
대장균에서 발굴된 Maa 보다 더 우수한 활성을 갖는 O-acetyl transferases를 발굴하기 위해서 대장균 Maa의 아미노산 서열로 BLAST 검색을 하고,
Staphylococcus carnosus, Halalkalicoccus jeotgali, Lactobacillus brevis, Bacillus subtilis, Pseudomonas putida 미생물로부터 추가로 5종의 maltose O-acetyl transferases(Sc-mOat(서열번호 2), Hj-mOat(서열번호 3), Lb-mOat(서열번호 4), Bs-mOat(서열번호 5), Pp-mOat(서열번호 6))를 확보하고 이들을 대장균에 발현 한 후에 모노아세틴과 다이아세틴 생산성을 비교했다(도 3).
상기 미생물 유래 유전자들은 숙주인 대장균에서의 발현을 최적화하기 위해서 GenScript (미국)에서 대장균 코돈 이용도에 맞춰서 합성을 했다. 상기 합성한 유전자들을 Sc-maa-F(서열번호 49)/Sc-maa-R(서열번호 50), Hj-maa-F(서열번호 51)/Hj-maa-R(서열번호 52), Lb-maa-F(서열번호 53)/Lb-maa-R(서열번호 54), Pp-maa-F(서열번호 55)/Pp-maa-R(서열번호 56), Bs-maa-F(서열번호 57)/Bs-maa-R(서열번호 58)의 PCR primers를 이용해서 증폭하여 얻은
Sc-maa(서열번호 17),
Hj-maa(서열번호 18),
Lb-maa(서열번호 19),
Pp-maa(서열번호 21),
Bs-maa(서열번호 20) 유전자를 BamHI과 XbaI을 이용해서 pTrc99A 벡터에 클로닝 하였다. 이렇게 구축한 플라스미드 pMD9 - pMD13로 대장균 DH5α를 형질전환해서 재조합균주 DH-MD9 ~ DH-MD13을 만들고 모노아세틴과 다이아세틴 생산성을 비교하였다(도 3).
비교 결과
B. subtilis의 Maa (
Bs-maa)가 가장 높은 모노아세틴과 다이아세틴 생산성을 보인 것을 확인하였다. 배양방법과 분석방법은 실시예 1과 동일하다.
3. Chloramphenicol-O-acetyltransferase를 이용한 트리아세틴 생산
모노아세틴과 다이아세틴 생산성이 가장 좋았던
B. subtilis의 Maa 유전자(
Bs-maa)의 발현 최적화를 위해서 pTrc99A(서열번호 78), pET28a(서열번호 79), pSTV28(서열번호 77) 등의 다양한 발현벡터에 클로닝해서 pMD13, pMD14, pMDT1) 플라스미드를 구축하고, 이 플라스미드들로 형질전환 된 재조합 대장균 DH-MD13, DH-MD14, DH-MDT1를 만들었다. T7 프로모터를 갖는 pMD14의 형질전환 숙주 균주로는 대장균 DH5α(DE3)를 이용했다. DH5α(DE3) 균주는 Novagen 회사(미국)의 λDE3 Lysogenization Kit를 이용해서 대장균 DH5α로부터 만들었다. DH-MDT1 균주에서 모노아세틴과 다이아세틴 생산성이 가장 높았을 뿐만 아니라 트리아세틴의 생산까지 관찰되었다(도 4).
이것은 pSTV28 벡터의 항생제 마커인 chloramphenicol-O-acetyltransferase (CAT, 서열번호 7)에 의한 것으로 추정된다. CAT은 광범위한 기질특이성을 갖고 있어서 다양한 기질들에 아세틸기를 전이시키는 것으로 알려져 있다. 모노아세틴과 다이아세틴에 추가적인 아세틸기 전이를 통해 트리아세틴(triacetin)을 생산하는 CAT 효소 유전자(
cat, 서열번호 24)의 발현을 강화하기 위해서 pMD13 플라스미드의
Bs-maa 유전자 앞에 도입한 pMDT2 플라스미드를 구축하였다(도 6).
이를 위해서 Cat-F(서열번호 60)/Cat-R(서열번호 61)의 PCR primers를 이용해서 pSTV28로부터
cat 유전자를 PCR 증폭하고, SacI과 BamHI으로 절단해서 pMD13의 해당 제한효소 부위로 도입하였다. pMDT2로 형질전환 된 DH-MDT2 제조합균주의 모노아세틴, 다이아세틴, 트리아세틴의 복합물 생산량과 트리아세틴의 비율이 모두 DH-MDT1 균주에 비해서 크게 증가했다. 배양방법과 분석방법은 실시예 1과 동일하다.
4. CAT 유사 효소들을 이용한 트리아세틴 화합물 생산
모노아세틴과 다이아세틴을 트리아세틴으로 전환하는 효소들을 추가로 발굴하기 위해서 CAT 효소의 아미노산 서열로 BLAST 검색을 실시하였다. 이 검색을 통해서 상동성이 높은 5종의 O-acetyltransferases (OAT, Bc-OAT(서열번호 8), Pa-OAT(서열번호 9), Ca-OAT(서열번호 10), Ma-OAT(서열번호 11), Lb-OAT(서열번호 12))를
Bacillus cereus, Pseudomonas aeruginosa, Clostridium acetobutylicum, Mycobacterium abscessus, Lactobacillus brevis에서 도출하고 숙주인 대장균에서의 발현을 최적화하기 위해서 GenScript 회사(미국)에서 대장균 코돈 이용도에 맞춰서 합성을 했다.
상기 미생물 유래 OAT 합성 유전자들(
Bc-Oat(서열번호 25)
, Pa-Oat(서열번호 26)
, Ca-Oat(서열번호 27)
, Ma-Oat(서열번호 28)
, Lb-Oat(서열번호 29))을 Bc.Oat-F(서열번호 64)/Bc.Oat-R(서열번호 65), Pa.Oat-F(서열번호 72)/Pa.Oat-R(서열번호 73), Ca.Oat-F(서열번호 66)/Ca.Oat-R(서열번호 67), Ma.Oat-F(서열번호 70)/Ma.Oat-R(서열번호 71), Lb.Oat-F(서열번호 68)/Lb.Oat-R(서열번호 69)의 PCR primers를 이용해서 증폭한다.
이렇게 증폭한 각 유전자들의 단편은 pMD13 기반의 플라스미드 골격과 HiFi DNA assembly 방법으로 연결해서 플라스미드 pMDT3 ~ pMDT7을 구축하였다(도 7).
HiFi DNA assembly는 NEB 회사(미국)의 HiFi DNA assembly kit를 이용했고, 상기 pMD13 기반의 플라스미드 골격은 pMD13을 주형으로 Trc-Bs.maa-F(서열번호 62)와 Trc-Bs.maa-R(서열번호 63)를 PCR primer로 PCR을 수행해서 얻었다. pMDT3 ~ pMDT7 플라스미드로 형질전환 된 재조합균주 DH-MDT2 ~ DH-MDT7의 아세틴 복합물 생산량을 비교하였다(도 7).
그 결과 OAT 유전자 종류에 따라서 아세틴 복합물의 생산량에 큰 차이가 있었고,
L. brevis와
M. abscessus 유래의 O-acetyltransferase는 트리아세틴 생산 능력이 없었고,
B. cereus, P. aeruginosa, C. acetobutylicum의 유래의 O-acetyltransferase는 트리아세틴을 생산했지만 pSTV28의 항생제 마커인 CAT에 비해서는 생산성이 낮았다. 배양방법과 분석방법은 실시예 1과 동일하다.
5. 대장균 균종 및 글리세롤 첨가량에 따른 아세틴 복합물 생성량 변화
앞의 실시예들에서 숙주로 대장균 DH5α를 이용했다. 대장균의 종류에 따른 아세틴 화합물의 생산성을 비교하기 위해서 본 실시예에서는 숙주로 대장균 AceCo, BW25113, W3110, MG1655를 플라스미드 pMDT2로 형질전환 한 재조합 대장균 DH-MDT2, AC-MDT2, BW-MDT2, W3-MDT2, MG-MDT2를 배양해서 아세틴 복합물 생산성을 비교했다(도 8A, 8B).
재조합균주 MG-MDT2에서 아세틴 복합물 생산성이 가장 높았기 때문에 대장균 MG1655가 아세틴 화합물 생산에 가장 적합한 숙주라는 것을 알았다. 배양방법과 분석방법은 실시예 1과 동일하다.
가장 높은 아세틴 화합물 생산성을 보인 재조합균주 MG-MDT2에서 기질인 글리세롤 첨가량에 따른 아세틴 화합물 생산성을 고찰하기 위해서 모든 배양조건과 분석방법은 실시예1과 동일하고 다만 첨가하는 글리세롤의 농도를 2 ~ 15% (v/v)로 변화시켰다(도 8C, 8D).
아세틴 복합물의 생산량은 출발기질인 글리세롤의 첨가량이 증가할수록 높아졌으나, 15% 이상의 과도한 글리세롤 첨가의 경우에는 과도한 삼투압 증가의 영향으로 균체 증식과 아세틴 생산이 모두 감소하는 결과를 얻었다.
6. 아세틴 화합물을 분해하는 효소 유전자 제거를 통한 생산성 향상
에스터 화합물인 아세틴은 에스터 결합 분해 효소(esterases, 서열번호 13)에 의해서 글리세롤과 아세테이트로 분해될 수 있기 때문에 대장균의 acetylesterase 효소 유전자(
aes, 서열번호 30)의 증폭 또는 결손의 영향을 고찰했다(도 9).
Aes 유전자 단편은 대장균 MG1655의 염색체를 주형으로 Ec-aes-F(서열번호 74)와 Ec-aes-R(서열번호 75)을 프라이머로 이용해서 PCR 증폭해서 얻었고, BamHI과 SalI 제한효소로 pTrc99A에 클로닝 해서 플라스미드 pTAes를 구축하였다. Aes 효소에 의한 트리아세틴의 분해를 관찰하기 위해서 대장균 BW25113을 공벡터 pTrc99A와 플라스미드 pTAes로 형질전환한 재조합균주 BW-Empty와 BW-Aes를 제조하고, 트리아세틴 표준화합물 15 g/L가 첨가된 배지에서 배양하였다. 배양조건은 상기 실시 예들에서 이용한 아세틴 복합물 생산조건과 동일하게 수행하였다(도 9A, 9B).
BW-Empty와 BW-Aes 균주에서 모두 트리아세틴 표준화합물의 분해가 일어났지만 분해의 정도는
aes 유전자를 과발현시킨 BW-Aes에서 훨씬 더 큰 것을 확인했다. 트리아세틴의 분해로 배양액에는 소량의 다이아세틴이 측정되었지만 모노아세틴은 검출되지 않았다. 이것은 모노아세틴의 분해가 더 빠르게 일어나기 때문인 것으로 추정된다.
Aes가 아세틴 화합물을 분해한다는 상기 결과로부터 유전자
aes가
결손된 JW0465와 야생형 균주인 BW25113을 pMDT2로 형질전환 해서 재조합균주 BW-MDT2와 BW-MDT2
(Daes)를 제조하고, 이들 재조합 균주들에서의 아세틴 복합물 생산과 균체 증식을 비교했다(도 9C, 9D).
JW0465 균주는 BW25113 균주에서
aes 유전자가 결손된 균주로 NBRP (NIG, 일본)에서 분양을 받았다. 기질인 글리세롤을 10% (v/v) 첨가한 2YT 복합배지(16 g tryptone, 10 g yeast extract, and 5 g sodium chloride per liter)에서 배양을 했고, 기타 배양 및 분석조건은 상기 실시 예들과 동일하게 실시하였다.
Aes가 결손된 BW-MDT2
(Daes) 균주에서 아세틴의 분해가 차단됨으로써 아세틴 복합물 생산량이 BW-MDT2 균주에 비해서 약 2배 이상 높은 것을 확인했다. 반면에 두 재조합 균주의 균체 증식에서는 차이가 없었다. 이 결과로부터 Aes가 아세틴 화합물의 분해에 관련되고, 이 유전자를 결손하면 아세틴 복합물의 생산성을 향상시킬 수 있다는 것을 알았다.
7. 포도당을 기질로 이용한 아세틴 화합물의 생산
도 2에 제시한 바와 같이 해당경로(Embden-Meyerhof pathway)의 중간 대사산물인 글리세론 인산(glycerone phosphate, DHAP)은 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase)와 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)에 의해 글리세롤 3-인산을 거쳐서 글리세롤로 전환될 수 있다. 따라서 포도당을 출발기질로 하는 아세틴 복합물의 생산도 글리세롤 3-인산 탈수소효소와 글리세롤 3-탈인산효소의 추가 과발현을 통해서 가능하다. 글리세롤 3-인산 탈수소효소와 글리세롤 3-탈인산효소로 사카라마이세스 세레비지애(
Saccharomyces cerevisiae) 유래의 Gpd1(서열번호 14)과 Gpp2(서열번호 15)를 이용했다.
도 10은 포도당으로부터 아세틴 복합물 생산을 위해서 사카라마이세스 세레비지애 유래 글리세롤 생산 유전자인
Sc-gpd1(서열번호 31)과
Sc-gpp2(서열번호 32)를 pMDT2 플라스미드에 클로닝해서 만들어진 플라스미드 pMDT8의 구조 도면(A)과 이 플라스미드로 형질전환 된 재조합 대장균 DH-MDT8의 포도당으로부터의 아세틴 복합물 생산과 균체 증식, 배양액의 pH변화를 대조구인 DH-MDT2와 비교한 도면(B), 도면(C), 도면(D)를 나타내고 있다.
사카라마이세스 세레비지애의 염색체를 주형으로 Sc-gpd1-F(서열번호 76)와 Sc-gpd1-R(서열번호 59)을 프라이머로 이용해서
Sc-gpd1을 PCR 증폭하고, Sc-gpp2-F(서열번호 22)와 Sc-gpp2-R(서열번호 23)을 프라이머로 이용해서
Sc-gpp2을 PCR 증폭해서, 전자는 BamHI과 PstI 제한효소로, 후자는 PstI과 HindIII 제한효소로 절단해서 pMDT2 플라스미드의 해당 제한효소 부위로 도입해서 플라스미드 pMDT8를 구축했다. 배양은 재조합균주 DH-MDT2와 DH-MDT8을 글리세롤 대신에 포도당 1% (w/v)를 첨가한 2YT 복합배지에서 접종해서 48시간 동안 진행했다. 기타 배양 및 분석조건은 상기 실시 예와 동일하게 수행했다.
두 재조합 균주 중에서 유전자
Sc-gpd1과
Sc-gpp2가 발현된 DH-MDT8 균주에서만 아세틴 복합물이 생산되었고, 균체 증식 및 배양액의 pH는 유사했다.
Claims (28)
- 제1 O-아세틸 전이효소(O-acetyl transferase) 존재 하에 아세틸-CoA와 글리세롤을 반응시켜 모노아세틴 또는 다이아세틴을 얻는 단계;를 포함하는 아세틴의 제조 방법.
- 청구항 1에 있어서, 상기 제1 O-아세틸 전이효소는 말토오스 O-아세틸 전이효소인, 아세틴의 제조 방법.
- 청구항 1에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 70에 상응하는 위치의 아미노산이 아스파르트산(ASP)이고, 위치 84에 상응하는 위치의 아미노산이 아스파라긴(ASN)이고, 위치 114에 상응하는 위치의 아미노산이 히스티딘(HIS)이고, 위치 126에 상응하는 위치의 아미노산이 글루탐산(GLU)인, 아세틴의 제조 방법.
- 청구항 3에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 15에 상응하는 위치의 아미노산이 티로신(TYR) 또는 페닐알라닌(PHE)이고, 위치 26에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 글루타민(GLN)이고, 위치 30에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 리신(LYS)이고, 위치 71에 상응하는 위치의 아미노산이 티로신(TYR)이고, 위치 82에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 티로신(TYR)인 아세틴의 제조 방법.
- 청구항 1에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 1 내지 6 중 어느 하나의 서열로 이루어진 것인, 아세틴의 제조 방법.
- 청구항 1에 있어서, 클로람페니콜-O-아세틸 전이효소(Chloramphenicol-O-acetyltransferase) 또는 제2 O-아세틸 전이효소 존재 하에 상기 반응 생성물인 다이아세틴을 아세틸-CoA와 반응시켜 트리아세틴을 얻는 단계;를 더 포함하는, 아세틴의 제조 방법.
- 청구항 6에 있어서, 상기 제2 O-아세틸 전이효소는 서열번호 7의 아미노산 서열의 위치 31에 상응하는 위치의 아미노산이 시스테인(CYS) 또는 류신(LEU)이고, 위치 102에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 이소류신(ILE)이고, 위치 143에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 166에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 170에 상응하는 위치의 아미노산이 발린(VAL), 이소류신(ILE), 또는 류신(LEU)이고, 위치 193에 상응하는 위치의 아미노산이 히스티딘(HIS)인, 아세틴의 제조 방법.
- 청구항 6에 있어서, 상기 클로람페니콜-O-아세틸 전이효소(Chloramphenicol-O-acetyltransferase)는 서열번호 7의 서열로 이루어지고, 제2 O-아세틸 전이효소는 서열번호 8 내지 10 중 어느 하나의 서열로 이루어진 것인, 아세틴의 제조 방법.
- 제1 O-아세틸 전이효소(O-acetyl transferase)를 코딩하는 유전자를 발현하는 미생물을 글리세롤을 포함하는 배지 중에서 배양하는 단계;를 포함하는 아세틴의 제조 방법.
- 청구항 9에 있어서, 상기 제1 O-아세틸 전이효소는 말토오스 O-아세틸 전이효소인, 아세틴의 제조 방법.
- 청구항 9에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 70에 상응하는 위치의 아미노산이 아스파르트산(ASP)이고, 위치 84에 상응하는 위치의 아미노산이 아스파라긴(ASN)이고, 위치 114에 상응하는 위치의 아미노산이 히스티딘(HIS)이고, 위치 126에 상응하는 위치의 아미노산이 글루탐산(GLU)인, 아세틴의 제조 방법.
- 청구항 9에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 15에 상응하는 위치의 아미노산이 티로신(TYR) 또는 페닐알라닌(PHE)이고, 위치 26에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 글루타민(GLN)이고, 위치 30에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 리신(LYS)이고, 위치 71에 상응하는 위치의 아미노산이 티로신(TYR)이고, 위치 82에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 티로신(TYR)인, 아세틴의 제조 방법.
- 청구항 9에 있어서, 상기 제1 O-아세틸 전이효소를 코딩하는 유전자는 서열번호 16 내지 21의 서열 중 어느 하나의 서열로 이루어진 것인, 아세틴의 제조 방법.
- 청구항 9에 있어서, 상기 미생물은 다이아세틴에 아세틸기를 전이하는 클로람페니콜-O-아세틸 전이효소(Chloramphenicol-O-acetyltransferase) 또는 제2 O-아세틸 전이효소를 코딩하는 유전자를 더 발현하는 것인, 아세틴의 제조 방법.
- 청구항 14에 있어서, 상기 제2 O-아세틸 전이효소는 서열번호 7의 아미노산 서열의 위치 31에 상응하는 위치의 아미노산이 시스테인(CYS) 또는 류신(LEU)이고, 위치 102에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 이소류신(ILE)이고, 위치 143에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 166에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 170에 상응하는 위치의 아미노산이 발린(VAL), 이소류신(ILE), 또는 류신(LEU)이고, 위치 193에 상응하는 위치의 아미노산이 히스티딘(HIS)인, 아세틴의 제조 방법.
- 청구항 14에 있어서, 상기 클로람페니콜-O-아세틸 전이효소(Chloramphenicol-O-acetyltransferase)를 코딩하는 유전자는 서열번호 24의 서열로 이루어지고, 제2 O-아세틸 전이효소를 코딩하는 유전자는 서열번호 25 내지 27 중 어느 하나의 서열로 이루어진 것인, 아세틴의 제조 방법.
- 청구항 9에 있어서, 상기 미생물은 아세틸에스테라제(acetylesterase)를 코딩하는 유전자가 감쇄 또는 결실된 것인, 아세틴의 제조 방법.
- 청구항 9에 있어서, 상기 미생물은 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)를 코딩하는 유전자를 더 발현하고, 상기 배지는 포도당을 포함하는 것인, 아세틴의 제조 방법.
- 제1 O-아세틸 전이효소(O-acetyl transferase)를 코딩하는 유전자를 발현하는 미생물을 포함하는 아세틴 제조용 조성물.
- 청구항 19에 있어서, 상기 제1 O-아세틸 전이효소는 말토오스 O-아세틸 전이효소인, 아세틴 제조용 조성물.
- 청구항 19에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 70에 상응하는 위치의 아미노산이 아스파르트산(ASP)이고, 위치 84에 상응하는 위치의 아미노산이 아스파라긴(ASN)이고, 위치 114에 상응하는 위치의 아미노산이 히스티딘(HIS)이고, 위치 126에 상응하는 위치의 아미노산이 글루탐산(GLU)인, 아세틴 제조용 조성물.
- 청구항 19에 있어서, 상기 제1 O-아세틸 전이효소는 서열번호 5의 아미노산 서열의 위치 15에 상응하는 위치의 아미노산이 티로신(TYR) 또는 페닐알라닌(PHE)이고, 위치 26에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 글루타민(GLN)이고, 위치 30에 상응하는 위치의 아미노산이 아르기닌(ARG) 또는 리신(LYS)이고, 위치 71에 상응하는 위치의 아미노산이 티로신(TYR)이고, 위치 82에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 티로신(TYR)인, 아세틴 제조용 조성물.
- 청구항 19에 있어서, 상기 제1 O-아세틸 전이효소를 코딩하는 유전자는 서열번호 16 내지 21 중 어느 하나의 서열로 이루어진 것인, 아세틴 제조용 조성물.
- 청구항 17에 있어서, 상기 미생물은 다이아세틴에 아세틸기를 전이하는 클로람페니콜-O-아세틸 전이효소(Chloramphenicol-O-acetyltransferase) 또는 제2 O-아세틸 전이효소를 코딩하는 유전자를 더 발현하는 것인, 아세틴 제조용 조성물.
- 청구항 24에 있어서, 상기 제2 O-아세틸 전이효소는 서열번호 7의 아미노산 서열의 위치 31에 상응하는 위치의 아미노산이 시스테인(CYS) 또는 류신(LEU)이고, 위치 102에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 이소류신(ILE)이고, 위치 143에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 166에 상응하는 위치의 아미노산이 페닐알라닌(PHE) 또는 타이로신(TYR)이고, 위치 170에 상응하는 위치의 아미노산이 발린(VAL), 이소류신(ILE), 또는 류신(LEU)이고, 위치 193에 상응하는 위치의 아미노산이 히스티딘(HIS)인, 아세틴 제조용 조성물.
- 청구항 24에 있어서, 상기 클로람페니콜-O-아세틸 전이효소(Chloramphenicol-O-acetyltransferase)를 코딩하는 유전자는 서열번호 24의 서열로 이루어지고, 제2 O-아세틸 전이효소를 코딩하는 유전자는 서열번호 25 내지 27 중 어느 하나의 서열로 이루어진 것인, 아세틴 제조용 조성물.
- 청구항 19에 있어서, 상기 미생물은 아세틸에스테라제(acetylesterase)를 코딩하는 유전자가 감쇄 또는 결실된 것인, 아세틴 제조용 조성물.
- 청구항 19에 있어서, 상기 미생물은 글리세롤 3-인산 탈수소효소(glycerol-3-phosphate dehydrogenase) 및 글리세롤 3-탈인산효소(DL-glycerol-3-phosphatase)를 코딩하는 유전자를 더 발현하는 것인, 아세틴 제조용 조성물.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE112019005312.4T DE112019005312T5 (de) | 2018-10-26 | 2019-10-28 | Verfahren zur biologischen herstellung einer acetinverbindung |
| CN201980070706.6A CN112912510A (zh) | 2018-10-26 | 2019-10-28 | 用于生物生产乙酸甘油酯化合物的方法 |
| US17/288,761 US12275977B2 (en) | 2018-10-26 | 2019-10-28 | Method for biologically producing acetin compound |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20180129090 | 2018-10-26 | ||
| KR10-2018-0129090 | 2018-10-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020085879A1 true WO2020085879A1 (ko) | 2020-04-30 |
Family
ID=70331532
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2019/014256 Ceased WO2020085879A1 (ko) | 2018-10-26 | 2019-10-28 | 아세틴 화합물의 생물학적 제조 방법 |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US12275977B2 (ko) |
| KR (1) | KR102320656B1 (ko) |
| CN (1) | CN112912510A (ko) |
| DE (1) | DE112019005312T5 (ko) |
| WO (1) | WO2020085879A1 (ko) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022142251A1 (zh) * | 2020-12-30 | 2022-07-07 | 中国医学科学院药物研究所 | 一种以双醋瑞因为供体的酶促合成乙酰辅酶a的方法 |
| CN115505581A (zh) * | 2021-06-22 | 2022-12-23 | 中国科学院青岛生物能源与过程研究所 | 一种芳胺-n乙酰转移酶的突变体及其应用 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008245600A (ja) * | 2007-03-30 | 2008-10-16 | National Institute Of Advanced Industrial & Technology | 新規細菌及び該細菌を用いたグリセロールからのモノアセチンの製造方法 |
| CN102030614A (zh) * | 2010-11-15 | 2011-04-27 | 上海大学 | 生物柴油副产物甘油的提纯及合成三醋酸甘油酯的方法 |
| US20150322412A1 (en) * | 2012-12-20 | 2015-11-12 | Dsm Ip Assets B.V. | Acetyl transferases and their use for producing carotenoids |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE3004660A1 (de) | 1980-02-08 | 1981-08-13 | Henkel KGaA, 4000 Düsseldorf | Verfahren zur kontinuierlichen herstellung von triacetin |
| US5601839A (en) | 1995-04-26 | 1997-02-11 | Theratech, Inc. | Triacetin as a penetration enhancer for transdermal delivery of a basic drug |
| KR100531671B1 (ko) * | 2003-12-04 | 2005-11-28 | 씨제이 주식회사 | 서로 다른 두 개의 유기체의 공동배양을 통한 발효가능한탄소원으로부터 1,3-프로판디올의 생산방법 |
| CN103159622A (zh) | 2011-12-19 | 2013-06-19 | 天津工业大学 | 一种甘油醋酸酯的制备方法 |
| KR101590268B1 (ko) | 2014-09-16 | 2016-02-01 | 광운대학교 산학협력단 | 효소를 이용한 글리세롤 아세테이트의 제조 방법 |
| KR102636395B1 (ko) * | 2016-06-10 | 2024-02-13 | 경상국립대학교산학협력단 | 터펜 알코올 또는 그 유도체의 제조 방법 |
-
2019
- 2019-10-28 KR KR1020190134943A patent/KR102320656B1/ko active Active
- 2019-10-28 CN CN201980070706.6A patent/CN112912510A/zh active Pending
- 2019-10-28 WO PCT/KR2019/014256 patent/WO2020085879A1/ko not_active Ceased
- 2019-10-28 US US17/288,761 patent/US12275977B2/en active Active
- 2019-10-28 DE DE112019005312.4T patent/DE112019005312T5/de active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008245600A (ja) * | 2007-03-30 | 2008-10-16 | National Institute Of Advanced Industrial & Technology | 新規細菌及び該細菌を用いたグリセロールからのモノアセチンの製造方法 |
| CN102030614A (zh) * | 2010-11-15 | 2011-04-27 | 上海大学 | 生物柴油副产物甘油的提纯及合成三醋酸甘油酯的方法 |
| US20150322412A1 (en) * | 2012-12-20 | 2015-11-12 | Dsm Ip Assets B.V. | Acetyl transferases and their use for producing carotenoids |
Non-Patent Citations (2)
| Title |
|---|
| OH SEOKHYEON; PARK CHULHWAN: "Enzymatic production of glycerol acetate from glycerol", ENZYME AND MICROBIAL TECHNOLOGY, vol. 69, 29 November 2014 (2014-11-29), pages 19 - 23, XP029136365, DOI: 10.1016/j.enzmictec.2014.11.004 * |
| TSOU, M. F.: "Characterization of arylamine N-acetyltransferase in Enterobacter aerogenes", MICROBIOS, vol. 94, no. 379, 1998, pages 133 - 143 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022142251A1 (zh) * | 2020-12-30 | 2022-07-07 | 中国医学科学院药物研究所 | 一种以双醋瑞因为供体的酶促合成乙酰辅酶a的方法 |
| CN115505581A (zh) * | 2021-06-22 | 2022-12-23 | 中国科学院青岛生物能源与过程研究所 | 一种芳胺-n乙酰转移酶的突变体及其应用 |
| CN115505581B (zh) * | 2021-06-22 | 2024-04-26 | 中国科学院青岛生物能源与过程研究所 | 一种芳胺-n乙酰转移酶的突变体及其应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| US12275977B2 (en) | 2025-04-15 |
| DE112019005312T5 (de) | 2021-09-16 |
| KR20200047437A (ko) | 2020-05-07 |
| KR102320656B1 (ko) | 2021-11-02 |
| US20220112527A1 (en) | 2022-04-14 |
| CN112912510A (zh) | 2021-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2012053777A2 (en) | O-phosphoserine sulfhydrylase mutants and method for production of cysteine using the same | |
| WO2009125924A2 (ko) | 퓨트레신 고생성능을 가지는 변이 미생물 및 이를 이용한 퓨트레신의 제조방법 | |
| WO2016032279A1 (en) | Recombinant Yeast Producing 3-Hydroxypropionic Acid and Method for Producing 3-Hydroxypropionic Acid Using the Same | |
| WO2019203435A1 (ko) | 유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법 | |
| WO2011155799A2 (ko) | 탄화수소 생성능을 가지는 변이 미생물 및 이를 이용한 탄화수소의 제조방법 | |
| WO2020085879A1 (ko) | 아세틴 화합물의 생물학적 제조 방법 | |
| WO2019009593A2 (en) | BACTERIUM PRODUCING COMPONENTLY A MONOPHOSPHORYLATED LIPID A AND METHOD FOR PRODUCING A MONOPHOSPHORYLATED LIPID USING THE BACTERIUM | |
| WO2011037415A2 (ko) | 부탄올 생성능이 증가된 재조합 미생물 및 이를 이용한 부탄올의 제조방법 | |
| WO2015093831A1 (ko) | D(-)2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 d(-)2,3-부탄디올의 생산 방법 | |
| WO2015163682A1 (ko) | 2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3-부탄디올의 생산 방법 | |
| WO2014148754A1 (ko) | 2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3-부탄디올의 생산 방법 | |
| WO2011037414A2 (ko) | 알코올 생성능이 증가된 재조합 변이 미생물 및 이를 이용한 알코올의 제조방법 | |
| WO2018208120A2 (ko) | 바이오매스에서 유래한 탄소원의 고성능 대사를 위한 신규 미생물 균주 | |
| WO2013103246A2 (ko) | 퀴놀린산을 생산하는 재조합 미생물 및 이를 이용한 퀴놀린산의 생산 방법 | |
| WO2022098163A1 (ko) | 포도당으로부터 3-히드록시프로피온산의 생산능을 가지는 미생물 및 이의 용도 | |
| WO2022149651A1 (ko) | 일산화탄소 탈수소효소 및 포름산 탈수소효소를 이용한 개미산의 제조 방법 | |
| WO2016195439A1 (ko) | O-아세틸-호모세린을 생산하는 미생물 및 이를 이용하여 o-아세틸-호모세린을 생산하는 방법 | |
| WO2015060649A1 (ko) | O-숙시닐호모세린 생산 미생물 및 이를 이용한 o-숙시닐호모세린의 생산방법 | |
| WO2022019371A1 (ko) | 전자전달체에 대한 친화도 및 반응 속도가 우수한 일산화탄소 탈수소효소 및 그의 용도 | |
| WO2014081084A1 (ko) | 부탄올 생성능이 증강된 재조합 미생물 및 이를 이용한 부탄올 생산 방법 | |
| WO2018212366A1 (ko) | 캔디다 트로피칼리스 유래의 피루베이트 데카르복실라아제가 도입된 2,3-부탄다이올 생산용 재조합 효모 및 이를 이용한 2,3-부탄다이올의 생산방법 | |
| WO2019231149A1 (ko) | Crispri 시스템을 이용하여 목적 유전자로 형질전환된 숙주세포를 선별하기 위한 키트 및 이의 용도 | |
| WO2016200239A1 (ko) | 3-하이드록시프로피온산에 의해 발현이 유도되는 프로모터 시스템 및 이를 이용한 3-하이드록시프로피온산의 생물학적 생산방법 | |
| WO2021080277A1 (ko) | 신규 d-트레오닌 생산 효소 및 이를 이용한 d-트레오닌의 입체특이적 생산 방법 | |
| WO2010093150A2 (ko) | 글리세롤 대사능력 및 숙신산 생산능력이 향상된 재조합 미생물 및 이를 이용한 숙신산의 제조방법 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19875925 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 19875925 Country of ref document: EP Kind code of ref document: A1 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 17288761 Country of ref document: US |