Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
  • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
  • A61K31/19—Carboxylic acids, e.g. valproic acid
  • A61K31/194—Carboxylic acids, e.g. valproic acid having two or more carboxyl groups, e.g. succinic, maleic or phthalic acid
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
  • A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/38—Heterocyclic compounds having sulfur as a ring hetero atom
  • A61K31/381—Heterocyclic compounds having sulfur as a ring hetero atom having five-membered rings
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
  • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
  • A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
  • A61K31/404—Indoles, e.g. pindolol
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
  • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
  • A61K31/415—1,2-Diazoles
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
  • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
  • A61K31/42—Oxazoles
  • A61K31/422—Oxazoles not condensed and containing further heterocyclic rings
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
  • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
  • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
  • A61K31/445—Non condensed piperidines, e.g. piperocaine
  • A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
  • A61K31/454—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
  • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
  • A61K31/50—Pyridazines; Hydrogenated pyridazines
  • A61K31/502—Pyridazines; Hydrogenated pyridazines ortho- or peri-condensed with carbocyclic ring systems, e.g. cinnoline, phthalazine
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
  • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
  • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
  • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
  • A61K31/713—Double-stranded nucleic acids or oligonucleotides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/0012—Galenical forms characterised by the site of application
  • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
  • C07C233/00—Carboxylic acid amides
  • C07C233/64—Carboxylic acid amides having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings
  • C07C233/81—Carboxylic acid amides having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by carboxyl groups
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
  • C07C235/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms
  • C07C235/42—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings and singly-bound oxygen atoms bound to the same carbon skeleton
  • C07C235/44—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings and singly-bound oxygen atoms bound to the same carbon skeleton with carbon atoms of carboxamide groups and singly-bound oxygen atoms bound to carbon atoms of the same non-condensed six-membered aromatic ring
  • C07C235/56—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings and singly-bound oxygen atoms bound to the same carbon skeleton with carbon atoms of carboxamide groups and singly-bound oxygen atoms bound to carbon atoms of the same non-condensed six-membered aromatic ring having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a six-membered aromatic ring
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
  • C07C237/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups
  • C07C237/28—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups having the carbon atom of at least one of the carboxamide groups bound to a carbon atom of a non-condensed six-membered aromatic ring of the carbon skeleton
  • C07C237/40—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups having the carbon atom of at least one of the carboxamide groups bound to a carbon atom of a non-condensed six-membered aromatic ring of the carbon skeleton having the nitrogen atom of the carboxamide group bound to a carbon atom of a six-membered aromatic ring
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
  • C07C381/00—Compounds containing carbon and sulfur and having functional groups not covered by groups C07C301/00 - C07C337/00
  • C07C381/10—Compounds containing sulfur atoms doubly-bound to nitrogen atoms
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D205/00—Heterocyclic compounds containing four-membered rings with one nitrogen atom as the only ring hetero atom
  • C07D205/02—Heterocyclic compounds containing four-membered rings with one nitrogen atom as the only ring hetero atom not condensed with other rings
  • C07D205/04—Heterocyclic compounds containing four-membered rings with one nitrogen atom as the only ring hetero atom not condensed with other rings having no double bonds between ring members or between ring members and non-ring members
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D207/00—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
  • C07D207/02—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
  • C07D207/04—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
  • C07D207/10—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
  • C07D207/12—Oxygen or sulfur atoms
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
  • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
  • C07D209/04—Indoles; Hydrogenated indoles
  • C07D209/30—Indoles; Hydrogenated indoles with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, directly attached to carbon atoms of the hetero ring
  • C07D209/32—Oxygen atoms
  • C07D209/34—Oxygen atoms in position 2
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
  • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
  • C07D209/44—Iso-indoles; Hydrogenated iso-indoles
  • C07D209/46—Iso-indoles; Hydrogenated iso-indoles with an oxygen atom in position 1
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D209/00—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom
  • C07D209/02—Heterocyclic compounds containing five-membered rings, condensed with other rings, with one nitrogen atom as the only ring hetero atom condensed with one carbocyclic ring
  • C07D209/44—Iso-indoles; Hydrogenated iso-indoles
  • C07D209/48—Iso-indoles; Hydrogenated iso-indoles with oxygen atoms in positions 1 and 3, e.g. phthalimide
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
  • C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
  • C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
  • C07D211/08—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms
  • C07D211/10—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with radicals containing only carbon and hydrogen atoms attached to ring carbon atoms
  • C07D211/14—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with radicals containing only carbon and hydrogen atoms attached to ring carbon atoms with hydrocarbon or substituted hydrocarbon radicals attached to the ring nitrogen atom
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
  • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
  • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
  • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
  • C07D213/72—Nitrogen atoms
  • C07D213/75—Amino or imino radicals, acylated by carboxylic or carbonic acids, or by sulfur or nitrogen analogues thereof, e.g. carbamates
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D233/00—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings
  • C07D233/54—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members
  • C07D233/56—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, attached to ring carbon atoms
  • C07D233/58—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, attached to ring carbon atoms with only hydrogen atoms or radicals containing only hydrogen and carbon atoms, attached to ring nitrogen atoms
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D249/00—Heterocyclic compounds containing five-membered rings having three nitrogen atoms as the only ring hetero atoms
  • C07D249/02—Heterocyclic compounds containing five-membered rings having three nitrogen atoms as the only ring hetero atoms not condensed with other rings
  • C07D249/04—1,2,3-Triazoles; Hydrogenated 1,2,3-triazoles
  • C07D249/06—1,2,3-Triazoles; Hydrogenated 1,2,3-triazoles with aryl radicals directly attached to ring atoms
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
  • C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
  • C07D277/08—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member
  • C07D277/12—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
  • C07D277/18—Nitrogen atoms
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D333/00—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
  • C07D333/02—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings
  • C07D333/04—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom
  • C07D333/26—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
  • C07D333/38—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
  • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
  • C07D401/04—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
  • C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
  • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
  • C07D403/04—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
  • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
  • C07D403/10—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a carbon chain containing aromatic rings
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
  • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
  • C07D403/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
  • C07D403/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing three or more hetero rings
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
  • C07D405/14—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
  • C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
  • C07D409/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings directly linked by a ring-member-to-ring-member bond
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
  • C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
  • C07D409/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
  • C07D409/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing three or more hetero rings
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
  • C07D413/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
  • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
  • C07D471/08—Bridged systems
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07B—GENERAL METHODS OF ORGANIC CHEMISTRY; APPARATUS THEREFOR
  • C07B2200/00—Indexing scheme relating to specific properties of organic compounds
  • C07B2200/05—Isotopically modified compounds, e.g. labelled
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
  • C07C2601/00—Systems containing only non-condensed rings
  • C07C2601/12—Systems containing only non-condensed rings with a six-membered ring
  • C07C2601/14—The ring being saturated

Definitions

• Cancer cells exhibit preference for glycolysis instead of oxidative phosphorylation even in normoxia. Cancer cells benefit from elevated glycolytic flux to meet their high energy demands for rapid growth and proliferation. This finding is exploited clinically as a diagnostic tool for solid tumors, measuring the uptake of 2-Deoxy-2-[ 18 F]fluoroglucose by positron-emission tomography (PET) imaging. In recent years glycolysis has drawn a revived attention due to its relation to cancer and the enzymes of glycolytic pathway were explored as potential targets for therapeutic intervention.
• PET positron-emission tomography
• Small-molecule inhibitors have been identified, for example, against glucose transporters, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), hexokinase II , and hypoxia-inducible factor 1 -alpha (HIF1 -alpha).
• GPDH glyceraldehyde 3-phosphate dehydrogenase
• HIF1 -alpha hypoxia-inducible factor 1 -alpha
• glycolytic enzymes may have detrimental effects to cells as evidenced by preclinical trials of Lonidamine, which revealed significant pancreatic and hepatic toxicities, and clinical trial of 2-deoxy-D-glucose, administration of which was related to hyperglycemia in all treated patients.
• Fructose-2, 6-bisphosphate is a potent positive allosteric regulator of a key glycolytic enzyme phosphofructokinase-1 (PFK1 ).
• Fru-2,6-BP Cellular level of Fru-2,6-BP is dynamically regulated by the family of bifunctional enzymes 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatases (PFKFB1 -4), also referred to as phosphofructokinase-2 (PFK2).
• PFKFB1 -4 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatases
• PFK2 phosphofructokinase-2
• Increased level of Fru-2,6-BP promotes glycolytic flux by relieving the inhibitory effect of high ATP concentrations of PFK1 .
• PFKFB4 has shown to play a similar role in glycolytic flux but has different tissue distribution and has lower kinase:bisphosphatase ratio 4:1 , as compared to 740:1 for PFKFB3. Both PFKFB3 and PFKFB4 are induced by hypoxia in various tumors. Interestingly, expression of PFKFB4 is higher than PFKFB3 in primary glioblastomas when compared with secondary glioblastomas as well as with the lower-grade astrocytomas and correlates with poor survival. PFKFB4 was shown to be important for glioma and prostate cancer cell survival.
• PFKFB3 level and, consequently, Fru-2,6-BP and glycolysis are temporarily controlled during cell cycle progression and are elevated in G1 -S phase transition.
• Another indication of the role of PFKFB3 in the cell cycle is the inactivation of cell-cycle inhibitor p27 and activation of cell-cycle promoting kinase Cdk1 by Fru-2,6-BP in the nucleus.
• cytokine interleukin-6 The proinflammatory cytokine interleukin-6 (IL6) was shown to enhance glycolytic flux in mouse embryonic fibroblasts and human cell lines.
• T-cell activation was accompanied by a marked increase of PFKFB3 level and Fru-2,6-BP concentration.
• Rheumatoid arthritis (RA) synovium is characterized by hypoxia induced changes in the expression of PFKFB3 and PFKFB4.
• Neurodegenerative pathologies are characterized by progressive loss of hippocampal and cortex neurons in Alzheimer’s disease, dopaminergic neurons of the substantia nigra in Parkinson’s disease, or motor neurons in Amyotrophic Lateral Sclerosis.
• Experimental data suggest that excitotoxicity along with mitochondrial dysfunction and increased ROS level are a common contributing cause.
• neurons maintain low level of PFKFB3, which is continuously degraded by the E3 ubiquitin ligase anaphase- promoting complex/cyclosome-Cdh1 (APC/C-Cdh1 ).
• APC/C-Cdh1 is inhibited resulting in stabilization of PFKFB3, which leads to shifted glucose consumption by glycolysis at the expense of the pentose- phosphate pathway (PPP). This is detrimental to the redox status of glutathione and, hence, compromises the ability of neurons to detoxify reactive oxygen species (ROS) leading to apoptotic death.
• ROS reactive oxygen species
• 3PO (3-(3-pyridinyl)-1 -(4-pyridinyl)-2-propen-1 -one) and ACT-PFK-158 ((E)-1 -(pyridin-4-yl)-3-(7-(trifluoromethyl)quinolin-2-yl)prop-2-en-1 -one) were reported to inhibit PFKFB3, reduce intracellular concentration of Fru-2,6-BP, reduce glucose uptake, and reduce growth of established tumors in vivo, however the PFKFB3 inhibition of 3PO is unclear based on a conflicting study. 3PO has been extensively used in research and was shown to inhibit proliferation of activated T-cells and inhibit angiogenesis.
• New therapies which are able to regulate the role of PFKFB3 and PFKFB4 in cell metabolism and proliferation may prove useful in the treatment of a variety of pathologies .
• This disclosure relates to new phthalimide and isoindolinone derivatives as 6-phosphofructo-2- kinase/fructose-2,6-bisphosphatase-3 and -4 (PFKFB3, PFKFB4) and other PFKFB3 modulators and to pharmaceutical compositions comprising these compounds, and methods of using these compounds to reduce cellular glycolytic flux and/or treat and prevent cancer, inflammation, neurodegeneration, aging and other diseases and conditions, where the modulation of PFKFB3 and/or PFKFB4 has beneficial effect, in mammals, including humans and its use in manufacturing of the corresponding medicament and related kits.
• this disclosure relates to the new uses of agents deleting, reducing, binding, inhibiting or degrading PFKFB3, including but not limited to the known PFKFB3 inhibitors and their analogs and the inventions related to such new uses.
• PFKFB3 inhibitors can be useful for treatment of neurodegeneration, aging and aging-related diseases, disorders and conditions, can be used for rejuventation and use in manufacturing of the corresponding medicament.
• the removal or inhibition or degradation of PFKFB3 or modulation of Indirect Target as defined below is effective in decreasing the biological age of a patient or as other anti-aging treatment.
• the removal or inhibition or degradation of PFKFB3 or modulation of Indirect Target as defined below is effective in neuroprotection or treatment of neurodegenerative disease.
• Formula (0) or a pharmaceutically acceptable salt thereof, wherein RG6 and RG5 is one of the following: A) RG6 and RG5 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more substituents;
• Formula (I), wherein: Z is selected from -C( 0)- and -C(R a )(R b )-;
• R a and R b are independently selected from hydrogen, hydroxyl, halogen, optionally substituted C1-C6 alkyl, optionally substituted Ci-C6 alkoxy, optionally substituted C3-C8 cycloalkyl, optionally substituted -O-C3- C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, and optionally substituted -O-C2-C8 heterocycloalkyl;
• Ar c is selected from C3-C8 cycloalkenylene, C2-C8 heterocycloalkenylene, arylene, and heteroarylene; wherein Ar c is substituted with one or more Rc;
• each R 1 and R 2 is independently selected from hydrogen, optionally substituted C1-C6 alkyl, and optionally substituted C 3 -C 8 cycloalkyl;
• R 1 and R 2 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy;
• each R 4 and R 5 is independently selected from hydrogen, optionally substituted Ci-Ce alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• each R 6 are independently selected from optionally substituted C1 -C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• each R 7 and R 8 is independently selected from hydrogen and C1 -C6 alkyl
• R 7 and R 8 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more C1 -C6 alkyl substituents;
• An is selected from pyridinyl, pyrimidinyl, pyridazinyl, pyrazinyl, phenyl, pyrrolyl, furanyl, thiophenyl, pyrazolyl, imidazolyl, triazolyl, and tetrazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, optionally substituted C1 -C6 alkyl, optionally substituted C1 -C6 alkoxy, optionally substituted C3-C8 cycloalkyl, optionally substituted -O-C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, and optionally substituted -O-C2-C8 heterocycloalkyl;
• each R 10 and R 1 1 is independently selected from hydrogen, optionally substituted Ci-Ce alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• R 10 and R 1 1 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy;
• R 12 is selected from optionally substituted C1 -C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• Rc is not -NHCOR 6 when RL is -NHCOR 12 and Arc is heterocycloalkenylene or heteroarylene;
• RG6 and RG5 do not form a C2-C8 heterocycloalkyl ;
• A is selected from:
• R 1 is selected from hydrogen, halogen, hydroxyl, C1-C6 alkyl, and Ci-C6 alkoxy,
• each R 2 and R 3 is independently selected from hydrogen and C1-C6 alkyl
• R 2 and R 3 are taken together with the N to which they are attached to form a 3- to 10-membered heterocycle optionally substituted with one or more substituents independently selected from C1-C6 alkyl;
• R 4 is selected from hydrogen, halogen, C1-C6 alkyl, and C1-C6 alkoxy,
• C1-C6 alkyl and C1-C6 alkoxy are optionally substituted with one or more substituents independently selected from halogens;
• 5-membered heteroaryl contains at least two heteroatoms and is optionally substituted with one or more substituents independently selected from R 17 ;
• R 7 is selected from hydrogen, -NO2, C1 -C6 alkyl, C1 -C6 alkoxy, C3-C8 cycloalkyl, -O-C3-C8 cycloalkyl, 3- to 10-membered heterocycloalkyl, -0-(3- to 10-membered heterocycloalkyl), aryl, and heteroaryl,
• C1-C6 alkyl and C1-C6 alkoxy are optionally substituted with one or more halogens, and wherein C 3 -Cs cycloalkyl, -0-C 3 -Cs cycloalkyl, 3- to 10-membered heterocycloalkyl, -0-(3- to 10- membered heterocycloalkyl), aryl and heteroaryl are optionally substituted with one or more R 24 ;
• R 8 is selected from hydrogen, -NO2, C1-C6 alkyl, aryl, and heteroaryl,
• C1-C6 alkyl and C1-C6 alkoxy are optionally substituted with one or more substituents independently selected at each occurrence from halogen;
• aryl and heteroaryl are optionally substituted with one or more substituents independently selected at each occurrence from R 23 ;
• R 7 and R 8 are taken together to form a Cs-Cio carbocycle or 5- to 10-membered heterocycle, wherein C5-C10 carbocycle and 5- to 10-membered heterocycle are optionally substituted with one or more substituents independently selected from halogen, hydroxyl, -NO2, C1 -C6 alkyl, C1 -C6 alkoxy, C 3 -Cs cycloalkyl, -0-C 3 -Cs cycloalkyl, 3- to 10-membered heterocycloalkyl, -0-(3- to 10-membered heterocycloalkyl), aryl, and heteroaryl,
• C1-C6 alkyl and C1-C6 alkoxy are optionally substituted with one or more halogens, and wherein aryl, heteroaryl, C 3 -Cs cycloalkyl, -O-C3-C8 cycloalkyl, 3- to 10-membered heterocycloalkyl, and -0-(3- to 10-membered heterocycloalkyl) are optionally substituted with one or more R 23 ;
• each R 9 is independently selected from hydroxy and -COOH
• R 11 is selected from hydrogen, -NO2, C1-C6 alkyl, C1-C6 alkoxy, C 3 -Cs cycloalkyl, -0-C 3 -Cs cycloalkyl, 3- to 10-membered heterocycloalkyl, and -0-(3- to 10-membered heterocycloalkyl),
• C1-C6 alkyl and C1-C6 alkoxy are optionally substituted with one or more halogens, and wherein C 3 -Cs cycloalkyl, -0-C 3 -Cs cycloalkyl, 3- to 10-membered heterocycloalkyl, and -0-(3- to 10- membered heterocycloalkyl) are optionally substituted with one or more R 23 ;
• R 12 is selected from alanine, arginine, asparagine, aspartic acid, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine, wherein the point of attachment of R 12 is a nitrogen atom;
• heterocyclyl is optionally substituted with one or more substituents independently selected at each occurrence from R 2 and R 3 .
• R 17 is selected from C1-C6 alkyl, aryl, and 6-membered heteroaryl,
• aryl and 6-membered heteroaryl are optionally substituted with one or more substituents independently selected from halogen, -R 2 , and -OR 2 ;
• 5-membered heteroaryl contains at least two heteroatoms
• C1-C6 alkyl is optionally substituted with one or more substituents independently selected from 5-membered heteroaryl, wherein the 5-membered heteroaryl contains at least two heteroatoms;
• R 21 is selected from hydrogen and nitrile
• R 22 is selected from hydrogen and hydroxy
• each R 23 is independently selected from halogen, C1-C6 alkyl, C1-C6 alkoxy,
• C1-C6 alkyl and C1-C6 alkoxy are optionally substituted with one or more substituents independently selected from halogens;
• each R 24 is independently selected from halogen, C1-C6 alkyl, C1-C6 alkoxy, 5-membered heteroaryl wherein the C1-C6 alkyl and C1-C6 alkoxy are optionally substituted with one or more substituents independently selected from halogens;
• each X 1 is independently selected from -NR 2 - and -CR 2 R 3 -;
• each X 3 is independently selected from NH and O.
• R a and R b are independently selected from hydrogen, hydroxyl, halogen, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, optionally substituted C3-C8 cycloalkyl, optionally substituted -O-C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, and optionally substituted -O-C2-C8 heterocycloalkyl;
• Ar c is selected from C3-C8 cycloalkenylene, C2-C8 heterocycloalkenylene, arylene, and heteroarylene; wherein Ar c is substituted with one or more Rc;
• R 1 and R 2 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy;
• each R 4 and R 5 is independently selected from hydrogen, optionally substituted Ci-Ce alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• R 4 and R 5 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy;
• each R 6 are independently selected from optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• each R 7 and R 8 is independently selected from hydrogen and C1-C6 alkyl
• R 7 and R 8 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more C1-C6 alkyl substituents;
• An is selected from pyridinyl, pyrimidinyl, pyridazinyl, pyrazinyl, phenyl, pyrrolyl, furanyl, thiophenyl, pyrazolyl, imidazolyl, triazolyl, and tetrazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, optionally substituted C3-C8 cycloalkyl, optionally substituted -O-C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, and optionally substituted -O-C2-C8 heterocycloalkyl;
• each RM is independently selected from hydrogen, halogen, -OH, -CN, optionally substituted Ci -Ob alkyl, optionally substituted C1 -C6 alkoxy, optionally substituted C3-C8 cycloalkyl, optionally substituted -O-C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, and optionally substituted -O-C2-C8 heterocycloalkyl;
• each R 10 and R 1 1 is independently selected from hydrogen, optionally substituted Ci-Ce alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• R 10 and R 1 1 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy;
• R 12 is selected from optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• Rc is not -NHCOR 6 when RL is -NHCOR 12 and Arc is heterocycloalkenylene or heteroarylene;
• Arc is arylene or heteroarylene; each substituted with one or more Rc. In some embodiments of a compound of Formula (I), Arc is arylene substituted with one or two Rc. In some embodiments of a compound of Formula (I), Arc is a phenylene substituted with one or two Rc. In some embodiments of a compound of Formula (I), Arc is arylene substituted with one Rc. In some embodiments of a compound of Formula (I), Arc is phenylene substituted with one Rc. In some embodiments of a compound of Formula (I), Arc is heteroarylene substituted with one or two Rc.
• Arc is a monocyclic heteroarylene substituted with one or two Rc. In some embodiments of a compound of Formula (I), Arc is heteroarylene substituted with one Rc. In some embodiments of a compound of Formula (I), Arc is thiophenylene substituted with one Rc. In some embodiments of a compound of Formula (I), Arc is thiophenylene substituted with two Rc.
• each R 3 is independently C1-C6 alkyl optionally substituted with one or more of -OH, C1-C6 alkoxy, and -NR 1 R 2 .
• each R 3 is
• each R 4 and R 5 is independently selected from hydrogen and C1-C6 alkyl; or R 4 and R 5 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl, optionally substituted with one or more C1-C6 alkyl substituents.
• each R 4 and R 5 are hydrogen.
• An is selected from pyridinyl, pyrimidinyl, pyrazinyl, phenyl, thiophenyl, pyrazolyl, and imidazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, Ci-Ce alkyl, and Ci-C6 alkoxy.
• An is phenyl optionally substituted by one or more substituents selected from halogen, -OH, -NR 7 R 8 , -CN, Ci-Ce alkyl, and Ci-C6 alkoxy.
• each RM is independently selected from hydrogen, halogen, -OH, -CN, Ci-Ce alkyl, and Ci-C6 alkoxy.
• one RM is selected from hydrogen, halogen, -OH, -CN, C1-C6 alkyl, and Ci-C6 alkoxy; and each other RM is independently selected from hydrogen and halogen.
• each RM is hydrogen.
• R 10 is hydrogen; and
• R 1 1 is selected from hydrogen, HO
• R 12 is selected from C1-C6 alkyl and aryl optionally substituted with one or more C1-C6 alkyl substituents.
• RL is tetrazolyl.
• RL is triazolyl.
• each R 1 and R 2 is independently selected from hydrogen and C1-C6 alkyl; or R 1 and R 2 are taken together with the N to which they are attached to form a C 2 -C8 heterocycloalkyl, optionally substituted with one or more C1-C6 alkyl substituents.
• each R 1 , R 2 , R 7 and R 8 is independently selected from hydrogen and C1-C6 alkyl.
• each R 1 and R 8 is hydrogen and each R 2 and R 7 is independently selected from hydrogen and C1-C6 alkyl.
• R 1 , R 2 , R 7 and R 8 are each hydrogen.
• the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug.
• the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug and the prodrug comprises an ester moiety.
• the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug and the prodrug comprises an amide moiety.
• the disclosure provides compounds of Formula (la) or Formula (lb):
• Arc is selected from arylene and heteroarylene; wherein Arc is substituted with one or more Rc;
• R 1 and R 2 are taken together with the N to which they are attached to form a C 2 -Cs heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy;
• each R 7 and R 8 is independently selected from hydrogen and C1-C6 alkyl
• R 7 and R 8 are taken together with the N to which they are attached to form an optionally substituted C2-C8 heterocycloalkyl optionally substituted with one or more Ci-Ce alkyl substituents;
• An is selected from pyridinyl, pyrimidinyl, pyrazinyl, phenyl, thiophenyl, pyrazolyl, and imidazolyl, wherein An is optionally substituted by one or more substituents selected from halogen, -OH, -NR 7 R 8 , -CN, Ci -Ce alkyl , and Ci-C6 alkoxy;
• R 9 is C1-C6 alkyl optionally substituted with one or more substituent independently selected from -OH and -NR 1 R 2 ;
• R 10 and R 1 1 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more C1-C6 alkyl substituents;
• Arc is arylene substituted with one or two Rc.
• Arc is a monocyclic arylene substituted with one or two Rc.
• Arc is arylene substituted with one Rc.
• Arc is phenylene substituted with one Rc.
• Arc is heteroarylene substituted with one or two Rc.
• Arc is a monocyclic heteroarylene substituted with one or two Rc. In some embodiments of a compound of Formula (la) or Formula (lb), Arc is heteroarylene substituted with one Rc. In some embodiments of a compound of Formula (la) or Formula (lb), Arc is thiophenylene substituted with one Rc. In some embodiments of a compound of Formula (la) or Formula (lb), Arc is thiophenylene substituted with two Rc.
• each R 3 is independently C1-C6 alkyl optionally substituted with one or more substituents independently selected from C1-C6 alkoxy and -NR 1 R 2 .
• each R 3 is independently C1-C6 alkyl optionally substituted with one or more substituents independently selected from C1-C6 alkoxy and -NR 1 R 2 .
• each R 4 and R 5 is independently selected from hydrogen and C1-C6 alkyl; or R 4 and R 5 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl, optionally substituted with one or more C1-C6 alkyl substituents.
• each R 4 and R 5 is hydrogen.
• at least one of Rc is -CN.
• at least one of Rc is tetrazolyl.
• An is phenyl optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, C1-C6 alkyl, and Ci-C6 alkoxy.
• An is selected from pyridinyl, pyrimidinyl, pyrazinyl, thiophenyl, pyrazolyl and imidazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, Ci-Ce alkyl, and Ci-C6 alkoxy.
• An is selected from thiophenyl, pyrazolyl, and imidazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, C1 -Ce alkyl , and Ci-C6 alkoxy.
• An is imidazolyl optionally substituted by methyl.
• ⁇ In some embodiments of a compound of Formula (la) or
• RL is triazolyl.
• each R 1 and R 2 is independently selected from hydrogen and C1-C6 alkyl, or R 1 and R 2 are taken together with the N to which they are attached to form an optionally substituted C2-C8 heterocycloalkyl optionally substituted with one or more C1- C6 alkyl substituents.
• each R 1 , R 2 , R 7 and R 8 is hydrogen.
• the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug.
• the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug and the prodrug comprises an ester moiety.
• the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug and the prodrug comprises an amide moiety.
• the disclosure provides compounds of Formula (II): Formula (II), a prodrug thereof, a pharmaceutically acceptable salt thereof, or combination thereof, wherein:
• Ft a and Ft b are each independently selected from hydrogen, halogen, -OH, C1-C6 alkyl, C1-C6 alkoxy;
• Arc is selected from arylene and heteroarylene; wherein Arc is substituted with one or more Rc;
• R 1 and R 2 are taken together with the N to which they are attached to form a C 2 -Cs heterocycloalkyl optionally substituted with one or more C1-C6 alkyl substituents;
• R 4 and R 5 are taken together with the N to which they are attached to form a C 2 -Cs heterocycloalkyl optionally substituted with one or more C1-C6 alkyl substituents;
• each R 7 and R 8 is independently selected from hydrogen and C1-C6 alkyl
• R 7 and R 8 are taken together with the N to which they are attached to form an optionally substituted C 2 -C8 heterocycloalkyl optionally substituted with one or more Ci-Ce alkyl substituents;
• An is selected from pyridinyl, pyrimidinyl, pyrazinyl, phenyl, thiophenyl, pyrazolyl, and imidazolyl, wherein An is optionally substituted by one or more substituents selected from halogen, -OH, -NR 7 R 8 , -CN, Ci -Ce alkyl , and C1-C6 alkoxy;
• each RM is independently selected from hydrogen, halogen, -OH, -CN, optionally substituted C1-C6 alkyl, and optionally substituted C1-C6 alkoxy;
• R 10 and R 11 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more C1-C6 alkyl substituents;
• R 12 is selected from C1-C6 alkyl and aryl optionally substituted with one or more C1-C6 alkyl substituents;
• one RM is selected from hydrogen, halogen, -OH, -CN, Ci -Ce alkyl , and Ci-C6 alkoxy; and each other RM is independently selected from hydrogen and halogen.
• each RM is hydrogen.
• the disclosure provides compounds of Formula (III):
• R a and R b are each independently selected from hydrogen, halogen, -OH, C1 -C6 alkyl, C1 -C6 alkoxy;
• Arc is selected from arylene and heteroarylene; wherein Arc is substituted with one or more Rc;
• R 1 and R 2 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more C1 -C6 alkyl substituents;
• R 4 and R 5 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more C1 -C6 alkyl substituents;
• R 6 is selected from optionally substituted C1 -C6 alkyl and optionally substituted aryl;
• each R 7 and R 8 is independently selected from hydrogen and C1-C6 alkyl
• R 7 and R 8 are taken together with the N to which they are attached to form an optionally substituted C2-C8 heterocycloalkyl optionally substituted with one or more C1 -C6 alkyl substituents;
• An is selected from pyridinyl, pyrimidinyl, pyrazinyl, phenyl, thiophenyl, pyrazolyl, and imidazolyl, wherein An is optionally substituted by one or more substituents selected from halogen, -OH, -NR 7 R 8 , -CN, Ci -Ce alkyl , and Ci-C6 alkoxy;
• each RM is independently selected from hydrogen, halogen, -OH, -CN, optionally substituted Ci-Ce alkyl, and optionally substituted Ci-C6 alkoxy;
• R 9 is C1-C6 alkyl optionally substituted with one or more substituents independently selected from -OH and -NR 1 R 2 ;
• R 10 and R 1 1 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more C1-C6 alkyl substituents;
• R 12 is selected from C1-C6 alkyl and aryl optionally substituted with one or more C1-C6 alkyl substituents;
• one RM is selected from hydrogen, halogen, -OH, -CN, Ci-Ce alkyl, and Ci-C6 alkoxy; and each other RM is independently selected from hydrogen and halogen. In some embodiments of a compound of Formula (III), each RM is hydrogen.
• the disclosure provides compounds of Formula (IV):
• R a and R b are each independently selected from hydrogen, fluorine and methyl ;
• Arc is selected from arylene and heteroarylene; each substituted with one or more Rc;
• each R 1 and R 2 is independently selected from hydrogen and C1-C6 alkyl
• R 1 and R 2 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl; each R 3 is independently C1-C6 alkyl optionally substituted with one or more -NR 1 R 2 or C1-C6 alkoxy;
• An is selected from pyridinyl, phenyl, thiophenyl, pyrazolyl, imidazolyl, and tetrazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, -NR 7 R 8 , C1-C6 alkyl, and C1-C6 alkoxy;
• each RM is independently selected from hydrogen and halogen
• R 12 is selected from C1-C6 alkyl and aryl.
• Arc is selected from phenylene and monocyclic heteroarylene; each substituted with one or more Rc;
• each R 3 is independently C1-C6 alkyl optionally substituted with one or more -NR 1 R 2 ;
• An is selected from pyridinyl, phenyl, thiophenyl, pyrazolyl, imidazolyl, and tetrazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, C1-C6 alkyl, and C1-C6 alkoxy;
• each RM is hydrogen
• R 12 is C1-C6 alkyl or aryl.
• Arc is arylene substituted with one Rc
• An is selected from pyridinyl, phenyl, thiophenyl, pyrazolyl, imidazolyl, and tetrazolyl, wherein An is optionally substituted by one or more of halogen, Ci -Ce alkyl, and C1-C6 alkoxy;
• each RM are hydrogen
• R 12 is Ci-Ce alkyl.
• Arc is phenylene.
• Arc is heteroarylene substituted with one or two Rc;
• each Rc is independently selected from -CN, Ci-Ce alkyl, and aryl ;
• An is phenyl optionally substituted by one or more substituents independently selected from halogen, C1- C 6 alkyl, or C1-C6 alkoxy;
• each RM are hydrogen
• Arc is thiophenylene.
• one of Rc is -CN.
• Arc is arylene substituted with one Rc
• R 1 and R 2 is independently selected from hydrogen and C1-C6 alkyl
• R 3 is C1-C6 alkyl optionally substituted with one NR 1 R 2 ;
• An is phenyl optionally substituted by one or more substituents independently selected from halogen, Ci- Ce alkyl, and C1-C6 alkoxy;
• each RM are hydrogen
• Arc is phenylene.
• Arc is arylene substituted with one Rc
• An is selected from pyridinyl, phenyl, thiophenyl, pyrazolyl, imidazolyl, and tetrazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, C1-C6 alkyl, and C1-C6 alkoxy;
• each RM are hydrogen
• R 12 is Ci-C 6 alkyl.
• Arc is phenylene.
• Arc is heteroarylene substituted with one or two Rc;
• each Rc is independently selected from -CN, Ci-Ce alkyl, and aryl ;
• An is phenyl optionally substituted by one or more of halogen, C1-C6 alkyl, or C1-C6 alkoxy;
• each RM are hydrogen
• R 12 is Ci-Ce alkyl.
• Arc is thiophenylene.
• one of Rc is -CN.
• Arc is arylene substituted with one Rc
• R 1 and R 2 is independently selected from hydrogen and C1-C6 alkyl
• R 3 is C1-C6 alkyl optionally substituted with one -NR 1 R 2 ;
• An is phenyl optionally substituted by one or more of halogen, Ci -Ob alkyl, or C1-C6 alkoxy;
• each RM are hydrogen
• R 10 is selected from hydrogen and C 1 -C 6 alkyl
• R 12 is Ci-Ce alkyl.
• Arc is phenylene.
• the disclosure provides compounds of Formula (V):
• R a and R b are each independently selected from hydrogen, fluorine and methyl ;
• RC2 is selected from hydrogen, halogen, -OH, Ci -Ce alkyl , C1-C6 hydroxyalkyl and Ci-C6 alkoxy;
• R 3 is C1-C6 alkyl optionally substituted with one or more substituent selected from -NR 1 R 2 or C1-C6 alkoxy; each R 1 and R 2 is independently selected from hydrogen and C1-C6 alkyl;
• R 1 and R 2 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl
• An is selected from pyridinyl, phenyl, thiophenyl, pyrazolyl, imidazolyl, and tetrazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, Ci-Ce alkyl, and C1-C6 alkoxy;
• each RM is independently selected from hydrogen and halogen
• R 10 is selected from hydrogen and C1-C6 alkyl
• R 12 is selected from C1-C6 alkyl and aryl.
• RC2 is hydrogen.
• An is selected from pyridinyl, phenyl and thiophenyl, each optionally substituted by one or more substituents independently selected from halogen, C1-C6 alkyl, and C1-C6 alkoxy.
• An is pyrazolyl or imidazolyl each optionally substituted by methyl.
• R a and R b are each independently selected from hydrogen, fluorine and methyl ;
• RC2 is selected from hydrogen, halogen, -OH, Ci -Ce alkyl , C1-C6 hydroxyalkyl, Ci-C6 alkoxy and aryl;
• An is phenyl optionally substituted by one or more substituents independently selected from halogen, C1- C6 alkyl, and Ci-C6 alkoxy;
• each RM is independently selected from hydrogen and halogen
• R 10 is selected from hydrogen and C1-C6 alkyl
• R 12 is selected from C1-C6 alkyl and aryl.
• Rc2 is selected from C1-C6 alkyl and phenyl.
• Z is -CH2-.
• each RM is hydrogen.
• RL is tetrazolyl.
• the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug.
• the prodrug comprises an ester moiety.
• the prodrug comprises an amide moiety.
• a pharmaceutical composition comprising a compound of Formula (0), (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VI IA) or (VIIB) and one or more pharmaceutically acceptable carrier.
• a pharmaceutical composition comprising a compound of Formula (0), (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VI IA) or (VI IB) in combination with another therapeutic agent, and optionally, one or more pharmaceutically acceptable carriers.
• the pharmaceutical composition further comprises a second therapeutic agent.
• the second therapeutic agent is an anti-cancer agent.
• Also disclosed herein is a method of inhibition of the glycolysis in a cell, comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VI I A) or (VI IB) .
• Also disclosed herein is a method of modulating the activity of PFKFB3 and/or PFKFB4 in a cell, comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III),
• Also disclosed herein is a method of inhibition of PFKFB3 and/or PFKFB4 in a cell, comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).
• Also disclosed herein is a method of inhibiting 6-phosphofructo-2-kinase/fructose-2,6- bisphosphatase 3 (PFKFB3), the method comprising contacting PFKFB3 with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).
• PFKFB3 6-phosphofructo-2-kinase/fructose-2,6- bisphosphatase 3
• Also disclosed herein is a method of inhibiting 6-phosphofructo-2-kinase/fructose-2,6- bisphosphatase 4 (PFKFB4), the method comprising contacting PFKFB4 with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). .
• Also disclosed herein is a method of inhibiting of PFKFB3 and/or PFKFB4 in a cell, the method comprising contacting a cell with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV),
• V (V), (VI), (VII), (VIIA) or (VIIB).
• Also disclosed herein is a method of treatment or prophylaxis of disease or condition for which glycolysis inhibition has beneficial effect, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).
• Also disclosed herein is a method of treatment or prophylaxis of disease or condition for which PFKFB3 and/or PFKFB4 inhibition has beneficial effect, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of reducing glycolytic flux in a cell, the method comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of treating an autoimmune disease, an inflammatory disorder, a metabolic disease, a viral disease, a proliferative disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of reducing proliferative capacity in a cell, the method comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).
• Also disclosed herein is a method of increasing of cell antioxidant capacity, the method comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of enhancing the effect of radiation treatment of cancer, the method comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of decreasing the ability of the cancer cells to repair their DNA, the method comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (la),
• Also disclosed herein is a method of sensitizing cancer cell towards cytostatic and/or radiation therapy, the method comprising contacting the cell with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of treatment of neoplasm sensitive to inhibition of PFKFB3 or/and PFKFB4, the method comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of treatment of neoplasm sensitive to inhibition of glycolysis, the method comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of reducing proliferative capacity in a cancer cell, the method comprising contacting the cancer cell with an effective amount of a compound of Formula (0), (I), (la), (lb), (II ),
• Also disclosed herein is a method of treatment of a cancer, the method comprising administering to the subject an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of treatment of cancer comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III),
• Also disclosed herein is a method of treatment of solid tumor comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).
• Also disclosed herein is a method of treatment of a hematological cancer, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of treatment of cancer selected from kidney cancer, colon cancer, pancreatic cancer, lung cancer, breast cancer, triple negative breast cancer, liver cancer, lymphoma, leukemia, myeloma, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of treatment of cancer selected from : atypical teratoid rhabdoid tumor, brain tumor, anal cancer, astrocytoma , vaginal cancer, extrahepatic bile duct cancer, intraocular melanoma, hairy cell leukemia, hepatocellular liver cancer, gestational trophoblastic disease , germ cell tumor, hypopharyngeal cancer, histiocytosis, histiocytosis Langerhans, high-grade astrocytoma, astrocytoma, glioma, brain stem glioma, invasive lobular carcinoma, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, non-specific lymphoma mantle cell, lymphogranulomatosis, colorectal cancer, craniopharyngioma, leukemia, mast cell leukemia, Burkitt'
• Also disclosed herein is a method for treating of a cancer, which comprises administering an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VI I A) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VII A) or (VIIB) and at least one other anti-cancer medication.
• Also disclosed herein is a method for treating of a cancer, which comprises administering an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VI IA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VII A) or (VIIB) and at least one other anti-cancer medication selected from Irinotecan and Sunitinib.
• Also disclosed herein is a method for treating of a cancer, which comprises administering an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). and at least one other anti-cancer medication, wherein anti-cancer medication is targeted therapy.
• Also disclosed herein is a method for treating of a cancer, which comprises administering an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). and at least one other anti-cancer medication, wherein anti-cancer medication is immunotherapy.
• Also disclosed herein is a method of treating a cancer cell, comprising contacting the cancer cell with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). .
• Also disclosed herein is a method of inducing an apoptosis of cancer cell, comprising contacting the cancer cell with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). .
• Also disclosed herein is a method of inhibition of angiogenesis comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB). or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB).
• Also disclosed herein is a method for neuroprotection comprising administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0),
• PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb),
• PFKFB3 inhibitor including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XI I), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX
• a neurodegenerative disease selected from Alzheimer's disease, amyotrophic lateral sclerosis, Huntington’s disease, and Parkinson’s disease, Late-onset Alzheimer disease, stroke, ataxia telangiectasia (Louis-Bar syndrome), argyrophilic grain disease, autosomal dominant cerebellar ataxia, Batten disease ( Saintmeyer-Vogt-Sjogren-Batten disease), corticobasal degeneration, corticobasal ganglionic degeneration, progressive supranuclear palsy (Steele-Richardson- Olszewski syndrome), Creutzfeldt-Jakob disease, fatal familial insomnia, frontotemporal dementia and parkinsonism linked to chromosome 17, neuronal intermediate filament inclusion disease, basophilic inclusion body disease, Pick disease, dementia with Lewy bodies, multiple-system atrophy, hereditary motor and sensory neuropathy with proximal dominance, infantile refsum disease, Machado-Jo
• Also disclosed herein is a method of decreasing a glycolytic uptake in neuron, comprising contacting the neuron with an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.
• PFKFB3 inhibitor including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI),
• Also disclosed herein is a method of prevention of apoptotic death of neuron, comprising contacting the neuron with an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.
• PFKFB3 inhibitor including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI
• Also disclosed herein is a method of prevention of apoptotic death of neuron triggered by glutamate receptor over-activation, administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VI IA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VI), (VI
• Also disclosed herein is a method of prevention of apoptotic death of neuron triggered by glutamate receptor over-activation, comprising contacting the neuron with an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.
• PFKFB3 inhibitor including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII
• Also disclosed herein is a method of decreasing a glycolytic uptake in astrocyte, comprising contacting the astrocyte with an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.
• PFKFB3 inhibitor including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (X
• PFKFB3 inhibitor including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XI I), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F , G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VI IB),(VII I), (
• PFKFB3 inhibitor including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XI I), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII),
• Also disclosed herein is a method of protection of enteric neuron against excitotoxicity comprising administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(V
• Also disclosed herein is a method of protection of neuron against excitotoxicity comprising, comprising contacting the neuron with an effective amount of a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application.
• PFKFB3 inhibitor including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (
• Also disclosed herein is a method of treatment of an autoimmune disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0) , (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VI IB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of treatment of an autoimmune disease selected from psoriasis, systemic lupus erythematosus, scleroderma, graft-versus-host disease, or transplanted organ rejection comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of treatment inflammation, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of treatment of disorder selected from atherosclerosis, arthritis, rheumatoid arthritis, cystic fibrosis, inflammatory bowel disease, cerebral ischemia, neurological insult, influenza, inflammation, comprising administering to a subject in need thereof an effective amount of a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (
• Also disclosed herein is a method of decreasing atherosclerotic inflammation and/or at least one of its clinical consequences comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of treatment of metabolic disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VI IA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb),
• Also disclosed herein is a method of treatment of glucose metabolism disorder comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II),
• Also disclosed herein is a method of treatment of hyperlactatemia comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI),
• VII (VII), (VIIA) or (VIIB) or a pharmaceutical composition
• a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of immunosuppression, comprising the step of administering to a patient in need thereof a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (V IIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of prophylaxis of cancer, an autoimmune disease, an inflammatory disorder, a metabolic disease, a viral disease, a proliferative disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of prophylaxis of neoplasm sensitive to inhibition of PFKFB3 or/and PFKFB4, the method comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of prophylaxis of neoplasm sensitive to inhibition of glycolysis, the method comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of prophylaxis of a cancer, the method comprising administering to the subject an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb),
• Also disclosed herein is a method of prophylaxis of cancer selected from solid tumors, namely kidney, colon, pancreas, lung, breast and liver cancers, and hematologic neoplasms, namely lymphoma, leukemia and myeloma, a hematological cancer, breast cancer, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of prophylaxis of a hematological cancer, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II),
• Also disclosed herein is a method of prophylaxis of cancer selected from kidney cancer, colon cancer, pancreatic cancer, lung cancer, breast cancer, triple negative breast cancer, liver cancer, lymphoma, leukemia, myeloma, comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of prophylaxis of cancer selected from: atypical teratoid rhabdoid tumor, anal cancer, astrocytoma , vaginal cancer, extrahepatic bile duct cancer, intraocular melanoma, hairy cell leukemia, hepatocellular liver cancer, gestational trophoblastic disease, germ cell tumor, hypopharyngeal cancer, histiocytosis, histiocytosis Langerhans, glioma, high-grade astrocytoma, astrocytoma, brain stem glioma, invasive lobular carcinoma, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, non-specific lymphoma mantle cell, lymphogranulomatosis, colorectal cancer, craniopharyngioma, leukemia, mast cell leukemia, Burkitt's
• Also disclosed herein is a method for prophylaxis of a cancer, which comprises administering an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VI I A) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VII A) or (VIIB) .
• PFKFB3 inhibitor including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XI I), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (
• Also disclosed herein is a method of prophylaxis of a neurodegenerative disease selected from Alzheimer's disease, amyotrophic lateral sclerosis, stroke, Huntington’s disease, and Parkinson’s disease, Late- onset Alzheimer disease, ataxia telangiectasia (Louis-Bar syndrome), argyrophilic grain disease, autosomal dominant cerebellar ataxia, Batten disease ( Saintmeyer-Vogt-Sjogren-Batten disease), corticobasal degeneration, corticobasal ganglionic degeneration, progressive supranuclear palsy (Steele-Ftichardson- Olszewski syndrome), Creutzfeldt-Jakob disease, fatal familial insomnia, frontotemporal dementia and parkinsonism linked to chromosome 17, neuronal intermediate filament inclusion disease, basophilic inclusion body disease, Pick disease, dementia with Lewy bodies, multiple-system atrophy, hereditary motor and sensory neuropathy with proximal dominance, infantile refsum disease, Macha
• PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1 863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II
• Also disclosed herein is a method of prophylaxis of an autoimmune disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), ( lb), (II),
• composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of prophylaxis of a disease selected from psoriasis, systemic lupus erythematosus, scleroderma, graft-versus-host disease, and transplanted organ rejection comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VI I A) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of prophylaxis of an inflammatory disorder comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) .
• Also disclosed herein is a method of prophylaxis of disorder selected from atherosclerosis, arthritis, rheumatoid arthritis, cystic fibrosis, inflammatory bowel disease, cerebral ischemia, neurological insult, influenza, inflammation, comprising administering to a subject in need thereof an effective amount of PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a compound of PFKFB3 inhibitor, including but not limited to a compound of Formula (0),
• Also disclosed herein is a method of prophylaxis of metabolic disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb),
• Also disclosed herein is a method of prophylaxis of glucose metabolism disorder comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II),
• Also disclosed herein is a method of prophylaxis of hyper lactatemia comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb),
• Also disclosed herein is a method of manufacturing a medication, comprising the use of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) as an active ingredient.
• Also disclosed herein is a method of manufacturing a medication, comprising the use of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) as an active ingredient, wherein the medicament is at least one of the following: medicament for treating a disease or condition for which glycolysis inhibition has beneficial effect, medicament for treating a cancer, a neuroprotector, a medicament for the treatment or prophylaxis of a disease or condition for which inhibition of kinase activity of PFKFB3 and/or PFKFB4 has beneficial effect, an inhibitor of glycolysis, an inhibitor of angiogenesis.
• the medicament is at least one of the following: medicament for treating a disease or condition for which glycolysis inhibition has beneficial effect, medicament for treating a cancer, a neuroprotector, a medicament for the treatment or prophylaxis of a disease or condition for which inhibition of kinase activity of PFKFB3 and/or
• kits for treating a PFKFB3 and/or PFKFB4-mediated condition comprising (a) a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) ; and (b) instructions for use.
• kits for treating a cancer comprising (a) a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA) or (VIIB) ; and (b) instructions for use.
• the compound described in this disclosure or a pharmaceutically acceptable salt thereof is in the form of a prodrug.
• the prodrug comprises an ester moiety.
• the prodrug comprises an amide moiety.
• a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB), (VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described in this application or other PFKFB3 inhibitors described in this application and one or more pharmaceutically acceptable carrier comprised in the inventions described in any one of the items 1 548 to 1848.
• a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II),
• the pharmaceutical composition further comprises a second therapeutic agent.
• Also disclosed herein is a method of modulating the activity of PFKFB3 in a neuron, comprising contacting the neuron with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VII A), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or
• Also disclosed herein is a method for neuroprotection comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitor
• Also disclosed herein is a method of treatment of a neurodegenerative disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PF
• Also disclosed herein is a method of treatment of a neurodegenerative disease selected from Alzheimer's disease, amyotrophic lateral sclerosis, Huntington’s disease, and Parkinson’s disease, Late-onset Alzheimer disease, stroke, ataxia telangiectasia (Louis-Bar syndrome), argyrophilic grain disease, autosomal dominant cerebellar ataxia, Batten disease ( Saintmeyer-Vogt-Sjogren-Batten disease), corticobasal degeneration, corticobasal ganglionic degeneration, progressive supranuclear palsy (Steele-Ftichardson- Olszewski syndrome), Creutzfeldt-Jakob disease, fatal familial insomnia, frontotemporal dementia and parkinsonism linked to chromosome 17, neuronal intermediate filament inclusion disease, basophilic inclusion body disease, Pick disease, dementia with Lewy bodies, multiple-system atrophy, hereditary motor and sensory neuropathy with proximal dominance, infantile refsum disease, Machado-Jo
• Also disclosed herein is a method of decreasing a glycolytic uptake in neuron, comprising contacting the neuron with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VI II), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application.
• Also disclosed herein is a method of prevention of apoptotic death of neuron, comprising contacting the neuron with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VII A), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or other formulas described below in this application or other PFKFB3 inhibitors described in this application
• Also disclosed herein is a method of prevention of apoptotic death of neuron triggered by glutamate receptor over-activation, administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII) , (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV),
• Also disclosed herein is a method of prevention of apoptotic death of neuron triggered by glutamate receptor over-activation, comprising contacting the neuron with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below
• Also disclosed herein is a method of decreasing a glycolytic uptake in astrocyte, comprising contacting the astrocyte with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V),
• Also disclosed herein is a method of inhibition reactive astrocyte proliferation comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VI IB),(VI II), (IX), (X) , (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items
• Also disclosed herein is a method of protection of neuron against excitotoxicity comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II),
• PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items
• Also disclosed herein is a method of protection of enteric neuron against excitotoxicity comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VI IB),(VI 11), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A
• Also disclosed herein is a method of protection of neuron against excitotoxicity comprising, comprising contacting the neuron with an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III),
• Also disclosed herein is a method of treatment of an autoimmune disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VI IB),(VI II), (IX), (X) , (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items
• Also disclosed herein is a method of prophylaxis of a neurodegenerative disease comprising administering to a subject in need thereof an effective amount of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below or a pharmaceutical composition comprising a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII), (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items
• Also disclosed herein is a method of manufacturing a medication, comprising the use of a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII) , (XIII) or any one of PFKFB3 inhibitors selected from any one of the items 1 to 1863 or items A,B,C,D,E, F, G,H below as an active ingredient, wherein the medicament is at least one of the following:, a neuroprotector, a anti-aging medication, a rejuvenation medication.
• kits for treating a PFKFB3-mediated neurodegerative condition comprising (a) a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII) ,
• kits for treating a PFKFB3-mediated aging related disease or condition comprising (a) a pharmaceutical composition comprising a PFKFB3 inhibitor, including but not limited to a compound of Formula (0), (I), (la), (lb), (II), (III), (IV), (V), (VI), (VII), (VIIA), (VIIB),(VIII), (IX), (X), (XI), (XII),
• this invention is a kit, comprising an agent, disclosed or described in this disclosure, including but not limited to PFKFB3 inhibitor, or composition disclosed in this application or its functional or structural analog or prodrug and the notice, description or instruction regarding the reduction or modulating or binding or inhibiting or degrading of PFKFB3, by the means of such agent or composition for anti-aging treatment or for neuroprotection, optionally comprising at least the medication labeling information, optionally wherein such notice, description or instruction comprises information about administration of corresponding agent or composition in a dosage and regimen, optionally to produce the biological effect comparable or alike or close to the inhibition of PFKFB3.
• this invention is a kit, comprising an agent, modulating or binding or inhibiting or degrading or activating at least one of the Indirect Targets, optionally, wherein such modulation or binding or inhibiting or degrading or activating has anti-aging or neurpoprotective effect and the notice, description or instruction regarding the modulation or binding or inhibiting or degrading or activating or reduction of at least one such Indirect Targets, by the means of such agent or compositionfor anti-aging treatment or neurpoprotection, optionally comprising at least the medication labeling information, optionally wherein such notice, description or instruction comprises information about administration of corresponding agent or composition in dosage and regimen to produce the biological effect comparable or alike or close to the inhibition of PFKFB3.
• this invention is a kit, comprising the PFKFB3 inhibitor or pharmaceutical composition, comprising such inhibitor and a notice, description or instruction regarding the inhibition of PFKFB3 by the means of such inhibitor or pharmaceutical composition for anti-aging treatment.
• this invention is a kit, comprising an PFKFB3 inhibitor or any other agent of this invention and a notice, description or instruction for its use by human or by other animal subject in a dosage and regimen to maintain concentration of such agent in blood of such subject.
• a notice, description or instruction comprises information related to the deactivation, inhibition or of PFKFB3 for anti-aging treatment.
• this invention is a kit, comprising an PFKFB3 inhibitor or any other agent of this invention and a notice, description or instruction for its use by human or by other animal subject in a dosage and regimen to maintain concentration of such agent in blood of such subject.
• a notice, description or instruction comprises information related to the deactivation, inhibition or of PFKFB3 for neuroprotection.
• the mentioned notice, description or instruction attached to such device or imprinted or drawn or in any other way displayed on such device or in any other way associated with such kit or composition e.g. in machine readable form.
• One of the primary purposes of some aspects of his invention is to provide medication for anti-aging treatment and treatment of neurodegeneration.
• the medication or kit comprising medication of this invention should be accompanied with the notice, description or instruction (e.g., treatment and/or operation guidelines).
• the contents and appearance of such notice, description or instruction is regulated by the respective national or international rules regarding labeling of medication, incorporated here by reference or such notice, description or instruction comsprise at least part or optionally most of the or optionally all the information required by applicable here nes labeling regulations.
• the Federal Food, Drug and Cosmetic Act (FFDCA) in USA is the law under which the FDA takes action against regulated products.
• label' is defined as a: 'display of written, printed, or graphic matter upon the immediate container of any article...' The term 'immediate container' does not include package liners.
• 'labeling' is : 'all labels and other written, printed, or graphic matter (1 ) upon any article or any of its containers or wrappers, or (2) accompanying such article' at any time while a device is held for sale after shipment or delivery for shipment in interstate commerce.
• the term 'accompanying' is interpreted liberally to mean more than physical association with the product. It extends to posters, tags, pamphlets, circulars, booklets, brochures, instruction books, direction sheets, fillers, etc.
• 'Accompanying' also includes labeling that is brought together with the device after shipment or delivery for shipment in interstate commerce. According to an appellate court decision: "Most, if not all advertising, is labeling.
• the notice, description or instruction including but not limited to labeling means (e.g., treatment and/or operation guidelines) can be provided in any form that conveys the requisite information.
• Instruction means can be audio, for example spoken word, recorded in analog or digital form (e.g., audio recording), or received and/or transmitted in analog or digital form (e.g., by telephone, conference call, or audio signal transmitted over a network).
• Such information can also be visual or video, for example hard-copy (e.g., as a manual, recorded medium, booklet, leaflet, book and the like) or soft-copy (e.g., recorded in analog or digital form as a file recorded on an magnit, electronic, optical, or computer readable medium such as a DVD, disk drive, CD-ROM and the like).
• instruction means can be interactive or real-time (e.g., a teleconference or internet chat or chat bot).
• Some mediums, kits, or agents of this invention can include printed or made in any other way instructions to inform the user of the steps required to properly use it, optionally for reduction, deactivation, inhibition or degradation of PFKFB3 for anti-aging treatment or for neuroprotection.
• an mediums, kits or agents of this invention include a label configured to be coupled to respective mediums, kits or agents of this invention.
• the label includes a first surface and a second surface.
• the first surface can be coupled to an outer surface of mediums, kits or agents of this invention.
• the first surface can include an adhesive.
• the second surface can include a textual indicia, such as, for example, a description of the mediums, kits, or agents of this invention , a mark indicating its manufacturer or distributor and/or an instruction associated with the use of such mediums, kits, or agents of this invention.
• the label can further include an electronic circuit system configured to output an electronic signal.
• the electronic signal can include an instruction associated with the use of the mediums, kits or agents of this invention.
• the instruction is an instruction for use as medication.
• the notice, description or instruction including but not limited to labeling can be shown on the lenses, computer glasses, transmitted via brain computer interface or by any other means or can be encoded by the Quick Response Code or any other machine readable form.
• the notice, description or instruction, including but not limited to labeling can be implemented in digital electronic circuitry, or in computer firmware, hardware, software, or in combinations thereof.
• the implementation can be as a computer program product, e.g., a computer program tangibly embodied in an information carrier, e.g., in a machine-readable storage device or in a propagated signal, for execution by, or to control the operation of, data processing apparatus, e.g., a programmable processor, a computer, or multiple computers.
• a computer program can be recorded in any form of programming language, including compiled or interpreted languages, and the computer program can be deployed in any form, including as a stand-alone program or as a subroutine, element, or other unit suitable for use in a computing environment.
• a computer program can be deployed to be executed on one computer or on multiple computers at one site or several sites.
• the notice, description or instruction can be performed by one or more programmable processors executing a computer program to perform functions of the invention by operating on input data and generating output. It can also be performed by, and an apparatus can be implemented as, special purpose logic circuitry, e.g., an FPGA (field programmable gate array) or an ASIC (application-specific integrated circuit). Subroutines can refer to portions of the computer program and/or the processor/special circuitry that implements that functionality.
• kit of this invention further comprises information about approval by the relevant agency of manufacture, use or sale for human administration.
• kits of this invention could be paper kits which are the paper boxes, comprising corresponding pharmaceutical described in this disclosure, paper instruction and description, comprising name of intervention, indication and instruction.
• this invention is a method, including but not limited to method of testing of efficacy of therapy deleting, reducing, binding, inhibiting or degrading PFKFB3 or therapy modulating (by deleting, reducing, binding, deactivating, inhibiting or degrading or by activating or by any other way) at least one of Indirect Targets, wherein such modulation has an anti-aging or neuroprotective effect, comprising the checking in the subject treated by such therapy at least one of the following: checking biological age of the patient, at least one aging biomarker, , at least one of markers of neurodegeneration or neuroprotection, at least one age related deficit or disease, at least one of rejuvenation marker, frailty, health span or life span, or any other marker or parameter reasonable for checking in testing of anti-aging therapy efficacy, optionally wherein therapy is a monoclonal or polyclonal antibody, optionally humanized, which recognizes the receptor of at least one respective Indirect Target
• checking of efficacy of therapy can be done as measurement of markers or symptoms of related diseases or conditions which is conducted in 1 month after the administration of therapy in therapeutically effective amount, in 3 months, in 6 months, in 12 months, in 18 months, in 24 months or in 36 months after such infusion, or in around such date, or in date reasonably defined by the doctor based on the parameter being measured and other factors known to the expert in the field .
• this invention is a tangible medium comprising a computer program, which, when executed, causes a medium to perform a method comprising: attribution to the information about a subject an information about a treatment or therapy related to deactivating, deleting, reducing, binding, inhibiting or degrading PFKFB3 or in some embodiments to treatment or therapy related to modulating or binding or inhibiting or degrading or activating at least one of Indirect Targets, wherein such modulation or binding or inhibiting or degrading or activating has anti-aging or neuroprotective effect, optionally wherein treatment is anti-aging or neurpoprotective treatment, optionally wherein such deactivating, deleting, reducing, binding, inhibiting or degrading is achieved by composition or agent described in this disclosure, optionally further comprising attributing to the information about patient before or after or before and after the treatment to information about checking of at least one selected from the group: biological age of the patient, at least one aging biomarker, at least one age related deficit or disease, at
• An example of such tangible medium could be a APPLETM 2014 MACBOOK AIRTM 13" intelTM i5 with MicrosoftTM ExcelTM installed and executed on it, wherein to patient with name John Junior Smith (born 2 Jan 1937) the information about inhibition of PFKFB3 is attributed in the sense that is logically linked as an information in Excel table (in this example attribution is realized as placing the information about treatment by inhibition of PFKFB3 in the same line in the file with the name and ID of the patient to whom such treatment is prescribed) and allows easy finding of patients in need of anti-aging or neuroprotective treatment to whom such
• PFKFB3 inhibitors could be a pharmaceutical composition comprising compound CHEMBL3422676 (AZ67), another example can be 4-( ⁇ 4-carboxy-2',4'-dichloro-[1 ,1 '-biphenyl]-3- yl ⁇ carbamoyl)-6-hydroxybenzene-1 ,3-dicarboxylic acid.
• processors suitable for the execution of a computer program related to this invention include, by way of example, both general and special purpose microprocessors, and any one or more processors of any kind of digital computer.
• a processor receives instructions and data from a read-only memory or a random access memory or both.
• the essential elements of a computer are a processor for executing instructions and one or more memory devices for storing instructions and data.
• a computer also includes, or be operatively coupled to receive data from or transfer data to, or both, one or more mass storage devices for storing data, e.g., magnetic, magneto-optical disks, or optical disks. Data transmission and instructions can also occur over a communications network.
• Information carriers suitable for embodying computer program instructions and data include all forms of non-volatile memory, including by way of example semiconductor memory devices, e.g., EPROM, EEPROM, and flash memory devices; magnetic disks, e.g., internal hard disks or removable disks; magneto-optical disks; and CD-ROM and DVD-ROM disks.
• semiconductor memory devices e.g., EPROM, EEPROM, and flash memory devices
• magnetic disks e.g., internal hard disks or removable disks
• magneto-optical disks e.g., CD-ROM and DVD-ROM disks.
• the processor and the memory can be supplemented by, or incorporated in special purpose logic circuitry.
• this invention is a tangible medium comprising a computer program, which, when executed, causes a device to perform a method comprising: attribution to the information regarding therapeutic agent or composition an information about deactivating, deleting, reducing, binding, inhibiting or degrading of PFKFB3, or in some embodiments an information about modulating or binding or inhibiting or degrading or activating at least one of Indirect Targets, if such modulation or binding or inhibiting or degrading or activating has anti-aging or neuroprotective effect or the purpose of such action is to induce anti-aging effect or neuroprotective effect, optionally, wherein information about deleting, reducing, binding, inhibiting or degrading PFKFB3 is associated with the information about anti-aging or neurodegeneration treatment, optionally wherein agent is described in this disclosure.
• this invention is a tangible medium comprising a computer program, which, when executed, causes a medium to perform a method comprising: attribution to the information about a therapy, agent, composition, medium or procedure associated with deletion, reduction, binding, inhibiting or degrading of PFKFB3 to the information related to anti-aging treatment or to neuroprotection.
• this invention is a method, comprising an attribution to information about the patient an information about the treatment related to deactivating deleting, reducing, binding, inhibiting or degrading of PFKFB3 or related to information about the modulating or binding or inhibiting or degrading or activating at least one the Indirect Targets, wherein such modulation or binding or inhibiting or degrading or activating has anti-aging or neuroprotective effect, wherein such attribution is performed in database or medium, comprising a computer program, which, when executed, causes a medium to perform such attribution or in other medium, optionally wherein the treatment is described as administration of PFKFB3 inhibitor or pharmaceutical composition, comprising such inhibitor or administration of Indirect Target modulator or pharmaceutical composition, comprising such moldulator .
• this invention is a method, comprising an attribution of information about the patient to an information about the agent deactivating, deleting, reducing, binding, inhibiting or degrading at least one of PFKFB3 or about the agent modulating or binding or inhibiting or degrading or activating at least one at least one of the Indirect Targets, wherein such modulation or binding or inhibiting or degrading or activating has anti-aging or neuroprotective effect, optionally wherein agent is selected from the group: a monoclonal or polyclonal antibody, protein, aptamer, peptide, polymer, gene therapy, virus or small molecule, nanoparticle or any identification meaning such agent or composition, or to the information related to treatment associated with deletion, reduction, binding, inhibiting or degrading of PFKFB3, wherein such attribution is performed in database or medium, comprising a computer program, which, when executed, causes a medium to perform such attribution or in other medium, optionally wherein inhibiting or binding of PFKFB3 is
• this invention is a method, comprising attribution of information about the therapy, agent, medium or procedure associated with deactivation, deletion, reduction, binding, inhibiting or degrading of PFKFB3 to the information related to anti-aging treatment or neurodegeneration treatment, wherein such attribution is performed in database or medium, comprising a computer program, which, when executed, causes a medium to perform such attribution or in other medium, optionally to the labeling information related to medication.
• this invention is a method of this disclosure, comprising attribution of information where in the patient age is above 30 years old or above 40 years old or above 50 years old and/or the patient is someone who is in need of anti-aging treatment and/or the patient is someone who is in need of neuroprotection treatment, optionally, wherein agent is selected from the group: a monoclonal or polyclonal antibody, optionally humanized, protein, aptamer, peptide, polymer, nanoparticle, virus or small molecule, or other agent described as PFKFB3 inhibitor in this application, or its analog or information about pharmaceutical composition, comprising such agent or its analog or any ID/identification meaning such agent or composition or wherein, wherein treatment is an anti-aging treatment or treatment of neurodegenerative disease or neuroprotection.
• agent is selected from the group: a monoclonal or polyclonal antibody, optionally humanized, protein, aptamer, peptide, polymer, nanoparticle, virus or small molecule, or other agent described as PFKFB3 inhibitor
• this invention is a method or a tangible medium comprising a computer program, which, when executed, causes a medium to perform a method comprising step of attributing to agent of this invention an information comprised in notice, description or instruction described in this disclosure for kits, comprising notice, description or instruction.
• the method of this invention comprising attribution of information described in this disclosure is a computer implemented method.
• this invention is a method, the method of this invention, comprising attribution of information executed on the medium of this invention and described in corresponding part of this disclosure related to such medium.
• this invention is a tangible medium or computer system or processor, comprising a executable instruction or computer program, which, when executed, causes a medium to perform a method comprising attribution of information described in this disclosure.
• this invention is an apparatus to execute method described in this disclosure the apparatus comprising the processor comprising the tangible medium described in this disclosure.
• PFKFB3 inhibitor is a PFKFB3 inhibiting Small RNA.
• kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium described in this application comprises instead of small molecule PFKFB3 inhibitor a PFKFB3 inhibiting Small RNA is used or PFKFB3 inhibitor is a PFKFB3 inhibiting Small RNA.
• RNA interference is a natural process used by cells to regulate gene expression. The process to silence genes first begins with the entrance of a double-stranded RNA (dsRNA) molecule into the cell, which triggers the RNAi pathway. The double-stranded molecule is then cut into small double-stranded fragments by an enzyme called Dicer. These small fragments, which include small interfering RNAs (siRNA) and microRNA (miRNA), are approximately 21 -23 nucleotides in length. The fragments integrate into a multi-subunit protein called the RNA-induced silencing complex, which contains Argonaute proteins that are essential components of the RNAi pathway.
• the guide or antisense strand of the fragment that remains bound to RISC directs the sequence-specific silencing of the target mRNA molecule.
• the genes can be silenced by siRNA molecules that cause the endonucleatic cleavage of the target mRNA molecules or by miRNA molecules that suppress translation of the mRNA molecule. With the cleavage or translational repression of the mRNA molecules, the genes that form them are essentially inactive.
• RNAi is thought to have evolved as a cellular defense mechanism against invaders, such as RNA viruses, or to combat the proliferation of transposons within a cell's DNA. Both RNA viruses and transposons can exist as double-stranded RNA and lead to the activation of RNAi.
• siRNAs are being widely used to suppress specific gene expression and to assess the function of genes. Companies utilizing this approach include Alnylam, Sanofi, Arrowhead, Discerna and Persomics, among others.
• siRNAs can now be easily produced by the methods known in the art and modified to be used in vivo. Another option could be a purchase of siRNAs or siRNAs modified for in vivo use for respective targets. For example Ambion® In Vivo siRNAs are designed using the Silencer® Select algorithm and incorporate chemical modifications that help provide superior serum stability for in vivo delivery.
• siRNAs are available for all human, mouse, and rat gene targets in the RefSeq database. These siRNAs are designed for maximum potency and specificity using a highly effective and extensively tested algorithm. Each siRNA is synthesized to the highest quality standards and is provided with full sequence information. Furthermore, when one purchases three Silencer Pre-Designed siRNAs to the same target, there is a guarantee that with at least two of the siRNAs you will achieve >70% reduction in target mRNA levels.
• Antisense therapy is a form of treatment.
• DNA DNA, RNA or a chemical analogue
• mRNA messenger RNA
• the strand might be targeted to bind a splicing site on pre-mRNA and modify the exon content of an mRNA.
• nucleases that cleave the phosphodiester linkage in DNA are expressed in almost every cell, unmodified DNA molecules are generally degraded before they reach their targets. Therefore, antisense drug candidate molecules are generally modified during the drug discovery phase of their development. Additionally, most targets of antisense are located inside cells, and getting nucleic acids across cell membranes is also difficult. Therefore, most clinical candidates have modified DNA "backbones", or the nucleobase or sugar moieties of the nucleotides are altered. Additionally, other molecules may be conjugated to antisense molecules in order to improve their ability to target certain cells or to cross barriers like cell membranes or the blood brain barrier
• PFKFB3 inhibiting RNAi can be delivered in vivo using a synthetic carrier for the siRNA or shRNA/DNA payload or naked DNA vectors or chemically modified siRNA (i.e. Ambion In Vivo siRNA).
• Synthetic carriers include cationic liposomes (stable nucleic-acid lipid particle SNALP carrier by Tekmira, siRNA-lipoplex AtuPLEXTM), anionic liposome, polymeric carriers (cyclodextrin nanoparticles from Calando, biodegradable polymeric matrix LODER).
• siRNA solution for systemic delivery of Ambion In Vivo siRNA (a dose starting with 7 mg/kg should be used) injection of siRNA solution of 0.7 mg/mL in PBS, saline (0.9% NaCI or variants containing sugars such as mannitol or glucose (5-15%) or Ringer’s solution (147 mM NaCI, 4 mM KCI, 1 .13 mM CaCI2) may be used.
• saline 0.9% NaCI or variants containing sugars such as mannitol or glucose (5-15%) or Ringer’s solution (147 mM NaCI, 4 mM KCI, 1 .13 mM CaCI2)
• Invivofectamine 2.0 reagent Invitrogen
• In order to prepare Invivofectamine-siRNA complex resuspended siRNA duplex should be diluted 1 :1 Complexation Buffer.
• the solution should be added to an equal volume of warm Invivofectamine 2.0 Reagent, vortex for 2-3 seconds and incubated for 30 minutes at 50°C. Afterwards ⁇ 14 volumes of PBS, pH 7.4 should be added. The solution is then diafiltrated using Amicon® Ultra-15 Centrifugal Device with Ultracel-50 membrane. The retentate retentate containing the Invivofectamine 2.0-siRNA complex is then collected, brought to 00 pL with PBS and used for in vivo injection immediately or alternatively can be stored at 4°C for up to a week prior to injection. Specific silencing of targeted genes can be confirmed by the independent experiments known in the art.
• siRNAs from ThermoFisher Scientific https://www.thermofisher.com/ru/ru/home/life- science/rnai/introduction-to-in-vivo-rnai/ambion-in-vivo-sirna.html: s10359, s10357, s10358, n364686,
• siRNA2 siRNA Human Kinase PFKFB3 (siRNA2), Nano Scale 0.25 nmol
• siRNA3 siRNA Human Kinase PFKFB3 (siRNA3), Nano Scale 0.25 nmol
• siRNA sequences for PFKFB3 are examples of siRNA sequences for PFKFB3:
• this invention is kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium of any one of items of this application, wherein PFKFB3 inhibitor is a small interfering RNA (siRNA) targeting a phosphoinositide PFKFB3 signal transduction pathway.
• siRNA small interfering RNA
• this invention is kit, method, composition , pharmaceutical composition, use, PFKFB3 inhibitor, medium of any one of items of this application, wherein PFKFB3 inhibitor is a small interfering RNA (siRNA) targeting a PFKFB3 signal transduction pathway
• PFKFB3 inhibitor is a small interfering RNA (siRNA) targeting a PFKFB3 signal transduction pathway
• this invention relates to following siRNA items :
• this invention is kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium of any one of items of this application, wherein inhibitor of PFKFB3 is a chemically modified double stranded siRNA molecule that down regulates expression of an PFKFB3 gene via RNA interference (RNAi), wherein:
• each strand of said siRNA molecule is independently about 18 to about 28 nucleotides in length; and b) one strand of said siRNA molecule comprises nucleotide sequence having sufficient complementarity to an RNA of said PFKFB3 gene for the siRNA molecule to direct cleavage of said RNA via RNA interference.
• each strand of the siRNAmolecule comprises about 18 to about 28 nucleotides, and wherein each strand comprises at least about 14 to 24 nucleotides that are complementary to the nucleotides of the other strand.
• siRNA molecule is assembled from two separate oligonucleotide fragments wherein a first fragment comprises the sense strand and a second fragment comprises the antisense strand of said siRNA molecule.
• terminal cap moiety is an inverted deoxy abasic moiety.
• siRNA molecule comprises at least one 2'-sugar modification.
• siRNA molecule comprises at least one nucleic acid base modification.
• siRNA molecule comprises at least one phosphate backbone modification.
• composition comprising the siRNA molecule of any of the items of this application in a pharmaceutically acceptable carrier or diluent.
• this invention relates to following siRNA items :
• this invention is kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium of any one of items of this application, wherein PFKFB3 inhibitor is an isolated siRNA (small interfering RNA) molecule comprising a sense region and an antisense region that down regulates expression of an PFKFB3 gene via RNA interference (RNAi), wherein the sense region comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 -, and wherein the antisense region comprises a sequence that is complementary to a nucleotide sequence from the group consisting of SEQ ID NOs: 1 -.13
• siRNA small interfering RNA
• siRNA further comprises non-nucleotide material.
• linker molecule is a polynucleotide linker.
• a recombinant nucleic acid construct comprising a nucleic acid that is capable of directing transcription of a small interfering RNA (siRNA), the nucleic acid comprising: (a) at least one promoter; (b) a DNA polynucleotide segment that is operably linked to the promoter, (c) a linker sequence comprising at least 4 nucleotides operably linked to the DNA polynucleotide segment of (b); and (d) operably linked to the linker sequence a second polynucleotide, wherein the polynucleotide segment of (b) comprises a polynucleotide that is selected from the group consisting of SEQ ID Nos: 1 -13, wherein the second polynucleotide of (d) comprises a polynucleotide that is complementary to at least one polynucleotide from the group consisting of SEQ ID NOs: 1 -13
• RNAi may be introduced in vivo as virus-delivered shRNA, for example MISSION® In Vivo shRNA from Sigma Aldrich (https://www.sigmaaldrich.com/life-science/functional-genomics-and-rnai/shrna/): SHCLNV-NM 004566 MISSION® shRNA Lentiviral Transduction Particles for human and SHCLNV- NM 172976 MISSION® shRNA Lentiviral Transduction Particles for mouse.
• MISSION® In Vivo shRNA from Sigma Aldrich (https://www.sigmaaldrich.com/life-science/functional-genomics-and-rnai/shrna/): SHCLNV-NM 004566 MISSION® shRNA Lentiviral Transduction Particles for human and SHCLNV- NM 172976 MISSION® shRNA Lentiviral Transduction Particles for mouse.
• siRNAs and shRNAs are also commercially available from Santa Cruz biotechnology (sc-4401 1 and sc-4401 1 -SH, respectively).
• this invention is kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium of any one of items of this application, wherein PFKFB3 inhibitor is MicroRNA.
• MicroRNAs are small non-coding RNA molecules (containing about 22 nucleotides) naturally occurring in plants, animals and some viruses, that functions in RNA silencing and post- transcriptional regulation of gene expression.
• MicroRNA mimics are double-stranded RNA oligonucleotides designed to mimic the function of endogenous, mature microRNAs. Micro RNA mimics are chemically enhanced with the ON-TARGET modification pattern to preferentially program RISC with the active microRNA strand.
• microRNAmimics are available for all human, mouse, and rat microRNAs, for example miRIDIAN microRNA Mimic from Dharmacon (http://dharmacon.horizondiscovery.com/rnai/microrna/miridian-microrna-mimic/) and miScript miRNA Mimics from Qiagen (https://www.qiagen.com/us/shop/pcr/real-time-pcr-enzymes-and- kits/miscript-mirna-mimics/)
• miRIDIAN microRNA Mimic from Dharmacon (http://dharmacon.horizondiscovery.com/rnai/microrna/miridian-microrna-mimic/)
• miScript miRNA Mimics https://www.qiagen.com/us/shop/pcr/real-time-pcr-enzymes-and- kits/miscript-mirna-mimics/)
• Non-exclusive list of microRNA that may target PFKFB3 hsa-miR-224-5p, hsa-miR-71 10-3p, hsa-miR-3160-5p ,hsa-miR-608, hsa-miR-940, hsa-miR-6893-5p, hsa-miR-6808-5p, hsa-miR-6791 -3p, hsa- miR-513a-3p, hsa-miR-6829-3p, hsa-miR-3606-3p, hsa-miR-513c-3p, hsa-miR-1468-3p, hsa-miR-4731 -5p, hsa-miR-4465, hsa-miR-26a-5p, hsa-miR-4660, hsa-miR-26b-5p,
• this invention is kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium of any one of items of this application, wherein PFKFB3 inhibitor is is a gene therapy, for example but not limited to therapy comprising CRISPR-CAS9.
• PFKFB3 may be inhibited be editing PFKFB3 gene for the purposes of this application such as neuroprotection or anti-aging treatment.
• Genome editing tools include engineered nucleases, i.e meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALEN), and the clustered regularly interspaced short palindromic repeats (CRISPR/Cas9) system. These nucleases create site-specific double-strand breaks (DSBs) at desired locations in the genome. The induced double-strand breaks are repaired through nonhomologous end-joining (NHEJ) or homologous recombination (HR), resulting in targeted mutations ('edits').
• NHEJ nonhomologous end-joining
• HR homologous recombination
• Meganucleases are naturally occurring endonucleases characterized by a large recognition site (double-stranded DNA sequences of 12 to 40 base pairs); as a result this site generally occurs only once in any given genome.
• Custom meganucleases may be produced by modifying the specificity of existing meganucleases by introducing a small number of variations to the amino acid sequence and then selecting the functional proteins on variations of the natural recognition site.
• Meganuclease design methods range from high- throughput experimental screening to in silico physical models and machine learning model [Zaslavskiy M, Bertonati C, Duchateau P, Duclert A, Silva GH. Efficient design of meganucleases using a machine learning approach. BMC Bioinformatics. 2014;15:191 ].
• Transcription activator-like effector nucleases are restriction enzymes that can be engineered to cut specific sequences of DNA. They are made by fusing a TAL effector DNA-binding domain to a DNA cleavage domain (a nuclease which cuts DNA strands). Transcription activator- 1 ike effectors (TALEs) can be engineered to bind to practically any desired DNA sequence, so when combined with a nuclease, DNA can be cut at specific locations [Boch J (February 201 1 ). "TALEs of genome targeting”. Nature Biotechnology. 29 (2): 135-6]
• Zinc finger nucleases are hybrid proteins composed of a nonspecific cleavage domain from the Type IIS restriction enzyme Fokl and a DNA-binding domain made up of zinc fingers (ZFs).
• the number of fingers in each ZFN can be varied. The minimum number to achieve adequate affinity is three fingers, and combinations up to six have been produced and tested in some contexts.
• three-finger and four-finger ZFNs have been used successfully [Carroll D, Morton JJ, Beumer KJ, Segal DJ. Design, construction and in vitro testing of zinc finger nucleases. Nat Protoc. 2006;1 (3):1329-41 ]
• CRISPR/Cas9 The CRISPR/Cas9 system is widely used for various genome editing approaches in cultured cells and living organisms and was broadly explored for preclinical applications.
• CRISPR/CRISPR-associated (Cas) systems use Streptococcus pyogenes Cas9 nuclease that is targeted to a genomic site by complexing with a synthetic guide RNA (sgRNA) binds to its complementary target protospacer sequence preceding a protospacer adjunct motif (PAM) recognized by Cas9.
• sgRNA synthetic guide RNA
• PAM protospacer adjunct motif
• CRISPR/Cas9 generates a double-strand break that is usually repaired by non-homologous end-joining (NHEJ), which is error-prone and conducive to frameshift mutations resulting in knock-out alleles of genes
• Adeno-associated viral vectors are commonly used for in vivo gene delivery due to their low immunogenicity and range of serotypes allowing preferential infection of certain tissues. Since packaging Streptococcus pyogenes (SpCas9) and a chimeric sgRNA together ( ⁇ 4.2 kb) into an AAV vector is challenging due to the low packaging capacity of AAV ( ⁇ 4.5 kb.) these elements are packed dual-vector system is used.
• AAV CRISPR/CAS9 systems are commercially available, for example from Takara (https ://www.takarabio.com/products/gene-function/viral-transduction/adeno-associated-virus-(aav)/vector- systems/crispr/cas9-system).
• sgRNA targeting PFKFB3 (chM O): AATGCGACAGGTGATTCCCGTGG Exon 7, TTACCGCTACCCCACCGGGGAGG Exon 1 0,
• AGGTAGGAGTCCCGGTGACGCGG Exon 1 CAGGTACCTCGGGCAGGTCGTGG Exon 1 1 , TTTCCTGAAGGGCATCGCGCCGG Exon 1 , ACCCTGAGGAGTATGCGCTGCGG Exon 10, GGCAAGCAGGCAGCGCAGGACGG Exon 1 1 , GGCGCTCAATGAGATCGACGCGG Exon 9.
• CRISPR PFKFB3 Knockout Kit is available from Origene (https://www.origene.com/) for mouse (CAT#: KN513141 ) and human (CAT#: KN206043), GeneCopoeia
• this invention is a Kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium of any one items decribed below or anywhere in this application, wherein PFKFB3 inhibitor comprises RNAi molecule or gene therapy selected from the described above or its analog.
• this invention is a Kit, method, composition, pharmaceutical composition, use, PFKFB3 inhibitor, medium of any one items decribed below or anywhere in this application, wherein PFKFB3 inhibitor comprises RNAi molecule or gene therapy selected from the described above or its analog for use in rejuvenation or any other anti-aging use selected from this application.
• Non-limiting list of parameters which age related change is regarded as age related decline and which can be changed into younger state or stabilized or its further change into the older state delayed by anti-aging intervention of this disclosure
• [00228] selected from, for example: alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl and heteroarylalkyl.
• Alkyl refers to a linear or branched hydrocarbon chain radical, which is fully saturated. Alkyl may have from one to thirty carbon atoms. Alkyl may be attached to the rest of the molecule by a single bond. An alkyl comprising up to 30 carbon atoms is referred to as a C1 -C30 alkyl, likewise, for example, an alkyl comprising up to 12 carbon atoms is a C1 -C12 alkyl. An alkyl comprising up to 6 carbons is a C1 -C6 alkyl. Alkyls (and other moieties defined herein) comprising other numbers of carbon atoms are represented similarly.
• Alkyl groups include, but are not limited to, C1 -C30 alkyl, C1 -C20 alkyl, C1 -C15 alkyl, C1 -C10 alkyl, Ci-Cs alkyl, C1 -C6 alkyl, C1 -C4 alkyl, C1 -C3 alkyl, C1 -C2 alkyl, C2-C8 alkyl, C3-C8 alkyl, C4-C8 alkyl, and C5-C12 alkyl.
• Representative alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, 1 -methylethyl (isopropyl), n-butyl, i-butyl, s- butyl, n-pentyl, 1 ,1 -dimethylethyl (t-butyl), 2-ethylpropyl, and the like.
• Representative linear alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, n-butyl, n-pentyl and the like.
• an alkyl group is optionally substituted by one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilyl, -OR a , -SR a , -OC(0)-R a , -N(R a ) 2 , -C(0)R a , -C(0)OR a , -C(0)N(R a ) 2 , -N(R a )C(0)OR f , -OC(O)- NR a R f , -N(R a )C(0)R f , -N(R a )S(0) t R f (where t is 1 or 2), -S(0) t OR a (where t is 1 or 2), -S(0) t R f (where t is 1 or 2) and -S(0)tN(R a )2 (where
• alkenyl refers to a straight or branched hydrocarbon chain radical, containing at least one carbon-carbon double bond. In certain embodiments, alkenyl comprises from two to twelve carbon atoms. In certain embodiments, an alkenyl comprises two to eight carbon atoms. In certain embodiments, an alkenyl comprises two to six carbon atoms. In other embodiments, an alkenyl comprises two to four carbon atoms.
• the alkenyl may be attached to the rest of the molecule by a single bond, for example, ethenyl (i.e., vinyl), prop-1 - enyl (i.e., allyl), but-1 -enyl, pent-1 -enyl, penta-1 ,4-dienyl, and the like.
• an alkenyl group is optionally substituted by one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilyl, -OR a , -SR a , -OC(0)-R a , -N(R a ) 2 , -C(0)R a , -C(0)OR a , -C(0)N(R a ) 2 , -N(R a )C(0)OR f , -OC(O)- NR a R f , -N(R a )C(0)R f , -N(R a )S(0)tR f (where t is 1 or 2), -S(0) t OR a (where t is 1 or 2), -S(0) t R f (where t is 1 or 2) and - S(0)tN(R a )2 (where
• alkynyl refers to a straight or branched hydrocarbon chain radical group, containing at least one carbon-carbon triple bond.
• alkynyl comprises from two to twelve carbon atoms.
• an alkynyl comprises two to eight carbon atoms.
• an alkynyl comprises two to six carbon atoms.
• an alkynyl has two to four carbon atoms.
• the alkynyl may be attached to the rest of the molecule by a single bond, for example, ethynyl, propynyl, butynyl, pentynyl, hexynyl, and the like.
• an alkynyl group is optionally substituted by one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilanyl, -OR a , -SR a , -OC(0)-R a , - N(R a ) 2 , -C(0)R a , -C(0)OR a , -C(0)N(R a ) 2 , -N(R a )C(0)OR f , -OC(O)- NR a R f , -N(R a )C(0)R f , -N(R a )S(0) t R f (where t is 1 or 2), -S(0)tOR a (where t is 1 or 2), -S(0)tR f (where t is 1 or 2) and -S(0)tN(R a ) 2 (
• “Alkylene” or“alkylene chain” refers to a straight or branched divalent hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen, containing no unsaturation and having, for example, from one to twelve carbon atoms, e.g., methylene, ethylene, propylene, n-butylene, and the like.
• the alkylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond.
• the points of attachment of the alkylene chain to the rest of the molecule and to the radical group are through one carbon in the alkylene chain or through any two carbons within the chain.
• an alkylene comprises one to eight carbon atoms (e.g., Ci-Cs alkylene). In other embodiments, an alkylene comprises one to five carbon atoms (e.g., C1-C5 alkylene). In other embodiments, an alkylene comprises one to four carbon atoms (e.g., C1-C4 alkylene). In other embodiments, an alkylene comprises one to three carbon atoms (e.g., C1-C3 alkylene). In other embodiments, an alkylene comprises one to two carbon atoms (e.g., Ci-C 2 alkylene). In other embodiments, an alkylene comprises one carbon atom (e.g., C1 alkylene).
• an alkylene comprises five to eight carbon atoms (e.g., Cs-Cs alkylene). In certain embodiments, an alkylene comprises two to five carbon atoms (e.g., C2-C5 alkylene). In certain embodiments, an alkylene comprises three to five carbon atoms (e.g., C3-C5 alkylene).
• an alkylene chain is optionally substituted by one or more of the following substituents: halo, cyano, nitro, oxo, thioxo, imino, oximo, trimethylsilyl, -OR a , -SR a , -OC(0)-R a , -N(R a ) 2 , -C(0)R a , -C(0)OR a , -C(0)N(R a ) 2 , - N(R a )C(0)OR f , -OC(0)-NR a R f , -N(R a )C(0)R f , -N(R a )S(0) t R f (where t is 1 or 2), -S(0) t OR a (where t is 1 or 2), - S(0)tR f (where t is 1 or 2) and -S(0)tN(R a ) 2 (where t is 1
• alkenylene or“alkenylene chain” refers to a straight or branched divalent hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen, containing at least one carbon-carbon double bond, and preferably having from two to twelve carbon atoms.
• the alkenylene chain may be attached to the rest of the molecule through a single bond and to the radical group through a single bond.
• the points of attachment of the alkenylene chain to the rest of the molecule and to the radical group may be through any two carbons within the chain.
• an alkenylene comprises two to ten carbon atoms (i.e., C 2 -Cio alkenylene).
• an alkenylene comprises two to eight carbon atoms (i.e., C 2 -Cs alkenylene). In other embodiments, an alkenylene comprises two to five carbon atoms (i.e., C2-C5 alkenylene). In other embodiments, an alkenylene comprises two to four carbon atoms (i.e., C2-C4 alkenylene). In other embodiments, an alkenylene comprises two to three carbon atoms (i.e., C2-C3 alkenylene). In other embodiments, an alkenylene comprises two carbon atom (i.e., C 2 alkenylene).
• an alkenylene comprises five to eight carbon atoms (i.e., Cs-Cs alkenylene). In other embodiments, an alkenylene comprises three to five carbon atoms (i.e., C3-C5 alkenylene). Unless stated otherwise specifically in the specification, an alkenylene chain is optionally substituted by one or more substituents such as those substituents described herein.
• “Alkynylene” or“alkynylene chain” refers to a straight or branched divalent hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen, containing at least one carbon-carbon triple bond, and preferably having from two to twelve carbon atoms.
• the alkynylene chain is attached to the rest of the molecule through a single bond and to the radical group th rough a single bond.
• the points of attachment of the alkynylene chain to the rest of the molecule and to the radical group may be through any two carbons within the chain.
• an alkynylene comprises two to ten carbon atoms (i.e., C2-C10 alkynylene).
• an alkynylene comprises two to eight carbon atoms (i.e., C2-C8 alkynylene). In other embodiments, an alkynylene comprises two to five carbon atoms (i.e., C2-C5 alkynylene). In other embodiments, an alkynylene comprises two to four carbon atoms (i.e., C2-C4 alkynylene). In other embodiments, an alkynylene comprises two to three carbon atoms (i.e., C2-C3 alkynylene). In other embodiments, an alkynylene comprises two carbon atom (i.e., C2 alkynylene).
• an alkynylene comprises five to eight carbon atoms (i.e., Cs-Cs alkynylene). In other embodiments, an alkynylene comprises three to five carbon atoms (i.e., C3-C5 alkynylene). Unless stated otherwise specifically in the specification, an alkynylene chain is optionally substituted by one or more substituents such as those substituents described herein.
• “Aminoalkyl” refers to a radical of the formula -R c -N(R a )2 or -R c -N(R a )-R c , where each R c is independently an alkylene chain as defined above, for example, methylene, ethylene, and the like; and each R a is independently hydrogen, or a substituent, e.g., alkyl, fluoroalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl.
• Alkoxy refers to a radical of the formula -O-alkyl where alkyl is as defined herein. Unless stated otherwise specifically in the specification, an alkoxy group may be optionally substituted as described above for alkyl.
• Aryl refers to a radical derived from an aromatic monocyclic hydrocarbon or aromatic multicyclic hydrocarbon ring system by removing a hydrogen atom from a ring carbon atom.
• Aryl may includes cycles with five to eighteen carbon atoms, where at least one of the rings in the ring system is aromatic, i.e., it contains a cyclic, delocalized (4n+2) p-electron system in accordance with the Hilckel theory.
• the ring system from which aryl groups are derived include, but are not limited to, groups such as benzene, fluorene, indane, indene, tetralin and naphthalene.
• arylene refers to the diradical derived from aryl as defined herein and is exemplified by phenylene and the like.
• an aryl or arylene is optionally substituted by one or more of the following substituents: alkyl, alkenyl, alkynyl, halo, fluoroalkyl, cyano, nitro, aryl, aralkyl, aralkenyl, aralkynyl, cycloalkyl, cycloalkylalkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl, heteroarylalkyl, -R b -OR a , -R b -OC(0)-R a , -R b -OC(0)-OR a , -R b -OC(0)-N(R a ) 2 , -R b -N(R a ) 2 , -R b -N(R
• Aralkyl refers to a radical of the formula -R c -aryl where R c is an alkylene chain as defined above, for example, methylene, ethylene, and the like.
• the alkylene chain part of the aralkyl radical is optionally substituted as described above for an alkylene chain.
• the aryl part of the aralkyl radical is optionally substituted as described above for an aryl group.
• “Aralkenyl” refers to a radical of the formula -R d -aryl where R d is an alkenylene chain as defined above.
• the aryl part of the aralkenyl radical is optionally substituted as described above for an aryl group.
• the alkenylene chain part of the aralkenyl radical is optionally substituted as defined above for an alkenylene group.
• “Aralkynyl” refers to a radical of the formula -R e -aryl, where R e is an alkynylene chain as defined above.
• the aryl part of the aralkynyl radical is optionally substituted as described above for an aryl group.
• the alkynylene chain part of the aralkynyl radical is optionally substituted as defined above for an alkynylene chain.
• C x -C y when used in conjunction with a chemical moiety, such as alkyl, alkenyl, or alkynyl is meant to include groups that contain from x to y carbons in the chain.
• C x -C y alkyl refers to substituted or unsubstituted saturated hydrocarbon groups, including straight-chain alkyl and branched-chain alkyl groups that contain from x to y carbons in the chain, including haloalkyl groups such as trifluoromethyl and 2,2,2-trifluoroethyl, etc.
• C x -C y alkenyl and“ C x -C y alkynyl” refer to substituted or unsubstituted unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double or triple bond respectively.
• “Cycloalkyl” refers to a saturated or partially unsaturated, monocyclic or polycyclic hydrocarbon radical.
• the cycloalkyl includes fused (when fused with an aryl or a heteroaryl ring, the cycloalkyl is bonded through a non-aromatic ring atom) or bridged ring systems.
• the cycloalkyl comprises from three to twenty carbon atoms.
• a cycloalkyl comprises three to ten carbon atoms.
• a cycloalkyl comprises five to seven carbon atoms.
• the cycloalkyl may be attached to the rest of the molecule by a single bond.
• the cycloalkyl is fully saturated.
• monocyclic fully saturated cycloalkyls include, e.g., cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.
• Polycyclic fully saturated cycloalkyl radicals include, for example, adamantyl, norbornyl (i.e., bicyclo[2.2.1 ]heptanyl), norbornenyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1 ]heptanyl, and the like.
• the cycloalkyl is partially unsaturated or also known as a“cycloalkenyl”.
• cycloalkenyls include cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, and the like.
• the cycloalkyl is optionally substituted by one or more substituents independently selected from alkyl, alkenyl, alkynyl, halo, fluoroalkyl, oxo, thioxo, cyano, nitro, optionally substituted aryl, optionally substituted aralkyl, optionally substituted aralkenyl, optionally substituted aralkynyl, optionally substituted cycloalkyl, optionally substituted cycloalkylalkyl, optionally substituted heterocycloalkyl, optionally substituted heterocycloalkylalkyl, optionally substituted heteroaryl, optionally substituted heteroarylalkyl, -R b -OR a , -R b - OC(0)-R a , -R b -OC(0)-OR a , -R b -OC(0)-N(R a ) 2 , -R b -N(R
• cycloalkylene refers to the diradical derived from cycloalkyl as defined herein.
• the cycloalkylene is fully saturated and is exemplified by cyclopropylene, cyclobutylene, cyclopentylene, cyclohexylene, and the like.
• the cycloalkylene is partially unsaturated or also known as a“cycloalkenylene” and is exemplified by 1 ,2-cyclobut-1 -enylene, 1 ,4-cyclohex-2-enylene and the like.
• “Cycloalkylalkyl” refers to a radical of the formula -R c -cycloalkyl where R c is an alkylene chain as defined above. The alkylene chain and the cycloalkyl radical are optionally substituted as described above.
• Halo or“halogen” refers to a halogen radical, e.g., bromo, chloro, fluoro or iodo. In some embodiments, halogen refers to chloro or fluoro.
• Haloalkyl refers to an alkyl radical, as defined above, that is substituted by one or more halo radicals, as defined above, e.g., trifluoromethyl, difluoromethyl, fluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1 ,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1 ,2-dibromoethyl, and the like.
• a haloalkyl group may be optionally substituted.
• Heterocycloalkyl refers to a saturated or partially unsaturated ring radical that comprises two to twenty carbon atoms and at least one heteroatom.
• the heteroatoms are independently selected from N, O, Si, P, B, and S atoms.
• the heterocycloalkyl may be selected from monocyclic or bicyclic, (fused when fused with an aryl or a heteroaryl ring, the heterocycloalkyl is bonded through a non aromatic ring atom) or bridged ring systems.
• the heteroatoms in the heterocycloalkyl radical are optionally oxidized.
• One or more nitrogen atoms, if present, are optionally quaternized.
• the heterocycloalkyl is attached to the rest of the molecule through any atom of the heterocycloalkyl, valence permitting, such as any carbon or nitrogen atoms of the heterocycloalkyl.
• the heterocycloalkyl comprises from five to twenty carbon atoms.
• a heterocycloalkyl comprises five to ten carbon atoms.
• a heterocycloalkyl comprises five to seven carbon atoms.
• the heterocycloalkyl is fully saturated.
• heterocycloalkyl radicals include, but are not limited to, 1 ,4-dioxanyl, dioxolanyl, thienyl[1 ,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl,
• 2-oxopiperidinyl 2-oxopyrrolidinyl, oxazolidinyl, oxiranyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1 -oxo-thiomorpholinyl, and 1 ,1 -dioxo-thiomorpholinyl.
• the heterocycloalkyl is partially unsaturated or also known as a “heterocycloalkenyl”.
• heterocycloalkenyl examples include 1 ,2,3,4-tetrahydropyridinyl, 1 ,2-dihydropyridinyl, 2-oxo-1 ,3-dioxolyl and the like.
• the heterocycloalkyl is optionally substituted by one or more of the following substituents selected from alkyl, alkenyl, alkynyl, halo, fluoroalkyl, oxo, thioxo, cyano, nitro, optionally substituted aryl, optionally substituted aralkyl, optionally substituted aralkenyl, optionally substituted aralkynyl, optionally substituted cycloalkyl, optionally substituted cycloalkylalkyl, optionally substituted heterocycloalkyl, optionally substituted heterocycloalkylalkyl, optionally substituted heteroaryl, optionally substituted heteroarylalkyl, -R b - OR a , -R b -OC(0)-R a , -R b -OC(0)-OR a , -R b -OC(0)-N(R a ) 2 , -R b -N(R
• heterocycloalkylene refers to the diradical derived from heterocycloalkyl as defined herein.
• the heterocycloalkylene is fully saturated and is exemplified by azetidinyllene, aziridinylene, pyrrolidylene, piperidinylene, morpholinylene, and the like.
• the heterocycloalkylene is partially unsaturated or also known as a“heterocycloalkenylene”.
• Heterocycloalkylalkyl refers to a radical of the formula -R c -heterocycloalkyl where R c is an alkylene chain as defined above. If the heterocycloalkyl is a nitrogen-containing heterocycloalkyl, the heterocycloalkyl is optionally attached to the alkyl radical at the nitrogen atom. The alkylene chain of the heterocycloalkylslkyl radical is optionally substituted as defined above for an alkylene chain. The heterocycloalkyl part of the heterocycloalkylalkyl radical is optionally substituted as defined above for a heterocycloalkyl group.
• Heteroaryl refers to a 5- to 14-membered ring system radical comprising hydrogen atoms, one to thirteen carbon atoms, one to six heteroatoms selected from the group consisting of nitrogen, oxygen, phosphorous and sulfur, and at least one aromatic ring.
• the heteroaryl is a 5-membered heteroaryl.
• the heteroaryl is a 6-membered heteroaryl.
• the heteroaryl radical may be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which may include fused (when fused with a cycloalkyl or heterocycloalkyl ring, the heteroaryl is bonded through an aromatic ring atom) or bridged ring systems; and the nitrogen, carbon or sulfur atoms in the heteroaryl radical may be optionally oxidized; the nitrogen atom may be optionally quaternized.
• Examples include, but are not limited to, azepinyl, acridinyl, benzimidazolyl, benzothiazolyl, benzindolyl, benzodioxolyl, benzofuranyl, benzooxazolyl, benzothiazolyl, benzothiadiazolyl, benzo[b][1 ,4]dioxepinyl, 1 ,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxinyl, benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothienyl (benzothiophenyl), benzotriazolyl, benzo[4,6]imidazo[1 ,2-a]pyridinyl, carbazolyl, cinnolinyl, dibenzofuranyl, dibenzothioph
• heteroarylene refers to the diradical derived from heteroaryl as defined herein and is exemplified by pyridinylene, pyrimidinylene, pyrazinylene, and the like.
• a heteroaryl group is optionally substituted by one or more of the following substituents selected from alkyl, alkenyl, alkynyl, halo, fluoroalkyl, haloalkenyl, haloalkynyl, oxo, thioxo, cyano, nitro, optionally substituted aryl, optionally substituted aralkyl, optionally substituted aralkenyl, optionally substituted aralkynyl, optionally substituted cycloalkyl, optionally substituted cycloalkylalkyl, optionally substituted heterocycloalkyl, optionally substituted heterocycloalkylalkyl, optionally substituted heteroaryl, optionally substituted heteroarylalkyl, -R b -OR a , -R b -0C(0)-R a , -R b -0C(0)-0R a , -R b -OR a , -R
• Heteroarylalkyl refers to a radical of the formula -R c -heteroaryl, where R c is an alkylene chain as defined above. If the heteroaryl is a nitrogen-containing heteroaryl, the heteroaryl is optionally attached to the alkyl radical at the nitrogen atom. The alkylene chain of the heteroarylalkyl radical is optionally substituted as defined above for an alkylene chain. The heteroaryl part of the heteroarylalkyl radical is optionally substituted as defined above for a heteroaryl group.
• A“tautomer” refers to a molecule wherein a proton shift from one atom of a molecule to another atom of the same molecule is possible.
• the compounds presented herein exist as tautomers.
• a chemical equilibrium of the tautomers will exist. The exact ratio of the tautomers depends on several factors, including physical state, temperature, solvent, and pH.
• Some examples of tautomeric equilibrium include: bsequently described event or circumstance may or may not occur and that the description includes instances when the event or circumstance occurs and instances in which it does not.
• “optionally substituted aryl” means that the aryl radical may or may not be substituted and that the description includes both substituted aryl radicals and aryl radicals having no substitution.“Optionally substituted” and“substituted or unsubstituted” and“unsubstituted or substituted” are used interchangeably herein.
• “Pharmaceutically acceptable salt” includes both acid and base addition salts.
• a pharmaceutically acceptable salt of any one of the compounds described herein is intended to encompass any and all pharmaceutically suitable salt forms.
• Preferred pharmaceutically acceptable salts of the compounds described herein are pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.
• “Pharmaceutically acceptable acid addition salt” refers to those salts which retain the biological effectiveness and properties of the free bases, which are not biologically or otherwise undesirable, and which are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid , nitric acid, phosphoric acid, hydroiodic acid, hydrofluoric acid, phosphorous acid, and the like. Also included are salts that are formed with organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, alkanedioic acids, aromatic acids, aliphatic and. aromatic sulfonic acids, etc.
• acetic acid trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, nicotinic acid, succinic acid, fumaric acid, formic acid, tartaric acid, camphor-10-sulfonic acid, citric acid, benzoic acid, cinnamic acid, isonipecotinic acid, levulinic acid, maleic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and the like.
• Exemplary salts thus include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, nitrates, phosphates, monohydrogenphosphates, dihydrogenphosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, acetates, trifluoroacetates, propionates, caprylates, isobutyrates, isonipecotinates, levuliates, oxalates, malonates, nicotinates, succinate, suberates, sebacates, fumarates, maleates, mandelates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, phthalates, benzenesulfonates, toluenesulfonates, phenylacetates, citrates, lactates, malates, tartrates, methanesulfonates, and the like.
• salts of amino acids such as arginates, gluconates, and galacturonates (see, for example, Berge S.M. et al. ,“Pharmaceutical Salts,” Journal of Pharmaceutical Science, 66:1 -19 (1997)).
• Acid addition salts of basic compounds are as a rule prepared by contacting the free base forms with a sufficient amount of the desired acid to produce the salt.
• “Pharmaceutically acceptable base addition salt” refers to those salts that retain the biological effectiveness and properties of the free acids, which are not biologically or otherwise undesirable. These salts are prepared by addition of an inorganic base or an organic base to the free acid. In some embodiments, pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like.
• Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, for example, isopropylamine, trimethylamine, diethylamine, triethylamine, triethanolamine, tripropylamine, ethanolamine, diethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, A/,A/-dibenzylethylenediamine, chloroprocaine, hydrabamine, choline, betaine, ethylenediamine, ethylenedianiline, /V-methylglucamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, /V-ethylpiperidine, polyamine resins and
• the term“pharmaceutically acceptable carrier” can mean a carrier, excipient or diluent approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
• the term“carrier” refers to a diluent, adjuvant (e.g., Freund's adjuvant (complete and incomplete)), excipient, or vehicle with which the therapeutic is administered.
• Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
• Water is a specific carrier when the pharmaceutical composition is administered intravenously.
• Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Examples of suitable pharmaceutical carriers are described in“Remington's Pharmaceutical Sciences” by E.W. Martin.
• subject or“patient” encompasses mammals and non-mammals.
• mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats ; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like.
• non-mammals include, but are not limited to, birds, fish and the like.
• the mammal is a human.
• modulate means to interact with a target protein either directly or indirectly so as to alter the activity of the target protein, including, by way of example only, to inhibit the activity of the target, or to limit or reduce the activity of the target, or to increase certain activity of a target compared to the magnitude of the activity in the absence of the modulator
• a modulator refers to a compound that alters an activity of a target.
• a modulator can cause an increase or decrease in the magnitude of a certain activity of a target compared to the magnitude of the activity in the absence of the modulator.
• a modulator is an inhibitor, which decreases the magnitude of one or more activities of a target.
• an inhibitor completely prevents one or more activities of a target.
• treatment or “treating “ or “palliating” or “ameliorating” are used interchangeably herein. These terms refers to an approach for obtaining beneficial or desired results including but not limited to therapeutic benefit and/or a prophylactic benefit.
• therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated.
• a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient is still afflicted with the underlying disorder.
• the compositions are administered to a patient at risk of developing a particular disease, or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease has been made.
• PFK1 refers to phosphofructokinase 1 , also known as 6-phosphofructo-1 - kinase.
• PFK2 refers to phosphofructokinase 2, also known as 6-phosphofructo-2- kinase/fructose-2,6-bisphosphatase.
• “PFKFB1 ,”“PFKFB2,”“PFKFB3,”“PFKFB4” refer to specific forms of PFK2.
• the term“subject,” as used herein, generally refers to an animal, such as a mammalian species (e.g., mouse or human) or avian (i.e., bird) species, nematode (e.g., C. elegans), or other organism, such as a plant. More specifically, the subject can be a vertebrate, e.g., a mammal such as a mouse, a primate, a simian or a human. Preferably, the subject is a human.
• the subject is more than 40 years old.
• Animals include, but are not limited to, farm animals, sport animals, and pets.
• a subject can be a healthy individual, an individual that has or is suspected of having a disease or a predisposition to the disease, or an individual that is in need of therapy or suspected of needing therapy, or an aged or frail individual.
• a subject can be any human being.
• Anti-aging treatment includes (but is not limited to) treatments leading to prevention, amelioration or lessening the effects of aging, decreasing or delaying an increase in the biological age, slowing rate of aging; treatment, prevention, amelioration and lessening the effects of frailty or at least one of aging related diseases and conditions or declines or slowing down the progression of such decline (including but not limited to those indicated in Table 1 ,“Declines”), condition or disease, increasing health span or lifespan, rejuvenation, increasing stress resistance or resilience, increasing rate or other enhancement of recovery after surgery, radiotherapy, disease and/or any other stress, prevention and/or the treatment of menopausal syndrome, restoring reproductive function, eliminating or decrease in spreading of senescent cells, decreasing all-causes or multiple causes of mortality risks or mortality risks related to at least one or at least two of age related diseases or conditions or delaying in increase of such risks, decreasing morbidity risks.
• the treatment leading to the modulating at least one of biomarkers of aging into more youthful state or slowing down its change into“elder” state is also regarded to be an anti-aging treatment, including but not limited to biomarkers of aging which are visible signs of aging, such as wrinkles, grey hairs etc.
• an age-related disease or disorder is selected from: atherosclerosis, cardiovascular disease, arthritis, cataracts, osteoporosis, type 2 diabetes, hypertension, neurodegeneration (including but not limited to Alzheimer's disease, Huntington’s disease, and other age-progressive dementias; Parkinson's disease; and amyotrophic lateral sclerosis [ALS]), stroke, atrophic gastritis, osteoarthritis, NASH, camptocormia, chronic obstructive pulmonary disease, coronary artery disease, dopamine dysregulation syndrome, metabolic syndrome, effort incontinence, Hashimoto's thyroiditis, heart failure , late life depression, immunosenescence (including but not limited to age related decline in immune response to vaccines, age related decline in response to immunotherapy etc.), myocardial infarction, acute coronary syndrome, sarcopenia, sarcopenic obesity, senile osteoporosis, urinary incontinence etc. Cancer survivors, patients under chemiotherapy and radio
• Aging-related changes in any parameter or physiological metric are also regarded as age-related conditions, including but not limited to aging related change in blood parameters, heart rate, cognitive functions/decline, bone density, basal metabolic rate, systolic blood pressure, heel bone mineral density (BMD), heel quantitative ultrasound index (QUI), heel broadband ultrasound attenuation, heel broadband ultrasound attenuation, forced expiratory volume in 1 -second (FEV1 ), forced vital capacity (FVC), peak expiratory flow (PEF), duration to first press of snap-button in each round, reaction time, mean time to correctly identify matches, hand grip strength (right and/or left), whole body fat-free mass, leg fat-free mass (right and/or left), and time for recovery after any stress (wound, operation, chemotherapy, disease, change in lifestyle etc.).
• the age-related disorder is a cardiovascular disease. In some embodiments, the age- related disorder is a bone loss disorder. In some embodiments, the age-related disorder is a neuromuscular disorder. In some embodiments, the age-related disorder is a neurodegenerative disorder or a cognitive disorder. In some embodiments, the age-related disorder is a metabolic disorder.
• the age-related disorder is sarcopenia, osteoarthritis, chronic fatigue syndrome, senile dementia, mild cognitive impairment due to aging, schizophrenia, Huntington's disease, Pick's disease, Creutzfeldt-Jakob disease, stroke, CNS cerebral senility, age-related cognitive decline, pre-diabetes, diabetes, obesity, osteoporosis, coronary artery disease, cerebrovascular disease, heart attack, stroke, peripheral arterial disease, aortic valve disease, stroke, Lewy body disease, amyotrophic lateral sclerosis (ALS), mild cognitive impairment, pre dementia, dementia, progressive subcortical gliosis, progressive supranuclear palsy, thalamic degeneration syndrome, hereditary aphasia, myoclonus epilepsy, macular degeneration, or cataracts.
• ALS amyotrophic lateral sclerosis
• Aging related change in any parameter of organism is also regarded as an aging related condition, including but not limited to aging related change in at least one of the parameter selected from the Table “Declines”.
• term “anti-aging treatment” means treatment of disease or condition mediated by PFKFB3, excluding cancer.
• term“anti-aging treatment” means treatment increasing resistance to radiation.
• anti-aging treatment means treatment of disease or age related condition or neurodegeneration associated with the alleviated level of PFKFB3 in subject’s cells
• some embodiments of this invention“aged subject” is understood as a human being of chronological age (or in some embodiments, of biological age) of 30 years or older, 35 years or older, 40 years or older, 45 years or older, 50 years or older, 55 years or older, 60 years or older, 65 years or older, 70 years or older, 75 years or older, 80 years or older, 85 years or older, 90 years or older, 95 years or older.
• this invention“aged subject” is understood as a frail human (or other animal).
• an age related disease or disorder is selected from: atherosclerosis, cardiovascular disease, arthritis, cataracts, osteoporosis, type 2 diabetes, hypertension, neurodegenaration, including but not limited to Alzheimer's disease, dementia, Parkinson's disease) , stroke, atrophic gastritis, osteoarthritis, NASH, camptocormia, chronic obstructive pulmonary disease, coronary artery disease, dopamine dysregulation syndrome, metabolic syndrome, effort incontinence, Hashimoto's thyroiditis, heart failure , late life depression, immunosenescence, myocardial infarction, acute coronary syndrome, sarcopenia, sarcopenic obesity, senile osteoporosis, urinary incontinence or diseases and conditions mentioned in “ Frameworks for Proof-of-Concept Clinical Trials of Interventions That Target Fundamental Aging Processes”. Justice et al., 2016), Juvenescence : Investing in the Age of Longevity, Mellon at
• age related, aging-related or ageing-related means "caused by pathological processes which persistently lead to the loss of organism's adaptation and progress in older ages”.
• Indirect Target means effector upstream or downstream of a PFKFB3, which can be an element (protein, small molecule, cell, electrolytes, antibodies, antigens, hormones, microRNA, RNA etc.) which is upstream or downstream in a pathway in relation to PFKFB3.
• Indirect Target means any upstream or downstream element, which modulation or reduction effects or mimics the effect of PFKFB3 reduction, inhibition or degradation, optionally that have anti-aging or neuroprotective effect.
• everything related to PFKFB3 relates to Indirect Target, e.g. when it is said that PFKFB3 inhibitor is for use as neuroprotector, in such embodiment it will mean that the modulator of Indirect Target is for use as neuroprotector.
• term“Small molecule” means an individual compound with molecular weight less than about 2000 daltons in size, usually less than about 1500 daltons in size, more usually less than about 750 daltons in size, preferably less than about 500 daltons in size, although molecules larger than 2000 daltons in size will also be PFKFB3 inhibitors herein.
• PFKFB3 inhibitor(s) selectively bind(s) a PFKFB3 can mean the following:
• PFKFB3 inhibitor(s) bind(s) exclusively to a PFKFB3, i.e. the PFKFB3 inhibitor(s) do(does) not bind to proteins other than a PFKFB3.
• the compounds, and compositions comprising the compounds described herein are useful for the treatment of diseases or conditions where the modulation of PFKFB3 and/or PFKFB4 has beneficial effect.
• compounds, and compositions comprising the compounds, described herein are useful for the treatment of diseases or conditions wherein the inhibition of kinase activity of PFKFB3 and/or PFKFB4 has beneficial effect or for manufacturing of corresponding medications.
• the compounds, and compositions comprising the compounds described herein are useful for many uses, including but not limited to the treatment of cancer, neudegenerative and aging related diseases or conditions where the modulation of PFKFB3 has beneficial effect.
• compounds, and compositions comprising the compounds, described herein are useful for the treatment of diseases or conditions wherein the inhibition of kinase activity of PFKFB3 has beneficial effect or for manufacturing of corresponding medications.
• the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1 x10-3M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1 x10-4 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1 x10-5 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1 x10-6 M.
• the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1 x10-7 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1 x10-8 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1 x10-9 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1 x10-10 M. In some embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1 x10-12 M.
• the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of less than 1 x10-15 M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x10-3M to about 1 X10-1 5M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x10-3M to about 1 X1 0-14M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x10-3M to about 1 X10-13M.
• the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x10-3M to about 1 X10-12M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x10-3M to about 1 X10-1 1 M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x1 0-3M to about 1 x10- 10M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x10-3M to about 1 x10-9M.
• the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x10-3M to about 1 x10-8M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x10-3M to about 1 x10-7M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x10-3M to about 1 x10-6M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x10-6M to about 1 X10-1 5M.
• the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x10-9M to about 1 X10-15M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x10-12M to about 1 x1 0- 15M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 x10-6M to about 1 x10-12M. In certain embodiments, the PFKFB3 inhibitor selectively binds the PFKFB3 with a KD of about 1 X1 0-6M to about 1 x10-9M.
• R a and R b are independently selected from hydrogen, hydroxyl, halogen, optionally substituted C1-C6 alkyl, optionally substituted Ci-C6 alkoxy, optionally substituted C3-C8 cycloalkyl, optionally substituted -O-C3- C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, and optionally substituted -O-C2-C8 heterocycloalkyl;
• Arc is selected from C3-C8 cycloalkenylene, C2-C8 heterocycloalkenylene, arylene, and heteroarylene; wherein Arc is substituted with one or more Rc;
• each R 3 is independently optionally substituted C1-C6 alkyl or optionally substituted C3-C8 cycloalkyl; each R 4 and R 5 is independently selected from hydrogen, optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• R 4 and R 5 are taken together with the N to which they are attached to form an optionally substituted C2-C8 heterocycloalkyl
• each R 6 are independently selected from optionally substituted C1 -C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• An is selected from pyridinyl, pyrimidinyl, pyridazinyl, pyrazinyl, phenyl, pyrrolyl, furanyl, thiophenyl, pyrazolyl, imidazolyl, triazolyl, and tetrazolyl, wherein An is optionally substituted;
• each RM is independently selected from hydrogen, halogen, -OH, -CN, optionally substituted Ci -Ob alkyl, optionally substituted C1 -C6 alkoxy, optionally substituted C3-C8 cycloalkyl, optionally substituted -O-C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, and optionally substituted -O-C2-C8 heterocycloalkyl;
• R 9 is optionally substituted C1-C6 alkyl
• R 9 is optionally substituted C3-C8 cycloalkyl
• each R 10 and R 1 1 is independently selected from hydrogen, optionally substituted Ci-Ce alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• R 10 and R 1 1 are taken together with the N to which they are attached to form an optionally substituted C2-C8 heterocycloalkyl;
• R 12 is selected from optionally substituted C1 -C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl; provided that:
• Rc is not -NFICOR 6 when RL is -NFICOR 12 and Arc is heterocycloalkenylene or heteroarylene;
• Ft a and Ft b are independently selected from hydrogen, hydroxyl, halogen, optionally substituted C1-C6 alkyl, optionally substituted Ci-C6 alkoxy, optionally substituted C3-C8 cycloalkyl, optionally substituted -O-C3- C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, and optionally substituted -O-C2-C8 heterocycloalkyl;
• Arc is selected from C3-C8 cycloalkenylene, C2-C8 heterocycloalkenylene, arylene, and heteroarylene; wherein Arc is substituted with one or more Rc;
• each R 1 and R 2 is independently selected from hydrogen, optionally substituted C1 -C6 alkyl, and optionally substituted C 3 -C 8 cycloalkyl;
• R 1 and R 2 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, -OH, C1 -C6 alkyl, and C1 -C6 alkoxy;
• each R 4 and R 5 is independently selected from hydrogen, optionally substituted Ci-Ce alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• R 4 and R 5 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, -OH, C1 -C6 alkyl, and C1 -C6 alkoxy;
• each R 6 are independently selected from optionally substituted C1 -C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• each R 7 and R 8 is independently selected from hydrogen and C1 -C6 alkyl
• R 7 and R 8 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more C1 -C6 alkyl substituents;
• An is selected from pyridinyl, pyrimidinyl, pyridazinyl, pyrazinyl, phenyl, pyrrolyl, furanyl, thiophenyl, pyrazolyl, imidazolyl, triazolyl, and tetrazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, optionally substituted C1 -C6 alkyl, optionally substituted C1 -C6 alkoxy, optionally substituted C3-C8 cycloalkyl, optionally substituted -O-C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, and optionally substituted -O-C2-C8 heterocycloalkyl;
• each R 10 and R 1 1 is independently selected from hydrogen, optionally substituted Ci-Ce alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• R 10 and R 1 1 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy;
• R 12 is selected from optionally substituted C1 -C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted aryl, and optionally substituted heteroaryl;
• Rc is not -NHCOR 6 when RL is -NHCOR 12 and Arc is heterocycloalkenylene or heteroarylene;
• Arc is arylene or heteroarylene; each substituted with one or more Rc. In some embodiments of a compound of Formula (I), Arc is arylene substituted with one or two Rc. In some embodiments of a compound of Formula (I), Arc is a phenylene substituted with one or two Rc. In some embodiments of a compound of Formula (I), Arc is arylene substituted with one Rc. In some embodiments of a compound of Formula (I), Arc is phenylene substituted with one Rc.
• Arc is heteroarylene selected from pyridinylene, pyrimidylene, pyrazinylene, and thiophenylene. In some embodiments of a compound of Formula (I), Arc is heteroarylene substituted with one or two Rc. In some embodiments of a compound of Formula (I), Arc is a monocyclic heteroarylene substituted with one or two Rc. In some embodiments of a compound of Formula (I), Arc is heteroarylene substituted with one Rc. In some embodiments of a compound of Formula (I), Arc is thiophenylene substituted with one Rc. In some embodiments of a compound of Formula (I), Arc is thiophenylene substituted with two Rc.
• at least one Rc is not ethoxy.
• each R 4 and R 5 is independently selected from hydrogen and C1-C6 alkyl; or R 4 and R 5 are taken together with the N to which they are attached to form a C 2 -Cs heterocycloalkyl, optionally substituted with one or more C1-C6 alkyl substituents.
• An is selected from pyridinyl, pyrimidinyl, pyrazinyl, phenyl, thiophenyl, pyrazolyl, and imidazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, Ci-Ce alkyl, and C1-C6 alkoxy.
• An is phenyl optionally substituted by one or more substituents selected from halogen, -OH, -NR 7 R 8 , -CN, Ci -Ce alkyl , and C1-C6 alkoxy.
• each RM is independently selected from hydrogen, halogen, -OH, -CN, C1-C6 alkyl, and C1-C6 alkoxy.
• one RM is selected from hydrogen, halogen, -OH, -CN, C1-C6 alkyl, and C1-C6 alkoxy; and each other RM is independently selected from hydrogen and halogen.
• each RM is hydrogen.
• R 9 is C1-C6 alkyl optionally substituted with -NR 1 R 2
• each R 1 and R 2 is hydrogen.
• RL is tetrazolyl.
• RL is triazolyl.
• each RM is independently selected from hydrogen, halogen, -OH, -CN, C1 -C6 alkyl, and C1 -C6 alkoxy.
• one RM is selected from hydrogen, halogen, -OH, -CN, Ci-Ce alkyl, and C1 -C6 alkoxy; and each other RM is independently selected from hydrogen and halogen.
• each RM is hydrogen.
• each R 1 and R 2 is independently selected from hydrogen and C1-C6 alkyl; or R 1 and R 2 are taken together with the N to which they are attached to form a C 2 -C8 heterocycloalkyl, optionally substituted with one or more C1-C6 alkyl substituents.
• each R 1 , R 2 , R 7 and R 8 is independently selected from hydrogen and C1-C6 alkyl.
• each R 1 and R 8 is hydrogen and each R 2 and R 7 is independently selected from hydrogen and C1-C6 alkyl.
• R 1 , R 2 , R 7 and R 8 are each hydrogen.
• the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug. In some embodiments of a compound of Formula (I), the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug and the prodrug comprises an ester moiety. In some embodiments of a compound of Formula (I), the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug and the prodrug comprises an amide moiety.
• Arc is selected from arylene and heteroarylene; wherein Arc is substituted with one or more Rc;
• each R 3 is independently optionally substituted C1-C6 alkyl
• each R 4 and R 5 is independently selected from hydrogen and optionally substituted C1-C6 alkyl
• R 4 and R 5 are taken together with the N to which they are attached to form an optionally substituted C 2 -C 8 heterocycloalkyl;
• each R 6 are independently selected from optionally substituted C1-C6 alkyl and optionally substituted aryl ;
• An is selected from pyridinyl, pyrimidinyl, pyrazinyl, phenyl , thiophenyl, pyrazolyl, and imidazolyl, wherein An is optionally substituted;
• R 9 is optionally substituted C1-C6 alkyl
• each R 10 and R 1 1 is independently selected from hydrogen and optionally substituted C1-C6 alkyl
• R 10 and R 1 1 are taken together with the N to which they are attached to form an optionally substituted C 2 -C 8 heterocycloalkyl;
• R 12 is selected from C1-C6 alkyl and optionally substituted aryl
• Arc is selected from arylene and heteroarylene; wherein Arc is substituted with one or more Rc;
• R 1 and R 2 are taken together with the N to which they are attached to form a C 2 -Cs heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy;
• R 4 and R 5 are taken together with the N to which they are attached to form a C 2 -Cs heterocycloalkyl optionally substituted with one or more substituents independently selected from halogen, -OH, C1-C6 alkyl, and C1-C6 alkoxy;
• each R 7 and R 8 is independently selected from hydrogen and C1-C6 alkyl
• R 7 and R 8 are taken together with the N to which they are attached to form an optionally substituted C 2 -C8 heterocycloalkyl optionally substituted with one or more Ci-Ce alkyl substituents;
• An is selected from pyridinyl, pyrimidinyl, pyrazinyl, phenyl, thiophenyl, pyrazolyl, and imidazolyl, wherein An is optionally substituted by one or more substituents selected from halogen, -OH, -NR 7 R 8 , -CN, Ci -Ce alkyl , and C1-C6 alkoxy;
• R 9 is C1-C6 alkyl optionally substituted with one or more substituent independently selected from -OH and -NR 1 R 2 ;
• R 10 and R 1 1 are taken together with the N to which they are attached to form a C 2 -Cs heterocycloalkyl optionally substituted with one or more C1-C6 alkyl substituents;
• Arc is arylene substituted with one or two Rc.
• Arc is a monocyclic arylene substituted with one or two Rc.
• Arc is arylene substituted with one Rc. In some embodiments of a compound of Formula (la) or (lb), Arc is phenylene substituted with one Rc. In some embodiments of a compound of Formula (la) or (lb), Arc is heteroarylene selected from pyridinylene, pyrimidylene, pyrazinylene, and thiophenylene. In some embodiments of a compound of Formula (la) or (lb), Arc is heteroarylene substituted with one or two Rc. In some embodiments of a compound of Formula (la) or (lb), Arc is a monocyclic heteroarylene substituted with one or two Rc.
• Arc is heteroarylene substituted with one Rc. In some embodiments of a compound of Formula (la) or (lb), Arc is thiophenylene substituted with one Rc. In some embodiments of a compound of Formula (la) or (lb), Arc is thiophenylene substituted with two Rc.
• at least one of Rc is not methyl.
• at least one of Rc is not ethyl.
• at least one of Rc is not ethoxy.
• An is phenyl optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, Ci-Ce alkyl, and C1-C6 alkoxy.
• An is selected from pyridinyl, pyrimidinyl, pyrazinyl, thiophenyl, pyrazolyl and imidazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, Ci-Ce alkyl, and C1-C6 alkoxy.
• An is selected from thiophenyl, pyrazolyl, and imidazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, Ci- Ce alkyl, and C1-C6 alkoxy.
• An is imidazolyl optionally substituted by methyl.
• R 10 is hydrogen;
• R 1 1 is selected from hydrogen
• RL is triazolyl.
• RL is not -OMe.
• each RM is independently selected from hydrogen, halogen, -OH, -CN, Ci-Ce alkyl, and Ci-C6 alkoxy.
• one RM is selected from hydrogen, halogen, -OH, -CN, Ci-Ce alkyl, and Ci-C6 alkoxy; and each other RM is independently selected from hydrogen and halogen.
• each RM is hydrogen
• each R 1 and R 2 is independently selected from hydrogen and C -C alkyl, or R 1 and R 2 are taken together with the N to which they are attached to form an optionally substituted C 2 -Cs heterocycloalkyl optionally substituted with one or more C -C alkyl substituents.
• each R 1 , R 2 , R 7 and R 8 is hydrogen.
• the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug. In some embodiments of a compound of Formula (la) or (lb), the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug and the prodrug comprises an ester moiety. In some embodiments of a compound of Formula (la) or (lb), the compound or a pharmaceutically acceptable salt thereof is in the form of a prodrug and the prodrug comprises an amide moiety.
• R a and R b are each independently selected from hydrogen, halogen, -OH, Ci-6 alkyl, Ci e alkoxy;
• Arc is selected from arylene and heteroarylene; wherein Arc is substituted with one or more Rc;
• each R 3 is independently optionally substituted Ci -Ob alkyl ;
• each R 4 and R 5 is independently selected from hydrogen and optionally substituted Ci -Ob alkyl ;
• R 4 and R 5 are taken together with the N to which they are attached to form an optionally substituted C 2 -C 8 heterocycloalkyl; each R 6 are independently selected from optionally substituted C1-C6 alkyl and optionally substituted aryl ;
• An is selected from pyridinyl, pyrimidinyl, pyrazinyl, phenyl, thiophenyl, pyrazolyl, and imidazolyl, wherein An is optionally substituted;
• each RM is independently selected from hydrogen, halogen, -OH, -CN, optionally substituted C1-C6 alkyl, and optionally substituted C1-C6 alkoxy;
• R 9 is C1-C6 alkyl optionally substituted with one or more substituents independently selected from -OH and-NR 1 R 2 ;
• each R 10 and R 1 1 is independently selected from hydrogen and optionally substituted C1-C6 alkyl
• R 10 and R 1 1 are taken together with the N to which they are attached to form an optionally substituted C 2 -C 8 heterocycloalkyl;
• R 12 is selected from C1-C6 alkyl and optionally substituted aryl
• R a and R b are each independently selected from hydrogen, halogen, -OH, C1 -6 alkyl, C1 -6 alkoxy;
• Arc is selected from arylene and heteroarylene; wherein Arc is substituted with one or more Rc;
• R 1 and R 2 are taken together with the N to which they are attached to form a C 2 -Cs heterocycloalkyl optionally substituted with one or more C1-C6 alkyl substituents;
• R 4 and R 5 are taken together with the N to which they are attached to form a C 2 -Cs heterocycloalkyl optionally substituted with one or more C1-C6 alkyl substituents;
• each R 7 and R 8 is independently selected from hydrogen and C1-C6 alkyl
• R 7 and R 8 are taken together with the N to which they are attached to form an optionally substituted C 2 -C8 heterocycloalkyl optionally substituted with one or more Ci-Ce alkyl substituents;
• An is selected from pyridinyl, pyrimidinyl, pyrazinyl, phenyl, thiophenyl, pyrazolyl, and imidazolyl, wherein An is optionally substituted by one or more substituents selected from halogen, -OH, -NR 7 R 8 , -CN, Ci -Ce alkyl , and C1-C6 alkoxy; each RM is independently selected from hydrogen, halogen, -OH, -CN, optionally substituted C1-C6 alkyl, and optionally substituted Ci-C6 alkoxy;
• R 9 is C1 -C6 alkyl optionally substituted with one or more substituents independently selected from -OH and-NR 1 R 2 ;
• R 10 and R 1 1 are taken together with the N to which they are attached to form a C2-C8 heterocycloalkyl optionally substituted with one or more C1-C6 alkyl substituents;
• Arc is arylene substituted with one or two Rc. In some embodiments of a compound of Formula (II), Arc is a monocyclic arylene substituted with one or two Rc. In some embodiments of a compound of Formula (II), Arc is arylene substituted with one Rc. In some embodiments of a compound of Formula (II), Arc is phenylene substituted with one Rc. In some embodiments of a compound of Formula (II), Arc is heteroarylene selected from pyridinylene, pyrimidylene, pyrazinylene, and thiophenylene.
• Arc is heteroarylene substituted with one or two Rc. In some embodiments of a compound of Formula (II), Arc is a monocyclic heteroarylene substituted with one or two Rc. In some embodiments of a compound of Formula (II), Arc is heteroarylene substituted with one Rc. In some embodiments of a compound of Formula (II), Arc is thiophenylene substituted with one Rc. In some embodiments of a compound of Formula (II), Arc is thiophenylene substituted with two Rc.
• at least one of Rc is not methyl.
• at least one of Rc is not ethyl.
• at least one of Rc is -CN.
• each R 3 is independently C1-C6 alkyl optionally substituted with one or more substituents independently selected from Ci-C6 alkoxy and -NR 1 R 2 .
• An is phenyl optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, Ci-Ce alkyl, and Ci-C6 alkoxy.
• An is selected from pyridinyl, pyrimidinyl, pyrazinyl, thiophenyl, pyrazolyl and imidazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, Ci-Ce alkyl, and Ci-C6 alkoxy.
• An is selected from thiophenyl, pyrazolyl, and imidazolyl, wherein An is optionally substituted by one or more substituents independently selected from halogen, -OH, -NR 7 R 8 , -CN, C1-C6 alkyl, and C1-C6 alkoxy.
• An is imidazolyl optionally substituted by methyl.
• R 10 is hydrogen;
• each RM is independently selected from hydrogen, halogen, -OH, -CN, Ci-Ce alkyl, and C1-C6 alkoxy.
• one RM is selected from hydrogen, halogen, -OH, -CN, C1 -Ce alkyl, and C1-C6 alkoxy; and each other RM is independently selected from hydrogen and halogen.
• each R M is hydrogen
• each R 1 and R 2 is independently selected from hydrogen and C1-C6 alkyl, or R 1 and R 2 are taken together with the N to which they are attached to form an optionally substituted C2-C8 heterocycloalkyl optionally substituted with one or more C1-C6 alkyl substituents.
• each R 1 , R 2 , R 7 and R 8 is hydrogen.
• R a and R b are each independently selected from hydrogen, halogen, -OH, Ci-6 alkyl, C1 -6 alkoxy;
• Arc is selected from arylene and heteroarylene; wherein Arc is substituted with one or more Rc;
• each R 3 is independently optionally substituted Ci -Ob alkyl ;
• each R 4 and R 5 is independently selected from hydrogen and optionally substituted Ci -Ob alkyl ;
• R 4 and R 5 are taken together with the N to which they are attached to form an optionally substituted C 2 -C 8 heterocycloalkyl;
• R 6 is selected from optionally substituted C1-C6 alkyl and optionally substituted aryl
• An is selected from pyridinyl, pyrimidinyl, pyrazinyl, phenyl, thiophenyl, pyrazolyl, and imidazolyl, wherein An is optionally substituted;
• each RM is independently selected from hydrogen, halogen, -OH, -CN, optionally substituted Ci -Ob alkyl, and optionally substituted Ci-C6 alkoxy;
• R 9 is optionally substituted C1-C6 alkyl
• each R 10 and R 11 is independently selected from hydrogen and optionally substituted C1-C6 alkyl

Landscapes

• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Animal Behavior & Ethology (AREA)
• Medicinal Chemistry (AREA)
• Pharmacology & Pharmacy (AREA)
• General Health & Medical Sciences (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Epidemiology (AREA)
• Molecular Biology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Biochemistry (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Dermatology (AREA)
• Neurology (AREA)
• Neurosurgery (AREA)
• Biomedical Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Engineering & Computer Science (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Priority Applications (9)

Applications Claiming Priority (2)

Related Child Applications (1)

Publications (1)

Family

ID=70284090

Family Applications (1)

Country Status (10)

Cited By (8)

Families Citing this family (3)

Citations (9)

Family Cites Families (16)

• 2019
  • 2019-10-15 EA EA202191050A patent/EA202191050A1/ru unknown
  • 2019-10-15 AU AU2019362747A patent/AU2019362747A1/en active Pending
  • 2019-10-15 GB GBGB2107039.6A patent/GB202107039D0/en not_active Ceased
  • 2019-10-15 EP EP19873172.1A patent/EP3867226A4/en active Pending
  • 2019-10-15 WO PCT/RU2019/095001 patent/WO2020080979A1/en unknown
  • 2019-10-15 CA CA3115981A patent/CA3115981A1/en active Pending
  • 2019-10-15 BR BR112021007101-6A patent/BR112021007101A2/pt unknown
  • 2019-10-15 CN CN201980082739.2A patent/CN113396145A/zh active Pending
  • 2019-10-15 JP JP2021545349A patent/JP2022508751A/ja active Pending
• 2021
  • 2021-04-14 US US17/230,726 patent/US20230047816A1/en active Pending

Patent Citations (10)

Non-Patent Citations (3)

Also Published As

Similar Documents

Legal Events