WO2020035598A1 - Élément is2 pour obtenir des vecteurs lentiviraux défectifs à intégration améliorée - Google Patents

Élément is2 pour obtenir des vecteurs lentiviraux défectifs à intégration améliorée Download PDF

Info

Publication number
WO2020035598A1
WO2020035598A1 PCT/EP2019/072025 EP2019072025W WO2020035598A1 WO 2020035598 A1 WO2020035598 A1 WO 2020035598A1 EP 2019072025 W EP2019072025 W EP 2019072025W WO 2020035598 A1 WO2020035598 A1 WO 2020035598A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
cells
nucleic acid
idlvs
cell
Prior art date
Application number
PCT/EP2019/072025
Other languages
English (en)
Inventor
Francisco MARTÍN MOLINA
Karim BENABDELLAH EL KHLANJI
Sabina SANCHEZ HERNANDEZ
María Alejandra GUTIÉRREZ GUERRERO
Rocío MARTÍN GUERRA
Original Assignee
Fundación Pública Andaluza Progreso Y Salud
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fundación Pública Andaluza Progreso Y Salud filed Critical Fundación Pública Andaluza Progreso Y Salud
Publication of WO2020035598A1 publication Critical patent/WO2020035598A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
    • C12N2830/003—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor tet inducible
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/40—Vector systems having a special element relevant for transcription being an insulator
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/46—Vector systems having a special element relevant for transcription elements influencing chromatin structure, e.g. scaffold/matrix attachment region, methylation free island

Definitions

  • the present invention refers to improved gene transfer vectors for gene therapy. Particularly, the present inventions relates to DNA sequences capable of enhancing expression of integration- defective lentiviral vectors (IDLVs).
  • IDLVs integration- defective lentiviral vectors
  • Lentiviral vectors have proven to be highly successful in several gene therapy protocols over the last twenty years. Their success is partly explained by their ability to transduce dividing and non-dividing cells, including hematopoietic stem cells (HSCs) neurons and T cells. However, concerns have been raised regarding the potential risk of inherent insertional mutagenesis caused by integrative lentiviral vectors.
  • IDLVs integration-defective lentiviral vectors
  • IDLVs are also an interesting alternative for transient expression in dividing cells. As with their integrative counterpart, the tropism of IDLV particles can be altered and adapted to target cells pseudotyped with different envelope proteins.
  • LVs are often more effective than their IDLV counterparts in terms of gene expression mainly due to the tendency of IDLVs to undergo epigenetic silencing as a result of nuclear chromatinization.
  • HDAC histone deacetylase
  • Different strategies have been used to enhance the transgene expression of episomal molecules in both viral- and non-viral-based systems.
  • genomic elements based on scaffold/matrix attachment regions (S/MARs) are widely used to enhance transcription levels and to maintain long-term expression rates.
  • S/MAR elements This is mainly due to the capacity of S/MAR elements to bind transcription factors such as special A+T-rich binding protein 1 (SATB1), nuclear matrix protein 4 (Nmp4) and CCCTC-binding factor (CTCF), in addition to their capacity to promote nucleoprotein structural aggregation, histone acetyltransferase recruitment and ATP- dependent chromatin remodeling complexes.
  • transcription factors such as special A+T-rich binding protein 1 (SATB1), nuclear matrix protein 4 (Nmp4) and CCCTC-binding factor (CTCF)
  • cHS4 5'HS4 chicken -globin insulator
  • This nuclear factor avoids heterochromatin spreading in episomal DNA when bound to the cHS4 sequence.
  • the authors of the present invention have previously reported that the inclusion of the IS2 element (which combines SAR2 and HS4-650 regions of a HS4 insulator) in LVs reduced biological viral titers but improved transgene expression and prevented epigenetic silencing in Human embryonic stem cells (hESCs) and hematopoietic pluripotent cells (HSCs).
  • these positive effects were cell-type dependent since no improvement in transgene expression could be observed on K562 cells and other immortalized cell lines.
  • the authors of the present invention until now, had not yet tested whether the IS2 element could improve IDLV gene expression, and not only LV gene expression, in different cell types, in order to overcome the unresolved need to significantly improve IDLV gene expression.
  • the inventors have tested whether the IS2 element could improve IDLV gene expression in different cell types. Although the presence of the IS2 element did not abrogate epigenetic silencing, it did improved IDLV efficiency in several cell lines. Surprisingly, in spite of the improved expression levels, the inclusion of the IS2 element into IDLVs (SE-IS2- IDLV) reduced 3-5 times the amount of episomal vector in transduced cells relative to those transduced with unmodified SE-IDLVs. We have estimated that the IS2 element enhances the transcriptional activity of SE-IS2-episomes 6-7 fold. The final effect of the IS2 element in IDLVs might depend on the target cell and the balance between the negative versus the positive effects of the IS2 element in each cell type.
  • FISH fluorescence in situ hybridization
  • FIG. 1 Inclusion of IS2 element into IDLVs enhances eGFP expression levels in 293T cells,
  • eGFP enhanced green florescence protein
  • SFFV spleen focus forming virus
  • WPRE Wildchuck Hepatitis Virus Posttranscriptional Regulatory Element
  • MOI 0.3 was used to maintain the percentage of eGFP+ cells below 50%.
  • the eGFP+ population gates were set to 0.2-0.7% of eGFP+ cells in the untransduced population and subtracted from the % obtained under the different vectors and conditions for the analysis.
  • the percentages (%) and expression levels (MFI) of the eGFP+ population are shown in each plot, (c) Graphs showing relative % of GFP+ cells (top graphs) and relative expression levels (MFI : bottom graphs) in 293T cells of SE- IS2-I DLVs and SE-IDLVs in the absence (Left graphs) or presence (Right Graphs) of the WPRE element. Values represent means + /- standard error of the mean (SEM) of at least four separate experiments (*p ⁇ 0.05).
  • (a) Representative Plots showing eGFP expression profiles of 293T cells transduced with the SE or SE-IS2 at MOI 0.2, in the absence or presence of 0.4 uMapicidin.
  • Figure 3 The insertion of the IS2 element into the LV backbone reduces their efficiency to generate vector genomes in target cells, (a) Representative plots showing eGFP expression profiles of 293T cells transduced with integrative LVs (left plots) and IDLVs (right plots) with (SE- IS2) or without (SE) the IS2 element. All the experiments were carried out using 0.7 viral particle/cells, (b) Graphs showing the amounts of reverse transcribed products (Vector genomes) in 293T cells transduced with LVs (left) and IDLVs (right) with (SE-IS2) or without (SE) the IS2 element at 72h after transduction. A clear decrease in the amount of the viral genome can be observed in both LV and IDLV in the presence of the IS2 sequence.
  • FIG. 4 The IS2 element does not affect stability of IDLVs episomes but enhance their transcriptional efficacy and relocate them into DAPI-low nuclear domains
  • a Graph showing the relative amount of mRNA expression level of eGFP cDNA normalized to the amount of vector genomes in 293T cells transduced with IDLVs-SE and IDLVs-SE-IS2.
  • b Representative Plots showing the effect of the IS2 on the stability of the episomes over the time almost the episomes disappear 7 days after transduction, either in the presence or in the absence of IS2.
  • the cells were subsequently fixed, methanol permeabilized, and incubated with the labeled probes.
  • the confocal images showed a differential localization of lentiviral episomes in the presence or in the absence of IS2.
  • One representative experiment out of two is shown, d.
  • FIG. 5 Insertion of the IS2 element or a control 1.2kb fragment into the IDLVs reduce the total number of episomes and the formation of lower expressing 2-LTR circles
  • eGFP enhanced green florescence protein
  • SFFV spleen focus-forming virus
  • FIG. 6 The IS2 sequence improves transgene expression in neural progenitor cells and in differentiated neuron-like cells,
  • (a) Representative image (Left) and plots (Right) showing eGFP expression profiles of undifferentiated neural stem cells transduced at MOI 3 with SE, SE-IS2, SEWP and SEWP-IS2 IDLVs and analyzed 72h post-transduction. The percentage (%) of the eGFP+ cells and the eGFP expression levels (MFI) are shown in each plot.
  • FIG. 7 The IS2 sequence improves transgene expression in iPSCs.
  • (b) Graphs showing the relative percentage of eGFP positive cells (top) and the relative transgene expression levels (bottom) in iPSCs transduced with different IDLVs and normalized to the levels obtained with SE IDLVs. The values represent means + /- SEM of at least four separate experiments (*p ⁇ 0.05).
  • Figure 8 Effects of IS2 elements on IDLV at different MOI. 293. Representative plots showing eGFP expression profiles of 293 T cells transduced with increased MOIs of SE (top) and SE-IS2 (bottom) IDLVs. The percentages (%) and expression levels (MFI) of the eGFP+ population are shown in each plot.
  • Figure 9 Scheme showing the different forms of the IDLV genome during transduction of target cells.
  • Vector RNA genome inside IDLV particles enter the cytoplasm of the target cell (middle) where vector DNA sequences can already be found with complete 5'AU3RU5 LTRs can be found.
  • the reverse transcription continues and in IDLVs generates mainly 1-LTR and 2-LTR DNA episomal circles, although some lineal DNAs forms can also be found.
  • Primers used to detect the different forms of vector DNA are indicated with arrows. AU3fw and PBSrev primer set were used to detect the amount of total reverse transcribed products (vector DNA genomes).
  • q2LTRfw and q2LTRrev primers were used to assess the relative amounts of 2LTR circles versus total vector DNA genomes.
  • Figure lO.Confocal images showing nuclear localization of Viral Episomes. Nuclear distribution of IDLV episomes. 293T Cells were transduced at MOI 5. The cells were subsequently fixed, methanol permeabilized, and incubated with the labeled probes. The confocal images showed a differential localization of lentiviral episomes in the presence or in the absence of IS2. Confocal images showing eight continuous optical sections, (Op. Sl-6) showing viral episomes localization within the nucleus of the transduced cells.
  • NPCs differentiated into neuron-like cells were cultured in neural differentiation media (See Material and Methods for details) and maintained at 37 ⁇ C in 5% C02 for 28 days. Neural-like cells were fixed and permeabilized for 30 min and stained with anti-b- tubulin (b-tubulin (TUJ1) mouse monoclonal antibody and Goat anti-mouse IgG Alexa Fluor 488. Optical images were captured using a Zeiss LSM 710 confocal microscope and an Axio Imager A1 microscope.
  • the different transduced cells were stained with CD45RA-PE and CD62L-PE-Cy7 and the different sub-populations (effector memory (CD62L- CD45RA-), effector (CD62L-CD45RA+), central memory (CD62L+CD45RA-) and nai ' ve/stem cell memory (CD62L+CD45RA+)) analyzed for eGFP expression.
  • FIG. 13 Performance of the different IDLVs in differentiated skin and oral mucosa cells
  • integrative vectors are the vectors of choice when stable gene expression in actively dividing cells is required, whereas non-integrative vectors are preferred for the stable expression in non-dividing cells or when transient expression is sufficient or desirable.
  • Integrative LVs have several properties that make them an attractive tool for gene delivery such as the ability to deliver inserts of up to 12Kb, the active translocation to intact nuclei and the possibility of using different envelopes that enable efficient gene delivery in almost all the cell lines analyzed.
  • IDLVs integrative deficient LVs
  • IDLVs have been linked to epigenetic silencing through cellular defense mechanisms which apply heterochromatin marks to episomal viral sequences.
  • This cellular response which is not restricted to IDLV systems, affects different vector genomes such as herpes simplex viruses and adenoviruses.
  • the episomal viral DNA is "chromatinized” and acquires nucleosome-like properties immediately after entry into the nucleus.
  • IDLV genomes have been previously reported to undergo heterochromatinization through histone deacetylation, a process which can be reversed using histone deacetylase inhibitors (HDACi) such as sodium butyrate and valproic acid.
  • HDACi histone deacetylase inhibitors
  • HDACi histone deacetylase inhibitors
  • the present invention confronted the above problems by using the improved IS2 element containing HS4 and synthetic S/MAR elements previously described in [Benabdellah, K., et al., A chimeric HS4-SAR insulator (IS2) that prevents silencing and enhances expression of lentiviral vectors in pluripotent stem cells.
  • IS2 chimeric HS4-SAR insulator
  • PLoS One, 2014.9(1): p. e84268. whose inclusion in IDLVs could improve their behavior by avoiding epigenetic transcriptional silencing through HS4 activity and by improving the transcription efficiency through S/MAR activity.
  • the presence of the IS2 element did not abrogate epigenetic silencing by histone deacetylases, although it did improve the transcriptional efficiency of episomal IDLVs.
  • SEQ. ID NO 1 was inserted into the lentiviral backbone 3'LTR in order to be duplicated during the reverse transcription process. This procedure enhances the effect of S/MAR sequences and/or increases homologous recombination in order to promote the formation of 1-LTR circles which is reported to be 2-4-fold more effective for expression than 2-LTR circles. To differentiate between these two effects, we constructed a 1.2kb-IDLV lentiviral backbone which has the same insertion in the LTR as IS2-IDLV but contains an irrelevant sequence.
  • the 1-LTR form is the result of homologous recombination between the LTRs, while 2-LTR circles are the result of non-homologous end joining (NHEJ), meaning that longer LTRs are expected to render higher levels of 1-LTRs.
  • NHEJ non-homologous end joining
  • the elements contained in the IS2 function as DNA anchor points for the chromatin scaffold and organize the chromatin into structural domains that separate different transcriptional units from each other and provide a platform for the assembly of the factors involved in transcription regulation.
  • Several studies indicate that these elements are located in proximity to expressed genes at the 5' end or near transcription start sites.
  • Several pieces of evidence suggest that these elements may poise the DNA for transcription by allowing interaction with ubiquitous tissue-specific transcription factors such as special AT-rich binding protein I (SATB-1), NMP4 and CTCF; these, in turn, recruit regulatory proteins such topoisomerases and ATP-dependent chromatin remodeling complexes to mediate a more expression-permissive state.
  • SATB-1 special AT-rich binding protein I
  • NMP4 and CTCF these, in turn, recruit regulatory proteins such topoisomerases and ATP-dependent chromatin remodeling complexes to mediate a more expression-permissive state.
  • the present invention is directed to the element IS2, which comprises the following combination of nucleic acid molecules, namely the combination of nucleic acid molecule HS4- 650 bp and a synthetic S/MAR nucleic acid molecules containing 4M/SARs recognition signatures (M RS) (SEQ I D NO 1).
  • M RS 4M/SARs recognition signatures
  • the authors of the invention have shown that when this element, namely element IS2, is inserted in the U3 of the 3'LTR region of integration- defective lentiviral vectors (I DLVs), it is able to enhance expression in different vectors backbones and different cell types.
  • a first aspect of the invention refers to an integration-defective lentiviral vector (I DLVs) comprising a sequence consisting of SEQ. I D No 1 or any combination of HS4650 and SAR2 sequences such as:
  • SAR2-HS4650-SAR2 taaataaacttataaattgtgagagaaattaatgaatgtctaagttaatgcagaaacggaggctcctcatttatttttgaacttaaagactt aatattgtgaaggtatactttcttttaataataagcctgcgcccaatatgttcaccccaaaaaaagctgtttgttaacttgtcaacctcatttAA
  • SAR2-HS4650-SAR2-SAR2 taaataaacttataaattgtgagagaaattaatgaatgtctaagttaatgcagaaacggaggctcctcatttatttttgaacttaaagactt aatattgtgaaggtatactttcttttaataataagcctgcgcccaatatgttcaccccaaaaaaagctgtttgtaacttgtcaacctcatttAA
  • AAACagccca aaga cAAT AACAAAAG AAT AAT AAAAAAG AAT G AAAT AT GT AATT CTTT CAG AGT AAAA
  • the combination of HS4650 a nd SAR2 sequences is in a 1 to 1 ratio SAR2:HS4650. More preferably, the combination of HS4650 and SAR2 sequences is in a 2 to 1 ratio SAR2:HS4650. More preferably, the combination of HS4650 and SAR2 sequences is in a 3 to 1 ratio SAR2:HS4650. More preferably, the combination of HS4650 and SAR2 sequences is in a 4 to 1 ratio SAR2:HS4650. In all of these preferred embodiments of the first aspect of the invention, the number of SAR2 sequences is between 1 and 8 sequences.
  • a second aspect of the invention refers to an integration-defective lentiviral vector (I DLVs) comprising a nucleic acid molecule which in turn comprises: a) The IS2 element or equivalent b) regulatory control elements, and c) coding nucleic acid molecules operatively associated with the regulatory elements and capable of expression in the target cell; wherein the insulator element is selected from any of the sequences defined in the first aspect of the invention or any combination of HS4650 and SAR2 sequences.
  • I DLVs integration-defective lentiviral vector
  • the term "integration-defective lentiviral vector (IDLVs)" is understood as any virus-like particle derived from the lentiviral family of retroviruses in which the integrase protein is mutated.
  • the generation of the IDLVs particles follow a similar procedure as for the generation of the integrative Lentiviral vectors (LVs) with the only difference of the packaging plasmids, expressing the gag-pol polyprotein.
  • the packaging plasmids harbor a mutation in the Integrase gene that block the ability of the vectors to integrate.
  • the genetic material delivered by the IDLV remains therefore as episomal DNA forms (mainly as episomal circles) in the nuclei of the target cells for a certain period of time, depending on the cell type.
  • the IS2 element of the present invention is capable of permitting the expression of coding nucleic acid molecules (please note that it is herein understood that the term “coding nucleic acid molecules” includes the term “transgene”) in research, protein production and gene therapy in mammalian cells, preferably in cell types such as 293T cells, NPCs, neurons and iPSCs.
  • coding nucleic acid molecules includes the term “transgene”
  • Other synthetic elements apart from the one disclosed herein, preferably using sequences from mammals, having a high level of sequence identity to the IS2 elements described in the first aspect of the invention can be used in the present invention.
  • Suitable sequences preferably have at least about: 70% identity, at least 80% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity or most preferably have at least 99% or 99.5% identity to the sequence of an insulator element as described in the first aspect above.
  • Identity refers to the similarity of two nucleotide sequences that are aligned so that the highest order match is obtained. Identity is calculated according to methods known in the art.
  • Sequence A a nucleotide sequence
  • Sequence A will be identical to the referenced portion of SEQ ID NO 1 except that Sequence A may include up to 10 point mutations (such as substitutions with other nucleotides) per each 100 nucleotides of the referenced portion of SEQ ID NO 1.
  • the invention also includes an IS2 element having DNA which in turn has a sequence with sufficient identity to the insulator elements described in the first aspect of the invention to hybridize under stringent hybridization conditions.
  • the present invention also includes IS2 elements having nucleic acid molecules that hybridize to one or more of the sequences in SEQ ID NO 1- SEQ ID NO 4 or its complementary sequences.
  • Such nucleic acid molecules preferably hybridize under high stringency conditions (see Sambrook et al. Molecular Cloning: A Laboratory Manual, Most Recent Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. ).
  • High stringency washes have preferably have low salt contents (preferably about 0.2% SSC) and a temperature of about 50-65 C.
  • these other insulator elements can be readily inserted in a nucleic acid molecule provided that expression of the coding nucleic acid molecule still occurs.
  • the element or the nucleic acid molecule is located at the U3 of the 3'LTR region of the IDLVs.
  • the insulator will be located at both sides of the regulatory and coding sequences.
  • the polypeptides produced from said vectors may also be administered to mammals, preferably humans.
  • the U3 of the 3'LTR region of a IDLV is a sequence that contains the regulatory control elements of the virus, is present only in the 3' end of the viral genome (in the virus particles) and in both ends in the integrated provirus. This sequence is eliminated/ mutated from the vectors for safety reasons.
  • the SEQ ID No 1 and SEQ ID No 2 or SEQ ID No 3 must be preferentially inserted into the Bbsl restriction site of the U3 of the 3'LTR.
  • mammalian cells are cells which are derived or isolated from tissue of a mammal, cell types such as 293T cells, NPCs, neurons and iPSCs.
  • these cells are stem cells, preferably pluripotent stem cells of adult tissue origin (iPS) or of embryonic origin (ESCs).
  • these cells are human mammalian cells of non-embryonic origin (ESCs) or non-human mammalian cells of any origin including embryonic stem cells (ESCs).
  • these cells are human embryonic stem cells when the nucleic acid molecules described in the present invention are used for therapeutic or diagnostic purposes which are applied to the human embryo and are useful to it.
  • the regulatory control elements of the second aspect of the invention are understood to be DNA sequences able to promote the synthesis of RNAs under different conditions.
  • the coding nucleic acid molecules of the second aspect of the invention are understood to be DNA sequences that, when transcribed into RNA molecules through the action of the regulatory elements, will give rise to functional proteins or RNAs.
  • nucleic acid molecules described in the second aspect of the present invention are constructed from regulatory elements, a coding nucleic acid molecule and the sequence/s of the invention.
  • These nucleic acid molecules may be used in vivo or in vitro, preferably for transforming or transducing cell types such as 293T cells, NPCs, neurons and iPSCs. Cells transfected or transduced in vitro with this molecules can be used for ex vivo gene therapy or as a research tool or for protein production.
  • These nucleic acid molecules are also useful for gene therapy by transfecting or transducing cells in vivo to express a therapeutic protein. For example, if one were to upregulate the expression of a gene, one could insert the sense sequence into the nucleic acid molecule.
  • nucleic acid molecule described in the second aspect of the present invention may be either isolated from a native source (in sense or antisense orientations) or synthesized. It may also be a mutated native or synthetic sequence or a combination of these. Examples of coding nucleic acid molecules to be expressed include 3- globin and GFP expressing reporter genes.
  • two identical IS2 elements are located flanking the regulatory and coding sequences, wherein these two identical elements comprise any of the sequences identified in the first aspect of the invention.
  • the regulatory control element comprises a drug-responsive element.
  • said regulatory control element comprises a doxycicline-responsive element.
  • said regulatory control element comprises a doxycicline-responsive element based on the original TetRrepresor.
  • the original TetRrepresor is the product of the tetR gene (the TetR protein) from Escherichia coli.
  • the coding nucleic acid molecule is a reporter gene.
  • the nucleic acid molecule of the second aspect of the invention comprises two regulatory elements and two coding nucleic acid molecules.
  • the nucleic acid molecule of the second aspect of the invention comprises two different regulatory elements, one drug-inducible and one constitutive.
  • the first regulatory element is regulated by the TetO operon and the second regulatory element expresses the TetR repressor.
  • the drug-inducible regulatory element is based on the cytomegalovirus (CMV) promoter and the constitutive regulatory element is based on the Spleen Focus Forming Virus LTR.
  • the drug-inducible regulatory element is based on any human gene promoter and the constitutive regulatory element is based on the EFlalpha gene promoter.
  • the vector is used in vivo or in vitro, preferably for transforming or transducing cell types such as 293T cells, NPCs, neurons and iPSCs.
  • the invention also relates, as a third aspect of the invention, to a method of medical treatment of a mammal, preferably a human, by administering to the mammal the vector of the first or second aspect of the invention, or of any of its preferred embodiments, or a cell containing any of these elements, preferably cell types such as 293T cells, NPCs, neurons and iPSCs.
  • Diseases such as blood diseases or neural diseases (neurodegenerative), that may be treated are diseases, such as thalassemia or sickle cell anemia that are treated by administering a globin gene.
  • Blood diseases treatable by stem cell transplant include leukemias, myelodysplastic syndromes, and stem cell disorders, myeloproliferative disorders, lymphoproliferative disorders phagocyte disorders, inherited metabolic disorders, histiocytic disorders, inherited erythrocyte abnonnalities, inherited immune system disorders, inherited platelet abnormalities, plasma cell disorders, and malignancies.
  • Stem cell nerve diseases to be treated by neural stem cell transplantation include diseases resulting in neural cell damage or loss, eg. paralysis, Parkinson's disease, Alzheimer's disease, ALS, multiple sclerosis).
  • the invention also relates to a mammalian host cell (isolated cell in vitro, a cell in vivo, or a cell treated ex vivo and returned to an in vivo site) comprising the vector of the first or second aspect of the invention.
  • a mammalian host cell isolated cell in vitro, a cell in vivo, or a cell treated ex vivo and returned to an in vivo site
  • cells transfected with suchvector may be used, for example, in bone marrow or cord blood cell transplants according to techniques known in the art. Examples of the use of transduced bone marrow or cord blood cells in transplants are for ex vivo gene therapy of Adenosine deaminase (ADA) deficiency.
  • Other cells which may be transfected or transduced either ex vivo or in vivo include purified stem cells.
  • such a mammalian cell or mammalian host cell transfected or transduced with such the vector can be useful as research tools to measure levels of expression of the coding nucleic acid molecule and the activity of the polypeptide encoded by the coding nucleic acid molecule.
  • a fourth aspect of the invention refers to a mammalian host cell comprising the vector of the first or second aspect of the invention.
  • cell types such as 293T cells, NPCs, neurons and iPSCs are used.
  • a fifth aspect of the invention refers to the use of the vector of the first or second aspect of the invention, for cell marking.
  • a sixth aspect of the invention refers to the use of vector of the first or second aspect of the invention, for cell genetic manipulation studies.
  • a seventh aspect of the invention refers to a method for expressing a nucleic acid molecule in a mammalian host cell, comprising a) administering to the cell an effective amount of the vector of the second aspect of the invention, and b) expressing the nucleic acid molecule to produce the coding nucleic acid molecule RNA and its encoding polypeptide.
  • An eight aspect of the invention refers to a method for producing a polypeptide in a mammalian host cell, comprising a) administering to the cell an effective amount of the vector of the second aspect of the invention, and b) expressing the nucleic acid molecule to produce the coding nucleic acid molecule RNA and its encoding polypeptide.
  • the host cell is a stem cell of adult tissue origin.
  • the host cell is a pluripotent stem cell of adult tissue origin (iPS) or of embryonic origen (ESCs), preferably a non human embryonic stem cell.
  • a further aspect of the invention refers to a composition comprising the vector of the second aspect of the invention, wherein this composition can be a pharmaceutical composition (from hereinafter pharmaceutical composition of the invention).
  • the pharmaceutical composition of this invention can be used to treat patients having diseases, disorders or abnormal physical states and could include acceptable carriers or excipients.
  • the pharmaceutical composition of the invention can be administered by ex vivo and in vivo methods such as electroporation, DNA microinjection, liposome DNA delivery, and virus vectors that have RNA or DNA genomes including retrovirus vectors, lentivirus vectors, Adenovirus vectors and Adeno-associated virus (AAV) vectors, Semliki Forest Virus. Derivatives or hybrids of these vectors may also be used.
  • the expression cassettes may be introduced into the cells or their precursors using ex vivo or in vivo delivery vehicles such as liposomes or DNA or RNA virus vectors. They may also be introduced into these cells using physical techniques such as microinjection or chemical methods such as coprecipitation.
  • the pharmaceutical composition of the invention can be prepared by known methods for the preparation of pharmaceutically acceptable compositions which can be administered to patients, and such that an effective quantity of the nucleic acid molecule is combined in a mixture with a pharmaceutically acceptable vehicle.
  • suitable vehicles are described, for example in Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa, USA).
  • the pharmaceutical composition could include an active compound or substance, such as a nucleic acid molecule, in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered solutions with a suitable pH and isosmotic with the physiological fluids.
  • the methods of combining the expression cassettes with the vehicles or combining them with diluents is well known to those skilled in the art.
  • the composition could include a targeting agent for the transport of the active compound to specified sites within the erythroid or other cells.
  • the present invention also includes compositions and methods (from hereinafter method of the invention) for providing a coding nucleic acid molecule as defined in the first or second aspect of the invention, to a subject such that expression of the molecule in the cells provides the biological activity of the polypeptide encoded by the coding nucleic acid molecule to those cells.
  • the invention includes methods and compositions for providing a coding nucleic acid molecule to the cells of an individual such that expression of the coding nucleic acid molecule in the cells provides the biological activity or phenotype of the polypeptide encoded by the coding nucleic acid molecule.
  • the method also relates to a method for providing an individual having a disease, disorder or abnormal physical state with a biologically active polypeptide by administering a nucleic acid molecule of the present invention.
  • the amount of polypeptide will vary with the subject's needs.
  • the optimal dosage of vector may be readily determined using empirical techniques, for example by escalating doses.
  • the invention includes a process for providing a human with a therapeutic polypeptide including: introducing human cells into a human, said human cells having been treated in vitro or ex vivo to insert therein a pharmaceutical composition of the invention of the invention or a vector of the invention, the human cells expressing in vivo in said human a therapeutically effective amount of said therapeutic polypeptide.
  • 293T cells (CRL11268; American Type Culture Collection, Rockville, MD) were cultured in Dulbecco's Modified Eagle Medium (DMEM, Invitrogen, Edinburgh, Scotland) supplemented with 10% Fetal Bovine Serum (FBS, Invitrogen).
  • DMEM Dulbecco's Modified Eagle Medium
  • FBS Fetal Bovine Serum
  • the Jurkat T lymphocyte line (TIB-152) (ATCC, Manassas, VA) were grown in RPMI medium supplemented with 10% FBS and Penicillin- Streptomycin Solution (Biowest).
  • Human neural progenitor cells (GIBCO Human Neural Stem Cells, H9 hESC-derived), Cat. No.
  • the complete growth medium was replaced by the neural differentiation media (NSC SFM Media without basic FGF recombinant protein or EGF recombinant protein) and maintained at 37 ⁇ C, in 5% C0 2 .
  • the medium was changed every 3-4 days for 28 days.
  • the mature neural-like cells were characterized by immunocytochemistry.
  • Mature neural-like cells were fixed in 4% paraformaldehyde for 30 min at room temperature. After fixation, the cells were washed three times with PBS. To permeabilize the cells and to avoid non-specific antigens, the fixed cells were incubated in PBS with 2% goat serum and 0.1% Triton-X100 buffer (SigmaAldrich, St. Louis, MO, http://www.sigmaaldrich.com) for 30 min at room temperature.
  • the IS2 element which combinethe HS4-650 fragment and the SAR2, were designed and synthesized.
  • the IS2 and an irrelevant 1.2 kb sequence were inserted into the 3'LTR of the SE or SEWP and AWE backbones.
  • LVs and IDLVs were generated by transient transfection of 293T cells using the transfer plasmid, the packaging plasmid pCMVDR8.91 for LVs and pCMVDRD8.74 for IDLVs as well as the plasmid encoding the VSV-G envelope gene http://www.addgene.org/Didier_Trono. Transfection was performed with the aid of LipoD293TM (SignaGen Laboratories, Ijamsville, MD, USA) according to the manufacturer's instructions, and the supernatants were harvested at 48h and 72h after transfection.
  • Viral titers were determined by the estimation of transduction units (TU) per milliliter using the ABM ' s Lentiviral qPCR Titer Kit. Converting the amount of viral copies per ml (GC/ml) to Transduction units (TU/ml) as indicated by the manufacturer. (qPCR Lentivirus Titration Kit, Applied Biological Materials (ABM) Inc.).
  • the cell line PBMCl-iPS4Fl was incubated for 5 hours on the day of passage with a concentrated virus in the presence of 8 pg/ml Polybrene and 10 mM Y-27632 (Sigma-Aldrich).
  • the 2-L.TR/ total IDLV DNA ratio in transduced cells was determined by real-time PCR using different primer pairs (Table 1) that enable to discriminate 2LTR from total IDLV DNA.
  • Table 1 As an internal control, we also used primers for the human albumin locus (hAlb).
  • DNA of transduced cells was extracted 72 hours after transduction using a QJAamp DNA Mini kit (QJAGEN, Hilden, Germany, https://www.qiagen.com).
  • Real-time PCRs were performed using the QuantiTectSYBRGreen PCR kit (Qjagen) on a Stratagene MX3005P System (Agilent Technologies, Santa Clara, CA, https://www.agilent.com).
  • PCRs were performed using the following run program: 10' at 95 ⁇ C for denaturation, 40 cycles of 15 min at 95 ⁇ C, 60min at 60 ⁇ C and 72 ⁇ C for 60" followed by the melting curve. PCR data were analyzed according to the comparative C T method [79]. mRNA Analysis by RT-qPCR
  • RNA samples were reverse-transcribed using the Superscript first-strand system (Invitrogen) and qPCRs were performed using the QuantiTectSYBRGreen PCR kit (Qiagen) on a Stratagene MX3005P system (Agilent Technologies, Santa Clara, CA, www.agilent.com), The primers used are listed in table 1.
  • FISH Fluorescence in situ hybridization
  • Table 1 Pairs of primers used to establish the 2LTR/total IDLV DNA ratio by real-time PCR and to estimate the cDNA amount of eGFP.
  • the q2LTR pair of primer flanks the c2LTR junction.
  • the second pair of primers amplify c2LTR, as well as clLTR and linearized IDLV DNA.
  • the qhAlb is used as a control for genomic normalization.
  • .GFP cDNA pair of primers, amplify the eGFP cDNA and GAPDH were used for cDNA normalization.
  • PBMCs Peripheral blood mononuclear cells
  • PBMCs Peripheral blood mononuclear cells
  • Isolated fibroblasts were collected by centrifugation and expanded in culture flasks containing basal culture medium (Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 0.25 mg /ml amphotericin B, all from Sigma-Aldrich, St. Louis, MO, http://www.sigmaaldrich.com under standard cell culture conditions).
  • basal culture medium Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 0.25 mg /ml amphotericin B, all from Sigma-Aldrich, St. Louis, MO, http://www.sigmaaldrich.com under standard cell culture conditions).
  • Activated T cells were transduced with viral supernatants and spinoculated at 800g during lh, and cells were washed 4 hours later. Similarly, Jurkat cells resuspended in viral supernatants were spinoculated at 800g at 32 ⁇ C during 30 minutes. Four hours after transduction, cells were washed and plated at a density of 100.000 cells/ml.
  • CD45RA-PE HI100 clone
  • CD62L-PE-Cy7 DREG56 clone antibodies
  • IS2 element into the IDLV backbone does not affect RNA packaging into vector particles but reduces the amount of IDLV episomes in the target cells. It has been described previously that insertions of large fragments into the 3'LTR of LVs reduce their efficacy. These insertions do not affect viral particles production but reduce reverse transcription efficacy in target cells.
  • the vector production efficacy was measured from the vector supernatants using the ABM's Lentiviral qPCR Titer Kit.
  • This Kit calculates the transduction units (TU) per milliliter (ml) based on an equation that convert genome copies per ml (GC/ml) values to TU/ml(See material and methods for details).
  • the value obtained using this formula is generally very close to the amount of effective particles per ml, although this can vary depending on the vector backbone.
  • the relative amounts of reverse transcription products of the different vectors were quantified by qPCR using the U3Fw/PBSRev primer pair (see Fig 9). As expected, we did not observe any effect of the IS2 on vector production of LVs or IDLVs.
  • IDLVs episomesharbouring the IS2 element express higher mRNA levels and have a distinct nuclear localization.
  • the IS2 is a chimeric DNA element containing a synthetic scaffold attachment region (SAR2) and a 650 pb fragment of the chicken b-globin HS4 insulator (Benabdellah, K., et al., A chimeric HS4- SAR insulator (IS2) that prevents silencing and enhances expression of lentiviral vectors in pluripotent stem cells. PLoS One, 2014. 9(1): p. e84268.]. As already mentioned, these elements could enhance transcription or increase episomalestability that can also lead to an improved transgene expression.
  • SAR2 synthetic scaffold attachment region
  • IS2 650 pb fragment of the chicken b-globin HS4 insulator
  • LTR inserts such as the IS2 element can also increase homologous LTR recombination favoring 1-LTR circles formation that are superior to 2-LTR circles in terms of transgenic expression and this could be another potential mechanism behind the improved transcriptional activity of SE- IS2-I DLVs.
  • SE-1.2kb control IDLV harboring an equivalent insertion (1.2kb) of irrelevant DNA at the same LTR location ( Figure 5a) and compared it effect on IDLVs behavior.
  • the final effect of the IS2 element depends on the target cell and vector backbone.
  • NPCs neural progenitor cells
  • NCs neuronal cells
  • iPSCs induced pluripotent stem cells
  • MSCs mesenchymal stromal cells
  • T cells human oral mucosa and skin fibroblasts and T cells.
  • the different cell types were transduced with SE-IDLVs and SE-IS2-IDLVs at equal MOIs and, 3 days later, we analyzed transgen expression levels in terms of Mean fluorescence intensity (MFI) and percentage of eGFP+ cells.
  • MFI Mean fluorescence intensity

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Dans la présente invention, les inventeurs ont testé si l'élément IS2 pourrait améliorer l'expression du gène IDLV dans différents types de cellules. Bien que la présence de l'élément IS2 n'a pas pu supprimer le silençage épigénétique, elle a eu pour effet d'améliorer l'efficacité de l'IDLV dans plusieurs lignées cellulaires. De manière surprenante, malgré les niveaux d'expression améliorés, l'inclusion de l'élément IS2 dans les IDLV (SE-IS2-IDLV) a permis de réduire d'un facteur 3 à 5 la quantité de vecteur épisomal dans les cellules transduites par rapport à celles transduites avec des SE-IDLV non modifiés. Nous avons estimé que l'élément IS2 améliore l'activité transcriptionnelle d'épisomes SE-IS2 d'un facteur 6 à 7.
PCT/EP2019/072025 2018-08-16 2019-08-16 Élément is2 pour obtenir des vecteurs lentiviraux défectifs à intégration améliorée WO2020035598A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP18382613 2018-08-16
EP18382613.0 2018-08-16

Publications (1)

Publication Number Publication Date
WO2020035598A1 true WO2020035598A1 (fr) 2020-02-20

Family

ID=63311964

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2019/072025 WO2020035598A1 (fr) 2018-08-16 2019-08-16 Élément is2 pour obtenir des vecteurs lentiviraux défectifs à intégration améliorée

Country Status (1)

Country Link
WO (1) WO2020035598A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014140218A1 (fr) * 2013-03-13 2014-09-18 Fundación Pública Andaluza Progreso Y Salud Isolateur pour améliorer les vecteurs de transfert de gènes
WO2015078999A1 (fr) * 2013-11-28 2015-06-04 Fundación Centro Nacional De Investigaciones Cardiovasculares Carlos Iii (Cnic) Épisomes stables basés sur des vecteurs lentiviraux non intégratifs
WO2018083274A1 (fr) * 2016-11-04 2018-05-11 Fundación Pública Andaluza Progreso Y Salud Système lent-on-plus pour l'expression conditionnelle dans des cellules souches humaines

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014140218A1 (fr) * 2013-03-13 2014-09-18 Fundación Pública Andaluza Progreso Y Salud Isolateur pour améliorer les vecteurs de transfert de gènes
WO2015078999A1 (fr) * 2013-11-28 2015-06-04 Fundación Centro Nacional De Investigaciones Cardiovasculares Carlos Iii (Cnic) Épisomes stables basés sur des vecteurs lentiviraux non intégratifs
WO2018083274A1 (fr) * 2016-11-04 2018-05-11 Fundación Pública Andaluza Progreso Y Salud Système lent-on-plus pour l'expression conditionnelle dans des cellules souches humaines

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
BENABDELLAH, K. ET AL.: "A chimeric HS4-SAR insulator (IS2) that prevents silencing and enhances expression of lentiviral vectors in pluripotent stem cells", PLOS ONE, vol. 9, no. 1, 2014, pages e84268, XP055127119, doi:10.1371/journal.pone.0084268
BENABDELLAH, K. ET AL.: "chimeric HS4-SAR insulator (IS2) that prevents silencing and enhances expression of lentiviral vectors in pluripotent stem cells", PLOS ONE, vol. 9, no. 1, 2014, pages e84268, XP055127119, doi:10.1371/journal.pone.0084268
FRECHA, C. ET AL.: "Improved lentiviral vectors for Wiskott-Aldrich syndrome gene therapy mimic endogenous expression profiles throughout haematopoiesis", GENE THER, vol. 15, no. 12, 2008, pages 930 - 41, XP002713319, doi:10.1038/gt.2008.20
GRANDCHAMP NICOLAS ET AL: "Influence of insulators on transgene expression from integrating and non-integrating lentiviral vectors", GENETIC VACCINES AND THERAPY, BIOMED CENTRAL, LONDON, GB, vol. 9, no. 1, 4 January 2011 (2011-01-04), pages 1, XP021088806, ISSN: 1479-0556, DOI: 10.1186/1479-0556-9-1 *
KARIM BENABDELLAH ET AL: "A Chimeric HS4-SAR Insulator (IS2) That Prevents Silencing and Enhances Expression of Lentiviral Vectors in Pluripotent Stem Cells", PLOS ONE, vol. 9, no. 1, 6 January 2014 (2014-01-06), pages e84268, XP055127119, DOI: 10.1371/journal.pone.0084268 *
KARIM BENABDELLAH ET AL: "Lent-On-Plus Lentiviral vectors for conditional expression in human stem cells", SCIENTIFIC REPORTS, vol. 6, no. 1, 17 November 2016 (2016-11-17), XP055443844, DOI: 10.1038/srep37289 *
KLAUS WANISCH ET AL: "Integration-deficient Lentiviral Vectors: A Slow Coming of Age", MOLECULAR THERAPY, vol. 17, no. 8, 1 August 2009 (2009-08-01), pages 1316 - 1332, XP055021370, ISSN: 1525-0016, DOI: 10.1038/mt.2009.122 *
KYMALAINEN, H. ET AL.: "Long-term episomal transgene expression from mitotically stable integration-deficient lentiviral vectors", HUM GENE THER, vol. 25, no. 5, 2014, pages 428 - 42
VERGHESE, S.C. ET AL.: "S/MAR sequence confers long-term mitotic stability on non-integrating lentiviral vector episomes without selection", NUCLEIC ACIDS RES, vol. 42, no. 7, 2014, pages e53
WANISCH, K.R.J. YANEZ-MUNOZ: "Integration-deficient lentiviral vectors: a slow coming of age", MOLTHER, vol. 17, no. 8, 2009, pages 1316 - 32, XP055021370, doi:10.1038/mt.2009.122
XU ZHEN ET AL: "Non-integrating lentiviral vectors based on the minimal S/MAR sequence retain transgene expression in dividing cells", SCIENCE CHINA LIFE SCIENCES, ZHONGGUO KEXUE ZAZHISHE, CHINA, vol. 59, no. 10, 6 September 2016 (2016-09-06), pages 1024 - 1033, XP036075098, ISSN: 1674-7305, [retrieved on 20160906], DOI: 10.1007/S11427-016-0067-0 *
XU, Z. ET AL.: "Non-integrating lentiviral vectors based on the minimal S/MAR sequence retain transgene expression in dividing cells", SCI CHINA LIFE SCI, vol. 59, no. 10, 2016, pages 1024 - 1033, XP036075098, doi:10.1007/s11427-016-0067-0

Similar Documents

Publication Publication Date Title
JP6143231B2 (ja) 副腎脳白質ジストロフィおよび副腎脊髄神経障害のための遺伝子療法ベクター
JP2021530985A (ja) フソソームの組成物及びその使用
JP7263327B2 (ja) 細胞の遺伝子修飾のための非組込みｄｎａベクター
US8569065B2 (en) Compositions and methods for the delivery of biologically active RNAs
JP2022507454A (ja) Ｃｎｓ送達のためのフソソーム組成物
JP2022507453A (ja) Ｔ細胞送達のためのフソソーム組成物
Pelascini et al. Histone deacetylase inhibition activates transgene expression from integration-defective lentiviral vectors in dividing and non-dividing cells
US20230250407A1 (en) Silencing of dux4 by recombinant gene editing complexes
JP7432621B2 (ja) 選択的遺伝子調節のための組成物および方法
US20200172913A1 (en) Peptides and nanoparticles for intracellular delivery of virus
US10053709B2 (en) Insulator to improve gene transfer vectors
US9018011B2 (en) Gamma satellite insulator sequences and their use in preventing gene silencing
US20210198698A1 (en) Fusosome compositions and uses thereof
US20130164845A1 (en) Compositions and Methods for the Delivery of Biologically Active RNAs
US20200261589A1 (en) Use of a Syncytin for Targeting Drug and Gene Delivery to Regenerate Muscle Tissue
JP2018519827A (ja) 逆配向のヒトユビキチンｃプロモーターを含むレトロウイルスベクター
JP2022522196A (ja) ラミノパシーを処置するための組成物および方法
US20190224337A1 (en) Inducible expression cassette, and uses thereof
WO2020035598A1 (fr) Élément is2 pour obtenir des vecteurs lentiviraux défectifs à intégration améliorée
JP4766297B2 (ja) 非ウィルス由来のエンハンサーと、ｃＰＰＴと、ＣＴＳとを含むことを特徴とするベクター
CN112512595A (zh) 心脏、骨骼肌和肌肉干细胞中的体内同源性定向修复
Thrasher A dose escalation study of cyclophosphamide (CTX) to enhance SB-728-T engraftment Dale Ando Sangamo BioSciences, Richmond CA, USA

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19765178

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19765178

Country of ref document: EP

Kind code of ref document: A1