WO2020032324A1 - 폐렴구균의 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도 - Google Patents

폐렴구균의 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도 Download PDF

Info

Publication number
WO2020032324A1
WO2020032324A1 PCT/KR2018/013791 KR2018013791W WO2020032324A1 WO 2020032324 A1 WO2020032324 A1 WO 2020032324A1 KR 2018013791 W KR2018013791 W KR 2018013791W WO 2020032324 A1 WO2020032324 A1 WO 2020032324A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
peptide
antibiotic
hica
hicba
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2018/013791
Other languages
English (en)
French (fr)
Inventor
이봉진
김도희
강성민
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SNU R&DB Foundation
Original Assignee
Seoul National University R&DB Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seoul National University R&DB Foundation filed Critical Seoul National University R&DB Foundation
Publication of WO2020032324A1 publication Critical patent/WO2020032324A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/06Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to antibiotic peptides targeting the toxin-antitoxin system of Streptococcus pneumoniae and their use.
  • Streptococcus pneumoniae is a Gram-positive and facultative anaerobic bacterium that causes otitis media, sinusitis, pneumonia, and meningitis, and is usually inhaled into the respiratory tract to stay in the pharynx and nasal cavity. Cause illness.
  • Glycopeptide antibiotics such as vancomycin and penicillin have been mainly used to eliminate pneumococci and alleviate the symptoms of these diseases, but pneumococci that are resistant to conventional antibiotics continue to be used. As it emerges, the need for antibiotic development in new strategies is emerging.
  • Bacteria generally have a toxin-antitoxin system, which plays an important role in physiological processes such as gene regulation, growth, survival and apoptosis.
  • toxins and allogeneic antitoxins form stable complexes, but under stress, unstable antitoxins are broken down to release free toxins.
  • the released toxins are toxic by inhibiting DNA replication, protein synthesis and cell wall synthesis by degrading the RNA of the host cell or binding to topoisomerase or ribosomes.
  • Toxin-antitoxin systems are classified into six types (types I to VI), depending on how the antitoxin inhibits toxin toxicity.
  • antitoxins are antisense RNAs capable of binding to toxin mRNA, which inhibits translation of toxins.
  • type II systems toxins and antitoxins in protein form bind to each other to form nontoxic protein complexes.
  • type III systems RNA forms of antitoxins bind directly to toxin proteins to form non-toxic RNA-protein complexes.
  • toxins and antitoxins do not bind to each other and compete competitively for the same cellular target.
  • the protein type antitoxin breaks down the toxin mRNA, and in the type VI system, the protein type antitoxin delivers the toxin protein to intracellular proteases to induce degradation of the toxin protein (Ki-Young Lee et al. , Toxins) . , 8 (10), 2016).
  • Pneumococci have several toxin-antitoxin systems, of which the HicBA toxin-antitoxin system is a type II system. Artificially inhibiting the formation of toxin-antitoxin complexes can be an attractive target for the development of new antibiotics because toxic toxins are not neutralized and cells die.
  • the present invention provides an antibiotic peptide consisting of the amino acid sequence of any one of SEQ ID NO: 1 to 4, inhibiting the formation of the HicBA complex is a toxin-antitoxin conjugate of pneumococcal.
  • the present invention also provides an antibiotic composition containing the antibiotic peptide as an active ingredient.
  • the present invention also provides an antibiotic quasi-drug containing the antibiotic peptide as an active ingredient.
  • the present invention also provides an antibiotic external preparation containing the antibiotic peptide as an active ingredient.
  • the present invention includes the pneumococcal, Bacillus subtilis , Staphylococcus aureus , Staphylococcus aureus , S. epidermidis , Escherichia coli , E. coli (Shigella dysenteriae), Salmonella typhimurium (Salmonella typhimurium), pneumonia rod bacteria (Klebsiella pneumoniae) and Pseudomonas aeruginosa prevention, improvement or treatment of the disease caused by any one or more bacteria selected from the group consisting of (Pseudomonas aeruginosa) To provide.
  • the present invention also provides the use of said antibiotic peptide for use in the manufacture of antibiotics.
  • the antibiotic peptide of the present invention inhibits the formation of pneumococcal toxin-antitoxin complex without affecting the active site of the toxin, thereby inducing the killing of pneumococci by RNA degradation activity of the isolated toxin, Since also shows antibiotic activity, it can be usefully used as an antibiotic composition.
  • Figures 1a to 1g shows the hetero-tetramer (1a), hetero-octamer (1b) and heterodimer (1c) structure of the S. pneumoniae HicBA protein complex, the Y. pestis HicBA protein complex
  • a diagram showing a heterodimer structure (1d), a tetramer structure of pneumococcal HicB protein (1e), and a comparison of HicB protein structures (1f and 1g) of pneumococcus and Pest bacterium (1c and 1d: square portions indicated by black dotted lines) Represents a C-terminal DNA-binding domain site which is not present in the HicB protein of Pest bacterium but only in the HicB protein of pneumococcal).
  • Figures 2a and 2b is a diagram showing the results of size exclusion chromatography combined with multi-angle light scattering (MALS) of the HicBA protein complex (2a) and HicB protein (2b) of pneumococci.
  • MALS multi-angle light scattering
  • 3A and 3B show the results of analyzing secondary structures of HicB protein (3a) and HicA protein (3b) of Y. pestis and S. pneumoniae .
  • FIG. 4 is a graph of the RNA degradation activity of the HicA protein of pneumococci and the VapC26 and VapC30 proteins of Mycobacterium tuberculosis.
  • Figures 5a to 5c shows the alignment of the amino acid sequence of the pneumococcal HicA protein with amino acid sequences such as other HicA protein (5a), the interaction of the RNA degradation activity site and the residues of the pneumococcal HicA protein with the HicB protein ( 5b) and the result of comparing the structure of the pneumococcal HicA protein with that of other HicA proteins (5c)
  • 5a residues indicated by red circles represent residues essential for RNA degradation activity; 5b: black
  • Dashed line means hydrogen bond and salt bridge between each residue; 5c: yellow circle indicates the site where residues are necessary for RNA degradation activity).
  • 6A and 6B show the electrostatic surface potentials 6a and 6b of the HicA protein of pneumococci and the double stranded RNA binding domain surface portion 6a of the HicA protein with RNA.
  • Figures 7a and 7b is a graph (7a) and the expression of these proteins or HicBA protein complexes as a result of comparing the RNA degradation activity of the protein (H36A) substituted histidine 36 of pneumococcal HicA protein with alanine It is the growth curve of Escherichia coli 7b.
  • 8A to 8C show hydrophobic (8a) and hydrophilic (8b) interactions of pneumococcal HicB protein and HicA protein, and confirm the cytotoxicity of Escherichia coli expressing the complex of HicB protein mutant and HicA protein.
  • 8c) (8b: black dashed lines represent hydrogen bonds and salt bridges, and the inserted table shows the respective bases involved in the interaction).
  • 9a to 9c show RNA degradation activity of the HicBA protein complex to which peptides I to IV were added (9a), RNA degradation activity when peptides II to IV were added with 100% RNA degradation activity when peptide I was added. (9b) and circular dichroism (9c) of each peptide.
  • 10A and 10B show RNA degradation activity of HicBA protein complex, HicBA protein complex with peptide I and HicA protein (10a), and RNA degradation activity of HicBA protein complex alone as 0%, and RNA degradation activity of HicA protein alone Shows the RNA degradation activity (10b) of the HicBA protein complex to which peptide I was added at 100%.
  • the present invention provides an antibiotic peptide composed of the amino acid sequence of any one of SEQ ID NOs: 1 to 4, which inhibits the formation of the HicBA complex, which is a toxin-antitoxin conjugate of pneumococci.
  • the peptide corresponds to amino acid residues 56-66 of HicA, which is a toxin protein of pneumococcal, and may inhibit the binding of the ⁇ 2 region consisting of the amino acid sequence of SEQ ID NO: 5 to the antitoxin protein HicB.
  • the peptide may not affect the activity of pneumococcal toxin.
  • the peptide may be to exhibit antibiotic activity against any one or more bacteria selected from the group consisting of pneumococci, Bacillus subtilis, Staphylococcus aureus, E. coli, E. coli, S. aureus, Salmonella typhimurium, P. pneumoniae and Pseudomonas aeruginosa.
  • the peptide may be synthesized by conventional chemical synthesis methods (WH Freeman and Co., Proteins; structures and molecular principles, 1983), specifically, liquid phase peptide synthesis (Solution Phase Peptide synthesis), solid phase peptide synthesis ( solid-phase peptide syntheses), fragment condensation and F-moc or T-BOC chemistry, and more specifically, solid phase peptide synthesis.
  • the peptide of the present invention can be prepared by the following genetic engineering method.
  • a DNA sequence encoding the peptide is prepared according to a conventional method.
  • DNA sequences can be prepared by amplification by polymerase chain reaction (PCR) using appropriate primers.
  • PCR polymerase chain reaction
  • DNA sequences may be synthesized by standard methods known in the art, such as using automated DNA synthesizers (eg, products from Biosearch or Applied Biosystems).
  • the DNA sequence is inserted into a vector comprising one or more expression control sequences (eg, promoters, enhancers, etc.) that are operably linked thereto to regulate expression of the DNA sequence.
  • expression control sequences eg, promoters, enhancers, etc.
  • the host cell is transformed with the recombinant expression vector formed therefrom, and the resulting transformant is then cultured under appropriate media and conditions to allow the DNA sequence to be expressed. Subsequently, substantially pure peptides encoded by the DNA sequence are recovered from the culture using methods known in the art (eg, chromatography).
  • the peptide may be a variant of an amino acid having a different sequence by deletion, insertion, substitution, or a combination of amino acid residues within a range that does not affect the function of the protein.
  • Amino acid exchange in proteins or peptides that do not alter the activity of the molecule as a whole is known in the art. In some cases, it may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation or farnesylation.
  • the present invention may include a peptide having an amino acid sequence substantially identical to a peptide consisting of the amino acid sequence of any one of SEQ ID NOs: 1 to 4, and variants or fragments thereof. Such substantially identical peptides may have homology with the peptides of the invention at least 80%, specifically at least 90%, more specifically at least 95%.
  • the inventors isolate and purify the toxin-antitoxin (HicBA) protein complex of pneumococci, determine the structure through X-ray diffraction analysis, and RNA degradation of the HicA toxin protein. Amino acid residues essential for activity and thus cytotoxicity were identified (see FIGS. 1-7).
  • HicBA toxin-antitoxin
  • peptides I to IV were constructed to mimic the ⁇ 2 region of the HicA protein that binds to the HicB protein, and the effect of increasing the RNA degradation activity was increased by increasing the HicA toxin protein isolated according to the inhibition of HicBA protein complex formation of the peptides.
  • Antibiotic activity of 8 bacteria other than pneumococcal of peptide I was confirmed (see FIGS. 9, 10 and Table 6).
  • the peptide that mimics the ⁇ 2 region of the HicA protein inhibits the binding of HicBA, a toxin-antitoxin complex of pneumococcal, induces the death of pneumococcal, and shows antibiotic activity against other bacteria. It can be usefully used.
  • the present invention also provides an antibiotic composition containing the antibiotic peptide as an active ingredient.
  • the antibiotic peptide may have the characteristics as described above.
  • the peptide may be composed of any one amino acid sequence of SEQ ID NO: 1 to 4.
  • composition corresponds to amino acid residues 56-66 of HicA, a toxin protein of pneumococcal, and may inhibit the binding of the ⁇ 2 region consisting of the amino acid sequence of SEQ ID NO: 5 to the antitoxin protein HicB.
  • the composition may be to exhibit an antibiotic activity against any one or more bacteria selected from the group consisting of pneumococci, Bacillus subtilis, Staphylococcus aureus, E. coli, Escherichia coli, Salmonella typhimurium, pneumococcal pneumoniae and Pseudomonas aeruginosa.
  • the present inventors confirmed the effect of increasing the RNA degradation activity according to the increase of HicA toxin protein isolated according to the inhibition of HicBA protein complex formation of the peptides I to IV (see Figs. 9 and 10), peptide I Antibiotic activity against Bacillus subtilis, Staphylococcus aureus, Epidermal Staphylococcus aureus, Escherichia coli, Heterobacteria, Salmonella typhimurium, Pneumococcal pneumoniae and Pseudomonas aeruginosa was confirmed (see Table 6). Therefore, the composition containing the peptide as an active ingredient may be usefully used as an antibiotic composition.
  • the antibiotic composition comprising the antibiotic peptide of the present invention preferably comprises 0.1 to 50% by weight of the antibiotic peptide based on the total weight of the composition, but is not limited thereto.
  • compositions of the present invention may further comprise suitable carriers, excipients and diluents commonly used in the manufacture of a medicament.
  • compositions according to the invention can be used in the form of oral dosage forms, external preparations, suppositories, and sterile injectable solutions, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., respectively, according to conventional methods. have.
  • Carriers, excipients and diluents that may be included in the compositions of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient in the composition of the present invention, for example, starch, calcium carbonate, sucrose (sucrose), lactose (lactose), gelatin, etc. are mixed and prepared.
  • lubricants such as magnesium stearate and talc are also used.
  • Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • the non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol (PEG), vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like can be used.
  • PEG polyethylene glycol
  • vegetable oils such as olive oil
  • injectable esters such as ethyl oleate, and the like
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerog
  • composition of the present invention can be administered orally or parenterally, any parenteral method can be used, systemic or topical administration is possible, but systemic administration is more preferred, and intravenous administration is most preferred.
  • Preferred dosages of the compositions of the present invention vary depending on the condition and weight of the patient, the extent of the disease, the form of the drug, the route of administration and the duration, and may be appropriately selected by those skilled in the art.
  • the effective dose of the antibiotic peptide of the present invention may be 0.001 to 100 mg / kg, specifically 0.01 to 10 mg / kg, and may be administered once to several times a day.
  • the antibiotic composition of the present invention may be administered to a patient in a single dose by bolus form or by infusion for a relatively short period of time, and multiple doses may be administered for a long time. It may be administered by a fractionated treatment protocol.
  • the present invention also provides an antibiotic quasi-drug containing the antibiotic peptide as an active ingredient.
  • the antibiotic peptide may have the characteristics as described above.
  • the peptide may be composed of any one amino acid sequence of SEQ ID NO: 1 to 4.
  • the quasi-drug may correspond to amino acid residues 56-66 of HicA, a toxin protein of pneumococcal, and may inhibit the binding of the ⁇ 2 region consisting of the amino acid sequence of SEQ ID NO: 5 to the antitoxin protein HicB, and the activity of pneumococcal toxin May not affect.
  • the present inventors confirmed the effect of increasing the RNA degradation activity according to the increase of HicA toxin protein isolated according to the inhibition of HicBA protein complex formation of the peptides I to IV (see Figs. 9 and 10), peptide I Antibiotic activity against Bacillus subtilis, Staphylococcus aureus, Epidermal Staphylococcus aureus, Escherichia coli, Heterobacteria, Salmonella typhimurium, Pneumococcal pneumoniae and Pseudomonas aeruginosa was confirmed (see Table 6). Therefore, the quasi-drug containing the peptide as an active ingredient may be usefully used as an antibiotic quasi-drug.
  • the peptide of the present invention When the peptide of the present invention is used as an quasi-drug additive, the peptide may be added as it is or used together with other quasi-drugs or quasi-drug components, and may be appropriately used according to a conventional method.
  • the mixing amount of the active ingredient may be appropriately determined depending on the intended use.
  • the quasi-drug composition of the present invention is not limited thereto, but may preferably be a disinfectant cleaner, a shower foam, a gagreen, a wet tissue, a detergent soap, a hand wash, a humidifier filler, a mask, an ointment, a patch, or a filter filler.
  • the present invention also provides an antibiotic external preparation containing the antibiotic peptide as an active ingredient.
  • the antibiotic peptide may have the characteristics as described above.
  • the peptide may be composed of any one amino acid sequence of SEQ ID NO: 1 to 4.
  • the external agent corresponds to amino acid residues 56-66 of HicA, a toxin protein of pneumococcal, and may inhibit the binding of the ⁇ 2 region consisting of the amino acid sequence of SEQ ID NO: 5 to the antitoxin protein HicB, and the activity of pneumococcal toxin May not affect.
  • the present inventors confirmed the effect of increasing the RNA degradation activity according to the increase of HicA toxin protein isolated according to the inhibition of HicBA protein complex formation of the peptides I to IV (see Figs. 9 and 10), peptide I Antibiotic activity against Bacillus subtilis, Staphylococcus aureus, Epidermal Staphylococcus aureus, Escherichia coli, Heterobacteria, Salmonella typhimurium, Pneumococcal pneumoniae and Pseudomonas aeruginosa was confirmed (see Table 6). Therefore, the external preparation containing the peptide as an active ingredient may be usefully used as an external preparation for antibiotics.
  • the peptide of the present invention When used as an external preparation for skin, it is additionally used as a fatty substance, organic solvent, solubilizer, thickening and gelling agent, emollient, antioxidant, suspending agent, stabilizer, foaming agent, fragrance, surfactant, Commonly used in water, ionic or nonionic emulsifiers, fillers, metal ion sequestrants and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or external preparations for the skin It may contain adjuvants conventionally used in the field of dermatology, such as any other ingredients used. In addition, the ingredients may be introduced in amounts generally used in the field of dermatology.
  • the present invention is selected from the group consisting of pneumococci, Bacillus subtilis, Staphylococcus aureus, Epidermal staphylococcus, Escherichia coli, Salmonella, Salmonella typhimurium, Pneumococcal pneumoniae and Pseudomonas aeruginosa comprising administering the antibiotic peptide to the subject.
  • the antibiotic peptide may have the characteristics as described above.
  • the peptide may be composed of any one amino acid sequence of SEQ ID NO: 1 to 4.
  • the subject may be a mammal, specifically a human.
  • the present invention also provides the use of said antibiotic peptide for use in the manufacture of antibiotics.
  • the antibiotic peptide may have the characteristics as described above.
  • the peptide may be composed of any one amino acid sequence of SEQ ID NO: 1 to 4.
  • a F means forward primer
  • R means reverse primer
  • the PCR products of the genes encoding the HicB and HicA proteins were linked to tag-free pET21a and pET28b, respectively, which were double-cut with the restriction enzymes Nde1 and Xho1 and cut with the same enzyme, and the gene encoding the HicA protein was To the linked pET28b was an N-terminal residue tag (SEQ ID NO: 6: MGSSHHHHHHSSGLVPRGSH).
  • SEQ ID NO: 6 MGSSHHHHHHSSGLVPRGSH
  • Each of the prepared plasmids was co-transformed into Escherichia coli Rosetta2 (DE3) pLysS receptor cells.
  • HicBA protein complexes were isolated and purified using cells co-transformed with plasmids containing the HicB and HicA genes prepared in Example 1-1.
  • the cells were cultured at 37 ° C. using LB (Luria Bertani) medium until the OD 600 value reached 0.8. Then, 0.5 mM of IPTG (isopropyl 1-thio- ⁇ -D-galactopyranoside) was added to induce protein overexpression, and further incubated at 37 ° C. for 4 hours. The cultured cells were recovered by centrifugation at 11,355 ⁇ at 4 ° C. and stored at ⁇ 80 ° C. The obtained cells were suspended in buffer A containing 20% (v / v) glycerol (20 mM Tris-HCl (pH 7.9) and 500 mM NaCl) and disrupted using ultrasound, and then crushed.
  • buffer A containing 20% (v / v) glycerol (20 mM Tris-HCl (pH 7.9) and 500 mM NaCl
  • Size-exclusion chromatography was performed on a HiLoad 16/600 Superdex 200 prep-grade column (GE Healthcare) to prepare a buffer containing the HicBA protein complex with 20 mM Tris (pH 7.5) and 150 mM NaCl. It was exchanged with a buffer containing, and the exchanged sample was concentrated to a concentration of 10 mg / mL using an Amicon Ultra centrifugal filter unit (Milipore). The purity of the concentrated HicBA protein complex was confirmed by SDS-PAGE.
  • SeMet labeled HicBA protein complexes were isolated and purified for resolving phase differences in protein crystal structure analysis.
  • SeMet was carried out in the same manner as described in Example 1-2 except that the cells prepared in Example 1-1 were cultured in M9 medium containing excess essential amino acids. Labeled HicBA protein complexes were obtained.
  • each protein complex solution contained at 10 mg / mL in 20 mM Tris (pH 7.5) and 150 mM NaCl solution is mixed with 1 ⁇ l of the reservoir solution, and crystal screening 1
  • Initial crystal screening was performed using, 2 and Index kits (Hampton Research).
  • Each crystal was grown using a sitting-drop vapor diffusion method at 4 ° C, and a solution consisting of 0.1 M Tris (pH 8.5) and 2.0 M ammonium sulfate was used as a crystallization solution. . 20% glycerol was added to the solution for cryoprotection of the HicBA protein complex. The crystals were immediately frozen in liquid nitrogen before data collection.
  • Example 2-1 X-ray diffraction analysis was performed using the crystals obtained in Example 2-1.
  • X-ray diffraction analysis data of the crystals were collected using an ADSC Quantum Q270r CCD detector at 5C and 7A beamlines at Pohang Accelerator Center (South Korea) and analyzed using the HKL2000 program.
  • a data collection of each crystal is shown in Table 2 below, where the calculated total mass of the HicBA protein complex including the N-terminal histidine tag was 26349.7 Da.
  • SeMet labeled HicBA crystals Circular HicBA Crystals X-ray source 5C beamline a 7A beamline a X-ray wavelength b ( ⁇ ) 0.9795 1.0000 Space group c P2 1 2 1 2 P2 1 2 1 2 Unit cell parameters d a, b, c ( ⁇ ) 106.88, 116.58, 42.67 106.93, 116.62, 42.68 ⁇ , ⁇ , ⁇ (°) 90.0, 90.0, 90.0 90.0, 90.0, 90.0 Resolution range e ( ⁇ ) 50.0-2.80 50.0-2.30 Molecules per ASU f 2 HicBA homodimers 2 HicBA homodimers Observed reflections g (> 1 ⁇ ) 294913 237881 Unique reflections h 12859 24090 ⁇ I / ⁇ (I)> i 50.69 (6.86) n 30.2 (5.27) n Completeness j (%) 96.7 (87.8) n 100.0 (100.0
  • c Space group refers to the symmetry of the unit cell of the crystal, a combination of the symmetry elements to form a group (230 groups in total) exists.
  • d unit cell dimension A value that defines a unit cell, the smallest interpretable smallest repeat unit constituting a space lattice, defined by three crystallographic axes, a three-way vector Means the length (a, b and c) and the angles ( ⁇ , ⁇ and ⁇ ) they form.
  • ASU asymmetric unit
  • k multiplicity The same meaning as redundancy, which is the actual number of measured reflections versus the total number of unique reflections, unique for highly symmetrical crystals The total number of reflections is low, indicating higher multiplicity (repeatability) compared to crystals with low symmetry.
  • R merge The degree of agreement between the measurement data associated with symmetry. The lower the value, the same meaning as the R sym meaning that the result is more reliable.
  • m CC correlation coefficient
  • CC 1/2 A measure for demonstrating the accuracy of a CC. It is calculated using a randomly selected half dataset.
  • n The value in parentheses is the value of the high-resolution shell.
  • the structure of the HicBA protein complex was analyzed at a resolution of 2.80 Hz by single-wavelength anomalous dispersion using SeMet labeled crystals, and the final structure was determined by molecular replacement.
  • a model was formed using PHENIX, and an initial model of structural improvement was formed using a COOT program.
  • the overall geometry was verified by MolProbity, the improved structure was visualized using PyMOL, and the results of structural improvement statistics of each crystal are shown in Table 3 below.
  • d-mean-square deviation (Root mean square deviation): The structure of the determined model represents a degree consistent with conventional molecules, with bond lengths and angles to obtain by using the MAC Lev (REFMAC).
  • Ramachandran analysis an analysis of the spatial angle of the main chain of a polypeptide, showing the contradictory existence of the chain at any angle, reflecting steric repulsion. It is used as an indicator to evaluate the model.
  • size exclusion chromatography was performed using a BioSep SEC-x3000 column (Phenomenex) and a 1260 Infinity HPLC system (Agilent Technologies), and scattering data was obtained from a miniDAWN-TREOS line (Wyatt Technology) at an emission wavelength of 657.4 nm. Was obtained and analyzed using ASTRA 6.0.1.10 software (Wyatt Technology). 100 ⁇ M HicBA protein heterodimer was used in the experiment, and analyzed in a solution consisting of 20 mM Tris (pH 7.5) and 150 mM NaCl, which are the conditions of the protein crystallization experiment, all experiments were performed at room temperature.
  • the HicBA protein complex crystal structure includes two HicBA protein complex heterodimers, and two HicB antitoxin proteins and two HicA toxin proteins are hetero-tetramers ( hetero-tetramer) to form a structure (Fig. 1a).
  • the molecular weight of the HicBA protein complex calculated from MALS bound size exclusion chromatography was 105 ⁇ 0.1 kDa, which is almost identical to the theoretical molecular weight (105.4 kDa) in the hetero-octamer form of the HicBA protein complex.
  • the HicBA protein complex was confirmed to exist in the hetero-octamer form (FIGS. 1B and 2A).
  • the HicA protein comprises two ⁇ -helix and three ⁇ -strands, and has a double stranded RNA binding domain fold topology of ⁇ - ⁇ - ⁇ - ⁇ - ⁇ (FIG. 1c).
  • the HicBA protein complex of pneumococci has a long and flexible loop between ⁇ 1 and ⁇ 2 of the HicB protein, especially as predicted by the DNA binding domain. It was confirmed that the C-terminal portion of the HicB protein is not present in the HicBA protein complex of the pest (FIG. 1C, 1D, 1F, 1G and FIG. 3).
  • HicA-H36A protein was isolated and purified in the same manner as described in Example 3.
  • a F means forward primer
  • R means reverse primer
  • RNA degradation activity of the HicA protein of pneumococci was confirmed and compared with the RNA degradation activity of the VapC26 and VapC30 proteins of Mycobacterium tuberculosis , a toxin protein having different RNA degradation activity.
  • VapC26 and VapC30 proteins of Mycobacterium tuberculosis were isolated and purified by the methods described in Korean Patent Nos. 10-1849347 and 10-1746160, respectively.
  • RNA degradation activity of each protein was measured according to the manufacturer's instructions using a kit (RNase Alert Kit, IDT).
  • Synthetic RNA used as a substrate has fluorophores and quenchers attached to both ends, and when RNA is decomposed, fluorophores and quencher are separated and fluorescence is emitted at 520 nm after excitation at 490 nm. do.
  • RNA degrading activity of pneumococcal toxin protein HicA protein was the highest compared to RNase A, a common RNA degrading enzyme, or VapC26 and VapC30 proteins, which are tuberculosis toxins (FIG. 4).
  • HicA protein of Streptococcus pneumoniae of Terre mousse Terre a brush loose hypothetical protein (hypothetical protein), Yersinia pestis of HicA protein, Burke holde Ria pseudo Malay HicA protein HicA protein and E. coli (Burkholderia pseudomallei) of (Thermus thermophilus) Alignment was made using Cluster Omega 1.2.1 with amino acid sequence and visualized with ESPRrip 3.0.
  • the structural similarity between the structure of pneumococcus and HicA protein of pneumococcus was compared to the structure of the remaining proteins except for the HicA protein of Escherichia coli, whose structure is not yet known. Analyzed.
  • histidine 36 a key residue in the RNA cleavage activity of the HicA protein of pneumococcus, forms a hydrogen bond with the threonine 33 and glutamate 47 residues of the HicB protein. It was confirmed that the interaction by forming a bridge) (Fig. 5b).
  • the HicA protein of pneumococci forms a double-stranded RNA binding domain, in which ⁇ 1 interacts with the minor groove of RNA and ⁇ 2 in the RNA-coupled double-stranded RNA binding domain (PDB code 1DI2). It was confirmed that it interacts with the major groove of (Fig. 6).
  • RNA degradation activity of the HicA protein and HicA-H36A protein purified in Examples 3 and 4 was measured to determine whether the histidine 36 residue is essential for RNA degradation activity of the HicA protein.
  • RNA degradation activity was measured in the same manner as described in Experiment 1 except that 1, 2, 4 or 8 ⁇ M HicA protein and 8 ⁇ M HicA-H36A protein were mixed with synthetic RNA, respectively.
  • HicA protein showed RNA degradation activity dependent on reaction time and treatment concentration, while HicA-H36A protein whose histidine 36 residue was substituted with alanine showed no RNA degradation activity (FIG. 7A). This suggests that histidine36 residues are essential for the RNA degradation activity of the HicA protein.
  • the plasmids containing the HicB and HicA genes prepared in Example 1-1 were co-transformed into E. coli BL21 (DE3), and the plasmids expressing the HicA protein prepared in Example 1-1 and Example Plasmids expressing the HicA-H36A protein prepared in 4 were transformed into E. coli BL21 (DE3), respectively. 0.1%, respectively, the transformant cultured overnight single colonies of transformed cells grown in M9 medium plate containing glucose, and diluted the OD 600 value was set at 0.1. The diluted cells were further incubated until the OD 600 value of the cell suspension became 0.4, and then 0.5 mM IPTG was added to induce protein expression. The cells were further incubated at 37 ° C. for 8 hours after IPTG addition, and absorbance was measured at 1 hour intervals to obtain cell growth curves.
  • Example 2 The data obtained in Example 2 was analyzed to confirm the interaction between HicB and HicA proteins in the HicBA protein complex.
  • the HicB protein occupies 1,183 ⁇ 2 of the HicA protein, about 43% of the residues of the HicA protein chain D are involved in complex formation, and about 28% of the total surface area of the HicA protein is the binding site. It was confirmed to occupy.
  • the hydrophobic interaction at the two protein binding sites consists of the phenylalanine 22, methionine 44, phenylalanine 80, phenylalanine 86 and tyrosine 90 of the HicB protein and the leucine 50 and tyrosine 57 residues of the HicA protein, among others. It was confirmed that the aromatic interaction plays an important role (Fig. 8a).
  • Hydrophilic interactions also include aspartic acid 12, alanine 19, tyrosine 30, threonine 33, glutamine 34, glutamate 47, threonine 89, glutamate 106 and glutamine 111 residues of the HicB protein, and arginine 30, lysine 33, serine 35,
  • histidine 36, lysine 38, glutamate 53, asparagine 55, lysine 56, tyrosine 57, threonine 58 and glutamine 65 residues in particular aspartic acid 12, glutamate 47, aspartic acid 55 and aspartic acid 83 residues of the HicB protein.
  • histidine 36, lysine 38, lysine 56, and lysine 64 residues of the HicA protein confirmed that additional salt bridges were formed (FIG. 8B).
  • phenylalanine 22 and phenylalanine 80 residues involved in hydrophobic interaction with threonine 33, glutamine 34, glutamate 47 and threonine 89 residues involved in hydrophilic interactions were selected. Proteins substituted with alanine were prepared.
  • PET28b-HicA and pET21a-HicB prepared in Example 1-1 were co-transformed into Escherichia coli BL21 (DE3), and pET28b-HicA and pET21a-HicB mutants prepared in Example 1-1 (F22A, T33A, Q34A, E47A, F80A or T89A) were co-transformed into E. coli BL21 (DE3). Each transformed cell was incubated for 18 hours at 37 ° C. in an LB plate containing 0.5 mM IPTG.
  • HicA protein mimicking peptides including tyrosine 57, threonine 58, lysine 64 and glutamine 65) were designed and made by ANYGEN (http://www.anygen.com) (Table 5).
  • the number in a parenthesis is a number which shows the amino acid sequence of the sequence among the amino acid sequences of all HicA proteins.
  • the peptides I to IV prepared in Example 5 were dissolved in a solution consisting of 20 mM Tris (pH 7.5) and 150 mM NaCl at 25 ⁇ M concentration, respectively, and a light path of 1 mm at 20 ° C.
  • CD spectroscopic analysis was performed using a cell having a spectropolarimeter (Chirascan Plus spectropolarimeter, Applied Photophysics, Ltd.). CD scans were measured with a band width of 1 nm from 260 to 190 nm and the scan rate was 100 nm / min.
  • the helicity of each peptide was determined quantitatively based on mean residue ellipticity [[ ⁇ ] 222 ).
  • the HicBA protein complex purified in Example 1-2 was prepared in a solution consisting of 20 mM Tris (pH 7.5) and 150 mM NaCl at a final concentration of 4 ⁇ M, and the peptides I to IV were final concentrations in the same solvent. The mixture was mixed with HicBA protein complex at 4 ⁇ M and incubated at 37 ° C. for 30 minutes. Thereafter, RNA degradation activity was measured by the same method as described in Experimental Example 1.
  • the concentration dependent effect of peptide I which confirmed the best inhibitory effect of HicBA protein complex formation in Experimental Example 5, was confirmed by measuring RNA degradation activity.
  • RNA degradation activity of the 4 ⁇ M HicA protein purified in Example 3 alone was measured. Except that RNA degradation activity was measured by the same method as described in Experimental Example 5.
  • the HicA protein showed RNA degrading activity, while the HicBA protein complex had no RNA degrading activity, whereas the concentration of RNA degrading activity was increased when peptide I was added to the HicBA protein complex (FIGS. 10A and 10B). .
  • Antibiotic activity of peptide I was confirmed by measuring the minimum inhibitory concentration (MIC) against gram positive and negative bacteria.
  • peptide I showed a MIC of 6.3 to 50 ⁇ M and showed the strongest antibiotic activity against S. aureus and K. pneumoniae against 8 bacteria. 6).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oncology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Communicable Diseases (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 폐렴구균의 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도에 관한 것으로, 구체적으로 본 발명의 항생 펩타이드는 독소의 활성부위에는 영향을 미치지 않으면서 폐렴구균의 독소-항독소 복합체 형성을 억제하고, 그에 따라 분리된 독소의 RNA 분해 활성에 의해 폐렴구균의 사멸을 유도하며, 다른 균들에 대해서도 항생 활성을 나타내므로, 항생용 조성물로 유용하게 사용될 수 있다.

Description

폐렴구균의 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도
본 발명은 폐렴구균(Streptococcus pneumoniae)의 독소-항독소 체계(toxin-antitoxin system)를 표적으로 하는 항생 펩타이드 및 이의 용도에 관한 것이다.
폐렴구균(Streptococcus pneumoniae)은 그람 양성 및 조건적 혐기성(facultative anaerobic) 세균으로 중이염, 축농증, 폐렴 및 뇌수막염을 유발하는 주요 병원체이며, 보통 호흡기로 흡입되어 인두(pharynx) 및 비강(nasal cavity)에 머물면서 병을 유발한다. 폐렴구균의 제거 및 상기와 같은 질병들의 증상 완화를 위하여, 반코마이신(vancomycin) 및 페니실린(penicillin)과 같은 글리코펩타이드(glycopeptide) 항생제가 주로 사용되어 왔으나, 기존의 항생제에 내성을 갖는 폐렴구균이 지속적으로 등장하면서, 새로운 전략의 항생제 개발 필요성이 대두되고 있다.
박테리아는 일반적으로 독소-항독소 체계를 갖추고 있으며, 이는 유전자 조절, 성장, 생존 및 세포 자멸사 등과 같은 생리적 과정에서 중요한 역할을 한다. 정상적인 성장 환경에서는 독소와 그 동종의 항독소는 안정한 복합체를 형성하고 있으나, 스트레스 상태에서는 불안정한 항독소가 분해되면서 유리 독소가 방출된다. 방출된 독소는 숙주세포의 RNA를 분해하거나, 토포이소머라제(topoisomerase) 또는 리보솜에 결합함으로써, DNA 복제, 단백질 합성 및 세포벽 합성 등을 억제하여 독성을 나타낸다.
독소-항독소 체계는 항독소가 독소의 독성을 억제하는 방법에 따라 6가지 종류(type I 내지 VI)로 분류된다. 타입 I 체계에서는 항독소가 독소 mRNA에 결합할 수 있는 안티센스(antisense) RNA로, 독소의 번역을 억제하고, 타입 II 체계에서는 단백질 형태의 독소 및 항독소가 서로 결합함으로써 비독성 단백질 복합체를 형성한다. 타입 III 체계에서는 RNA 형태의 항독소가 독소 단백질에 직접적으로 결합하여 비독성 RNA-단백질 복합체를 형성하며, 타입 IV 체계에서는 독소 및 항독소가 서로 결합하지 않고, 동일한 세포 표적에 대하여 경쟁적으로 작용한다. 타입 V 체계에서는 단백질 형태의 항독소가 독소 mRNA를 분해하고, 타입 VI 체계에서는 단백질 형태의 항독소가 독소 단백질을 세포 내 프로테아제에 전달하여 독소 단백질의 분해를 유도한다(Ki-Young Lee et al., Toxins, 8(10), 2016).
폐렴구균은 몇 가지 독소-항독소 체계를 갖고 있으며, 그 중 HicBA 독소-항독소 체계는 타입 II 체계에 해당한다. 독소-항독소 복합체의 형성을 인위적으로 억제할 수 있으면 독성을 갖는 독소가 중화되지 못하여 결국 세포가 사멸하기 때문에 독소-항독소 체계는 새로운 항생제 개발을 위한 매력적인 표적이 될 수 있다.
본 발명의 목적은 폐렴구균의 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이를 유효성분으로 함유하는 조성물을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 서열번호 1 내지 4 중 어느 하나의 아미노산 서열로 구성되며, 폐렴구균의 독소-항독소 결합체인 HicBA 복합체의 형성을 억제하는 항생 펩타이드를 제공한다.
또한, 본 발명은 상기 항생 펩타이드를 유효성분으로 함유하는 항생용 조성물을 제공한다.
또한, 본 발명은 상기 항생 펩타이드를 유효성분으로 함유하는 항생용 의약외품을 제공한다.
또한, 본 발명은 상기 항생 펩타이드를 유효성분으로 함유하는 항생용 외용제를 제공한다.
또한, 본 발명은 상기 항생 펩타이드를 개체에 투여하는 단계를 포함하는 폐렴구균, 고초균(Bacillus subtilis), 황색포도상구균(Staphylococcus aureus), 표피포도상구균(S. epidermidis), 대장균(Escherichia coli), 이질균(Shigella dysenteriae), 살모넬라 티피무리움(Salmonella typhimurium), 폐렴막대균(Klebsiella pneumoniae) 및 녹농균(Pseudomonas aeruginosa)으로 이루어진 군으로부터 선택되는 어느 하나 이상의 균에 의해 발생하는 질환에 대한 예방, 개선 또는 치료 방법을 제공한다.
또한, 본 발명은 항생용 약제의 제조에 사용하기 위한 상기 항생 펩타이드의 용도를 제공한다.
본 발명의 항생 펩타이드는 독소의 활성부위에는 영향을 미치지 않으면서 폐렴구균의 독소-항독소 복합체 형성을 억제하고, 그에 따라 분리된 독소의 RNA 분해 활성에 의해 폐렴구균의 사멸을 유도하며, 다른 균들에 대해서도 항생 활성을 나타내므로, 항생용 조성물로 유용하게 사용될 수 있다.
도 1a 내지 1g는 폐렴구균(S. pneumoniae) HicBA 단백질 복합체의 헤테로-테트라머(1a), 헤테로-옥타머(1b) 및 헤테로다이머(1c) 구조, 페스트균(Y. pestis) HicBA 단백질 복합체의 헤테로다이머 구조(1d), 폐렴구균 HicB 단백질의 테트라머 구조(1e), 및 폐렴구균과 페스트균의 HicB 단백질 구조 비교(1f 및 1g)를 나타낸 도면이다(1c 및 1d: 검은 점선으로 표시된 사각형 부분은 페스트균의 HicB 단백질에는 존재하지 않고, 폐렴구균의 HicB 단백질에만 존재하는 C-말단의 DNA-결합 도메인 부위를 나타낸다).
도 2a 및 2b는 폐렴구균의 HicBA 단백질 복합체(2a) 및 HicB 단백질(2b)의 멀티-앵글 광 산란(multi-angle light scattering, MALS)이 결합된 크기 배제 크로마토그래피 분석 결과를 나타낸 도면이다.
도 3a 및 3b는 페스트균(Y. pestis) 및 폐렴구균(S. pneumoniae)의 HicB 단백질(3a) 및 HicA 단백질(3b)의 2차 구조를 분석한 결과를 나타낸 도면이다.
도 4는 폐렴구균의 HicA 단백질, 및 결핵균의 VapC26 및 VapC30 단백질의 RNA 분해 활성을 측정한 결과 그래프이다.
도 5a 내지 5c는 폐렴구균 HicA 단백질의 아미노산 서열을 다른 HicA 단백질 등의 아미노산 서열과 함께 정렬한 결과(5a), 폐렴구균 HicA 단백질의 RNA 분해 활성 부위 및 그 주변 잔기들의 HicB 단백질과의 상호작용(5b), 및 폐렴구균 HicA 단백질의 구조를 다른 HicA 단백질 등의 구조와 비교한 결과(5c)를 나타낸 도면이다(5a: 빨간 원으로 표시한 잔기는 RNA 분해 활성에 필수적인 잔기를 나타낸다; 5b: 검은 점선은 각 잔기들 간의 수소결합 및 염다리(salt bridge)를 의미한다; 5c: 노란 원은 RNA 분해 활성에 필수적인 잔기들이 있는 부위를 나타낸다).
도 6a 및 6b는 폐렴구균의 HicA 단백질의 정전기적 표면전위(electrostatic surface potential)(6a 및 6b) 및 RNA가 결합된 HicA 단백질의 이중가닥 RNA 결합 도메인 표면 부분(6a)을 나타낸 도면이다.
도 7a 및 7b는 폐렴구균 HicA 단백질의 히스티딘36을 알라닌으로 치환한 단백질(H36A)의 RNA 분해활성을 HicA 단백질의 RNA 분해 활성과 비교한 결과 그래프(7a) 및 이들 단백질 또는 HicBA 단백질 복합체를 발현하는 대장균의 성장곡선(7b)이다.
도 8a 내지 8c는 폐렴구균 HicB 단백질 및 HicA 단백질의 소수성(8a) 및 친수성(8b) 상호작용을 나타낸 결과, 및 HicB 단백질 돌연변이체와 HicA 단백질의 복합체를 발현하는 대장균의 세포독성 여부를 확인한 도면(8c)이다(8b: 검은 점선은 수소결합 및 염다리(salt bridge)를 의미하며, 삽입된 표는 상호작용에 관여하는 각 염기들을 나타낸다).
도 9a 내지 9c는 펩타이드 I 내지 IV를 첨가한 HicBA 단백질 복합체의 RNA 분해 활성(9a), 펩타이드 I을 첨가한 경우의 RNA 분해 활성을 100%로 하여 펩타이드 II 내지 IV을 첨가한 경우의 RNA 분해 활성(9b), 및 각 펩타이드의 원평광 이색성(circular dichroism)(9c)을 나타낸 도면이다.
도 10a 및 10b는 HicBA 단백질 복합체, 펩타이드 I을 첨가한 HicBA 단백질 복합체 및 HicA 단백질의 RNA 분해 활성(10a), 및 HicBA 단백질 복합체 단독의 RNA 분해 활성을 0%로 하고, HicA 단백질 단독의 RNA 분해 활성을 100%로 한 경우의 펩타이드 I을 첨가한 HicBA 단백질 복합체의 RNA 분해 활성(10b)을 나타낸 도면이다.
이하 본 발명을 상세히 설명한다.
본 발명은 서열번호 1 내지 4 중 어느 하나의 아미노산 서열로 구성되며, 폐렴구균의 독소-항독소 결합체인 HicBA 복합체의 형성을 억제하는 항생 펩타이드를 제공한다.
상기 펩타이드는 폐렴구균의 독소 단백질인 HicA의 아미노산 잔기 56-66에 해당하고, 서열번호 5의 아미노산 서열로 구성되는 α2 영역이 항독소 단백질 HicB와 결합하는 것을 억제하는 것일 수 있다.
상기 펩타이드는 폐렴구균 독소의 활성에는 영향을 미치지 않을 수 있다.
상기 펩타이드는 폐렴구균, 고초균, 황색포도상구균, 표피포도상구균, 대장균, 이질균, 살모넬라 티피무리움, 폐렴막대균 및 녹농균으로 이루어진 군으로부터 선택되는 어느 하나 이상의 균에 대한 항생 활성을 나타내는 것일 수 있다.
상기 펩타이드는 당업계의 통상적인 화학적 합성 방법(W. H. Freeman and Co., Proteins; structures and molecular principles, 1983)으로 합성될 수 있으며, 구체적으로는 액상 펩타이드 합성법(Solution Phase Peptide synthesis), 고상 펩타이드 합성법(solid-phase peptide syntheses), 단편 응축법 및 F-moc 또는 T-BOC 화학법으로 합성될 수 있고, 더욱 구체적으로는 고상 펩타이드 합성법으로 합성될 수 있다.
또한, 본 발명의 펩타이드는 하기와 같은 유전공학적 방법에 의해 제조될 수 있다. 우선, 통상적인 방법에 따라 상기 펩타이드를 코딩하는 DNA 서열을 제작한다. DNA 서열은 적절한 프라이머를 사용하여 중합 효소 연쇄 반응(polymerase chain reaction, PCR)으로 증폭함으로써 제작할 수 있다. 다른 방법으로 당업계에 공지된 표준 방법에 의해, 예컨대, 자동 DNA 합성기(예를 들면, Biosearch 또는 Applied Biosystems 사의 제품)를 사용하여 DNA 서열을 합성할 수도 있다.
상기 DNA 서열은 이에 작동 가능하게 연결되어 DNA 서열의 발현을 조절하는 하나 또는 그 이상의 발현 조절 서열(예: 프로모터, 인핸서 등)을 포함하는 벡터에 삽입한다. 그리고 이로부터 형성된 재조합 발현 벡터로 숙주세포를 형질전환한 다음, 생성된 형질전환체를 상기 DNA 서열이 발현되도록 하기에 적절한 배지 및 조건 하에서 배양한다. 그 다음, 배양물로부터 상기 DNA 서열에 의해 암호화된 실질적으로 순수한 펩타이드를 당업계에 공지된 방법(예컨대, 크로마토그래피)을 이용하여 회수한다. 본 발명의 펩타이드 합성을 위한 유전공학적 방법은 다음의 문헌을 참고할 수 있다: Maniatis et al., Molecular Cloning: A laboratory Manual, Cold Spring Harbor laboratory, 1982; Sambrook et al., Molecular Cloning: A Laboratory Manual 등.
상기 펩타이드는 단백질의 기능에 영향을 미치지 않는 범위 내에서, 아미노산 잔기의 결실, 삽입, 치환 또는 이들의 조합에 의해서 상이한 서열을 가지는 아미노산의 변이체일 수 있다. 분자의 활성을 전체적으로 변경시키지 않는 단백질 또는 펩타이드에서의 아미노산 교환은 당해 분야에 공지되어 있다. 경우에 따라서는 인산화(phosphorylation), 황화(sulfation), 아크릴화(acrylation), 당화(glycosylation), 메틸화(methylation) 또는 파네실화(farnesylation) 등으로 수식(modification)될 수 있다. 따라서, 본 발명은 상기 서열번호 1 내지 4 중 어느 하나의 아미노산 서열로 구성되는 펩타이드와 실질적으로 동일한 아미노산 서열을 갖는 펩타이드 및 이의 변이체 또는 단편을 포함할 수 있다. 상기 실질적으로 동일한 펩타이드는 본 발명의 펩타이드와 80% 이상, 구체적으로 90% 이상, 더욱 구체적으로 95% 이상으로 상동성을 가질 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 폐렴구균의 독소-항독소(HicBA) 단백질 복합체를 분리 및 정제한 후, X-선 회절(diffraction) 분석을 통해 구조를 결정하고, HicA 독소 단백질의 RNA 분해 활성 및 그에 따른 세포 독성에 필수적인 아미노산 잔기를 확인하였다(도 1 내지 7 참조).
또한, HicBA 단백질 복합체를 형성하는 HicB 및 HicA 단백질 간의 상호작용을 확인하고, 복합체 형성에 필수적인 HicB 단백질의 아미노산 잔기를 확인하였다(도 8 참조).
아울러, HicB 단백질과 결합하는 HicA 단백질의 α2 영역을 모방하는 펩타이드 I 내지 IV를 제작하고, 상기 펩타이드들의 HicBA 단백질 복합체 형성 억제에 따라 분리된 HicA 독소 단백질 증가에 따른 RNA 분해 활성 증가 효과를 확인하였으며, 펩타이드 I의 폐렴구균 외의 8종 세균에 대한 항생 활성을 확인하였다(도 9, 도 10 및 표 6 참조).
따라서, 상기 HicA 단백질의 α2 영역을 모방하는 펩타이드는 폐렴구균의 독소-항독소 복합체인 HicBA의 결합을 억제하여, 폐렴구균의 사멸을 유도하며, 다른 균들에 대해서도 항생 활성을 나타냄으로써, 항생용 펩타이드로 유용하게 사용될 수 있다.
또한, 본 발명은 상기 항생 펩타이드를 유효성분으로 함유하는 항생용 조성물을 제공한다.
상기 항생 펩타이드는 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 펩타이드는 서열번호 1 내지 4 중 어느 하나의 아미노산 서열로 구성되는 것일 수 있다.
상기 조성물은 폐렴구균의 독소 단백질인 HicA의 아미노산 잔기 56-66에 해당하고, 서열번호 5의 아미노산 서열로 구성되는 α2 영역이 항독소 단백질 HicB와 결합하는 것을 억제하는 것일 수 있다.
상기 조성물은 폐렴구균, 고초균, 황색포도상구균, 표피포도상구균, 대장균, 이질균, 살모넬라 티피무리움, 폐렴막대균 및 녹농균으로 이루어진 군으로부터 선택되는 어느 하나 이상의 균에 대한 항생 활성을 나타내는 것일 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 상기 펩타이드 I 내지 IV의 HicBA 단백질 복합체 형성 억제에 따라 분리된 HicA 독소 단백질 증가에 따른 RNA 분해 활성 증가 효과를 확인하였고(도 9 및 10 참조), 펩타이드 I의 고초균, 황색포도상구균, 표피포도상구균, 대장균, 이질균, 살모넬라 티피무리움, 폐렴막대균 및 녹농균에 대한 항생 활성을 확인하였다(표 6 참조). 따라서, 상기 펩타이드를 유효성분으로 함유하는 조성물은 항생용 조성물로 유용하게 사용될 수 있다.
본 발명의 항생 펩타이드를 포함하는 항생용 조성물은, 조성물 총 중량에 대하여 상기 항생 펩타이드를 0.1 내지 50 중량%로 포함하는 것이 바람직하나 이에 한정되지 않는다.
본 발명의 조성물은 약제의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다.
본 발명에 따른 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 본 발명의 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜(polyethylene glycol, PEG), 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 조성물은 경구 또는 비경구로 투여될 수 있으며, 비경구 투여법이라면 어느 것이나 사용 가능하고, 전신 투여 또는 국소 투여가 가능하나, 전신 투여가 더 바람직하며, 정맥 내 투여가 가장 바람직하다.
본 발명의 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나, 바람직한 효과를 위해서, 본 발명의 항생 펩타이드의 유효용량은 0.001 내지 100 ㎎/㎏, 구체적으로 0.01 내지 10 mg/kg일 수 있으며, 하루에 1회 내지 수회 투여될 수 있다.
본 발명의 항생용 조성물은 볼루스(bolus) 형태 혹은 상대적으로 짧은 기간동안 주입(infusion) 등에 의해 단일 투여량(single dose)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple dose)이 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다.
또한, 본 발명은 상기 항생 펩타이드를 유효성분으로 함유하는 항생용 의약외품을 제공한다.
상기 항생 펩타이드는 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 펩타이드는 서열번호 1 내지 4 중 어느 하나의 아미노산 서열로 구성되는 것일 수 있다.
상기 의약외품은 폐렴구균의 독소 단백질인 HicA의 아미노산 잔기 56-66에 해당하고, 서열번호 5의 아미노산 서열로 구성되는 α2 영역이 항독소 단백질 HicB와 결합하는 것을 억제하는 것일 수 있고, 폐렴구균 독소의 활성에는 영향을 미치지 않을 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 상기 펩타이드 I 내지 IV의 HicBA 단백질 복합체 형성 억제에 따라 분리된 HicA 독소 단백질 증가에 따른 RNA 분해 활성 증가 효과를 확인하였고(도 9 및 10 참조), 펩타이드 I의 고초균, 황색포도상구균, 표피포도상구균, 대장균, 이질균, 살모넬라 티피무리움, 폐렴막대균 및 녹농균에 대한 항생 활성을 확인하였다(표 6 참조). 따라서, 상기 펩타이드를 유효성분으로 함유하는 의약외품은 항생용 의약외품으로 유용하게 사용될 수 있다.
본 발명의 펩타이드를 의약외품 첨가물로 사용할 경우, 상기 펩타이드를 그대로 첨가하거나 다른 의약외품 또는 의약외품 성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효성분의 혼합량은 사용 목적에 따라 적합하게 결정될 수 있다.
본 발명의 의약외품 조성물은 이에 제한되지는 않으나, 바람직하게는 소독청결제, 샤워폼, 가그린, 물티슈, 세제비누, 핸드워시, 가습기 충진제, 마스크, 연고제, 패치, 또는 필터 충진제일 수 있다.
또한, 본 발명은 상기 항생 펩타이드를 유효성분으로 함유하는 항생용 외용제를 제공한다.
상기 항생 펩타이드는 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 펩타이드는 서열번호 1 내지 4 중 어느 하나의 아미노산 서열로 구성되는 것일 수 있다.
상기 외용제는 폐렴구균의 독소 단백질인 HicA의 아미노산 잔기 56-66에 해당하고, 서열번호 5의 아미노산 서열로 구성되는 α2 영역이 항독소 단백질 HicB와 결합하는 것을 억제하는 것일 수 있고, 폐렴구균 독소의 활성에는 영향을 미치지 않을 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 상기 펩타이드 I 내지 IV의 HicBA 단백질 복합체 형성 억제에 따라 분리된 HicA 독소 단백질 증가에 따른 RNA 분해 활성 증가 효과를 확인하였고(도 9 및 10 참조), 펩타이드 I의 고초균, 황색포도상구균, 표피포도상구균, 대장균, 이질균, 살모넬라 티피무리움, 폐렴막대균 및 녹농균에 대한 항생 활성을 확인하였다(표 6 참조). 따라서, 상기 펩타이드를 유효성분으로 함유하는 외용제는 항생용 외용제로 유용하게 사용될 수 있다.
본 발명의 펩타이드를 피부 외용제로 사용하는 경우, 추가로 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속이온봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 친수성 또는 친유성 활성제, 지질 소낭 또는 피부용 외용제에 통상적으로 사용되는 임의의 다른 성분과 같은 피부 과학 분야에서 통상적으로 사용되는 보조제를 함유할 수 있다. 또한, 상기 성분들은 피부 과학 분야에서 일반적으로 사용되는 양으로 도입될 수 있다.
또한, 본 발명은 상기 항생 펩타이드를 개체에 투여하는 단계를 포함하는 폐렴구균, 고초균, 황색포도상구균, 표피포도상구균, 대장균, 이질균, 살모넬라 티피무리움, 폐렴막대균 및 녹농균으로 이루어진 군으로부터 선택되는 어느 하나 이상의 균에 의해 발생하는 질환에 대한 예방, 개선 또는 치료 방법을 제공한다.
상기 항생 펩타이드는 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 펩타이드는 서열번호 1 내지 4 중 어느 하나의 아미노산 서열로 구성되는 것일 수 있다. 상기 개체는 포유동물, 구체적으로 인간일 수 있다.
또한, 본 발명은 항생용 약제의 제조에 사용하기 위한 상기 항생 펩타이드의 용도를 제공한다.
상기 항생 펩타이드는 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 펩타이드는 서열번호 1 내지 4 중 어느 하나의 아미노산 서열로 구성되는 것일 수 있다.
이하 본 발명을 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해서 한정되는 것은 아니다.
실시예 1. HicBA 단백질 복합체 및 셀레노메티오닌(selenomethionine, SeMet) 표지된 HicBA 단백질 복합체의 분리 및 정제
1-1. HicB 및 HicA 유전자의 클로닝 및 형질전환
먼저, 폐렴구균(S. pneumoniae)의 항독소 단백질 HicB를 암호화하는 유전자 SP1786 및 독소 단백질 HicA를 암호화하는 유전자 SP1787을 하기 표 1에 기재된 프라이머들을 이용하여 중합효소 연쇄 반응(polymerase chain reaction, PCR)으로 증폭시켰다.
프라이머명a 서열(5'→3')b 서열번호
HicB-F GGAATTCCATATGATGTTAGTTACGTATCC 7
HicB-R CCGCTCGAGCGGTTAGGCTTGAACTTTCTTATC 8
HicA-F GGAATTCCATATGATGGTGTTGTCAGGAGG 9
HicA-R CCGCTCGAGCGGTTACAACCCAGCTTGCTTTC 10
aF는 정방향(forward) 프라이머, R은 역방향(reverse) 프라이머를 의미한다.
b밑줄로 표시된 서열은 제한효소 부위를 의미한다.
상기 HicB 및 HicA 단백질을 암호화하는 유전자의 PCR 산물들을 제한효소인 Nde1 및 Xho1으로 이중 절단하고 동일한 효소로 절단한, 태그(tag)가 없는 pET21a 및 pET28b에 각각 연결하였고, HicA 단백질을 암호화하는 유전자가 연결된 pET28b에는 N-말단(N-terminal) 잔류 태그(서열번호 6: MGSSHHHHHHSSGLVPRGSH)를 첨가하였다. 상기 제조된 각 플라스미드들을 대장균(Escherichia coli) Rosetta2(DE3) pLysS 수용체 세포에 공-형질전환시켰다(co-transformed).
1-2. HicBA 단백질 복합체의 발현 및 정제
상기 실시예 1-1에서 제작한 HicB 및 HicA 유전자를 포함하는 플라스미드들로 공-형질전환된 세포를 이용하여 HicBA 단백질 복합체를 분리 및 정제하였다.
구체적으로, 상기 세포를 OD600 값이 0.8에 도달할 때까지 LB(Luria Bertani) 배지를 사용하여 37℃에서 배양하였다. 이후, 0.5 mM의 IPTG(isopropyl 1-thio-β-D-galactopyranoside)를 첨가하여 단백질 과발현을 유도하고, 37℃에서 4시간 동안 더 배양하였다. 배양된 세포를 4℃에서 11,355×로 원심분리하여 회수하였고, -80℃에 보관하였다. 수득된 세포를 5%(v/v) 글리세롤(glycerol)을 포함하는 버퍼 A(20 mM의 Tris-HCl(pH 7.9) 및 500 mM의 NaCl)에 현탁시키고 초음파를 이용하여 파쇄한 뒤, 파쇄된 세포는 다시 28,306×에서 1시간 동안 원심분리하여 상층액을 얻었다. 가용성 단백질을 포함하는 상기 상층액을 버퍼 A로 평형화된 Ni2+ 친화 오픈 컬럼(Ni2+ affinity open column, Bio-Rad)에 충진하고, 50 mM 이미다졸(imidazole)을 포함하는 버퍼 A로 컬럼을 세척하였다. Ni2+ 컬럼에 결합한 단백질은 100 내지 700 mM의 이미다졸 농도구배를 이용하여 용출시켰고, 용출된 분획 내에 존재하는 HicBA 단백질 복합체를 SDS-PAGE(sodium dodecyl sulfate polyacrylamide gel electrophoresis)로 확인하였다. HiLoad 16/600 Superdex 200 prep-grade 컬럼(GE Healthcare)을 이용한 크기 배제 크로마토그래피(size-exclusion chromatography)를 수행하여 HicBA 단백질 복합체를 포함하는 버퍼를 20 mM의 Tris(pH 7.5) 및 150 mM의 NaCl을 포함하는 버퍼로 교환하였고, 교환한 시료를 아미콘 초원심분리 필터 유닛(Amicon Ultra centrifugal filter unit, Milipore)을 이용하여 10 mg/mL의 농도로 농축하였다. 농축한 HicBA 단백질 복합체의 순도를 SDS-PAGE로 확인하였다.
1-3. SeMet 표지된 HicBA 단백질 복합체의 발현 및 정제
단백질 결정 구조 분석에서의 위상차 해결을 위해 SeMet 표지된 HicBA 단백질 복합체를 분리 및 정제하였다.
구체적으로, 상기 실시예 1-1에서 제작한 세포를 배양할 때 여분의 필수 아미노산을 포함하는 M9 배지에서 배양한 것을 제외하고는 상기 실시예 1-2에 기재된 것과 동일한 방법으로 실험을 수행하여 SeMet 표지된 HicBA 단백질 복합체를 수득하였다.
실시예 2. HicBA 단백질 복합체의 구조 분석
2-1. 단백질의 결정화(crystallization)
상기 실시예 1에서 분리 및 정제한 HicBA 단백질 복합체 및 SeMet 표지된 HicBA 단백질 복합체의 결정 구조를 확인하기 위하여 하기와 같은 실험을 수행하였다.
구체적으로, 20 mM Tris(pH 7.5) 및 150 mM NaCl 용액에 10 mg/mL 농도로 포함된 각 단백질 복합체 용액 1 ㎕를 저장 용액(reservoir solution) 1 ㎕와 혼합하고, 크리스탈 스크리닝(Crystal Screening) 1, 2 및 인덱스(Index) 키트들(Hampton Research)을 이용하여 초기 결정 스크리닝을 수행하였다. 각 결정은 4℃에서 싯팅 드롭 증발법(sitting-drop vapor diffusion method)을 이용하여 성장시켰으며, 결정화 용액으로 0.1 M Tris(pH 8.5) 및 2.0 M 암모늄 설페이트(ammonium sulfate)로 구성된 용액을 사용하였다. HicBA 단백질 복합체의 동결보호(cryoprotection)를 위하여 20% 글리세롤을 용액에 첨가하였다. 상기 결정은 데이터 모음 전에 액체 질소에서 즉시 동결하였다.
2-2. X-선 회절 분석 데이터 모음
상기 실시예 2-1에서 수득한 결정을 이용하여 X-선 회절 분석(X-ray diffraction analysis)을 수행하였다.
구체적으로, 상기 결정의 X-선 회절 분석 데이터는 포항 가속기 센터(대한민국)의 5C 및 7A 빔라인(beamline)에서 ADSC Quantum Q270r CCD 검출기를 이용하여 수집하였고, HKL2000 프로그램을 이용하여 분석하였다. 각 결정의 데이터 모음을 하기 표 2에 나타냈으며, N-말단 히스티딘 태그를 포함한 HicBA 단백질 복합체의 계산된 총 질량은 26349.7 Da였다.
SeMet 표지된 HicBA 결정 원형 HicBA 결정
X-ray source 5C beamlinea 7A beamlinea
X-ray wavelengthb (Å) 0.9795 1.0000
Space groupc P21212 P21212
Unit cell parametersd
a, b, c (Å) 106.88, 116.58, 42.67 106.93, 116.62, 42.68
α, β, γ (°) 90.0, 90.0, 90.0 90.0, 90.0, 90.0
Resolution rangee (Å) 50.0-2.80 50.0-2.30
Molecules per ASUf 2 HicBA homodimers 2 HicBA homodimers
Observed reflectionsg (>1σ) 294913 237881
Unique reflectionsh 12859 24090
<I /σ(I)>i 50.69 (6.86)n 30.2 (5.27)n
Completenessj (%) 96.7 (87.8)n 100.0 (100.0)n
Multiplicityk 22.9 (22.8)n 9.9 (10.1)n
Rmerge (%)l 11.0 (66.6)n 9.2 (53.7)n
CC1/2, CCm (0.906, 0.975)n
a포항 가속기 센터(대한민국)의 빔라인
b사용된 X-선의 파장 길이
c공간군: 결정의 단위 세포(unit cell)의 대칭성을 의미하며, 대칭요소들을 조합하면 군(group)을 형성하는데 총 230개의 공간군이 존재한다.
d단위 세포 치수: 공간 격자(space lattice)를 구성하는 가장 해석이 용이한 최소 반복 단위인 단위 세포를 규정하는 값으로, 3개의 결정학상 축(crystallographic axes)으로 정의되며, 3방향 벡터(vector)들의 길이(a, b 및 c)와 이들이 서로 이루는 각(α, β 및 γ)을 의미한다.
e수집된 데이터를 통해 얻을 수 있는 모델의 해상도의 한계
f한 분자에 포함되는 비대칭 단위(asymmetric unit, ASU)
gX-선 회절 분석 데이터의 총 반사 횟수
hX-선 회절 분석 데이터 중 수집한 범위 내에 존재하는 반사 횟수
i각 쉘(shell)에서 얻은 반사 데이터의 강도(intensity, I)를 오류값으로 나눈 값으로, 높을수록 신뢰성 높은 결과임을 의미한다.
j완성도: 특정 해상도에 존재하는 반사(reflection)의 총 수를 백분율로 나타낸 값으로, 높을수록 고해상도임을 의미한다.
k다중도: 고유한 반사의 총 수(number of unique reflections)에 대한 실제 측정된 반사의 총 수(number of measured reflections)인 반복도(redundancy)와 동일한 의미이며, 대칭도가 높은 결정의 경우 고유한 반사의 총 수가 낮아 대칭도가 낮은 결정에 비하여 높은 다중도(반복도)를 나타낸다.
lRmerge = Σ(I - <I>) / Σ<I>
Rmerge: 대칭(symmetry)으로 연관된 측정 데이터 간의 일치하는 정도로, 낮을수록 신뢰성 높은 결과임을 의미하는 Rsym과 동일한 의미를 나타낸다.
mCC(correlation coefficient): X-선 데이터 중 구조 결정에 사용된 데이터들의 정확도를 나타내는 척도로, 높을수록 정확도가 높음을 의미한다.
CC1/2: CC의 정확도를 증명하기 위한 척도로, 무작위로 선정된 절반의 데이터세트(dataset)를 이용하여 산출된다.
n괄호 안의 값은 가장 높은 해상도 쉘의 값이다.
2-3. 단백질 구조 결정 및 구조 개선(refinement)
HicBA 단백질 복합체의 구조는 SeMet 표지된 결정을 이용한 단일 파장 변칙 분산(single-wavelength anomalous dispersion)에 의하여 2.80Å의 해상도로 분석하였고, 최종 구조는 분자 치환법(molecular replacement)으로 결정되었다. 먼저, 피닉스(PHENIX)를 이용하여 모델을 형성하고, 쿠트(COOT) 프로그램을 이용하여 구조 개선의 초기 모델을 형성하였다. 전반적인 기하 구조는 몰프로비티(MolProbity)로 검증하였고, 개선된 구조는 파이몰(PyMOL)을 이용하여 시각화하였으며, 각 결정의 구조 개선 통계 결과를 하기 표 3에 나타내었다.
SeMet 표지된 HicBA 결정 원형 HicBA 결정
Rwork a (%) 20.2 20.5
Rfree b (%) 24.0 23.6
No. of atoms / average B factorc (Å2)
Protein 3266 / 55.6 3354 / 40.4
Water oxygen 50 / 50.14 85 / 34.06
RMSDd from ideal geometry
Bond distance (Å) 0.007 0.005
Bond angle (°) 1.314 0.963
Ramachandran statisticse
Most favoured regions (%) 96.3 98.0
Additional allowed regions (%) 3.2 2.0
Disallowed regions (%) 0.5 0.0
MolProbity scoref 2.12 (98th percentile) 1.66 (98th percentile)
PDB accession code 5YRZ
a실제 X-선 회절 데이터와 모델 사이의 일치하는 정도. 낮을수록 일치도가 높다. (R = Σhkl||Fobs| - k|Fcalc|| / Σhkl|Fobs|)
b무작위로 선택된 데이터와 모델 사이의 일치하는 정도. 수득된 데이터 중 무작위로 선택된 5%의 데이터를 Rwork와 동일한 식으로 계산하여 얻었다.
c모델에 제시된 원자의 위치로부터 원자가 진동하여 움직이는 범위를 의미한다.
d평균 제곱근 편차(Root mean square deviation): 결정된 모델의 구조가 통상적인 분자들이 지닌 결합 길이 및 각도와 부합하는 정도를 나타내며, 레프맥(REFMAC)을 사용하여 얻었다.
e라마찬드란 분석: 폴리펩타이드의 주 사슬(main chain)의 공간 상 각도를 나타내는 분석으로, 입체 장애(steric repulsion)를 반영하여 사슬이 어느 각도로 존재하는 것이 모순이 없는지를 보여주며, 이에 따라 모델을 평가하는 지표로 활용된다.
f단백질 및 핵산의 구조 모델 품질을 평가하는 척도로, 백분위가 높을수록 고품질을 의미한다.
2-4. HicBA 단백질 복합체의 구조적 특성 확인
상기 실시예 2-2 및 2-3에서 얻은 데이터를 기반으로 하여, HicBA 단백질 복합체의 구조적 특성을 확인하고, 멀티-앵글 광 산란(multi-angle light scattering, MALS)이 결합된 크기 배제 크로마토그래피를 수행하여 HicBA 단백질 올리고머의 구조를 결정하였다.
구체적으로, BioSep SEC-x3000 컬럼(Phenomenex) 및 1260 Infinity HPLC 시스템(Agilent Technologies)을 이용하여 크기 배제 크로마토그래피를 수행하였으며, 산란(scattering) 데이터는 방출 파장 657.4 nm에서 miniDAWN-TREOS 라인(Wyatt Technology)으로 수득하였고, ASTRA 6.0.1.10 소프트웨어(Wyatt Technology)를 이용하여 분석하였다. 실험에는 100 μM의 HicBA 단백질 헤테로다이머를 사용하였으며, 단백질 결정화 실험의 조건인 20 mM Tris(pH 7.5) 및 150 mM NaCl으로 구성된 용액 내에서 분석하였고, 모든 실험은 상온에서 수행하였다.
X-선 회절 분석 데이터를 기반으로 분석한 결과, HicBA 단백질 복합체 결정 구조는 2개의 HicBA 단백질 복합체 헤테로다이머(heterodimer)를 포함하며, 2개의 HicB 항독소 단백질과 2개의 HicA 독소 단백질이 헤테로-테트라머(hetero-tetramer) 구조를 형성함을 확인하였다(도 1a). 그러나, MALS가 결합된 크기 배제 크로마토그래피로부터 계산된 HicBA 단백질 복합체의 분자량이 105 ±0.1 kDa이었고, 이는 HicBA 단백질 복합체의 헤테로-옥타머(hetero-octamer) 형태의 이론적 분자량(105.4 kDa)과 거의 일치하여, HicBA 단백질 복합체가 헤테로-옥타머 형태로 존재함을 확인하였다(도 1b 및 2a).
한편, 2Struc 서버를 이용하여 2차 구조 분석을 수행한 결과, HicB 단백질은 3개의 α-헬릭스(α-helices), 3개의 310-헬릭스(η) 및 4개의 β-가닥(β-strands)을 포함하고, HicA 단백질은 2개의 α-헬릭스 및 3개의 β-가닥을 포함하며, α-β-β-β-α의 이중 가닥 RNA 결합 도메인 접힘 위상(fold topology)을 가짐을 확인하였다(도 1c). 또한, 기존에 유일하게 알려진 페스트균(Yersinia pestis)의 HicBA 단백질 복합체 구조와 비교할 때, 폐렴구균의 HicBA 단백질 복합체는 HicB 단백질의 η1과 η2 사이의 길고 유연한 루프가 존재하며, 특히 DNA 결합 도메인으로 예측되는 HicB 단백질의 C-말단 부위가 페스트균의 HicBA 단백질 복합체에는 존재하지 않음을 확인하였다(도 1c, 1d, 1f, 1g 및 도 3).
2-5. HicB 단백질의 구조적 특성 확인
상기 실시예 2-2 내지 2-4에서 얻은 데이터를 기반으로 하여, HicB 단백질의 구조적 특성을 확인하였다.
그 결과, 2개의 HicB 단백질 모노머가 각 모노머의 N-말단 도메인 중 주로 β1, α4 및 β4를 통하여 호모다이머(homodimer)를 형성함을 확인하였다. 그러나, MALS가 결합된 크기 배제 크로마토그래피로부터 계산된 HicB 단백질의 분자량이 71.8 ±0.8 kDa이었고, 이는 HicB 단백질 테트라머의 이론적 분자량(71.3 kDa)과 거의 일치하여, HicB 단백질이 테트라머 형태로 존재함을 확인하였다(도 1e 및 2b).
실시예 3. HicA 단백질의 분리 및 정제
상기 실시예 1-1에서 제작한 HicA 단백질을 암호화하는 유전자가 연결된 pET28b 플라스미드를 대장균(Escherichia coli) Rosetta2(DE3) pLysS 수용체 세포에 형질전환시킨 후, 상기 세포를 IPTG 처리 후 2시간 동안 배양한 것을 제외하고는 상기 실시예 1-2에 기재된 것과 동일한 방법으로 HicA 단백질을 분리 및 정제하였다.
실시예 4. HicA-H36A 단백질의 분리 및 정제
HicA 단백질을 암호화하는 유전자 SP1787을 주형으로 하고, 하기 표 4에 기재된 프라이머들(서열번호 11 및 12) 및 부위-특이적 돌연변이 유도 키트(EZchangeTM Site-Directed Mutagenesis Kit, Enzynomics)를 이용하여 제조사의 설명서에 따라 PCR을 수행함으로써 HicA 단백질의 히스티딘36이 알라닌으로 치환된 돌연변이 유전자를 수득하였다. HicA 단백질을 암호화하는 유전자를 증폭시킨 PCR 산물 대신 상기 PCR 산물을 이용한 것을 제외하고는 실시예 1-1에 기재된 것과 동일한 방법으로 HicA-H36A 단백질을 발현하는 세포를 제작하였다. 이후, 상기 실시예 3에 기재된 것과 동일한 방법으로 HicA-H36A 단백질을 분리 및 정제하였다.
프라이머명a 서열(5'→3') 서열번호
HicA-H36A-F TAGAGGCGGTAAAGGCTCCGCTATTAAAATGGAAAAGCAAG 11
HicA-H36A-R CTTGCTTTTCCATTTTAATAGCGGAGCCTTTACCGCCTCTA 12
HicB-F22A-F GGAACAGAAGCGACTTATGCTGTCCATTTCCCAGATTTT 13
HicB-F22A-R AAAATCTGGGAAATGGACAGCATAAGTCGCTTCTGTTCC 14
HicB-T33A-F GATTTTGAATACTCAGCTACACAAGGAGAGGGGATTTCT 15
HicB-T33A-R AGAAATCCCCTCTCCTTGTGTAGCTGAGTATTCAAAATC 16
HicB-Q34A-F TTTGAATACTCAGCTACAGCAGGAGAGGGGATTTCTGAG 17
HicB-Q34A-R CTCAGAAATCCCCTCTCCTGCTGTAGCTGAGTATTCAAA 18
HicB-E47A-F GCTTTGGCTATGGGGTCGGCGTGGCTAGGGATAACTGTT 19
HicB-E47A-R AACAGTTATCCCTAGCCACGCCGACCCCATAGCCAAAGC 20
HicB-F80A-F TTAATTGATAATGATCCTGCTAAAGATGATGAAGATTTC 21
HicB-F80A-R GAAATCTTCATCATCTTTAGCAGGATCATTATCAATTAA 22
HicB-T89A-F GATGAAGATTTCGTGTCAGCCTATGACCTTGATAAATCT 23
HicB-T89A-R AGATTTATCAAGGTCATAGGCTGACACGAAATCTTCATC 24
aF는 정방향(forward) 프라이머, R은 역방향(reverse) 프라이머를 의미한다.
실험예 1. HicA 단백질의 RNA 분해 활성 확인
폐렴구균의 HicA 단백질의 RNA 분해 활성을 확인하고, 이를 다른 RNA 분해 활성을 갖는 독소 단백질인 결핵균(Mycobacterium tuberculosis)의 VapC26 및 VapC30 단백질의 RNA 분해 활성과 비교하였다.
구체적으로, 결핵균의 VapC26 및 VapC30 단백질은 국내 등록특허 제10-1849347호 및 제10-1746160호에 각각 기재된 방법으로 분리 및 정제하였다. 각 단백질의 RNA 분해 활성은 키트(RNase Alert Kit, IDT)를 이용하여 제조사의 설명서에 따라 측정하였다. 기질로 사용한 합성 RNA는 양 말단에 각각 형광단(fluorophore)과 소광제(quencher)가 붙어있어, RNA가 분해되면 형광단 및 소광제가 분리되어 490 nm에서 여기(excitation) 후 520 nm에서 형광이 방출된다. 실시예 3에서 정제한 HicA 단백질 4 μM, VapC26 단백질 4 μM, VapC30 단백질 4 μM 또는 RNase A 3 ×10-5 units을 20 mM Tris(pH 7.5) 및 150 mM NaCl로 구성된 용액에 오염을 방지하기 위해 RNase 억제제(40 units, RiboLockTM, Thermo Scientific)를 첨가하여 준비한 후, 상기 합성 RNA와 각각 혼합하고, 방출되는 형광을 분광형광계(SPECTRAmax GEMINI XS spectrofluorometer)로 시간에 따라 측정하였다.
그 결과, 일반적인 RNA 분해 효소인 RNase A나 결핵균의 독소 단백질인 VapC26 및 VapC30 단백질에 비하여 폐렴구균의 독소 단백질인 HicA 단백질의 RNA 분해 활성이 가장 높게 나타났다(도 4).
실험예 2. HicA 단백질의 RNA 분해 활성에 필수적인 히스티딘 잔기 확인
상기 실시예 3에서 정제한 HicA 단백질의 RNA 분해 활성에 필수적인 히스티딘 잔기를 확인하기 위하여, 하기와 같은 실험들을 수행하였다.
2-1. 서열 정렬(sequence alignment) 및 구조 분석
폐렴구균의 HicA 단백질의 아미노산 서열을 테르무스 테르모필루스(Thermus thermophilus)의 가설 단백질(hypothetical protein), 페스트균의 HicA 단백질, 버크홀데리아 슈도말레이(Burkholderia pseudomallei)의 HicA 단백질 및 대장균의 HicA 단백질의 아미노산 서열과 함께 클러스탈 오메가 1.2.1(Clustal Omega 1.2.1)을 이용하여 정렬하였고, 이를 에스프리트 3.0(ESPript 3.0)으로 시각화하였다. 또한, 보다 구체적인 비교 분석을 위하여, 상기 비교 단백질 중 아직 구조가 밝혀지지 않은 대장균의 HicA 단백질을 제외한 나머지 단백질들의 구조를 대상으로 달리(DALI)를 이용하여 폐렴구균의 HicA 단백질 구조와의 구조적 유사성을 분석하였다.
그 결과, 모든 HicA 단백질에서 β2 가닥의 히스티딘 잔기가 고도로 보존되어 있었고, β1 및 β2 가닥 사이 루프의 글리신 잔기가 잘 보존되어 있었다(도 5a). 또한, 테르무스 테르모필루스의 가설 단백질(PDB code 1WHZ(사슬 A)), 페스트균의 HicA 단백질(PDB code 4P78(사슬 C 및 D)) 및 버크홀데리아 슈도말레이의 HicA 단백질(PDB code 4C26(사슬 A))의 서열 동등성(sequence identity)은 각각 29%, 34% 및 28%였다(도 5c).
구조 분석 결과, 폐렴구균의 HicA 단백질의 RNA 분해 활성 부위 중 주요 잔기(key residue)인 히스티딘36은 HicB 단백질의 트레오닌33 및 글루타메이트47 잔기와 수소결합을 형성하고, 특히 글루타메이트47 잔기와는 염다리(salt bridge)를 형성함으로써 상호작용함을 확인하였다(도 5b). 또한, 폐렴구균의 HicA 단백질은 이중가닥 RNA 결합 도메인을 형성하는데, RNA가 결합된 이중가닥 RNA 결합 도메인(PDB code 1DI2)에서 α1은 RNA의 작은 홈(minor groove)과 상호작용하고, α2는 RNA의 큰 홈(major groove)과 상호작용함을 확인하였다(도 6).
2-2. HicA 단백질의 히스티딘36이 RNA 분해 활성에 필수적인지 여부 확인
상기 실시예 3 및 4에서 정제한 HicA 단백질 및 HicA-H36A 단백질의 RNA 분해 활성을 측정하여, HicA 단백질의 RNA 분해 활성에 히스티딘36 잔기가 필수적인지 여부를 확인하였다.
구체적으로, 1, 2, 4 또는 8 μM의 HicA 단백질 및 8 μM의 HicA-H36A 단백질을 합성 RNA와 각각 혼합한 것을 제외하고는 상기 실험예 1에 기재된 것과 동일한 방법으로 RNA 분해 활성을 측정하였다.
그 결과, HicA 단백질은 반응 시간 및 처리 농도에 의존적인 RNA 분해 활성을 나타낸 반면, 히스티딘36잔기가 알라닌으로 치환된 HicA-H36A 단백질은 RNA 분해 활성을 전혀 나타내지 못했다(도 7a). 이는 HicA 단백질의 RNA 분해 활성에 있어 히스티딘36 잔기가 필수적임을 제시한다.
2-3. HicA 단백질의 히스티딘36이 세포 독성에 필수적인지 여부 확인
상기 실험예 2-1 및 2-2에서 확인한 결과에 따라, HicA 단백질의 RNA 분해 활성에 따른 세포 독성도 동일한 결과로 나타나는지 확인하기 위하여, HicBA 단백질 복합체, HicA 단백질 또는 HicA-H36A 단백질을 발현하는 세포의 생존율을 측정하였다.
구체적으로, 상기 실시예 1-1에서 제작한 HicB 및 HicA 유전자를 포함하는 플라스미드들을 대장균 BL21(DE3)에 공-형질전환시키고, 실시예 1-1에서 제작한 HicA 단백질을 발현하는 플라스미드 및 실시예 4에서 제작한 HicA-H36A 단백질을 발현하는 플라스미드를 각각 대장균 BL21(DE3)에 형질전환하였다. 0.1% 글루코스를 포함하는 M9 배지 플레이트에서 자란 형질전환된 세포의 단일 콜로니를 각각 밤새 배양하고, OD600 값이 0.1이 되도록 희석하였다. 희석된 세포를 세포 현탁액의 OD600 값이 0.4가 될 때까지 더 배양한 후, 단백질 발현을 유도하기 위하여 0.5 mM IPTG를 첨가하였다. 상기 세포는 IPTG 첨가 후 8시간 동안 37℃에서 더 배양하였고, 1시간 간격으로 흡광도를 측정하여 세포 성장곡선을 수득하였다.
그 결과, HicBA 단백질 복합체를 발현하는 대장균 및 HicA-H36A 단백질을 발현하는 대장균은 대조군과 동일한 성장곡선을 보인 반면, HicA 단백질을 발현하는 대장균은 대조군에 비하여 현저히 낮은 성장곡선을 나타냈다(도 7b). 이는 HicA 단백질이 RNA 분해 활성을 통해 세포 독성을 나타내고, HicBA 단백질 복합체를 형성하면 세포 독성이 중화되며, HicA 단백질의 히스티딘36 잔기가 HicA 단백질의 독성에 필수적임을 제시한다.
실험예 3. HicBA 단백질 복합체 형성에 필수적인 아미노산 잔기 확인
HicBA 단백질 복합체 형성에 필수적인 HicB 단백질의 아미노산 잔기를 확인하기 위하여, 하기와 같은 실험들을 수행하였다.
3-1. HicB 및 HicA 단백질 간의 상호작용 확인
상기 실시예 2에서 수득한 데이터를 분석하여 HicBA 단백질 복합체 내에서의 HicB 및 HicA 단백질 간의 상호작용을 확인하였다.
그 결과, HicBA 단백질 복합체 내에서, HicB 단백질은 HicA 단백질의 1,183 Å2을 차지하고, HicA 단백질 사슬 D의 잔기 중 약 43%가 복합체 형성에 관여하며, HicA 단백질의 전체 표면적 중 약 28%가 결합 부위를 차지함을 확인하였다. 두 단백질 결합부위에서 소수성 상호작용은 HicB 단백질의 페닐알라닌22, 메티오닌44, 페닐알라닌80, 페닐알라닌86 및 티로신90 및 HicA 단백질의 루신50 및 티로신57 잔기에 의하여 이루어지며, 그 중에서도 HicA 단백질의 티로신57 잔기에 의한 방향족성 상호작용이 중요한 역할을 함을 확인하였다(도 8a). 또한, 친수성 상호작용은 HicB 단백질의 아스파르트산12, 알라닌19, 티로신30, 트레오닌33, 글루타민34, 글루타메이트47, 트레오닌89, 글루타메이트106 및 글루타민111 잔기가 HicA 단백질의 아르기닌30, 라이신33, 세린35, 히스티딘36, 라이신38, 글루타메이트53, 아스파라긴55, 라이신56, 티로신57, 트레오닌58 및 글루타민65 잔기와 상호작용함으로써 이루어지며, 특히 HicB 단백질의 아스파르트산12, 글루타메이트47, 아스파르트산55 및 아스파르트산83 잔기와 HicA 단백질의 히스티딘36, 라이신38, 라이신56 및 라이신64 잔기와의 상호작용으로 추가적인 염다리가 형성됨을 확인하였다(도 8b).
3-2. HicBA 단백질 복합체 형성에 필수적인 HicB 단백질의 아미노산 잔기 확인
HicBA 단백질 복합체 형성에 관여하는 HicB 단백질의 아미노산 잔기 중 친수성 상호작용에 관여하는 트레오닌33, 글루타민34, 글루타메이트47 및 트레오닌89 잔기와 소수성 상호작용에 관여하는 페닐알라닌22 및 페닐알라닌80 잔기를 선정하여 상기 잔기를 알라닌으로 치환한 단백질들을 제작하였다.
구체적으로, HicB 단백질을 암호화하는 유전자 SP1786을 주형으로 하고, 상기 표 4에 기재된 프라이머들(서열번호 13 내지 24) 및 부위-특이적 돌연변이 유도 키트(EZchangeTM Site-Directed Mutagenesis Kit, Enzynomics)를 이용하여 제조사의 설명서에 따라 PCR을 수행함으로써 각 돌연변이 유전자를 수득하고, 이를 상기 실시예 1-1에 기재된 것과 동일한 방법으로 pET21a에 연결하였다. 상기 실시예 1-1에서 제작한 pET28b-HicA 및 pET21a-HicB를 대장균 BL21(DE3)에 공-형질전환시키고, 실시예 1-1에서 제작한 pET28b-HicA 및 상기 pET21a-HicB 돌연변이체(F22A, T33A, Q34A, E47A, F80A 또는 T89A)를 대장균 BL21(DE3)에 공-형질전환시켰다. 형질전환된 각 세포는 0.5 mM IPTG가 포함된 LB 플레이트에서 37℃ 조건으로 18시간 동안 배양하였다.
배양 세포를 관찰한 결과, 공 벡터를 삽입한 대조군 및 HicBA 단뱁질 복합체를 발현하는 대장균에서는 세포 독성 없이 대장균이 잘 자라났고, HicB 단백질의 돌연변이체 중 T33A, Q34A, F80A 또는 T89A와 HicA 단백질의 복합체를 발현하는 대장균에서는 대조군과 유사하게 세포 독성이 나타나지 않은 반면, HicB 단백질의 돌연변이체 중 F22A 또는 E47A와 HicA 단백질의 복합체를 발현하는 대장균에서 세포 생장이 현저히 억제되었다(도 8c). 이는 HicB 단백질이 HicA 독소 단백질과의 복합체 형성을 통하여 독성을 억제할 때, HicB 단백질의 아미노산 잔기 중 페닐알라닌22 및 글루타메이트47 잔기가 필수적임을 제시한다.
실시예 5. HicA 단백질의 모방 펩타이드 제작
HicA 단백질의 α2 헬릭스 영역인 11개 잔기(라이신56부터 알라닌66까지, KYTERGIRKQA, 서열번호 5)를 포함하고, HicB 단백질과 복합체를 형성하는데 관여하는 7개 잔기(글루타메이트53, 아스파라긴55, 라이신56, 티로신57, 트레오닌58, 라이신64 및 글루타민65)를 포함하는 HicA 단백질 모방 펩타이드 4종을 디자인하고, 애니젠(ANYGEN, http://www.anygen.com)에 의뢰하여 제작하였다(표 5). 펩타이드 제작 시, 단백질 가수분해를 방지하기 위하여 헬릭스 구조를 모방하는 것이 유리하고, 선택성 감소 및 자가 응집(self-aggregation)을 방지하기 위한 최적 길이의 펩타이드를 제작하는 것이 중요하므로, 이를 고려하여 펩타이드를 제작하였다.
펩타이드명 서열 펩타이드 길이(aa) 분자량(Da) 서열번호
펩타이드 I ELNKYTERGIRKQAG (53-67)a 15 1,763 1
펩타이드 II GELNKYTERGIRKQAG (52-67)a 16 1,820 2
펩타이드 III ELNKYTERGIRKQAGL (53-68)a 16 1,876 3
펩타이드 IV GELNKYTERGIRKQAGL (52-68)a 17 1,933 4
a괄호 안의 숫자는 전체 HicA 단백질의 아미노산 서열 중 해당 서열의 아미노산 순서를 나타내는 번호이다.
실험예 4. HicA 단백질 모방 펩타이드의 원평광 이색성(circular dichroism, CD) 확인
상기 실시예 5에서 제작한 HicA 단백질 모방 펩타이드의 CD 분광 분석을 수행하여 각 펩타이드의 헬리시티(helicity)를 측정하였다.
구체적으로, 상기 실시예 5에서 제작한 펩타이드 I 내지 IV를 각각 25 μM 농도로 20 mM Tris(pH 7.5) 및 150 mM NaCl로 구성된 용액에 용해하고, 20℃에서 1 mm의 광 경로(light path)를 갖는 셀(cell)을 이용하여 분광편광계(Chirascan Plus spectropolarimeter, Applied Photophysics, Ltd.)로 CD 분광 분석을 수행하였다. CD 스캔은 260에서 190 nm까지 1 nm의 밴드 폭으로 측정하였고, 스캔 속도는 100 nm/분이었다. 각 펩타이드의 헬리시티는 평균 잔기 타원율(mean residue ellipticity, [θ]222)에 기초하여 정량적으로 측정하였다.
그 결과, 펩타이드 I, II, III 및 IV의 헬리시티는 각각 39.8, 25.5, 25.5 및 33.3%였고, 펩타이드 I이 가장 높은 헬리시티를 나타냈다(도 9c).
실험예 5. HicA 단백질 모방 펩타이드들의 HicBA 단백질 복합체 형성 억제 효과 확인
상기 실시예 5에서 제작한 HicA 단백질 모방 펩타이드의 HicBA 단백질 복합체 형성 억제 효과를 확인하기 위하여, HicBA 단백질 복합체에 HicA 단백질 모방 펩타이드를 첨가한 후, RNA 분해 활성을 측정하였다.
구체적으로, 상기 실시예 1-2에서 정제한 HicBA 단백질 복합체를 최종 농도 4 μM로 20 mM Tris(pH 7.5) 및 150 mM NaCl로 구성된 용액에 준비하고, 상기 펩타이드 I 내지 IV를 동일한 용매에 최종 농도 4 μM로 하여 HicBA 단백질 복합체와 각각 혼합한 후, 37℃에서 30분간 배양하였다. 이후, 상기 실험예 1에 기재된 것과 동일한 방법으로 RNA 분해 활성을 측정하였다.
그 결과, HicBA 단백질 복합체에 HicA 단백질 모방 펩타이드들의 첨가 시, RNA 분해가 모두 증가하였으며, 그 중 펩타이드 I의 효과가 가장 크게 나타났다(도 9a 및 9b). 이는 상기 HicA 단백질 모방 펩타이드들의 첨가로 HicBA 단백질 복합체 형성이 경쟁적으로 저해됨으로써, 분리된 HicA 단백질이 늘어남에 따라 RNA 분해 정도가 증가한 결과로 해석되며, 펩타이드 I의 HicBA 단백질 복합체 형성 억제 효과가 가장 우수함을 제시한다.
실험예 6. 펩타이드 I의 HicBA 단백질 복합체 형성 억제 효과 확인
상기 실험예 5에서 가장 우수한 HicBA 단백질 복합체 형성 억제 효과를 확인한 펩타이드 I의 농도 의존적 효과를 RNA 분해 활성을 측정하여 확인하였다.
구체적으로, 펩타이드 I 내지 IV 대신 펩타이드 I을 2, 4, 8 또는 16 μM로 HicBA 단백질 복합체 4 μM과 혼합한 경우와, 상기 실시예 3에서 정제한 HicA 단백질 4 μM 단독의 RNA 분해 활성을 측정한 것을 제외하고는 상기 실험예 5에 기재된 것과 동일한 방법으로 RNA 분해 활성을 측정하였다.
그 결과, HicA 단백질은 RNA 분해 활성을 나타냈고, HicBA 단백질 복합체는 RNA 분해 활성이 전혀 없는 반면, HicBA 단백질 복합체에 펩타이드 I을 첨가한 경우 농도 의존적으로 RNA 분해 활성이 증가하였다(도 10a 및 10b). 이는 펩타이드 I이 HicBA 단백질 복합체 형성을 경쟁적으로 저해하여 분리된 HicA 단백질이 늘어남에 따라 RNA 분해 정도가 증가한 것임을 제시한다.
실험예 7. 펩타이드 I의 항생 활성 확인
펩타이드 I의 항생 활성을 그람 양성 및 음성 세균들에 대한 최소 저해 농도(minimum inhibitory concentration, MIC)를 측정하여 확인하였다.
구체적으로, 하기 표 6에 기재된 그람 양성 균주 3종 및 그람 음성 균주 5종을 각각 0.4 내지 100 μM의 펩타이드 I과 함께 37℃에서 24시간 동안 배양한 후, 세포 생장이 완전히 억제되는 최소 농도를 MIC로 나타내었다.
분류 세균학명 ATCC 번호 MIC(μM)
그람 양성 Bacillus subtilis 6633 6.3 - 12.5
Staphylococcus aureus 6538p 6.3
Staphylococcus epidermis 12228 12.5
그람 음성 E. coli 25922 12.5 - 25
Shigella dysenteriae 9752 25
Salmonella typhimurium 14028 50
Klebsiella pneumoniae 10031 6.3
Pseudomonas aeruginosa 27853 12.5 - 25
aAmerican Type Culture Collection
그 결과, 총 8종의 세균에 대하여 펩타이드 I은 6.3 내지 50 μM의 MIC를 나타냈고, 황색포도상구균(S. aureus) 및 폐렴막대균(K. pneumoniae)에 대하여 가장 강한 항생 활성을 보였다(표 6).

Claims (10)

  1. 서열번호 1 내지 4 중 어느 하나의 아미노산 서열로 구성되며, 폐렴구균의 독소-항독소 결합체인 HicBA 복합체의 형성을 억제하는 항생 펩타이드.
  2. 제1항에 있어서, 상기 펩타이드는 폐렴구균의 독소 단백질인 HicA의 아미노산 잔기 56-66에 해당하고, 서열번호 5의 아미노산 서열로 구성되는 α2 영역이 항독소 단백질 HicB와 결합하는 것을 억제하는, 항생 펩타이드.
  3. 제1항에 있어서, 상기 펩타이드가 폐렴구균 독소의 활성에는 영향을 미치지 않는, 항생 펩타이드.
  4. 제1항의 항생 펩타이드를 유효성분으로 함유하는 항생용 조성물.
  5. 제4항에 있어서, 상기 조성물은 폐렴구균의 독소 단백질인 HicA의 아미노산 잔기 56-66에 해당하고, 서열번호 5의 아미노산 서열로 구성되는 α2 영역이 항독소 단백질 HicB와 결합하는 것을 억제하는, 항생용 조성물.
  6. 제4항에 있어서, 상기 조성물은 폐렴구균, 고초균(Bacillus subtilis), 황색포도상구균(Staphylococcus aureus), 표피포도상구균(S. epidermidis), 대장균(Escherichia coli), 이질균(Shigella dysenteriae), 살모넬라 티피무리움(Salmonella typhimurium), 폐렴막대균(Klebsiella pneumoniae) 및 녹농균(Pseudomonas aeruginosa)으로 이루어진 군으로부터 선택되는 어느 하나 이상의 균에 대한 항생 활성을 나타내는 것인, 항생용 조성물.
  7. 제1항의 항생 펩타이드를 유효성분으로 함유하는 항생용 의약외품.
  8. 제1항의 항생 펩타이드를 유효성분으로 함유하는 항생용 외용제.
  9. 제1항의 항생 펩타이드를 개체에 투여하는 단계를 포함하는 폐렴구균, 고초균, 황색포도상구균, 표피포도상구균, 대장균, 이질균, 살모넬라 티피무리움, 폐렴막대균 및 녹농균으로 이루어진 군으로부터 선택되는 어느 하나 이상의 균에 의해 발생하는 질환에 대한 예방, 개선 또는 치료 방법.
  10. 항생용 약제의 제조에 사용하기 위한 제1항의 항생 펩타이드의 용도.
PCT/KR2018/013791 2018-08-10 2018-11-13 폐렴구균의 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도 Ceased WO2020032324A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020180093969A KR102097040B1 (ko) 2018-08-10 2018-08-10 폐렴구균의 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도
KR10-2018-0093969 2018-08-10

Publications (1)

Publication Number Publication Date
WO2020032324A1 true WO2020032324A1 (ko) 2020-02-13

Family

ID=69414170

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/013791 Ceased WO2020032324A1 (ko) 2018-08-10 2018-11-13 폐렴구균의 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도

Country Status (2)

Country Link
KR (1) KR102097040B1 (ko)
WO (1) WO2020032324A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102551038B1 (ko) * 2020-12-30 2023-07-05 서울대학교산학협력단 폐렴구균 내인성 독소의 독성을 증가시키며, HigBA 독소-항독소 체계를 표적으로 하는 항균 펩타이드 및 이의 용도
KR102581500B1 (ko) * 2021-01-20 2023-09-20 서울대학교산학협력단 폐렴간균 독소-항독소 시스템을 표적으로 하는 항균 펩타이드 및 화합물, 및 이들의 용도

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007039398A (ja) * 2005-08-04 2007-02-15 Institute Of Physical & Chemical Research トキシン−アンチトキシン複合体の形成を指標とする抗生物質のスクリーニング方法
US20070298043A1 (en) * 2003-10-02 2007-12-27 Ehud Gazit Novel Antibacterial Agents and Methods of Identifying and Utilizing Same
KR20090013762A (ko) * 2006-03-22 2009-02-05 유니버시티 오브 메디신 앤드 덴티스트리 오브 뉴 저지 신규 항생제 개발을 위한 박테리아 자멸 경로의 표적화
KR20160140137A (ko) * 2015-05-29 2016-12-07 서울대학교산학협력단 결핵균 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101849347B1 (ko) 2017-07-31 2018-04-16 서울대학교 산학협력단 결핵균 독소-항독소 체계를 표적으로 하는 펩타이드 및 이의 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070298043A1 (en) * 2003-10-02 2007-12-27 Ehud Gazit Novel Antibacterial Agents and Methods of Identifying and Utilizing Same
JP2007039398A (ja) * 2005-08-04 2007-02-15 Institute Of Physical & Chemical Research トキシン−アンチトキシン複合体の形成を指標とする抗生物質のスクリーニング方法
KR20090013762A (ko) * 2006-03-22 2009-02-05 유니버시티 오브 메디신 앤드 덴티스트리 오브 뉴 저지 신규 항생제 개발을 위한 박테리아 자멸 경로의 표적화
KR20160140137A (ko) * 2015-05-29 2016-12-07 서울대학교산학협력단 결핵균 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI 8 April 2013 (2013-04-08), Database accession no. EMY90279.1 *
KIM, D.-H.: "Functional insights into the Streptococcus pneumoniae HicBA toxin-antitoxin system based on a structural study", NUCLEIC ACIDS RES., 6 June 2018 (2018-06-06), pages 6371 - 6386, XP055685468 *

Also Published As

Publication number Publication date
KR20200018123A (ko) 2020-02-19
KR102097040B1 (ko) 2020-04-03

Similar Documents

Publication Publication Date Title
WO2016195336A1 (ko) 결핵균 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도
WO2012050402A2 (ko) 세포투과성 parkin 재조합 단백질 및 이를 함유하는 퇴행성 뇌질환 치료용 약학적 조성물
WO2013169060A1 (ko) 패혈증 예방 또는 치료용 조성물
WO2020256387A1 (ko) Romo1 유래 항균 펩타이드 및 그 변이체
WO2015156649A1 (ko) 섬유증 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물
WO2016195157A1 (ko) 안정성이 증가된 인간 섬유아세포 성장인자-2 변이체 및 이의 용도
WO2021235876A1 (ko) 신규한 폴리펩타이드, 융합 폴리펩타이드, 및 이를 포함하는 그람음성균에 대한 항생제
WO2022005174A1 (ko) 항-lag-3 항체 및 il-2를 포함하는 융합단백질 및 이의 용도
WO2019027224A2 (ko) 결핵균 독소-항독소 체계를 표적으로 하는 펩타이드 및 이의 용도
US7829666B2 (en) Maurotoxin, PI1 and HSTX1 derivatives
KR102097040B1 (ko) 폐렴구균의 독소-항독소 체계를 표적으로 하는 항생 펩타이드 및 이의 용도
WO2022215946A1 (ko) 세포 투과성 펩타이드 변이체 및 이의 용도
WO2013129852A1 (ko) 신규한 인터루킨-6에 대한 리피바디 및 그 용도
WO2022108148A1 (ko) 자가 항체에 대한 회피율 또는 활성이 증가된 adamts13 변이체
WO2022010319A1 (ko) 글루카곤-유사 펩타이드-1 및 인터루킨-1 수용체 길항제를 포함하는 융합단백질 및 이의 용도
WO2020246760A1 (ko) 퇴행성관절염 예방 또는 치료용 항-oscar 항체
WO2019004674A1 (ko) 아세틸콜린수용체 결합 펩타이드
WO2019240429A1 (ko) 세포 투과 펩티드 및 아데노신 탈아미노화효소의 융합 단백질을 포함하는 중증복합면역결핍증 치료용 약학적 조성물
WO2023003331A1 (en) Sirp-alpha variants and use thereof
WO2024029992A1 (ko) 아밀로이드 베타 특이적 펩타이드 sma_04088-2 및 이를 포함하는 알츠하이머병 치료용 조성물
WO2021242046A1 (ko) 신규한 항염증성 펩타이드 및 이의 용도
WO2022158875A1 (ko) 폐렴간균 독소-항독소 시스템을 표적으로 하는 항균 펩타이드 및 화합물, 및 이들의 용도
WO2022245183A1 (en) Composition for preventing or treating non-alcoholic fatty liver disease or non-alcoholic steatohepatitis comprising growth differentiation factor-15 variant
WO2020139031A1 (ko) Crispr-cas를 기반으로 하는 유전자 교정용 조성물
KR102551038B1 (ko) 폐렴구균 내인성 독소의 독성을 증가시키며, HigBA 독소-항독소 체계를 표적으로 하는 항균 펩타이드 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18929617

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18929617

Country of ref document: EP

Kind code of ref document: A1