WO2020028830A1 - Improved clinical parameters by expression of factor viii - Google Patents
Improved clinical parameters by expression of factor viii Download PDFInfo
- Publication number
- WO2020028830A1 WO2020028830A1 PCT/US2019/044946 US2019044946W WO2020028830A1 WO 2020028830 A1 WO2020028830 A1 WO 2020028830A1 US 2019044946 W US2019044946 W US 2019044946W WO 2020028830 A1 WO2020028830 A1 WO 2020028830A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- fviii
- aav
- administration
- seq
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/36—Blood coagulation or fibrinolysis factors
- A61K38/37—Factors VIII
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/745—Blood coagulation or fibrinolysis factors
- C07K14/755—Factors VIII, e.g. factor VIII C (AHF), factor VIII Ag (VWF)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14041—Use of virus, viral particle or viral elements as a vector
- C12N2750/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14071—Demonstrated in vivo effect
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- Gene therapy can be used to genetically engineer a cell to have one or more inactivated genes and/or to cause that cell to express a product not previously being produced in that cell ( e.g ., via transgene insertion and/or via correction of an endogenous sequence).
- transgene insertion include the insertion of one or more genes encoding one or more novel therapeutic proteins, insertion of a coding sequence encoding a protein that is lacking in the cell or in the individual, insertion of a wild type gene in a cell containing a mutated gene sequence, and/or insertion of a sequence that encodes a structural nucleic acid such as a microRNA or siRNA.
- Examples of useful applications of 'correction' of an endogenous gene sequence include alterations of disease-associated gene mutations, alterations in sequences encoding splice sites, alterations in regulatory sequences and/or targeted alterations of sequences encoding structural characteristics of a protein.
- Hepatic gene transfer provides an effective means of delivering transgenes to a subject for treatment and/or prevention of various disorders, including hemophilias and lysosomal storage disorders.
- various disorders including hemophilias and lysosomal storage disorders.
- Vectors specific for liver-directed gene therapy have also been described. See, e.g., WO 2014064277; WO 2009130208; EP 2451474B1, Chuah et ctl, (2014) Molecular Therapy, 22, 1605-1613; and Nair et al. (2014 ) Blood 123:3195-3199.
- Hemophilias such as Hemophilia A and Hemophilia B, are genetic disorders of the blood-clotting system, characterized by bleeding into joints and soft tissues, and by excessive bleeding into any site experiencing trauma or undergoing surgery.
- Hemophilia A is clinically indistinguishable from Hemophilia B, but factor VIII (FVIII or F8) is deficient or absent in Hemophilia A while factor IX (FIX or F.IX) is deficient or absent in patients with Hemophilia B.
- the F8 gene encodes a plasma glycoprotein that circulates in association with von Wilebrand's factor in its inactive form. Upon surface injury, the intrinsic clotting cascade initiates and FVIII is released from the complex and is activated. The activated form works with Factor IX to activate Factor X to become the activated Xa, eventually leading to change of fibrinogen to fibrin and clot induction. See, Levinson el al.
- Hemophilia A patients are evaluated and stratified depending on how often a patient has a bleeding episode, and how long those episodes last. Both of these characteristics are directly dependent on the amount of FVIII protein in a patient's blood. Patients with severe hemophilia typically have less than 1 % of the normal blood level of FVIII, experience bleeding following injury and often spontaneous bleeding into their joints. Moderate patients have 1 -5% of the normal FVIII level while mild patients have 6% or more of normal FVIII and have bleeding episodes only after serious injury, trauma or surgery (Kulkami et al. (2009) Haemophilia 15 : 1281 -90).
- Patients with Hemophilia A are treated with replacement FVIII protein (often referred to as“factor”) derived either from human plasma or produced recombinantly where the frequency of treatment is based upon bleeding patterns and severity of the hemophilia.
- Patients with severe Hemophilia A receive prophylaxtic treatment on a regular basis to prevent bleeds from occurring while less severe patients can receive treatment only as needed following injury.
- AAV vectors expressing Factor VIII and methods of treatment of hemophilia as well as other aspects are disclosed.
- a method of providing a Factor VIII (FVIII) protein to a human is provided.
- the method comprises administering to the human one or more dose of from 6xlO n to lxlO 13 or 3xl0 13 , lxlO 13 to lxlO 14 , or lxlO 13 to 5xl0 13 , or 2xl0 13 to 4xl0 13 vg/kg of an Adenovirus-Associated Virus (AAV) vector as described herein, wherein administration of the AAV vector results in production of the Factor VIII protein in the human.
- AAV Adenovirus-Associated Virus
- the dose is 9xlO n vg/kg, 2x10 12 vg/kg, lxlO 13 vg/kg, 2x10 13 vg/kg, 3x10 13 vg/kg or 4x10 13 vg/kg.
- the AAV vector has an AAV6 serotype comprising a nucleotide sequence comprising AAV2 inverted terminal repeat sequences flanking an expression cassette comprising a liver-specific enhancer and a promoter operably linked to a polynucleotide encoding SEQ ID NO: l.
- the method further comprises measuring FVIII protein in blood of the human before and after the administrating.
- administration of the AAV vector e.g., at a dose ranging from 1 xlO 13 vg/kg to 3 x 10 13 or lxlO 13 to lxlO 14 , or lxlO 13 to 5xl0 13 , or 2xl0 13 to 4xl0 13 vg/kg, results in a clinically relevant increase in FVIII activity, relative to patient circulating FVIII activity assessed in the patient before administration, ranging from 5% to 150%, or greater.
- administration of the AAV vector results in a clinically relevant increase in FVIII activity ranging from 20% to 150%, or greater.
- administration results in one or zero occurrences of spontaneous bleeding episodes in the human subject between 3-12 months (or, e.g., 3-6 months, 3 months - 1, 2, 5 or 10 years, or more) after administration.
- (FVIII) protein in a human subject comprising administering to the human subject one or more doses of from 2 xlO 12 vg/kg to 3 x 10 13 or lxlO 13 to lxlO 14 , or lxlO 13 to 5xl0 13 , or 2xl0 13 to 4xl0 13 vg/kg of an Adenovirus-Associated Virus (AAV) vector that encodes a FVIII protein (optionally comprising the amino acid sequence of SEQ ID NO: 1), wherein administration of the AAV vector results in a clinically relevant increase of the level of circulating FVIII activity, e.g., by 5% to 150%; or by 50% to 150%.
- AAV Adenovirus-Associated Virus
- the one or more doses of Factor VIII administered to the patient is in the range from lxl 0 13 vg/kg to 3xl0 13 vg/kg.
- the AAV vector has an AAV6 serotype.
- the AAV vector comprises an expression cassette comprising a polynucleotide that encodes the FVIII protein operably linked to a liver-specific enhancer and a promoter.
- the liver-specific enhancer is a Serpin 1 enhancer and/or the promoter is a transthyretin minimal promoter.
- the liver-specific enhancer comprises the nucleotide sequence of SEQ ID NO:2 and/or the promoter comprises the nucleotide sequence of SEQ ID NO:3.
- the AAV vector comprises a AAV2 5’ inverted terminal repeat (ITR) sequence and AAV2 3’ ITR sequence that flank the expression cassette.
- the AAV2 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 12 and/or the AAV2 3’ITR comprises the nucleotide sequence of SEQ ID NO: 13.
- the sequence of the expression cassette comprises the nucleotide sequence of SEQ ID NO:5.
- the human subject has hemophilia.
- (FVIII) protein in a human subject comprising administering to the human subject one or more doses of from 2 xlO 12 vg/kg to 3 x 10 13 or lxlO 13 to lxlO 14 , or lxlO 13 to 5xl0 13 , or 2xl0 13 to 4xl0 13 vg/kg of an Adenovirus-Associated Virus (AAV) vector that encodes a FVIII protein (optionally comprising the amino acid sequence of SEQ ID NO: 1), wherein administration of the AAV vector results a reduction of the number of FVIII treatments the human subject receives.
- AAV Adenovirus-Associated Virus
- the human subject does not receive any FVIII treatments 3-12 months (or, e.g., 3-6 months, 3 months - 1, 2, 5 or 10 years, or more) after administration.
- the one or more doses of Factor VIII are not administered to the human subject.
- the AAV vector has an AAV6 serotype.
- the AAV vector comprises an expression cassette comprising a polynucleotide that encodes the FVIII protein operably linked to a liver-specific enhancer and a promoter.
- the liver-specific enhancer is a Serpin 1 enhancer and/or the promoter is a transthyretin minimal promoter.
- the liver-specific enhancer comprises the nucleotide sequence of SEQ ID NO:2 and/or the promoter comprises the nucleotide sequence of SEQ ID NO:3.
- the AAV vector comprises a AAV2 5’ inverted terminal repeat (ITR) sequence and AAV2 3’ ITR sequence that flank the expression cassette.
- the AAV2 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 12 and/or the AAV2 3’ITR comprises the nucleotide sequence of SEQ ID NO: 13.
- the sequence of the expression cassette comprises the nucleotide sequence of SEQ ID NO:5.
- the human subject has hemophilia.
- administration of the AAV vector results in a reduction in use of FVIII treatments, e.g.,. a reduction in the number of FVIII injections a patient receives per week or per month.
- use of FVIII is reduced by at least 20%.
- use of FVIII is reduced by at least 50%.
- use of FVIII is reduced by 90% or greater.
- the human prior to the administrating the human had less than 1% of normal human circulating FVIII activity and within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32,
- the human prior to the administrating the human had less than 5% of normal human circulating FVIII activity and within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32,
- the human displays no more than 1.5 times upper limit of normal (ULN) of at least one of alanine aminotransferase (ALT), aspartate
- AST aminotransferase
- the human does not have detectable levels of FVIII inhibitor 4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after the administrating.
- the subject to be administered the AAV vector undergoes prophylactic steroid treatment.
- the method further comprises measuring a level of at least one of Von Willebrand factor (vWF), soluble epidermal growth factor receptor
- sEGFR Galectin-3-binding protein
- GAL3BP Galectin-3-binding protein
- CRP C-reactive protein
- IL-6 circulating alpha fetoprotein
- vWF Von Willebrand factor
- sEGFR soluble epidermal growth factor receptor
- GAL3BP Galectin-3-binding protein
- CRP C-reactive protein
- IL-6 circulating alpha fetoprotein
- the human displays fewer bleeding episodes after the administering. In some embodiments, the human has 10%, 15%, 20%, 25%, 30%, 35%,
- the human displays a reduced need for treatment with replacement Factor VIII protein.
- the human requires 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% less treatment with replacement Factor VIII protein after the administering.
- the human has hemophilia.
- the nucleotide sequence comprises SEQ ID NO:5.
- the AAV2 inverted terminal repeat sequences are SEQ ID NO: 12 and SEQ ID NO: 13.
- FIG. 1 shows FVIII activity data from Example 6 using a chromogenic assay as described in Example 1.
- FIG. 2 shows FVIII activity data from Example 6 using a chromogenic assay as described in Example 1.
- FIG. 3 shows FVIII activity data from Example 6 using a one-stage clotting assay as described in Example 1.
- FIG. 4 shows FVIII activity based on a one-stage clotting assay as described in
- Example 1 in ten patients over time post-treatment with the vector.
- FIG. 5 shows FVIII activity based on a chromogenic assay as described in
- Example 1 in ten patients over time post-treatment with the vector.
- FIG. 6 shows data for spontaneous bleeding episodes of patients at least 3 weeks after vector administration at the dosage indicated.
- FIG. 7 shows FVIII usage of patients three or more weeks post-vector injection.
- FIG. 8 provides a Serious Adverse Event (SAE) summary.
- FIG. 9 provides a Treatment-Related Adverse Event (AE) Summary.
- FIG. 10 provides a summary of results. DETAILED DESCRIPTION OF THE INVENTION
- FVIII are effective in generating increased FVIII activity in humans, including humans having hemophilia.
- administration of the AAV vector as described herein results in raised circulating FVIII activity from less than 1% normal FVIII activity to at least 1% and in some embodiments at least 2, 3, 4, or 5% normal FVIII activity.
- circulating FVIII activity is increased in a human with little or no adverse effect on liver function or other biomarkers as described herein.
- concentrations of vector at or above 1 xlO 13 vg/kg At administered concentrations of vector at or above 1 xlO 13 vg/kg, rates of bleeding episodes at 3 weeks (or more than 3 weeks) after administration dropped to zero for most patients, indicating that concentrations at or above 1 xlO 13 vg/kg (e.g., 1 xlO 13 vg/kg to 1 x 10 14 vg/kg, e.g. 2-4 x 10 13 vg/kg) resulted in highly effective treatment.
- concentrations at or above 1 xlO 13 vg/kg e.g., 1 xlO 13 vg/kg to 1 x 10 14 vg/kg, e.g. 2-4 x 10 13 vg/kg
- patients receiving the vector at these concentrations do not require further FVIII infusions, or at least do not require them in within 3, 6, 9, or 12 months after vector administration.
- Adeno- Associated Virus (AAV) vectors that encode FVIII are provided.
- Exemplary AAV vectors are of the AAV6 serotype and comprise inverted repeat (ITR) sequences flanking an expression cassette comprising a liver-specific enhancer and promoter operably linked to an intron and a polynucleotide encoding FVIII.
- An exemplary FVIII is SEQ ID NO: 1.
- the ITR sequences are AAV2 ITRs, and thus the vector can be referred to as an“AAV2/6” vector.
- AAV2 ITR sequences are:
- Exemplary liver-specific enhancers include for example a wild-type or mutated Serpinl enhancers and an exemplary promoter is a transthyretin minimal (TTRm) promoter.
- the AAV vector is an AAV2/6 vector comprising AAV2 ITR sequences flanking a wild-type or mutated Serpinl enhancer linked to a TTRm promoter operably linked to a polynucleotide encoding FVIII (e.g., SEQ ID NO: 1).
- Exemplary vector sequences are described in for example, WO 2017/074526.
- SEQ ID NO: 1 displays the human FVIII amino acid sequence with signal peptide:
- the signal peptide portion of SEQ ID NO: 1 is MQIELSTCFFLCLLRFCFS
- an exemplary SERPIN1 enhancer is
- TTRm promoter is
- SEQ ID NO:5 comprises (from 5’ to 3’) insulator (spacer) sequence Insl (nt 14-32 of SEQ ID NO:5), Serpinl enhancer CRMSBS2 (nt 33-104 of SEQ ID NO:5), transthyretin minimal promoter TTRm (nt 117-339 of SEQ ID NO:5), SBR Intron3 (nt 340- 432 of SEQ ID NO:5), FVIII coding sequence hF8 BDD (438-4811 of SEQ ID NO:5),
- the effective amount of the AAV vector to be administered can vary from patient to patient. In some embodiments, effective amounts are determined by the physician administering the compositions (AAV vectors). Analysis of the serum, plasma or other tissue levels of the therapeutic polypeptide and comparison to the initial level prior to
- administration can determine whether the amount being administered is too low, within the right range or too high. Suitable regimes for initial and subsequent administrations are also variable, but are typified by an initial administration, optionally followed by subsequent administrations if necessary. Subsequent administrations may be administered at variable intervals, ranging from daily to annually to every several years. In some embodiments, appropriate immunosuppressive techniques may be recommended to avoid inhibition or blockage of transduction by immunosuppression of the delivery vectors. See, e.g., Vilquin et al, (1995) Human Gene Ther., 6: 1391-1401.
- Administration can be by any means. Both in vivo and ex vivo methods are contemplated.
- intravenous injection (for example, though not limited to, via the portal vein) is the method of administration.
- administration is through a standard intravenous administration.
- Other in vivo administration modes include, for example, direct injection into the lobes of the liver or the biliary duct and intravenous injection distal to the liver, including through the hepatic artery, direct injection in to the liver parenchyma, injection via the hepatic artery, and/or retrograde injection through the biliary tree.
- Ex vivo modes of administration include transduction in vitro of resected hepatocytes or other cells of the liver, followed by infusion of the transduced, resected hepatocytes back into the portal vasculature, liver parenchyma or biliary tree of the human patient, see e.g., Grossman et al, (1994) Nature Genetics, 6:335-341.
- Exemplary intravenous doses of an AAV vector as described herein can in some embodiments be between 6xlO n to lxlO 13 or 3 x 10 13 or lxlO 13 to lxlO 14 , or lxlO 13 to 5xl0 13 , or 2xl0 13 to 4xl0 13 vg/kg, e.g, from 1 x 10 12 or 2 x 10 12 to 3 x 10 13 , viral
- the dosage is lxlO 11 to lxlO 12 vg/kg. In some embodiments, the dosage is lxl0 12 to lxlO 13 vg/kg or 3 x 10 13 . In some embodiments, the dosage is 2xl0 12 to 3xl0 13 . In some embodiments, the dosage is 5x10 12 to 5x10 13 vg/kg. As noted above, in some embodiments, the AAV vector is supplied to the recipient as a single dose. In some embodiments, the dosage is 6x10 11 ,
- a patient receives a single dose of the AAV vector.
- a pharmaceutically-acceptable carrier can be included as part of the formulation administered.
- Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions available, as described below (see, e.g., Remington’s
- Formulations for both ex vivo and in vivo administrations can include suspensions (e.g., of genetically modified cells, liposomes or nanoparticles) in liquid or emulsified liquids.
- the active ingredients can be mixed with excipients that are
- Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol or the like, and combinations thereof.
- the composition may contain minor amounts of auxiliary substances, such as, wetting or emulsifying agents, pH buffering agents, stabilizing agents or other reagents that enhance the effectiveness of the pharmaceutical composition.
- Subjects receiving the described AAV vector can be any human.
- exemplary recipients include for example individuals having hemophilia (for example hemophilia A).
- a therapeutically effective amount in reference to the treatment of hemophilia A or for use in a method for reducing bleeding time during a bleeding episode in a subject suffering from hemophilia A, refers to an amount capable of invoking one or more of the following effects: (1) reduction, inhibition, or prevention, to some extent, of one or more of the physiological symptoms of hemophilia A including, for example, bruising, joint pain or swelling, prolonged headache, vomiting or fatigue, (2) improvement in the capability to clot blood, (3) reduction of overall bleeding time during a bleeding episode, (4) administration resulting in a measurable increase in the concentration or activity of functional FVIII protein in the plasma of a subject, and/or (5) relief, to some extent, of one or more symptoms associated with the disorder.
- a FVIII blood concentration that is greater than 1% of factor concentration found in a normal individual results from administration of the AAV vector as described herein, thereby changing a severe disease phenotype to a moderate one.
- a severe phenotype is characterized by joint damage and life-threatening bleeds.
- administration of the AAV vector as described herein results in a FVIII blood concentration of at least 5% of normal.
- a FVIII blood concentration greater than 5% of normal is needed to convert a moderate disease phenotype into a mild one.
- FVIII levels in normal humans are about 1.14 +- 0.48 nM plasma, for example, by an activated partial thromboplastin time (aPTT) one-stage clotting assay (see, e.g., Butenas, el al., Thromb Res. (2010 Aug); 126(2): 119-123).
- aPTT activated partial thromboplastin time
- a therapeutic effect can be achieved by expression of FVIII such that the total amount of FVIII in the subject/human is greater than 1% of the FVIII present in normal subjects/humans, e.g., 1% of 1.14 +- 0.48 nM.
- administering results in an increase in functional FVIII protein activity in the plasma of the human recipient of at least 1, 2, 3, 4, 5,
- IU/dl IU/dl circulating FVIII activity in the plasma of the subject.
- IU or "international unit” in regards to FVIII activity is a commonly-understood term, wherein 1 IU of FVIII activity is equivalent to the quantity of FVIII in one ml of normal human plasma.
- normal human FVIII activity is 0.500-1.500 IU/ml plasma.
- FVIII activity in the plasma may be quantitatively determined by a number of well-known and accepted assays including, for example, the activated partial thromboplastin time (APPT) method (see, e.g., Miletich JP: Activated partial thromboplastin time.
- APPT activated partial thromboplastin time
- Miletich JP Activated partial thromboplastin time.
- E Beutler, MA Lichtman, BA Coller, TJ Kipps. New York, McGraw-Hill, 1995 pp L85-86, Greaves and Preston, Approach to the bleeding patient.
- Hemostasis and Thrombosis Basic Principles and Clinical Practice. Fourth edition. Edited by RW Colman, J Hirsh, VJ Marder, et al.
- bleeding time in a subject may be measured by well- known and accepted techniques including, for example, the Ivy method (see, e.g., Ivy et al, Surg. Gynec. Obstet. 60:781 (1935) and Ivy et al, J. Lab. Clin. Med. 26: 1812 (1941)) or the Duke method (see, e.g., Duke et al, JAMA 55: 1185 (1910)).
- a "bleeding episode" in a subject refers to an injury that results in bleeding in the subject, either externally or internally, and generally comprises the time period from injury to formation of a blood clot.
- the frequency of bleeding episodes is reduced in a subject after the
- the frequency of bleeding episodes is reduced 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% after the administering.
- the concentration of FVIII protein in blood of the human is measured before, after, or before and after the administrating.
- Direct or indirect assays for measuring FVIII blood concentration can be used. Exemplary indirect methods include for example those described in Over, J. (1986) Scand. J. Haematol. 33 (Suool. 41), 13-24; Kemball-Cook, G., et al. (1993) Brit. J. Haematol. 84, 273-278.
- Direct detection methods include those described in, e.g., US Patent No. 8715951.
- the FVIII blood concentration is determined within two weeks before the initial administration of the AAV vector to best determine the effect after administration.
- administration and treatment with the AAV vectors described herein will cause a reduction in the need for treatment with replacement Factor VIII protein by the subject. This can be measured by noting the frequency of need for treatment prior to administration of the AAV vectors described herein, and then noting the frequency of need for treatment after administering. In some embodiments, the reduction in need for treatment is 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% reduced after the administering. [0057] In some embodiments, administration and treatment with the AAV vectors described herein cause little or no harm to the liver.
- Liver status can be measured, for example, by measuring one or more markers in the blood of the individual.
- markers indicative of liver health include but are not limited to Alanine aminotransferase (ALT) or aspartate aminotransferase (AST)) bilirubin, alkaline phosphatase, and albumin.
- the human displays no more than 1.0, 1.2, 1.5, 1.7, or 2.0 times upper limit of normal (ULN) of at least one of alanine aminotransferase (ALT), aspartate aminotransferase (AST), bilirubin, alkaline phosphatase, or albumin within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks of the administering.
- the ULN can generally be determined from a population. See, e.g., Neuschwander-Tetri, B., el al. , Arch Intern Med. 2004 Mar 24; 168(6): 663-666 discussing for ALT.
- the ULN for ALT is 44 U/L.
- the ULN for AST is 39 U/L.
- the ULN for bilirubin is 0.1-1.0 mg/dl for total bilirubin 0.2-0.7 mg/dl for conjugated bilirubin and 0.1-0.4 mg/dl for unconjugated bilirubin. See, e.g., Lisa B, VanWagner (2015).
- the ULN for alkaline phosphatase is 129 or 133 U/L. See, e.g., Gowda, et al., PanAfrMedJ. (2009) 3: 17.
- the normal range for albumin is 35-55 g/liter (Burtis and Ashwood (1999) Tietz Textbook of Clinical Chemistry. 3 rd edition. Saunders Editor).
- administration and treatment with the AAV vectors described herein do not result in detectable levels of FVIII inhibitor, for example at any one or more of time points: 4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after the administrating.
- FVIII inhibitors are detected by the Nijmegen-Bethesda assay (Duncan, el al. , Methods Mol Biol. 2013;992:321-33 and Miller CH, et al. Am J Hematol. 90:871-876 (2015)).
- the limit of detection of this assay is 0.6 BU. Any result under 0.6 BU is considered undetectable.
- biomarkers include, e.g., Von Willebrand factor (vWF), soluble epidermal growth factor receptor (sEGFR), Galectin-3 -binding protein (GAL3BP), C-reactive protein (CRP), IL-6, circulating alpha fetoprotein.
- vWF Von Willebrand factor
- sEGFR soluble epidermal growth factor receptor
- GAL3BP Galectin-3 -binding protein
- CRP C-reactive protein
- IL-6 circulating alpha fetoprotein
- the blood level of one or more of the biomarkers when assayed within 2, 4, 6, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, or 52 weeks after the administering is no more than 1.0, 1.2, 1.5, 1.7, or 2.0 times a level within two weeks prior to the administering.
- compositions disclosed herein employ, unless otherwise indicated, conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA and related fields as are within the skill of the art. These techniques are fully explained in the literature. See, for example, Sambrook el al.
- MOLECULAR CLONING A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001 ; Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304,“Chromatin” (P.M. Wassarman and A. P.
- nucleic acid refers to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form.
- polynucleotide refers to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form.
- these terms are not to be construed as limiting with respect to the length of a polymer.
- the terms can encompass known analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties ( e.g .,
- an analogue of a particular nucleotide has the same base-pairing specificity; i.e., an analogue of A will base-pair with T.
- polypeptide peptide
- protein protein
- amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of a corresponding naturally-occurring amino acids.
- the“expression construct” or“expression cassette” or“vector”) can contain sequences that are homologous, but not identical, to genomic sequences in the region of interest, thereby stimulating homologous recombination to insert a non-identical sequence in the region of interest.
- portions of the expression cassette sequence that are homologous to sequences in the region of interest exhibit between about 80 to 99% (or any integer therebetween) sequence identity to the genomic sequence that is replaced.
- the homology between the expression cassette and genomic sequence is higher than 99%, for example if only 1 nucleotide differs as between the homology regions of the expression cassette and genomic sequences of over 100 contiguous base pairs.
- a non-homologous portion of the expression cassette can contain sequences not present in the region of interest, such that new sequences are introduced into the region of interest.
- the non-homologous sequence is generally flanked by sequences of 50-1,000 base pairs (or any integral value therebetween) or any number of base pairs greater than 1,000, that are homologous or identical to sequences in the region of interest.
- sequence refers to a nucleotide sequence of any length, which can be DNA or RNA; can be linear, circular or branched and can be either single-stranded or double stranded.
- transgene refers to a nucleotide sequence that is inserted into a genome.
- a transgene can be of any length, for example between 2 and 100,000,000 nucleotides in length (or any integer value therebetween or thereabove), preferably between about 100 and 100,000 nucleotides in length (or any integer therebetween), more preferably between about 2000 and 20,000 nucleotides in length (or any value therebetween) and even more preferable, between about 5 and 15 kb (or any value therebetween).
- a "chromosome,” is a chromatin complex comprising all or a portion of the genome of a cell.
- the genome of a cell is often characterized by its karyotype, which is the collection of all the chromosomes that comprise the genome of the cell.
- the genome of a cell can comprise one or more chromosomes.
- An "episome” is a replicating nucleic acid, nucleoprotein complex or other structure comprising a nucleic acid that is not part of the chromosomal karyotype of a cell.
- Examples of episomes include plasmids and certain viral genomes.
- the liver specific constructs described herein may be epiosomally maintained or, alternatively, may be stably integrated into the cell.
- exogenous molecule is a molecule that is not normally present in a cell, but can be introduced into a cell by one or more genetic, biochemical or other methods. “Normal presence in the cell” is determined with respect to the particular developmental stage and environmental conditions of the cell. Thus, for example, a molecule that is present only during embryonic development of muscle is an exogenous molecule with respect to an adult muscle cell. Similarly, a molecule induced by heat shock is an exogenous molecule with respect to a non-heat-shocked cell.
- An exogenous molecule can comprise, for example, a functioning version of a malfunctioning endogenous molecule or a malfunctioning version of a normally-functioning endogenous molecule.
- An exogenous molecule can be, among other things, a small molecule, such as is generated by a combinatorial chemistry process, or a macromolecule such as a protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide, any modified derivative of the above molecules, or any complex comprising one or more of the above molecules.
- Nucleic acids include DNA and RNA, can be single- or double-stranded; can be linear, branched or circular; and can be of any length. Nucleic acids include those capable of forming duplexes, as well as triplex-forming nucleic acids. See, for example, U.S. Patent Nos. 5,176,996 and 5,422,251.
- Proteins include, but are not limited to, DNA-binding proteins, transcription factors, chromatin remodeling factors, methylated DNA binding proteins, polymerases, methylases, demethylases, acetylases, deacetylases, kinases, phosphatases, ligases, deubiquitinases, integrases, recombinases, ligases, topoisomerases, gyrases and helicases.
- an exogenous molecule can be the same type of molecule as an endogenous molecule, e.g., an exogenous protein or nucleic acid.
- an exogenous nucleic acid can comprise an infecting viral genome, a plasmid or episome introduced into a cell, or a chromosome that is not normally present in the cell.
- Methods for the introduction of exogenous molecules into cells include, but are not limited to, lipid-mediated transfer (i.e., liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate co precipitation, DEAE-dextran-mediated transfer and viral vector-mediated transfer.
- exogenous molecule can also be the same type of molecule as an endogenous molecule but derived from a different species than the cell is derived from.
- a human nucleic acid sequence may be introduced into a cell line originally derived from a mouse or hamster.
- exogenous molecules are known to those of skill in the art and include, but are not limited to, protoplast transformation, silicon carbide (e.g., WHISKERSTM), Agrobacterium- mediated transformation, lipid-mediated transfer (i.e., liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment (e.g., using a“gene gun”), calcium phosphate co-precipitation, DEAE- dextran-mediated transfer and viral vector-mediated transfer.
- an "endogenous" molecule is one that is normally present in a particular cell at a particular developmental stage under particular environmental conditions.
- an endogenous nucleic acid can comprise a chromosome, the genome of a mitochondrion, chloroplast or other organelle, or a naturally-occurring episomal nucleic acid.
- Additional endogenous molecules can include proteins, for example, transcription factors and enzymes.
- the term“product of an exogenous nucleic acid” includes both polynucleotide and polypeptide products, for example, transcription products
- RNA Ribonucleotides
- translation products polypeptides
- Gene expression refers to the conversion of the information, contained in a gene, into a gene product.
- a gene product can be the direct transcriptional product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA or any other type of RNA) or a protein produced by translation of an mRNA.
- Gene products also include RNAs which are modified, by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristilation, and glycosylation.
- Modulation of gene expression refers to a change in the activity of a gene.
- Modulation of expression can include, but is not limited to, gene activation and gene repression.
- Genome editing e.g., cleavage, alteration, inactivation, random mutation
- Gene inactivation refers to any reduction in gene expression as compared to a cell that does not include a ZFP, TALE or CRISPR/Cas system as described herein. Thus, gene inactivation may be partial or complete.
- Eukaryotic cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells and human cells (e.g., T-cells), including stem cells (pluripotent and multipotent).
- operative linkage and “operatively linked” (or“operably linked”) are used interchangeably with reference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components.
- a transcriptional regulatory sequence such as a promoter
- a transcriptional regulatory sequence is generally operatively linked in cis with a coding sequence, but need not be directly adjacent to it.
- an enhancer is a transcriptional regulatory sequence that is operatively linked to a coding sequence, even though they are not contiguous.
- a "functional fragment" of a protein, polypeptide or nucleic acid is a protein, polypeptide or nucleic acid whose sequence is not identical to the full-length protein, polypeptide or nucleic acid, yet retains the same function as the full-length protein, polypeptide or nucleic acid.
- a functional fragment can possess more, fewer, or the same number of residues as the corresponding native molecule, and/or can contain one or more amino acid or nucleotide substitutions.
- Methods for determining the function of a nucleic acid e.g., coding function, ability to hybridize to another nucleic acid
- methods for determining protein function are well-known.
- the B-domain deleted human Factor VIII is a functional fragment of the full-length Factor VIII protein.
- a polynucleotide "vector” or“construct” is capable of transferring gene sequences to target cells.
- vector construct means any nucleic acid construct capable of directing the expression of a gene of interest and which can transfer gene sequences to target cells.
- the term includes cloning, and expression vehicles, as well as integrating vectors.
- subject and patient are used interchangeably and refer to mammals such as human patients and non-human primates, as well as experimental animals such as rabbits, dogs, cats, rats, mice, and other animals. Accordingly, the term “subject” or “patient” as used herein means any mammalian patient or subject to which the expression cassettes of the invention can be administered. Subjects of the present invention include those with a disorder.
- treating and“treatment” as used herein refer to reduction in severity and/or frequency of symptoms, elimination of symptoms and/or underlying cause, prevention of the occurrence of symptoms and/or their underlying cause, and improvement or remediation of damage. Cancer and graft versus host disease are non-limiting examples of conditions that may be treated using the compositions and methods described herein. Thus, “treating” and“treatment includes:
- the particular malady or condition may not have a known causative agent (so that etiology has not yet been worked out) and it is therefore not yet recognized as a disease but only as an undesirable condition or syndrome, wherein a more or less specific set of symptoms have been identified by clinicians.
- A“pharmaceutical composition” refers to a formulation of a compound of the invention and a medium generally accepted in the art for the delivery of the biologically active compound to mammals, e.g., humans.
- a medium includes all pharmaceutically acceptable carriers, diluents or excipients therefor.
- Effective amount refers to that amount of a compound of the invention which, when administered to a mammal, preferably a human, is sufficient to effect treatment in the mammal, preferably a human.
- the amount of a composition of the invention which constitutes a“therapeutically effective amount” will vary depending on the compound, the condition and its severity, the manner of administration, and the age of the mammal to be treated, but can be determined routinely by one of ordinary skill in the art having regard to his own knowledge and to this disclosure.
- expression cassettes for use in directing expression of a transgene in a liver cell, including in vivo following administration of the expression cassette(s) to the subject ( e.g ., hepatic delivery).
- the expression construct may be maintained episomally and drive expression of the transgene extrachromosomally or, alternatively, the expression construct may be integrated into the genome of a liver cell, for example by nuclease-mediated targeted integration.
- the polynucleotide expression construct comprises an enhancer sequence, a promoter sequence, and one or more transgenes.
- an intronic sequence e.g., an RNA sequence
- a polyadenylation sequence e.g., a polyadenylation sequence
- a signal peptide e.g., a signal peptide.
- Any enhancer sequence may be used in the expression constructs described herein.
- the enhancer is a wild-type or modified Serpinl enhancer (Chuah et al, (2014) Molecular Therapy , 22, 1605-1613,; Nair et al., (2014) Blood, 123, 3195-3199)
- any transgene can be used in the constructs described herein.
- the individual components (promoter, enhancer, insulator, transgene, etc.) of the constructs described herein may be mixed and matched in any combination.
- constructs described herein may be contained within any viral or non- viral vector.
- the constructs may be maintained episomally or may be integrated into the genome of the cell (e.g., via nuclease-mediated targeted integration).
- Non-viral vectors include DNA or RNA plasmids, DNA MCs, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome, nanoparticle or poloxamer.
- Viral vectors that may be used to carry the expression cassettes described herein include, but are not limited to, retroviral, lentivirus, adenoviral, adeno-associated viral vectors, vaccinia and herpes simplex virus vectors. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, and as described herein may be facilitated by nuclease-mediated integration.
- the constructs are included in an adeno-associated virus (“AAV”) vector or vector system that may be maintained episomally or integrated into the genome of a liver cell (e.g., via nuclease-mediated targeted integration).
- AAV adeno-associated virus
- Construction of recombinant AAV vectors is in a number of publications, including U.S. Pat. No. 5,173,414; Tratschin et al, Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al, Mol. Cell. Biol.
- the expression construct is carried on an AAV construct and further comprises 5’ and 3’ ITRs flanking the expression constructs elements (e.g., enhancer, promoter, optional intron, transgene, etc.) as described herein.
- elements e.g., enhancer, promoter, optional intron, transgene, etc.
- spacer molecules are also included between one or more of the components of the expression construct, for example, between the 5’ ITR and the enhancer and/or between the
- the spacers may function as homology arms to facilitate recombination into a safe-harbor locus (e.g . albumin).
- the AAV vectors as described herein can be derived from any AAV.
- the AAV vector is derived from the defective and nonpathogenic parvovirus adeno-associated type 2 virus. All such vectors are derived from a plasmid that retains only the AAV 145 bp inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genomes of the transduced cell are key features for this vector system. (Wagner el al, Lancet 351:9117 1702-3 (1998), Kearns et al, Gene Ther. 9:748-55 (1996)).
- AAV serotypes including AAV1, AAV2, AAV 3, AAV4, AAV5, AAV6, AAV7, AAV 8, AAV9 and AAVrh.lO and any novel AAV serotype can also be used in accordance with the present invention.
- chimeric AAV is used where the viral origins of the LTR sequences of the viral nucleic acid are heterologous to the viral origin of the capsid sequences.
- Non-limiting examples include chimeric virus with LTRs derived from AAV2 and capsids derived from AAV5, AAV6, AAV8 or AAV9 (i.e. AAV2/5, AAV2/6, AAV2/8 and AAV2/9, respectively).
- Packaging cells are used to form virus particles that are capable of infecting a host cell.
- Such cells include HEK293 and Sf9 cells, which can be used to package AAV and adenovirus, and y2 cells or PA317 cells, which package retrovirus.
- Viral vectors used in gene therapy are usually generated by a producer cell line that packages a nucleic acid vector into a viral particle.
- the vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable), other viral sequences being replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line.
- AAV vectors used in gene therapy typically only possess inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and integration into the host genome.
- Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
- the cell line is also infected with adenovirus as a helper.
- the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
- the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.
- AAV is produced using a baculovirus expression system.
- a viral vector can be modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus.
- the ligand is chosen to have affinity for a receptor known to be present on the cell type of interest. For example, Han et al., Proc. Natl. Acad. Sci.
- Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells expressing human epidermal growth factor receptor.
- This principle can be extended to other virus-target cell pairs, in which the target cell expresses a receptor and the virus expresses a fusion protein comprising a ligand for the cell-surface receptor.
- filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) having specific binding affinity for virtually any chosen cellular receptor.
- the polynucleotides described herein may include one or more non-natural bases and/or backbones.
- an expression cassette as described herein may include methylated cytosines to achieve a state of transcriptional quiescence in a region of interest.
- the expression constructs as described herein may also include additional transcriptional or translational regulatory or other sequences, for example, Kozak sequences, additional promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides, furin cleavage sites and/or polyadenylation signals.
- additional transcriptional or translational regulatory or other sequences for example, Kozak sequences, additional promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides, furin cleavage sites and/or polyadenylation signals.
- control elements of the genes of interest can be operably linked to reporter genes to create chimeric genes (e.g., reporter expression cassettes).
- the constructs described herein may be delivered in vivo or ex vivo by any suitable means into any cell type, preferably to the liver (hepatic delivery).
- the nucleases when used in combination with nucleases for targeted integration, may be delivered in polynucleotide and/or protein form, for example using non-viral vector(s), viral vectors(s) and/or in RNA form, e.g., as mRNA.
- Non-viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer.
- Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
- DNA and RNA viruses which have either episomal or integrated genomes after delivery to the cell.
- Any vector systems may be used including, but not limited to, plasmid vectors, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors;
- herpesvirus vectors and adeno-associated virus vectors See, also, U.S. Patent Nos. 8,586,526; 6,534,261; 6,607,882; 6,824,978; 6,933,113; 6,979,539; 7,013,219; and
- Methods of non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, other nanoparticle, poly cation or lipidmucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA.
- Sonoporation using, e.g., the Sonitron 2000 system (Rich- Mar) can also be used for delivery of nucleic acids.
- Additional exemplary nucleic acid delivery systems include those provided by AmaxaBiosystems (Cologne, Germany),
- Maxcyte, Inc. Rockville, Maryland
- BTX Molecular Delivery Systems Holliston, MA
- Copernicus Therapeutics Inc. see for example US6008336.
- the expression constructs are AAV vectors.
- the optional nucleases may be administered in mRNA form or using one or more viral vectors (AAV, Ad, etc.). Administration can be by any means in which the polynucleotides are delivered to the desired target cells. Both in vivo and ex vivo methods are contemplated. Intravenous injection to the portal vein is a possible method of administration.
- in vivo administration modes include, for example, direct injection into the lobes of the liver or the biliary duct and intravenous injection distal to the liver, including through the hepatic artery, direct injection in to the liver parenchyma, injection via the hepatic artery, and/or retrograde injection through the biliary tree.
- Ex vivo modes of administration include transduction in vitro of resected hepatocytes or other cells of the liver, followed by infusion of the transduced, resected hepatocytes back into the portal vasculature, liver parenchyma or biliary tree of the human patient, see e.g., Grossman el al, (1994) Nature Genetics, 6:335-341.
- the two or more polynucleotide(s) are delivered using one or more of the same and/or different vectors.
- the nuclease in polynucleotide form may be delivered in mRNA form and the liver- specific constructs as described herein may be delivered via other modalities such as viral vectors (e.g., AAV), minicircle DNA, plasmid DNA, linear DNA, liposomes, nanoparticles and the like.
- nucleic acid delivery systems include those provided by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland), BTX
- lipofection reagents are sold commercially (e.g., Transfectam ® and Lipofectin ® and Lipofectamine ® RNAiMAX).
- Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Felgner, WO 91/17424, WO 91/16024. Delivery can be to cells (ex vivo administration) or target tissues (in vivo administration).
- lipidmucleic acid complexes including targeted liposomes such as immunolipid complexes
- crystal Science 270:404-410 (1995); Blaese et al, Cancer Gene Ther. 2:291-297 (1995); Behr et al, Bioconjugate Chem. 5:382-389 (1994); Remy et al, Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al, Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787).
- Additional methods of delivery include the use of packaging the nucleic acids to be delivered into EnGeneIC delivery vehicles (EDVs). These EDVs are specifically delivered to target tissues using bispecific antibodies where one arm of the antibody has specificity for the target tissue and the other has specificity for the EDV. The antibody brings the EDVs to the target cell surface and then the EDV is brought into the cell by endocytosis. Once in the cell, the contents are released (see MacDiarmid et al (2009) Nature
- Adenoviral based systems can be used.
- Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and high levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system.
- Adeno-associated virus (“AAV”) vectors are also used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West el al, Virology 160:38-47 (1987); U.S. Patent No.
- rAAV Recombinant adeno-associated virus vectors
- All vectors are derived from a plasmid that retains only the AAV 145 bp inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genomes of the transduced cell are key features for this vector system.
- AAV serotypes including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV8AAV 8.2, AAV9, and AAV rhlO and pseudotyped AAV such as AAV2/8, AAV2/9, AAV2/5 and AAV2/6 can also be used in accordance with the present invention.
- Novel AAV serotypes capable of crossing the blood- brain barrier can also be used in accordance with the present invention (see e.g.
- AAV6 is used.
- Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and y2 cells or PA317 cells, which package retrovirus.
- Viral vectors used in gene therapy are usually generated by a producer cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable), other viral sequences being replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line.
- AAV vectors used in gene therapy typically only possess inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and integration into the host genome.
- ITR inverted terminal repeat
- Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
- the cell line is also infected with adenovirus as a helper.
- the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
- the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.
- AAV particles from a 293 or baculovirus system typically involves growth of the cells which produce the virus, followed by collection of the viral particles from the cell supernatant or lysing the cells and collecting the virus from the crude lysate.
- AAV is then purified by methods known in the art including ion exchange chromatography (e.g. see U.S. Patents 7,419,817 and 6,989,264), ion exchange
- a viral vector can be modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus.
- the ligand is chosen to have affinity for a receptor known to be present on the cell type of interest. For example, Han et al., Proc. Natl. Acad. Sci.
- Moloney mouse leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells expressing human epidermal growth factor receptor.
- This principle can be extended to other virus-target cell pairs, in which the target cell expresses a receptor and the virus expresses a fusion protein comprising a ligand for the cell-surface receptor.
- filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) having specific binding affinity for virtually any chosen cellular receptor.
- Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion, including direct injection into the brain) or topical application, as described below.
- systemic administration e.g., intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion, including direct injection into the brain
- topical application e.g., topical application, as described below.
- compositions are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions available, as described below (see, e.g., Remington’s Pharmaceutical Sciences , l7th ed., 1989).
- the effective amount of expression cassette (and optional nuclease(s), and/or modified cells) to be administered will vary from patient to patient. Accordingly, effective amounts are best determined by the physician administering the compositions (e.g., cells) and appropriate dosages can be determined readily by one of ordinary skill in the art. Analysis of the serum, plasma or other tissue levels of the therapeutic polypeptide and comparison to the initial level prior to administration can determine whether the amount being administered is too low, within the right range or too high. Suitable regimes for initial and subsequent administrations are also variable, but are typified by an initial administration followed by subsequent administrations if necessary. Subsequent administrations may be administered at variable intervals, ranging from daily to annually to every several years.
- Formulations for both ex vivo and in vivo administrations include suspensions (e.g,. of genetically modified cells, liposomes or nanoparticles) in liquid or emulsified liquids.
- the active ingredients often are mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol or the like, and combinations thereof.
- the composition may contain minor amounts of auxiliary substances, such as, wetting or emulsifying agents, pH buffering agents, stabilizing agents or other reagents that enhance the effectiveness of the pharmaceutical composition.
- compositions disclosed herein are for providing therapies for any disease by provision of a transgene that expresses a product that is lacking or deficient in the disease or otherwise treats or prevents the disease.
- RNA/DNA is isolated from plasma using AllPrep DNA/RNA kit per the manufacturer’s instructions (Qiagen, Carlsbad CA). Extracted RNA is then used to make cDNA using Quantitect cDNA synthesis kit (Qiagen, Carlsbad CA). Quantitative PCR is then carried out using SsoAdvanced
- RNA/DNA is isolated from plasma using AllPrep DNA/RNA kit per the manufacturer’s instructions (Qiagen, Carlsbad CA). Extracted DNA is used for quantitative PCR with TaqMan Fast Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems, Foster City, CA) on the AB 7300 real-time PCR system (Applied Biosystems, Foster City, CA).
- the primer/probe assay is custom; forward primer (CCTGGGCCAGTTCCTGCT) (SEQ ID NO:9), probe (TTCTGCCACATCAGCAGCCACCA) (SEQ ID NO: 10) and reverse primer (GGCCTCCATGCCATCATG) (SEQ ID NO: 11).
- No-template controls are run with all samples and produce no detectable signal.
- a qPCR DNA standard curve is generated from seven, serial 4-fold dilutions of a known amount of purified, linearized human Factor VIII plasmid.
- Human FVIII total antigen immunoassay Human Factor VIII B-Domain Deleted (hFVIII-BDD) total antigen in citrated human plasma is measured using an hFVIIIBDD immunoassay developed at Sangamo Therapeutics, Inc.
- Xyntha® human recombinant BDD-FVIII reference material will be used as the calibrator.
- Xyntha® will also be used as the QC to represent hFVlll-BDD antigen.
- the assay is a sandwich ELISA that uses a monoclonal antibody (mAh) as the capture antibody and a biotinylated mAh as the detection antibody, both of which have the A2 domain of the FVIII as the epitope.
- Captured hFVIII-BDD antigen is quantified against a linear standard curve that is regressed using a log-log linear fit across a range of 0.020 IU/mL to 0.500 IU/mL.
- Calibrators will be prepared using a 10.0 IU/mL Xyntha® Working Solution prepared in pooled congenital FVIII-deficient plasma (George King Bio-Medical, or equivalent).
- a 9-point calibration curve (range of quantitation from 0.500 IU/mL to 0.020 IU/mL with anchor points at 0.010 IU/mL and 0.000 IU/mL) is prepared using the assay calibrator diluted to the applicable levels in Assay Diluent. Calibration is performed as a single curve in duplicate using a log-log linear fitting with the total hFVIII-BDD antigen content measured in IU/mL on the x-axis, and the optical density (OD, measured at 450nm) on the y axis. The last two standard levels will be anchor points prepared at 0.010 IU/mL and 0.000 IU/mL, not having acceptance criteria. Samples and QCs are assayed in duplicate, and back-calculated against the calibration curve to determine total hFVIII-BDD antigen
- Chromogenic human Factor VIII Activity Assay Activity of secreted human Factor VIII in plasma is determined using the Diapharma Chromogenic Coamatic Factor VIII assay (West Chester, OH) according to the manufacturer’s protocol with the exception of the human Factor VIII standard.
- the human Factor VIII standard used in the ELISA assay is a recombinant purified human Factor VIII (#F00l6-06) from US Biologicals (Salem, MA).
- Clotting Activity Assay Activity of secreted human Factor VIII in plasma is determined using the activated partial thromboplastin time (aPTT) assay by Diagnostica Stago (Boston MA) according to the manufacturer’s protocol with the exception of the human Factor VIII standard and human Factor Vlll-deficient plasma.
- the human Factor VIII standard is the same as used in the ELISA assay (recombinant purified human Factor VIII, #F00l6-06 from US Biologicals, Salem, MA).
- the deficient FVIII reagent used in the clotting assay is FVIII-CD ⁇ 1 % FVIII Activity (frozen deficient FVIII) from Haematologic Technologies, Inc. (Essex Junction, VT).
- the final product formulation base buffer, SBR-0099 comprised of phosphate buffered saline (PBS) containing CaCh, MgCh, 35mM NaCl (i.e., 0.90mM CaCh, 0.49mM MgCh, 2.68mM KC1, l.47mM KH2PO4, l72mM NaCl, 8 0mM Na2HPO4), was prepared using USP grade reagents.
- PBS phosphate buffered saline
- the SB-525 Bulk was adjusted to a target concentration of 1.0 x 10 13 vg/mL in final formulation buffer comprised of PBS containing CaCh, MgCh, 35mM NaCl, 1% Sucrose, 0.05% Kolliphor (Poloxamer) P 188.
- the SB-525 vector is an AAV vector comprising an AAV6 capsid and comprising SEQ ID NO:5 flanked 5’ and 3’ by AAV2 ITRs SEQ ID NOS: 12 and 13, respectively.
- the SB-525 product was prepared by calculating the product component volume by multiplication of the dose level (vg/kg) by the subject’s weight (kg) and then dividing by the viral genome concentration (vg/mL).
- the volume of normal saline (NS) was calculated to be at a 1: 1 ratio of the SB-525 product.
- the total volume was calculated by adding together the volume of the NS plus the volume of the SB-525 product.
- Exemplary doses for the SB-525 product in subjects is shown below in Table I below:
- Total volumes were expected to be between 4 mL and 200 mL, depending on subject’s dose level assignment and body weight. If the total volume was less than 50 mL, then the infusion product was administered via syringe, while when the volume was greater than 50 mL, the infusion product was administered via infusion bag. Both infusion rates were at 100 mL/hour using a constant rate infusion pump.
- Inclusion and exclusion criteria For the study, the inclusion criteria included a subject being male and > 18 years of age that had been treated or exposed to FVIII concentrates or cryoprecipitate for at least 150 exposure days. In addition, the subject needed to have > 12 bleeding episodes over the preceding 12 months. Exclusion criteria included a subject having neutralizing antibodies against the AAV6 capsid, FVIII inhibitor or history of one, hypersensitivity to FVIII, evidence of any bleeding disorder in addition to Hemophilia A, markers of hepatic inflammation, and use of systemic (IV or oral) immunomodulatory agent.
- Study objectives The primary object of this study was to evaluate safety. This the primary objectives were to examine the safety and tolerability of SB-525 and evaluate the time-course profile of FVIII activity after dosing with SB-525. Secondary endpoints included observation in a change in baseline use of FVIII replacement therapy (“factor”) and the frequency and severity in bleeding episodes, an evaluation of the clinical impact on the hemophilia A after dosing, and also evaluating the immune response to FVIII and vector shedding of the AAV2/6 vector. Exploratory objectives included evaluating the concurrence between FVIII levels by ELISA and FVIII activity assays and to evaluate any immune response to SB-525.
- factor FVIII replacement therapy
- Exploratory objectives included evaluating the concurrence between FVIII levels by ELISA and FVIII activity assays and to evaluate any immune response to SB-525.
- Example 6 ⁇ Eight patients treated with SB-525 gene therapy showed dose-dependent increases in FVIII activity, with two patients treated with the 3 x 10 13 vg/kg dose reaching normal FVIII levels
- the Phase 1/2 data include eight patients treated across four ascending dosage cohorts (9xlO n vg/kg, 2xl0 12 vg/kg, lxlO 13 vg/kg and 3xl0 13 vg/kg, with two patients per cohort). Patients demonstrated a dose-dependent increase in FVIII levels, achieving clinically relevant increases in FVIII activity in the higher dosage cohorts and normal FVIII levels in the 3xl0 13 vg/kg dosage cohort (normal range: 50-150%). A dose-dependent reduction in the use of Factor VIII replacement therapy was also observed, with significant reductions observed in the higher dose cohorts.
- SB-525 was generally well-tolerated, with one patient (treated with the 3x10 13 vg/kg dose) reporting a treatment-related serious adverse event of hypotension and fever, which occurred following vector infusion and resolved with treatment within 24 hours of completion of vector infusion.
- Table II provides data illustrating results of administration of dosages of AAV vector of 9 x 10 11 , 2 x 10 12 , 1 x 10 13 and 3 x 10 13 vg/Kg.
- FIGS. 1-3 provide FVIII activity data obtained post-administration.
- Example 7 Ten patients treated with SB-525 gene therapy showed dose-dependent increases in FVIII activity, with four patients treated with the 3 x 10 13 vg/kg dose reaching normal FVIII levels
- FIG. 4 and 5 illustrate FVIII activity in all ten patients over time post treatment with the vector.
- FIGs. 8-10 summarizes adverse event findings from the clinical trial.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Veterinary Medicine (AREA)
- Hematology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Diabetes (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Toxicology (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicinal Preparation (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17/265,750 US12497632B2 (en) | 2018-08-03 | 2019-08-02 | Clinical parameters by expression of factor VIII |
| AU2019314513A AU2019314513A1 (en) | 2018-08-03 | 2019-08-02 | Improved clinical parameters by expression of factor viii |
| KR1020217006266A KR20210039428A (ko) | 2018-08-03 | 2019-08-02 | 인자 viii의 발현에 의한 개선된 임상 파라미터 |
| CA3105382A CA3105382A1 (en) | 2018-08-03 | 2019-08-02 | Improved clinical parameters by expression of factor viii |
| MX2021001375A MX2021001375A (es) | 2018-08-03 | 2019-08-02 | Parametros clinicos mejorados por la expresion del factor viii. |
| JP2021504376A JP7684212B2 (ja) | 2018-08-03 | 2019-08-02 | 第viii因子の発現による改善された臨床パラメーター |
| EP19843874.9A EP3829650A4 (en) | 2018-08-03 | 2019-08-02 | CLINICAL PARAMETERS IMPROVED BY FACTOR VIII EXPRESSION |
| BR112021001315-6A BR112021001315A2 (pt) | 2018-08-03 | 2019-08-02 | parâmetros clínicos melhorados através da expressão do fator viii |
| CN201980051349.9A CN112533645A (zh) | 2018-08-03 | 2019-08-02 | 通过因子viii的表达改善临床参数 |
| IL280402A IL280402A (en) | 2018-08-03 | 2021-01-26 | Clinical parameters are improved through factor VIII expression |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862714553P | 2018-08-03 | 2018-08-03 | |
| US62/714,553 | 2018-08-03 | ||
| US201962826887P | 2019-03-29 | 2019-03-29 | |
| US62/826,887 | 2019-03-29 | ||
| US201962869445P | 2019-07-01 | 2019-07-01 | |
| US62/869,445 | 2019-07-01 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020028830A1 true WO2020028830A1 (en) | 2020-02-06 |
Family
ID=69230742
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2019/044946 Ceased WO2020028830A1 (en) | 2018-08-03 | 2019-08-02 | Improved clinical parameters by expression of factor viii |
Country Status (11)
| Country | Link |
|---|---|
| US (1) | US12497632B2 (enExample) |
| EP (1) | EP3829650A4 (enExample) |
| JP (1) | JP7684212B2 (enExample) |
| KR (1) | KR20210039428A (enExample) |
| CN (1) | CN112533645A (enExample) |
| AU (1) | AU2019314513A1 (enExample) |
| BR (1) | BR112021001315A2 (enExample) |
| CA (1) | CA3105382A1 (enExample) |
| IL (1) | IL280402A (enExample) |
| MX (1) | MX2021001375A (enExample) |
| WO (1) | WO2020028830A1 (enExample) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022133324A1 (en) | 2020-12-18 | 2022-06-23 | Sangamo Therapeutics, Inc. | Improved pharmaceutical compositions containing adeno-associated viral vector |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050276787A1 (en) * | 1998-10-20 | 2005-12-15 | Couto Linda B | Adeno-associated vector compositions for expression of factor VIII |
| US20170233455A1 (en) * | 2015-11-13 | 2017-08-17 | Baxalta Incorporated | Viral vectors encoding recombinant fviii variants with increased expression for gene therapy of hemophilia a |
Family Cites Families (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998024479A1 (en) | 1996-12-02 | 1998-06-11 | Cell Genesys, Inc. | Adeno-associated viral vector-mediated delivery of dna to cells of the liver |
| CA2392863A1 (en) | 2002-07-08 | 2004-01-08 | Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw | A high capacity recombinant adenoviral vector for treatment of hemophilia a |
| JP4745972B2 (ja) | 2003-10-21 | 2011-08-10 | メルク セローノ ソシエテ アノニム | クロマチンインスレーターとして作用する極小dna配列、及びタンパク質発現におけるその使用 |
| JPWO2006043354A1 (ja) | 2004-10-20 | 2008-05-22 | 独立行政法人放射線医学総合研究所 | 組込型の低線量放射線誘導性ベクター |
| AU2006280428A1 (en) | 2005-06-10 | 2007-02-22 | Genentech, Inc. | Improving antibody expression using vectors containing insulator elements |
| US8338571B2 (en) | 2007-11-01 | 2012-12-25 | University Of Rochester | Recombinant factor VIII having increased stability |
| US9617548B2 (en) | 2008-04-22 | 2017-04-11 | Vib Vzw | Liver-specific nucleic acid regulatory elements and methods and use thereof |
| WO2009134681A2 (en) * | 2008-04-30 | 2009-11-05 | The Trustees Of The University Of Pennsylvania | Aav7 viral vectors for targeted delivery of rpe cells |
| GB0911870D0 (en) | 2009-07-08 | 2009-08-19 | Ucl Business Plc | Optimised coding sequence and promoter |
| EP2758529B1 (en) | 2011-09-21 | 2019-03-20 | Sangamo Therapeutics, Inc. | Methods and compositions for regulation of transgene expression |
| SMT202200355T1 (it) * | 2011-12-16 | 2022-11-18 | Modernatx Inc | Composizioni di mrna modificato |
| EP2804623B1 (en) | 2012-01-12 | 2019-08-07 | Bioverativ Therapeutics Inc. | Chimeric factor viii polypeptides and uses thereof |
| EP2872625B1 (en) | 2012-07-11 | 2016-11-16 | Sangamo BioSciences, Inc. | Methods and compositions for the treatment of lysosomal storage diseases |
| JP2015529466A (ja) | 2012-09-14 | 2015-10-08 | ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア | 鎌状赤血球症の幹細胞遺伝子治療のためのレンチウイルスベクター |
| EP2911687B1 (en) | 2012-10-26 | 2019-02-13 | Vrije Universiteit Brussel | Vector for liver-directed gene therapy of hemophilia and methods and use thereof |
| US20160046694A1 (en) | 2013-03-30 | 2016-02-18 | Usha Biotech Limited | Methods and constructs for expressing biologically active proteins in mammalian cells |
| HUE050484T2 (hu) | 2013-09-12 | 2020-12-28 | Biomarin Pharm Inc | VIII. faktort kódoló gént tartalmazó AAV vektorok |
| HUE051628T2 (hu) | 2013-12-09 | 2021-03-01 | Sangamo Therapeutics Inc | Eljárások és kompozíciók genom-manipulálására |
| HRP20220960T1 (hr) | 2014-01-10 | 2022-10-28 | Bioverativ Therapeutics Inc. | Kimerni proteini faktora viii i njihova upotreba |
| CA2975734C (en) | 2015-02-06 | 2025-02-18 | The University Of North Carolina At Chapel Hill | OPTIMIZED GENE EXPRESSION CASSETTES FOR HUMAN COAGULATION FACTOR VIII AND THEIR USE |
| CN115074366A (zh) | 2015-04-16 | 2022-09-20 | 埃默里大学 | 用于肝脏中蛋白质表达的重组启动子和载体及其用途 |
| EP3294064A1 (en) | 2015-05-11 | 2018-03-21 | Bayer CropScience AG | Herbicide combinations comprising l-glufosinate and indaziflam |
| AU2016291778B2 (en) | 2015-07-13 | 2021-05-06 | Sangamo Therapeutics, Inc. | Delivery methods and compositions for nuclease-mediated genome engineering |
| IL257939B2 (en) * | 2015-09-24 | 2023-03-01 | Biomarin Pharm Inc | Adeno-associated virus factor 8 vectors, associated virus particles, and medicinal formulations comprising the same |
| KR102766526B1 (ko) * | 2015-10-28 | 2025-02-13 | 상가모 테라퓨틱스, 인코포레이티드 | 간-특이적 작제물인, 인자 viii 발현 카세트 및 이의 사용 방법 |
| KR20240160648A (ko) * | 2017-08-01 | 2024-11-11 | 스파크 테라퓨틱스, 인코포레이티드 | 인자 viii (fviii) 유전자 요법 방법 |
-
2019
- 2019-08-02 CA CA3105382A patent/CA3105382A1/en active Pending
- 2019-08-02 US US17/265,750 patent/US12497632B2/en active Active
- 2019-08-02 JP JP2021504376A patent/JP7684212B2/ja active Active
- 2019-08-02 WO PCT/US2019/044946 patent/WO2020028830A1/en not_active Ceased
- 2019-08-02 KR KR1020217006266A patent/KR20210039428A/ko active Pending
- 2019-08-02 CN CN201980051349.9A patent/CN112533645A/zh active Pending
- 2019-08-02 AU AU2019314513A patent/AU2019314513A1/en active Pending
- 2019-08-02 BR BR112021001315-6A patent/BR112021001315A2/pt unknown
- 2019-08-02 EP EP19843874.9A patent/EP3829650A4/en active Pending
- 2019-08-02 MX MX2021001375A patent/MX2021001375A/es unknown
-
2021
- 2021-01-26 IL IL280402A patent/IL280402A/en unknown
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050276787A1 (en) * | 1998-10-20 | 2005-12-15 | Couto Linda B | Adeno-associated vector compositions for expression of factor VIII |
| US20170233455A1 (en) * | 2015-11-13 | 2017-08-17 | Baxalta Incorporated | Viral vectors encoding recombinant fviii variants with increased expression for gene therapy of hemophilia a |
Non-Patent Citations (1)
| Title |
|---|
| See also references of EP3829650A4 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022133324A1 (en) | 2020-12-18 | 2022-06-23 | Sangamo Therapeutics, Inc. | Improved pharmaceutical compositions containing adeno-associated viral vector |
| JP2024500133A (ja) * | 2020-12-18 | 2024-01-04 | サンガモ セラピューティクス, インコーポレイテッド | アデノ随伴ウイルスベクターを含む改善された医薬組成物 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3829650A4 (en) | 2022-05-04 |
| MX2021001375A (es) | 2021-04-19 |
| US20210171982A1 (en) | 2021-06-10 |
| CN112533645A (zh) | 2021-03-19 |
| US12497632B2 (en) | 2025-12-16 |
| IL280402A (en) | 2021-03-01 |
| JP2021533098A (ja) | 2021-12-02 |
| AU2019314513A1 (en) | 2021-01-28 |
| EP3829650A1 (en) | 2021-06-09 |
| BR112021001315A2 (pt) | 2021-04-27 |
| CA3105382A1 (en) | 2020-02-06 |
| JP7684212B2 (ja) | 2025-05-27 |
| KR20210039428A (ko) | 2021-04-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230119850A1 (en) | Liver-specific constructs, factor viii expression cassettes and methods of use thereof | |
| TWI753168B (zh) | 用於血友病b基因療法之編碼具有增強表現的重組fix變異體之病毒載體 | |
| KR20180053335A (ko) | 아데노-관련 바이러스 인자 viii 벡터, 연합된 바이러스 입자 및 이를 포함하는 치료학적 제형 | |
| US11596671B2 (en) | Gene therapy of hemophilia B using viral vectors encoding recombinant fix variants with increased expression | |
| TW202334194A (zh) | 用於表現因子ix以便治療b型血友病的組成物及方法 | |
| US12497632B2 (en) | Clinical parameters by expression of factor VIII | |
| RU2799048C2 (ru) | Улучшение клинических параметров посредством экспрессии фактора viii | |
| US20230175014A1 (en) | Compositions and methods for reducing nuclease expression and off-target activity using a promoter with low transcriptional activity | |
| RU2774874C2 (ru) | Печень-специфичные конструкции, экспрессионные кассеты фактора viii и способы их применения | |
| WO2023081807A1 (en) | Compositions and methods for reducing pcsk9 levels in a subject | |
| WO2023140971A1 (en) | Methods for treatment of ornithine transcarbamylase (otc) deficiency | |
| BR122021018761B1 (pt) | Construto de expressão de polinucleotídeo, vetor aav e composição farmacêutica | |
| BR112018008519B1 (pt) | Construto de expressão de polinucleotídeo,vetor aav e composição farmacêutica | |
| HK1185623B (en) | Methods and compositions for treating hemophilia b |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19843874 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3105382 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021504376 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019314513 Country of ref document: AU Date of ref document: 20190802 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112021001315 Country of ref document: BR |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20217006266 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019843874 Country of ref document: EP Effective date: 20210303 |
|
| ENP | Entry into the national phase |
Ref document number: 112021001315 Country of ref document: BR Kind code of ref document: A2 Effective date: 20210125 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 17265750 Country of ref document: US |