WO2019217708A1 - Compounds and methods for reducing atxn3 expression - Google Patents

Compounds and methods for reducing atxn3 expression Download PDF

Info

Publication number
WO2019217708A1
WO2019217708A1 PCT/US2019/031562 US2019031562W WO2019217708A1 WO 2019217708 A1 WO2019217708 A1 WO 2019217708A1 US 2019031562 W US2019031562 W US 2019031562W WO 2019217708 A1 WO2019217708 A1 WO 2019217708A1
Authority
WO
WIPO (PCT)
Prior art keywords
modified
certain embodiments
oligomeric compound
modified oligonucleotide
compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/031562
Other languages
English (en)
French (fr)
Inventor
Susan M. Freier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to PE2020001754A priority Critical patent/PE20212131A1/es
Priority to CN201980029792.6A priority patent/CN112189053B/zh
Priority to JOP/2020/0283A priority patent/JOP20200283A1/ar
Priority to SG11202010215TA priority patent/SG11202010215TA/en
Priority to EP25197374.9A priority patent/EP4663758A3/en
Priority to EP19799466.8A priority patent/EP3799602A4/en
Priority to CA3098144A priority patent/CA3098144A1/en
Priority to US17/053,997 priority patent/US11434488B2/en
Priority to BR112020021253-9A priority patent/BR112020021253A2/pt
Priority to JP2020561893A priority patent/JP2021522800A/ja
Priority to MX2020011911A priority patent/MX2020011911A/es
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Priority to AU2019266307A priority patent/AU2019266307A1/en
Priority to KR1020207035007A priority patent/KR20210008497A/ko
Priority to CR20200604A priority patent/CR20200604A/es
Priority to EA202092500A priority patent/EA202092500A1/ru
Publication of WO2019217708A1 publication Critical patent/WO2019217708A1/en
Priority to CONC2020/0013433A priority patent/CO2020013433A2/es
Priority to PH12020500668A priority patent/PH12020500668A1/en
Anticipated expiration legal-status Critical
Priority to US17/852,939 priority patent/US20230235323A1/en
Priority to US18/485,724 priority patent/US12618069B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/311Phosphotriesters
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/11Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/50Methods for regulating/modulating their activity
    • C12N2320/53Methods for regulating/modulating their activity reducing unwanted side-effects

Definitions

  • Such compounds, methods, and pharmaceutical compositions for reducing the amount or activity of ATXN3 RNA in a cell or animal, and in certain instances reducing the amount of Ataxin-3 protein in a cell or animal.
  • Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodegenerative disease.
  • symptoms and hallmarks include ataxia, neuropathy, and aggregate formation.
  • neurodegenerative diseases include spinocerebellar ataxia type 3(SCA3).
  • SCA3 Spinocerebellar ataxia type 3
  • MTD Machado-Joseph disease
  • SCA3 is inherited in an autosomal dominant manner. Offspring of affected individuals have a 50% chance of inheriting the mutation.
  • the diagnosis of SCA3 rests on the use of molecular genetic testing to detect an abnormal CAG trinucleotide repeat expansion in ATXN3. Affected individuals have alleles with 52 to 86 CAG trinucleotide repeats.
  • Expanded CAG repeats in the ATXN3 gene are translated into expanded poly glutamine repeats (polyQ) in the ataxin-3 protein and this toxic ataxin-3 protein is associated with aggregates.
  • polyQ expanded poly glutamine repeats
  • the poly glutamine expanded ataxin-3 protein in these aggregates is ubiquinated and the aggregates contain other proteins, including heat shock proteins and transcription factors. Aggregates are frequently observed in the brain tissue of SCA3 patients.
  • SCA3 Management of SCA3 is supportive as no medication slows the course of disease; restless legs syndrome and extrapyramidal syndromes resembling parkinsonism may respond to levodopa or dopamine agonists; spasticity, drooling, and sleep problems respond variably to lioresal, atropine-like drags, and hypnotic agents; botulinum toxin has been used for dystonia and spasticity; daytime fatigue may respond to psychostimulants such as modafinil;
  • compounds, methods, and pharmaceutical compositions for reducing the amount or activity of ATXN3 RNA, and in certain embodiments reducing the amount of Ataxin-3 protein in a cell or animal In certain embodiments, the animal has a neurodegenerative disease. In certain embodiments, the animal has SCA3. In certain embodiments, compounds useful for reducing expression of ATXN3 RNA are oligomeric compounds. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide.
  • the neurodegenerative disease is SCA3.
  • symptoms and hallmarks include ataxia, neuropathy, and aggregate formation.
  • amelioration of these symptoms results in improved motor function, reduced neuropathy, and reduction in number of aggregates.
  • “2’-deoxynucleoside” means a nucleoside comprising a 2’-H(H) deoxyribosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA).
  • a 2’ -deoxy nucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • “2’ -substituted nucleoside” means a nucleoside comprising a 2’ -substituted sugar moiety.
  • “2’-substituted” in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.
  • “5-methyl cytosine” means a cytosine modified with a methyl group attached to the 5-position.
  • a 5-methyl cytosine is a modified nucleobase.
  • administering means providing a pharmaceutical agent to an animal.
  • animal means a human or non-human animal.
  • antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
  • antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • antisense compound means an oligomeric compound capable of achieving at least one antisense activity.
  • “ameliorate” in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment.
  • amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom.
  • the symptom or hallmark is ataxia, neuropathy, and aggregate formation. In certain embodiments, amelioration of these symptoms results in improved motor function, reduced neuropathy, or reduction in number of aggregates.
  • “bicyclic nucleoside” or“BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • “bicyclic sugaf’ or“bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
  • the first ring of the bicyclic sugar moiety is a furanosyl moiety.
  • the bicyclic sugar moiety does not comprise a furanosyl moiety.
  • cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
  • “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
  • Complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
  • Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G).
  • Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • “fully complementary” or“100% complementary” in reference to oligonucleotides means that oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.
  • conjugate group means a group of atoms that is directly or indirectly attached to an oligonucleotide.
  • Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • conjugate moiety means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other.
  • “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.
  • “constrained ethyl” or“cEt” or“cEt modified sugar” means a b-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4’-carbon and the 2’-carbon of the b- D ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH 3 )-0-2', and wherein the methyl group of the bridge is in the S configuration.
  • cEt nucleoside means a nucleoside comprising cEt modified sugar.
  • “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
  • the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
  • chirally controlled in reference to an intemucleoside linkage means chirality at that linkage is enriched for a particular stereochemical configuration.
  • “gapmer” means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the“gap” and the external regions may be referred to as the“wings.”
  • “gapmer” refers to a sugar motif. Unless otherwise indicated, the sugar moieties of the nucleosides of the gap of a gapmer are unmodified 2’-deoxyribosyl.
  • MOE gapmef indicates a gapmer having a sugar motif of 2’ -MOE nucleosides in both wings and a gap of T- deoxynucleosides.
  • a MOE gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
  • hotspot region is a range of nucleobases on a target nucleic acid amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.
  • hybridization means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • intemucleoside linkage is the covalent linkage between adjacent nucleosides in an oligonucleotide.
  • modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
  • Phosphorothioate intemucleoside linkage is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom.
  • linker-nucleoside means a nucleoside that links, either directly or indirectly, an
  • Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
  • “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
  • “mismatch” or“non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.
  • “MOE” means methoxy ethyl.”2’-MOE” or“2’-MOE modified sugar” means a 2’- OCH2CH2OCH3 group in place of the 2’-OH group of a ribosyl sugar moiety.
  • “2’ -MOE nucleoside” means a nucleoside comprising a 2’ -MOE modified sugar.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
  • neurodegenerative disease means a condition marked by progressive loss of structure or function of neurons, including death of neurons.
  • neurodegenerative disease is spinocerebellar ataxia type 3 (SCA3).
  • nucleobase means an unmodified nucleobase or a modified nucleobase.
  • an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G).
  • a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
  • A“5-methyl cytosine” is a modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • “nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
  • nucleoside means a compound comprising a nucleobase and a sugar moiety.
  • the nucleobase and sugar moiety are each, independently, unmodified or modified.
  • modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
  • Modified nucleosides include abasic nucleosides, which lack a nucleobase.“Linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
  • oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
  • A“singled-stranded oligomeric compound” is an unpaired oligomeric compound.
  • the term“oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a“duplexed oligomeric compound.”
  • oligonucleotide means a strand of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein,“modified oligonucleotide” means an
  • oligonucleotide wherein at least one nucleoside or intemucleoside linkage is modified.
  • “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
  • “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.
  • a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.
  • pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • a pharmaceutical composition means a mixture of substances suitable for administering to a subject.
  • a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • phosphorus moiety means a group of atoms comprising a phosphorus atom.
  • a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.
  • prodrug means a therapeutic agent in a form outside the body that is converted to a different form within an animal or cells thereof. Typically, conversion of a prodmg within the animal is facilitated by the action of an enzyme (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
  • an enzyme e.g., endogenous or viral enzyme
  • reducing or inhibiting the amount or activity refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.
  • RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • RNAi compound means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
  • an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid.
  • RNAi compound excludes antisense compounds that act through RNase H.
  • oligonucleotide As used herein,“self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.
  • standard cell assay means the assay described in Example 1 and reasonable variations thereof.
  • stereorandom in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration.
  • the number of molecules having the ( S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the ( R ) configuration of the stereorandom chiral center.
  • the stereochemical configuration of a chiral center is considered random when it is the results of a synthetic method that is not designed to control the stereochemical configuration.
  • a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.
  • “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety.
  • “unmodified sugar moiety” means a 2’-OH(H) ribosyl moiety, as found in RNA (an“unmodified RNA sugar moiety”), or a 2’-H(H) moiety, as found in DNA (an“unmodified DNA sugar moiety”).
  • Unmodified sugar moieties have one hydrogen at each of the G, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position.
  • “modified sugar moiety” or“modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
  • Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.
  • symptom or hallmark means any physical feature or test result that indicates the existence or extent of a disease or disorder.
  • a symptom is apparent to a subject or to a medical professional examining or testing said subject.
  • a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.
  • target nucleic acid and“target RNA” mean a nucleic acid that an antisense compound is designed to affect.
  • target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
  • terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • therapeutically effective amount means an amount of a pharmaceutical agent that provides a therapeutic benefit to an animal.
  • a therapeutically effective amount improves a symptom of a disease.
  • Embodiment 1 An oligomeric compound, comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an ATXN3 nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified intemucleoside linkage.
  • Embodiment 2 An oligomeric compound, comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-2787.
  • Embodiment 3 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases, wherein the portion is complementary to: an equal length portion of nucleobases 138-175 of SEQ ID NO: 1;
  • nucleobases 1120-1146 of SEQ ID NO: 1 an equal length portion of nucleobases 1120-1146 of SEQ ID NO: 1;
  • nucleobases 1823-1882 of SEQ ID NO: 1 an equal length portion of nucleobases 1823-1882 of SEQ ID NO: 1;
  • nucleobases 5997-6021 of SEQ ID NO: 1 an equal length portion of nucleobases 5997-6021 of SEQ ID NO: 1;
  • nucleobases 34440-34486 of SEQ ID NO: 2 an equal length portion of nucleobases 34440-34486 of SEQ ID NO: 2;
  • nucleobases 39883-39904 of SEQ ID NO: 2 an equal length portion of nucleobases 39883-39904 of SEQ ID NO: 2; or
  • Embodiment 4 The oligomeric compound of any one of embodiments 1-3, wherein the ATXN3 nucleic acid has the nucleobase sequence of any of SEQ ID NOs: 1, 2, 3, 4, or 5.
  • Embodiment 5 The oligomeric compound of any one of embodiments 1-4, consisting of a single-stranded modified oligonucleotide.
  • Embodiment 6 The oligomeric compound of any one of embodiments 1-5, wherein at least one intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage.
  • Embodiment 7 The oligomeric compound of embodiment 6, wherein the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 8 The oligomeric compound of any one of embodiments 1-5, wherein each intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage.
  • Embodiment 9 The oligomeric compound of embodiment 8, wherein each modified intemucleoside linkage of the modified oligonucleotide is a phosphorothioate intemucleoside linkage.
  • Embodiment 10 The oligomeric compound of any one of embodiments 1-7, wherein at least one intemucleoside linkage of the modified oligonucleotide is a phosphodiester intemucleoside linkage.
  • Embodiment 11 The oligomeric compound of any one of embodiments 1-7 and 10, wherein each intemucleoside linkage of the modified oligonucleotide is either a phosphodiester intemucleoside linkage or a phosphorothioate intemucleoside linkage.
  • Embodiment 12 The oligomeric compound of any one of embodiments 1-11, wherein at least one nucleobase of the modified oligonucleotide comprises a modified nucleobase.
  • Embodiment 13 The oligomeric compound of embodiment 12, wherein the modified nucleobase is a 5-methyl cytosine.
  • Embodiment 14 The oligomeric compound of any one of embodiments 1-13, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
  • Embodiment 15 The oligomeric compound of embodiment 14, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.
  • Embodiment 16 The oligomeric compound of embodiment 15, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2’-4’ bridge, wherein the 2’-4’ bridge is selected from -0-CH2-; and -0-CH(CH3)-.
  • Embodiment 17 The oligomeric compound of any of embodiments 1-13, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic sugar moiety.
  • Embodiment 18 The oligomeric compound of embodiment 17, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified non-bicyclic sugar moiety comprising a 2’-MOE or 2’-OMe.
  • Embodiment 19 The oligomeric compound of embodiment 18, wherein each modified nucleoside of the modified oligonucleotide comprises a modified non-bicyclic sugar moiety comprising a 2’-MOE or 2’-OMe.
  • Embodiment 20 The oligomeric compound of any of embodiments 1-13, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate.
  • Embodiment 21 The oligomeric compound of embodiment 20, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA.
  • Embodiment 22 The oligomeric compound of any of embodiments 1-18 and 20-21, wherein the modified
  • oligonucleotide is a gapmer.
  • Embodiment 23 The oligomeric compound of any of embodiments 1-18 and 20-21, wherein the modified
  • oligonucleotide has a sugar motif comprising:
  • central region consisting of 6-10 linked central region nucleosides
  • each of the 5’ -region nucleosides and each of the 3’- region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’- deoxyribosyl sugar moiety.
  • Embodiment 24 The oligomeric compound of embodiments 1-7 or 10-23, wherein the modified oligonucleotide consists of 20 linked nucleosides and has the following intemucleoside motif: sooossssssssssooss; wherein,
  • o a phosphodiester intemucleoside linkage.
  • Embodiment 25 The oligomeric compound of any one of embodiments 1-23, wherein the modified oligonucleotide consists of 12-22, 12-20, 14-20, 16-20, 18-20, or 18-22 linked nucleosides.
  • Embodiment 26 The oligomeric compound of any one of embodiments 1-23 and 25, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.
  • Embodiment 27 The oligomeric compound of any of embodiments 1-26 consisting of the modified oligonucleotide.
  • Embodiment 28 The oligomeric compound of any of embodiments 1-26 comprising a conjugate group comprising a conjugate moiety and a conjugate linker.
  • Embodiment 29 The oligomeric compound of embodiment 28, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.
  • Embodiment 30 The oligomeric compound of embodiment 28 or 29, wherein the conjugate linker consists of a single bond.
  • Embodiment 31 The oligomeric compound of embodiment 28, wherein the conjugate linker is cleavable.
  • Embodiment 32 The oligomeric compound of embodiment 28, wherein the conjugate linker comprises 1-3 linker- nucleosides.
  • Embodiment 33 The oligomeric compound of any of embodiments 28-32, wherein the conjugate group is attached to the modified oligonucleotide at the 5’ -end of the modified oligonucleotide.
  • Embodiment 34 The oligomeric compound of any of embodiments 28-32, wherein the conjugate group is attached to the modified oligonucleotide at the 3’ -end of the modified oligonucleotide.
  • Embodiment 35 The oligomeric compound of any of embodiments 1-26 or 28-34 comprising a terminal group.
  • Embodiment 36 The oligomeric compound of any of embodiments 1-35 wherein the oligomeric compound is a singled-stranded oligomeric compound.
  • Embodiment 37 The oligomeric compound of any of embodiments 1-31 or 33-34, wherein the oligomeric compound does not comprise linker-nucleosides.
  • Embodiment 38 An oligomeric duplex comprising an oligomeric compound of any of embodiments 1-35 and 37.
  • Embodiment 39 An antisense compound comprising or consisting of an oligomeric compound of any of embodiments 1-37 or an oligomeric duplex of embodiment 38.
  • Embodiment 40 A modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-2787.
  • Embodiment 41 A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-37, an oligomeric duplex of embodiment 38, an antisense compound of embodiment 39, or a modified oligonucleotide of embodiment 40 and at least one of a pharmaceutically acceptable carrier or diluent.
  • Embodiment 42 The pharmaceutical composition of embodiment 41, wherein the modified oligonucleotide is a sodium salt.
  • Embodiment 43 A method comprising administering to an animal the pharmaceutical composition of any of embodiments 41-42.
  • Embodiment 44 The method of embodiment 43, wherein the animal is a human.
  • Embodiment 45 A method of treating a disease associated with ATXN3 comprising administering to an individual having or at risk for developing a disease associated with ATXN3 a therapeutically effective amount of a pharmaceutical composition of embodiments 41 and 42, and thereby treating the disease associated with ATXN3.
  • Embodiment 46 The method of embodiment 45, wherein the disease associated with ATXN3 is a neurodegenerative disease.
  • Embodiment 47 The method of embodiment 46, wherein the neurodegenerative disease is SCA3.
  • Embodiment 48 The method of embodiment 47, wherein at least one symptom or hallmark of the neurodegenerative disease is ameliorated.
  • Embodiment 49 The method of embodiment 48, wherein the symptom or hallmark is ataxia, neuropathy, and aggregate formation.
  • Embodiment 50 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 51 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 53 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 54 A modified oligonucleotide according to the following chemical structure
  • Embodiment 55 A modified oligonucleotide according to the following chemical structure
  • Embodiment 56 The modified oligonucleotide of any of embodiments 50, 52, or 54, which is a sodium salt of the formula.
  • Embodiment 57 A pharmaceutical composition comprising the modified oligonucleotide of any of embodiments 50-56 and a pharmaceutically acceptable carrier or diluent.
  • Embodiment 58 The pharmaceutical composition of embodiment 57, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid.
  • Embodiment 59 The pharmaceutical composition of embodiment 57, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid.
  • Embodiment 60 A compound comprising a modified oligonucleotide according to the following chemical notation (5’ to 3’): Ges m Ceo Teo m Ceo Aes Tds Tds Tds Ads Tds Tds m Cds Tds m Cds Ads Aeo Geo Tes Aes m Ce (SEQ ID NO: 423), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine
  • G a guanine nucleobase
  • T a thymine nucleobase
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage
  • Embodiment 61 A compound comprising a modified oligonucleotide according to the following chemical notation (5’ to 3’): Ges m Ceo Aeo m Ceo m Ces Ads Tds Ads Tds Ads Tds Ads Tds m Cds Tds m Ceo Aeo Ges Aes Ae (SEQ ID NO: 1226), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine
  • G a guanine nucleobase
  • T a thymine nucleobase
  • o a phosphodiester intemucleoside linkage.
  • Embodiment 62 A compound comprising a modified oligonucleotide according to the following chemical notation (5’ to 3’): Ges Teo Teo Aeo Aes Tds Ads m Cds Tds Tds Tds Tds m Cds m Cds Aeo Geo m Ces m Ces Te (SEQ ID NO: 1673), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine
  • G a guanine nucleobase
  • T a thymine nucleobase
  • o a phosphodiester intemucleoside linkage.
  • Embodiment 63 The compound of any of embodiments 60-62, comprising the modified oligonucleotide covalently linked to a conjugate group.
  • Embodiment 64 The compound of any of embodiment 1-63, wherein at least one intemucleoside linkage of the modified oligonucleotide is chirally controlled.
  • Embodiment 65 The compound of any of embodiments 1-64, wherein at least one intemucleoside linkage of the modified oligonucleotide is stereorandom.
  • Embodiment 66 A pharmaceutical composition comprising the compound of any of embodiments 60-65 and a pharmaceutically acceptable diluent or carrier.
  • Embodiment 67 The pharmaceutical composition of embodiment 66, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid.
  • Embodiment 68 The pharmaceutical composition of embodiment 66, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid.
  • Embodiment 69 A chirally enriched population of modified oligonucleotides of any of embodiments 50-55, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.
  • Embodiment 70 The chirally enriched population of embodiment 69, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (Sp) configuration.
  • Embodiment 71 The chirally enriched population of embodiment 69, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having the (Rp) configuration.
  • Embodiment 72 The chirally enriched population of embodiment 69, wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage
  • Embodiment 73 The chirally enriched population of embodiment 73, wherein the population is enriched for modified oligonucleotides having the (Sp) configuration at each phosphorothioate intemucleoside linkage.
  • Embodiment 74 The chirally enriched population of embodiment 73, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at each phosphorothioate intemucleoside linkage.
  • Embodiment 75 The chirally enriched population of embodiment 73, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate intemucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate intemucleoside linkages.
  • Embodiment 76 The chirally enriched population of embodiment 69 or embodiment 73 wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate intemucleoside linkages in the Sp, Sp, and Rp configurations, in the 5’ to 3’ direction.
  • Embodiment 77 A chirally enriched population of modified oligonucleotides of any of embodiments 50-55, wherein all of the phosphorothioate intemucleoside linkages of the modified oligonucleotide are stereorandom.
  • oligonucleotides which consist of linked nucleosides.
  • Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
  • Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage.
  • Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.
  • modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
  • modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure.
  • Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 4’, and/or 5’ positions.
  • one or more non-bridging substituent of non- bicyclic modified sugar moieties is branched.
  • 2’ -substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-OCH 3 (“OMe” or“O-methyl”), and 2'-0(CH 2 ) 2 0CH 3 (“MOE”).
  • 2’-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O-Ci-Cio alkoxy, O-Ci-Cio substituted alkoxy, O-Ci-Cio alkyl, O-Ci-Cio substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, 0(CF1 2 ) 2 SCF[ 3 , 0(CH 2 ) 2 0N(R m )(
  • these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (N0 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • Examples of 4’ -substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128.
  • Examples of 5’ -substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5’-methyl (R or S), 5'-vinyl, and 5’-methoxy.
  • non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al.,
  • a non-bridging 2’-substituent group selected from: F, OCF 3 OCH 3 , OCH 2 CH 2 OCH 3 , 0(CH 2 ) 2 SCH 3 , 0(CH 2 ) 2 0N(CH 3 ) 2 , 0(CH 2 ) 2 0(CH 2 ) 2 N(CH 3 ) 2 , and 0CH 2 C(
  • a 2’ -substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2’-substituent group selected from: F, OCH 3 , and OCH 2 CH 2 OCH 3 .
  • Certain modifed sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety.
  • the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms.
  • Examples of such 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -0-2' (“LNA”), 4'-CH 2 -S-2', 4'-(CH 2 ) 2 -0-2' (“ENA”), 4'- CH(CH 3 )-0-2' (referred to as“constrained ethyl” or“cEt”), 4’-CH 2 -0-CH 2 -2’, 4’-CH 2 -N(R)-2’, 4'-CH(CH 2 0CH 3 )-0-2' (“constrained MOE” or“cMOE”) and analogs thereof (see, e.g., Seth et al., U.S.
  • each R, R a , and R b is, independently, H, a protecting group, or Ci-Ci 2 alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).
  • x 0, 1, or 2;
  • n 1, 2, 3, or 4;
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an LNA nucleoside (described herein) may be in the a-L configuration or in the b-D configuration.
  • bicyclic nucleosides include both isomeric configurations.
  • positions of specific bicyclic nucleosides e.g., LNA or cEt
  • they are in the b-D configuration, unless otherwise specified.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5’ -substituted and 4’-2’ bridged sugars).
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
  • certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position (see, e.g., Bhat et al., U.S.
  • sugar surrogates comprise rings having other than 5 atoms.
  • a sugar surrogate comprises a six-membered tetrahydropyran (“THP”).
  • THP tetrahydropyran
  • Such tetrahydropyrans may be further modified or substituted.
  • Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:
  • F-HNA see e.g. Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S. 8,796,437; and Swayze et al., U.S. 9,005,906;
  • F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:
  • Bx is a nucleobase moiety
  • T 3 and T 4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T 3 and T 4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T 3 and T is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group;
  • modified THP nucleosides are provided wherein q i. q 2 , q 3 , q 4 , qs. q 6 and q 7 are each H. In certain embodiments, at least one of qi, q 2 , q 3 , q 4 , qs, q 6 and q 7 is other than H. In certain embodiments, at least one of qi, q 2 , q 3 , q 4 , qs, q 6 and q 7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R 2 is F. In certain embodiments, Ri is F and R 2 is H, in certain embodiments, Ri is methoxy and R 2 is H, and in certain embodiments, Ri is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et ah, U.S. 5,698,685; Summerton et ah, U.S. 5, 166,315; Summerton et ah, U.S. 5,185,444; and Summerton et ah, U.S. 5,034,506).
  • the term“morpholino” means a sugar surrogate having the following structure:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are refered to herein as“modifed morpholinos.”
  • sugar surrogates comprise acyclic moieites.
  • nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et ah, Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
  • modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
  • modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines.
  • modified nucleobases are selected from: 2-aminopropyladenine, 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-CoC-CH 3 ) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5- ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7
  • nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, 1,3- diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2-one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza- adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in Merigan et al, U.S.
  • nucleosides of modified oligonucleotides may be linked together using any intemucleoside linkage.
  • the two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphoms atom.
  • Modified intemucleoside linkages compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
  • intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous- containing intemucleoside linkages are well known to those skilled in the art.
  • Representative intemucleoside linkages having a chiral center include but are not limited to
  • Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations.
  • populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom.
  • modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular, independently selected stereochemical configuration.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population.
  • modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al, JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (.S'p) configuration.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration.
  • modified oligonucleotides comprising (Rp) and/or (S'p) phosphorothioates comprise one or more of the following formulas, respectively, wherein“B” indicates a nucleobase:
  • chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research, Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
  • modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety.
  • modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase.
  • modified oligonucleotides comprise one or more modified intemucleoside linkage.
  • the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif.
  • the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another.
  • a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
  • oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif.
  • sugar motifs include but are not limited to any of the sugar modifications discussed herein.
  • modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or“wings” and a central or internal region or“gap.”
  • the three regions of a gapmer motif (the 5’-wing, the gap, and the 3’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
  • the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
  • the sugar moieties within the gap are the same as one another.
  • the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
  • the sugar motifs of the two wings are the same as one another (symmetric gapmer).
  • the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).
  • the wings of a gapmer comprise 1-5 nucleosides.
  • each nucleoside of each wing of a gapmer is a modified nucleoside.
  • each nucleoside of each wing of a gapmer is a modified nucleoside.
  • at least one nucleoside of each wing of a gapmer is a modified nucleoside.
  • at least two nucleosides of each wing of a gapmer are modified nucleosides.
  • at least three nucleosides of each wing of a gapmer are modified nucleosides.
  • at least four nucleosides of each wing of a gapmer are modified nucleosides.
  • the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer is an unmodified 2’-deoxy nucleoside.
  • the gapmer is a deoxy gapmer.
  • the nucleosides on the gap side of each wing/gap junction are unmodified 2’-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides.
  • each nucleoside of the gap is an unmodified 2’ -deoxy nucleoside.
  • each nucleoside of each wing of a gapmer is a modified nucleoside.
  • modified oligonucleotides comprise or consist of a region having a fully modified sugar motif.
  • each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety.
  • each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
  • modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
  • a fully modified oligonucleotide is a uniformly modified oligonucleotide.
  • each nucleoside of a uniformly modified comprises the same 2’ -modification.
  • the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5’-wing] - [# of nucleosides in the gap] - [# of nucleosides in the 3’-wing]
  • a 5- 10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap.
  • that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise unmodified deoxynucleosides sugars.
  • a 5-10-5 MOE gapmer consists of 5 linked MOE modified nucleosides in the 5’-wing, 10 linked deoxynucleosides in the gap, and 5 linked MOE nucleosides in the 3’ -wing.
  • modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers.
  • oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each nucleobase is modified.
  • none of the nucleobases are modified.
  • each purine or each pyrimidine is modified.
  • each adenine is modified.
  • each guanine is modified.
  • each thymine is modified.
  • each uracil is modified.
  • each cytosine is modified.
  • cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
  • modified oligonucleotides comprise a block of modified nucleobases.
  • the block is at the 3’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5’-end of the oligonucleotide.
  • oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
  • one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
  • the sugar moiety of said nucleoside is a 2’- deoxyribosyl moiety.
  • the modified nucleobase is selected from: a 2-thiopyrimidine and a 5- propynepyrimidine.
  • oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each intemucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage and phosphodiester intemucleoside linkage.
  • each phosphorothioate intemucleoside linkage is independently selected from a stereorandom phosphorothioate a (.S'p) phosphorothioate, and a (/(p) phosphorothioate.
  • the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified.
  • the intemucleoside linkages in the wings are unmodified phosphodiester intemucleoside linkages.
  • the terminal intemucleoside linkages are modified.
  • the sugar motif of a modified oligonucleotide is a gapmer, and the intemucleoside linkage motif comprises at least one phosphodiester intemucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal intemucleoside linkage, and the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages.
  • all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (.S'p) phosphorothioates, and the gap comprises at least one .S'p. .S'p. /(p motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such intemucleoside linkage motifs.
  • oligonucleotide it is possible to increase or decrease the length of an oligonucleotide without eliminating activity.
  • Woolf et al. Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992
  • a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches.
  • target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
  • oligonucleotides can have any of a variety of ranges of lengths.
  • oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
  • X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
  • oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to
  • each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
  • the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif.
  • sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
  • Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for b-D ribosyl sugar moieties, and all of the phosphorothioate intemucleoside linkages are stereorandom.
  • the modified oligonucleotides of a chirally enriched population are enriched for both b-D ribosyl sugar moieties and at least one, particular phosphorothioate intemucleoside linkage in a particular stereochemical configuration.
  • oligonucleotides are further described by their nucleobase sequence.
  • oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
  • the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
  • oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
  • Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups.
  • conjugate groups or terminal groups are attached at the 3’ and/or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’-end of oligonucleotides.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • oligonucleotides are covalently attached to one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
  • conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
  • conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et ak, Proc. Natl. Acad. Sci.
  • Acids Res., 1992, 20, 533- 538 an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO ./., 1991, 10, 1111- 1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac -glycerol or triethyl-ammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 3(5, 3651-3654; Shea et al., Nucl.
  • a phospholipid e.g., di-hexadecyl
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino- carbonyl-oxycholesterol moiety (Crooke et al., ./. Pharmacol. Exp.
  • Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
  • a conjugate moiety comprises an active drag substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (,S')-(+)-pranoprofcn.
  • an active drag substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (,S')-(+)-pranoprofcn.
  • carprofen dansylsarcosine, 2,3,5- triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drag, an antidiabetic, an antibacterial or an antibiotic.
  • Conjugate moieties are attached to oligonucleotides through conjugate linkers.
  • the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
  • the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
  • a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
  • conjugate linkers are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein.
  • a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
  • bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
  • conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxy late (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • ADO 8-amino-3,6-dioxaoctanoic acid
  • SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxy late
  • AHEX or AHA 6-aminohexanoic acid
  • conjugate linkers include but are not limited to substituted or unsubstituted Ci-Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
  • conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker- nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker- nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
  • a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N- benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N- isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
  • linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
  • an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
  • the total number of contiguous linked nucleosides in such an oligomeric compound is more than 30.
  • an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
  • conjugate linkers comprise no more than 10 linker-nucleosides.
  • conjugate linkers comprise no more than 5 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
  • a conjugate group it is desirable for a conjugate group to be cleaved from the oligonucleotide.
  • oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
  • certain conjugate linkers may comprise one or more cleavable moieties.
  • a cleavable moiety is a cleavable bond.
  • a cleavable moiety is a group of atoms comprising at least one cleavable bond.
  • a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
  • a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
  • a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • a cleavable moiety comprises or consists of one or more linker-nucleosides.
  • the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
  • such cleavable bonds are unmodified phosphodiester bonds.
  • a cleavable moiety is 2'-deoxy nucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphate intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage.
  • the cleavable moiety is 2'-deoxyadenosine.
  • oligomeric compounds comprise one or more terminal groups.
  • oligomeric compounds comprise a stabilized 5’-phophate.
  • Stabilized 5’-phosphates include, but are not limited to 5’-phosphanates, including, but not limited to 5’-vinylphosphonates.
  • terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides.
  • terminal groups comprise one or more 2’-linked nucleosides. In certain such embodiments, the 2’-linked nucleoside is an abasic nucleoside.
  • oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid.
  • an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex.
  • Such oligomeric duplexes comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound.
  • the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group.
  • Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group.
  • the oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.
  • oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds.
  • antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid.
  • Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
  • hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
  • certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA.
  • described herein are antisense compounds that are sufficiently“DNA-like” to elicit RNase H activity.
  • one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
  • an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
  • RISC RNA-induced silencing complex
  • certain antisense compounds result in cleavage of the target nucleic acid by Argonaute.
  • Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).
  • hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
  • Antisense activities may be observed directly or indirectly.
  • observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid.
  • the target nucleic acid is an endogenous RNA molecule.
  • the target nucleic acid encodes a protein.
  • the target nucleic acid is selected from: a mature RNA and a pre-mRNA, including intronic, exonic and untranslated regions.
  • the target RNA is a mature mRNA.
  • the target nucleic acid is a pre- mRNA.
  • the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction.
  • the target region is at least 50% within an intron.
  • the target nucleic acid is the RNA transcriptional product of a retrogene.
  • the target nucleic acid is a non-coding RNA.
  • the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.
  • Gautschi et al J. Natl. Cancer Inst. 93:463-471, March 2001
  • this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res.
  • oligonucleotides that are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80%
  • oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.
  • oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
  • antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
  • selectivity of the oligonucleotide is improved.
  • the mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
  • the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region.
  • the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3’-end of the gap region.
  • the mismatch is at position 1, 2, 3, or 4 from the 5’-end of the wing region.
  • the mismatch is at position 4, 3, 2, or 1 from the 3’-end of the wing region.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is ATXN3.
  • ATXN3 nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No: NM 004993.5); SEQ ID NO: 2 (the complement of GENBANK Accession No NC 000014.9 truncated from nucleotides 92,056,001 to 92,110,000); SEQ ID NO: 3 (GENBANK Accession No: NM 001164781.1); SEQ ID NO: 4 (GENBANK Accession No: NM 001127697.2); and SEQ ID NO: 5 (ensemble transcript No: ENST00000558190.5).
  • contacting a cell with an oligomeric compound complementary to any of SEQ ID NOs: 1-5 reduces the amount of ATXN3 RNA, and in certain embodiments reduces the amount of Ataxin-3 protein.
  • the oligomeric compound consists of a modified oligonucleotide.
  • contacting a cell in an animal with an oligomeric compound complementary to any of SEQ ID NOs: 1-5 ameliorate one or more symptom or hallmark of a neurodegenerative disease.
  • the symptom or hallmark is ataxia, neuropathy, and aggregate formation.
  • contacting a cell in an animal with an oligonucleotide complementary to any of SEQ ID Nos: 1-5 results in improved motor function, reduced neuropathy, and/or reduction in number of aggregates.
  • the oligomeric compound consists of a modified oligonucleotide.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue.
  • the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system (CNS), including spinal cord, cortex, cerebellum, brain stem, and pons.
  • compositions comprising one or more oligomeric compounds.
  • the one or more oligomeric compounds each consists of a modified
  • the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
  • a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound.
  • the sterile saline is pharmaceutical grade saline.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water.
  • the sterile water is pharmaceutical grade water.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate- buffered saline (PBS).
  • the sterile PBS is pharmaceutical grade PBS.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid.
  • the artificial cerebrospinal fluid is pharmaceutical grade.
  • a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
  • compositions comprise one or more oligomeric compound and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone .
  • oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters.
  • pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
  • Lipid moieties have been used in nucleic acid therapies in a variety of methods.
  • the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
  • DNA complexes with mono- or poly -cationic lipids are formed without the presence of a neutral lipid.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
  • compositions comprise a delivery system.
  • delivery systems include, but are not limited to, liposomes and emulsions.
  • Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
  • certain organic solvents such as dimethylsulfoxide are used.
  • compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types.
  • pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
  • compositions comprise a co-solvent system.
  • co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • co-solvent systems are used for hydrophobic compounds.
  • a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
  • the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
  • co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or
  • compositions are prepared for oral administration.
  • pharmaceutical compositions are prepared for buccal administration.
  • a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.).
  • a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
  • Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • Aqueous injection suspensions may contain.
  • certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, in ionized (anion) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion, and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain
  • oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium.
  • the term“oligonucleotide” is intended to include all such forms.
  • Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms.
  • a structure depicting the free acid of a compound followed by the term“or salts thereof’ expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.
  • modified oligonucleotides are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides are in PBS. In certain embodiments, modified oligonucleotides are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH.
  • Compound No. 1100673 is characterized as a 5-10-5 MOE gapmer having a sequence of (from 5’ to 3’) GCTCATTTATTCTCAAGTAC (SEQ ID NO: 423), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) comprise a 2’-MOE sugar moiety and each of nucleosides 6-15 are 2 -b-D-dcoxy nucleosides wherein the intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages and the intemucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, and wherein each cytosine is a 5-methyl cytosine
  • Compound No. 1100673 is represented by the following chemical notation (5’ to 3’): Ges m Ceo Teo m Ceo Aes Tds Tds Tds Ads Tds Tds m Cds Tds m Cds Ads Aeo Geo Tes Aes m Ce (SEQ ID NO: 423), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine
  • G a guanine nucleobase
  • T a thymine nucleobase
  • o a phosphodiester intemucleoside linkage.
  • Compound No. 1100673 is represented by the following chemical structure:
  • composition 1 Compound No. 1100673
  • the sodium salt of Compound No. 1100673 is represented by the following chemical structure:
  • Compound No. 1101657 is characterized as a 5-10-5 MOE gapmer having a sequence of (from 5’ to 3’) GCACCATATATATCTCAGAA (SEQ ID NO: 1226), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) comprise a 2’-MOE sugar moiety and each of nucleosides 6-15 are 2 ‘ -[l-D-dcoxy nucleosides (from 5’ to 3’), wherein the intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages (from 5’ to 3’) and the intemucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages
  • Compound No. 1101657 is represented by the following chemical notation (5’ to 3’): Ges m Ceo Aeo m Ceo m Ces Ads Tds Ads Tds Ads Tds Ads Tds m Cds Tds m Ceo Aeo Ges Aes Ae (SEQ ID NO: 1226), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine
  • G a guanine nucleobase
  • T a thymine nucleobase
  • d a 2 -(i-D deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage.
  • Compound No. 1101657 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1101657 is represented by the following chemical structure:
  • Compound No. 1102130 is characterized as a 5-10-5 MOE gapmer having a sequence of (from 5’ to 3’) GTTAATACTTTTTCCAGCCT (SEQ ID NO: 1673), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) comprise a 2’-MOE sugar moiety and each of nucleosides 6-15 are 2 ‘ -[l-D-dcoxy nucleosides (from 5’ to 3’), wherein the intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester intemucleoside linkages (from 5’ to 3’) and the intemucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages
  • Compound No. 1102130 is represented by the following chemical notation (5’ to 3’): Ges Teo Teo Aeo Aes Tds Ads m Cds Tds Tds Tds Tds m Cds m Cds Aeo Geo m Ces m Ces Te (SEQ ID NO: 1673), wherein,
  • A an adenine nucleobase
  • mC a 5-methyl cytosine
  • G a guanine nucleobase
  • T a thymine nucleobase
  • o a phosphodiester intemucleoside linkage.
  • Compound No. 1102130 is represented by the following chemical structure:
  • the sodium salt of Compound No. 1102130 is represented by the following chemical structure:
  • Compound No. 650528 which has been described in Moore, et al, Mol. Ther. Nucleic Acids, 2017, 7:200-210 (Moore, 2017) (“ASO-5”), WO 2018/089805, and McLoughlin et al., Ann. Neurol., 2018, 84:64-77 (McLoughlin, 2018) (each of which are incorporated herein by reference) was used as a comparator compound.
  • Compound No. 650528 is a 5-8-5 MOE gapmer, having a sequence (from 5’ to 3’)
  • each cytosine is a 5’-methylcytosine
  • each intemucleoside linkage is either a phosphodiester intemucleoside linkage or a phosphorothioate intemucleoside linkage and the intemucleoside linkage motif is sooosssssssooss, wherein‘s’ represents a phosphorothioate intemucleoside linkage and‘o’ represents a phosphodiester intemucleoside linkage, and wherein each of nucleosides 1-5 and 14-18 comprise a 2’-MOE sugar moiety.
  • Compound No. 650668 which has been described in Moore, 2017 (”ASO-2”), WO 2018/089805, and McLoughlin, 2018 was used as a comparator compound.
  • Compound No. 650668 is a 5-8-5 MOE gapmer, having a sequence (from 5’ to 3’) AGCCATTAATCTATACTG (SEQ ID NO: 2792), wherein each cytosine is a 5’-methylcytosine, each intemucleoside linkage is either a phosphodiester intemucleoside linkage or a
  • phosphorothioate intemucleoside linkage and the intemucleoside linkage motif is sooosssssssooss, wherein‘s’ represents a phosphorothioate intemucleoside linkage and‘o’ represents a phosphodiester intemucleoside linkage, and wherein each of nucleosides 1-5 and 14-18 comprise a 2’-MOE sugar moiety.
  • Compound No. 650528 and Compound No. 650668 were selected as comparator compounds because according to Moore, 2017 these compounds were“top ASO candidates” that were effective and tolerable. See, e.g., page 206, column 2, paragraph 1. In a follow up manuscript, Compound No. 650528 was further characterized as“ ...the best ASO candidate ... [f]rom this short-term safety and efficacy study...” See, McLoughlin, 2018.
  • Compound No. 1244463 (“SH06”), which has been described in WO2013/138353 (incorporated by reference) is a comparator compound.
  • Compound No. 1244463 is a 3-9-3 LNA gapmer, having a sequence (from 5’ to 3’) ATAGGTCCCGCTGCT (SEQ ID NO: 2793), and wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Compound No. 1244464 (“SH10”), which has been described in WO2013/138353 is a comparator compound.
  • Compound No. 1244464 is a 3-10-3 LNA gapmer, having a sequence (from 5’ to 3’)
  • each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Compound No. 1244465 (“SH13”), which has been described in WO2013/138353 is a comparator compound.
  • Compound No. 1244465 is a 3-10-3 LNA gapmer, having a sequence (from 5’ to 3’)
  • each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Compound No. 1244466 (“SH16”), which has been described in WO2013/138353 is a comparator compound.
  • Compound No. 1244466 is a 3-9-3 LNA gapmer, having a sequence (from 5’ to 3’)
  • each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Compound No. 1244467 (“SH20”), which has been described in WO2013/138353 is a comparator compound.
  • Compound No. 1244467 is a 2-9-3 LNA gapmer, having a sequence (from 5’ to 3’)
  • each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Compound No. 1244463, Compound No. 1244464, Compound No. 1244465, Compound No. 1244466, and Compound No. 1244467 were selected as comparator compounds because according to Example 2 of WO2013/138353 these compounds were selected for further study. Accordingly, these compounds were tested in further studies.
  • compounds described herein are superior relative to compounds described in Moore, 2017, WO 2018/089805, and WO2013/138353 because they demonstrate one or more improved properties, such as, potency and tolerability.
  • certain compounds Compound No. 1100673, Compound No. 1101657, and Compound No. 1102130 are more efficacious and potent than comparator compounds in vivo. See, e.g., Examples 4, 6, and 9, hereinbelow.
  • certain compounds Compound No. 1100673, Compound No. 1101657, and Compound No. 1102130 achieved an average expression level (% control) of 13%, 23%, and 27%, respectively, in spinal cord of transgenic mice whereas comparator compound, Compound No. 650528 (“ASO-5”) achieved an average expression level (% control) of 32% in spinal cord of transgenic mice.
  • comparator compound, Compound No. 650528 (“ASO-5”) achieved an average expression level (% control) of 32% in spinal cord of transgenic mice.
  • Compound No. 1101657, and Compound No. 1102130 achieved an average expression level (% control) of 13%, 23%, and 42%, respectively, in cortex of transgenic mice whereas comparator compound, Compound No. 650528 (“ASO-5”) achieved an average expression level (% control) of 43% in cortex of transgenic mice.
  • comparator compound, Compound No. 650528 (“ASO-5”) achieved an average expression level (% control) of 43% in cortex of transgenic mice.
  • certain compounds Compound No. 1100673, Compound No. 1101657, and Compound No. 1102130 achieved an average expression level (% control) of 60%, 62%, and 68%, respectively, in cerebellum of transgenic mice whereas comparator compound, Compound No. 650528 (“ASO-5”) achieved an average expression level (% control) of 75% in cerebellum of transgenic mice.
  • Compound No. 650528 (“ASO-5”) in every tissue tested in this assay.
  • nucleobases 138-175 of SEQ ID NO: 1 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 138-175 of SEQ ID NO: 1.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified
  • oligonucleotides are gapmers.
  • the gapmers are MOE gapmers.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • nucleobase sequences of SEQ ID Nos: 1060, 1061, 1062, 1063, 1064, and 1065 are complementary to nucleobases 138-175 of SEQ ID NO: 1.
  • modified oligonucleotides complementary to nucleobases 138-175 of SEQ ID NO: 1 achieve at least 79% reduction of ATXN3 RNA in vitro in the standard cell assay.
  • nucleobases 392-436 of SEQ ID NO: 1 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 392-436 of SEQ ID NO: 1.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length.
  • oligonucleotides are gapmers.
  • the gapmers are MOE gapmers.
  • the nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages and
  • nucleobase sequences of SEQ ID Nos: 196, 197, 198 ,199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209 are complementary to nucleobases 392-436 of SEQ ID NO 1.
  • modified oligonucleotides complementary to nucleobases 392-436 of SEQ ID NO: 1 achieve an average of 77% reduction of ATXN3 RNA in vitro in the standard cell assay.
  • nucleobases 1120-1146 of SEQ ID NO: 1 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 1120-1146 of SEQ ID NO: 1.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length.
  • oligonucleotides are gapmers.
  • the gapmers are MOE gapmers.
  • the nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages and
  • nucleobase sequences of SEQ ID Nos: 313, 314, 315, 316, and 317 are complementary to nucleobases 1120-1146 of SEQ ID NO: 1.
  • modified oligonucleotides complementary to nucleobases 1120-1146 of SEQ ID NO: 1 achieve at least 60% reduction of ATXN3 RNA in vitro in the standard cell assay.
  • nucleobases 1823-1882 of SEQ ID NO: 1 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 1823-1882 of SEQ ID NO: 1.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length.
  • oligonucleotides are gapmers.
  • the gapmers are MOE gapmers.
  • the nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages and
  • nucleobase sequences of SEQ ID Nos: 413-423 are complementary to nucleobases 1823-1882 of SEQ ID Nos: 413-423.
  • modified oligonucleotides complementary to nucleobases 1823-1882 of SEQ ID NO: 1 achieve at least 60% reduction of ATXN3 RNA in vitro in the standard cell assay.
  • nucleobases 3042-3098 of SEQ ID NO: 1 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 3042-3098 of SEQ ID NO: 1.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified
  • oligonucleotides are gapmers.
  • the gapmers are MOE.
  • the nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • nucleobase sequences of SEQ ID Nos:43, 44, 45, and 635-653 are complementary to nucleobases 3042- 3098 of SEQ ID NO: 1.
  • modified oligonucleotides complementary to nucleobases 3042-3098 of SEQ ID NO: 1 achieve at least 64% reduction of ATXN3 RNA in vitro in the standard cell assay.
  • nucleobases 3749-3801 of SEQ ID NO: 1 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 3749-3801 of SEQ ID NO: 1.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length.
  • oligonucleotides are gapmers.
  • the gapmers are MOE gapmers.
  • the nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages and
  • nucleobase sequences of SEQ ID Nos: 719-732 are complementary to nucleobases 3749-3801 of SEQ ID Nos: 719-732.
  • modified oligonucleotides complementary to nucleobases 3749-3801 of SEQ ID NO: 1 achieve at least 52% reduction of ATXN3 RNA in vitro in the standard cell assay.
  • nucleobases 5997-6021 of SEQ ID NO: 1 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 5997-6021 of SEQ ID NO: 1.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length.
  • oligonucleotides are gapmers.
  • the gapmers are MOE gapmers.
  • the nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages and
  • nucleobase sequences of SEQ ID Nos: 920-924 are complementary to nucleobases 5997-6021 of SEQ ID Nos: 920-924.
  • modified oligonucleotides complementary to nucleobases 5997-6021 of SEQ ID NO: 2 achieve at least 75% reduction of ATXN3 RNA in vitro in the standard cell assay.
  • nucleobases 19437-19476 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 19437-19476 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length.
  • oligonucleotides are gapmers.
  • the gapmers are MOE.
  • the nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • nucleobase sequences of SEQ ID Nos: 1671, 1672, 1673, and 1674 are complementary to nucleobases 19437-19476 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to nucleobases 19437-19476 of SEQ ID NO: 2 achieve at least 83% reduction of ATXN3 RNA in vitro in the standard cell assay.
  • nucleobases 34440-34486 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 34440-34486 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are gapmers.
  • the gapmers are MOE gapmers.
  • nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages and
  • nucleobase sequences of SEQ ID Nos: 2233, 2234, 2235, 2236, and 2237 are complementary to nucleobases 34440-34486 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to nucleobases 34440-34486 of SEQ ID NO: 2 achieve at least 71% reduction of ATXN3 RNA in vitro in the standard cell assay.
  • nucleobases 39883-39904 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 39860-39904 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length.
  • oligonucleotides are gapmers.
  • the gapmers are MOE.
  • the nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • nucleobase sequences of SEQ ID Nos: 2510, 2511, and 2512 are complementary to nucleobases 39883- 39904 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to nucleobases 39883-39904 of SEQ ID NO: 2 achieve at least 89% reduction of ATXN3 RNA in vitro in the standard cell assay.
  • nucleobases 6597-6618 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to nucleobases 6597-6618 of SEQ ID NO: 2.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified
  • oligonucleotides are gapmers.
  • the gapmers are MOE.
  • the nucleosides of the modified oligonucleotides are linked by phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • nucleobase sequences of SEQ ID Nos: 1226, 1227, and 1228 are complementary to nucleobases 6597-6618 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to nucleobases 6597-6618 of SEQ ID NO: 2 achieve at least 75% reduction of ATXN3 RNA in vitro in the standard cell assay.
  • accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.
  • sequence listing accompanying this filing identifies each sequence as either“RNA” or“DNA” as required, in reality, those sequences may be modified with any combination of chemical
  • RNA RNA having a modified sugar moiety and a thymine base
  • RNA having a modified base thymine (methylated uracil) in place of a uracil of RNA
  • nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound having the nucleobase sequence“ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence“AUCGAUCG” and those having some DNA bases and some RNA bases such as“AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.
  • Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as ( R ) or ( S ), as a or b such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
  • Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
  • Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
  • tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.
  • the compounds described herein include variations in which one or more atoms are replaced with a nonradioactive isotope or radioactive isotope of the indicated element.
  • compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 3 ⁇ 4 hydrogen atoms.
  • Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of ⁇ . 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 0 or 18 0 in place of 16 0, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
  • non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
  • radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
  • Modified oligonucleotides complementary to a human ATXN3 nucleic acid were designed and tested for their effect on ATXN3 RNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had similar culture conditions.
  • Human primer probe set RTS38920 forward sequence CTATCAGGACAGAGTTCACATCC, designated herein as SEQ ID NO: 6; reverse sequence GTTTCTAAAGACATGGTCACAGC, designated herein as SEQ ID NO: 7; probe sequence AAAGGCCAGCCACCAGTTCAGG, designated herein as SEQ ID: 8) was used to measure RNA levels.
  • ATXN3 RNA levels were adjusted according to total RNA content, as measured by RiboGreen®. Results are presented in the table below as percent ATXN3 RNA levels relative to untreated control cells.
  • the modified oligonucleotides marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of oligonucleotides targeting the amplicon region.
  • the modified oligonucleotides in the tables below are 5-10-5 MOE gapmers.
  • the gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and is flanked by wing segments on both the 5’ end and on the 3’ end comprising five 2’ -MOE nucleosides each.
  • the sugar motif for the gapmers is (from 5’ to 3’): eeeeeddddddddddddeeeee; wherein‘d’ represents a 2’-deoxyribose sugar and‘e’ represents a 2’-MOE modified sugar. All cytosine residues throughout each gapmer are 5-methyl cytosines.
  • the intemucleoside linkages are mixed phosphodiester and phosphorothioate linkages.
  • the intemucleoside linkage motif for the gapmers is (from 5’ to 3’): sooosssssssssooss; wherein‘o’ represents a phosphodiester intemucleoside linkage and‘s’ represents a
  • “Start Site” indicates the 5’-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence.
  • “Stop Site” indicates the 3’ -most nucleoside to which the gapmer is complementary in the human nucleic acid sequence.
  • modified oligonucleotide listed in the tables below is complementary to human ATXN3 nucleic acid sequences SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, or SEQ ID No: 5, as indicated.‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular nucleic acid sequence with 100%
  • modified oligonucleotides complementary to human ATXN3 reduced the amount of human ATXN3 RNA.
  • Modified oligonucleotides selected from the examples above were tested at various doses in A431 cells by free uptake.
  • Compound No. 650528 described in WO 2018/089805, was also tested.
  • Compound No. 650528 is a 5-8-5 MOE gapmer, having a sequence (from 5’ to 3’) GCATCTTTTCATACTGGC (incorporated herein as SEQ ID NO: 2788), wherein each cytosine is a 5-methyl cytosine, each intemucleoside linkage is either a phosphodiester intemucleoside linkage or a phosphorothioate intemucleoside linkage and the intemucleoside linkage motif is sooosssssssooss, where‘s’ represents a phosphorothioate intemucleoside linkage and‘o’ represents a phosphodiester intemucleoside linkage, and each of nucleosides 1-5 and 14-18 comprise a 2
  • RNA samples were plated at a density of 10,000 cells per well with 109.4 nM, 437.5 nM, 1,750.0 nM, and 7,000.0 nM concentrations of modified oligonucleotide, as specified in the tables below.
  • total RNA was isolated from the cells and ATXN3 RNA levels were measured by RT-qPCR.
  • Human ATXN3 primer probe set RTS38920 (described hereinabove in Example 1) was used to measure RNA levels.
  • ATXN3 RNA levels were adjusted according to total RNA content, as measured by RiboGreen®. Results are presented in the table below as percent ATXN3 RNA levels relative to untreated control cells.
  • IC 50 was calculated using the “log(inhibitor) vs. response - variable slope (4 parameters)” formula using Prism6 software.
  • Example 3 Tolerability of modified oligonucleotides complementary to human ATXN3 in wild-type mice
  • Modified oligonucleotides described above were tested in wild-type female C57/B16 mice to assess the tolerability of the oligonucleotides.
  • Wild-type female C57/B16 mice each received a single ICV dose of 700 pg of modified oligonucleotide listed in the table below.
  • Each treatment group consisted of 2 mice.
  • a group of 2 mice received PBS as a negative control.
  • mice were evaluated according to 7 different criteria.
  • the criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli; (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to tail pinching; (7) regular breathing.
  • a mouse was given a subscore of 0 if it met the criteria and 1 if it did not (the functional observational battery score or FOB score). After all 7 criteria were evaluated, the scores were summed for each mouse and averaged within each treatment group. The results are presented in the table below. Table 8
  • Example 4 Activity of modified oligonucleotides complementary to human ATXN3 in transgenic mice
  • RNAi Modified oligonucleotides described above were tested in the ATXN3 YAC transgenic mouse model which contains the full-length human ATXN3 disease gene harboring an expanded CAG repeat (CAGxi. Q84).
  • the hemizygous SCA3-Q84.2 mice are designated as wt/Q84 and were described in Costa Mdo C., et al., Toward RNAi
  • mice were divided into groups of 3 mice each. Mice in each group were given a single ICV bolus of oligonucleotide at a dose of 300 pg and sacrificed two weeks later. A group of 4-6 mice was injected with PBS and served as the control group to which oligonucleotide-treated groups were compared.
  • mice were sacrificed and RNA was extracted from brain tissue for real-time PCR analysis of measurement of RNA expression of ATXN3 using primer probe set RTS39540 (forward sequence CCTTCTTCCTGCGCCTTATT, designated herein as SEQ ID NO: 12; reverse sequence TCATGGTGGGTACGTATGTTTAG, designated herein as SEQ ID NO: 13; probe sequence AGTATGCAGGCAAGTCTCCTTCTGT, designated herein as SEQ ID NO: 14). Results are presented as percent change of RNA, relative to PBS control, normalized with cyclophilin A. As shown in the tables below, human ATXN3 RNA was reduced in various tissues.
  • Example 5 Tolerability of modified oligonucleotides complementary to human ATXN3 in wild-type mice
  • Modified oligonucleotides described above were tested in wild-type female C57/B16 mice to assess the tolerability of the oligonucleotides.
  • Wild-type female C57/B16 mice each received a single ICV dose of 700 pg of modified oligonucleotide listed in the table below.
  • Each treatment group consisted of 4 mice.
  • a group of 3-4 mice received PBS as a negative control.
  • 1244463 (a 3-9-3 LNA gapmer with uniform PS intemucleoside linkages complementary to human ATXN3); Compound No. 1244464 (a 3-10-3 LNA gapmer with uniform PS intemucleoside linkages complementary to human ATXN3); Compound No. 1244465 (a 3-10- 3 LNA gapmer with uniform PS intemucleoside linkages complementary to human ATXN3); Compound No. 1244466 (a 3-9-3 LNA gapmer with uniform PS intemucleoside linkages complementary to human ATXN3); and Compound No. 1244467 (a 2-9-3 LNA gapmer with uniform PS intemucleoside linkages complementary to human ATXN3), described in WO2013/138353 were tested.
  • mice were evaluated according to 7 different criteria.
  • the criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli; (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to tail pinching; (7) regular breathing.
  • a mouse was given a subscore of 0 if it met the criteria and 1 if it did not (the functional observational battery score or FOB score). After all 7 criteria were evaluated, the scores were summed for each mouse and averaged within each treatment group. The results are presented in the table below. Table 19
  • Example 6 Activity of modified oligonucleotides complementary to human ATXN3 RNA in transgenic mice
  • oligonucleotides were tested in the ATXN3 YAC transgenic mouse model which contains the full- length human ATXN3 disease gene harboring an expanded CAG repeat (C’AGsi. Q84).
  • the hemizygous SCA3-Q84.2 mice are designated as wt/Q84 and were described in Costa Mdo C., et al, Toward RNAi Therapy for the Polyglutamine Disease Machado-Joseph Disease. Mol Ther, 2013. 21 (10): 1898-908.
  • mice were divided into groups of 2-3 mice each. Mice in each group were given a single ICV bolus of oligonucleotide at a dose of 300 pg and sacrificed two weeks later. A group of 2 to 5 mice was injected with PBS and served as the control group to which oligonucleotide-treated groups were compared. After two weeks, mice were sacrificed, and RNA was extracted from various regions of the central nervous system. ATXN3 RNA levels were measured by quantitative real-time RTPCR using human primer probe set RTS43981 (forward sequence TGACACAGACATCAGGTACAAATC, designated herein as SEQ ID NO: 2798; reverse sequence
  • TGCTGCTGTTGCTGCTT designated herein as SEQ ID NO: 2799; probe sequence
  • AGCTTCGGAAGAGACGAGAAGCCTA designated herein as SEQ ID NO: 2800. Results are presented as percent change of RNA, relative to PBS control, normalized to mouse cyclophilin A measured using mouse primer probe set m_cyclo24 (forward sequence TCGCCGCTTGCTGCA, designated herein as SEQ ID NO: 2801; reverse sequence ATCGGCCGTGATGTCGA, designated herein as SEQ ID NO: 2802; probe sequence
  • Example 7 Effect of 5-10-5 MOE gapmers with mixed internucleoside linkages on human ATXN3 in vitro, multiple doses
  • Modified oligonucleotides selected from the examples above were tested at various doses in A431 cells by free uptake. Also tested was comparator Compound No. 650528, a 5-8-5 MOE gapmer with mixed PO/PS intemucleoside linkages complementary to human ATXN3, described hereinabove and in WO 2018/089805.
  • RNA samples were plated at a density of 10,000 cells per well, and treated with 109.4 nM, 437.5 nM, 1,750.0 nM, and 7,000.0 nM concentrations of modified oligonucleotide, as specified in the tables below. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and ATXN3 RNA levels were measured by RT-qPCR. Human ATXN3 primer probe set RTS38920 (described hereinabove in Example 1) was used to measure RNA levels. ATXN3 RNA levels were adjusted according to total RNA content, as measured by RiboGreen®.
  • ATXN3 RNA levels were also normalized to human GAPDH levels measured by human GAPDH primer-probe set RTS 104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO: 2804; reverse sequence GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO: 2805; probe sequence
  • CAAGCTTCCCGTTCTCAGCC designated herein as SEQ ID: 2806. Results are presented in the table below as percent ATXN3 RNA levels relative to untreated control cells. IC50 was calculated using the“log(inhibitor) vs.
  • Example 8 Tolerability of modified oligonucleotides complementary to human ATXN3 in rats, 3 mg dose
  • oligonucleotides described above were tested in rats to assess the tolerability of the oligonucleotides.
  • Sprague Dawley rats each received a single intrathecal (IT) dose of 3 mg of oligonucleotide listed in the table below.
  • Each treatment group consisted of 4 rats.
  • a group of four rats received PBS as a negative control.
  • movement in 7 different parts of the body were evaluated for each rat.
  • the 7 body parts are (1) the rat’s tail; (2) the rat’s posterior posture; (3) the rat’s hind limbs; (4) the rat’s hind paws; (5) the rat’s forepaws; (6) the rat’s anterior posture; (7) the rat’s head.
  • each rat was given a sub-score of 0 if the body part was moving or 1 if the body part was paralyzed. After each of the 7 body parts were evaluated, the sub-scores were summed for each rat and then averaged for each group.
  • Example 9 Activity of modified oligonucleotides complementary to human ATXN3 in transgenic mice, multiple dose
  • mice were divided into groups of 4 mice each. Mice in each group were given a single ICV bolus of oligonucleotide at a dose of 10 pg. 30 pg. 100 pg, 300 pg, or 700 pg, and sacrificed two weeks later. A group of 3-4 mice was injected with PBS and served as the control group to which oligonucleotide-treated groups were compared. After two weeks, mice were sacrificed, and RNA was extracted from brain cortex, spinal cord, brain stem and/or cerebellum for real-time PCR analysis of measurement of RNA expression of ATXN3 using primer probe set
  • Results are presented as percent change of RNA, relative to PBS control, normalized to mouse cyclophilin A measured using mouse primer probe set m_cyclo24 as previously described herein.
  • human ATXN3 RNA was reduced in various tissues.
  • ED 5 o was calculated for the compounds using the“non-linear fit of transform ED50” formula in GraphPad Prism 7.01. In some cases, ED 5 o could not be reliably calculated and is represented as“N.C.” (not calculated).
  • Example 10 Effect of modified oligonucleotides complementary to human ATXN3 in cynomolgus monkeys following repeat-dose intrathecal injection, 13-week study
  • Cynomolgus monkeys are treated with modified oligonucleotides to determine the local and systemic tolerability and pharmacokinetics at 1 dose level, following 3 intrathecal lumbar bolus injections administered 4 weeks apart. Cynomolgus monkeys in groups of 4 are treated with either artificial CSF or modified oligonucleotide. Tissues are collected 1 week after the final injection.
  • Assessment of tolerability is based on clinical observations, body weights, food consumption, physical and neurological examinations including sensorimotor reflexes, cerebral reflexes and spinal reflexes, coagulation, hematology, clinical chemistry (blood and cerebral spinal fluid (CSF)), cell count, and anatomic pathology evaluations.
  • Complete necropsies are performed with a recording of any macroscopic abnormality.
  • Organ weights are taken and microscopic examinations are conducted. Blood was collected for complement analysis.
  • blood, CSF, and tissues (at necropsy) are collected for toxicokinetic evaluations.
  • Activity of modified oligonucleotides is analyzed in brain and spinal cord tissue by measuring cynomolgus monkey ATXN3 RNA. Brain and spinal cord samples are collected and flash frozen in liquid nitrogen and stored frozen (-60°C to -90°C). At time of sampling, 2 mm biopsy punches are used to collect samples from frozen tissues for RNA analysis. Punches are taken from multiple brain and spinal cord regions.
  • Ascending doses of modified oligonucleotide are evaluated in a randomized, double-blind study to evaluate the safety, tolerability, pharmacokinetics and pharmacodynamics, and clinical efficacy in patients with confirmed genetic mutation in SCA3.
  • Patient safety will be monitored closely during the study.
  • Safety and tolerability evaluations include: physical examination and standard neurological assessment, vital signs, ECG, AEs and concomitant medications, Columbia Suicide Severity Rating Scale (C-SSRS), CSF safety labs, plasma laboratory tests, urinalysis, and neuroimaging studies.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hospice & Palliative Care (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Psychiatry (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2019/031562 2018-05-09 2019-05-09 Compounds and methods for reducing atxn3 expression Ceased WO2019217708A1 (en)

Priority Applications (19)

Application Number Priority Date Filing Date Title
MX2020011911A MX2020011911A (es) 2018-05-09 2019-05-09 Compuestos y metodos para reducir de la expresion de atxn3.
JOP/2020/0283A JOP20200283A1 (ar) 2018-05-09 2019-05-09 مركبات وطرق لتقليل التعبير الوراثي عن atxn3
SG11202010215TA SG11202010215TA (en) 2018-05-09 2019-05-09 Compounds and methods for reducing atxn3 expression
EP25197374.9A EP4663758A3 (en) 2018-05-09 2019-05-09 Compounds and methods for reducing atxn3 expression
EP19799466.8A EP3799602A4 (en) 2018-05-09 2019-05-09 COMPOUNDS AND METHODS FOR REDUCING ATXN3 EXPRESSION
CA3098144A CA3098144A1 (en) 2018-05-09 2019-05-09 Compounds and methods for reducing atxn3 expression
AU2019266307A AU2019266307A1 (en) 2018-05-09 2019-05-09 Compounds and methods for reducing ATXN3 expression
CN201980029792.6A CN112189053B (zh) 2018-05-09 2019-05-09 用于减少atxn3表达的化合物和方法
JP2020561893A JP2021522800A (ja) 2018-05-09 2019-05-09 Atxn3発現を低減するための化合物及び方法
PE2020001754A PE20212131A1 (es) 2018-05-09 2019-05-09 Compuestos y metodos para reducir de la expresion de atxn3
BR112020021253-9A BR112020021253A2 (pt) 2018-05-09 2019-05-09 compostos e métodos para redução da expressão de atxn3
US17/053,997 US11434488B2 (en) 2018-05-09 2019-05-09 Compounds and methods for reducing ATXN3 expression
KR1020207035007A KR20210008497A (ko) 2018-05-09 2019-05-09 Atxn3 발현 감소용 화합물 및 방법
CR20200604A CR20200604A (es) 2018-05-09 2019-05-09 Compuestos y métodos para reducir de la expresión de atxn3
EA202092500A EA202092500A1 (ru) 2018-05-09 2019-05-09 Соединения и способы для снижения экспрессии atxn3
CONC2020/0013433A CO2020013433A2 (es) 2018-05-09 2020-10-26 Compuestos y métodos para reducir de la expresión de atxn3
PH12020500668A PH12020500668A1 (en) 2018-05-09 2020-11-05 Compounds and methods for reducing atxn3 expression
US17/852,939 US20230235323A1 (en) 2018-05-09 2022-06-29 Compounds and Methods for Reducing ATXN3 Expression
US18/485,724 US12618069B2 (en) 2023-10-12 Compounds and methods for reducing ATXN3 expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862669238P 2018-05-09 2018-05-09
US62/669,238 2018-05-09

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US17/053,997 A-371-Of-International US11434488B2 (en) 2018-05-09 2019-05-09 Compounds and methods for reducing ATXN3 expression
US17/852,939 Continuation US20230235323A1 (en) 2018-05-09 2022-06-29 Compounds and Methods for Reducing ATXN3 Expression

Publications (1)

Publication Number Publication Date
WO2019217708A1 true WO2019217708A1 (en) 2019-11-14

Family

ID=68468406

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/031562 Ceased WO2019217708A1 (en) 2018-05-09 2019-05-09 Compounds and methods for reducing atxn3 expression

Country Status (21)

Country Link
US (2) US11434488B2 (https=)
EP (2) EP4663758A3 (https=)
JP (1) JP2021522800A (https=)
KR (1) KR20210008497A (https=)
CN (1) CN112189053B (https=)
AR (1) AR115375A1 (https=)
AU (1) AU2019266307A1 (https=)
BR (1) BR112020021253A2 (https=)
CA (1) CA3098144A1 (https=)
CL (1) CL2020002888A1 (https=)
CO (1) CO2020013433A2 (https=)
CR (1) CR20200604A (https=)
EA (1) EA202092500A1 (https=)
JO (1) JOP20200283A1 (https=)
MX (1) MX2020011911A (https=)
PE (1) PE20212131A1 (https=)
PH (1) PH12020500668A1 (https=)
SG (1) SG11202010215TA (https=)
TW (1) TW202003541A (https=)
UY (1) UY38225A (https=)
WO (1) WO2019217708A1 (https=)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020245233A1 (en) 2019-06-06 2020-12-10 F. Hoffmann-La Roche Ag Antisense oligonucleotides targeting atxn3
WO2021102373A1 (en) * 2019-11-22 2021-05-27 Alnylam Pharmaceuticals, Inc. Ataxin3 (atxn3) rnai agent compositions and methods of use thereof
JPWO2021230286A1 (https=) * 2020-05-12 2021-11-18
WO2021249993A1 (en) * 2020-06-09 2021-12-16 Roche Innovation Center Copenhagen A/S Guanosine analogues for use in therapeutic polynucleotides
US20220177883A1 (en) * 2020-12-03 2022-06-09 Hoffmann-La Roche Inc. Antisense Oligonucleotides Targeting ATXN3
WO2022117747A2 (en) 2020-12-03 2022-06-09 F. Hoffmann-La Roche Ag Antisense oligonucleotides targeting atxn3
US11359197B2 (en) 2018-01-12 2022-06-14 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
US11434488B2 (en) 2018-05-09 2022-09-06 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN3 expression
US11583548B2 (en) 2016-11-10 2023-02-21 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN3 expression
US12241065B2 (en) 2018-01-12 2025-03-04 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
WO2025252669A1 (en) 2024-06-03 2025-12-11 Evotec International Gmbh Modified oligonucleotides for reducing atxn3 expression
US12618069B2 (en) 2023-10-12 2026-05-05 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN3 expression

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020172559A1 (en) * 2019-02-22 2020-08-27 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing atxn3 expression
CN120505310A (zh) * 2020-02-28 2025-08-19 Ionis制药公司 用于调节smn2的化合物和方法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130225659A1 (en) * 2010-07-19 2013-08-29 Isis Pharmaceuticals, Inc. Modulation of nuclear-retained rna
US20150315595A1 (en) * 2012-03-12 2015-11-05 Santaris Pharma A/S Compositions and Methods for Modulation of ATXN3 Expression
WO2018089805A1 (en) 2016-11-10 2018-05-17 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing atxn3 expression

Family Cites Families (200)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US5132418A (en) 1980-02-29 1992-07-21 University Patents, Inc. Process for preparing polynucleotides
US4500707A (en) 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4973679A (en) 1981-03-27 1990-11-27 University Patents, Inc. Process for oligonucleo tide synthesis using phosphormidite intermediates
US4415732A (en) 1981-03-27 1983-11-15 University Patents, Inc. Phosphoramidite compounds and processes
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
DE3329892A1 (de) 1983-08-18 1985-03-07 Köster, Hubert, Prof. Dr., 2000 Hamburg Verfahren zur herstellung von oligonucleotiden
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
USRE34036E (en) 1984-06-06 1992-08-18 National Research Development Corporation Data transmission using a transparent tone-in band system
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
FR2567892B1 (fr) 1984-07-19 1989-02-17 Centre Nat Rech Scient Nouveaux oligonucleotides, leur procede de preparation et leurs applications comme mediateurs dans le developpement des effets des interferons
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
FR2575751B1 (fr) 1985-01-08 1987-04-03 Pasteur Institut Nouveaux nucleosides de derives de l'adenosine, leur preparation et leurs applications biologiques
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5506337A (en) 1985-03-15 1996-04-09 Antivirals Inc. Morpholino-subunit combinatorial library and method
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
EP0260032B1 (en) 1986-09-08 1994-01-26 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
EP0366685B1 (en) 1987-06-24 1994-10-19 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US4924624A (en) 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
ATE151467T1 (de) 1987-11-30 1997-04-15 Univ Iowa Res Found Durch modifikationen an der 3'-terminalen phosphodiesterbindung stabilisierte dna moleküle, ihre verwendung als nukleinsäuresonden sowie als therapeutische mittel zur hemmung der expression spezifischer zielgene
US5403711A (en) 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
JPH03503894A (ja) 1988-03-25 1991-08-29 ユニバーシィティ オブ バージニア アランミ パテンツ ファウンデイション オリゴヌクレオチド n‐アルキルホスホラミデート
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
DE69034150T2 (de) 1989-10-24 2005-08-25 Isis Pharmaceuticals, Inc., Carlsbad 2'-Modifizierte Oligonukleotide
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5177198A (en) 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US6005087A (en) 1995-06-06 1999-12-21 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5457191A (en) 1990-01-11 1995-10-10 Isis Pharmaceuticals, Inc. 3-deazapurines
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5859221A (en) 1990-01-11 1999-01-12 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5587470A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. 3-deazapurines
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US7101993B1 (en) 1990-01-11 2006-09-05 Isis Pharmaceuticals, Inc. Oligonucleotides containing 2′-O-modified purines
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
GB9009980D0 (en) 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
ES2116977T3 (es) 1990-05-11 1998-08-01 Microprobe Corp Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente.
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
JPH0874B2 (ja) 1990-07-27 1996-01-10 アイシス・ファーマシューティカルス・インコーポレーテッド 遺伝子発現を検出および変調するヌクレアーゼ耐性、ピリミジン修飾オリゴヌクレオチド
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
US5386023A (en) 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5223618A (en) 1990-08-13 1993-06-29 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
MY107332A (en) 1990-08-03 1995-11-30 Sterling Drug Inc Compounds and methods for inhibiting gene expression.
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
JPH06505704A (ja) 1990-09-20 1994-06-30 ギリアド サイエンシズ,インコーポレイテッド 改変ヌクレオシド間結合
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5948903A (en) 1991-01-11 1999-09-07 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
US7015315B1 (en) 1991-12-24 2006-03-21 Isis Pharmaceuticals, Inc. Gapped oligonucleotides
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
EP0538194B1 (de) 1991-10-17 1997-06-04 Novartis AG Bicyclische Nukleoside, Oligonukleotide, Verfahren zu deren Herstellung und Zwischenprodukte
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
TW393513B (en) 1991-11-26 2000-06-11 Isis Pharmaceuticals Inc Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
AU3222793A (en) 1991-11-26 1993-06-28 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5792608A (en) 1991-12-12 1998-08-11 Gilead Sciences, Inc. Nuclease stable and binding competent oligomers and methods for their use
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
FR2687679B1 (fr) 1992-02-05 1994-10-28 Centre Nat Rech Scient Oligothionucleotides.
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
EP0577558A2 (de) 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
GB9304620D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Compounds
CA2159631A1 (en) 1993-03-30 1994-10-13 Sanofi Acyclic nucleoside analogs and oligonucleotide sequences containing them
HU9501974D0 (en) 1993-03-31 1995-09-28 Sterling Winthrop Inc Oligonucleotides with amide linkages replacing phosphodiester linkages
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
DE733059T1 (de) 1993-12-09 1997-08-28 Univ Jefferson Verbindungen und verfahren zur ortsspezifischen mutation in eukaryotischen zellen
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5646269A (en) 1994-04-28 1997-07-08 Gilead Sciences, Inc. Method for oligonucleotide analog synthesis
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
JP3517988B2 (ja) 1994-09-21 2004-04-12 小野薬品工業株式会社 ヒトマッカード−ジョセフ病関連蛋白質、その蛋白質をコードするcDNAおよび遺伝子、そのDNAまたは遺伝子を含むベクター、その発現ベクターで形質転換された宿主細胞、マッカード−ジョセフ病の診断方法および治療剤
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
CN1120707C (zh) 1995-11-22 2003-09-10 约翰斯·霍普金斯大学 增强生物分子的细胞摄取的配体
JP3756313B2 (ja) 1997-03-07 2006-03-15 武 今西 新規ビシクロヌクレオシド及びオリゴヌクレオチド類縁体
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
USRE44779E1 (en) 1997-03-07 2014-02-25 Santaris Pharma A/S Bicyclonucleoside and oligonucleotide analogues
US7572582B2 (en) 1997-09-12 2009-08-11 Exiqon A/S Oligonucleotide analogues
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
JP4236812B2 (ja) 1997-09-12 2009-03-11 エクシコン エ/エス オリゴヌクレオチド類似体
AU1384299A (en) 1997-11-06 1999-05-31 Mosaic Technologies Multiple sequential polynucleotide displacement reactions for signal amplification and processing
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6300319B1 (en) 1998-06-16 2001-10-09 Isis Pharmaceuticals, Inc. Targeted oligonucleotide conjugates
US6043352A (en) 1998-08-07 2000-03-28 Isis Pharmaceuticals, Inc. 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides
US5945290A (en) 1998-09-18 1999-08-31 Isis Pharmaceuticals, Inc. Antisense modulation of RhoA expression
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
US7491805B2 (en) 2001-05-18 2009-02-17 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
WO2002058626A2 (en) 2000-10-27 2002-08-01 Baylor College Of Medicine Methods and compositions for the identification and treatment of neurodegenerative disorders
US6426220B1 (en) 2000-10-30 2002-07-30 Isis Pharmaceuticals, Inc. Antisense modulation of calreticulin expression
CN100406065C (zh) 2000-12-01 2008-07-30 细胞工厂治疗公司 糖基化/半乳糖基化肽、双官能接头和核苷酸单体/多聚体的缀合物以及相关的组合物和使用方法
US20030158403A1 (en) 2001-07-03 2003-08-21 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US20030175906A1 (en) 2001-07-03 2003-09-18 Muthiah Manoharan Nuclease resistant chimeric oligonucleotides
US20050106731A1 (en) 2002-08-05 2005-05-19 Davidson Beverly L. siRNA-mediated gene silencing with viral vectors
US20040241854A1 (en) 2002-08-05 2004-12-02 Davidson Beverly L. siRNA-mediated gene silencing
WO2004041889A2 (en) 2002-11-05 2004-05-21 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
AU2003291755A1 (en) 2002-11-05 2004-06-07 Isis Pharmaceuticals, Inc. Oligomers comprising modified bases for binding cytosine and uracil or thymine and their use
WO2006006948A2 (en) 2002-11-14 2006-01-19 Dharmacon, Inc. METHODS AND COMPOSITIONS FOR SELECTING siRNA OF IMPROVED FUNCTIONALITY
AU2003295600A1 (en) 2002-11-14 2004-06-15 Dharmacon, Inc. Functional and hyperfunctional sirna
US7250289B2 (en) 2002-11-20 2007-07-31 Affymetrix, Inc. Methods of genetic analysis of mouse
US7732591B2 (en) * 2003-11-25 2010-06-08 Medtronic, Inc. Compositions, devices and methods for treatment of huntington's disease through intracranial delivery of sirna
US7723509B2 (en) 2003-04-17 2010-05-25 Alnylam Pharmaceuticals IRNA agents with biocleavable tethers
WO2004106356A1 (en) 2003-05-27 2004-12-09 Syddansk Universitet Functionalized nucleotide derivatives
EP1661905B9 (en) 2003-08-28 2012-12-19 IMANISHI, Takeshi Novel artificial nucleic acids of n-o bond crosslinkage type
CA2538252C (en) 2003-09-18 2014-02-25 Isis Pharmaceuticals, Inc. 4'-thionucleosides and oligomeric compounds
US20050244851A1 (en) 2004-01-13 2005-11-03 Affymetrix, Inc. Methods of analysis of alternative splicing in human
US7374927B2 (en) 2004-05-03 2008-05-20 Affymetrix, Inc. Methods of analysis of degraded nucleic acid samples
US20060148740A1 (en) 2005-01-05 2006-07-06 Prosensa B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
WO2007090071A2 (en) 2006-01-27 2007-08-09 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
US7569686B1 (en) 2006-01-27 2009-08-04 Isis Pharmaceuticals, Inc. Compounds and methods for synthesis of bicyclic nucleic acid analogs
US8178503B2 (en) 2006-03-03 2012-05-15 International Business Machines Corporation Ribonucleic acid interference molecules and binding sites derived by analyzing intergenic and intronic regions of genomes
US7666854B2 (en) 2006-05-11 2010-02-23 Isis Pharmaceuticals, Inc. Bis-modified bicyclic nucleic acid analogs
AU2007249349B2 (en) 2006-05-11 2012-03-08 Isis Pharmaceuticals, Inc. 5'-Modified bicyclic nucleic acid analogs
ES2526295T5 (es) 2006-10-18 2021-05-04 Ionis Pharmaceuticals Inc Compuestos antisentido
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom
CA2688321A1 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
DK2173760T4 (en) 2007-06-08 2016-02-08 Isis Pharmaceuticals Inc Carbocyclic bicyclic nukleinsyreanaloge
AU2008272918B2 (en) 2007-07-05 2012-09-13 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
KR101654007B1 (ko) 2007-08-15 2016-09-05 아이오니스 파마수티컬즈, 인코포레이티드 테트라하이드로피란 핵산 유사체
WO2009067647A1 (en) 2007-11-21 2009-05-28 Isis Pharmaceuticals, Inc. Carbocyclic alpha-l-bicyclic nucleic acid analogs
WO2009073809A2 (en) 2007-12-04 2009-06-11 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
WO2009100320A2 (en) 2008-02-07 2009-08-13 Isis Pharmaceuticals, Inc. Bicyclic cyclohexitol nucleic acid analogs
WO2009099326A1 (en) 2008-02-08 2009-08-13 Prosensa Holding Bv Methods and means for treating dna repeat instability associated genetic disorders
CA2732343C (en) 2008-07-29 2017-05-09 The Board Of Regents Of The University Of Texas System Selective inhibition of polyglutamine protein expression
DK2356129T3 (da) 2008-09-24 2013-05-13 Isis Pharmaceuticals Inc Substituerede alpha-L-bicykliske nukleosider
US9012421B2 (en) 2009-08-06 2015-04-21 Isis Pharmaceuticals, Inc. Bicyclic cyclohexose nucleic acid analogs
JP5716217B2 (ja) 2009-12-15 2015-05-13 公益財団法人ヒューマンサイエンス振興財団 長鎖繰返し配列を含有する遺伝子又は遺伝子産物の選択又は優先的回収方法
WO2011097388A1 (en) 2010-02-03 2011-08-11 Alnylam Pharmaceuticals, Inc. Selective inhibition of polyglutamine protein expression
WO2011097614A1 (en) * 2010-02-08 2011-08-11 Isis Pharmaceuticals, Inc. Mehods and compositions useful in diseases or conditions related to repeat expansion
US8957040B2 (en) 2010-02-08 2015-02-17 Isis Pharmaceuticals, Inc. Selective reduction of allelic variants
US9102938B2 (en) 2010-04-01 2015-08-11 Alnylam Pharmaceuticals, Inc. 2′ and 5′ modified monomers and oligonucleotides
US10913767B2 (en) 2010-04-22 2021-02-09 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising acyclic and abasic nucleosides and analogs
EP2601294B1 (en) 2010-08-05 2018-11-28 Academisch Ziekenhuis Leiden h.o.d.n. LUMC Antisense oligonucleotide directed removal of proteolytic cleavage sites from proteins
CA2812046A1 (en) 2010-09-15 2012-03-22 Alnylam Pharmaceuticals, Inc. Modified irna agents
EP2673361B1 (en) 2011-02-08 2016-04-13 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2013033223A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Methods and compounds useful in conditions related to repeat expansion
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013159108A2 (en) 2012-04-20 2013-10-24 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
US20150141320A1 (en) 2012-05-16 2015-05-21 Rana Therapeutics, Inc. Compositions and methods for modulating gene expression
EP2850183A4 (en) 2012-05-16 2016-02-10 Rana Therapeutics Inc COMPOSITIONS AND METHOD FOR MODULATING GENE EXPRESSION
KR102213609B1 (ko) 2012-07-13 2021-02-08 웨이브 라이프 사이언시스 리미티드 키랄 제어
US9695418B2 (en) 2012-10-11 2017-07-04 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleosides and uses thereof
ES2762326T5 (es) 2012-10-15 2023-04-27 Ionis Pharmaceuticals Inc Métodos para modular la expresión de C9ORF72
CN104837996A (zh) 2012-11-15 2015-08-12 罗氏创新中心哥本哈根有限公司 抗apob反义缀合物化合物
DK2992098T3 (da) 2013-05-01 2019-06-17 Ionis Pharmaceuticals Inc Sammensætninger og fremgangsmåder til modulering af hbv- og ttr-ekspression
US10435430B2 (en) 2013-07-31 2019-10-08 Ionis Pharmaceuticals, Inc. Methods and compounds useful in conditions related to repeat expansion
JP2016531570A (ja) 2013-08-16 2016-10-13 ラナ セラピューティクス インコーポレイテッド ユークロマチン領域を標的とするオリゴヌクレオチド
RU2692634C2 (ru) 2013-10-07 2019-06-25 Академиш Зикенхойс Лейден Х.О.Д.Н. Люмк Направляемое антисмысловым олигонуклеотидом удаление сайтов протеолитического расщепления, мутации hchwa-d и увеличенного числа тринуклеотидных повторов
JP6712948B2 (ja) * 2013-12-12 2020-06-24 ザ・ブロード・インスティテュート・インコーポレイテッド 組成物、及びヌクレオチドリピート障害におけるcrispr−cas系の使用方法
US10119136B2 (en) 2014-01-09 2018-11-06 Alnylam Pharmaceuticals, Inc. RNAi agents modified at the 4′-C position
EP3119888B1 (en) 2014-03-19 2021-07-28 Ionis Pharmaceuticals, Inc. Compositions for modulating ataxin 2 expression
IL320434A (en) 2015-07-22 2025-06-01 Wave Life Sciences Ltd Oligonucleotide preparations and methods
EP4285912A3 (en) 2015-09-25 2024-07-10 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating ataxin 3 expression
WO2018002886A1 (en) 2016-06-29 2018-01-04 Crispr Therapeutics Ag Materials and methods for treatment of spinocerebellar ataxia 3 (sca3) and other related disorders
EP4663758A3 (en) 2018-05-09 2026-04-29 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing atxn3 expression
WO2020172559A1 (en) 2019-02-22 2020-08-27 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing atxn3 expression
CN113950529A (zh) 2019-06-06 2022-01-18 豪夫迈·罗氏有限公司 靶向atxn3的反义寡核苷酸

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130225659A1 (en) * 2010-07-19 2013-08-29 Isis Pharmaceuticals, Inc. Modulation of nuclear-retained rna
US20150315595A1 (en) * 2012-03-12 2015-11-05 Santaris Pharma A/S Compositions and Methods for Modulation of ATXN3 Expression
WO2018089805A1 (en) 2016-11-10 2018-05-17 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing atxn3 expression

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE GenBank [online] 8 April 2018 (2018-04-08), "Homo sapiens ataxin 3 (ATXN3), transcript variant reference, mRNA", XP55662684, Database accession no. NM_004993.5 *
MCLOUGHLIN ET AL., ANN. NEUROL., vol. 84, 2018, pages 64 - 77
MOORE ET AL., MOL. THER. NUCLEIC ACIDS, vol. 7, 2017, pages 200 - 210

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12350285B2 (en) 2016-11-10 2025-07-08 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN3 expression
US11583548B2 (en) 2016-11-10 2023-02-21 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN3 expression
US12241065B2 (en) 2018-01-12 2025-03-04 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
US12180478B2 (en) 2018-01-12 2024-12-31 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
US11359197B2 (en) 2018-01-12 2022-06-14 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
US11447775B2 (en) 2018-01-12 2022-09-20 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
US11434488B2 (en) 2018-05-09 2022-09-06 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN3 expression
WO2020245233A1 (en) 2019-06-06 2020-12-10 F. Hoffmann-La Roche Ag Antisense oligonucleotides targeting atxn3
US11542501B2 (en) * 2019-06-06 2023-01-03 Hoffmann-La Roche Inc. Antisense oligonucleotides targeting ATXN3
EP4061945A1 (en) * 2019-11-22 2022-09-28 Alnylam Pharmaceuticals, Inc. Ataxin3 (atxn3) rnai agent compositions and methods of use thereof
WO2021102373A1 (en) * 2019-11-22 2021-05-27 Alnylam Pharmaceuticals, Inc. Ataxin3 (atxn3) rnai agent compositions and methods of use thereof
US12565653B2 (en) 2019-11-22 2026-03-03 Alnylam Pharmaceuticals, Inc. ATAXIN3 (ATXN3) RNAi agent compositions and methods of use thereof
EP4151237A4 (en) * 2020-05-12 2024-08-14 Mitsubishi Tanabe Pharma Corporation Compound, method and pharmaceutical composition for regulating expression of ataxin 3
WO2021230286A1 (ja) 2020-05-12 2021-11-18 田辺三菱製薬株式会社 Ataxin 3発現を調節するための化合物、方法及び医薬組成物
JP7776420B2 (ja) 2020-05-12 2025-11-26 田辺三菱製薬株式会社 Ataxin 3発現を調節するための化合物、方法及び医薬組成物
JPWO2021230286A1 (https=) * 2020-05-12 2021-11-18
WO2021249993A1 (en) * 2020-06-09 2021-12-16 Roche Innovation Center Copenhagen A/S Guanosine analogues for use in therapeutic polynucleotides
WO2022117747A3 (en) * 2020-12-03 2022-07-28 F. Hoffmann-La Roche Ag Antisense oligonucleotides targeting atxn3
WO2022117747A2 (en) 2020-12-03 2022-06-09 F. Hoffmann-La Roche Ag Antisense oligonucleotides targeting atxn3
WO2022117745A1 (en) 2020-12-03 2022-06-09 F. Hoffmann-La Roche Ag Antisense oligonucleotides targeting atxn3
US20220177883A1 (en) * 2020-12-03 2022-06-09 Hoffmann-La Roche Inc. Antisense Oligonucleotides Targeting ATXN3
US12618069B2 (en) 2023-10-12 2026-05-05 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing ATXN3 expression
WO2025252669A1 (en) 2024-06-03 2025-12-11 Evotec International Gmbh Modified oligonucleotides for reducing atxn3 expression

Also Published As

Publication number Publication date
CA3098144A1 (en) 2019-11-14
MX2020011911A (es) 2021-01-29
AU2019266307A1 (en) 2020-11-19
US11434488B2 (en) 2022-09-06
CN112189053A (zh) 2021-01-05
CN112189053B (zh) 2024-05-14
EA202092500A1 (ru) 2021-03-01
SG11202010215TA (en) 2020-11-27
PH12020500668A1 (en) 2021-06-07
EP3799602A1 (en) 2021-04-07
JP2021522800A (ja) 2021-09-02
PE20212131A1 (es) 2021-11-05
JOP20200283A1 (ar) 2020-11-08
CO2020013433A2 (es) 2020-10-30
US20240301412A1 (en) 2024-09-12
US20230235323A1 (en) 2023-07-27
CL2020002888A1 (es) 2021-05-14
TW202003541A (zh) 2020-01-16
CR20200604A (es) 2021-02-09
EP4663758A2 (en) 2025-12-17
EP4663758A3 (en) 2026-04-29
BR112020021253A2 (pt) 2021-02-02
KR20210008497A (ko) 2021-01-22
UY38225A (es) 2019-11-29
EP3799602A4 (en) 2022-02-16
US20220064637A1 (en) 2022-03-03
AR115375A1 (es) 2021-01-13

Similar Documents

Publication Publication Date Title
US12350285B2 (en) Compounds and methods for reducing ATXN3 expression
US11434488B2 (en) Compounds and methods for reducing ATXN3 expression
EP3826645A1 (en) Compounds and methods for reducing atxn2 expression
AU2019294838A1 (en) Compounds and methods for reducing LRRK2 expression
AU2019384181A1 (en) Compounds and methods for reducing prion expression
EP3927827A1 (en) Compounds and methods for reducing atxn3 expression
AU2020241693B2 (en) Compounds and methods for reducing KCNT1 expression
AU2020253821A1 (en) Compounds and methods for modulating UBE3A-ATS
EP3897837A1 (en) Compounds and methods for reducing pmp22 expression
WO2020243292A1 (en) Compounds and methods for reducing fus expression
AU2021264010A1 (en) Compounds and methods for modulating ATXN1
EP3956450A1 (en) Compounds and methods for modulating gfap
US12618069B2 (en) Compounds and methods for reducing ATXN3 expression
WO2021263082A2 (en) Compounds and methods for reducing kcnt1 expression
WO2021178769A1 (en) Compounds and methods for modulating kcnq2
WO2021102341A2 (en) Compounds for modulating beta globin expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19799466

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3098144

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: NC2020/0013433

Country of ref document: CO

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020021253

Country of ref document: BR

WWP Wipo information: published in national office

Ref document number: NC2020/0013433

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 2020561893

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019266307

Country of ref document: AU

Date of ref document: 20190509

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20207035007

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: DZP2020000632

Country of ref document: DZ

ENP Entry into the national phase

Ref document number: 2019799466

Country of ref document: EP

Effective date: 20201209

ENP Entry into the national phase

Ref document number: 112020021253

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20201016

WWE Wipo information: entry into national phase

Ref document number: 520420498

Country of ref document: SA

WWR Wipo information: refused in national office

Ref document number: 520420498

Country of ref document: SA

WWW Wipo information: withdrawn in national office

Ref document number: 001754-2020

Country of ref document: PE

WWW Wipo information: withdrawn in national office

Ref document number: 278486

Country of ref document: IL

WWW Wipo information: withdrawn in national office

Ref document number: 768962

Country of ref document: NZ

WWW Wipo information: withdrawn in national office

Ref document number: 2019799466

Country of ref document: EP