WO2019168261A1 - 정성적 또는 정량적 돌연변이 유전형 분석방법 및 이 방법을 수행하기 위한 실시간 pcr 키트 - Google Patents

정성적 또는 정량적 돌연변이 유전형 분석방법 및 이 방법을 수행하기 위한 실시간 pcr 키트 Download PDF

Info

Publication number
WO2019168261A1
WO2019168261A1 PCT/KR2018/016559 KR2018016559W WO2019168261A1 WO 2019168261 A1 WO2019168261 A1 WO 2019168261A1 KR 2018016559 W KR2018016559 W KR 2018016559W WO 2019168261 A1 WO2019168261 A1 WO 2019168261A1
Authority
WO
WIPO (PCT)
Prior art keywords
value
pcr
values
real
fluorescence
Prior art date
Application number
PCT/KR2018/016559
Other languages
English (en)
French (fr)
Inventor
김재종
임시규
차선호
박인경
박미득
경아영
Original Assignee
(주)제노텍
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020180167134A external-priority patent/KR102084965B1/ko
Application filed by (주)제노텍 filed Critical (주)제노텍
Publication of WO2019168261A1 publication Critical patent/WO2019168261A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification

Definitions

  • the present invention distinguishes the homozygous type and the heterozygous type of a mutation by using an internal control (IC) together with probes and primers capable of distinguishing mutant traits, and identifies specific mutant genotypes.
  • the present invention relates to an efficient mutation genotyping method based on real-time PCR and a heterogeneous incorporation rate quantitative analysis method that can be quantitatively analyzed. More specifically, the present invention simultaneously performs a target gene PCR reaction capable of selectively amplifying a specific mutant trait and an internal control that is amplified by PCR irrespective of the mutant genotype, and based on the amount of amplification product of the internal control that results from PCR.
  • the present invention relates to a method for determining a mutant genotype by analyzing a relative change in the amount of amplification product of a target gene.
  • the present invention relates to a method for quantitatively analyzing the incorporation rate of a mixed sample of heterogeneous individuals by simultaneously performing PCR and internal control PCR on a mutant marker that can distinguish species.
  • Real-time polymerase chain reaction also called quantitative polymerase chain reaction (qPCR) is an analytical technology based on polymerase chain reaction.
  • Polymerase chain reaction is one of the most powerful techniques in molecular biology experiments, and can be used to replicate or amplify specific sequences in DNA or cDNA thousands to tens of thousands of times.
  • PCR real-time PCR
  • the initial DNA amount can be determined by the amount of PCR product that has been completed.
  • the actual accurate analysis is not easy. Indeed, in the initial cycle of PCR, there is an exponential phase in which the amount of PCR product increases rapidly, but a plateau occurs due to the decrease of enzyme activity, dNTP and Mg + during PCR reaction. Therefore, in order to measure the exact amount of DNA, it should be measured in an exponential period where the amount of DNA increases exponentially. Therefore, it is difficult to measure the exact amount of DNA by the traditional method of analyzing the result after the PCR reaction is completed.
  • the technology developed to overcome the limitations of this analytical method is real-time polymerase chain reaction. In real-time polymerase chain reaction, the amount of PCR product is measured every cycle, thereby distinguishing the change pattern of PCR product amount, that is, exponent and stagnation phase.
  • a fluorescent reporter In real-time polymerase chain reaction, a fluorescent reporter is used to measure the amount of DNA changed every cycle.
  • a fluorescent reporter it is possible to use a substance capable of binding double-stranded DNA (dsDNA), such as 'SYBR Green', or a specific sequence such as 'TaqMan probe' or 'Molecular Beacons'. Fluorescent materials bound to primers or probes that can specifically bind are used.
  • the intensity of the fluorescence signal is measured by a fluorescence measurement device connected to the PCR equipment, and the change in the intensity of the fluorescence signal is displayed as a curve graph according to the reaction, so that it is possible to check how much PCR products are produced in real time.
  • Nucleic acid quantification using real-time polymerase chain reaction has two methods (absolute quantification and relative quantification) (Dhannasekaran, S. et al. 2010. Immunol Methods, 354 (1-2) : 34-9).
  • Absolute quantification is a method of preparing a calibration curve using standard DNA and measuring the amount of target DNA using this method, which essentially requires the same PCR efficiency of the sample and the standard DNA (Bar, T. et al. 2012 Nucleic Acids Research., 40 (4): 1395-1406).
  • Relative quantification is a method of determining the difference in the relative expression level of the target gene based on the expression level of the reference gene.
  • the reference gene must be measured in addition to the target gene for which the expression level is known.
  • Reference genes are for template standardization (correction) between samples, and housekeeping genes are commonly used as reference genes.
  • To compare the expression levels first, the template amount between samples is standardized using the quantitative value of the reference gene, and the standardized value is compared with the control sample to investigate the change in expression level.
  • Relative quantification is a method of quantifying using a calibration curve, but there is a comparative quantification method that measures relative quantitative values by mathematical calculation without using a calibration curve.
  • all samples used for analysis should be prepared in the same way, and the PCR amplification efficiency should be almost constant for all the genes measured, and the calibration standard sample may be used as a reference material. Should be used.
  • the calibration curve used for quantitative analysis is obtained by stepwise dilution of standard DNA or standard sample, and the quality of calibration curve is very important because it is the standard for absolute or relative quantification of unknown sample.
  • the quality of the calibration curve is assessed by the slope and linearity (correlation coefficient, R 2 value) used to calculate the amplification efficiency of the PCR.
  • the equation for calculating the PCR amplification efficiency through the slope of the calibration curve varies depending on the method of taking the X-axis and Y-axis of the calibration curve and converting the initial template amount to algebra, but the X-axis is substituted for the initial template concentration (Log10) and the Y-axis as the Ct value.
  • the equation 'Efficiency (E) -1 +10 (-1 / slope) ' is applied.
  • the amplification efficiency is 90 to 110%.
  • the amplification efficiency is acceptable at an appropriate level of 80 ⁇ 120%, if the amplification efficiency is low, redesign of the primer or suspected the presence of a PCR inhibitor, the method of preparing the sample will be reviewed.
  • the linearity of the calibration curve is represented by the correlation coefficient (R 2 ) and the closer to 1, the closer to the straight line.
  • the linearity generally accepted in real time polymerase chain reaction is above 0.98.
  • Single nucleotide polymorphism is a single-substituted DNA polymorphism that occurs more than 1% of the population. Depending on the SNP trait that an individual has, individual differences may arise that are important for metabolic processes such as disease susceptibility and therapeutic response. In particular, SNP is usefully used to investigate the distribution of individual genes for diseases with complex multiple gene biases.
  • SNP genotyping refers to determining the sequencing of SNPs, which is performed using various molecular biological analysis techniques to distinguish DNA variations. Most SNP discrimination methods are based on the use of hybridization, enzymes such as nucleases or polymerases, and SNPs can be determined through direct sequencing.
  • SNP identification methods utilizing polymerase chain reaction or real-time polymerase chain reaction include ARM-PCR (Tetra-primer amplification refractory mutation system PCR) (Newton, CR et al. 1989. Nucleic Acids Research, 17 (7): 25032516), Allele-specific PCR (AS-PCR) (Gaudet, MI et al. 2009. Methods Mol Biol., 578: 415-424), SSCP (Single-strand conformational polymorphism) assay (Masato, Oc. Et al. 1989. Proc. Natl. Acad. Sci.
  • ARM-PCR Tetra-primer amplification refractory mutation system PCR
  • AS-PCR Allele-specific PCR
  • SSCP Single-strand conformational polymorphism
  • SNP genotyping methods based on real-time polymerase chain reaction have many advantages over other SNP discrimination techniques, such as large-scale analysis, reduced risk of false PCR results due to contamination of other unwanted templates or amplification products, and labor savings. It is actively used in basic research and diagnostics.
  • a typical hydrolysis probe is an oligonucleotide consisting of several to several tens of bases with complementary sequences to SNPs and its surrounding sequences. Reporter dyes and quenchers are applied at the 5 'and 3' ends, respectively. Modified polymers. Depending on the mutant trait, different kinds of fluorescent materials are used as reporters, for example, using mutant trait 1 as 'VIC' and mutant trait 2 as 'FAM'.
  • the length of the nucleotide sequence of the TaqMan probe should be as short as possible to give specificity for each SNP trait. As a result, the Tm value is inevitably lowered, making it difficult to maintain a stable annealing state.
  • Groove Binder is also used to combine MGB-TaqMan probes (Kutyavin, IV et al. 2000. Nucleic Acids Res., 28: 655-661).
  • the MGB-TaqMan probe is similar to the general TaqMan probe, but by adding a minor groove coupling portion to the 3 'end, it maintains a stable annealing condition under PCR conditions because the Tm is high even if the probe is short.
  • SNPs can be analyzed by applying the AMRS (amplification refractory mutation system) PCR principle with TaqMan probes without the use of separate modified probes such as MGB (Ellison, G. et al. 2010. J. Exp. Clin. Cancer Res) , 29: 132).
  • AMRS amplification refractory mutation system
  • ARMS PCR is very difficult to find the optimal PCR conditions for distinguishing SNPs (Punia, P. et al., Http://www.horizonpress.com/pcrbooks).
  • FenDEL FEN 1 activity de creasing
  • the ed by a probe system is a new SNP detection technology that can analyze mutations by real-time polymerase chain reaction using the flap endonuclease ("FEN") specificity of DNA polymerase.
  • FEN flap endonuclease
  • Korean Patent No. 10-1598398 more specifically, the 3 'terminal sequence of the probe and the 3' terminal sequence of the sense primer is complementary, the probe 5 'terminal is positioned to correspond to the SNP point of the PCR product, When a part of the 5 'end of the probe meets the mutation of the SNP point, the flap structure of two or more bases is formed, and the polymerization reaction is stopped.
  • real-time polymerase chain reaction and hybridization probes such as hybridization probes or TaqMan probes are used to distinguish SNPs by simply using the difference in complementary binding force of the probes with temperature
  • the FenDEL system can The specificity of the test is excellent because it uses the characteristics of the enzyme rather than the classification according to the advantage, and has an advantage in the multivariate analysis.
  • Real-time polymerase chain reaction using FenDEL probe is a rapid, sensitive, specific, and economical means of detecting genetic mutations, and is one of the methods applicable to tumor-specific mutation detection requiring high specificity and sensitivity.
  • SNP genotyping using fluorescent probes such as MGB-TaqMan and real-time polymerase chain reaction uses the fluorescent signal of the reporter dye at the end of the PCR reaction.
  • the fluorescent signal of the reporter dyes representing the two SNP traits is measured, and the SNP genotype of the sample is determined by analyzing the type and ratio of the measured fluorescent signal.
  • the signal of the reporter dye is visualized in the form of a plot and used for transfection.
  • a series of analytical procedures such as SNP calling, genotyping and visualization of the measured fluorescence signal, is performed by an automated analysis program.
  • SNP calling is performed by an automated analysis program.
  • all genotyping assays may include a positive control assay or a statistical assay called K-mer (Ranade, K. et al. 2001. Genome Res. , 11: 1262-1268).
  • the PCR cycle which is the exponential increase in the PCR product, is used as basic information, and the SNP genotyping is used.
  • the type of fluorescence and the magnitude value of the fluorescence signal Rn or RFU
  • Threshold cycle refers to the period at which the fluorescence signal crosses a threshold and may be used as the term Cp (cross point cycle) or Cq (quantification cycle) depending on the real-time polymerase chain reaction device used.
  • the change in Ct value is related to the amount of target DNA used in the PCR.
  • the magnitude of the Ct value is inversely proportional to the concentration of the initial template to be added in the reaction. In other words, if the Ct value is large, the concentration of the initial template used for PCR is low. If the Ct value is small, the concentration of the initial template is high.
  • the magnitude value of the fluorescence signal is expressed differently as Rn or RFU.
  • Rn Relative normalized fluorescence
  • ABI's 7300/7500 Real Time PCR System is a representative analyzer that uses Rn.
  • RFU Relative fluorescent units
  • the RFU value increases as the amount of amplified DNA increases. The value can range from 0 to thousands.
  • Bio-Rad's CFX-96 Real Time System is a representative analyzer that uses RFU.
  • the fluorescence value may vary depending on the state of the instrument at the time of measurement, for example, the intensity and emission of the light emission and the position of the well to determine the distance from the light source. For this reason, in the real-time polymerase chain reaction analysis, the Rn or RFU value at the end of the PCR reaction could not be used for quantitative analysis of the sample.
  • An object of the present invention is to simultaneously perform a PCR reaction capable of selectively amplifying a specific mutant trait and an internal control that is amplified by a PCR reaction regardless of the mutant genotype in a real-time polymerase chain reaction simultaneously, in a single well, By comparing and analyzing the relative changes in the amount of amplified product of the mutant trait that is selectively amplified based on the amount of amplified product of the control group, a qualitative analysis method to determine the mutant genotype of the target gene is more clearly and economically than the conventional method. will be.
  • the present inventors PCR amplified a common internal control with a specific mutation test sample to determine the mutant genotype based on the real-time polymerase chain reaction.
  • the Ct value of the internal control and the Ct of the specific mutation test sample were measured.
  • the relative change in the value, and the relative change in the fluorescence intensity of the stagnant or exponential phase on the amplification curve of the internal control and the exponential fluorescence intensity on the amplification curve of the specific mutation test sample were extracted.
  • the present invention was completed by deriving a formula capable of clearly determining the mutant genotype and quantitatively analyzing the incorporation rate of a specific mutant trait by applying various relations based on the calculated values.
  • the term 'amplification plot (plot)' refers to a curve expressed by connecting the magnitude value of the fluorescence signal measured every cycle in the real-time polymerase chain reaction. The greater the initial number of copies of the target nucleic acid to be amplified, the faster the onset period in which an increase in fluorescence value is observed.
  • the term 'passive reference dye' refers to a reference dye used for correcting a deviation of a fluorescence signal generated between PCR wells. If the reference dye does not affect the reaction, there is no particular limitation, but ROX Dyes are most commonly used.
  • the term 'Rn (Relative normalized fluorescence)' refers to a normalized value by dividing the magnitude value of the fluorescence signal emitted from the reporter dye by the magnitude value of the fluorescence signal emitted from the passive reference dye.
  • the term 'delta Rn ( ⁇ Rn)' means a magnitude value of a fluorescent signal obtained by subtracting a baseline from Rn.
  • the term 'threshold' refers to the delta Rn used to determine the Ct value in a real time polymerase chain reaction.
  • the threshold is typically the position above the baseline where the amplification starts exponentially and is set automatically or manually.
  • the term 'Relative fluorescent unit (RFU)' is a unit of measurement used for fluorescence detection analysis. As the amount of amplified DNA increases, the RFU value increases and the RFU value may range from 0 to thousands.
  • 'Raf (Relative Amplification efficiency)' refers to amplification efficiency relative to an internal control of a specific mutant trait.
  • the term 'RCt (relative Ct)' is a value obtained by dividing the Ct value of a specific mutant trait by the Ct value of an internal control.
  • the term ' ⁇ Ct' is obtained by subtracting the Ct value of the internal control from the Ct value of a specific mutant trait.
  • the term 'R ⁇ Rn1 (relative ⁇ Rn1)' refers to the fluorescence value of the internal control when the fluorescence value of the real-time polymerase chain reaction is expressed as ⁇ Rn and the fluorescence value of the internal control is greater than that of a specific mutant trait. It is divided by the fluorescence value of the mutant trait.
  • the term 'RRFU1 refers to the fluorescence value of the internal control when the fluorescence value of the real-time polymerase chain reaction is expressed as RFU and the fluorescence value of the internal control is greater than that of a specific mutant trait. It is divided by the fluorescence value of the mutant trait.
  • the term 'R ⁇ Rn2 (relative ⁇ Rn2)' refers to the fluorescence value of a specific mutant trait when the fluorescence value of a real-time polymerase chain reaction is expressed as ⁇ Rn and the fluorescence value of a specific mutant is greater than that of an internal control. It is divided by the fluorescence value of the internal control.
  • the term 'RRFU2 refers to the fluorescence value of a specific mutant trait when the fluorescence value of a real-time polymerase chain reaction is expressed as RFU and the fluorescence value of a specific mutant is greater than that of an internal control. It is divided by the fluorescence value of the internal control.
  • the term ' ⁇ Rn1' refers to the fluorescence value of a specific mutant trait at the fluorescence value of the internal control when the fluorescence value of the real-time polymerase chain reaction is expressed as ⁇ Rn and the fluorescence value of the internal control is greater than the fluorescence value of the specific mutant trait. Minus value.
  • the term ' ⁇ RFU1' refers to the fluorescence value of a specific mutant trait at the fluorescence value of the internal control when the fluorescence value of the real time polymerase chain reaction is expressed as RFU and the fluorescence value of the internal control is greater than that of the specific mutant trait. Minus value.
  • the term ' ⁇ Rn2' is a case where the fluorescence value of the real-time polymerase chain reaction is expressed as ⁇ Rn and the fluorescence value of a specific mutant is greater than the fluorescence value of an internal control. Minus value.
  • ' ⁇ RFU2' refers to the fluorescence value of the internal control at the fluorescence value of the specific mutant trait when the fluorescence value of the real-time polymerase chain reaction is expressed as RFU and the fluorescence value of the specific mutant is greater than the fluorescence value of the internal control. Minus value.
  • the term 'C value (c-value)' is a value calculated for each experimental condition to clarify the classification of mutant genotypes including SNPs, and results of real-time polymerase chain reaction of the same number of standard heterozygotes and standard homozygous DNA.
  • Different relative values ⁇ Ct, RCt, ⁇ Rn, ⁇ RFU, R ⁇ Rn, RRFU
  • various correlation values multiplied or divided relative Ct and relative fluorescence values
  • the present invention is intended to economically and accurately determine one or more mutant alleles using real-time polymerase chain reaction and / or to effectively analyze the incorporation rate of a particular mutant trait.
  • the present invention is characterized by performing internal control amplification simultaneously with amplification for analysis of specific mutant traits.
  • the internal control is characterized in that the gene is amplified in common irrespective of the mutant trait. It is preferable to select a housekeeping gene as the internal control.
  • the present invention is characterized by using a primer or probe that can distinguish and amplify the mutant trait.
  • the method of distinguishing mutant traits is a method using a mutant-specific primer capable of selectively amplifying a mutant trait (hereinafter referred to as ARMS) or using FEN (Flap endonuclease) specificity of DNA polymerase.
  • ARMS mutant-specific primer capable of selectively amplifying a mutant trait
  • FEN overlap endonuclease
  • the present invention is characterized by using a fluorescence modified probe such as a TaqMan probe that can confirm the amplification and the amount of amplification.
  • the present invention is characterized by using the Ct value measured in real time polymerase chain reaction and the fluorescence value of the exponent or stagnant phase of the amplification curve.
  • the fluorescence value of the internal control measured in the real-time polymerase chain reaction is the fluorescence value of the exponent or stagnant phase of the amplification curve, and the fluorescence value of a specific mutant trait is characterized by the fluorescence value of the exponent phase of the amplification curve.
  • the Ct value of a specific mutant is always greater than the Ct value of an internal control, and the fluorescence value of a specific mutant is characterized by being smaller or greater than the fluorescence value of an internal control.
  • the present invention relates to the internal control and the relative Ct value (combined with “Rct” or “ ⁇ Ct (delta Ct)” in the specification and drawings) and the internal control measured in the real control polymerase chain reaction.
  • Relative fluorescence values relative fluorescence values, interchangeable with “R ⁇ Rn”, “RRFU”, “ ⁇ Rn” or “ ⁇ RFU” in the specification and figures below) of particular mutant traits are used.
  • the method of calculating the relative Ct value or the relative fluorescence value of the internal control and the specific mutant trait is characterized by subtracting a small value from a large value or dividing a large value by a small value.
  • the present invention is characterized by using a correlation value multiplied or divided by the relative Ct value and the relative fluorescence value of the internal control and the specific mutant trait.
  • the present invention calculates coefficients of various relative and correlation values based on the Ct and fluorescence values measured in real time polymerase chain reaction (hereinafter referred to as "C-value"), respectively. It is characterized by determining the mutant genotype using this.
  • the 'C-value' is calculated based on the Ct value and the fluorescence value confirmed as a result of real-time polymerase chain reaction of the standard heterozygotes and the standard homozygotease DNAs of the same quantity under the same analysis conditions. It is done.
  • the analysis conditions for calculating the 'C-value' are the same as the unknown test sample analysis conditions, and the types of analyzers used in the analysis and the preparation conditions of the kit are the same.
  • the 'C-value' is a variable relative value ( ⁇ Ct, RCt, ⁇ Rn, ⁇ RFU, R ⁇ Rn, RRFU) or various correlation values (relative Ct value and relative fluorescence value) that can be calculated based on the Ct value and the fluorescence value. Multiplied by or divided by the average value of each).
  • the present invention divides various relative or correlation values calculated based on the Ct value and the fluorescence value into respective C-values to determine the conjugate form of the mutant trait when the value is greater than or less than one. It is characterized by.
  • Correlation for mutant genotyping in the present invention is Ct value-based calculated value and fluorescence than ⁇ Rn, ⁇ RFU, R ⁇ Rn, RRFU calculated by using only Ct value divided by each C-value Genetic traits can be more clearly distinguished by multiplying or dividing the value-based output and dividing by the C-value.
  • the correlation is characterized in that when the fluorescence value of a particular mutant trait is less than the fluorescence value of the internal control, the calculated value based on the Ct value and the calculated value based on the fluorescence value.
  • Raf1 (RCt x R ⁇ Rn1) / C-value.
  • the correlation is characterized in that when the fluorescence value of the specific mutant trait is greater than the fluorescence value of the internal control, the calculated value based on the Ct value and the calculated value based on the fluorescence value.
  • Raf2 (RCt ⁇ RRFU2) / C-value.
  • the present invention is characterized by providing a method for preparing a calibration curve using a standard sample knowing the incorporation rate of a specific mutant trait and measuring the mixing ratio of a specific mutant trait of an unknown test sample using the prepared calibration line.
  • the standard sample used for preparing the calibration curve is characterized by using two or more types of standard samples having different incorporation rates of specific mutant traits.
  • the calibration curve is characterized by using a correlation value obtained by multiplying or dividing a relative Ct value or a relative fluorescence value or a relative Ct value and a relative fluorescence value measured in a real-time polymerase chain reaction.
  • an unknown test is performed using a calibration curve having a larger slope than a calibration curve having a small slope among calibration curves prepared by using a correlation value multiplied or divided by a relative Ct value, a relative fluorescence value, or a relative Ct value and a relative fluorescence value.
  • Analysis of the specific mutational incorporation rate of the sample is characterized by a more accurate value.
  • homozygous and heterozygous forms of mutant alleles based on real-time polymerase chain reaction can be quickly and clearly distinguished.
  • the mutant genotype is more accurately determined by utilizing the Ct value and the fluorescence signal value identified in the real-time polymerase chain reaction result for the determination and quantitative analysis of the mutant trait.
  • the mixing ratio can be quantified efficiently.
  • the internal control amplification product reflecting fluorescence
  • labeled probes and fluorescent label probes that reflect only one of the two mutant traits provides an economical means of analyzing multiple mutations simultaneously in one in vitro.
  • 3 is a gDNA of 100% domestic sesame (A / A Homo), 100% foreign sesame (B / B Homo), 50% mixed sesame (A / B Hetero) using CFX96 Real-Time System (Bio-Rad) The amplification curve was analyzed three times (set 1, 2, 3).
  • Figure 4 is a gDNA of 100% foreign sesame seeds (B / B Homo) and 50% mixed sesame seeds (A / B Hetero) was measured in an amplification curve repeated three times using the CFX96 Real-Time System (Bio-Rad) The genotype is classified by the correlation using the Ct value and the fluorescence value.
  • Figure 7 shows the gDNA of 100% domestic sesame seeds (A / A Homo), 100% foreign sesame seeds (B / B Homo), 50% mixed sesame seeds (A / B Hetero) to determine the effect of DNA concentration on genotyping.
  • FIG. 8 is a double repeated analysis of gDNA of 100% domestic sesame seeds (A / A Homo), 100% foreign sesame seeds (B / B Homo), and 50% mixed sesame seeds (A / B Hetero) using ARMS PCR technique. set 1, 2) Amplification curve.
  • 10a and 10b show amplification curves 10a and five foreign 80% mixed samples of two types of standard samples (70% foreign SNP trait and 80% foreign SNP traits) for measuring the mixing ratio of foreign SNP traits.
  • Real-time polymerase chain reaction amplification curve (10b) shows amplification curves 10a and five foreign 80% mixed samples of two types of standard samples (70% foreign SNP trait and 80% foreign SNP traits) for measuring the mixing ratio of foreign SNP traits.
  • FIG. 11 shows a calibration curve using relative Ct values (RCt), relative fluorescence values ( ⁇ Rn2) and correlation values (RCt / ⁇ Rn2) calculated from the real-time polymerase chain reaction amplification of the standard sample. This is the result of calculating the foreign SNP transfection rate of 5 foreign 80% mixed samples using this calibration curve. "DdRn" in the graph is used in the same meaning as " ⁇ Rn”.
  • the present invention is a method for detecting mutations using real-time PCR
  • step (H) when the value obtained in step (g) is greater than 1, the heterozygotease, if less than 1, the homozygous step; relates to a method for identifying a mutation using a real-time PCR comprising a.
  • the present invention is a mutation using a real-time PCR, characterized in that the mutation is any one or more of the insertion (insertion), deletion, substitution (substitution) and single nucleotide polymorphism (SNP) of the base It is about how to check.
  • the present invention also relates to a method for identifying a mutation using real-time PCR, characterized in that the mutation is present in plants, animals, microorganisms, human body, agricultural products and processed products thereof.
  • the present invention uses a real-time PCR, characterized in that the real-time PCR method for screening and amplifying the specific mutant trait selected from one of FenDEL-PCR, ARMS-PCR, TaqMan-PCR, MGB-TaqMan-PCR and PNA-PCR To identify a mutation.
  • the present invention also relates to a method for identifying mutations using real-time PCR, characterized by selecting a house keeping gene as the internal control.
  • the steps (b), (e) and (b) are performed separately from the other steps, so that each Ct value and each fluorescence value ⁇ Rn and RFU for the homozygous standard sample and the heterozygous standard sample are different.
  • the present invention provides a primer and probe for the internal control to perform the method; Standard sample including homozygous sample and heterozygous sample; Primers and probes for the standard sample; And a primer and a probe capable of distinguishing mutant traits of a test sample.
  • the present invention provides a method for carrying out the above method.
  • It relates to a real-time PCR kit comprising a; and a primer and a probe that can distinguish the mutant trait of the test sample.
  • the present invention is a method for detecting a mutation using real-time PCR
  • step (G) preparing a calibration curve for the standard sample using the values obtained in step (f);
  • step (I) substituting the value obtained in step (h) into the calibration curve obtained in step (g) to calculate the homozygote / heterozygote mixing rate of the test zone; It is about how to check.
  • the present invention also relates to a method wherein the mutation is any one or more of: insertion, deletion, substitution, and single nucleotide polymorphism (SNP) of the base.
  • the mutation is any one or more of: insertion, deletion, substitution, and single nucleotide polymorphism (SNP) of the base.
  • the present invention also relates to a method characterized in that the mutation is present in plants, animals, microorganisms, human bodies, agricultural products and processed products thereof.
  • the present invention is characterized in that the real-time PCR method for screening and amplifying the specific mutant trait is one selected from FenDEL-PCR, ARMS-PCR, TaqMan-PCR, MGB-TaqMan-PCR and PNA-PCR.
  • the present invention is characterized by selecting a house keeping gene as the internal control.
  • the present invention (B), (E), (B) and (G) step is carried out separately from other steps, homozygotes standard samples, heterozygotes standard samples and homozygotes and heterozygotes exist in a specific molar ratio ⁇ Ct, RCt, ⁇ Rn, each Ct value and at least one of each fluorescence value ⁇ Rn and RFU for one or more standard samples, or Ct values of homozygous and heterozygous samples in standard samples, ⁇ Rn fluorescence values, or relative values of RFU values , ⁇ RFU, R ⁇ Rn, RRFU, and C-values, which are average values of multiplying or dividing the relative values, and calibration curves prepared for the standard sample.
  • the present invention provides a method for carrying out the above method.
  • a standard sample comprising a homozygote sample, a heterozygote sample, and two or more mixed samples in which the homozygote and the heterozygote are mixed at a predetermined ratio;
  • It relates to a real-time PCR kit comprising a; and a primer and a probe that can distinguish the mutant trait of the test sample.
  • the present invention provides a method for carrying out the above method.
  • It relates to a real-time PCR kit comprising a; and a primer and a probe that can distinguish the mutant trait of the test sample.
  • the present invention is characterized in that the kit is used for discriminating the variety of the variety or breeding of any one of agricultural products, livestock products, aquatic products and processed products thereof.
  • Genomic DNA was extracted from domestic fresh sesame and foreign (Chinese) fresh sesame and used as a template for real-time polymerase chain reaction. Domestic and foreign sesame samples were taken 10g each and ground using a mortar and pestle, and 20mg each of the ground sesame powder was taken and used for gDNA extraction and purification. DNA extraction and purification was carried out using the NucleoSpin Plant II kit (MN) and the detailed method was in accordance with the manual provided in the extraction kit.
  • MN NucleoSpin Plant II kit
  • Extracted and purified gDNA of domestic and foreign sesame seeds was quantified using Qubit dsDNA BR Assay kits (Thermo Fisher Scientific) and fluorescence detection system, and the detailed method was in accordance with the manual provided in the kit and fluorescence detection system.
  • a / A homozygotes (homozygote) are 100% domestic
  • B / B homozygotes (100%) foreign
  • a / B heterozygotes 50%) are domestic and foreign gDNA.
  • Each was prepared by mixing the same amount.
  • a sample of 70% and 80% mixed with foreign sesame gDNA was prepared for the mixing rate measurement experiment. The gDNA thus prepared was cryopreserved until use in experiments.
  • Primer and TaqMan probe designed for PCR amplification and amplification of internal control were commonly designed for PCR amplification of specific parts of gDNA prepared from domestic and foreign sesame. Based on SNP markers that can distinguish domestic and foreign sesame Primers and probes designed to PCR amplify only foreign sesame seeds were designed for PCR amplification and confirmation of specific SNP traits.
  • the designed primers and probes were prepared using the oligonucleotide synthesis system of the present inventors Genotech.
  • the primers or probes used in each example were prepared and used in the form of 10x primer mix or 10x probe mix in order to facilitate the preparation of the PCR reaction composition and reduce the experimental error between repeated experiments.
  • the base sequence and the surrounding sequence of sesame genomic DNA used as the internal control gene is shown in Table 1.
  • Target gene front primer 5'-TTCGGCAGAATTTCCTGCtGAAG-3 '
  • Target gene posterior primer 5'-CATGGACAACATAAACTCCCTACC-3 '
  • FenDEL probe 5'- C gTGCTTtaGCAGGAAATTCTGCCG-P-3 '
  • Target Gene TaqMan Probe 5'-JOE-TGTGGACATAGAACAAAGCAGC-BHQ1-3 '
  • Target gene posterior primer 5'-AAGACCTAGTTGTTGCCCCAAG-3 '
  • Target Gene TaqMan Probe 5'-JOE-TGTGGACATAGAACAAAGCAGC-BHQ1-3 '
  • Lower case of the above sequence means the base sequence and non-complementary sequence of the template. It is an artificially substituted base to improve SNP discrimination ability.
  • the dark base represents the SNP trait of the foreign sesame.
  • P means phosphate
  • Sesame origin SNP markers (domestic T, G) and surrounding sequences used as target genes are shown in Table 2.
  • Real-time polymerase chain reaction conditions were denatured at 95 °C for 10 minutes, repeated 40 times 30 seconds at 95 °C-60 seconds at 55 °C 40 times, the fluorescence measurement was set to measure at 55 °C.
  • 7500 Real Time PCR System (ABI) or CFX96 Real-Time System (Bio-Rad) was used as the analyzer, and Ct value and ⁇ Rn or RFU value for quantitative analysis of fluorescence signal change were The decision was made using the software provided with the analyzer.
  • each reaction tube 5 ul (1.38ng / ul) sesame gDNA and 2 ul 10x Primer Mix (10 uM internal control front primer, 10 uM internal control rear primer, 1.25 uM internal control TaqMan probe, 6 uM Target gene anterior primer, 6 uM target gene posterior primer, 2.25 uM FenDEL probe, 5 uM target gene TaqMan probe) and 4 ul of 5x qPCRMix and sterile water were mixed to a final total dose of 20 ul.
  • 10x Primer Mix 10 uM internal control front primer, 10 uM internal control rear primer, 1.25 uM internal control TaqMan probe, 6 uM Target gene anterior primer, 6 uM target gene posterior primer, 2.25 uM FenDEL probe, 5 uM target gene TaqMan probe
  • A is a method for determining a mutant genotype by real-time polymerase chain reaction using a FenDEL probe capable of selectively amplifying only an internal control and a single SNP trait (foreign SNP trait) (A) and a heterozygote (A / B heterozygote).
  • B is a basic conceptual diagram that distinguishes between B and B homozygote.
  • IC amplification curve is determined as A / A homozygotes (100% domestic), and if the amplification curves of IC and foreign SNP traits are confirmed together, the Ct value and the fluorescence value ( Various calculations calculated on the basis of ⁇ Rn or RFU) can be used to determine B / B homozygotes (100% foreign) and A / B heterozygotes (mix 50%).
  • FIG. 2 shows the amplification curves of 100% foreign sesame seeds (B / B Homo) and 50% mixed sesame seeds (A / B Hetero) three times using 7500 Real Time PCR System (ABI) and in each amplification curve.
  • the C-value is a result of real-time polymerase chain reaction for three heterozygous samples (# 1, 3, 5) and three homozygous samples (# 2, 4, 6).
  • the average value of the RCt x R ⁇ Rn1 values of the prepared samples was 3.34.
  • the correlation Raf1 is a value obtained by dividing RCt x R ⁇ Rn1 by C-values and distinguishing homozygotes and heterozygotes based on '1'.
  • the correlation Raf1 result value is greater than 1 in the heterozygote [A / B Hetero (50%)] and less than 1 in the homozygote [B / B Homo (100%)].
  • Table 3 shows the repeated analysis of the gDNA of 100% foreign sesame seeds (B / B Homo) and 50% mixed sesame seeds (A / B Hetero) identified in FIG. 2 using a 7500 Real Time PCR System (ABI) three times. This is the result of applying various correlations to determine the genotype based on the Ct and fluorescence values measured in the amplification curve obtained from.
  • ABSI Real Time PCR System
  • 3 is a gDNA of 100% domestic sesame (A / A Homo), 100% foreign sesame (B / B Homo), 50% mixed sesame (A / B Hetero) using CFX96 Real-Time System (Bio-Rad) 3 times (set 1, 2, 3) amplification curves.
  • CFX96 Real-Time System Bio-Rad 3 times (set 1, 2, 3) amplification curves.
  • As a result of analysis of domestic 100% gDNA as a template only the amplification curve (- ⁇ -) of the internal control was confirmed, and as a result of analysis of 50% mixed gDNA and 100% gDNA of the foreign as a template, the amplification curve of the internal control (- ⁇ -) ) And the amplification curve (- ⁇ -) of foreign SNP traits are confirmed at the same time.
  • Table 4 shows the repeated analysis of the gDNA of 100% foreign sesame seeds (B / B Homo) and 50% mixed sesame seeds (A / B Hetero) identified by using a CFX96 Real-Time System (Bio-Rad) three times. In addition, various correlations and relative coefficients are applied using the Ct and fluorescence values measured in the resulting amplification curve.
  • FIG. 4 shows gDNA of 100% foreign sesame seeds (B / B Homo) and 50% mixed sesame seeds (A / B Hetero) 3 times using CFX96 Real-Time System (Bio-Rad). The analysis was repeated and the genotypes were compared by correlation using the Ct and fluorescence values measured in the resulting amplification curve. Eight kinds of values ( ⁇ Ct, RCt, ⁇ RFU1, RRFU1, ⁇ Ct * ⁇ RFU1, ⁇ Ct * RRFU1, RCt * ⁇ RFU1, RCt * RRFU1) calculated based on the Ct value and the fluorescence value (RFU) are calculated.
  • C-value the value divided by the value (C-value) is greater than 1, it can be determined as a 50% mixed heterozygote (A / B heterozygote), and if less than 1, it can be regarded as a 100% homozygote (B / B homozygote).
  • genotype differences can be identified and genotypes can be more clearly distinguished when two values are used together than when Ct and fluorescence values are used respectively.
  • FIG. 5 shows gDNA of 100% foreign sesame seeds (B / B Homo) and 50% mixed sesame seeds (A / B Hetero) 10 times under the same conditions using 7500 Real Time PCR System (ABI).
  • This is the result of applying the correlation Raf1 (RCt x R ⁇ Rn1 / C-value) using the Ct and fluorescence values measured in the amplification curve.
  • the result of applying the correlation Raf1 is 1.22 ⁇ 0.05 for heterozygotes [A / B Heterozygote (50%)] and 0.8 ⁇ 0.02 for homozygotes [B / B Homozygote (100%)]. not big.
  • FIG. 6 compares the results of experiments using reagents (5x qPCRMix, 10x Primer Mix) and three batches (set 1, set 2, set 3) having different analysis dates.
  • gDNAs of 100% sesame seeds (B / B Homo) and 50% mixed sesame seeds (A / B Hetero) were repeated four times under the same conditions using the 7500 Real Time PCR System (ABI).
  • the correlation Raf1 (RCt x R ⁇ Rn1 / C-value) was applied using the Ct and fluorescence values measured at.
  • the calculated C-value of each batch is changed, but the result is the same as the case of applying the average C-value calculated as their average value.
  • Each reaction tube contains 5ul (6.9ng) or 3ul (4.1ng) of sesame gDNA and 2ul of 10x primer mix (10uM of internal control front primer, 10uM of internal control back primer, 1.25uM of internal control TaqMan probe , 6 uM target gene front primer, 6 uM target gene back primer, 2.25 uM FenDEL probe, 5 uM target gene TaqMan probe), and 4 ul 5x qPCR Mix and sterile water were mixed to a final total dose of 20 ul.
  • Table 5 uses the Ct and fluorescence values measured in real time polymerase chain reaction amplification curve using gDNA of 100% foreign sesame (B / B Homo) and 50% mixed sesame (A / B Hetero) as shown in FIG. This is the result of applying various correlations.
  • each reaction tube 5ul (1.38ng / ul) sesame gDNA and 2ul 10x Primer Mix (6uM internal control anterior primer, 6uM internal control anterior primer, 1uM internal control TaqMan probe, 10uM target gene anterior ARMS primer, 10 uM target gene posterior primer, 5 uM target gene TaqMan probe) and 4 ul 5x qPCR Mix were mixed with sterile water to a final total volume of 20 ul.
  • FIG. 8 shows amplification of two sets of gDNA of 100% domestic sesame seeds (A / A Homo), 100% foreign sesame seeds (B / B Homo), and 50% mixed sesame seeds (A / B Hetero) (set 1, 2) It is a curve.
  • a / A Homo 100% domestic sesame seeds
  • B / B Homo 100% foreign sesame seeds
  • a / B Hetero 50% mixed sesame seeds
  • Table 6 shows the repeated analysis of the gDNA of 100% foreign sesame seeds (B / B Homo) and 50% mixed sesame seeds (A / B Hetero) twice, and the Ct and fluorescence values measured in the obtained amplification curve. This is the result of applying various correlations using.
  • this test is to confirm the correlation between heterozygotes and homozygotes that can be applied to reaction conditions in which the fluorescence value at the end of PCR is greater than that of the internal control.
  • CFX96 Real-Time System (Bio-Rad) analyzer was used, and the PCR reaction composition was as follows.
  • Each reaction tube contains 5ul (1.38ng / ul) sesame gDNA and 2ul 10x Primer Mix (1.5uM internal control anterior primer, 1.5uM internal control anterior primer, 1.25uM internal control TaqMan probe, 6uM target gene anterior) Primers, 6uM target gene posterior primer, 2.25uM FenDEL probe, 5uM target gene TaqMan probe) and 4ul of 5x qPCR Mix and sterile water were mixed to a final total volume of 20ul.
  • the RCt, ⁇ Rn, and RCt / ⁇ Rn values of the standard samples with 70% and 80% mixing rates of the foreign sesame gDNA were calculated, respectively.
  • the 7500 Real Time PCR System (ABI) was used as an analyzer, and the PCR reactant composition was as follows.
  • Each reaction tube contains 5ul (1.38ng / ul) of sesame gDNA and 2ul of 10x Primer Mix (1uM internal control anterior primer, 1uM internal control anterior primer, 1.25uM internal control TaqMan probe, 10uM target gene anterior primer, 10 uM target gene posterior primer, 2.25 uM FenDEL probe, 3.5 uM target gene TaqMan probe) and 4 ul 5x qPCR Mix were mixed with sterile water to a final total volume of 20 ul.
  • A amplification curve of two standard samples (70% foreign SNP transgenic, 80% foreign SNP transgenic mixture) and five foreign mixed 80% samples for measuring the mixing ratio of foreign SNP traits Enzyme chain reaction amplification curve (B).
  • FIG. 11 shows the calibration curve using the relative Ct value (RCt), the relative fluorescence value ( ⁇ Rn2) and the correlation value (RCt / ⁇ Rn2) using the two values calculated from the real-time polymerase chain reaction amplification of the standard sample. This is the result of calculating the foreign SNP trait mixing ratio of five foreign 80% mixed samples using this calibration curve.
  • the mixing rate was average 74.868% using the calibration curve 1 (RCt value) [error range 3.294 ⁇ 8.045 (average 5.132)], 78.752% using the calibration curve 2 ( ⁇ Rn2 value) [0.344 ⁇ 3.821 (average 2.737)] And using the calibration curve 3 (RCt / ⁇ Rn2 value) it can be seen that 78.907% [0.114 ⁇ 2.75 (average 1.798)].
  • a calibration curve may be prepared by using relative Ct values and relative fluorescence values based on Ct values and fluorescence values that can be measured by real-time polymerase chain reaction.
  • the quantitative method using the relative Ct value and the relative fluorescence value can reduce the error between experiments and provide more accurate mixing rate calculation results.
  • the present invention can be used to determine the breeding of the agricultural products, livestock products, aquatic products and their processed products or the degree of mixing of the varieties.
  • the present invention can be used in the field of medicine, forensics, and the like.

Abstract

본 발명은 돌연변이 형질을 구분할 수 있는 프로브 또는 프라이머와 함께 내부 대조구(internal control, IC)를 이용하여 돌연변이의 동형접합 형태(homozygous type)와 이형접합 형태(heterozygous type)를 구분하며, 특정한 돌연변이 유전형질을 정량적으로 분석할 수 있는 실시간 중합효소 연쇄반응(Real-Time PCR) 기반의 효율적인 SNP 형질분석 및 정량분석 방법에 관한 것이다. 좀 더 자세하게는, 돌연변이 유전자형과 관계없이 PCR로 증폭되는 내부 대조구와 특정한 돌연변이 형질을 선별하여 PCR로 증폭할 수 있는 FenDEL 프로브 또는 ARMS 프라이머를 이용한 표적 유전자의 PCR 반응을 동시에 수행하며, PCR 결과 내부 대조구의 증폭산물량을 기준으로 표적 유전자의 증폭산물량의 상대적인 변화를 분석함으로써 돌연변이 유전형질을 판정하는 방법에 관한 것이다. 또한, 본 발명은 종 구분이 가능한 돌연변이 마커에 대한 FenDEL 프로브와 내부 대조구의 동시 실시간 중합효소 연쇄반응을 활용하여 이종 개체 혼합시료의 혼입률을 정량적으로 분석하는 방법에 관한 것이다.

Description

정성적 또는 정량적 돌연변이 유전형 분석방법 및 이 방법을 수행하기 위한 실시간 PCR 키트
본 발명은 돌연변이 형질을 구분할 수 있는 프로브 및 프라이머와 함께 내부 대조구 (internal control, IC)를 이용하여 돌연변이의 동형접합 형태 (homozygous type)와 이형접합 형태 (heterozygous type)를 구분하며 특정한 돌연변이 유전형질을 정량적으로 분석할 수 있는 실시간 중합효소 연쇄반응 (Real-Time PCR) 기반의 효율적인 돌연변이 유전형 분석방법 및 이종 혼입률 정량 분석방법에 관한 것이다. 좀 더 자세하게는, 본 발명은 돌연변이 유전자형과 관계없이 PCR로 증폭되는 내부 대조구와 특정한 돌연변이 형질을 선택적으로 증폭할 수 있는 표적 유전자 PCR 반응을 동시에 수행하고, PCR 결과 내부 대조구의 증폭산물 양을 기준으로 표적 유전자의 증폭산물 양의 상대적인 변화를 분석함으로써 돌연변이 유전형질을 판정하는 방법에 관한 것이다. 또한, 본 발명은 종 구분이 가능한 돌연변이 마커에 대한 PCR과 내부 대조구 PCR을 동시에 수행하여 이종 개체 혼합시료의 혼입률을 정량적으로 분석하는 방법에 관한 것이다.
실시간 중합효소 연쇄반응 (real-time polymerase chain reaction, real-time PCR)은 정량 중합효소 연쇄반응 (quantitative polymerase chain reaction, qPCR)이라고도 불리며 중합효소 연쇄반응을 기반으로 하는 분석기술이다.
중합효소 연쇄반응은 분자생물학 실험에서 가장 강력한 기술 중 하나이며, 이 기술을 이용하면 DNA 혹은 cDNA 중의 특정 염기서열을 수천 배 내지 수만 배로 복제하거나 증폭할 수 있다.
엔드 포인트 (End point) PCR이라고도 불리는 전통적인 PCR 방법은 증폭된 DNA의 양을 검출하거나 정량하기 위해서 PCR 반응이 완전히 완료된 이후 전기영동을 수행하고 그 결과를 이미지로 확인해야 한다. 반면 실시간 중합효소 연쇄반응 (real-time PCR 또는 qPCR)은 표적 DNA 분자의 증폭과 정량을 동시에 수행할 수 있다.
PCR은 이론적으로 표적 DNA의 양이 두 배씩 증폭되므로 반응이 완료된 PCR 산물의 양으로 최초의 DNA 양을 구할 수 있다. 그러나 PCR 반응에 영향을 미치는 여러 인자로 인해 실제 정확한 분석은 쉽지 않다. 실제로 PCR의 초기 사이클에서는 PCR 산물의 양이 급격히 증가하는 지수기 (exponential phase)가 나타나지만 PCR 반응 동안 효소의 활성 감소, dNTP 및 Mg+ 등의 감소로 인하여 정체기 (plateau)가 나타나게 된다. 따라서, 정확한 DNA 양을 측정하고자 할 때는 DNA 양이 기하급수적으로 증가하는 구간, 즉 지수기에서 측정해야 한다. 그러므로 PCR 반응이 완료된 후 반응결과를 분석하는 전통적인 방법으로는 정확한 DNA 양을 측정하기 어렵다. 이러한 분석방법의 한계를 극복하기 위해 개발된 기술이 실시간 중합효소 연쇄반응이다. 실시간 중합효소 연쇄반응에서는 PCR 산물의 양을 사이클마다 매번 측정하므로 PCR 산물 양의 변화 양상, 즉 지수기와 정체기를 구분할 수 있다.
실시간 중합효소 연쇄반응에서는 형광 리포터를 이용하여 사이클마다 매번 변화된 DNA 양을 측정하게 된다. 형광 리포터로는 'SYBR Green'과 같이 염기서열과는 관계없이 이중 가닥 DNA (dsDNA)에 결합할 수 있는 물질을 이용하거나 'TaqMan 프로브'나 '분자 비콘 (Molecular Beacons)' 등과 같이 특정 염기서열에 특이적으로 결합할 수 있는 프라이머나 프로브에 결합된 형광물질이 사용된다. 사이클마다 형광 신호의 세기는 PCR 장비에 연결된 형광 측정 장치를 통해 측정되고, 형광 신호 세기의 변화가 반응에 따라 곡선 그래프로 나타나게 되어 실시간으로 PCR 산물이 얼마나 생성되는지를 확인할 수 있다.
실시간 중합효소 연쇄반응의 장점은 첫째, PCR 반응에 대한 실시간 모니터링이 가능하며, 둘째, 사이클마다 증폭된 PCR 산물의 양을 정확하게 측정할 수 있고, 셋째, 하나의 튜브 안에서 반응 및 분석이 완료되므로 PCR 이후 별도의 실험이 필요 없다는 것이다.
실시간 중합효소 연쇄반응의 기본적인 용도는 유전자 발현 해석과 도입 유전자의 복제수 해석과 같은 정량분석이지만, SNP 유전형 분석, 유전자 조작 식품 검사, 바이러스 병원균 검출과 같은 정성적인 분석에도 활용되고 있는데, 이것은 중합효소 연쇄반응 후 증폭 산물을 별도의 전기영동으로 확인할 필요가 없어서 간편하고 신속하게 결과를 얻을 수 있을 뿐만 아니라, 원하지 않는 다른 주형이나 증폭 산물의 오염으로 인한 잘못된 PCR 결과를 얻을 위험을 낮출 수 있기 때문이다.
실시간 중합효소 연쇄반응을 이용하는 핵산 정량분석으로는 절대정량 (absolute quantification)과 상대정량 (relative quantification)의 두 가지 방식이 있다 (Dhannasekaran, S. et al. 2010. Immunol Methods, 354(1-2): 34-9). 절대정량은 표준 DNA를 이용하여 검량선을 작성하고 이를 이용하여 표적 DNA의 양을 측정하는 방식으로, 이 방식은 필수적으로 검체와 표준 DNA의 PCR 효율이 동일해야 한다 (Bar, T. et al. 2012. Nucleic Acids Research., 40(4): 1395-1406). 상대정량은 참조 유전자의 발현량을 기준으로 표적 유전자의 상대적 발현량의 차이를 결정하는 방식이다. 따라서 상대정량 실험에서는 발현량을 알고 싶은 표적 유전자 외에 반드시 참조 유전자도 함께 측정해야 한다. 참조 유전자는 시료 간의 주형량 표준화 (보정)를 위한 것이며, 통상 항존 유전자 (housekeeping gene)가 참조 유전자로서 많이 이용된다. 발현량 비교를 위해서는 우선 참조 유전자의 정량 값을 이용해 시료 간의 주형량을 표준화하고 표준화된 값을 대조군 시료와 비교해 발현량의 변동을 조사하게 된다.
상대정량은 검량선을 이용해 정량하는 방식 외에 검량선을 이용하지 않고 상대적인 정량 값을 수리적 계산으로 측정하는 비교정량 (comparative quantification) 방식이 있다. 비교정량 방식으로 발현량을 분석하기 위해서는 분석에 사용되는 모든 시료는 동일한 방식으로 준비되어야 하며 측정되는 모든 유전자에 대해 PCR 증폭 효율이 거의 일정해야 하며, 또한 교정용 표준 (calibrator) 시료가 표준물질로 사용되어야 한다.
정량분석에 사용되는 검량선은 표준 DNA 또는 표준 시료의 단계적 희석에 의해 얻어지는데 미지 시료의 절대적인 정량 또는 상대적인 정량의 기준이 되므로 검량선의 품질은 매우 중요하다. 검량선의 품질은 PCR의 증폭 효율을 계산하기 위해 사용되는 기울기와 직선성 (상관계수, R2값)으로 평가된다.
검량선의 기울기를 통해 PCR 증폭 효율을 산출하는 수식은 검량선의 X축, Y축을 취하는 방법과 초기 주형량을 대수로 변환했을 때 달라지지만 X축을 초기 주형 농도 (Log10), Y축을 Ct 값으로 대입했을 경우 ‘Efficiency (E) = -1 +10(-1/slope)’의 수식이 적용되며, 이 경우 기울기가 -3.1에서 -3.6 사이라면 증폭 효율은 90~110%이다. 통상적으로 적정수준으로 받아들여지는 증폭효율은 80~120%이며 증폭 효율이 낮은 경우에는 프라이머를 재설계하거나 PCR 저해 물질의 존재가 의심되므로 시료의 조제 방법을 재검토하게 된다.
검량선의 직선성은 상관계수 (R2)로 나타내며 그 값이 1에 가까울수록 직선에 가까운 것이다. 실시간 중합효소 연쇄반응에서 일반적으로 받아들여지는 직선성은 0.98 이상이다.
단일염기다형성 (single nucleotide polymorphism, SNP)은 한 개의 염기가 치환된 형태의 DNA 다형성으로 인구집단에서 1% 이상의 빈도로 존재한다. 개인이 어떤 SNP 형질을 갖느냐에 따라서 질병 감수성과 치료제 반응과 같은 대사 과정에 중요한 개인별 차이가 나타나기도 한다. 특히 SNP는 복합 다중 유전자 편중을 갖는 질병에 대한 개인별 유전자의 분포를 조사할 때 유용하게 이용되고 있다.
SNP 유전형 분석 (genotyping)이란 SNP의 염기서열을 판별하는 것을 말하며, 이는 DNA 변이를 구별할 수 있는 다양한 분자생물학적 분석기술을 이용하여 수행한다. 대부분의 SNP 판별 방법은 혼성화 (hybridization)나 핵산 분해효소 또는 중합효소 등 효소를 이용하는 방식을 기반으로 하고 있으며 직접적인 염기서열분석을 통해 SNP를 판별하기도 한다.
중합효소 연쇄반응 또는 실시간 중합효소 연쇄반응을 활용하는 대표적인 SNP 판별 방법으로는 ARMS-PCR (Tetra-primer amplification refractory mutation system PCR) (Newton, C. R. et al. 1989. Nucleic Acids Research, 17 (7): 25032516), 알릴 특이적 PCR (Allele-specific PCR; AS-PCR) (Gaudet, M. I. et al. 2009. Methods Mol Biol., 578: 415-424), SSCP (Single-strand conformational polymorphism) 분석법 (Masato, O. et al. 1989. Proc. Natl. Acad. Sci. USA., 86 (8): 2766-2770), DHPLC (Denaturing high performance liquid chromatography) (Oefner, P. J. et al. 1995. Am J Hum Genet.,57: 10310), 전체 앰플리콘에 대한 고해상도 용융 (High-resolution melting of the entire amplicon) (Pasay C. et al. 2008. Med. Vet. Entomol.,22(1): 8288 ) 등이 있다.
실시간 중합효소 연쇄반응을 기반으로 하는 SNP 유전형 분석방법은 다른 SNP 판별 기술에 비해 대용량 분석, 원하지 않는 다른 주형이나 증폭 산물의 오염으로 인한 잘못된 PCR 결과 발생의 위험 감소 및 노동력 절감 등 많은 장점이 있기 때문에 기초 연구와 진단분야에서 활발하게 이용되고 있다.
실시간 중합효소 연쇄반응을 이용하여 SNP 형질을 구별하기 위해서는 두 종류의 가수분해 프로브를 동시에 사용하는 것이 일반적인 방식이다 (Wittwe, C. T. et al., 1997. BioTechniques, 22: 176-181). 대표적인 가수분해 프로브인 TaqMan 프로브는 SNP와 그 주변 서열에 상보적인 염기서열을 갖는 수 개에서 수십 개의 염기로 구성된 올리고뉴클레오타이드이며, 5' 말단과 3' 말단에 각각 리포터 염료와 소광제 (quencher)가 수식된 중합체이다. 돌연변이 형질에 따라 다른 종류의 형광물질이 리포터로 사용되는데 예를 들면 돌연변이 형질 1은 ‘VIC'로, 그리고 돌연변이 형질 2는 'FAM'으로 수식된 TaqMan 프로브를 사용하는 식이다. 또한, TaqMan 프로브의 염기서열 길이는 각 SNP 형질에 대한 특이도를 부여하기 위해서 가급적 짧아야 하는데 이로 인해 Tm 값이 필연적으로 낮아지게 되어 안정한 어닐링 상태 유지가 어려워지므로 이를 극복하기 위해 가격이 비싼 MGB (Minor Groove Binder)가 결합된 구조의 MGB-TaqMan 프로브를 사용하기도 한다 (Kutyavin, I. V. et al. 2000. Nucleic Acids Res., 28: 655-661). MGB-TaqMan 프로브는 일반적인 TaqMan 프로브와 유사하지만 3' 말단에 마이너 그루브 결합부분을 더해 줌으로써 프로브의 길이가 짧아도 Tm이 높기 때문에 PCR 조건에서 안정한 어닐링 상태를 유지하게 된다.
MGB와 같이 별도의 변형 프로브를 사용하지 않고 TaqMan 프로브와 함께 AMRS (amplification refractory mutation system) PCR 원리를 적용하여 SNP를 분석하기도 한다 (Ellison, G. et al. 2010. J. Exp. Clin. Cancer Res., 29: 132). 그러나 ARMS PCR은 SNP를 구분할 수 있는 최적의 PCR 조건을 찾기가 매우 까다롭다 (Punia, P. et al., http://www.horizonpress.com/pcrbooks).
FenDEL ( FEN 1 activity de creasing l ed by a probe) 시스템은 DNA 폴리머레이즈의 플랩 엔도뉴클레이즈 (Flap endonuclease; "FEN") 특이도를 이용하여 실시간 중합효소 연쇄반응으로 돌연변이를 분석할 수 있는 새로운 SNP 검출기술로서(본 출원인의 대한민국특허 10-1598398호), 좀 더 자세히 설명하면, 프로브의 3' 말단 서열과 센스 프라이머의 3' 말단 서열이 상보적이며, 프로브 5' 말단이 PCR 산물의 SNP 포인트에 대응하도록 위치하며, 프로브 5' 말단의 일부가 SNP 포인트의 돌연변이를 만나면 2염기 이상의 플랩구조가 형성되면서 중합반응이 중단되는 특성을 이용하여 시험대상 시료의 SNP 포인트에 돌연변이가 존재하는지를 밝히는 기술이다. 실시간 중합효소 연쇄반응과 혼성화 프로브 (hybridization probe) 또는 TaqMan 프로브 등의 가수분해 프로브 등을 이용하는 방법은 단순히 온도에 따른 프로브의 상보적 결합력의 차이를 이용하여 SNP를 구분하는 반면, FenDEL 시스템은 온도에 따른 구분이 아니라 효소의 특성을 이용하기 때문에 검사의 특이성이 뛰어나고 다종 분석에 장점이 있다. FenDEL 프로브를 이용하는 실시간 중합효소 연쇄반응은 신속하고 민감도와 특이도가 우수하고 경제적인 유전자 돌연변이 탐지수단으로서, 높은 특이도와 민감도가 요구되는 종양 특이적인 돌연변이 검출에 적용 가능한 방법 중 하나이다.
MGB-TaqMan 등 형광 프로브와 실시간 중합효소 연쇄반응을 이용한 SNP 유전자형 분석은 PCR 반응이 최종 종료된 시점에서 리포터 염료의 형광 신호를 이용하게 된다. 즉 PCR 반응이 끝날 때 두 SNP 형질을 각각 대변하는 리포터 염료의 형광 신호가 측정되고 측정된 형광 신호의 종류와 비율 분석 등을 통해 시료의 SNP 유전자형을 판정하는 방식이다. 그리고 일반적으로 리포터 염료의 신호는 플롯 (plot) 형태로 가시화되어 형질분석에 이용되고 있다.
측정된 형광 신호의 SNP 호출 (SNP calling), 유전형질 판독 및 가시화 등 일련의 분석과정은 자동 분석 프로그램에 의해 수행된다. 그러나 희소 대립인자를 분석하거나 SNP 유전자형의 신호 구분이 분명하지 않은 경우는 형질 판정에 주의를 기울여야 한다. 즉 정확한 SNP 호출은 데이터 품질을 평가하고 형광신호 임계값 (threshold)을 설정하며 SNP의 유전자형을 결정하는 전문가의 수작업을 필요로 한다. 이러한 문제를 피하기 위해서 모든 유전형질 분석실험에 양성 대조군 분석을 포함하거나 K-mer라 불리는 통계적 분석이 사용되기도 한다 (Ranade, K. et al. 2001. Genome Res., 11: 1262-1268).
실시간 중합효소 연쇄반응을 이용하여 시료의 절대량 또는 상대적인 양을 측정하기 위해서는 PCR 산물이 지수 함수적으로 증가하기 시작하는 PCR 주기, 즉 Ct (Threshold cycle) 값을 기초 정보로 활용하며, SNP 유전형질을 분석하는 경우에는 PCR 반응 종료 시점에서 형광의 종류와 형광 신호의 크기 값 (Rn 또는 RFU)을 기초 정보로 활용하는 것이 일반적이다.
Ct (Threshold cycle)란 형광 신호가 임계값을 넘어가는 주기를 말하며 사용되는 실시간 중합효소 연쇄반응 기기에 따라서 Cp (cross point cycle) 또는 Cq (quantification cycle)라는 용어로 사용되기도 한다. Ct 값의 변화는 PCR에 사용되는 표적 DNA의 양과 관계되는데 Ct 값의 크기는 반응시 가하는 최초 주형의 농도와 반비례한다. 즉 Ct 값이 크면 PCR에 사용된 최초 주형의 농도가 낮다는 것이고 Ct 값이 작으면 최초 주형의 농도가 높다는 것이다.
분석기기에 따라서 형광 신호의 크기 값은 Rn 또는 RFU로 다르게 표현되고 있다. Rn (Relative normalized fluorescence)은 PCR 웰 간에 발생하는 형광 신호의 편차를 보정하기 위해 사용되는 값으로, 리포터 염료에서 방출되는 형광 신호의 크기 값을 참조 시료에서 방출되는 형광 신호의 크기 값으로 나누어 정규화된 값을 말한다. ABI 사의 7300/7500 Real Time PCR System 등이 Rn을 사용하는 대표적인 분석기기이다. 또 다른 형광 검출 분석에 사용되는 측정 단위인 RFU (Relative fluorescent units)는 PCR 웰 간에 편차를 보정할 필요가 없는 분석기기에서 사용되는 형광 신호의 단위로 RFU 값은 증폭된 DNA의 양이 많을수록 높아지며 그 값은 0에서 수천까지의 범위일 수 있다. Bio-Rad 사의 CFX-96 Real Time System 등이 RFU를 사용하는 대표적인 분석기기이다.
일반적으로 PCR 반응시 프라이머와 PCR 산물 간의 결합 경쟁 때문에 PCR 산물의 증가가 더이상 일어나지 않는 정체기가 나타나는 것으로 알려져 있다 (Kainz, P. et al. 2000. Biochim Biophys Acta, 1494(1-2): 23-27). 즉, 더 많은 PCR 산물이 표적에 결합할수록 프라이머가 표적에 결합할 가능성이 작아지게 되어 새로운 합성이 일어날 수 없는 상황이 되기 때문이다. 따라서, PCR 주기의 증가가 반드시 PCR 생성물의 총량을 증가시키지는 않으며 결과적으로 정체기에서 확인되는 총 PCR 산물과 출발 표적의 양 사이에는 상관관계가 없게 되는 것이다. 또한, 실시간 중합효소 연쇄반응에 어떤 종류의 분석기를 이용하느냐에 따라서 동일한 분석 조건이라 하더라도 최종 검출되는 형광 신호의 크기는 다르게 나타날 수 있다. 또한, 동일한 분석기를 이용하더라도 측정 당시의 기기 상태, 예를 들면 발광의 세기와 검출기 상태 및 광원으로부터의 거리를 결정하는 웰의 위치에 따라서 형광 값은 다를 수 있다. 이와 같은 이유로 실시간 중합효소 연쇄반응 분석에서 PCR 반응 종료 단계의 Rn 또는 RFU 값을 시료의 정량적 분석에는 활용하지 못하고 있었다.
상기와 같이 실시간 중합효소 연쇄반응을 이용한 다양한 유전형질 분석방법 및 유전자 정량분석 방법이 개발되어 왔지만, 여전히 좀 더 경제적이고 효율적인 개선된 기술이 필요하다.
본 발명의 목적은 실시간 중합효소 연쇄반응에서 돌연변이 유전자형과 관계없이 PCR 반응으로 증폭되는 내부 대조구와 특정한 돌연변이 형질을 선택적으로 증폭할 수 있는 PCR 반응을 하나의 웰에서 동시에 시행하며, PCR 결과 생성된 내부 대조구의 증폭산물 양을 기준으로 선택적으로 증폭된 돌연변이 형질의 증폭산물 양의 상대적인 변화를 비교 분석함으로써 표적 유전자의 돌연변이 유전형을 기존의 방법보다 명확하고 경제적으로 판정할 수 있는 정성적 분석방법을 제공하려는 것이다.
또한, 본 발명의 목적은 종 구분이 가능한 돌연변이 마커에 대하여 FenDEL 프로브와 내부 대조구를 이용한 이중 PCR (dual PCR)을 활용하여 이종 개체 혼합시료의 혼입률을 정량적으로 분석할 수 있는 방법을 제공하려는 것이다.
이를 위하여 본 발명자들은 실시간 중합효소 연쇄반응을 기반으로 돌연변이 유전자형을 판정하기 위해서 공동의 내부 대조구를 특정한 돌연변이 시험시료와 함께 PCR 증폭하였으며, 그 결과 측정되는 내부 대조구의 Ct 값과 특정한 돌연변이 시험시료의 Ct 값의 상대적인 값의 변화, 그리고 내부 대조구의 증폭곡선상의 정체기 또는 지수기의 형광 세기와 특정한 돌연변이 시험시료의 증폭곡선상의 지수기 형광 세기의 상대적인 변화 값을 상출하였다. 그리고 산출된 값을 토대로 다양한 관계식을 적용함으로써 돌연변이 유전자형을 명확하게 판정하고 특정 돌연변이 형질의 혼입률을 정량적으로 분석할 수 있는 수식을 도출하여 본 발명을 완성하였다.
본 발명에서 용어, '증폭 플롯(plot)'은 실시간 중합효소 연쇄반응에서 매 주기별로 측정되는 형광 신호의 크기 값을 연결하여 곡선으로 표현한 것을 말한다. 증폭될 표적 핵산의 최초 복제수가 많을수록 형광 값의 증가가 관찰되는 시작 주기가 빠르다.
본 발명에서 용어, '패시브 참조 염료(passive reference dye)’는 PCR 웰 간에 발생하는 형광 신호의 편차를 보정하기 위해 사용되는 참조 염료를 말하며, 반응에 영향을 미치지 않는 참조 염료이면 특별한 제한은 없으나 ROX 염료가 가장 일반적으로 사용된다.
본 발명에서 용어, 'Rn(Relative normalized fluorescence)'은 리포터 염료에서 방출되는 형광 신호의 크기 값을 패시브 참조 염료(passive reference dye)에서 방출되는 형광 신호의 크기 값으로 나누어 정규화된 값을 말한다.
본 발명에서 용어, '델타 Rn(ΔRn)'은 Rn에서 기저선(baseline)을 뺀 형광 신호의 크기 값을 의미한다.
본 발명에서 용어, '임계값(threshold)'은 실시간 중합효소 연쇄반응에서 Ct 값을 결정하기 위해 사용되는 델타 Rn을 말한다. 임계값은 일반적으로 기저선보다 높으면서 지수적으로 증폭을 시작하는 위치이며 자동 또는 수동으로 설정된다.
본 발명에서 용어, 'RFU(Relative fluorescent unit)'는 형광 검출 분석에 사용되는 측정 단위로서, 증폭된 DNA의 양이 많을수록 RFU 값은 커지며 RFU 값은 0에서 수천까지의 범위일 수 있다.
본 발명에서 'Raf (Relative Amplification efficiency)'는 특정한 돌연변이 형질의 내부 대조구 대비 상대적인 증폭효율을 말한다.
본 발명에서 용어, 'RCt (relative Ct)'는 특정한 돌연변이 형질의 Ct 값을 내부 대조구의 Ct 값으로 나눈 값이다.
본 발명에서 용어, 'ΔCt'는 특정 돌연변이 형질의 Ct 값에서 내부 대조구의 Ct 값을 뺀 값이다.
본 발명에서 용어, 'RΔRn1 (relative ΔRn1)'은 실시간 중합효소 연쇄반응의 형광 값이 ΔRn으로 표현되는 경우이면서 내부 대조구의 형광 값이 특정한 돌연변이 형질의 형광 값보다 큰 경우 내부 대조구의 형광 값을 특정한 돌연변이 형질의 형광 값으로 나눈 값이다.
본 발명에서 용어, 'RRFU1 (relative RFU1)'은 실시간 중합효소 연쇄반응의 형광 값이 RFU로 표현되는 경우이면서 내부 대조구의 형광 값이 특정한 돌연변이 형질의 형광 값보다 큰 경우 내부 대조구의 형광 값을 특정한 돌연변이 형질의 형광 값으로 나눈 값이다.
본 발명에서 용어, 'RΔRn2 (relative ΔRn2)'은 실시간 중합효소 연쇄반응의 형광 값이 ΔRn으로 표현되는 경우이면서 특정한 돌연변이 형질의 형광 값이 내부 대조구의 형광 값보다 큰 경우 특정한 돌연변이 형질의 형광 값을 내부 대조구의 형광 값으로 나눈 값이다.
본 발명에서 용어, 'RRFU2 (relative RFU2)'은 실시간 중합효소 연쇄반응의 형광 값이 RFU로 표현되는 경우이면서 특정한 돌연변이 형질의 형광 값이 내부 대조구의 형광 값보다 큰 경우 특정한 돌연변이 형질의 형광 값을 내부 대조구의 형광 값으로 나눈 값이다.
본 발명에서 용어, 'ΔΔRn1'은 실시간 중합효소 연쇄반응의 형광 값이 ΔRn으로 표현되는 경우이면서 내부 대조구의 형광 값이 특정한 돌연변이 형질의 형광 값보다 큰 경우 내부 대조구의 형광 값에서 특정한 돌연변이 형질의 형광 값을 뺀 값이다.
본 발명에서 용어, 'ΔRFU1'은 실시간 중합효소 연쇄반응의 형광 값이 RFU로 표현되는 경우이면서 내부 대조구의 형광 값이 특정한 돌연변이 형질의 형광 값보다 큰 경우 내부 대조구의 형광 값에서 특정한 돌연변이 형질의 형광 값을 뺀 값이다.
본 발명에서 용어, 'ΔΔRn2'는 실시간 중합효소 연쇄반응의 형광 값이 ΔRn으로 표현되는 경우이면서 특정한 돌연변이 형질의 형광 값이 내부 대조구의 형광 값보다 큰 경우 특정한 돌연변이 형질의 형광 값에서 내부 대조구의 형광 값을 뺀 값이다.
본 발명에서 용어, 'ΔRFU2'는 실시간 중합효소 연쇄반응의 형광 값이 RFU로 표현되는 경우이면서 특정한 돌연변이 형질의 형광 값이 내부 대조구의 형광 값보다 큰 경우 특정한 돌연변이 형질의 형광 값에서 내부 대조구의 형광 값을 뺀 값이다.
본 발명에서 용어, 'C 값(c-value)'은 SNP를 비롯한 돌연변이 유전자형 구분을 명확히 하기 위해 실험조건별로 산출되는 값으로서 동일 수량의 표준 이형접합자와 표준 동형접합자 DNA의 실시간 중합효소 연쇄반응 결과 확인 가능한 Ct 값과 형광 값을 기초로 산출될 수 있는 다양한 상대 값(ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU) 또는 다양한 상관관계 값(상대 Ct 값과 상대 형광 값을 곱하거나 나눈 값) 각각의 평균값이다.
본 발명은 실시간 중합효소 연쇄반응을 이용하여 하나 이상의 돌연변이 대립 유전형질을 경제적이고 정확하게 판정하고 및/또는 특정한 돌연변이 형질의 혼입률을 효과적으로 분석하기 위한 것이다.
본 발명은 특정한 돌연변이 형질의 분석을 위한 증폭과 동시에 내부 대조구 증폭을 수행하는 것을 특징으로 한다.
본 발명에서 내부 대조구는 돌연변이 형질과는 관계없이 공통으로 증폭되는 유전자임을 특징으로 한다. 내부 대조구로는 항존 유전자 (housekeeping gene)를 선택하는 것이 바람직하다.
본 발명은 돌연변이 형질을 구분하여 증폭할 수 있는 프라이머나 프로브를 이용하는 것을 특징으로 한다. 돌연변이 형질을 구분하는 방법은 돌연변이 형질을 선택적으로 증폭할 수 있는 돌연변이 형질 특이적 프라이머 (allele-specific primer)를 사용하는 방법 (이하, ARMS)이거나 DNA 폴리머레이즈의 FEN (Flap endonuclease) 특이도를 이용하여 SNP 등의 돌연변이를 검출할 수 있는 FenDEL 시스템을 이용하는 방법일 수 있다.
본 발명은 증폭 여부 및 증폭량을 확인할 수 있는 TaqMan 프로브와 같은 형광 수식 프로브를 이용하는 것을 특징으로 한다.
본 발명은 실시간 중합효소 연쇄반응에서 측정되는 Ct 값과 증폭곡선의 지수기 또는 정체기의 형광 값을 함께 이용하는 것을 특징으로 한다.
본 발명에서 실시간 중합효소 연쇄반응에서 측정되는 내부 대조구의 형광 값은 증폭곡선의 지수기 또는 정체기의 형광 값이며, 특정한 돌연변이 형질의 형광 값은 증폭곡선의 지수기의 형광 값으로 하는 것을 특징으로 한다.
본 발명에서 특정한 돌연변이 형질의 Ct 값은 내부 대조구의 Ct 값보다 항상 큰 값이며, 특정한 돌연변이 형질의 형광 값은 내부 대조구의 형광 값보다 작거나 또는 큰 값임을 특징으로 한다.
본 발명은 실시간 중합효소 연쇄반응에서 측정되는 내부 대조구와 특정한 돌연변이 형질의 상대적인 Ct 값(상대 Ct 값, 이하 명세서 및 도면에서 "Rct" 또는 "ΔCt (delta Ct)"와 혼용함)과 내부 대조구와 특정한 돌연변이 형질의 상대적인 형광 값(상대 형광 값, 이하 명세서 및 도면에서 "RΔRn", "RRFU", "ΔΔRn" 또는 "ΔRFU"와 혼용함)을 이용하는 것을 특징으로 한다.
본 발명에서 내부 대조구와 특정한 돌연변이 형질의 상대 Ct 값 또는 상대 형광 값을 산출하는 방법은 큰 값에서 작은 값을 빼거나 큰 값을 작은 값으로 나누는 것을 특징으로 한다.
또한, 본 발명은 내부 대조구와 특정한 돌연변이 형질의 상대 Ct 값과 상대 형광 값을 곱하거나 나눈 상관관계 값을 이용하는 것을 특징으로 한다.
본 발명은 실시간 중합효소 연쇄반응에서 측정되는 Ct 값 및 형광 값을 기반으로 하는 다양한 상대 값 및 상관관계 값의 계수 (이하에서 "C-값 (C-value)"와 혼용함)를 각각 산출하고 이를 이용하여 돌연변이 유전자형을 판정하는 것을 특징으로 한다.
본 발명에서 'C-값 (C-value)'은 동일한 분석조건으로 동일 수량의 표준 이형접합자와 표준 동형접합자 DNA의 실시간 중합효소 연쇄반응 결과 확인되는 Ct 값과 형광 값을 기초로 산출되는 것을 특징으로 한다.
본 발명에서 'C-값' 산출을 위한 분석조건은 미지의 시험시료 분석조건과 동일하고 분석에 사용되는 분석기 종류와 키트의 조제 조건이 동일함을 특징으로 한다.
본 발명에서 'C-값'은 Ct 값과 형광 값을 기초로 산출될 수 있는 다양한 상대 값 (ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU) 또는 다양한 상관관계 값 (상대 Ct 값과 상대 형광 값을 곱하거나 나눈 값)의 각각의 평균값으로 한다.
본 발명은 Ct 값과 형광 값을 기반으로 산출된 다양한 상대 값 또는 상관관계 값을 각각의 C-값으로 나누어 그 값이 1보다 큰 경우와 작은 경우로 돌연변이 형질의 접합자 형태를 판단할 수 있음을 것을 특징으로 한다.
본 발명에서 돌연변이 유전형 판정을 위한 상관관계식은 Ct 값만으로 산출된 ΔCt, RCt 또는 형광 값만으로 산출된 ΔΔRn, ΔRFU, RΔRn, RRFU를 각각의 C-값으로 나눈 경우보다 Ct 값 기반의 산출 값과 형광 값 기반의 산출 값을 곱하거나 나눈 뒤 C-값으로 나눈 경우 유전형질을 좀 더 명확하게 구분할 수 있음을 특징으로 한다.
본 발명에서 상관관계식은 특정한 돌연변이 형질의 형광 값이 내부 대조구의 형광 값보다 작은 경우에는 Ct 값 기반의 산출 값과 형광 값 기반의 산출 값을 곱하는 것을 특징으로 한다. 예컨대, Raf1 = (RCt x RΔRn1) / C-value이다.
본 발명에서 상관관계식은 특정한 돌연변이 형질의 형광 값이 내부 대조구의 형광 값보다 큰 경우에는 Ct 값 기반의 산출 값과 형광 값 기반의 산출 값을 나누는 것을 특징으로 한다. 예컨대, Raf2 = (RCt ÷ RRFU2) / C-value이다.
또한, 본 발명은 특정한 돌연변이 형질의 혼입률을 알고 있는 표준시료를 이용하여 검량선을 작성하고 작성된 검량선을 이용하여 미지의 시험시료의 특정한 돌연변이 형질의 혼합률을 측정하는 방법을 제공하는 것을 특징으로 한다.
본 발명에서 검량선 작성에 이용되는 표준시료는 특정한 돌연변이 형질의 혼입률이 다른 두 종류 이상의 표준시료를 이용하는 것을 특징으로 한다.
본 발명에서 검량선은 실시간 중합효소 연쇄반응에서 측정되는 상대 Ct 값 또는 상대 형광 값 또는 상대 Ct 값과 상대 형광 값을 곱하거나 나눈 상관관계 값을 이용하는 것을 특징으로 한다.
본 발명에서 상대 Ct 값, 상대 형광 값 또는 상대 Ct 값과 상대 형광 값을 곱하거나 나눈 상관관계 값을 이용하여 각각 작성된 검량선 중에서 기울기가 작은 검량선을 이용하는 경우보다 기울기가 큰 검량선을 이용하여 미지의 시험시료의 특정한 돌연변이 형질 혼입률을 분석한 결과가 좀 더 정확한 값을 산출할 수 있음을 특징으로 한다.
본 발명에 따르면, 실시간 중합효소 연쇄반응을 기반으로 하는 돌연변이 대립 형질의 동형 및 이형 접합 형태를 빠르고 명확하게 구별할 수 있다.
또한, 본 발명에 따르면, 시료 중 특정한 돌연변이 형질의 혼입 비율을 정량적으로 분석할 수 있다.
본 발명의 방법에 의하면, 돌연변이 형질의 판정 및 정량적 분석을 위해서 실시간 중합효소 연쇄반응 결과에서 확인되는 Ct 값과 형광 신호 값을 함께 활용함으로써 좀 더 정확하게 돌연변이 유전자형을 판정하고 또는 시료 중 특정한 돌연변이 형질의 혼입률을 효율적으로 정량할 수 있다.
또한, 본 발명에 의하면 실시간 중합효소 연쇄반응을 기반으로 돌연변이 형질을 판정하기 위해 돌연변이 형질을 각각 반영하는 두 종류의 형광표지 프로브를 사용하는 기존의 방법과 달리 공동으로 사용하는 내부 대조구 증폭산물 반영 형광 표지 프로브와 두 돌연변이 형질 중 한쪽의 형질만을 반영하는 형광표지 프로브를 사용하므로 한 개의 시험관 내에서 다수의 돌연변이를 동시에 분석할 수 있는 경제적인 수단이 제공된다.
도 1은 내부 대조구 (internal control, IC)와 한 종의 SNP 형질(외산 SNP 형질)만을 선별하여 증폭할 수 있는 FenDEL 프로브를 사용한 실시간 중합효소 연쇄반응으로 SNP 유전자형을 판정하는 방법 (A)과 이형접합자 (A/B heterozygote)와 동형접합자 (B/B homozygote)를 구분하는 기본 개념도이다 (B).
도 2는 100% 외산 참깨 (B/B Homo)와 50% 혼합 참깨 (A/B Hetero)의 gDNA를 7500 Real Time PCR System (ABI 사)을 이용하여 3회씩 반복 분석한 증폭곡선 (A)과 각 증폭곡선에서 측정된 Ct 값과 형광 값을 기초로 유전자형을 판단하기 위해 상관관계식 (Raf1 = RCt x RΔRn1 / C-value)을 적용한 결과이다 (B).
도 3은 100% 국산 참깨 (A/A Homo), 100% 외산 참깨 (B/B Homo), 50% 혼합 참깨 (A/B Hetero)의 gDNA를 CFX96 Real-Time System (Bio-Rad)을 이용하여 3회 반복 분석한 증폭곡선이다 (set 1, 2, 3).
도 4는 100% 외산 참깨 (B/B Homo)와 50% 혼합 참깨 (A/B Hetero)의 gDNA를 CFX96 Real-Time System (Bio-Rad)을 이용하여 3회씩 반복 분석한 증폭곡선에서 측정된 Ct 값과 형광 값을 이용한 상관관계식으로 유전형을 구분한 것이다.
도 5는 100% 외산 참깨 (B/B Homo)와 50% 혼합 참깨 (A/B Hetero)의 gDNA를 7500 Real Time PCR System (ABI)을 이용하여 동일한 조건으로 10회씩 반복 분석한 증폭곡선에서 측정된 Ct 값과 형광 값을 이용하여 상관관계식 Raf1 (RCt x RΔRn1 / C-value)을 적용하여 재현성을 확인한 실험 결과이다.
도 6은 분석에 사용된 시약 (5x qPCRMix, 10x Primer Mix)과 분석 일자를 달리한 3번의 반복 실험[3 배치 (set 1, set 2, set 3)] 및 각 배치별 산출된 C-값과 3 배치의 평균 C-값을 상관관계식 Raf1 (RCt x RΔRn1 / C-value)에 적용하였을 때 유전형질 판정결과를 비교한 것이다.
도 7은 DNA 농도가 유전형 판정에 미치는 영향을 확인하기 위해 100% 국산 참깨 (A/A Homo), 100% 외산 참깨 (B/B Homo), 50% 혼합 참깨 (A/B Hetero)의 gDNA를 각각 6.9ng (set 1, 2), 4.1ng (set 3, 4)씩 사용한 실시간 중합효소 연쇄반응 증폭곡선이다.
도 8은 ARMS PCR 기법을 사용하여 100% 국산 참깨 (A/A Homo), 100% 외산 참깨 (B/B Homo), 50% 혼합 참깨 (A/B Hetero)의 gDNA를 2회 반복 분석한 (set 1, 2) 증폭곡선이다.
도 9는 특정한 SNP 형질의 형광 값이 내부 대조구 형광 값보다 큰 경우 100% 국산 참깨 (A/A Homo), 100% 외산 참깨 (B/B Homo)와 50% 혼합 참깨 (A/B Hetero)의 gDNA를 분석한 증폭곡선과 각 증폭곡선에서 측정된 Ct 값과 형광 값을 기초로 SNP 유전자형을 판단하기 위해 상관관계식 Raf2 ((RCt ÷ RRFU2) / C-value)을 적용한 결과이다.
도 10a, 10b는 외산 SNP 형질의 혼합률을 측정하기 위한 두 종류의 표준시료 (70% 외산 SNP 형질 혼합, 80% 외산 SNP 형질 혼합)의 증폭곡선 (10a)과 외산 80% 혼합시료 5종의 실시간 중합효소 연쇄반응 증폭곡선 (10b)이다.
도 11은 표준시료의 실시간 중합효소 연쇄반응 증폭결과 산출된 상대 Ct 값 (RCt), 상대 형광 값 (ΔΔRn2) 및 이 두 값의 상관관계 값 (RCt/ΔΔRn2)을 이용하여 각각의 검량선을 작성하고 이 검량선을 이용하여 5종의 외산 80% 혼합시료의 외산 SNP 형질 혼입률을 계산한 결과이다. 그래프의 "ddRn"은 "ΔΔRn"과 동일한 의미로 사용하였다.
본 발명은 실시간 PCR을 이용하여 돌연변이를 검출하는 방법에 있어서,
(가) 하나의 튜브 안에서 시험구의 특정한 돌연변이 형질을 선별 증폭하는 실시간 PCR과 상기 특정 돌연변이를 포함하는 유전체 내의 유전자 중 하나를 내부 대조구로 지정하여 내부 대조구에 대한 실시간 PCR을 수행하는 단계;
(나) 상기 특정 돌연변이 형질에 대한 동형접합자 (homozygote) 시료와 이형접합자 (heterozygote) 시료가 특정 몰비로 존재하는 표준시료에 대한 실시간 PCR을 상기 (가)와 동일 조건 및 동일 기종으로 수행하는 단계;
(다) 상기 내부 대조구 PCR과 시험구 PCR에서 측정한 Ct 값 및 PCR 종료 시점의 형광 값인 ΔRn 및 RFU 중 하나 이상을 얻는 단계;
(라) 내부 대조구 PCR에서 측정한 Ct 값과 시험구 PCR에서 측정한 Ct 값 중 작은 값으로 큰 값을 나눈 값인 RCt (relative Ct), Ct 값 중 큰 값에서 작은 값을 뺀 값인 ΔCt (delta Ct), 형광 값 중 작은 값으로 큰 값을 나눈 값인 RΔRn, RRFU, 형광 값 중 큰 값에서 작은 값을 뺀 값인 ΔΔRn, ΔRFU 및 이들 값을 곱한 값 또는 이들 값을 나눈 값 중 하나 이상의 값을 얻는 단계;
(마) 상기 표준시료에 대한 PCR 결과 동형접합자 시료 및 이형접합자 시료에 대한 각 Ct 값 및 각 형광 값 ΔRn 및 RFU 중 하나 이상을 얻는 단계;
(바) 상기 표준시료 중 동형접합자 시료와 이형접합자 시료의 Ct 값, 형광 값인 ΔRn 값 또는 RFU 값, 이들 값의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 상대값을 나눈 값 및 이들 값의 평균값인 C-값을 구하는 단계;
(사) 상기 (라)에서 얻은 내부 대조구와 시험구의 Ct 값, ΔRn 값, RFU 값, 이들의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 이들 상대값을 나눈 값을 각각 상응하는 상기 (바) 단계의 평균값인 C-값으로 나누는 단계; 및
(아) 상기 (사) 단계에서 얻은 값이 1보다 큰 경우 이형접합자로, 1보다 작은 경우 동형접합자로 구분하는 단계;를 포함하는 실시간 PCR을 이용하여 돌연변이를 확인하는 방법에 관한 것이다.
또한, 본 발명은 상기 돌연변이가 염기의 삽입 (insertion), 결실 (deletion), 치환 (substitution) 및 단일 염기서열 다형성 (single nucleotidepolymorphism, SNP) 중 어느 하나 이상인 것을 특징으로 하는, 실시간 PCR을 이용하여 돌연변이를 확인하는 방법에 관한 것이다.
또한, 본 발명은 상기 돌연변이가 식물, 동물, 미생물, 인체, 농수산물 및 그 가공품에 존재하는 돌연변이임을 특징으로 하는, 실시간 PCR을 이용하여 돌연변이를 확인하는 방법에 관한 것이다.
또한, 본 발명은 상기 특정한 돌연변이 형질을 선별 증폭하는 실시간 PCR 방법이 FenDEL-PCR, ARMS-PCR, TaqMan-PCR, MGB-TaqMan-PCR 및 PNA-PCR 중 선택된 하나임을 특징으로 하는, 실시간 PCR을 이용하여 돌연변이를 확인하는 방법에 관한 것이다.
또한, 본 발명은 상기 내부 대조구로서 항존 유전자 (house keeping gene)를 선택함을 특징으로 하는, 실시간 PCR을 이용하여 돌연변이를 확인하는 방법에 관한 것이다.
또한, 본 발명은 상기 (나) 단계, (마) 단계 및 (바) 단계가 여타 단계와 별도로 진행되어 동형접합자 표준시료 및 이형접합자 표준시료에 대한 각 Ct 값 및 각 형광 값 ΔRn 및 RFU 중 하나 이상 또는 표준시료 중 동형접합자 시료와 이형접합자 시료의 Ct 값, 형광 값인 ΔRn 값 또는 RFU 값 또는 이들의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 상대값을 나눈 값의 평균값인 C-값이 프로토콜화되어 제공됨을 특징으로 하는, 실시간 PCR을 이용하여 돌연변이를 확인하는 방법에 관한 것이다.
또한, 본 발명은 상기 방법을 수행하기 위하여 내부 대조구에 대한 프라이머 및 프로브; 동형접합자 시료, 이형접합자 시료를 포함하는 표준시료; 상기 표준시료에 대한 프라이머 및 프로브; 및 시험대상 시료의 돌연변이 형질을 구분할 수 있는 프라이머 및 프로브;를 포함하는 것을 특징으로 하는 실시간 PCR 키트에 관한 것이다.
또한, 본 발명은 상기 방법을 수행하기 위하여
동형접합자 표준시료와 이형접합자 표준시료에 대한 각 Ct 값 및 각 형광 값 ΔRn 및 RFU 중 하나 이상 또는 표준시료 중 동형접합자 시료와 이형접합자 시료의 Ct 값, 형광 값인 ΔRn 값 또는 RFU 값, 이들 값의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 상대값을 나눈 값과 이들 값의 평균값인 C-값이 기록된 프로토콜;
내부 대조구에 대한 프라이머 및 프로브; 및
시험대상 시료의 돌연변이 형질을 구분할 수 있는 프라이머 및 프로브;를 포함하는 것을 특징으로 하는 실시간 PCR 키트에 관한 것이다.
또한, 본 발명은 실시간 PCR을 이용하여 돌연변이를 검출하는 방법에 있어서,
(가) 하나의 튜브 안에서 시험구의 특정한 돌연변이 형질을 선별 증폭하는 실시간 PCR과 상기 특정 돌연변이를 포함하는 유전체 내의 유전자 중 하나를 내부 대조구로 하여 내부 대조구에 대한 실시간 PCR을 수행하는 단계;
(나) 상기 특정 돌연변이 형질에 대한 동형접합자 (homozygote) 표준시료와 이형접합자 (heterozygote) 표준시료 및 동형접합자와 이형접합자가 특정 몰비로 존재하는 하나 이상의 표준시료에 대한 실시간 PCR을 상기 (가)와 동일 조건 및 동일 기종으로 수행하는 단계;
(다) 상기 내부 대조구 PCR과 시험구 PCR에서 측정한 Ct 값 및 PCR 종료 시점의 형광 값인 ΔRn 및 RFU 중 하나 이상을 얻는 단계;
(라) 내부 대조구 PCR에서 측정한 Ct 값과 시험구 PCR에서 측정한 Ct 값 중 작은 값으로 큰 값을 나눈 값인 RCt (relative Ct), Ct 값 중 큰 값에서 작은 값을 뺀 값인 ΔCt (delta Ct), 형광 값 중 작은 값으로 큰 값을 나눈 값인 RΔRn, RRFU, 형광 값 중 큰 값에서 작은 값을 뺀 값인 ΔΔRn, ΔRFU 및 이들 값을 곱한 값 또는 이들 값을 나눈 값 중 하나 이상의 값을 얻는 단계;
(마) 상기 표준시료에 대한 PCR 이후 각 표준시료에 대한 각 Ct 값 및 각 형광 값 ΔRn 및 RFU 중 하나 이상을 얻는 단계;
(바) 상기 표준시료 중 동형접합자 표준시료와 이형접합자 표준시료의 Ct 값, 형광 값인 ΔRn 값 또는 RFU 값의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 상대값을 나눈 값의 평균값인 C-값을 구하는 단계;
(사) 상기 (바) 단계에서 얻은 값을 이용하여 상기 표준시료에 대하여 검량곡선을 작성하는 단계;
(아) 상기 (라)에서 얻은 내부 대조구와 시험구의 Ct 값, ΔRn 값, RFU 값, 이들의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 이들 상대값을 나눈 값을 각각 상응하는 상기 (바) 단계의 평균값인 C-값으로 나누는 단계; 및
(자) 상기 (아) 단계에서 얻은 값을 상기 (사) 단계에서 얻은 검량곡선에 대입하여 시험구의 동형접합자/이형접합자 혼합률을 산출하는 단계;를 포함하는 실시간 PCR을 이용하여 특정 돌연변이 혼합률을 확인하는 방법에 관한 것이다.
또한, 본 발명은 상기 돌연변이가 염기의 삽입 (insertion), 결실 (deletion), 치환 (substitution) 및 단일 염기서열 다형성 (single nucleotidepolymorphism, SNP) 중 어느 하나 이상인 것을 특징으로 하는 방법에 관한 것이다.
또한, 본 발명은 상기 돌연변이가 식물, 동물, 미생물, 인체, 농수산물 및 그 가공품에 존재하는 돌연변이임을 특징으로 하는 방법에 관한 것이다.
또한, 본 발명은 상기 특정한 돌연변이 형질을 선별 증폭하는 실시간 PCR 방법이 FenDEL-PCR, ARMS-PCR, TaqMan-PCR, MGB-TaqMan-PCR 및 PNA-PCR 중 선택된 하나임을 특징으로 한다.
또한, 본 발명은 상기 내부 대조구로서 항존 유전자 (house keeping gene)를 선택함을 특징으로 한다.
또한, 본 발명은 상기 (나), (마), (바) 및 (사) 단계가 여타 단계와 별도로 진행되어 동형접합자 표준시료, 이형접합자 표준시료 및 동형접합자와 이형접합자가 특정 몰비로 존재하는 하나 이상의 표준시료에 대한 각 Ct 값 및 각 형광 값 ΔRn 및 RFU 중 하나 이상 또는 표준시료 중 동형접합자 시료와 이형접합자 시료의 Ct 값, 형광 값인 ΔRn 값 또는 RFU 값의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 상대값을 나눈 값의 평균값인 C-값, 및 표준시료에 대하여 작성된 검량곡선이 프로토콜화되어 제공됨을 특징으로 한다.
또한, 본 발명은 상기 방법을 수행하기 위하여
내부 대조구에 대한 프라이머 및 프로브;
동형접합자 시료, 이형접합자 시료 및 동형접합자와 이형접합자가 일정 비율로 혼합된 두 개 이상의 혼합시료를 포함하는 표준시료;
상기 표준시료에 대한 프라이머 및 프로브; 및
시험대상 시료의 돌연변이 형질을 구분할 수 있는 프라이머 및 프로브;를 포함하는 것을 특징으로 하는 실시간 PCR 키트에 관한 것이다.
또한, 본 발명은 상기 방법을 수행하기 위하여
동형접합자 표준시료, 이형접합자 표준시료 및 동형접합자와 이형접합자가 특정 몰비로 존재하는 하나 이상의 표준시료에 대한 각 Ct 값 및 각 형광 값 ΔRn 및 RFU 중 하나 이상 또는 표준시료 중 동형접합자 시료와 이형접합자 시료의 Ct 값, 형광 값인 ΔRn 값 또는 RFU 값의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 상대값을 나눈 값의 평균값인 C-값, 또는 표준시료에 대하여 작성된 검량곡선이 기록된 프로토콜;
내부 대조구에 대한 프라이머 및 프로브; 및
시험대상 시료의 돌연변이 형질을 구분할 수 있는 프라이머 및 프로브;를 포함하는 것을 특징으로 하는 실시간 PCR 키트에 관한 것이다.
또한, 본 발명은 상기 키트가 농산물, 축산물, 수산물 및 이들의 가공품 중 어느 하나의 품종판별 또는 품종의 혼입도 판별용임을 특징으로 한다.
이하, 실시예를 들어 본 발명의 구성을 좀 더 구체적으로 설명한다. 이들 실시예는 오로지 본 발명을 설명하기 위한 것으로서, 본 발명의 범위가 이들 실시예의 기재에 국한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 자명하다.
[DNA 준비]
국산 생참깨와 외산(중국산) 생참깨로부터 유전체 DNA (gDNA)를 추출하여 실시간 중합효소 연쇄반응의 주형으로 사용하였다. 국산 및 외산 참깨 시료는 각각 10g씩을 취하여 막자사발을 이용하여 분쇄한 후, 분쇄된 참깨 가루 20mg씩을 취하여 gDNA 추출 및 정제에 사용하였다. DNA 추출 및 정제는 NucleoSpin Plant II kit (MN)를 이용하였으며 세부 방법은 추출 키트에서 제공되는 매뉴얼에 따랐다. 추출 및 정제된 국산과 외산 참깨의 gDNA는 Qubit dsDNA BR Assay kits (Thermo Fisher Scientific) 와 형광 검출 시스템을 이용하여 정량하였으며 세부 방법은 키트 및 형광 검출 시스템에서 제공되는 매뉴얼에 따랐다. PCR 실험에 주형으로 사용할 gDNA로서 A/A 동형접합자 (homozygote)는 국산 100%, B/B 동형접합자 (homozygote)는 외산 100%, A/B 이형접합자 (heterozygote)는 국산과 외산 gDNA를 50%씩 동일 양 혼합하여 준비하였다. 또한, 혼합률 측정 실험을 위해 외산 참깨 gDNA가 각각 70%와 80% 혼합된 시료를 준비하였다. 이와 같이 준비된 gDNA는 실험에 사용하기까지 냉동보관하였다.
[ 프라이머 및 프로브 제작]
국산 참깨와 외산 참깨로부터 준비된 gDNA의 특정 부위를 공통적으로 PCR 증폭할 수 있는 프라이머와 TaqMan 프로브를 내부 대조구의 PCR 증폭 및 증폭 확인용으로 디자인하였으며, 국산 참깨와 외산 참깨를 구분할 수 있는 SNP 마커를 기초로 외산 참깨만을 PCR 증폭할 수 있도록 고안된 프라이머와 프로브를 특정한 SNP 형질의 PCR 증폭 및 증폭 확인용으로 디자인하였다. 디자인된 프라이머 및 프로브는 본 출원인인 (주)제노텍의 올리고뉴클레오타이드 합성 시스템을 이용하여 제작하였다. 각 실시예에서 사용된 프라이머 또는 프로브는 PCR 반응 조성물 제조를 원활히 하고 반복 실험 간의 실험 오차를 줄이기 위해 10x 프라이머 믹스 또는 10x 프로브 믹스 형태로 제조하여 사용하였다.
<내부 대조구 PCR 증폭용 프라이머와 프로브>
- 내부 대조구 전방 프라이머 : 5'-GTCCAACTCGGAATTTGCATGGAAG-3'
- 내부 대조구 후방 프라이머 : 5'-TTTTCACCAATTTTCCAACACTGG-3'
- 내부 대조구 TaqMan 프로브 : 5'-FAM-TAGAGGCGTCTATATATGATGGCA-BHQ1-3'
내부 대조구 유전자로 사용된 참깨 유전체 DNA의 염기서열 및 주변 염기서열은 표 1에 나타내었다.
-----------------------------------TATATATATATCGGTAATAAATACTTATTTACAAAGGTAACGAAATAATCTTTATATAGTTCAATTAAATCAAATTAATTAGGCGTTATGTGTATGAAATTAATATGTATACATTGAATTGAGTTATTAATCATAAATTCCACAACGATGTTATGTATATAT GTCCAACTCGGAATTTGCATGGAAG CTACGCTCTGACATAAACTAACACATAGATATTGACCTCTTACACTACATGTAGAGGCGTCTATATATGATGGCAGGACCCAGCTACTTAACACCCTTTCCACATTATTTTTGCAGAATTT CCAGTGTTGGAAAATTGGTGAAAA TTACACTTTTAGTCTCTTCGGATAGAAAATTCGTCATTTTTAGACTTATACTTTATGAAACTTTTAAATGATCCCAAAGTTAGAAAAAGATCGACATATCTAGTCCCATAAATTGTGTAAAGCAAGAACTAAATATGTCAAAATTTCTCAATTTCATGACCA-----------------------
<표적 유전자 PCR 증폭용 프라이머와 프로브>
FenDEL 시스템용 프라이머와 프로브
- 표적 유전자 전방 프라이머 : 5'-TTCGGCAGAATTTCCTGCtGAAG-3'
- 표적 유전자 후방 프라이머 : 5'-CATGGACAACATAAACTCCCTACC-3'
- FenDEL 프로브 : 5'-CgTGCTTtaGCAGGAAATTCTGCCG-P-3'
- 표적 유전자 TaqMan 프로브 : 5'-JOE-TGTGGACATAGAACAAAGCAGC-BHQ1-3'
ARMS 용 프라이머와 프로브
- 표적 유전자 전방 ARMS 프라이머 : 5'-CAGAATTTCCTGCCGAAGCtAG-3'
- 표적 유전자 후방 프라이머 : 5'-AAGACCTAGTTGTTGCCCCAAG-3'
- 표적 유전자 TaqMan 프로브 : 5'-JOE-TGTGGACATAGAACAAAGCAGC-BHQ1-3'
위 서열 중 소문자는 주형의 염기서열과 비상보적인 서열을 의미한다. 이는 SNP 구분 능력을 향상시키기 위해 인위적으로 치환한 염기이다.
진한 글씨의 염기는 외산 참깨의 SNP 형질을 나타낸다.
P는 인산 (phosphate)을 의미한다.
표적 유전자로 사용된 참깨 원산지 구분 SNP 마커 (국산 T, 외산 G)와 주변 염기서열은 표 2에 나타내었다.
---------------------------------AGGATCATTATGCTACTATATAAAGTTAAAATACGAAAACATCAAATGAACTAAGTTACGAGACTCTATGCTTCAATTCACATTACTATGTTTAATTTGAGTTGTGAAATATCCTAAAATCTTTCAAAGAAACTTCGTGTCGTATCGTCGTTTTTGTGTCAATGCATCATAAATAAATAACGATCTCTATTAATGTGCGGTCATTTTTGAATCTTTTCTTTTCGGCAGAATTTCCTGCCGAAGCAA[T/G]TTTGAATGCAGATACGTTAGCGGGATGTGGACATAGAACAAAGCAGCCATGTTTGCCCTTTTGGTAGGGAGTTTATGTTGTCCATGAATTTCTGGGAACAAAGACGGCTACAAACGACCTAGGAGTACTCGGACTTGTCTAGCTATATATCATTGATCAACCCCGGCAGGAGACAATCTCAAATTCCAAGCGCATAAAATTTTACTTGGGGCAACAACTAGGTCTTTGTGCATTTTTACTAGGAAT----------------------
[ qPCR 반응 및 확인]
상기와 같이 준비한 국산과 외산 참깨 gDNA를 주형으로 하고, 준비한 프라이머 및 프로브를 이용하여 실시간 중합효소 연쇄반응을 수행하였다. 본 실시예에 사용한 중합효소 및 반응 조성물은 5x qPCRMix (50mM Tris, pH 9.0, 7.5mM MgCl2, 300mM KCl, 50mM (NH4)2SO4, 5mM dNTPs, 0.05% Tween20, 3.5x α-E10 AFA 용액, 2.5x ROX dye, 5U Hot-Taq DNA 폴리머레이즈, (주)제노텍, 한국)를 사용하였다. 실시간 중합효소 연쇄반응 조건은 95℃에서 10분간 변성, 95℃에서 30초 - 55℃에서 60초를 40회 반복 수행하였으며, 형광 측정은 55℃에서 측정할 수 있도록 설정하였다. 실시간 중합효소 연쇄반응에 분석기기로서 7500 Real Time PCR System (ABI) 또는 CFX96 Real-Time System (Bio-Rad)을 사용하였으며, 형광신호 변화를 정량적으로 분석하기 위한 Ct 값과 ΔRn 또는 RFU 값은 각 분석기기에서 제공되는 소프트웨어를 이용하여 결정하였다.
실시예 1
내부 대조구 (internal control, IC)와 외산 참깨의 SNP 형질만을 선별하여 증폭할 수 있는 FenDEL 프로브를 이용한 실시간 중합효소 연쇄반응으로 국산 동형접합자 (A/A homozygote, 국산 100%), 외산 동형접합자 (B/B homozygote, 외산 100%) 및 혼합 이형접합자 (A/B heterozygote, 50%)를 판정하는 개념과 방법을 설명하기 위한 시험이다. 사용된 분석기기는 7500 Real Time PCR System (ABI) 또는 CFX96 Real-Time System (Bio-Rad)을 사용하였으며, PCR 반응물 조성은 아래와 같다.
<RT-PCR 반응물 조성>
각 반응 튜브에 5 ul (1.38ng/ul)의 참깨 gDNA와 2 ul의 10x Primer Mix (10 uM의 내부 대조구 전방 프라이머, 10 uM의 내부 대조구 후방 프라이머, 1.25 uM의 내부 대조구 TaqMan 프로브, 6 uM의 표적 유전자 전방 프라이머, 6 uM의 표적 유전자 후방 프라이머, 2.25 uM의 FenDEL 프로브, 5 uM의 표적 유전자 TaqMan 프로브) 그리고 4 ul의 5x qPCRMix와 멸균수를 혼합하여 최종 총 용량 20 ul로 맞추었다.
도 1은 내부 대조구와 한 종의 SNP 형질 (외산 SNP 형질)만을 선별 증폭할 수 있는 FenDEL 프로브를 사용한 실시간 중합효소 연쇄반응으로 돌연변이 유전자형을 판정하는 방법 (A)과 이형접합자 (A/B heterozygote)와 동형접합자 (B/B homozygote)를 구분하는 기본 개념도이다 (B). 실시간 중합효소 연쇄반응 결과에서 IC 증폭곡선만이 확인되는 경우는 A/A 동형접합자 (국산 100%)로 판정하며, IC와 외산 SNP 형질의 증폭곡선이 함께 확인되는 경우는 Ct 값과 형광 값 (ΔRn 또는 RFU)을 기초로 산출되는 다양한 계산 값을 이용하여 B/B 동형접합자 (외산 100%)와 A/B 이형접합자 (혼합 50%)를 판정할 수 있다.
(-△-) : 내부 대조구 (IC)의 증폭곡선, (-○-) : 외산 SNP 형질 (B)의 증폭곡선, (-×-) : 국산 SNP 형질 (A)의 증폭곡선, CtJOE : 외산 SNP 형질 (B)의 Ct 값, CtFAM : 내부 대조구 (IC)의 Ct 값, ΔRnJOE : 외산 SNP 형질 (B)의 형광 값, ΔRnFAM : 내부 대조구 (IC)의 형광 값.
도 2는 100% 외산 참깨 (B/B Homo)와 50% 혼합 참깨 (A/B Hetero)의 gDNA를 7500 Real Time PCR System (ABI)을 이용하여 3회씩 반복 분석한 증폭곡선과 각 증폭곡선에서 측정된 Ct 값과 형광 값을 기초로 유전자형을 판단하기 위해 상관관계식 Raf1 (RCt x RΔRn1 / C-value)을 적용한 결과이다. 여기에서 C-값 (C-value)은 3종의 이형접합 시료 (#1, 3, 5)와 3종의 동형접합 시료 (#2, 4, 6)를 대상으로 실시간 중합효소연쇄반응 결과 산출된 각 시료의 RCt x RΔRn1 값의 평균값이며, 그 값은 3.34이다. 상관관계식 Raf1은 RCt x RΔRn1을 C-값으로 나눈 값으로 ‘1’을 기준으로 동형접합체와 이형접합체를 구분하는 기준 값이다.
본 실시예에서 상관관계식 Raf1 결과 값이 이형접합자 [A/B Hetero (50%)]에서는 1보다 크며, 동형접합자 [B/B Homo (100%)]에서는 1보다 작음을 알 수 있다.
(-△-) : 내부 대조구 (IC)의 증폭곡선, (-○-) : 외산 SNP 형질(B)의 증폭곡선, (-×-) : 국산 SNP 형질 (A)의 증폭곡선.
표 3은 도 2에서 확인되는 100% 외산 참깨 (B/B Homo)와 50% 혼합 참깨 (A/B Hetero)의 gDNA를 7500 Real Time PCR System (ABI)을 이용하여 3회씩 반복 분석하고, 여기에서 얻은 증폭곡선에서 측정된 Ct 값과 형광 값을 기초로 유전자형을 판단하기 위해 다양한 상관관계식을 적용한 결과이다. Ct 값과 형광 값 (ΔRn)을 기반으로 산출된 값들 (ΔCt, RCt, ΔΔRn1, RΔRn1, ΔCt*ΔΔRn1, ΔCt*RΔRn1, RCt*ΔΔRn1, RCt*RΔRn1)과 각 산출 값들의 C-값 (C-value)을 이용한 상관관계식을 적용한 결과 값이 ‘1’보다 작거나 큰 값으로 구분됨으로써 외산 100% 동형접합자 (B/B homozygote)와 50% 혼합 이형접합자 (A/B heterozygote)를 쉽게 판단할 수 있다. 이형접합자는 1보다 큰 값, 동형접합자는 1보다 작은 값이 얻어진다.
도 3은 100% 국산 참깨 (A/A Homo), 100% 외산 참깨 (B/B Homo), 50% 혼합 참깨 (A/B Hetero)의 gDNA를 CFX96 Real-Time System (Bio-Rad)을 이용하여 3회 반복 분석한 (set 1, 2, 3) 증폭곡선이다. 국산 100% gDNA를 주형으로 분석한 결과는 내부 대조구의 증폭곡선 (-△-)만 확인되며, 50% 혼합 gDNA와 외산 100% gDNA를 주형으로 분석한 결과는 내부 대조구의 증폭곡선 (-△-)과 외산 SNP 형질의 증폭곡선 (-○-)이 동시에 확인된다.
(-△-) : 내부 대조구 (IC)의 증폭곡선, (-○-) : 외산 SNP 형질 (B)의 증폭곡선, (-×-) : 국산 SNP 형질 (A)의 증폭곡선.
표 4는 도 3에서 확인되는 100% 외산 참깨 (B/B Homo)와 50% 혼합 참깨 (A/B Hetero)의 gDNA를 CFX96 Real-Time System (Bio-Rad)을 이용하여 3회씩 반복 분석하고, 그 결과로 얻은 증폭곡선에서 측정된 Ct 값과 형광 값을 이용하여 다양한 상관관계식 및 상대적 계수를 적용한 결과이다. Ct 값과 형광 값 (RFU)을 기반으로 산출된 값들 (ΔCt, RCt, ΔRFU1, RRFU1, ΔCt*ΔRFU1, ΔCt*RRFU1, RCt*ΔRFU1, RCt*RRFU1)과 각 산출 값들의 C-값 (C-value)을 이용한 상관관계식을 적용한 결과 값이 1보다 크면 50% 혼합 이형접합자 (A/B heterozygote)로, 1보다 작으면 외산 100% 동형접합자 (B/B homozygote)로 판단할 수 있다.
도 4는 도 3과 표2에서 확인되는 100% 외산 참깨 (B/B Homo)와 50% 혼합 참깨 (A/B Hetero)의 gDNA를 CFX96 Real-Time System (Bio-Rad)을 이용하여 3회씩 반복 분석하고, 그 결과로 얻은 증폭곡선에서 측정된 Ct 값과 형광 값을 이용하여 상관관계식으로 유전형을 비교한 것이다. Ct 값과 형광 값 (RFU)을 기반으로 산출된 8종류의 값들 (ΔCt, RCt, ΔRFU1, RRFU1, ΔCt*ΔRFU1, ΔCt*RRFU1, RCt*ΔRFU1, RCt*RRFU1)을 각 값들의 평균값인 C-값 (C-value)으로 나눈 값이 1보다 크면 50% 혼합 이형접합자 (A/B heterozygote)로, 1보다 작으면 외산 100% 동형접합자 (B/B homozygote)로 판단할 수 있다. 적용되는 상관관계식에 따라서 유전형의 차이를 확인할 수 있으며 Ct 값과 형광 값을 각각 사용하는 경우보다는 두 값을 함께 이용하는 경우 유전형이 좀 더 명확하게 구분될 수 있다.
도 5는 100% 외산 참깨 (B/B Homo)와 50% 혼합 참깨 (A/B Hetero)의 gDNA를 7500 Real Time PCR System (ABI)을 이용하여 동일한 조건으로 10회씩 반복 분석하고, 그 결과 얻은 증폭곡선에서 측정된 Ct 값과 형광 값을 이용하여 상관관계식 Raf1 (RCt x RΔRn1 / C-value)을 적용한 결과이다. 상관관계식 Raf1을 적용한 결과 값이 이형접합자 [A/B Heterozygote (50%)]는 1.22±0.05이며, 동형접합자 [B/B Homozygote (100%)]는 0.8±0.02로 반복 분석 간의 값의 차이는 크지 않다. 즉 동일한 조건 [분석기기, PCR 반응조건 (온도, 시간) 및 시약 (5x qPCRMix, 10x Primer Mix 등)]의 실시간 중합효소 연쇄반응의 결과는 재현성이 있음을 알 수 있다.
도 6은 분석에 사용된 시약 (5x qPCRMix, 10x Primer Mix)과 분석 일자를 다르게 한 3 배치 (set 1, set 2, set 3) 실험결과를 비교한 것이다. 각 배치에서 100% 외산 참깨 (B/B Homo)와 50% 혼합 참깨 (A/B Hetero)의 gDNA를 7500 Real Time PCR System (ABI)을 이용하여 동일한 조건으로 4회씩 반복 분석하였으며, 각 증폭곡선에서 측정된 Ct 값과 형광 값을 이용하여 상관관계식 Raf1 (RCt x RΔRn1 / C-value)을 적용하였다. 실험 결과, 각 배치별 C-값 (Calculated C-value)은 변화가 있지만 이들의 평균값으로 계산된 C-값 (average C-value)을 적용하는 경우와 결과는 동일함을 알 수 있다.
실시예 2
내부 대조구와 외산 SNP 형질만을 선별하여 증폭할 수 있는 FenDEL 프로브를 이용하여 국산 동형접합자 (A/A homozygote, 국산 100%), 외산 동형접합자 (B/B homozygote, 외산 100%) 및 혼합 이형접합자 (A/B heterozygote, 50%)를 판정하는 실시간 중합효소 연쇄반응에 있어서 주형으로 사용되는 gDNA의 양이 분석결과에 미치는 영향을 파악하기 위한 시험이다. 준비된 참깨 gDNA 5ul (6.9ng)를 사용한 경우와 3ul (4.1ng)를 사용한 경우에 각각 측정된 Ct 값과 형광 값을 이용하여 gDNA의 양이 형질 판정에 미치는 영향을 분석하였다. 이를 위해 CFX96 Real-Time System (Bio-Rad) 분석기기를 사용하였으며, PCR 반응물 조성은 아래와 같다.
<RT-PCR 반응물 조성>
각 반응 튜브에 5ul (6.9ng) 또는 3ul (4.1ng)의 참깨 gDNA와 2ul의 10x 프라이머 혼합물 (primer mix) (10uM의 내부 대조구 전방 프라이머, 10uM의 내부 대조구 후방 프라이머, 1.25uM의 내부 대조구 TaqMan 프로브, 6uM의 표적 유전자 전방 프라이머, 6uM의 표적 유전자 후방 프라이머, 2.25uM의 FenDEL 프로브, 5uM의 표적 유전자 TaqMan 프로브) 그리고 4ul의 5x qPCR Mix와 멸균수를 혼합하여 최종 총 용량 20ul로 맞추었다.
도 7은 100% 국산 참깨 (A/A Homo), 100% 외산 참깨 (B/B Homo), 50% 혼합 참깨 (A/B Hetero)의 gDNA를 각각 6.9ng (set 1, 2), 4.1ng (set 3, 4)씩 사용한 실시간 중합효소 연쇄반응 증폭곡선이다. 국산 100% gDNA를 주형으로 분석한 결과는 내부 대조구의 증폭곡선 (-△-)만 확인되며, 50% 혼합과 외산 100% gDNA를 주형으로 분석한 결과는 내부 대조구의 증폭곡선 (-△-)과 외산 SNP 형질의 증폭곡선 (-○-)이 동시에 확인된다.
(-△-) : 내부 대조구 (IC)의 증폭곡선, (-○-) : 외산 SNP 형질 (B)의 증폭곡선, (-×-) : 국산 SNP 형질 (A)의 증폭곡선
표 5는 도 7에서 확인되는 100% 외산 참깨 (B/B Homo)와 50% 혼합 참깨 (A/B Hetero)의 gDNA를 사용한 실시간 중합효소 연쇄반응 증폭곡선에서 측정된 Ct 값과 형광 값을 이용하여 다양한 상관관계식을 적용한 결과이다. 주형으로 사용된 gDNA 양에 관계없이 Ct 값과 형광 값 (RFU)을 기반으로 산출된 값들 (ΔCt, RCt, ΔRFU1, RRFU1, ΔCt*ΔRFU1, ΔCt*RRFU1, RCt*ΔRFU1, RCt*RRFU1) 및 각 값들의 평균값인 C-값 (C-value)을 이용한 상관관계식을 적용한 결과, 그 값이 1보다 크면 50% 혼합 이형접합자 (A/B heterozygote)로, 1보다 작으면 외산 100% 동형접합자 (B/B homozygote)로 판단할 수 있다.
실시예 3
내부 대조구 (internal control, IC)와 외산 SNP의 형질만을 선별하여 증폭할 수 있는 ARMS 프라이머를 이용한 실시간 중합효소 연쇄반응으로 국산 동형접합자 (A/A homozygote, 국산 100%), 외산 동형접합자 (B/B homozygote, 외산 100%) 및 혼합 이형접합자 (A/B heterozygote, 50%)를 판정하기 위한 시험이다. 분석기기는 7500 Real Time PCR System (ABI)을 사용하였으며, PCR 반응물 조성은 아래와 같다.
<RT-PCR 반응물 조성>
각 반응 튜브에 5ul (1.38ng/ul)의 참깨 gDNA와 2ul의 10x Primer Mix (6uM의 내부 대조구 전방 프라이머, 6uM의 내부 대조구 후방 프라이머, 1uM의 내부 대조구 TaqMan 프로브, 10uM의 표적 유전자 전방 ARMS 프라이머, 10uM의 표적 유전자 후방 프라이머, 5uM의 표적 유전자 TaqMan 프로브) 그리고 4ul의 5x qPCR Mix와 멸균수를 혼합하여 최종 총 용량 20ul로 맞추었다.
도 8은 100% 국산 참깨 (A/A Homo), 100% 외산 참깨 (B/B Homo), 50% 혼합 참깨 (A/B Hetero)의 gDNA를 2회 반복 분석한 (set 1, 2) 증폭곡선이다. 국산 100% gDNA를 주형으로 분석한 결과는 내부 대조구의 증폭곡선 (-△-)만 확인되며, 50% 혼합과 외산 100% gDNA를 주형으로 분석한 결과는 내부 대조구의 증폭곡선 (-△-)과 외산 SNP 형질의 증폭곡선 (-○-)이 동시에 확인된다.
(-△-) : 내부 대조구 (IC)의 증폭곡선, (-○-) : 외산 SNP 형질 (B)의 증폭곡선, (-×-) : 국산 SNP 형질 (A)의 증폭곡선
표 6은 도 8에서 확인되는 100% 외산 참깨 (B/B Homo)와 50% 혼합 참깨 (A/B Hetero)의 gDNA를 2회씩 반복 분석한 다음, 얻은 증폭곡선에서 측정된 Ct 값과 형광 값을 이용하여 다양한 상관관계식을 적용한 결과이다. Ct 값과 형광 값 (ΔRn)을 기반으로 산출된 값들 (ΔCt, RCt, ΔΔRn1, RΔRn1, ΔCt*ΔΔRn1, ΔCt*RΔRn1, RCt*ΔΔRn1, RCt*RΔRn1) 및 각 값들의 평균값인 C-값 (C-value)을 이용한 상관관계식을 적용한 결과, 그 값이 1보다 크면 50% 혼합 이형접합자 (A/B heterozygote)로, 1보다 작으면 외산 100% 동형접합자 (B/B homozygote)로 판단할 수 있다.
실시예 4
외산 SNP 형질을 선별하여 PCR 증폭한 결과 PCR 종료 시점의 형광 값이 내부 대조구의 형광 값보다 큰 반응조건에 적용할 수 있는 이형접합자와 동형접합자 판정 상관관계식을 확인하기 위한 시험이다. CFX96 Real-Time System (Bio-Rad) 분석기기를 사용하였으며, PCR 반응물 조성은 아래와 같다.
<RT-PCR 반응물 조성>
각 반응 튜브에 5ul (1.38ng/ul)의 참깨 gDNA와 2ul의 10x Primer Mix (1.5uM의 내부 대조구 전방 프라이머, 1.5uM의 내부 대조구 후방 프라이머, 1.25uM의 내부 대조구 TaqMan 프로브, 6uM의 표적 유전자 전방 프라이머, 6uM의 표적 유전자 후방 프라이머, 2.25uM의 FenDEL 프로브, 5uM의 표적 유전자 TaqMan 프로브) 그리고 4ul의 5x qPCR Mix와 멸균수를 혼합하여 최종 총 용량 20ul로 맞추었다.
도 9는 100% 국산 참깨 (A/A Homo), 100% 외산 참깨 (B/B Homo)와 50% 혼합 참깨 (A/B Hetero)의 gDNA를 분석한 증폭곡선과 각 증폭곡선에서 측정된 Ct 값과 형광 값을 기초로 SNP 유전자형을 판단하기 위해 상관관계식 Raf2 (RCt / RRFU2 / C-value)를 적용한 결과이다. 상관관계식 Raf2를 적용한 결과, 그 값이 1보다 크면 이형접합자 [A/B Hetero (50%)], 1보다 작으면 동형접합자 [B/B Homo (100%)]임을 알 수 있다.
(-△-) : 내부 대조구 (IC)의 증폭곡선, (-○-) : 외산 SNP 형질 (B)의 증폭곡선, (-×-) : 국산 SNP 형질 (A)의 증폭곡선
실시예 5
외산 SNP 형질의 혼합률을 측정하기 위해서 외산 참깨 gDNA의 혼합률이 각각 70%와 80%인 표준시료의 RCt 값, ΔΔRn 값 그리고 두 값을 함께 이용한 RCt/ΔΔRn 값을 산출하였고, 이를 이용하여 각각의 검량선을 작성하였다. 작성된 각각의 검량선을 기준으로 미지의 시험시료 (실제로는 80% 외산 혼합 시료)의 혼합률을 측정하였다. 분석기기로 7500 Real Time PCR System (ABI)을 사용하였으며, PCR 반응물 조성은 아래와 같다.
<RT-PCR 반응물 조성>
각 반응 튜브에 5ul (1.38ng/ul)의 참깨 gDNA와 2ul의 10x Primer Mix (1uM의 내부 대조구 전방 프라이머, 1uM의 내부 대조구 후방 프라이머, 1.25uM의 내부 대조구 TaqMan 프로브, 10uM의 표적 유전자 전방 프라이머, 10uM의 표적 유전자 후방 프라이머, 2.25uM의 FenDEL 프로브, 3.5uM의 표적 유전자 TaqMan 프로브) 그리고 4ul의 5x qPCR Mix와 멸균수를 혼합하여 최종 총 용량 20ul로 맞추었다.
도 10은 외산 SNP 형질의 혼합률을 측정하기 위한 두 종류의 표준시료 (70% 외산 SNP 형질 혼합, 80% 외산 SNP 형질 혼합)의 증폭곡선 (A)과 외산 80% 혼합시료 5종의 실시간 중합효소 연쇄반응 증폭곡선 (B)이다.
도 11은 표준시료의 실시간 중합효소 연쇄반응 증폭결과 산출된 상대 Ct 값 (RCt), 상대 형광 값 (ΔΔRn2) 및 두 값을 함께 이용한 상관관계 값 (RCt/ΔΔRn2)을 이용하여 각각의 검량선을 작성하고 이 검량선을 이용하여 5종의 외산 80% 혼합시료의 외산 SNP 형질 혼합률을 계산한 결과이다.
(-△-) : 내부 대조구 (IC)의 증폭곡선, (-○-) : 외산 SNP 형질 (B)의 증폭곡선, (-×-) : 국산 SNP 형질 (A)의 증폭곡선
두 종류 표준 시료의 실시간 중합효소 연쇄반응 분석결과 측정되는 Ct 값과 형광 값을 기초로 각각 RCt, ΔΔRn2, RCt/ΔΔRn2 값을 산출하고 [도 11의 (A)], 이 값을 이용하는 세 종류의 검량선 [검량선 1 (RCt 값), 검량선 2 (ΔΔRn2 값), 검량선 3 (RCt/ΔΔRn2 값)]을 각각 작성하였다 [도 11의 (C)]. 그리고 준비된 미지의 시험시료 5종 (실제로는 외산 SNP 형질이 80% 혼합)의 외산 SNP 형질 혼합률을 각각의 검량선을 이용하여 분석하였다 [도 11의 (B)]. 분석 결과, 검량선 1 (RCt 값)을 이용할 경우 혼합률은 평균 74.868% [오차범위 3.294 ~ 8.045(평균 5.132)], 검량선 2 (ΔΔRn2 값)를 이용할 경우 78.752% [0.344 ~ 3.821(평균 2.737)] 그리고 검량선 3 (RCt/ΔΔRn2 값)을 이용할 경우 78.907% [0.114 ~ 2.75 (평균 1.798)] 임을 확인할 수 있다.
도 10 및 도 11에서 확인할 수 있듯이 실시간 중합효소 연쇄반응으로 측정될 수 있는 Ct 값과 형광 값을 기반으로 하는 상대 Ct 값과 상대 형광 값을 이용하여 검량선을 작성할 수 있다. 그러나 상대 Ct 값과 상대 형광 값을 함께 이용한 정량 방식이 실험간 오차를 줄이고 좀 더 정확한 혼합률 산출 결과를 제공할 수 있음을 확인할 수 있다.
Figure PCTKR2018016559-appb-T000001
Figure PCTKR2018016559-appb-T000002
Figure PCTKR2018016559-appb-T000003
Figure PCTKR2018016559-appb-T000004
본 발명은 농산물, 축산물, 수산물 및 이들의 가공품의 품종판별 또는 품종의 혼입도 판별에 이용할 수 있다.
또한, 본 발명은 의학, 법의학 분야 등에 이용할 수 있다.

Claims (17)

  1. 실시간 PCR을 이용하여 돌연변이를 확인하는 방법에 있어서,
    (가) 하나의 튜브 안에서 시험구의 특정한 돌연변이 형질을 선별 증폭하는 실시간 PCR과 상기 특정 돌연변이를 포함하는 유전체 내의 유전자 중 하나를 내부 대조구로 지정하여 내부 대조구에 대한 실시간 PCR을 수행하는 단계;
    (나) 상기 특정 돌연변이 형질에 대한 동형접합자(homozygote) 시료와 이형접합자(heterozygote) 시료가 특정 몰비로 존재하는 표준시료에 대한 실시간 PCR을 상기 (가)와 동일 조건 및 동일 기종으로 수행하는 단계;
    (다) 상기 내부 대조구 PCR과 시험구 PCR에서 측정한 Ct 값 및 PCR 종료 시점의 형광 값인 ΔRn 및 RFU 중 하나 이상을 얻는 단계;
    (라) 내부 대조구 PCR에서 측정한 Ct 값과 시험구 PCR에서 측정한 Ct 값 중 작은 값으로 큰 값을 나눈 값인 RCt (relative Ct), Ct 값 중 큰 값에서 작은 값을 뺀 값인 ΔCt (delta Ct), 형광 값 중 작은 값으로 큰 값을 나눈 값인 RΔRn, RRFU, 형광 값 중 큰 값에서 작은 값을 뺀 값인 ΔΔRn, ΔRFU 및 이들 값을 곱한 값 또는 이들 값을 나눈 값 중 하나 이상의 값을 얻는 단계;
    (마) 상기 표준시료에 대한 PCR 결과 동형접합자 시료 및 이형접합자 시료에 대한 각 Ct 값 및 각 형광 값 ΔRn 및 RFU 중 하나 이상을 얻는 단계;
    (바) 상기 표준시료 중 동형접합자 시료와 이형접합자 시료의 Ct 값, 형광 값인 ΔRn 값 또는 RFU 값, 이들 값의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 상대값을 나눈 값 및 이들 각 값의 평균값인 C-값을 구하는 단계;
    (사) 상기 (라)에서 얻은 내부 대조구와 시험구의 Ct 값, ΔRn 값, RFU 값, 이들의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 이들 상대값을 나눈 값을 각각 상응하는 상기 (바) 단계의 C-값으로 나누는 단계; 및
    (아) 상기 (사) 단계에서 얻은 값이 1보다 큰 경우 이형접합자로, 1보다 작은 경우 동형접합자로 구분하는 단계;를 포함하는 실시간 PCR을 이용하여 돌연변이를 확인하는 방법.
  2. 청구항 1에 있어서,
    상기 돌연변이는 염기의 삽입(insertion), 결실(deletion), 치환(substitution) 및 단일 염기서열 다형성(single nucleotide polymorphism, SNP) 중 어느 하나 이상인 것을 특징으로 하는 방법.
  3. 청구항 1에 있어서,
    상기 돌연변이는 식물, 동물, 미생물, 인체, 농수산물 및 그 가공품에 존재하는 돌연변이임을 특징으로 하는 방법.
  4. 청구항 1에 있어서,
    특정한 돌연변이 형질을 선별 증폭하는 실시간 PCR은 FenDEL-PCR, ARMS-PCR, TaqMan-PCR, MGB-TaqMan-PCR 및 PNA-PCR 중 선택된 하나임을 특징으로 하는 방법.
  5. 청구항 1에 있어서,
    내부 대조구로서 항존 유전자(house keeping gene)를 선택함을 특징으로 하는 방법.
  6. 청구항 1에 있어서,
    상기 (나) 단계, (마) 단계 및 (바) 단계는 여타 단계와 별도로 진행되어 동형접합자 표준시료 및 이형접합자 표준시료에 대한 각 Ct 값 및 각 형광 값 ΔRn 및 RFU 중 하나 이상 또는 표준시료 중 동형접합자 시료와 이형접합자 시료의 Ct 값, 형광 값인 ΔRn 값 또는 RFU 값의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 상대값을 나눈 값의 각 평균값인 C-값이 프로토콜화되어 제공됨을 특징으로 하는 방법.
  7. 상기 청구항 1 내지 청구항 5 중 어느 한 항의 방법을 수행하기 위하여
    내부 대조구에 대한 프라이머 및 프로브;
    동형접합자 시료, 이형접합자 시료를 포함하는 표준시료;
    상기 표준시료에 대한 프라이머 및 프로브; 및
    시험대상 시료의 돌연변이 형질을 구분할 수 있는 프라이머 및 프로브;를 포함하는 것을 특징으로 하는 실시간 PCR 키트.
  8. 상기 청구항 6의 방법을 수행하기 위하여
    동형접합자 표준시료와 이형접합자 표준시료에 대한 각 Ct 값 및 각 형광 값 ΔRn 및 RFU 중 하나 이상 또는 표준시료 중 동형접합자 시료와 이형접합자 시료의 Ct 값, 형광 값인 ΔRn 값 또는 RFU 값, 이들 값의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 상대값을 나눈 값과 이들 각 값의 평균값인 C-값이 기록된 프로토콜;
    내부 대조구에 대한 프라이머 및 프로브; 및
    시험대상 시료의 돌연변이 형질을 구분할 수 있는 프라이머 및 프로브;를 포함하는 것을 특징으로 하는 실시간 PCR 키트.
  9. 실시간 PCR을 이용하여 돌연변이를 확인하는 방법에 있어서,
    (가) 하나의 튜브 안에서 시험구의 특정한 돌연변이 형질을 선별 증폭하는 실시간 PCR과 상기 특정 돌연변이를 포함하는 유전체 내의 유전자 중 하나를 내부 대조구로 하여 내부 대조구에 대한 실시간 PCR을 수행하는 단계;
    (나) 상기 특정 돌연변이 형질에 대한 동형접합자(homozygote) 표준시료와 이형접합자(heterozygote) 표준시료 및 동형접합자와 이형접합자가 특정 몰비로 존재하는 하나 이상의 표준시료에 대한 실시간 PCR을 상기 (가)와 동일 조건 및 동일 기종으로 수행하는 단계;
    (다) 상기 내부 대조구 PCR과 시험구 PCR에서 측정한 Ct 값 및 PCR 종료 시점의 형광 값인 ΔRn 및 RFU 중 하나 이상을 얻는 단계;
    (라) 내부 대조구 PCR에서 측정한 Ct 값과 시험구 PCR에서 측정한 Ct 값 중 작은 값으로 큰 값을 나눈 값인 RCt (relative Ct), Ct 값 중 큰 값에서 작은 값을 뺀 값인 ΔCt (delta Ct), 형광 값 중 작은 값으로 큰 값을 나눈 값인 RΔRn, RRFU, 형광 값 중 큰 값에서 작은 값을 뺀 값인 ΔΔRn, ΔRFU 및 이들 값을 곱한 값 또는 이들 값을 나눈 값 중 하나 이상의 값을 얻는 단계;
    (마) 상기 표준시료에 대한 PCR 이후 각 표준시료에 대한 각 Ct 값 및 각 형광 값 ΔRn 및 RFU 중 하나 이상을 얻는 단계;
    (바) 상기 표준시료 중 동형접합자 표준시료와 이형접합자 표준시료의 Ct 값, 형광 값인 ΔRn 값 또는 RFU 값의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 상대값을 나눈 값의 각 평균값인 C-값을 구하는 단계;
    (사) 상기 (바) 단계에서 얻은 값을 이용하여 상기 표준시료에 대하여 검량곡선을 작성하는 단계;
    (아) 상기 (라) 단계에서 얻은 내부 대조구와 시험구의 Ct 값, ΔRn 값 또는 RFU 값, 이들의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 이들 상대값을 나눈 값을 각각 상응하는 상기 (바) 단계의 C-값으로 나누는 단계; 및
    (자) 상기 (아) 단계에서 얻은 값을 상기 (사) 단계에서 얻은 검량곡선에 대입하여 시험구의 동형접합자/이형접합자 혼합률을 산출하는 단계;를 포함하는 실시간 PCR을 이용하여 특정 돌연변이 혼합률을 확인하는 방법.
  10. 청구항 9에 있어서,
    상기 돌연변이는 염기의 삽입(insertion), 결실(deletion), 치환(substitution) 및 단일 염기서열 다형성(single nucleotide polymorphism, SNP) 중 어느 하나 이상인 것을 특징으로 하는 방법.
  11. 청구항 9에 있어서,
    상기 돌연변이는 식물, 동물, 미생물, 인체, 농수산물 및 그 가공품에 존재하는 돌연변이임을 특징으로 하는 방법.
  12. 청구항 9에 있어서,
    특정한 돌연변이 형질을 선별 증폭하는 실시간 PCR은 FenDEL-PCR, ARMS-PCR, TaqMan-PCR, MGB-TaqMan-PCR 및 PNA-PCR 중 선택된 하나임을 특징으로 하는 방법.
  13. 청구항 9에 있어서,
    내부 대조구로서 항존 유전자(house keeping gene)를 선택함을 특징으로 하는 방법.
  14. 청구항 9에 있어서,
    상기 (나), (마), (바), (사) 단계는 여타 단계와 별도로 진행되어 동형접합자 표준시료, 이형접합자 표준시료 및 동형접합자와 이형접합자가 특정 몰비로 존재하는 하나 이상의 표준시료에 대한 각 Ct 값 및 각 형광 값 ΔRn 및 RFU 중 하나 이상 또는 표준시료 중 동형접합자 시료와 이형접합자 시료의 Ct 값, 형광 값인 ΔRn 값 또는 RFU 값의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 상대값을 나눈 값의 각 평균값인 C-값, 또는 표준시료에 대하여 작성된 검량곡선이 프로토콜화되어 제공됨을 특징으로 하는 방법.
  15. 상기 청구항 9 내지 청구항 13 중 어느 한 항의 방법을 수행하기 위하여
    내부 대조구에 대한 프라이머 및 프로브;
    동형접합자 시료, 이형접합자 시료 및 동형접합자와 이형접합자가 일정 비율로 혼합된 두 개 이상의 혼합시료를 포함하는 표준시료;
    상기 표준시료에 대한 프라이머 및 프로브; 및
    시험대상 시료의 돌연변이 형질을 구분할 수 있는 프라이머 및 프로브;를 포함하는 것을 특징으로 하는 실시간 PCR 키트.
  16. 상기 청구항 14의 방법을 수행하기 위하여
    동형접합자 표준시료, 이형접합자 표준시료 및 동형접합자와 이형접합자가 특정 몰비로 존재하는 하나 이상의 표준시료에 대한 각 Ct 값 및 각 형광 값 ΔRn 및 RFU 중 하나 이상 또는 표준시료 중 동형접합자 시료와 이형접합자 시료의 Ct 값, 형광 값인 ΔRn 값 또는 RFU 값의 상대값인 ΔCt, RCt, ΔΔRn, ΔRFU, RΔRn, RRFU 및 이들 상대값을 곱한 값 또는 상대값을 나눈 값의 각 평균값인 C-값, 또는 표준시료에 대하여 작성된 검량곡선이 기록된 프로토콜;
    내부 대조구에 대한 프라이머 및 프로브; 및
    시험대상 시료의 돌연변이 형질을 구분할 수 있는 프라이머 및 프로브;를 포함하는 것을 특징으로 하는 실시간 PCR 키트.
  17. 청구항 15 또는 청구항 16에 있어서,
    상기 키트는 농산물, 축산물, 수산물 및 이들의 가공품 중 어느 하나의 품종판별 또는 품종의 혼입도 판별용임을 특징으로 하는 실시간 PCR 키트.
PCT/KR2018/016559 2018-02-28 2018-12-24 정성적 또는 정량적 돌연변이 유전형 분석방법 및 이 방법을 수행하기 위한 실시간 pcr 키트 WO2019168261A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2018-0024573 2018-02-28
KR20180024573 2018-02-28
KR10-2018-0167134 2018-12-21
KR1020180167134A KR102084965B1 (ko) 2018-02-28 2018-12-21 정성적 또는 정량적 돌연변이 유전형 분석방법 및 이 방법을 수행하기 위한 실시간 pcr 키트

Publications (1)

Publication Number Publication Date
WO2019168261A1 true WO2019168261A1 (ko) 2019-09-06

Family

ID=67805433

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/016559 WO2019168261A1 (ko) 2018-02-28 2018-12-24 정성적 또는 정량적 돌연변이 유전형 분석방법 및 이 방법을 수행하기 위한 실시간 pcr 키트

Country Status (1)

Country Link
WO (1) WO2019168261A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3839958A1 (de) * 2019-12-20 2021-06-23 Euroimmun Medizinische Labordiagnostika AG Verfahren und vorrichtung zur qualitativen auswertung von real-time pcr daten
CN114457144A (zh) * 2022-03-22 2022-05-10 上海润达榕嘉生物科技有限公司 一种用于靶基因拷贝数检测的方法

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101515861B1 (ko) * 2013-10-18 2015-05-04 경희대학교 산학협력단 배추 속 식물의 외래 유전자 도입 수 확인을 위한 중합효소 연쇄반응 분석 방법
KR20150082848A (ko) * 2014-01-08 2015-07-16 (주) 제노텍 5''-플랩 엔도뉴클레이즈 활성이 억제된 dna 폴리머레이즈를 이용하여 실시간 중합효소 연쇄반응으로 돌연변이 유전자를 검사하는 방법
KR101634958B1 (ko) * 2014-06-13 2016-06-30 한국생명공학연구원 필라그린 유전자 돌연변이 검출용 프로브, 키트 및 방법
KR101775953B1 (ko) * 2016-03-22 2017-09-07 (주) 제노텍 돌연변이 유전자 검사 방법 및 킷트

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101515861B1 (ko) * 2013-10-18 2015-05-04 경희대학교 산학협력단 배추 속 식물의 외래 유전자 도입 수 확인을 위한 중합효소 연쇄반응 분석 방법
KR20150082848A (ko) * 2014-01-08 2015-07-16 (주) 제노텍 5''-플랩 엔도뉴클레이즈 활성이 억제된 dna 폴리머레이즈를 이용하여 실시간 중합효소 연쇄반응으로 돌연변이 유전자를 검사하는 방법
KR101634958B1 (ko) * 2014-06-13 2016-06-30 한국생명공학연구원 필라그린 유전자 돌연변이 검출용 프로브, 키트 및 방법
KR101775953B1 (ko) * 2016-03-22 2017-09-07 (주) 제노텍 돌연변이 유전자 검사 방법 및 킷트

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SCHIAVO, I.: "Development of new molecular diagnostic tests for personalized medicine: analysis of IL 28B polymorphisms and MPL/CALR mutations", P.H..D. THESIS, 2015, pages 1 - 163, XP055633907 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3839958A1 (de) * 2019-12-20 2021-06-23 Euroimmun Medizinische Labordiagnostika AG Verfahren und vorrichtung zur qualitativen auswertung von real-time pcr daten
WO2021123171A1 (de) * 2019-12-20 2021-06-24 Euroimmun Medizinische Labordiagnostika Ag Verfahren zur qualitativen auswertung von real-time pcr daten
CN114457144A (zh) * 2022-03-22 2022-05-10 上海润达榕嘉生物科技有限公司 一种用于靶基因拷贝数检测的方法

Similar Documents

Publication Publication Date Title
Norton et al. Universal, robust, highly quantitative SNP allele frequency measurement in DNA pools
Ahlawat et al. Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes
Alonso et al. Specific quantification of human genomes from low copy number DNA samples in forensic and ancient DNA studies
Wiseman State of the art and limitations of quantitative polymerase chain reaction
WO2019168261A1 (ko) 정성적 또는 정량적 돌연변이 유전형 분석방법 및 이 방법을 수행하기 위한 실시간 pcr 키트
US20110091900A1 (en) Method for determining dna copy number by competitive pcr
WO2018080225A2 (ko) 시식성 파리의 종 구별용 snp 마커 및 이의 용도
KR102084965B1 (ko) 정성적 또는 정량적 돌연변이 유전형 분석방법 및 이 방법을 수행하기 위한 실시간 pcr 키트
CN111793707B (zh) 一种基因编辑转基因作物编辑位点特异性pcr方法及其应用
Mattarucchi et al. Different real time PCR approaches for the fine quantification of SNP's alleles in DNA pools: assays development, characterization and pre-validation
US20050255485A1 (en) Detection of gene duplications
CN116004775A (zh) 一种人运动神经元拷贝数定量的引物探针组合物、试剂盒及方法
WO2022220527A1 (ko) 피부색 판단용 유전자 다형성 마커 및 이의 용도
KR20130075760A (ko) 실시간 ｐｃｒ 분석법에 의한 인삼 품종 판별용 프라이머 및 프로브 세트
US20190284643A1 (en) Materials and methods for detecting source body fluids
Soejima et al. Real-time PCR-based detection of the Alu-mediated deletion of FUT2 (sedel2)
SK284231B6 (en) Method of genetic varietal differentiation of hop
CN105039526B (zh) 基于外源基因旁侧序列鉴定转基因水稻吉生粳2号的方法
WO2022220575A1 (ko) 피부색 판단용 유전자 다형성 마커 및 이의 용도
WO2023106680A1 (ko) 비타민 c를 포함하는 처방의 피부 밝기 변화 예측 방법 및 시스템
US20220017963A1 (en) Methods, Compositions and Systems for Detecting PNPLA3 Allelic Variants
WO2016003047A1 (ko) 디지털 ｐｃｒ을 이용하여 임부의 혈액 또는 혈장으로부터 태아의 유전자 정보를 분석하는 방법
KR102054696B1 (ko) 포도의 위단위결과 무핵 또는 유핵 특성 판별방법
WO2022039336A1 (ko) 바이러스성출혈성패혈증 실시간 rt-pcr 법을 표준으로 하는 목적 질병의 병원체 유전자 검출에서 나타날 수 있는 거짓음성 및 거짓양성 반응 판별 방법
WO2022075747A1 (ko) 인체 모발 탄력 인장강도 관련 유전자 다형성 마커 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18908221

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18908221

Country of ref document: EP

Kind code of ref document: A1