WO2019147014A1 - 연장된 단일 가이드 rna 및 그 용도 - Google Patents

연장된 단일 가이드 rna 및 그 용도 Download PDF

Info

Publication number
WO2019147014A1
WO2019147014A1 PCT/KR2019/000962 KR2019000962W WO2019147014A1 WO 2019147014 A1 WO2019147014 A1 WO 2019147014A1 KR 2019000962 W KR2019000962 W KR 2019000962W WO 2019147014 A1 WO2019147014 A1 WO 2019147014A1
Authority
WO
WIPO (PCT)
Prior art keywords
rna
base
composition
guide rna
sgrna
Prior art date
Application number
PCT/KR2019/000962
Other languages
English (en)
French (fr)
Inventor
김진수
임가영
강범창
류석민
Original Assignee
기초과학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 기초과학연구원 filed Critical 기초과학연구원
Priority to EP19743145.5A priority Critical patent/EP3744844A4/en
Priority to CN201980014548.2A priority patent/CN111742051A/zh
Priority to JP2020561562A priority patent/JP7075170B2/ja
Priority to US16/964,277 priority patent/US20210032621A1/en
Priority to KR1020207021532A priority patent/KR20200103769A/ko
Publication of WO2019147014A1 publication Critical patent/WO2019147014A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • the present invention relates to an extended guide RNA and a composition for correcting a base comprising the same; And a base correction method using the composition for orthodontic treatment and a method for producing a genetically modified animal or plant.
  • the genetic editing technique is based on the recognition of a fragment of bacteriophage by the infection of a bacteriophage, and a caspase 9 (caspase 9 (RNA-guided DNA endonuclease enzyme), which starts with an immune system that cleaves the DNA.
  • caspase 9 RNA-guided DNA endonuclease enzyme
  • the base-editor which is made by modifying the existing CRISPR-Cas9 gene scissors, is a technology that has recently attracted attention in that it can change specific bases without cutting both strands of DNA.
  • the base-pairing gene scissors bind to the target site through sgRNA having a complementary sequence to the target DNA and then bind cytosine (C) to uracil (U) by deaminase, which can act on single- ) Or adenine (A) to hypoxanthine (I).
  • C -> thymine (T), adenine (A) -> guanine (G) as a result of DNA repair and replication during DNA repair and replication.
  • the base editing window in which the base-editor operates is known as the 13th to 17th position from the PAM (Protospacer Adjacent Motif) toward the protospacer, and the efficiency is very low in the off-range.
  • the inventors of the present invention have confirmed that the working range of the base-corrected gene scissors can be further extended when the shape and length of the sgRNA designating the target position of the base- Thereby completing the present invention.
  • the present invention provides an extended guide RNA capable of hybridizing with a target sequence, which comprises 1 to 3 guanines (G) and 1 to 10 nucleotides at the 5 ' Provide orthodontic guide RNA.
  • the present invention also relates to a method for producing a target gene, which comprises (i) a diaminase or a gene encoding the same, (ii) an RNA-guide nuclease or a gene coding therefor and (iii) an extended guide RNA capable of hybridizing with the target sequence, A method for preparing a base composition,
  • the extended guide RNA further comprises 1 to 3 guanines (G) and 1 to 10 nucleotides at the 5 'terminus.
  • the present invention also provides a method for correcting a base comprising the step of introducing the composition for orthodontic treatment into a cell.
  • the present invention also relates to a method for the treatment of cancer, comprising the steps of: (a) introducing the composition for correcting a base into a mammalian embryo or an eukaryotic plant embryo; And (b) growing the embryo to obtain an adult.
  • the present invention also provides a method for producing a mutant mammal or an eukaryotic plant adult.
  • FIG. 1 schematically illustrates Base-Editor operation according to sgRNA length.
  • Deamination may occur in single-stranded DNA exposed after binding to the target site using the conventional method of GX19 sgRNA (a) and extended sgRNA (b).
  • GX19 sgRNA a
  • extended sgRNA b
  • the use of Extended sgRNA increases the single stranded DNA exposed in the 5 'direction from PAM, resulting in a wider range of deamination.
  • FIG. 2 shows changes in the base-editing window according to sgRNA length measured by deep-sequencing each activity in the HEK293T cell line.
  • FIG. 2a shows the ABE 7.10 substitution activity according to the sgRNA length in the HEK2 site at the base position
  • FIG. 2B is a graph showing the relative substitution activity [gX20-30 activity / GX19 activity] compared to the case using GX19 sgRNA
  • FIG. 2C shows the most frequently occurring mutation allele (mutation in WT sequence
  • FIG. 2d is a graph showing BE3 substitution activity according to the base position according to the sgRNA length in the HBB site
  • FIG. 2e shows the relative substitution activity [gX20 ⁇ 30 activity / GX19 activity]
  • FIG. 2F shows the most frequently occurring mutation allele (WT sequence (The base-editing window, which is known to work efficiently when using the GX19 sgRNA, is shown in light blue).
  • FIG. 3 shows changes in the baseediting window when sgRNA containing one or two additional mismatches G was measured by deep-sequencing each activity in the HEK293T cell line.
  • Figs. 3a and 3c show the sgRNA length
  • FIG. 3B and FIG. 3D show the relative substitution activity [gX20 ⁇ 30 activity / GX19 activity (GX19 activity / GX19 activity) compared with the GX19 sgRNA using FANCF site (a) ] Are shown in the FANCF site (b) and the HBB site (d).
  • FIG. 4 shows changes in the base-editing window according to the sgRNA length at four different sites measured by the deep-sequencing method for each activity in the HEK293T cell line.
  • FIG. 4A shows the results of using GX19 sgRNA at four sites
  • FIG. 4B is a graph showing the relative substitution activity [gX20 ⁇ 30 activity / GX19 activity] of ABE 7.10 relative to that when using GX19 sgRNA. / GX19 activity] (a blue-colored base-editing window known to work efficiently when using GX19 sgRNA).
  • Figure 5 shows the activity of the base-editing window according to the sgRNA type in rapeseed and soybean, analyzed by deep-sequencing.
  • Figure 5a shows that the gX19 sgRNA and gX20 sgRNA in the rapeseed protoplast were detected with the AID2 cytosine base-editor 5b shows the change of the allele with the most frequent mutation depending on the type of sgRNA (when the gX20 sgRNA is used, only the TAG stop codon is used)
  • FIG. 5c shows the substitution efficiency according to the cytosine position when the gX19 sgRNA and gX20 sgRNA were used together with the AID2 cytosine baseeditor in the protoplast of the soybean
  • FIG. 5d shows the results of substitution It is a variation of the allele in which mutations are introduced frequently (we can see that a TAG stop codon is produced only when using gX20 sgRNA).
  • FIG. 6 shows the change of the base-editing window according to the sgRNA type in a mouse. After microinjection of ABE 7.10 mRNA with different kinds of sgRNA into mouse embryo, deep- FIG. 6B shows the result of analysis of the microinjection of embryo with ABE 7.10 mRNA using GX21 sgRNA. As a result, three pups with the desired H420R mutation were obtained.
  • the present invention proposes a technique that can broaden the working range of the base-corrected gene scissors by modifying the shape and length of the sgRNA that specifies the target position of the base-corrected gene scissors (Fig. 1B).
  • deamination can occur in single-stranded DNA exposed after binding to the target site when using the conventional method GX19 sgRNA (a) and extended sgRNA (b).
  • GX19 sgRNA a
  • extended sgRNA b
  • the use of Extended sgRNA increases the single stranded DNA exposed in the 5 'direction from PAM, resulting in a wider range of deamination.
  • the new method adds two mismatch guanines (G) in front of 20 nucleotides in the 5' Or extended gsX20 form of gX21 to gX30 using 21 to 30 nucleotide sequences.
  • G mismatch guanines
  • the HEK293T cell was tested for HEK2 site with ABE (Adenosine Base Editor) and extended sgRNA.
  • the extended guide RNA of the present invention may be single guide RNA (sgRNA).
  • the extended guide RNA may be a conventional guide RNA, for example, sgRNA (the targeting sequence is 20 nt, of which the first nucleotide at the 5 'end matches guanine (G) or miss 1 to 10 nucleotides (each independently selected from among A, T, C, and G) at the 5 'end of the corresponding DNA target sequence (which may be a match (non-complementary) guanine (g) Which may be complementary to the sequence of SEQ ID NO: 1).
  • sgRNA the targeting sequence is 20 nt, of which the first nucleotide at the 5 'end matches guanine (G) or miss 1 to 10 nucleotides (each independently selected from among A, T, C, and G) at the 5 'end of the corresponding DNA target sequence (which may be a match (non-complementary) guanine (g) Which may be
  • the extended sgRNA may further comprise 1 to 3 matches (complementary to the corresponding DNA target sequence) at the 5 'end or guanine (G) to mismatch (non-complementary to the corresponding DNA target sequence).
  • the 1-10 random nucleotides additionally contained at the 5 'end may be complementary sequences to the target DNA sequence of the target site, and thereby the single strand DNA exposed in the 5' direction from the PAM at the target site (For example, a mutation (basal correction) may be introduced at the 18-30 nt or 18-22 nt position from the PAM in the 5 'direction at the target site) (See FIG.
  • the present invention relates to a method for screening for a target gene comprising (i) a diaminase or a gene encoding the same, (ii) an RNA-guide nuclease or a gene encoding the same, and (iii) To a base composition for orthodontic treatment.
  • a method for screening a target gene which comprises (1) a diaminase and a gene encoding the same, (2) a target specific nuclease (RNA-guide nuclease) (Or a recombinant vector comprising the coding DNA) of a guide RNA or a coding DNA thereof capable of hybridizing (or having a complementary nucleic acid sequence) with the target region of the target RNA.
  • RNA-guide nuclease Or a recombinant vector comprising the coding DNA of a guide RNA or a coding DNA thereof capable of hybridizing (or having a complementary nucleic acid sequence) with the target region of the target RNA.
  • the guide RNA may be selected from among 1 to 10 nucleotides (each independently selected from A, T, C and G) at the 5 'end of a conventional guide RNA, for example, sgRNA, which may optionally be complementary to the corresponding target sequence, optionally further comprising an extension comprising 1 to 3 matches or mismatching guanines (G) at the 5'end of the sgRNA, Lt; / RTI > guide RNA.
  • sgRNA which may optionally be complementary to the corresponding target sequence, optionally further comprising an extension comprising 1 to 3 matches or mismatching guanines (G) at the 5'end of the sgRNA, Lt; / RTI > guide RNA.
  • the composition for correcting a base may be one having a base-fixing (e. G., Base substitution) activity in eukaryotic cells.
  • the eukaryotic cell may be a cell of an eukaryotic animal, such as an embryonic cell, or an eukaryotic plant (e. G., Algae, monocotyledons, dicotyledonous plants, etc.), and in one embodiment, a mammalian cell such as a mammalian embryonic cell, It can be a cell of an eukaryotic plant.
  • the coding gene used herein can be used in the form of cDNA, rDNA or a recombinant vector containing it, or mRNA.
  • the diaminase generally refers to an enzyme having activity to remove an amine group from a specific base in eukaryotic cells, for example, a cytidine diaminase and / or an adenosine diaminase which converts cytidine to uridine.
  • the diaminase may be at least one selected from the group consisting of APOBEC1 (apolipoprotein B editing complex 1), activation-induced deaminase (AID), and tadA (tRNA-specific adenosine deaminase) .
  • APOBEC1 apolipoprotein B editing complex 1
  • AID activation-induced deaminase
  • tadA tRNA-specific adenosine deaminase
  • the composition for orthodontic treatment comprises (1) a diaminase or a gene encoding it (a recombinant vector comprising mRNA or a coding DNA), (2) an RNA-guide nuclease or a gene encoding the same (4) a uracil DNA glycosylase inhibitor (UGI) or a recombinant vector encoding the same, in addition to an extended guide RNA or a gene (DNA) encoding the same. And / or (5) Nuclear Locating Sequence (NLS) or a gene encoding the same.
  • a diaminase or a gene encoding it a recombinant vector comprising mRNA or a coding DNA
  • UMI uracil DNA glycosylase inhibitor
  • NLS Nuclear Locating Sequence
  • a linker suitable for at least one of the protein or gene for example, between the diaminase and the RNA-guide nuclease, between the nuclease and the UGI, and between UGI and NLS (in the case of a fusion protein, a peptide linker -30, or 3-20 amino acids), and in the case of a fusion gene an oligonucleotide linker (9-90 or 9-60 nt).
  • the RNA-guided nuclease may be a modified RNA-guided nuclease modified to lose gene duplex cleavage activity.
  • the modified RNA-guided nuclease may be a modified Cas9 (CRISPR-related protein 9) or a modified Cpf1 (Prevotella and Francisella 1 derived CRISPR) system modified to nick (nick) one strand of the target gene.
  • the modified RNA-guide nuclease may be selected from the group consisting of Cas9 nickase (nCas9) or catalytically-deficient Cas9 (dCas9).
  • the coding gene when the composition for base correction comprises a diaminase coding gene and an RNA-guide nuclease coding gene, the coding gene may be a coding DNA or an mRNA.
  • the diaminase coding gene and the RNA-guide nuclease coding gene may be contained in the form of mRNA, or a recombinant vector containing the gene (DNA) in a separate vector (that is, A recombinant vector comprising a recombinant vector and an RNA-guided nuclease-encoding DNA) or in the form of a recombinant vector contained together in one vector.
  • the guide RNA may be a double guide RNA comprising a CRISPR RNA (crRNA), a trans-activating crRNA (tracrRNA), a crRNA and a tracrRNA (a complex of crRNA and tracrRNA), or a single guide RNA (sgRNA).
  • the composition for orthodontics comprises a diamine and a ribon comprising a guide RNA and a mRNA encoding a modified RNA-guide nuclease, or a ribonucleotide comprising a diaminase and a modified RNA-guide nuclease and a guide RNA And may include ribonucleoprotein (RNP).
  • RNP ribonucleoprotein
  • the ribonucleic acid protein may include a mixture of a diaminase and a modified RNA-guide nuclease and a guide RNA, or in the form of a complex in which a diaminase and a modified RNA-guide nuclease are combined with a guide RNA .
  • the present invention relates to a method for correcting a base comprising the step of introducing the composition for orthodontic treatment into a cell.
  • Another example provides a method of base correction comprising the step of introducing the composition for orthodontic treatment into a cell.
  • the cell may be a eukaryotic cell, and the method may be to perform base correction (e. G., Base substitution) in eukaryotic cells.
  • base correction e. G., Base substitution
  • the eukaryotic cell may be a cell of an eukaryotic animal, such as an embryonic cell of an eukaryotic animal, and / or an eukaryotic plant cell, and in one embodiment may be a mammalian cell such as a mammalian germ cell, and / or an eukaryotic plant cell .
  • the above-mentioned base correction method is a method of generating a termination codon in a gene (for example, a coding sequence) by base substitution to knock-out the gene, introducing a mutation into a noncoding DNA sequence that does not generate a protein
  • a mutation can cause a variety of mutations.
  • a base range correction can be performed by increasing sgRNA length based on the above, and examined in rapeseed (Brassica napus) and soybean (Glycine max).
  • GX19 and gX20 sgRNAs capable of targeting the herbicide resistance gene ALS gene were transfected into AID2 Base-Edito in a protoplast derived from cotyledon of rapeseed.
  • Fig. 5A the cytosine at position 20 was changed to thymine
  • the STOP codon was generated and the gene could be knocked out (Fig.
  • the present invention provides, in a further aspect, a method for preparing a base composition comprising: (a) introducing the composition for correcting a base into a mammalian embryo or an eukaryotic plant embryo; And (b) growing the embryo to obtain an adult.
  • the present invention also relates to a method for producing a mutant mammal or an eukaryotic plant adult except for a human.
  • composition for orthodontic treatment of the present invention can be applied to a mammalian embryo or an eukaryotic plant embryo, so that it can be usefully applied to the production of a mammalian or eukaryotic plant adult in which a desired gene is inactivated or a desired mutation is induced.
  • the step of introducing a base-fixing composition into the cell may comprise adding to the cell a diaminase or diaminase coding gene, an RNA-guide nuclease or an RNA-guide nuclease coding gene and an extended guide RNA or an extended guide RNA coding gene.
  • One or more of the coding genes may be incorporated into each other or contained in one recombinant vector.
  • the direct injection may be in the form of a mixture or complex comprising the diamines of the 2), the RNA-guide nuclease, and the extended guide RNA (e.g., diaminase, RNA-guide nuclease, Or 3) the diaminase-coding mRNA, RNA-guide nuclease coding mRNA and extended guide RNA of the ribonucleic acid protein of the genome, And may be performed, for example, by electroporation, lipofection, microinjection, or the like.
  • the extended guide RNA e.g., diaminase, RNA-guide nuclease, Or 3
  • the diaminase-coding mRNA, RNA-guide nuclease coding mRNA and extended guide RNA of the ribonucleic acid protein of the genome and may be performed, for example, by electroporation, lipofection, microinjection, or the like.
  • the genetically modified cell may be a cell in which a base substitution, such as a single base substitution or a point mutation, occurs in the target gene by the base correction.
  • the cell may be a eukaryotic cell.
  • the eukaryotic cell may be a cell of an eukaryotic animal, such as an embryonic cell, and / or an eukaryotic plant cell, and in one embodiment may be a mammalian cell, including, but not limited to, a human or a mammalian cell other than a human, Embryonic cells, and / or eukaryotic plant cells.
  • Another example includes transplanting a transgenic mammal embryo injected with a composition for the base correction or a transgenic mammalian embryo comprising a base that has been corrected by the method of base-pairing, to the oviduct of a mammal to produce a transgenic animal , And a method for producing a transgenic animal.
  • the genetically modified mammal may be an animal resulting from an embryo in which a base substitution, for example, a single base substitution or point mutation, has occurred in the target gene by the above base correction.
  • the mammal transplanted with the embryo cell into the fallopian tube may be a mammal of the same species (foster mother) as the mammal from which the embryo cell is derived.
  • transgenic animal obtained from said transgenic cell.
  • the transgenic animal may be one produced by the method for producing the transgenic animal.
  • the animal may be an eukaryotic animal, such as a human, or a mammal other than a human.
  • the cells to which the composition for orthodontic treatment is applied may be eukaryotic cells such as eukaryotic animal cells.
  • the eukaryotic animal may be a primate such as a human, a mammal including a rodent such as a mouse, and the like.
  • the eukaryotic animal cell may be a mammalian embryo.
  • the embryo may be a fertilized embryo obtained by crossing a male mammal with a superovulation-induced female mammal (for example, induction of superovulation by gonadal hormone injection such as PMSG (Pregnant Mare Serum Gonadotropin) or hCG (human Coldinic Gonadotropin) May be obtained from the oviduct of the female mammal.
  • the embryo to which the base composition is applied (injected) may be a zygote of a modified 1-celloma.
  • the term " base editing " refers to a base mutation (substitution, deletion, substitution, deletion, insertion, Deletion or addition), which can be distinguished from gene editing involving a relatively large number of base mutations in that only a few bases (one or two bases, e.g. one base) are mutated.
  • the base correction may be one which does not involve double-stranded DNA cleavage of the gene.
  • the opposite strand of the nicked DNA strand (the strand opposite to the strand where the PAM sequence is located, the strand to which the guide RNA binds (hybridizes)) (Base mutation or base substitution; mutation by A or C deamination) can occur.
  • base correction base modification or base substitution
  • base correction occurs at the 17th nucleotide in the 5 'direction from PAM.
  • Base correction can also occur in the extended range from the 18th to the 30th, the 18th to the 25th, or the 18th to the 22th positions from the 17th and subsequent positions in the 5 'direction from the PAM, for example, from the PAM in the 5' direction .
  • &quot means that a mutation (e.g., substitution) has occurred in a nucleotide comprising the base, and the term " nucleotide mutation (or nucleotide substitution) " , And such base mutations can occur in one or both of the alleles.
  • the base mutation or the accompanying base correction can result in a termination codon at the target site, or a codon that encodes a wild-type and other amino acid, thereby knocking out the target gene, but not limited to, introducing a mutation into a noncoding DNA sequence that does not result in the production of the DNA sequence.
  • the base correction or base mutation may be performed in vitro or in vivo .
  • &quot means a sequence of a nucleotide comprising the base, which may be used in the same sense as a nucleotide sequence or a nucleic acid sequence.
  • a 'target gene' refers to a gene to be subjected to base correction (or base mutation)
  • a 'target site or target region' refers to a target specific target Refers to a site where base correction by an anti-nuclease is performed.
  • the target specific nuclease includes an RNA-guided engineered nuclease (RGEN)
  • RGEN RNA-guided engineered nuclease
  • the target gene Double-stranded or double-stranded
  • PAM sequence RNA-guided nuclease-recognizing sequence
  • the target specific nuclease when it comprises an RNA-guided nuclease, it may comprise, along with the RNA-guided nuclease, a guiding RNA comprising a targeting sequence.
  • the 'targeting sequence' may be a (hybridizable) region of the guide RNA comprising a nucleotide sequence complementary to the nucleotide sequence of a site comprising about 20 consecutive nucleotides (nt) in the target site.
  • the extended guide RNA described herein further comprises 1-10 additional optional nucleotides at the 5 'end (selected from A, T, C, G; for example, may be a complementary sequence to the corresponding target sequence) And / or comprise 1-3 additional matching or mismatched guanines at the 5 'end.
  • the 1-10 additional optional nucleotides at the 5 'end may be complementary sequences to sequences of the extended target DNA region corresponding thereto, whereby a single strand in which the PAM is exposed in the 5' direction at the target site By extending the length of the DNA, deamination can take place in a wider range.
  • the base sequence of the target region including the base sequence complementary to the targeting sequence can be referred to as a 'target sequence', and the target sequence can be referred to as a 5 'region of the PAM sequence recognized by the RNA- Terminus and / or a contiguous nucleotide sequence of about 20 nt in length contiguous to the 3 ' end, or a corresponding site of the complementary strand.
  • the diaminase generally refers to an enzyme having activity to remove an amine group from a specific base in eukaryotic cells, for example, a cytidine diaminase and / or an adenosine diaminase which converts cytidine to uridine.
  • the diaminase may be at least one selected from the group consisting of APOBEC (apolipoprotein B mRNA editing enzyme, catalytic polypeptidelile), AID (activation-induced deaminase), tadA (tRNA-specific adenosine deaminase) But is not limited to.
  • the APOBEC1, AID, and tadA may be derived from eukaryotic animals such as mammals such as primates including humans such as E. coli or primates including humans and rodents including mice.
  • the diaminase may be used in the form of a protein, a gene (for example, DNA or mRNA) encoding the protein, or a recombinant vector containing the gene.
  • a target-specific nuclease is also referred to as programmable nuclease and refers to any form capable of recognizing a specific position on a desired genomic DNA and cleaving (single strand cleavage or double strand cleavage) (E. G., Endonuclease). ≪ / RTI >
  • the target-specific nuclease may be one or more selected from all nuclease capable of recognizing a specific sequence of a target gene and having a nucleotide-cleaving activity and causing indel (insertion and / or deletion, Indel) in the target gene .
  • the target-specific nuclease may be one or more selected from the group consisting of RGEN (RNA-guided engineered nuclease; e.g. Cas protein (e.g., Cas9 etc.), Cpf1, etc.) derived from CRISPR But is not limited thereto.
  • RGEN RNA-guided engineered nuclease; e.g. Cas protein (e.g., Cas9 etc.), Cpf1, etc.) derived from CRISPR But is not limited thereto.
  • the target specific nuclease may recognize a specific nucleotide sequence in the genome of an animal, including a prokaryotic cell, and / or a human cell, such as an eukaryotic cell (e. G., Eukaryotic cell) to cause a double strand break (DSB).
  • a prokaryotic cell e. G., Eukaryotic cell
  • the double helix cleavage can cut the double helix of DNA to produce a blunt end or a cohesive end.
  • DSBs can be efficiently repaired by homologous recombination or non-homologous end-joining (NHEJ) mechanisms in cells, where desired mutations can be introduced into the target site.
  • NHEJ non-homologous end-joining
  • the target-specific nuclease is selected from the group consisting of Cas protein (e.g., Cas9 protein (CRISPR (Clustered regularly interspersed short palindromic repeats) associated protein 9), Cpf1 protein (CRISPR from Prevotella and Francisella 1) And / or a nuclease associated with a CRISPR system of type V (e. G. Endonuclease), and the like.
  • the target specific nuclease further comprises a target DNA-specific guide RNA for directing to a target site of the genomic DNA.
  • the guide RNA may be transcribed in vitro, and may be, for example, an oligonucleotide double strand or a plasmid template, but is not limited thereto.
  • the target specific nuclease may act in the form of a ribonucleic acid protein (RNP) by in vitro or in vivo (intracellular) delivery followed by RNAGuided Engineered Nuclease coupled to a guide RNA.
  • RNP ribonucleic acid protein
  • Cas proteins are a major protein component of the CRISPR / Cas system and are capable of forming an activated endonuclease or nickase.
  • Cas protein or gene information can be obtained from known databases such as GenBank of the National Center for Biotechnology Information (NCBI).
  • the Cas protein may be selected from the group consisting of Streptococcus sp.
  • Campylobacter genus for example, Campylobacter Jeju Needle (Campylobacter jejuni ) Cas proteins, such as Cas9 protein; Cas proteins derived from Streptococcus such as Streptococcus thermophiles or Streptocuccus aureus such as Cas9 protein; Neisseria Meningidithis Casing proteins derived from the meningitidis , such as Cas9 protein; Cas proteins from the genus Pasteurella , such as Pasteurella multocida , such as Cas9 protein; The genus Francisella , for example, Francisella novicida- derived Cas proteins, such as Cas9 protein, and the like, but are not limited thereto.
  • the Cpf1 protein is an endonuclease of the novel CRISPR system that is distinct from the CRISPR / Cas system, and is relatively small in size as compared to Cas9, does not require tracrRNA, and can function by a single guide RNA.
  • it recognizes thymine-rich protospacer-adjacent motif (PAM) sequences and cuts double strands of DNA to produce a cohesive end (cohesive double-strand break).
  • PAM thymine-rich protospacer-adjacent motif
  • the Cpf1 protein is Pseudomonas as Candida tooth (Candidatus), A la pants Spira (Lachnospira), A beauty Lee V. (Butyrivibrio) in, Ferre Greenwich bacteria (Peregrinibacteria), axial domino nose kusu (Acidominococcus) in, formate pie ( Porphyromonas spp., Prevotella spp., Francisella spp., Candidatus spp.
  • Methanoplasma or Eubacterium genus; for example, Parcubacteria bacterium (GWC2011_GWC2_44_17), Lachnospiraceae bacterium (MC2017), Butyrivibrio proteoclasicus , Peregrinibacteria bacterium (GW2011_GWA_33_10), Acidaminococcus sp. (BV3L6), Porphyromonas macacae, Lachnospiraceae bacterium (ND2006), Porphyromonas crevioricanis , Prevotella disiens , Moraxella bovoculi (237), Smiihella sp.
  • SC_KO8D17 Leptospira inadai , Lachnospiraceae bacterium (MA2020), Francisella novicida (U112), Candidatus Methanoplasma termite, Candidatus Paceibacter , Eubacterium eligens, and the like, but the present invention is not limited thereto.
  • the target specific nuclease may be isolated from the microorganism or nonnaturally occurring such as recombinant or synthetic methods.
  • the target specific nuclease may be used in the form of a mRNA previously transcribed in vitro or a pre-produced protein form, or a form contained in a recombinant vector for expression in a target cell or in vivo.
  • the target specific nuclease e.g., Cas9, Cpf1, etc.
  • Recombinant DAN refers to a DNA molecule artificially created by genetic recombination methods, such as molecular cloning, to include heterologous or homologous genetic material obtained from a variety of organisms.
  • the target-specific nuclease may be a mutated form of a mutated target-specific nuclease.
  • the mutated target specific nuclease may mean that the mutant target nuclease is mutated to lose the endonuclease activity that cleaves the double strand of the DNA.
  • a mutant target that has lost endonuclease activity and is mutated to have a nuclease activity A specific nuclease and a mutated target specific nuclease which is mutated to lose both endonuclease activity and niacase activity.
  • the base conversion is sequentially or sequentially carried out with the base conversion by the diaminase (for example, conversion to cytidine is uradine)
  • Nicks can be introduced in the strand or the opposite strand (e.g., the opposite strand of the strand where the base conversion takes place) (e.g., at the opposite strand of the strand where the PAM is located, at the 5 ' A nick is introduced at the position corresponding to the position between the fourth nucleotide).
  • Such a variation of the target specific nuclease may be that occurring at least in the catalytic domain of the nuclease (e.g., the RuvC catalytic domain in the case of Cas9).
  • the mutation is catalytic aspartate residue (catalytic aspartate residue Aspartic acid (D10) of the 986th position, glutamic acid (E762) at the 762nd position, histidine (H840) at the 840th position, asparagine (N854) at the 854th position, asparagine Acid (D986), and the like.
  • catalytic aspartate residue catalytic aspartate residue Aspartic acid (D10) of the 986th position, glutamic acid (E762) at the 762nd position, histidine (H840) at the 840th position, asparagine (N854) at the 854th position, asparagine Acid (D986), and the like.
  • any other amino acid to be substituted may be alanine, but is not limited thereto.
  • the mutation target-specific nuclease may be mutated to recognize a PAM sequence that is different from the wild-type Cas9 protein.
  • the mutation target-specific nuclease may include at least one of an aspartic acid (D1135) at position 1135, arginine at position 1335 (R1335), and threonine at position 1337 (T1337) of Cas9 protein derived from Streptococcus pyoensis , Such as all three of which are mutated to recognize an NGA (N is any base selected from A, T, G, and C) that is different from the PAM sequence (NGG) of wild-type Cas9.
  • NGA is any base selected from A, T, G, and C
  • the mutation target specific nuclease is selected from the amino acid sequence of Cas9 protein from Streptococcus fyiensense,
  • the 'other amino acids' include, but are not limited to, alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, valine, aspartic acid, cysteine, glutamine, glycine, serine, threonine, tyrosine, aspartic acid, Arginine, histidine, lysine, and any of the known variants of the above amino acids, amino acids other than the amino acids that the wild-type protein originally has at the mutation position.
  • the 'other amino acid' may be alanine, valine, glutamine, or arginine.
  • the modified Cas9 protein is a Cas9 protein derived from Streptococcus pyogenes,
  • a strain Cas9 having a mutation (for example, substitution with another amino acid) at the position of D10 or H840 to lose endonuclease activity and having a niacase activity or a Cas9 protein derived from Streptococcus pyogenes
  • Mutations of (1) and (2) are all introduced to recognize PAM sequences having a nicase activity and different from wild type, or to lose endonuclease activity and niacase activity and recognize PAM sequences that are different from wild type Gt; Cas9 < / RTI > protein.
  • a mutation at the D10 position of the CAs9 protein may result in a D10A mutation
  • nuclease &quot means, unless otherwise stated, a " target specific nuclease ", such as Cas9, Cpf1,
  • the nuclease may be isolated from microorganisms or artificially or non-naturally occurring such as recombinant or synthetic methods.
  • the nuclease e.g., Cas9, Cpf1, etc.
  • the nuclease may be a recombinant protein made by recombinant DNA.
  • Recombinant DNA refers to DNA molecules artificially created by recombinant methods such as molecular cloning to include heterologous or homologous genetic material obtained from various organisms.
  • the nuclease may be selected from the group consisting of a protein, a nucleic acid molecule (for example, DNA or mRNA) encoding the same, a ribonucleic acid protein bound to a guide RNA, a nucleic acid molecule encoding the ribonucleic acid protein, or a recombinant vector Can be used.
  • the diamines and nuclease, and / or nucleic acid molecules encoding them may be in a form that can be delivered into the nucleus, acted on, and / or expressed in the nucleus.
  • the diamines and nuclease can be in a form that is easy to introduce into cells.
  • the diamines and nuclease can be linked to a cell penetration peptide and / or protein transduction domain.
  • the protein transfer domain may be a poly-arginine or a TAT protein derived from HIV, but is not limited thereto.
  • Various types of cell penetrating peptide or protein transfer domains other than the above-described examples are well known in the art, so that a person skilled in the art can apply various examples without limitation to the above examples.
  • the diamines and nucleases and / or nucleic acid molecules encoding the same may further comprise a nuclear localization signal (NLS) sequence or a nucleic acid sequence encoding the same.
  • NLS nuclear localization signal
  • the expression cassette comprising the diaminase-encoding nucleic acid molecule and / or nuclease-encoding nucleic acid molecule may comprise a regulatory sequence such as a promoter sequence for expressing the diaminase and / or nuclease and optionally an NLS sequence CCCAAGAAGAAGAGGAAAGTC: SEQ ID NO: 2).
  • NLS sequences are well known in the art.
  • the diamines and nucleases and / or nucleic acid molecules encoding the same may be linked to tags for separation and / or purification, or nucleic acid sequences encoding the tags.
  • the tag may be appropriately selected from the group consisting of a small peptide tag such as a His tag, a Flag tag, and an S tag, a GST (Glutathione S-transferase) tag, an MBP (Maltose binding protein) tag, It is not limited.
  • composition for correcting a base used in the present invention may contain a uracil DNA glycosylase inhibitor (UGI) or a gene encoding the Uracil DNA glycosylase inhibitor (UGI), such as a recombinant vector form containing coding DNA or an in vitro transcribed mRNA form May be further included.
  • UMI uracil DNA glycosylase inhibitor
  • Uracil DNA glycosylase inhibitor a gene encoding the Uracil DNA glycosylase inhibitor
  • composition for orthodontic treatment further comprises a uracil DNA glycosylase inhibitor, a specific base substitution by a diaminase (for example, a C to T substitution by a cytosine diaminase) , And when the uracil DNA glycosylase inhibitor is not further contained, the base substitution ratio of the form other than the specific base substitution (for example, C to T substitution by the cytosine diaminase) becomes high (that is, ≪ / RTI >
  • the term " guide RNA " refers to an RNA comprising a targeting sequence capable of hybridizing to a specific base sequence (target sequence) in a target region in a target gene, and may be in vitro or in vivo Or cells), such as cas proteins, Cpf1, and the like, and directs them to a target gene (or target site).
  • the guide RNA may be appropriately selected depending on the kind of nuclease to be complexed and / or the microorganism derived therefrom.
  • RNA crRNA
  • a trans-activating crRNA comprising a site that interacts with a nocrease such as Cas protein, Cpf1, etc.
  • a single guide RNA in the form of fusion of the major parts of the crRNA and the tracrRNA (for example, a crRNA site including a targeting sequence and a site of a tracrRNA interacting with a nuclease)
  • a dual RNA comprising CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA), or a single guide RNA (sgRNA) comprising a major region of a crRNA and a tracrRNA.
  • crRNA CRISPR RNA
  • tracrRNA trans-activating crRNA
  • sgRNA single guide RNA
  • the sgRNA is a part having a sequence (a targeting sequence) complementary to a target sequence in a target gene (also referred to as a target DNA recognition sequence, a base pairing region, etc.) and a hairpin structure . ≪ / RTI > More specifically, it may include a portion including a sequence complementary to the target sequence in the target gene (targeting sequence), a hairpin structure for cas protein binding, and a terminator sequence.
  • the structures described above may be sequentially present in the order of 5 'to 3', but are not limited thereto. Any type of guide RNA can be used in the present invention if the guide RNA comprises a major portion of the crRNA and tracrRNA and a complementary portion of the target DNA.
  • the Cas9 protein contains two guide RNAs, a CRISPR RNA (nucleotide sequence) capable of hybridizing with the target region of the target gene and a trans-activating crRNA
  • CRISPR RNA nucleotide sequence
  • tracrRNAs can be used in the form of a double-stranded crRNA: tracrRNA complex linked to each other or in the form of a single guide RNA (sgRNA) linked through a linker.
  • sgRNA single guide RNA
  • the sgRNA comprises at least a portion of the crRNA comprising the hybridizable nucleotide sequence of the crRNA, and a portion of the tracrRNA portion comprising at least a site that interacts with the Cas9 protein of the cas9 tracrRNA Or all may form a hair-pin structure (stem-loop structure) through the nucleotide linker (the nucleotide linker may correspond to a loop structure).
  • the guide RNA specifically a crRNA or an sgRNA, comprises a sequence complementary to a target sequence in a target gene (targeting sequence), and includes at least one upstream region of a crRNA or sgRNA, specifically at the 5 'end of a sRNA or dualRNA crRNA, , 1-10, 1-5, or 1-3 additional nucleotides.
  • the additional nucleotide may be, but is not limited to, guanine (G).
  • the guide RNA may contain crRNA and may be appropriately selected according to the kind of Cpf1 protein to be complexed and / or the microorganism derived therefrom.
  • the specific sequence of the guide RNA can be appropriately selected according to the kind of nuclease (Cas9 or Cpf1) (that is, the derived microorganism), and it can be easily determined by those skilled in the art to be.
  • the sgRNA when the Cas9 protein from Streptococcus pyogenes is used as the target specific nuclease, the sgRNA can be represented by the following general formula 1:
  • the guide RNA may be represented by the following general formula 1:
  • N cas9 ) l is a targeting sequence in which N cas9 binds (hybridizes) to a target site of a target gene, and its nucleic acid sequence is determined according to the sequence of the target site (that is, , L represents the number of nucleotides contained in the targeting sequence and may be 20, and the first nucleic acid from the 5'-terminus may be a guanine (designated G) that matches the target site sequence (C)) or mismatching guanine (expressed in g; the corresponding position of the target site is not cytosine (C));
  • the oligonucleotide linker may contain 3 to 5 nucleotides, for example 4 nucleotides, and the nucleotides may be the same or different from each other and may be independently selected from the group consisting of A, U, C and G.
  • X20 (the number after X represents the number of arbitrary nucleotides (X: selected from A, T, C, and G) Can be represented by GX19 when the guanine matched to the first nucleic acid is located, and gX19 when the guanine mismatching from the 5'-terminus to the first nucleic acid is located.
  • the sgRNA may further comprise a termination site comprising 5 to 7 uracil (U) at the 3 'terminus.
  • the extended guide RNA may further comprise 1 to 10 nucleotides at the 5 'end of the sgRNA of the general formula 1 described above.
  • the further included nucleotides may each independently be selected from among A, T, C, and G.
  • the nucleotide further included may have a sequence complementary to the nucleotide at the corresponding position (extended position) of the target DNA sequence.
  • the sgRNA may further include 1 to 3 guanines (G) at the 5 'terminus.
  • G guanines
  • the additional guanine may be independently complementary (matched) to the nucleotide at the corresponding position in the target sequence, or may be non-complementary (mismatching).
  • the base correction frequency and / or efficiency is increased in the case of elongated sgRNA forms, further comprising 1 to 10 nucleotides (each independently selected from among A, T, C, and G) Base correction can occur.
  • the target sequence of the guide RNA is a strand in which a PAM (Protospacer Adjacent Motif sequence on the target DNA (5'-NGG-3 '(N is A, T, G, or C) in the case of S. pyogenes Cas9) May be 20 contiguous nucleic acid sequences located 5 ' of PAM on the opposite strand (complementary strand).
  • PAM Protospacer Adjacent Motif sequence on the target DNA
  • the targeting sequence of the guide RNA capable of hybridizing with the target sequence of the guide RNA is a DNA strand (i.e., a PAM sequence (5'-NGG-3 '(N is A, T, G, or C)
  • a PAM sequence 5'-NGG-3 '(N is A, T, G, or C
  • a sequence of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or at least 100% identical to the nucleotide sequence of the complementary strand of the complementary strand Refers to a nucleotide sequence having complementarity, and complementary binding with the nucleotide sequence of the complementary strand is possible.
  • the nucleic acid sequence of the target site is represented by the nucleic acid sequence of the strand where the PAM sequence is located in the two DNA strands of the corresponding gene site of the target gene.
  • the targeting sequence contained in the guide RNA can be obtained by substituting the sequence of the target site Lt; / RTI > Therefore, in this specification, the targeting sequence of the guide RNA and the sequence of the target site (or the sequence of the cleavage site) are represented by the same nucleic acid sequence except that T and U are mutually modified.
  • the guide RNA may be used (or included in the composition) in the form of a plasmid containing (or included in) the above-described RNA or a DNA encoding the same.
  • Example 1 Change in base-editing window according to sgRNA length
  • FIG. 2A shows ABE 7.10 substitution activity according to the base position according to sgRNA length in HEK2 site.
  • Figure 2b shows the relative substitution activity [gX20 ⁇ 30 activity / GX19 activity] as compared to when using GX19 sgRNA.
  • FIG. 2C shows the most frequently occurring mutation allele. In FIG. 2C, the portion where the mutation was introduced in the WT sequence is shown in red.
  • FIG. 2D shows the BE3 substitution activity according to the base position according to the sgRNA length in the HBB site.
  • Figure 2E shows the relative substitution activity [gX20 ⁇ 30 activity / GX19 activity] compared to when using GX19 sgRNA.
  • FIG. 2F shows the most frequently occurring mutation allele, and the portion where the mutation was introduced in the WT sequence is shown in red.
  • a base-editing window known as a site that works efficiently when using GX19 sgRNA, is shown in sky blue.
  • Example 2 Change in base-editing window when using sgRNA containing 1 or 2 additional mismatch G
  • BE3 substitution activity with sgRNA length was determined at the FANCF site (FIG. 3A) and HBB site (FIG. 3C) by base position.
  • Relative substitution activity [gX20 ⁇ 30 activity / GX19 activity] is shown in the FANCF site ( Figure 3b) and the HBB site ( Figure 3d), as compared to using GX19 sgRNA.
  • Example 3 Change of baseediting window according to sgRNA length at four different sites
  • FIG. 4A shows the substitution activity [gX20-30 activity / GX19 activity] of ABE 7.10 relative to the use of GX19 sgRNA at four sites, and the results are shown in FIG. 4A.
  • FIG. 4B shows the relative substitution activity [gX20-30 activity / GX19 activity] of BE3 relative to that of GX19 sgRNA, and the result is shown in FIG. 4B.
  • a base-editing window known as a site that works efficiently when using GX19 sgRNA, is shown in sky blue. Each activity was measured by HEK293T cell line by deep-sequencing method.
  • Example 4 Change of base-editing window according to sgRNA type in rape and soybean
  • Figure 5b shows the change of the allele with the most frequently occurring mutation according to the sgRNA type. It was confirmed that TAG stop codon was produced only when gX20 sgRNA was used.
  • Example 5 Change of base-editing window according to sgRNA type in mouse
  • the present invention it is possible to improve the frequency and / or efficiency of base correction by using an elongated guide RNA of an elongated form than the normal guide RNA in the gene base calibration using diaminase, So that the desired point mutation can be effectively induced.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

본 발명은 연장된 가이드 RNA 및 이를 포함하는 염기 교정용 조성물; 및 상기 염기 교정용 조성물을 이용한 염기 교정 방법 및 유전자 변형 동물 또는 식물의 제조 방법에 관한 것이다.

Description

연장된 단일 가이드 RNA 및 그 용도
본 발명은 연장된 가이드 RNA 및 이를 포함하는 염기 교정용 조성물; 및 상기 염기 교정용 조성물을 이용한 염기 교정 방법 및 유전자 변형 동물 또는 식물의 제조 방법에 관한 것이다.
유전자 편집 기술은 박테리오 파지의 감염에 의해 박테리오 파지의 단편을 DNA로 기억하고 있다가 2차 감염이 되었을 때 유전자 가위 역할을 하는 뉴클레아제(nuclease)인 Cas9(CRISPRassociated protein 9: RNA-guided DNA endonuclease enzyme)으로 해당 DNA를 잘라 없애는 면역 시스템에서 시작되었다. 이는 가이드 RNA(guide RNA, gRNA)가 특정 염기 서열을 인식 하게 되면 Cas9 단백질이 해당 부위를 잘라 고칠 수 있는 유전자 교정 기술로 발전하게 되었다(Ran FA et al., Nat Protoc, 8:2281-2308, 2013, Woo JW et al., Nat Biotechnol, 33: 1162-1164, 2015).
기존의 CRISPR-Cas9 유전자가위를 변형하여 만들어진 염기교정 유전자가위(Base-editor)는 DNA의 양쪽 가닥을 자르지 않고 특정 염기를 바꿀 수 있다는 점에서 최근 주목 받고 있는 기술이다. 염기교정 유전자가위는 표적 DNA와 상보적인 서열을 갖는 sgRNA를 통해 표적 위치에 결합한 후, 반대쪽에 노출되는 단일가닥 DNA에 작동할 수 있는 디아미나제(deaminase)에 의해 시토신(C)을 우라실(U)로, 또는 아데닌(A)를 하이포잔틴(I)으로 바꾼다. 바뀐 염기들은 DNA repair과정과 replication 과정 중에 티민(T)과 구아닌(G)로 바뀌게 되고, 결과적으로 시토신(C)->티민(T), 아데닌(A)->구아닌(G)으로 DNA 특정 염기를 교정할 수 있다. 이때, Base-editor가 작동하는 염기교정 범위(Base editing window)는 PAM(Protospacer Adjacent Motif)으로부터 protospacer 방향으로 13~17번째 떨어진 위치라고 알려져 있으며 이를 벗어난 범위에서는 효율이 매우 떨어진다(도 1a).
이에, 본 발명자들은 상기한 문제점을 보완하기 위하여, 염기교정 유전자가위의 표적위치를 지정해주는 sgRNA의 형태와 길이를 변형시키는 경우, 염기교정 유전자가위의 작동 범위를 보다 확장시킬 수 있는 것을 확인하고, 본 발명을 완성하게 되었다.
발명의 요약
본 발명의 목적은 염기교정 유전자가위의 작동 범위를 보다 확장시킬 수 있는 연장된 가이드 RNA를 제공하는데 있다.
본 발명의 다른 목적은 디아미나제, 표적특이적 뉴클레아제, 및 연장된 가이드 RNA를 포함하는 염기교정 유전자가위의 작동 범위를 보다 확장시킬 수 있는 염기 교정용 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 염기 교정용 조성물을 이용한 염기 교정 방법에 관한 것이다.
본 발명의 또다른 목적은 상기 염기 교정용 조성물을 이용한 유전자 변형 동물 또는 식물의 제조 방법에 관한 것이다.
상기 목적을 달성하기 위하여, 본 발명은 표적서열과 혼성화 가능한 연장된 가이드 RNA에 있어서, 5′말단에 1~3개의 구아닌(G)과 1~10개의 뉴클레오타이드를 추가로 포함하는 것을 특징으로 하는 염기교정용 가이드 RNA를 제공한다.
본 발명은 또한, (i) 디아미나제 또는 이를 코딩하는 유전자, (ii) RNA-가이드 뉴클레아제 또는 이를 코딩하는 유전자 및 (iii) 표적서열과 혼성화 가능한 연장된 가이드 RNA 또는 이를 코딩하는 유전자를 포함하는 염기교정용 조성물로,
여기서, 상기 연장된 가이드 RNA는 5′말단에 1~3개의 구아닌(G)과 1~10개의 뉴클레오타이드를 추가로 포함하는 것을 특징으로 하는 염기교정용 조성물을 제공한다.
본 발명은 또한 상기 염기교정용 조성물을 세포에 도입시키는 단계를 포함하는 염기 교정방법을 제공한다.
본 발명은 또한, (a) 상기 염기 교정용 조성물을 포유동물 배아 또는 진핵식물 배아에 도입시키는 단계; 및 (b) 상기 배아를 성장시켜 성체를 획득하는 단계를 포함하는 돌연변이가 유발된 인간을 제외한 포유동물 또는 진핵 식물 성체의 제조방법을 제공한다.
도 1은 sgRNA 길이에 따른 Base-Editor 작동을 모식적으로 나타낸 것이다. 기존 방법인 GX19 sgRNA(a)를 사용했을 때와 extended sgRNA(b)를 사용했을 때, 표적 위치에 결합한 뒤에 노출되는 단일가닥 DNA에 deamination이 일어날수 있다. Extended sgRNA를 사용하게 되면 PAM으로부터 5′방향으로 노출되는 단일가닥 DNA가 늘어나게 되어 더 넓은 범위에서 deamination 현상이 나타나게 된다.
도 2는 HEK293T cell line에서 각각의 activity를 deep-sequencing을 통해 측정한 sgRNA 길이에 따른 base-editing window의 변화를 보여주는 것으로, 도 2a는 HEK2 site에서 sgRNA 길이에 따른 ABE 7.10 substitution activity를 base position 별로 나타낸 그래프이고, 도 2b는 GX19 sgRNA를 사용했을 때와 비교하여 상대적인 substitution activity[gX20∼30 activity/GX19 activity]를 나타낸 그래프이며, 도 2c는 가장 빈번하게 나타나는 mutation allele을 보여주는 것이고 (WT sequence에서 변이가 도입된 부분을 빨간색으로 표시함), 도 2d는 HBB site에서 sgRNA 길이에 따른 BE3 substitution activity를 base position 별로 나타낸 그래프이며, 도 2e는 GX19 sgRNA를 사용했을 때와 비교하여 상대적인 substitution activity[gX20~30 activity/GX19 activity]를 나타낸 그래프이고, 도 2f는 가장 빈번하게 나타나는 mutation allele을 표기한 것이다 (WT sequence에서 변이가 도입된 부분을 빨간색으로 표시)(GX19 sgRNA를 사용했을 때 효율적으로 작동하는 위치로 알려진 base-editing window를 하늘색으로 표시함).
도 3은 HEK293T cell line에서 각각의 activity를 deep-sequencing을 통해 측정한, 추가적인 mismatch G 1개 또는 2개를 포함한 sgRNA를 사용했을 때 baseediting window의 변화를 보여주는 것으로, 도 3a 및 3c는 sgRNA 길이에 따른 BE3 substitution activity를 base position 별로 FANCF site(a)와 HBB site(c)에서 확인한 결과이고, 도 3b 및 도 3d는 GX19 sgRNA를 사용했을 때와 비교하여 상대적인 substitution activity [gX20~30 activity / GX19 activity]를 FANCF site(b)와 HBB site(d)에서 나타낸 그래프이다.
도 4는 HEK293T cell line에서 각각의 activity를 deep-sequencing 방법으로 측정한, 서로 다른 4개의 site에서 sgRNA 길이에 따른 base-editing window의 변화를 보여주는 것으로, 도 4a는 4개의 site에서 GX19 sgRNA를 사용했을 때와 비교하여 상대적인 ABE 7.10의 substitution activity [gX20~30 activity / GX19 activity]를 확인한 결과를 보여주는 그래프이고, 도 4b는 GX19 sgRNA를 사용했을 때와 비교하여 상대적인 BE3의 substitution activity[gX20~30 activity / GX19 activity]를 확인한 결과를 보여주는 그래프이다 (GX19 sgRNA를 사용했을 때 효율적으로 작동하는 위치로 알려진 base-editing window를 하늘색으로 표시함).
도 5는 activity는 deep-sequencing 을 통해 분석한, 유채와 콩에서 sgRNA 형태에 따른 base-editing window의 변화를 보여주는 것으로, 도 5a는 유채의 protoplast에서 gX19 sgRNA와 gX20 sgRNA 를 AID2 cytosine base-editor와 함께 사용했을 때, 시토신 위치에 따른 substitution 효율을 측정한 결과이고, 도 5b는 sgRNA 형태에 따라 가장 빈번하게 나타나는 mutation이 도입된 allele의 변화를 보여주며 (gX20 sgRNA를 사용했을 때에만 TAG stop codon이 만들어지는 것을 확인할 수 있음), 도 5c는 콩의 protoplast에서 gX19 sgRNA와 gX20 sgRNA 를 AID2 cytosine baseeditor와 함께 사용했을 때, 시토신 위치에 따른 substitution 효율을 측정한 결과이고, 도 5d는 sgRNA 형태에 따라 가장 빈번하게 나타나는 mutation이 도입된 allele 의 변화를 나타낸 것이다 (gX20 sgRNA를 사용했을 때에만 TAG stop codon이 만들어 지는 것을 확인할 수 있음).
도 6은 생쥐에서 sgRNA 형태에 따른 base-editing window의 변화를 보여주는 것으로, 도 6a는 생쥐의 embryo에 서로 다른 종류의 sgRNA와 함께 ABE 7.10 mRNA를 microinjection 한 후, blastocyst 단계에서 deep-sequencing 으로 substitution activity를 분석한 결과이고, 도 6b는 GX21 sgRNA를 사용하여 ABE 7.10 mRNA와 함께 embryo에 microinjection을 진행해서 얻은 pup를 분석한 결과로서, 원하는 H420R mutation을 가진 3마리의 pup을 얻을 수 있었다.
발명의 상세한 설명 및 바람직한 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술 분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법은 본 기술 분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명에서는 염기교정 유전자가위의 표적위치를 지정해주는 sgRNA의 형태와 길이를 변형시킴으로써, 염기교정 유전자가위의 작동 범위를 보다 확장시킬 수 있는 기술을 제안한다 (도 1b).
도 1에 나타난 바와 같이, 기존 방법인 GX19 sgRNA(a)를 사용했을 때와 extended sgRNA(b)를 사용했을 때, 표적 위치에 결합한 뒤에 노출되는 단일가닥 DNA에 deamination이 일어날 수 있다. Extended sgRNA를 사용하게 되면 PAM으로부터 5′ 방향으로 노출되는 단일가닥 DNA가 늘어나게 되어 더 넓은 범위에서 deamination 현상이 나타나게 된다.
일반적으로 사용하는 sgRNA 는 PAM에서 5′방향의 20개의 뉴클레오타이드(nt)의 서열을 이용한 GX19 또는 gX19 형태였다면, 새로운 방법에서는 PAM에서 5′방향의 20개의 뉴클레오타이드 앞에 추가적으로 mismatch 구아닌(G) 2개를 붙인 ggX20 형태, 또는 21개부터 30개의 뉴클레오타이드 서열을 이용한 gX21~gX30형태의 extended sgRNA로 실험하였다. ABE(Adenosine Base Editor)와 extended sgRNA 로 HEK2 site에 대해 HEK293T cell에서 실험한 결과, 기존의 GX19 sgRNA에서는 PAM으로부터 13~17번째의 아데노신에서 변이가 나타났고, gX20/gX21/gX22 sgRNA를 사용하였을 때는 18~19번째의 아데노신도 바뀐 것을 확인할 수 있었다(도 2a, 2b, 및 2c 참조). gX20/gX21/gX22 sgRNA를 사용하여 도입된 18~19번째 아데노신 변이의 효율은 GX19 sgRNA에서 나타나는 효율보다 10배 이상 증가한 것을 확인할 수 있다(도 2b). 마찬가지로 CBE(Cytosine Base Editor)와 extended sgRNA로 HBB site에서 확인한 결과, gX20/gX22 sgRNA를 사용하였을 때 20, 21, 23 번째 위치의 시토신에 변이가 도입되는 것을 확인하였다(도 2d, 2e, 및 2f 참조). 이뿐만 아니라 mismatch 구아닌을 추가적으로 갖고 있는 ggX20 sgRNA를 사용했을 때 20~23번째 위치의 시토신에서 CBE에 의한 변이가 3배 가량 증가하는 것을 볼 수 있다(도 3 참조). 서로 다른 4개의 target site에서 CBE와 ABE에 대해 각각 실험했을 때, GX19 sgRNA 대신 에extended sgRNA를 사용하면 기존의 염기교정 범위(PAM에서 5′방향으로 13~17번째)보다 먼 지역인 18~23번째 위치까지 작동할 수 있으며 그 효율이 최대 5~60배 증가하는 것을 확인하였다(도 4 참조).
따라서, 본 발명은 일 관점에서, 표적서열과 혼성화 가능한 연장된 가이드 RNA로, 5′말단에 1~3개의 구아닌(G)과 1~10개의 뉴클레오타이드(각각 독립적으로 A, T, C, 및 G 중에서 선택될 수 있음)를 추가로 포함하는 것을 특징으로 하는 염기교정용 가이드 RNA에 관한 것이다.
본 발명의 연장된 가이드 RNA는 단일 가닥 형태 (single guide RNA; sgRNA)일 수 있다. 상기 연장된 가이드 RNA는 통상의 가이드 RNA, 예를 들어, sgRNA (표적화 서열이 20nt임; 이 중에서 5′말단의 첫 번째 뉴클레오타이드는 대응 DNA 표적부위 서열과 매칭(상보적) 구아닌(G) 또는 미스매칭(비상보적)인 구아닌(g)일 수 있음)의 5′말단에 1 내지 10개의 뉴클레오타이드 (각각 독립적으로 A, T, C, 및 G 중에서 선택될 수 있음; 일 예에서, 대응 DNA 표적 서열과 상보적 서열일 수 있음)를 추가로 포함하는 것일 수 있다. 이와 같은 연장된 형태의 sgRNA는 그렇지 않은 경우와 비교하여 염기 교정 빈도 및/또는 교정 효율을 증가시킬 수 있다.
또한, 상기 연장된 sgRNA는 5′말단에 1 내지 3개의 매칭 (대응 DNA 표적 서열과 상보적) 또는 미스매칭 (대응 DNA 표적 서열과 비상보적)의 구아닌(G)을 추가로 포함할 수 있다. 상기 5′말단에 추가로 포함되는 1-10개의 임의의 뉴클레오타이드는 해당 표적 부위의 표적 DNA 서열과 상보적 서열일 수 있으며, 이로 인하여, 표적 부위에서 PAM으로부터 5′방향으로 노출되는 단일가닥 DNA의 길이를 늘여서 더 넓은 범위에서 유전자 교정 (deamination)이 일어나도록 할 수 있다 (예컨대, 표적 부위에서 PAM으로부터 5′방향으로 18-30nt 또는 18-22nt 위치에서도 변이(염기교정)가 도입될 수 있음) (도 1b 참조).
다른 관점에서, 본 발명은 (i) 디아미나제 또는 이를 코딩하는 유전자, (ii) RNA-가이드 뉴클레아제 또는 이를 코딩하는 유전자 및 (iii) 표적서열과 혼성화 가능한 연장된 가이드 RNA 또는 이를 코딩하는 유전자를 포함하는 염기교정용 조성물에 관한 것이다.
본 발명의 일 양태로는, (1) 디아미나제, 및 이를 코딩하는 유전자, (2) 표적 특이적 뉴클레아제 (RNA-가이드 뉴클레아제) 또는 이를 코딩하는 유전자, 및 (3) 표적 유전자의 표적 부위와 혼성화 가능한 (또는 상보적 핵산 서열을 갖는) 가이드 RNA 또는 이의 코딩 DNA (또는 코딩 DNA를 포함하는 재조합 벡터)를 포함하는 염기 교정용 조성물을 제공한다. 이 때, 상기 가이드 RNA는 앞서 설명한 바와 같이, 통상의 가이드 RNA, 예컨대, sgRNA의 5′말단에 1 내지 10개의 뉴클레오타이드 (각각 독립적으로 A, T, C, 및 G 중에서 선택될 수 있음; 예컨대, 대응 표적 서열과 상보적 서열일 수 있음)를 추가로 포함하는 것일 수 있으며, 여기에 더하여 임의로, sgRNA의 5′말단에 1 내지 3개의 매칭 또는 미스매칭의 구아닌(G)을 추가로 포함하는 연장된 가이드 RNA일 수 있다.
상기 염기 교정용 조성물은 진핵세포에서 염기 교정 (예컨대, 염기치환) 활성을 갖는 것일 수 있다. 상기 진핵세포는 진핵 동물의 세포, 예컨대 배아 세포, 또는 진핵 식물 (예컨대, 조류, 단자엽 식물, 쌍자엽 식물 등)이 세포일 수 있으며, 일 구체예에서, 포유 동물 세포, 예컨대 포유 동물 배아세포, 또는 진핵 식물의 세포 일 수 있다. 본 명세서에 사용된 코딩 유전자는 cDNA, rDNA 또는 이를 포함하는 재조합 벡터, 또는 mRNA 형태로 사용될 수 있다.
상기 디아미나제는 진핵세포에서 특정 염기에서 아민기를 제거하는 활성을 갖는 효소를 총칭하는 것으로, 예컨대, 시티딘을 우리딘으로 전환시키는 시티딘 디아미나제 및/또는 아데노신 디아미나제일 수 있다. 일 예에서 상기 디아미나제는 APOBEC1 (apolipoprotein B editing complex 1), AID (activation-induced deaminase), tadA (tRNA-specific adenosine deaminase) 등으로 이루어진 군에서 선택된 1종 이상일 수 있으나, 이에 제한되는 것은 아니다. 이와 같은 염기 전환(예컨대, 시티딘을 우리딘으로 전환)에 의하여 진핵세포에서 단일 뉴클레오타이드 치환을 유도할 수 있다.
일 예에서, 상기 염기 교정용 조성물은, (1) 디아미나제 또는 이를 코딩하는 유전자 (mRNA 또는 코딩 DNA를 포함하는 재조합 벡터), (2) RNA-가이드 뉴클레아제 또는 이를 코딩하는 유전자 (mRNA 또는 코딩 DNA를 포함하는 재조합 벡터), 및 (3) 연장된 가이드 RNA 또는 이를 코딩하는 유전자 (DNA)에 더하여, (4) 우라실 DNA 글리코실라제 억제제 (uracil DNA glycosylase inhibitor: UGI) 또는 이를 코딩하는 유전자 및/또는 (5) 핵위치화서열 (NLS) 또는 이를 코딩하는 유전자를 추가로 포함할 수 있다.
본 발명의 상기 염기 교정용 조성물에서, 상기 디아미나제, RNA-가이드 뉴클레아제, 및 임의로 UGI 및/또는 NLS가 연결된 융합 단백질 또는 이들의 코딩 유전자가 연결된 융합 유전자 형태로 사용되는 경우, 각각의 단백질 또는 유전자 사이 중 하나 이상, 예컨대, 상기 디아미나제와 RNA-가이드 뉴클레아제 사이, 뉴클레아제와 UGI이, 및 UGI와 NLS 사이 중 하나 이상에 적절한 링커 (융합 단백질의 경우 펩타이드 링커 (3-30, 또는 3-20 아미노산), 융합 유전자의 경우 올리고뉴클레오타이드링커 (9 내지 90 또는 9-60nt))를 추가로 포함할 수 있다.
일 예에서, 상기 RNA-가이드 뉴클레아제는 유전자 이중가닥 절단 활성을 상실하도록 변형된 변형 RNA-가이드 뉴클레아제일 수 있다.
상기 변형 RNA-가이드 뉴클레아제는 표적 유전자의 한 가닥을 절단(닉 (nick) 생성)하도록 변형된 변형 Cas9 (CRISPR 관련 단백질 9) 또는 변형 Cpf1(Prevotella 및 Francisella 1 유래 CRISPR) 시스템일 수 있다. 일 예에서, 상기변형 RNA-가이드 뉴클레아제는 Cas9 니카아제 (Cas9 nickase; nCas9) 또는 촉매활성 결핍 Cas9 (catalytically-deficient Cas9; dCas9) 등으로 이루어진 군에서 선택된 것일 수 있다.
본 발명에 있어서, 상기 염기 교정용 조성물이 디아미나제 코딩 유전자 및 RNA-가이드뉴클레아제 코딩 유전자를 포함하는 경우, 상기 코딩 유전자는 코딩 DNA 또는 mRNA 일 수 있다. 또한, 상기 디아미나제 코딩 유전자 및 RNA-가이드 뉴클레아제 코딩 유전자는 mRNA 형태로 포함되거나, 상기 유전자(DNA)를 각각 별개의 벡터에 포함하는 재조합 벡터 (즉, 디아미나제 코딩 DNA를 포함하는 재조합 벡터 및 RNA-가이드 뉴클레아제 코딩 DNA를 포함하는 재조합 벡터) 또는 하나의 벡터에 함께 포함하는 재조합 벡터의 형태로 포함될 수 있다.
상기 가이드 RNA는 CRISPR RNA (crRNA), trans-activating crRNA(tracrRNA), crRNA 및 tracrRNA (crRNA 및 tracrRNA의 복합체)를 포함하는 이중 가이드 RNA, 또는 단일 가이드 RNA (sgRNA)일 수 있다. 일 예에서, 상기 염기 교정용 조성물은 디아미나제 및 변형 RNA-가이드 뉴클레아제를 코딩하는 mRNA와 가이드 RNA를 포함하거나, 디아미나제 및 변형 RNA-가이드 뉴클레아제와 가이드 RNA를 포함하는 리보핵산단백질 (ribonucleoprotein; RNP)를 포함하는 것일 수 있다. 상기 리보핵산단백질은 디아미나제 및 변형 RNA-가이드 뉴클레아제와 가이드 RNA를 혼합물 형태로 포함하거나, 디아미나제 및 변형 RNA-가이드 뉴클레아제와 가이드 RNA가 결합된 복합체 형태로 포함할 수 있다.
본 발명은 또 다른 관점에서, 상기 염기교정용 조성물을 세포에 도입시키는 단계를 포함하는 염기 교정방법에 관한 것이다.
다른 예는 상기 염기 교정용 조성물을 세포에 도입시키는 단계를 포함하는, 염기 교정 방법을 제공한다. 상기 세포는 진핵세포일 수 있고, 상기 염기교정 방법은 진핵세포에서 염기 교정 (예컨대, 염기 치환)을 수행하는 것일 수 있다.
상기 진핵세포는 진핵 동물의 세포, 예컨대, 진핵 동물의 배아세포, 및/또는 진핵 식물 세포일 수 있으며, 일 구체예에서, 포유 동물 세포, 예컨대 포유 동물 배아 세포, 및 또는 진핵 식물 세포일 수 있다. 상기 염기 교정 방법 에 의하여 진핵 세포 (예컨대, 진핵 동물 배아 세포 및/또는 진핵 식물 세포)에서 40% 이상, 45% 이상, 50% 이상, 55% 이상, 60% 이상, 65% 이상, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 97% 이상, 99% 이상 또는 100%의 염기 전환률 (염기 치환률)을 달성할 수 있다. 또한, 상기 염기 교정 방법은 염기 치환에 의해 유전자 (예컨대, 코딩 서열) 내에 종결코돈을 생성하여 상기 유전자를 불활성화 (knock-out)시키거나, 단백질을 생성하지 않는 비코딩 DNA 서열에 변이를 도입하는 등, 다양한 돌연변이를 유발시킬 수 있다.
본 발명의 일 양태에서는, 이를 토대로 sgRNA 길이를 늘려줌에 따라 더 넓은 범위에서 염기교정이 가능를 유채(Brassica napus)와 콩(Glycine max)에서 살펴보았다. 유채의 cotyledon에서 유래한 protoplast에서 제초제 저항성 유전자인 ALS 유전자를 target할 수 있는 gX19와 gX20 sgRNA를AID2 Base-Edito께transfection하였다. 그 결과 gX20 sgRNA를 사용했을 때 20번째 위치의 시토신이 티민으로 바뀌었으며(도 5a), 이 경우에만 STOP codon이 생겨 해당 유전자가 knock-out 될 수 있었다(도 5b). 다른 작물인 콩의 callus에서 얻은 protoplast에 transfection 하여ALS gene을 targeting 하였을 때, 마찬가지로 gX20 sgRNA를 사용했을 때 20번째 위치의 시토신이 티민으로 바뀌는 효율이 증가함을 확인하였다(도 5c, 및 5d 참조). 마지막으로, mouse의 Tyrosinase 유전자에 albinism-causing mutation으로 알려진 H420R substituion을 도입하기 위하여 ABE를 사용하였다. Tyrosinase를 target하는 sgRNA의 형태를 달리하여 ABE mRNA와 함께 mouse embryo에 microinjection을 한 후 blastocyst 단계에서 분석한 결과, gX19보다 GX20나 GX21 sgRNA를 사용했을 때 18번째 위치의 아데노신이 바뀌는 효율이 증가하는 것을 볼 수 있었다(도 6a). 원하는 H420R mutation을 도입하기 위해서는 18번째 아데노신이 바뀌어야 하므로 해당 위치를 가장 높은 효율로 바꿀 수 있는 GX21 sgRNA를 사용해 mouse pup을 얻었다. 그 중 3마리의 pup에서 H420R mutation을 갖고 있는 것을 확인할 수 있었다(도 6b). 이처럼 기존의 base-editing window 밖의 5′쪽 방향의 염기를 교정해야만 하는 경우, 일반적인 GX19 sgRNA보다 extended sgRNA를 사용하는 것이 더 효율임을 확인할 수 있었다.
따라서, 본 발명은 또 다른 관점에서, (a) 상기 염기 교정용 조성물을 포유동물 배아 또는 진핵식물 배아에 도입시키는 단계; 및 (b) 상기 배아를 성장시켜 성체를 획득하는 단계를 포함하는 돌연변이가 유발된 인간을 제외한 포유동물 또는 진핵 식물 성체의 제조방법에 관한 것이다.
특히, 본 발명의 상기 염기 교정용 조성물은 포유 동물 배아 또는 진핵 식물 배아에 적용되어, 소망하는 유전자가 불활성화되거나 소망하는 돌연변이가 유발된 포유 동물 또는 진핵 식물 성체 제작에 유용하게 적용될 수 있다.
상기 세포에 염기 교정용 조성물을 도입하는 단계는 상기 세포에 디아미나제 또는 디아미나제 코딩 유전자, RNA-가이드 뉴클레아제 또는 RNA-가이드 뉴클레아제 코딩 유전자, 및 연장된 가이드 RNA 또는 연장된 가이드 RNA 코딩 유전자를 도입시키는 단계일 수 있다. 상기 코딩 유전자들 중 하나 이상은 각각 별개의 또는 하나의 재조합 벡터에 포함되어 도입될 수 있다.
일 예에서, 상기 세포에 염기 교정용 조성물을 도입하는 단계는,
1) 상기 세포를 디아미나제 코딩 DNA, RNA-가이드 뉴클레아제 코딩 DNA, 및 연장된 가이드 RNA 코딩 유전자를 각각 포함하거나 이들 중 2 이상을 포함하는 재조합 벡터로 형질감염시키거나,
2) 상기 세포에 디아미나제, RNA-가이드 뉴클레아제, 및 연장된 가이드 RNA (예컨대, 디아미나제, RNA-가이드 뉴클레아제, 및 연장된 가이드 RNA를 포함하는 혼합물 또는 복합체 형태의 리보핵산단백질)를 직접 주입하거나,
3) 상기 세포에 디아미나제 코딩 mRNA, RNA-가이드 뉴클레아제 코딩mRNA 및 가이드 RNA의 혼합물 또는 이들 각각을 직접 주입하여 수행할 수 있다.
상기 직접 주입은 상기 2)의 디아미나제, RNA-가이드 뉴클레아제, 및 연장된 가이드 RNA (예컨대, 디아미나제, RNA-가이드 뉴클레아제, 및 연장된 가이드 RNA를 포함하는 혼합물 또는 복합체 형태의 리보핵산단백질), 또는 3)의 디아미나제 코딩 mRNA, RNA-가이드 뉴클레아제 코딩 mRNA 및 연장된 가이드 RNA가, 재조합 벡터를 사용하지 않고, 세포막 및/또는 핵막을 통과하여 유전체(genome)에 전달되는 것을 의미할 수 있으며, 예컨대, 전기천공법, 리포펙션, 미세주입(microinjection) 등에 의하여 수행될 수 있다.
본 발명의 다른 예는 상기 염기 교정 방법에 의하여 교정된 염기를 포함하는 유전자 변형 세포를 제공한다. 상기 유전자 변형 세포는 상기 염기 교정에 의하여 표적 유전자에 염기 치환, 예컨대 단일 염기 치환 또는 점 돌연변이가 발생한 세포일 수 있다. 상기 세포는 진핵세포일 수 있다. 상기 진핵세포는 진핵 동물의 세포, 예컨대 배아 세포, 및/또는 진핵 식물 세포일 수 있으며, 일 구체예에서, 인간을 포함하거나 인간을 제외한 포유 동물 세포, 예컨대 인간을 포함하거나 인간을 제외한 포유 동물의 배아 세포, 및/또는 진핵 식물 세포일 수 있다.
다른 예는 염기 교정용 조성물이 주입된 포유 동물 배아 또는 상기염기 교정 방법에 의하여 교정된 염기를 포함하는 유전자 변형 포유 동물 배아를 포유 동물의 난관에 이식하여, 유전자 변형 동물을 생산하는 단계를 포함하는, 유전자 변형 동물의 제조 방법을 제공한다. 상기 유전자 변형 포유 동물은 상기 염기교정에 의하여 표적 유전자에 염기 치환, 예컨대 단일 염기 치환 또는 점 돌연변이가 발생한 배아로부터 발생한 동물일 수 있다.
상기 배아 세포를 난관에 이식받는 포유 동물은 상기 배아 세포가 유래하는 포유 동물과 동종의 포유류 (위탁모)일 수 있다.
다른 예는 상기 유전자 변형 세포로부터 얻어진 유전자 변형 동물을 제공한다. 상기 유전자 변형 동물은 상기 유전자 변형 동물의 제조 방법에 의하여 제조된 것일 수 있다. 상기 동물은 진핵 동물, 예컨대 인간을 포함하거나 인간을 제외한 포유 동물일 수 있다.
본 명세서에서 상기 염기 교정용 조성물이 적용되는 세포는 진핵 세포, 예컨대, 진핵 동물 세포일 수 있다. 상기 진핵 동물은 인간 등의 영장류, 마우스 등의 설치류를 포함하는 포유 동물일 수 있다. 상기 진핵 동물 세포는 포유동물의 배아일 수 있다. 예컨대, 상기 배아는 과배란 유도된 암컷 포유 동물 (예컨대, PMSG (Pregnant Mare Serum Gonadotropin), hCG (human Choirinic Gonadotropin) 등과 같은 생식선 호르몬 주입에 의한 과배란 유도 등)과 수컷 포유동물을 교배하여 얻어진 수정된 배아를 상기 암컷 포유 동물의 난관에서 채취한 것 일 수 있다. 상기 염기 교정용 조성물이 적용 (주입)되는 배아는 수정된 1-세포기의 배아 (zygote)일 수 있다.
본 명세서에 사용된 바로서, 용어 “염기 교정 (base editing)”은 표적 유전자 내의 표적 부위에 점돌연변이 (유전자 수준 또는 유전자 수준의 점돌연변이로 인한 단일 아미노산 변이 등)를 유발하는 염기 변이 (치환, 결실 또는 부가)를 의미하는 것으로, 소수의 염기 (하나 또는 두 개의 염기, 예컨대 하나의 염기)만이 변이된다는 점에서 비교적 다수의 염기의 변이를 수반하는 유전자 교정(gene editing)과 구별될 수 있다. 상기 염기 교정은 유전자의 이중가닥 절단(double-stranded DNA cleavage)를 수반하지 않는 것일 수 있다.
본 명세서에서 제공되는 염기 교정용 조성물 또는 방법에 의하면, nick이 형성된 DNA 가닥 (PAM 서열이 위치하는 가닥과 반대 가닥, 가이드 RNA가 결합(혼성화)하는 가닥)의 반대 가닥 (즉, PAM 서열이 위치하는 가닥)에서 염기 교정(염기 변형 또는 염기 치환; A 또는 C의 deamination에 의한 변이)이 일어날 수 있다. 통상적인 길이의 가이드 RNA를 사용하는 경우에는 예컨대, PAM으로부터 5′방향으로 17번째 뉴클레오타이드에서 염기 교정 (염기 변형 또는 염기 치환)이 일어나지만, 본 명세서에서 제공되는 연장된 가이드 RNA를 사용하게 되면, PAM으로부터 5′방향으로 17번째 이후의 부위, 예컨대, PAM으로부터 5′방향으로 18번째부터 30번째, 18번째부터 25번째, 또는 18번째부터 22번째까지의 확장된 범위에서도 염기교정이 일어날 수 있다.
본 명세서에 사용된 바로서, 용어 “염기 변이 (또는 염기 치환)”은 해당 염기를 포함하는 뉴클레오타이드에 변이 (예컨대, 치환)이 일어난 것을 의미하는 것으로, “뉴클레오타이드 변이 (또는 뉴클레오타이드 치환)”와 동일한 의미로 사용될 수 있으며, 이러한 염기 변이는 대립유전자 중 하나 또는 두 개 모두에서 일어날 수 있다.
일 예에서, 상기 염기 변이 또는 이를 수반하는 염기 교정은 표적부위에 종료코돈을 생성시키거나, 야생형과 다른 아미노산을 코딩하는 코돈을 생성시킴으로써, 표적 유전자를 불활성화 (knock-out)시키거나, 단백질을 생성하지 않는 비코딩 DNA 서열에 변이를 도입하는 등 다양한 형태일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 염기 교정 또는 염기 변이는 생체 외 (in vitro) 또는 생체 내 (in vivo)에서 수행되는 것일 수 있다.
본 명세서에 사용된 바로서, 용어 “염기 서열”은 해당 염기를 포함하는 뉴클레오타이드의 서열을 의미하는 것으로, 뉴클레오타이드 서열 또는 핵산 서열과 동일한 의미로 사용될 수 있다.
본 명세서에 사용된 바로서, ‘표적 유전자 (target gene)’는 염기 교정 (또는 염기 변이)의 대상이 되는 유전자를 의미하고, ‘표적 부위 (target site or target region)’는 표적 유전자 내의 표적 특이적 뉴클레아제에 의한 염기 교정이 일어나는 부위를 의미하는 것으로, 일 예에서 상기 표적 특이적 뉴클레아제가 RNA-가이드 뉴클레아제 (RNA-guided engineered nuclease; RGEN)를 포함하는 것인 경우, 표적 유전자 내의 RNA-가이드 뉴클레아제가 인식하는 서열 (PAM 서열)의 5′말단 및/또는 3′말단에 인접하여 위치하고, 최대 길이가 약 50bp 또는 약 40bp인 유전자 부위 (이중 가닥 또는 이중가닥 중 어느 하나의 단일 가닥)를 의미한다.
일 예에서, 상기 표적 특이적 뉴클레아제가 RNA-가이드 뉴클레아제를 포함하는 경우, 상기 RNA-가이드 뉴클레아제와 함께, 표적화 서열을 포함하는 가이드 RNA를 포함할 수 있다. 상기 ‘표적화 서열 (targeting sequence)’은 표적 부위 내의 연속하는 약 20개의 뉴클레오타이드(nt)를 포함하는 부위의 염기서열과 상보적인 염기서열을 포함하는(혼성화 가능한) 가이드 RNA의 부위일 수 있다. 본 명세서에 기재된 연장된 가이드 RNA는 5′말단에 1-10개의 추가의 임의의 뉴클레오타이드 (A, T, C, G 중에서 선택됨; 예컨대, 대응 표적 서열과 상보적 서열일 수 있음)를 추가로 포함하거나, 및/또는 5′말단에 1-3개의 추가의 매칭 또는 미스매칭 구아닌을 포함하는 것일 수 있다. 상기 5′말단의 1-10개의 추가의 임의의 뉴클레오타이드는 여기에 해당하는 연장된 표적 DNA 부위의 서열과 상보적 서열일 수 있으며, 이로 인하여, 표적 부위에서 PAM이 5′방향으로 노출되는 단일가닥 DNA의 길이를 늘여서 더 넓은 범위에서 유전자 교정 (deamination)이 일어나도록 할 수 있다.
본 발명에서 상기 표적화 서열과 상보적인 염기서열을 포함하는 표적 부위의 염기서열을 ‘표적 서열 (target sequence)’이라고 칭할 수 있으며, 상기 표적 서열은 RNA-가이드 뉴클레아제가 인식하는 PAM 서열의 5′말단 및/또는 3′말단에 인접하여 위치하는 연속하는 약 20nt 길이의 염기서열 또는 그 상보적 가닥의 해당 부위를 의미할 수 있다.
상기 디아미나제는 진핵세포에서 특정 염기에서 아민기를 제거하는 활성을 갖는 효소를 총칭하는 것으로, 예컨대, 시티딘을 우리딘으로 전환시키는 시티딘 디아미나제 및/또는 아데노신 디아미나제일 수 있다. 일 예에서 상기 디아미나제는 APOBEC　(apolipoprotein B mRNA editing enzyme, catalytic polypeptidelike) 효소, AID (activation-induced deaminase), tadA (tRNA-specific adenosine deaminase) 등으로 이루어진 군에서 선택된 1종 이상일 수 있으나, 이에 제한되는 것은 아니다. 상기 APOBEC1, AID, 및 tadA는 대장균 등의 원핵동물 유래, 또는 인간을 포함하는 영장류, 마우스를 포함하는 설치류 등의 포유동물과 같은 진핵 동물 유래의 것일 수 있다.
상기 디아미나제는, 단백질, 이를 코딩하는 유전자 (예컨대, DNA 또는 mRNA), 또는 상기 유전자를 포함하는 재조합 벡터의 형태로 사용될 수 있다. 본 명세서에 사용된 바로서, 표적 특이적 뉴클레아제는, 유전자 가위 (programmable nuclease)라고도 불리며, 목적하는 유전체 DNA 상의 특정 위치를 인식하여 절단 (단일가닥 절단 또는 이중가닥 절단)할 수 있는 모든 형태의 뉴클레아제 (예컨대, 엔도뉴클레아제)를 통칭한다.
예컨대, 상기 표적 특이적 뉴클레아제는 표적 유전자의 특정 서열을 인식하고 뉴클레오티드 절단 활성을 가져 표적 유전자에서 인델 (insertion and/or deletion, Indel)을 야기할 수 있는 모든 뉴클레아제에서 선택된 1종 이상일 수 있다.
예컨대, 상기 표적 특이적 뉴클레아제는 미생물 면역체계인 CRISPR에서 유래한 RGEN (RNA-guided engineered nuclease; 예컨대, Cas 단백질 (예컨대, Cas9 등), Cpf1, 등) 등으로 이루어진 군에서 선택된 1종 이상을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 표적 특이적 뉴클레아제는 원핵 세포, 및/또는 인간 세포를 비롯한 동식물 세포 (예컨대, 진핵 세포)의 유전체에서 특정 염기서열을 인식해 이중나선절단 (double strand break, DSB)을 일으킬 수 있다. 상기 이중나선절단은 DNA의 이중 나선을 잘라, 둔단 (blunt end) 또는 점착종단 (cohesive end)을 생성시킬 수 있다. DSB는 세포 내에서 상동재조합 (homologous recombination) 또는 비상동재접합 (non-homologous end-joining, NHEJ) 기작에 의해 효율적으로 수선될 수 있는데, 이 과정에 소망하는 변이를 표적 위치에 도입할 수 있다.
일 구체예에서, 상기 표적 특이적 뉴클레아제는 Cas 단백질(예컨대, Cas9 단백질(CRISPR (Clustered regularly interspaced short palindromic repeats) associated protein 9)), Cpf1 단백질 (CRISPR from Prevotella and Francisella 1) 등과 같은 타입 Ⅱ 및/또는 타입 V의 CRISPR 시스템에 수반되는 뉴클레아제 (예컨대, 엔도뉴클레아제) 등으로 이루어진 군에서 선택된 1종 이상일 수 있다. 이 경우, 상기 표적 특이적 뉴클레아제는 유전체 DNA의 표적 부위로 안내하기 위한 표적 DNA 특이적 가이드 RNA를 추가로 포함한다. 상기 가이드 RNA는 생체 외 (in vitro)에서 전사된(transcribed) 것일 수 있고, 예컨대 올리고뉴클레오티드 이중가닥 또는 플라스미드 주형으로부터 전사된 것일 수 있으나, 이에 제한되지 않는다. 상기 표적 특이적 뉴클레아제는, 생체 외에서 또는 생체(세포) 내 전달 후, 가이드 RNA에 결합된 리보핵산-단백질 복합체를 형성(RNAGuided Engineered Nuclease)하여 리보핵산 단백질 (RNP) 형태로 작용할 수 있다. Cas 단백질은 CRISPR/Cas 시스템의 주요 단백질 구성 요소로, 활성화된 엔도뉴클레아제 또는 nickase를 형성할 수 있는 단백질이다.
Cas 단백질 또는 유전자 정보는 NCBI (National Center for Biotechnology Information)의 GenBank와 같은 공지의 데이터 베이스에서 얻을 수 있다. 예컨대, 상기 Cas 단백질은, 스트렙토코커스 sp. (Streptococcus sp.), 예컨대, 스트렙토코커스 피요게네스 (Streptococcus pyogenes) 유래의 Cas 단백질, 예컨대, Cas9 단백질(예컨대, SwissProt Accession number Q99ZW2(NP_269215.1)); 캄필로박터 속, 예컨대, 캄필로박터 제주니 (Campylobacter jejuni) 유래의 Cas 단백질, 예컨대, Cas9 단백질; 스트렙토코커스 속, 예컨대, 스트렙토코커스 써모필러스(Streptococcus thermophiles) 또는 스트렙토코커스 아우레우스 (Streptocuccus aureus) 유래의 Cas 단백질, 예컨대, Cas9 단백질; 네이세리아 메닝기디티스 (Neisseria meningitidis) 유래의 Cas 단백질, 예컨대, Cas9 단백질; 파스테우렐라 (Pasteurella) 속, 예컨대, 파스테우렐라 물토시다(Pasteurella multocida) 유래의 Cas 단백질, 예컨대 Cas9 단백질; 프란시셀라 (Francisella) 속, 예컨대, 프란시셀라 노비시다(Francisella novicida) 유래의 Cas 단백질, 예컨대 Cas9 단백질등으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, Cpf1 단백질은 상기 CRISPR/Cas 시스템과는 구별되는 새로운 CRISPR 시스템의 엔도뉴클레아제로서, Cas9에 비해 상대적으로 크기가 작고 tracrRNA가 필요 없으며, 단일 가이드 RNA에 의해 작용할 수 있다. 또한, 티민 (thymine)이 풍부한 PAM (protospacer-adjacent motif) 서열을 인식하고 DNA의 이중 사슬을 잘라 점착종단 (cohesive end; cohesive double-strand break)을 생성한다.
예컨대, 상기 Cpf1 단백질은 캔디다투스 (Candidatus) 속, 라치노스피라(Lachnospira) 속, 뷰티리비브리오 (Butyrivibrio) 속, 페레그리니박테리아(Peregrinibacteria), 액시도미노코쿠스 (Acidominococcus) 속, 포르파이로모나스(Porphyromonas) 속, 프레보텔라 (Prevotella) 속, 프란시셀라 (Francisella) 속, 캔디다투스 메타노플라스마(Candidatus Methanoplasma), 또는 유박테리움(Eubacterium) 속 유래의 것일 수 있고, 예컨대, Parcubacteria bacterium(GWC2011_GWC2_44_17), Lachnospiraceae bacterium (MC2017), Butyrivibrio proteoclasiicus , Peregrinibacteria bacterium (GW2011_GWA_33_10), Acidaminococcus sp. (BV3L6), Porphyromonas macacae, Lachnospiraceae bacterium(ND2006), Porphyromonas crevioricanis , Prevotella disiens , Moraxella bovoculi(237), Smiihella sp. (SC_KO8D17), Leptospira inadai , Lachnospiraceae bacterium(MA2020), Francisella novicida (U112), Candidatus Methanoplasma termitum, Candidatus Paceibacter , Eubacterium eligens 등의 미생물 유래의 것일 수 있으나, 이에 제한되는 것은 아니다 .
상기 표적 특이적 뉴클레아제는 미생물에서 분리된 것 또는 재조합적 방법 또는 합성적 방법 등과 같이 인위적 또는 비자연적 생산된 것(nonnaturally occurring)일 수 있다. 상기 표적 특이적 뉴클레아제는 in vitro에서 미리 전사된 mRNA 또는 미리 생산된 단백질 형태, 또는 표적 세포 또는 생체 내에서 발현하기 위하여 재조합 벡터에 포함된 형태로 사용될 수 있다. 일 예에서, 상기 표적 특이적 뉴클레아제 (예컨대, Cas9, Cpf1, 등)는 재조합 DNA(Recombinant DNA; rDNA)에 의하여 만들어진 재조합 단백질일 수 있다. 재조합 DAN는 다양한 유기체로부터 얻어진 이종 또는 동종 유전 물질을 포함하기 위하여 분자 클로닝과 같은 유전자 재조합 방법에 의하여 인공적으로 만들어진 DNA 분자를 의미한다. 예컨대, 재조합 DNA를 적절한 유기체에서 발현시켜 표적 특이적 뉴클레아제를 생산 (in vivo 또는 in vitro)하는 경우, 재조합 DNA는 제조하고자 하는 단백질을 코딩 하는 코돈들 중에서 상기 유기체에 발현하기에 최적화된 코돈을 선택하여 재구성된 뉴클레오타이드 서열을 갖는 것일 수 있다.
본 명세서에서 사용된 상기 표적특이적 뉴클레아제는 변이된 형태의 변이 표적특이적 뉴클레아제일 수 있다. 상기 변이 표적특이적 뉴클레아제는 DNA 이중 가닥을 절단하는 엔도뉴클레아제 활성을 상실하도록 변이된 것을 의미할 수 있으며, 예컨대, 엔도뉴클레아제 활성을 상실하고 니카아제 활성을 갖도록 변이된 변이 표적특이적 뉴클레아제 및 엔도뉴클레아제 활성과 니카아제 활성을 모두 상실하도록 변이된 변이 표적특이적 뉴클레아제 중에서 선택된 1종 이상일 수 있다.
상기 변이 표적특이적 뉴클레아제가 니카아제 활성을 갖는 것인 경우, 상기 디아미나제에 의한 염기변환(예컨대, 시티딘이 우라딘으로 변환)과 동시 또는 순서와 무관하게 순차적으로, 상기 염기 변환이 일어난 가닥 또는 그 반대 가닥 (예컨대, 염기 변환이 일어난 가닥의 반대 가닥)에서 nick이 도입될 수 있다 (예컨대, PAM이 위치하는 가닥의 반대가닥에서, PAM 서열의 5′말단 방향으로 3번째 뉴클레오타이드와 4번째 뉴클레오타이드 사이에 해당하는 위치에 nick이 도입됨). 이와 같은 표적특이적 뉴클레아제의 변이 (예컨대, 아미노산 치환 등)는 적어도 뉴클레아제의 촉매 활성 도메인 (예컨대, Cas9의 경우 RuvC 촉매 도메인)에서 일어나는 것일 수 있다. 일 예에서, 상기 표적특이적 뉴클레아제가 스트렙토코커스 피요젠스 유래 Cas9 단백질 (SwissProt Accession number Q99ZW2(NP_269215.1))인 경우, 상기 변이는 촉매 활성을 갖는 아스파르트산 잔기 (catalytic aspartate residue; 10번째 위치의 아스파르트산 (D10) 등), 762번째 위치의 글루탐산 (E762), 840번째 위치의 히스티딘 (H840), 854번째 위치의 아스파라긴 (N854), 863번째 위치의 아스파라긴(N863), 986번째 위치의 아스파르트산 (D986) 등으로 이루어진 군에서 선택된 하나 이상 임의의 다른 아미노산으로 치환된 돌연변이를 포함할 수 있다. 이 때, 치환되는 임의의 다른 아미노산은 알라닌 (alanine)일 수 있지만, 이에 제한되지 않는다.
다른 예에서, 상기 변이 표적특이적 뉴클레아제는 야생형 Cas9 단백질과 상이한 PAM 서열을 인식하도록 변이된 것일 수 있다. 예컨대, 상기 변이 표적특이적 뉴클레아제는 스트렙토코커스 피요젠스 유래 Cas9 단백질의 1135번째 위치의 아스파르트산 (D1135), 1335번째 위치의 아르기닌 (R1335), 및 1337번째 위치의 트레오닌 (T1337) 중 하나 이상, 예컨대 3개 모두가 다른 아미노산으로 치환되어, 야생형 Cas9의 PAM 서열 (NGG)와 상이한 NGA (N은 A, T, G, 및 C 중에서 선택된 임의의 염기임)을 인식하도록 변이된 것일 수 있다.
일 예에서, 상기 변이 표적특이적 뉴클레아제는 스트렙토코커스 피요젠스 유래 Cas9 단백질의 아미노산 서열 중,
(1) D10, H840, 또는 D10 + H840;
(2) D1135, R1335, T1337, 또는 D1135 + R1335 + T1337; 또는
(3) (1)과 (2) 잔기 모두에서 아미노산 치환이 일어난 것일 수 있다.
본 명세서에 사용된 바로서, 상기 '다른 아미노산'은, 알라닌, 이소류신, 류신, 메티오닌, 페닐알라닌, 프롤린, 트립토판, 발린, 아스파라긴산, 시스테인, 글루타민, 글리신, 세린, 트레오닌, 티로신, 아스파르트산, 글루탐산, 아르기닌, 히스티딘, 라이신, 상기 아미노산들의 공지된 모든 변형체 중에서, 야생형 단백질이 원래 변이 위치에 갖는 아미노산을 제외한 아미노산들 중에서 선택된 아미노산을 의미한다. 일 예에서, 상기 '다른 아미노산'은 알라닌, 발린, 글루타민, 또는 아르기닌일 수 있다.
일 예에서, 상기 변이 표적특이적 뉴클레아제는 엔도뉴클레아제 활성을 상실(예컨대, 니카아제 활성을 갖거나, 엔도뉴클레아제 활성 및 니카아제 활성을 모두 상실)한 변형 Cas9 단백질, 또는 야생형 Cas9과 상이한 PAM 서열을 인식하는 것일 수 있다. 예컨대, 상기 변형 Cas9 단백질은, 스트렙토코커스 피요제네스 (Streptococcus pyogenes) 유래의 Cas9 단백질에 있어서,
(1) D10 또는 H840 위치에 돌연변이 (예컨대, 다른 아미노산으로의 치환)가 도입되어 엔도뉴클레아제 활성이 상실되고 니카아제 활성을 갖는 변형 Cas9, 또는 스트렙토코커스 피요젠스 (Streptococcus pyogenes) 유래의 Cas9 단백질에 D10 및 H840 위치에 모두 돌연변이 (예컨대, 다른 아미노산으로의 치환)가 도입되어 엔도뉴클레아제 활성 및 니카아제 활성을 모두 상실한 변형 Cas9 단백질;
(2) D1135, R1335 및 T1337 중에서 하나 이상 또는 이들 모두에 돌연변이(예컨대, 다른 아미노산으로의 치환)가 도입되어 야생형과 상이한 PAM 서열을 인식하는 변형 Cas9 단백질; 또는
(3) (1) 및 (2)의 돌연변이가 모두 도입되어 니카아제 활성을 갖고 야생형과 상이한 PAM 서열을 인식하거나, 엔도뉴클레아제 활성 및 니카아제 활성을 모두 상실하고 야생형과 상이한 PAM 서열을 인식하는 변형 Cas9 단백질 일 수 있다.
예컨대, 상기 CAs9 단백질의 D10 위치에서의 돌연변이는 D10A 돌연
변이 (Cas9 단백질의 아미노산 중 10번째 아미노산인 D가 A로 치환된 돌연변이를 의미함; 이하, Cas9에 도입된 돌연변이는 동일한 방법으로 표기됨)일 수 있고, 상기 H840 위치에서의 돌연변이는 H840A 돌연변이일 수 있으며, D1135, R1335, 및 T1337 위치에서의 돌연변이는 각각 D1135V, R1335Q, 및T1337R일 수 있다.
본 명세서에서, “뉴클레아제”는, 다른 언급이 없는 한, 앞서 설명된, 예컨대, Cas9, Cpf1, 등과 같은 “표적 특이적 뉴클레아제”를 의미한다.
상기 뉴클레아제는 미생물에서 분리된 것 또는 재조합적 방법 또는 합성적 방법 등과 같이 인위적 또는 비자연적 생산된 것(non-naturally occurring)일 수 있다. 일 예에서, 상기 뉴클레아제 (예컨대, Cas9, Cpf1, 등)은 재조합 DNA에 의하여 만들어진 재조합 단백질일 수 있다. 재조합 DAN(Recombinant DNA; rDNA)는 다양한 유기체로부터 얻어진 이종 또는 동종 유전 물질을 포함하기 위하여 분자 클로닝과 같은 유전자 재조합 방법에 의하여 인공적으로 만들어진 DNA 분자를 의미한다. 예컨대, 재조합 DNA를 적절한 유기체에서 발현시켜 단백질(뉴클레아제)를 생산 (in vivo 또는 in vitro)하는 경우, 재조합 DNA는 제조하고자하는 단백질을 코딩 하는 코돈들 중에서 상기 유기체에 발현하기에 최적화된 코돈을 선택하여 재구성된 뉴클레오타이드 서열을 갖는 것일 수 있다.
상기 뉴클레아제는, 단백질, 이를 코딩하는 핵산 분자 (예컨대, DNA 또는 mRNA), 가이드 RNA와 결합된 리보핵산 단백질, 상기 리보핵산 단백질을 코딩하는 핵산 분자, 또는 상기 핵산 분자를 포함하는 재조합 벡터의 형태로 사용될 수 있다.
상기 디아미나제 및 뉴클레아제, 및/또는 이들을 코딩하는 핵산 분자는 핵 내로 전달, 작용, 및/또는 핵 내에서 발현될 수 있는 형태일 수 있다.
상기 디아미나제 및 뉴클레아제는 세포 내로 도입되기에 용이한 형태일 수 있다. 일 예로, 상기 디아미나제 및 뉴클레아제는 세포 침투 펩타이드 및/또는 단백질 전달 도메인 (protein transduction domain)과 연결될 수 있다. 상기 단백질 전달 도메인은 폴리-아르기닌 또는 HIV 유래의 TAT 단백질일 수 있으나, 이에 제한되지 않는다. 세포 침투 펩타이드 또는 단백질 전달 도메인은 상기 기술된 예 외에도 다양한 종류가 당업계에 공지되어 있으므로, 당업자는 상기 예에 제한되지 않고 다양한 예를 적용할 수 있다.
또한, 상기 디아미나제 및 뉴클레아제, 및/또는 이들을 코딩하는 핵산 분자는 핵 위치 신호 (nuclear localization signal, NLS) 서열 또는 이를 코딩하는 핵산 서열을 추가로 포함할 수 있다. 따라서, 상기 디아미나제 코딩 핵산 분자 및/또는 뉴클레아제 코딩 핵산 분자를 포함하는 발현 카세트는 상기 디아미나제 및/또는 뉴클레아제를 발현시키기 위한 프로모터 서열 등의 조절 서열 및 임의로, NLS 서열(CCCAAGAAGAAGAGGAAAGTC: 서열번호 2)을 추가로 포함할 수 있다. 상기 NLS 서열은 당업계에 잘 알려져 있다.
상기 디아미나제 및 뉴클레아제, 및/또는 이를 코딩하는 핵산 분자는 분리 및/또는 정제를 위한 태그 또는 상기 태그를 코딩하는 핵산 서열과 연결될 수 있다. 일 예로, 상기 태그는 His 태그, Flag 태그, S 태그 등과 같은 작은 펩 타이드 태그, GST (Glutathione S-transferase) 태그, MBP (Maltose binding protein) 태그 등으로 이루어진 군에서 적절하게 선택될 수 있으나, 이에 제한되지 않는다.
또한, 본 명세서에 사용된 염기 교정용 조성물은 우라실 DNA 글리코실라제 억제제 (uracil DNA glycosylase inhibitor: UGI) 또는 이를 코딩하는 유전자(코딩 DNA를 포함하는 재조합 벡터 형태 또는 in vitro 전사된 mRNA 형태 등)를 추가로 포함할 수 있다. 상기 염기 교정용 조성물이 우라실 DNA 글리코실라제 억제제를 추가로 포함하는 경우, 이를 포함하지 않는 경우와 비교하여, 디아미나제에 의한 특정 염기 치환 (예컨대 시토신 디아미나제에 의한 C에서 T로의 치환)의 비율이 높아지며, 우라실 DNA 글리코실라제 억제제를 추가로 포함하지 않는 경우에는 특정 염기 치환 (예컨대 시토신 디아미나제에 의한 C에서 T로의 치환) 이외의 형태의 염기 치환 비율이 높아진다 (즉, 다양한 형태의 염기 치환이 일어남).
본 발명에서, 용어 “가이드 RNA (guide RNA)”는 표적 유전자 내의 표적 부위 내의 특이적인 염기 서열 (표적서열)에 혼성화 가능한 표적화 서열을 포함하는 RNA를 의미하며, 생체 외 (in vitro) 또는 생체 (또는 세포) 내에서 Cas 단백질, Cpf1 등과 같은 뉴클레아제와 결합하여 이를 표적 유전자 (또는 표적 부위)로 인도하는 역할을 한다. 상기 가이드 RNA는 복합체를 형성할 뉴클레아제의 종류 및/또는 그 유래 미생물에 따라서 적절히 선택될 수 있다.
예컨대, 상기 가이드 RNA는,
표적 서열과 혼성화 가능한 부위 (표적화 서열)을 포함하는 CRISPR
RNA (crRNA);
Cas 단백질, Cpf1 등과 같은 뉴클레아제와 상호작용하는 부위를 포함하는 trans-activating crRNA (tracrRNA); 및
상기 crRNA 및 tracrRNA의 주요 부위 (예컨대, 표적화 서열을 포함하는 crRNA 부위 및 뉴클레아제와 상호작용하는 tracrRNA의 부위)가 융합된 형태의 단일 가이드 RNA (single guide RNA; sgRNA)
로 이루어진 군에서 선택된 1종 이상일 수 있으며,
구체적으로 CRISPR RNA (crRNA) 및 trans-activating crRNA(tracrRNA)를 포함하는 이중 RNA (dual RNA), 또는 crRNA 및 tracrRNA의 주요 부위를 포함하는 단일 가이드 RNA (sgRNA)일 수 있다.
상기 sgRNA는 표적 유전자 (표적 부위) 내의 표적 서열과 상보적인서열 (표적화 서열)을 가지는 부분 (이를 Spacer region, Target DNA recognition sequence, base pairing region 등으로도 명명함) 및 Cas 단백질 결합을 위한 hairpin 구조를 포함할 수 있다. 보다 구체적으로, 표적 유전자 내의 표적서열과 상보적인 서열(표적화 서열)을 포함하는 부분, Cas 단백질 결합을 위한 hairpin 구조, 및 Terminator 서열을 포함할 수 있다. 상기 기술된 구조는 5′에서 3′순으로 순차적으로 존재하는 것일 수 있으나, 이에 제한되는 것은 아니다. 상기 가이드 RNA가 crRNA 및 tracrRNA의 주요 부분 및 표적 DNA의 상보적인 부분을 포함하는 경 우라면 어떠한 형태의 가이드 RNA도 본 발명에서 사용될 수 있다.
예컨대, Cas9 단백질은 표적 유전자 교정을 위하여 두 개의 가이드 RNA, 즉, 표적 유전자의 표적 부위와 혼성화 가능한 뉴클레오타이드 서열을 갖는 CRISPR RNA (crRNA)와 Cas9 단백질와 상호작용하는 trans-activating crRNA (tracrRNA; Cas9 단백질과 상호작용함)를 필요로 하며, 이들 crRNA와 tracrRNA는 서로 결합된 이중 가닥 crRNA:tracrRNA 복합체 형태, 또는 링커를 통하여 연결되어 단일 가이드 RNA (single guide RNA; sgRNA) 형태로 사용될 수 있다. 일 예에서, Streptococcus pyogenes 유래의 Cas9 단백질을 사용하는 경우, sgRNA는 적어도 상기 crRNA의 혼성화 가능한 뉴클레오타이드 서열을 포함하는 crRNA 일부 또는 전부와 상기 Cas9의 tracrRNA의 Cas9 단백질와 상호작용하는 부위를 적어도 포함하는 tracrRNA 일부 또는 전부가 뉴클레오타이드 링커를 통하여 헤어핀 구조 (stem-loop 구조)를 형성하는 것일 수 있다 (이 때 뉴클레오타이드 링커가 루프 구조에 해당할 수 있음).
상기 가이드 RNA, 구체적으로 crRNA 또는 sgRNA는 표적 유전자 내표적 서열과 상보적인 서열(표적화 서열)을 포함하며, crRNA 또는 sgRNA의 업스트림 부위, 구체적으로 sgRNA 또는 dualRNA의 crRNA의 5′ 말단에 하나 이상, 예컨대, 1-10개, 1-5개, 또는 1-3개의 추가의 뉴클레오티드를 포함할 수 있다. 상기 추가의 뉴클레오티드는 구아닌 (guanine, G)일 수 있으나, 이에 제한되는 것은 아니다.
다른 예에서, 상기 뉴클레아제가 Cpf1인 경우, 상기 가이드 RNA는 crRNA을 포함하는 것일 수 있으며, 복합체를 형성할 Cpf1 단백질 종류 및/또는 그 유래 미생물에 따라서 적절히 선택될 수 있다.
상기 가이드 RNA의 구체적 서열은 뉴클레아제 (Cas9 또는 Cpf1)의 종류 (즉, 유래 미생물)에 따라서 적절히 선택할 수 있으며, 이는 이 발명이 속하는 기술 분야의 통상의 지식을 가진 자가 용이하게 알 수 있는 사항이다.
일 예에서, 표적특이적 뉴클레아제로서 Streptococcus pyogenes 유래의 Cas9 단백질을 사용하는 경우, sgRNA는 다음의 일반식 1로 표현될 수 있다:
일 예에서, 상기 가이드 RNA는 다음의 일반식 1로 표현되는 것일 수 있다:
5′-(Ncas9)l-(GUUUUAGAGCUA)-(올리고뉴클레오타이드 링커)-
(UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC(서열번호 1)-3′ (일반식 1)
상기 일반식 1에서,
(Ncas9)l는 Ncas9는 표적 유전자(target gene)의 표적 부(target site)위에 결합 (혼성화)하는 표적화 서열로서, 그 핵산 서열은 상기 표적 부위의 서열에 따라서 결정되며 (즉, 표적 부위의 서열과 혼성화 가능한 서열임), l은 상기 표적화 서열에 포함된 뉴클레오타이드 수를 나타내는 것으로, 20일 수 있고, 5′-말단으로부터 첫 번째 핵산은 표적 부위 서열과 매칭인 구아닌 (G로 표시; 표적 부위의 대응 위치가 시토신 (C)인 경우) 또는 미스매칭인 구아닌 (g로 표시; 표적 부위의 대응 위치가 시토신 (C)이 아닌 경우);
상기 올리고뉴클레오타이드 링커는 3 내지 5개, 예컨대 4개의 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 뉴클레오타이드들은 서로 같거나 다를 수 있고, A, U, C 및 G로 이루어진 군에서 각각 독립적으로 선택될 수 있다.
예컨대, Ncas9이 총 20개의 뉴클레오타이드로 이루어진 경우, X20 (X뒤의 숫자는 임의의 뉴클레오타이드 (X: A, T, C, 및 G 중에서 선택됨)의 개수를 나타냄)으로 표시하거나, 5′-말단으로부터 첫 번째 핵산에 매칭되는 구아닌이 위치하는 경우에는 GX19로 표시될 수 있으며, 5′-말단으로부터 첫 번째 핵산에 미스매칭되는 구아닌이 위치하는 경우에는 gX19로 표시될 수 있다.
상기 sgRNA는 3′ 말단에 5개 내지 7개의 우라실 (U)을 포함하는 종결부위를 추가로 포함할 수 있다.
상기 연장된 가이드 RNA는 앞서 설명한 일반식 1의 sgRNA의 5′말단에 1 내지 10개의 뉴클레오타이드를 추가로 포함할 수 있다. 상기 추가로 포함되는 뉴클레오타이드는 각각 독립적으로 A, T, C, 및 G 중에서 선택될 수 있다. 이때 추가로 포함되는 뉴클레오타이드는 표적 DNA 서열의 해당 위치(연장된 위치)의 뉴클레오타이드와 상보적인 서열을 갖는 것일 수 있다.
또한, 상기 sgRNA는 5′말단에 1 내지 3개의 구아닌(G)을 추가로 포함할 수 있다. 이 때 추가로 포함되는 구아닌은 각각 독립적으로 표적 서열의 해당 위치의 뉴클레오타이드와 상보적(매칭)이거나, 비상보적 (미스매칭)인 것일 수 있다.
이와 같이 앞서 설명한 일반식 1의 sgRNA, 예컨대, X20, GX19, 또는 gX19와 비교하여, 5′말단에 1 내지 3개의 구아닌(G)을 추가로 포함하거나 및/또는 sgRNA 또는 sgRNA의 5′말단에 1 내지 10개의 뉴클레오타이드 (각각 독립적으로 A, T, C, 및 G 중에서 선택될 수 있음)를 추가로 포함하는 연장된 sgRNA 형태인 경우에 염기 교정 빈도 및/또는 효율이 증가되고, 보다 광범위한 부우에서 염기 교정이 일어날 수 있다.
상기 가이드 RNA의 표적 서열은 표적 DNA 상의 PAM (Protospacer Adjacent Motif　서열(S. pyogenes Cas9의 경우, 5′-NGG-3′(N은 A, T, G, 또는 C임))이 위치하는 가닥 또는 그 반대 가닥 (상보적 가닥)에서 PAM의 5′에 인접하여 위치하는 20개의 연속하는 핵산 서열일 수 있다.
상기 가이드 RNA의 표적 서열과 혼성화 가능한 가이드 RNA의 표적화 서열은 상기 표적 서열이 위치하는 DNA 가닥 (즉, PAM 서열(5'-NGG-3' (N은 A, T, G, 또는 C임)이 위치하는 DNA 가닥 또는 그 반대 가닥)의 상보적인 가닥의 뉴클레오타이드 서열과 50% 이상, 60% 이상, 70% 이상, 80% 이상, 90% 이상, 95% 이상, 99% 이상, 또는 100%의 서열 상보성을 갖는 뉴클레오타이드 서열을 의미하는 것으로, 상기 상보적 가닥의 뉴클레오타이드 서열과 상보적 결합이 가능하다.
본 명세서에서, 표적 부위의 핵산 서열은 표적 유전자의 해당 유전자 부위의 두 개의 DNA 가닥 중 PAM 서열이 위치하는 가닥의 핵산 서열로 표시된다. 이 때, 실제로 가이드 RNA가 결합하는 DNA 가닥은 PAM 서열이 위치하는 가닥의 상보적 가닥이므로, 상기 가이드 RNA에 포함된 표적화 서열은, RNA 특성상 T를 U로 변경하는 것을 제외하고, 표적 부위의 서열과 동일한 핵산 서열을 갖게 된다. 따라서, 본 명세서에서, 가이드 RNA의 표적화 서열과 표적 부위의 서열 (또는 절단 부위의 서열)은 T와 U가 상호 변경되는 것을 제외하고 동일한 핵산 서열로 표시된다.
상기 가이드 RNA는 RNA 형태로 사용 (또는 상기 조성물에 포함)되거나, 이를 암호화하는 DNA를 포함하는 플라스미드 형태로 사용 (또는 상기 조성물에포함)될 수 있다.
실시예
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1: sgRNA 길이에 따른 base-editing window의 변화 시험
HEK293T cell line에서 각각의 activity를 deep-sequencing을 통해 측정하였다. 그 결과를 도 2a-2f에 나타내었다.
도 2a는 HEK2 site에서 sgRNA 길이에 따른 ABE 7.10 substitution activity를 base position 별로 나타낸 것이다. 도 2b는 GX19 sgRNA를 사용했을 때와 비교하여 상대적인 substitution activity[gX20~30 activity / GX19 activity]를 나타낸 것이다. 도 2c는 가장 빈번하게 나타나는 mutation allele을 표시한 것으로, WT sequence에서 변이가 도입된 부분을 빨간색으로 나타내었다. 도 2d는 HBB site에서 sgRNA 길이에 따른 BE3 substitution activity를 base position 별로 나타낸 것이다. 도 2e는 GX19 sgRNA를 사용했을 때와 비교하여 상대적인 substitution activity[gX20~30 activity / GX19 activity]를 나타낸 것이다. 도 2f는 가장 빈번하게 나타나는 mutation allele을 표시한 것으로, WT sequence에서 변이가 도입된 부분을 빨간색으로 나타내었다. GX19 sgRNA를 사용했을 때 효율적으로 작동하는 위치로 알려진 base-editing window를 하늘색으로 표시하였다.
실시예 2: 추가적인 mismatch G 1개 또는 2개를 포함한 sgRNA를 사용했을 때 base-editing window의 변화 시험
HEK293T cell line에서 각각의 activity를 deep-sequencing을 통해 측정하여, 얻어진 결과를 도 3에 나타내었다.
sgRNA 길이에 따른 BE3 substitution activity를 base position 별로 FANCF site(도 3a)와 HBB site(도 3c)에서 확인하였다. GX19 sgRNA를 사용했을 때와 비교하여 상대적인 substitution activity [gX20~30 activity / GX19 activity]를 FANCF site(도 3b)와 HBB site(도 3d)에서 나타내었다.
실시예 3: 서로 다른 4개의 site에서 sgRNA 길이에 따른 baseediting window의 변화 시험
서로 다른 4개의 site에서 sgRNA 길이에 따른 base-editing window의 변화 시험하여, 그 결과를 도 4a 및 4b에 나타내었다.
4개의 site에서 GX19 sgRNA를 사용했을 때와 비교하여 상대적인 ABE 7.10의 substitution activity [gX20~30 activity / GX19 activity]를 확인하여, 그 결과를 도 4a에 나타내었다. 도 4b는 GX19 sgRNA를 사용했을 때와 비교하여 상대적인 BE3의 substitution activity[gX20~30 activity / GX19 activity]를 확인하여 그 결과를 도 4b에 나타내었다. GX19 sgRNA를 사용했을 때 효율적으로 작동하는 위치로 알려진 base-editing window를 하늘색으로 표시하였다. HEK293T cell line에서 각각의 activity를 deep-sequencing 방법으로 측정하였다.
실시예 4: 유채와 콩에서 sgRNA 형태에 따른 base-editing window의 변화 시험
진핵 식물을 대표하여, 유채와 콩에서 sgRNA 형태에 따른 baseediting window의 변화 시험하여 그 결과를 도 5a 내지 5d에 나타내었다.
각각의 activity는 deep-sequencing을 통해 분석하였다.
유채의 protoplast에서 gX19 sgRNA와 gX20 sgRNA를 AID2 cytosine base-editor와 함께 사용했을 때, 시토신 위치에 따른 substitution 효율을 측정하여 그 결과를 도 5a에 나타내었다.
sgRNA 형태에 따라 가장 빈번하게 나타나는 mutation이 도입된 allele의 변화를 도 5b에 나타내었다. gX20 sgRNA를 사용했을 때에만 TAG stop codon이 만들어지는 것을 확인할 수 있었다.
콩의 protoplast에서 gX19 sgRNA와 gX20 sgRNA 를 AID2 cytosine base-editor와 함께 사용했을 때, 시토신 위치에 따른 substitution 효율을 측정하여 도 5c에 나타내었다. sgRNA 형태에 따라 가장 빈번하게 나타나는 mutation이 도입된 allele의 변화를 도 5d에 나타내었다. 마찬가지로 gX20 sgRNA를 사용했을 때에만 TAG stop codon이 만들어지는 것을 확인할 수 있다.
실시예 5: 생쥐에서 sgRNA 형태에 따른 base-editing window의 변화 시험
진핵 식물을 대표하여, 생쥐에서 sgRNA 형태에 따른 base-editing window의 변화 시험하여, 그 결과를 도 6a 및 6b에 나타내었다.
생쥐의 embryo에 서로 다른 종류의 sgRNA와 함께 ABE 7.10 mRNA를 microinjection 한 후, blastocyst 단계에서 deep-sequencing으로 substitution activity를 분석하여, 그 결과를 도 6a에 나타내었다.
GX21 sgRNA를 사용하여 ABE 7.10 mRNA와 함께 embryo에 microinjection을 진행해서 얻은 pup를 분석한 그 결과, 도 6b에 나타낸 바와 같이, 원하는 H420R mutation을 가진 3마리의 pup을 얻을 수 있었다.
본 발명에 따르면, 디아미나제를 사용한 유전자 염기 교정에 있어서, 통상의 가이드 RNA보다 연장된 형태의 연장된 가이드 RNA를 사용함으로써, 염기 교정 빈도 및/또는 효율을 증진시킬 수 있으며, 이러한 기술을 적용하여 원하는 점 돌연변이를 효과적으로 유도할 수 있다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일로 첨부하였음

Claims (17)

  1. 표적서열과 혼성화 가능한 연장된 가이드 RNA로, 5′말단에 1~3개의 구아닌(G)과 1~10개의 뉴클레오타이드(각각 독립적으로 A, T, C, 및 G 중에서 선택될 수 있음)를 추가로 포함하는 것을 특징으로 하는 염기교정용 가이드 RNA.
  2. 제1항에 있어서, 상기 5′말단에 추가되는 구아닌은 표적 서열과 상보적이거나 비상보적인 것을 특징으로 하는 가이드 RNA.
  3. 제1항에 있어서, 상기 가이드 RNA는 표적서열과 혼성화 가능한 부위인 CRISPR RNA (crRNA) 및 상기 RNA-가이드 뉴클레아제와 상호작용하는 부위인 trans-activating crRNA(tracrRNA)를 포함하는 것을 특징으로 하는 가이드 RNA.
  4. (i) 디아미나제 또는 이를 코딩하는 유전자, (ii) RNA-가이드 뉴클레아제 또는 이를 코딩하는 유전자 및 (iii) 표적서열과 혼성화 가능한 연장된 가이드 RNA 또는 이를 코딩하는 유전자를 포함하는 염기교정용 조성물로,
    여기서, 상기 연장된 가이드 RNA는 5′말단에 1~3개의 구아닌(G)과 1~10개의 뉴클레오타이드(각각 독립적으로 A, T, C, 및 G 중에서 선택될 수 있음)를 추가로 포함하는 것을 특징으로 하는 염기교정용 조성물.
  5. 제4항에 있어서, 상기 연장된 가이드 RNA의 5′말단에 추가되는 구아닌은 표적 서열과 상보적이거나 비상보적인 것을 특징으로 하는 조성물.
  6. 제4항에 있어서, 상기 가이드 RNA는 표적서열과 혼성화 가능한 부위인 CRISPR RNA (crRNA) 및 상기 RNA-가이드 뉴클레아제와 상호작용하는 부위인 trans-activating crRNA(tracrRNA)를 포함하는 것을 특징으로 하는 조성물.
  7. 제4항에 있어서, 상기 가이드 RNA는 이중 가이드 RNA 또는 단일 가이드 RNA (sgRNA)인 것을 특징으로 하는 조성물.
  8. 제4항에 있어서, 상기 디아미나제는 APOBEC1 (apolipoprotein B editing complex 1), AID (activation-induced deaminase) 및 tadA (tRNA-specific adenosine deaminase)로 구성된 군에서 선택되는 것을 특징으로 하는 조성물.
  9. 제4항에 있어서, 우라실 DNA 글리코실라제 억제제 (uracil DNA glycosylase inhibitor: UGI) 또는 이를 코딩하는 유전자를 추가로 포함하는 것을 특징으로 하는 조성물.
  10. 제4항에 있어서, 핵위치화서열 (NLS) 또는 이를 코딩하는 유전자를 추가로 포함하는 것을 특징으로 하는 조성물.
  11. 제4항에 있어서, 상기 RNA-가이드 뉴클레아제는 표적 유전자의 한 가닥을 절단하도록 변형된 변형 Cas9 (CRISPR 관련 단백질 9) 또는 변형 Cpf1(Prevotella 및 Francisella 1 유래 CRISPR) 시스템인 것을 특징으로 하는 조성물.
  12. 제8항에 있어서, 상기 RNA-가이드 뉴클레아제는 Cas9 니카아제 (Cas9 nickase; nCas9) 또는 촉매활성 결핍 Cas9 (catalytically-deficient Cas9; dCas9)인 것을 특징으로 하는 조성물.
  13. 제4항의 염기교정용 조성물을 세포에 도입시키는 단계를 포함하는 염기 교정방법.
  14. 제13항에 있어서, 상기 세포는 진핵세포인 것을 특징으로 하는 방법.
  15. 제14항에 있어서, 상기 진핵세포는 동물 세포 또는 진핵 식물 세포인 것을 특징으로 하는 방법.
  16. 제15항에 있어서, 상기 진핵세포는 포유동물 배아세포 또는 진핵식물 배아인 것을 특징으로 하는 방법.
  17. 다음 단계를 포함하는 돌연변이가 유발된 인간을 제외한 포유동물 또는 진핵 식물 성체의 제조방법;
    (a) 제4항의 염기 교정용 조성물을 포유동물 배아 또는 진핵식물 배아에 도입시키는 단계; 및
    (b) 상기 배아를 성장시켜 성체를 획득하는 단계.
PCT/KR2019/000962 2018-01-23 2019-01-23 연장된 단일 가이드 rna 및 그 용도 WO2019147014A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP19743145.5A EP3744844A4 (en) 2018-01-23 2019-01-23 EXTENDED SINGLE GUIDE RNA AND ITS USES
CN201980014548.2A CN111742051A (zh) 2018-01-23 2019-01-23 延伸的单向导rna及其用途
JP2020561562A JP7075170B2 (ja) 2018-01-23 2019-01-23 延長された単一ガイドｒｎａ及びその用途
US16/964,277 US20210032621A1 (en) 2018-01-23 2019-01-23 Extended single guide rna and use thereof
KR1020207021532A KR20200103769A (ko) 2018-01-23 2019-01-23 연장된 단일 가이드 rna 및 그 용도

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2018-0008492 2018-01-23
KR20180008492 2018-01-23

Publications (1)

Publication Number Publication Date
WO2019147014A1 true WO2019147014A1 (ko) 2019-08-01

Family

ID=67394687

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/000962 WO2019147014A1 (ko) 2018-01-23 2019-01-23 연장된 단일 가이드 rna 및 그 용도

Country Status (6)

Country Link
US (1) US20210032621A1 (ko)
EP (1) EP3744844A4 (ko)
JP (1) JP7075170B2 (ko)
KR (1) KR20200103769A (ko)
CN (1) CN111742051A (ko)
WO (1) WO2019147014A1 (ko)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021032155A1 (zh) * 2019-08-20 2021-02-25 中国科学院遗传与发育生物学研究所 一种碱基编辑系统和其使用方法
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115678900A (zh) * 2021-07-30 2023-02-03 中国科学院天津工业生物技术研究所 缩小碱基编辑器的编辑窗口的方法、碱基编辑器及用途

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100076057A1 (en) * 2008-09-23 2010-03-25 Northwestern University TARGET DNA INTERFERENCE WITH crRNA
EP3009511A2 (en) * 2015-06-18 2016-04-20 The Broad Institute, Inc. Novel crispr enzymes and systems
KR20160133380A (ko) * 2015-05-12 2016-11-22 연세대학교 산학협력단 선형 이중가닥 ＤＮＡ를 활용한 ＣＲＩＳＰＲ／Ｃａｓ９ 시스템을 이용한 표적 유전체 교정
KR20170068400A (ko) * 2015-12-08 2017-06-19 기초과학연구원 Cpf1을 포함하는 유전체 교정용 조성물 및 그 용도

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2007329458A1 (en) * 2006-12-04 2008-06-12 Abbott Laboratories Companion diagnostic assays for cancer therapy
CN110066775B (zh) * 2012-10-23 2024-03-19 基因工具股份有限公司 用于切割靶dna的组合物及其用途
US9834791B2 (en) * 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US9840699B2 (en) * 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
EP3080260B1 (en) * 2013-12-12 2019-03-06 The Broad Institute, Inc. Crispr-cas systems and methods for altering expression of gene products, structural information and inducible modular cas enzymes
JP2015133554A (ja) 2014-01-10 2015-07-23 三菱電機株式会社 有線伝送装置及び終端抵抗の抵抗値の調整方法
JP6206893B2 (ja) * 2014-03-05 2017-10-04 国立大学法人神戸大学 標的化したｄｎａ配列の核酸塩基を特異的に変換するゲノム配列の改変方法及びそれに用いる分子複合体
BR112016028564A2 (pt) * 2014-06-06 2018-01-30 Regeneron Pharma método para modificar um locus-alvo em uma célula.
MX2017010480A (es) * 2015-02-18 2017-11-13 Univ Iowa State Res Found Inc Modificacion del sitio de enlace represor transcripcional en el promotor nf-yc4 para contenido de proteina incrementado y resistencia al estres.
US10167457B2 (en) * 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
JP6826930B2 (ja) 2016-03-29 2021-02-10 住友化学株式会社 発光素子
EP3447139B1 (en) * 2016-04-21 2022-06-08 National University Corporation Kobe University Method for increasing mutation introduction efficiency in genome sequence modification technique, and molecular complex to be used therefor
US11192929B2 (en) * 2016-12-08 2021-12-07 Regents Of The University Of Minnesota Site-specific DNA base editing using modified APOBEC enzymes
CN106834341B (zh) * 2016-12-30 2020-06-16 中国农业大学 一种基因定点突变载体及其构建方法和应用

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100076057A1 (en) * 2008-09-23 2010-03-25 Northwestern University TARGET DNA INTERFERENCE WITH crRNA
KR20160133380A (ko) * 2015-05-12 2016-11-22 연세대학교 산학협력단 선형 이중가닥 ＤＮＡ를 활용한 ＣＲＩＳＰＲ／Ｃａｓ９ 시스템을 이용한 표적 유전체 교정
EP3009511A2 (en) * 2015-06-18 2016-04-20 The Broad Institute, Inc. Novel crispr enzymes and systems
KR20170068400A (ko) * 2015-12-08 2017-06-19 기초과학연구원 Cpf1을 포함하는 유전체 교정용 조성물 및 그 용도

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
LI, BIN: "Engineering CRISPR-Cpfl crRNAs and mRNAs to maximize genome editing efficiency", NAT BIOMED ENG., vol. 1, no. 5, 2017, pages 1 - 21, XP055564263 *
RAN F.A. ET AL., NAT. PROTOC., vol. 8, 2013, pages 2281 - 2308
See also references of EP3744844A4
WOO J.W. ET AL., NAT. BIOTECHNOL., vol. 33, 2015, pages 1162 - 1164

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
WO2021032155A1 (zh) * 2019-08-20 2021-02-25 中国科学院遗传与发育生物学研究所 一种碱基编辑系统和其使用方法
CN114945670A (zh) * 2019-08-20 2022-08-26 上海蓝十字医学科学研究所 一种碱基编辑系统和其使用方法
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Also Published As

Publication number Publication date
EP3744844A1 (en) 2020-12-02
JP2021511824A (ja) 2021-05-13
KR20200103769A (ko) 2020-09-02
EP3744844A4 (en) 2021-10-20
US20210032621A1 (en) 2021-02-04
JP7075170B2 (ja) 2022-05-25
CN111742051A (zh) 2020-10-02

Similar Documents

Publication Publication Date Title
WO2019147014A1 (ko) 연장된 단일 가이드 rna 및 그 용도
CN108441520B (zh) 利用CRISPR/Cas9系统构建的基因条件性敲除方法
KR102151065B1 (ko) 동물 배아의 염기 교정용 조성물 및 염기 교정 방법
KR102098915B1 (ko) 키메라 게놈 조작 분자 및 방법
CN103388006B (zh) 一种基因定点突变的构建方法
Zhang et al. Disruption of the sheep BMPR-IB gene by CRISPR/Cas9 in in vitro-produced embryos
CN104651399B (zh) 一种利用CRISPR/Cas系统在猪胚胎细胞中实现基因敲除的方法
JP7257062B2 (ja) ゲノム編集方法
WO2021201653A1 (ko) Crispr/cas9 시스템을 기반으로 한 유전체 편집 방법 및 이의 용도
US20220298494A1 (en) Enzymes with ruvc domains
US20220251580A1 (en) Improved gene editing system
US11208659B2 (en) Pig with a genetically modified CD163 gene resistant to PRRSv
WO2022065689A1 (ko) 편집 효율이 향상된 프라임 편집 기반 유전자 교정용 조성물 및 이의 용도
CN110643636A (zh) 一种团头鲂MSTNa&b基因敲除方法与应用
CN117187220A (zh) 腺嘌呤脱氨酶及其在碱基编辑中的用途
WO2022059928A1 (ko) 신규의 개량된 염기 편집 또는 교정용 융합단백질 및 이의 용도
KR102679001B1 (ko) 신규의 개량된 염기 편집 또는 교정용 융합단백질 및 이의 용도
KR20180082981A (ko) 중첩된 가이드핵산을 이용한 표적 핵산에 특정 핵산 서열을 삽입하기 위한 조성물 및 방법
Henderson et al. Processing of DNA prior to illegitimate recombination in mouse cells
Tasheva et al. Deoxycytidine methylation and the origin of spontaneous transition mutations in mammalian cells
JP6956995B2 (ja) ゲノム編集方法
WO2024063273A1 (en) Novel adenine deaminase variants and a method for base editing using the same
WO2023008887A1 (ko) 염기 편집기 및 이의 용도
Li et al. Effect of ARTEMIS (DCLRE1C) deficiency and microinjection timing on editing efficiency during somatic cell nuclear transfer and in vitro fertilization using the CRISPR/Cas9 system
CN112522269A (zh) 特异性靶向鸡TYR基因的sgRNA导向序列及应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19743145

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2020561562

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20207021532

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019743145

Country of ref document: EP

Effective date: 20200824