WO2019144107A1 - Methods and compositions for discrete melt analysis - Google Patents

Methods and compositions for discrete melt analysis Download PDF

Info

Publication number
WO2019144107A1
WO2019144107A1 PCT/US2019/014512 US2019014512W WO2019144107A1 WO 2019144107 A1 WO2019144107 A1 WO 2019144107A1 US 2019014512 W US2019014512 W US 2019014512W WO 2019144107 A1 WO2019144107 A1 WO 2019144107A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
signal
target
probe
predetermined
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/014512
Other languages
English (en)
French (fr)
Inventor
Douglas Whitman
Jennifer BERNIER
William Wang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Luminex Corp
Original Assignee
Luminex Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Luminex Corp filed Critical Luminex Corp
Priority to KR1020207024174A priority Critical patent/KR20200115552A/ko
Priority to BR112020014412-6A priority patent/BR112020014412A2/pt
Priority to CN201980009454.6A priority patent/CN111629831A/zh
Priority to CA3088250A priority patent/CA3088250A1/en
Priority to EP19741859.3A priority patent/EP3743211A4/en
Priority to JP2020540385A priority patent/JP2021511056A/ja
Priority to AU2019209444A priority patent/AU2019209444A1/en
Publication of WO2019144107A1 publication Critical patent/WO2019144107A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/6823Release of bound markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6851Quantitative amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/30Oligonucleotides characterised by their secondary structure
    • C12Q2525/301Hairpin oligonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00Reactions demanding special reaction conditions
    • C12Q2527/101Temperature
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00Reactions demanding special reaction conditions
    • C12Q2527/107Temperature of melting, i.e. Tm
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00Reactions demanding special reaction conditions
    • C12Q2527/143Concentration of primer or probe
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00Reactions of nucleic acids characterised by
    • C12Q2531/10Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/113PCR

Definitions

  • the present invention relates generally to the field of molecular biology. More particularly, it concerns methods for identifying and quantifying nucleic acid targets in biological samples.
  • melt analysis of duplex nucleic acids utilizes melt or anneal peaks to discriminate amplicon identity, but melt peaks are not easily distinguishable in amplicons or nucleic acid duplexes that melt near the same temperature unless the amplicons or nucleic acids are distinctly labeled. Furthermore, melt analysis is generally performed after target amplification and increases turnaround time of an assay due to the time required to slowly increase or decrease temperature of the sample and acquire images at multiple temperatures.
  • Digital polymerase chain reaction is a refinement of conventional PCR and can be used to directly quantify and clonally amplify nucleic acids, e.g., DNA, cDNA or RNA.
  • Conventional PCR is generally used for measuring nucleic acid amounts and is carried out by a single reaction per sample. Utilizing dPCR methodology, a single reaction is also carried out on a sample, however the sample is separated into a large number of partitions and the reaction is carried out in each partition individually. This separation allows for a more reliable collection and sensitive measurement of nucleic acid amounts.
  • Current methods for dPCR rely on end point PCR to quantify the presence of target nucleic acids. This end point PCR analysis is limiting in multiple ways.
  • One of the drawbacks is the time required to acquire a melt profile in dPCR applications. Images must be acquired over a large number (e.g. up to 30,000) of partitions at many different temperatures, such as around 35 - 70 unique temperatures, which can be very time consuming. Typical exposure times are on the order of ls, not accounting for time to turn LED on prior to imaging. The footprint for 30,000 lnL partitions could be on the order of l2.5mm x 12.5mm.
  • Typical field of view dimensions to achieve appropriate resolution on 1 nL partitions is on the order of 6mm x 6mm.
  • 630 images may be required for a single sample and image acquisition alone may take more than 10 minutes, not accounting for melt acquisition in additional channels.
  • This method also requires maintaining the partitions at successively higher temperatures for extended periods and extended exposure of the sample to light which can degrade the fluorescence signal through photobleaching.
  • the present disclosure provides a method of performing a melt analysis on a labeled duplex nucleic acid in a reaction mixture, the labeled duplex nucleic acid having a predetermined Tm and the method comprising: (a) measuring a first signal from a labeled duplex nucleic acid at a first temperature that is lower than the predetermined Tm of the labeled duplex nucleic acid; (b) measuring a second signal from the labeled duplex nucleic acid at a second temperature that is higher than the predetermined Tm of the labeled duplex nucleic acid; and (c) determining if the labeled duplex nucleic acid is the result of specific hybridization of a target-specific probe to a target sequence by comparing the first signal and the second signal, wherein a change between the first signal and the second signal indicates that the labeled duplex nucleic acid is the result of specific hybridization of a target-specific probe to a target sequence in the reaction mixture and wherein a
  • a method comprising performing a melt analysis on a labeled duplex nucleic acid in a reaction mixture, the labeled duplex nucleic acid having a predetermined Tm and the method comprising (a) measuring a first signal from a labeled duplex nucleic acid at a first temperature that is lower than the predetermined Tm of the labeled duplex nucleic acid; (b) measuring a second signal from the labeled duplex nucleic acid at a second temperature that is higher than the predetermined Tm of the labeled duplex nucleic acid without measuring a signal at the predetermined Tm; and (c) comparing the first signal and the second signals determining that the labeled duplex nucleic acid is the result of specific hybridization of a target-specific probe to a target sequence in the reaction mixture when there is a change between the first and second signals.
  • the target-specific probe is a cleavable probe that is cleaved upon specific hybridization of the target-specific probe to the target sequence.
  • the target-specific probe is capable of adopting a first temperature-dependent conformation or a second temperature-dependent conformation.
  • signal is not measured within 2 degrees Celsius of the predetermined Tm of the labeled duplex nucleic acid. In some aspects, is not measured within 5 degrees Celsius of the predetermined Tm of the labeled duplex nucleic acid.
  • the difference between the first temperature and the second temperature is greater than two degrees Celsius. In some aspects, the difference between the first temperature and the second temperature is greater than 5 degrees Celsius.
  • the difference between the first temperature and the second temperature is greater than 8 degrees Celsius.
  • the method further comprises the steps of measuring a third signal at a third temperature at which all labeled duplex nucleic acids in the reaction mixture are denatured, and normalizing the first and second signals relative to the third signal.
  • the reaction mixture contains at least two different duplex nucleic acids, each having a unique, predetermined Tm, and each different duplex nucleic acid having the same signal generating label, further comprising the steps of: e) measuring a signal from each different labeled duplex nucleic acid at a temperature that is lower than the unique, predetermined Tm of the labeled duplex nucleic acid and a temperature that is higher than the unique, predetermined Tm of the labeled duplex nucleic acid, and wherein, for each different labeled duplex nucleic acid, a change in signal measured at the temperature that is lower than the unique, predetermined Tm and the signal measured at the temperature that is higher than the unique, predetermined Tm indicates that the labeled duplex nucleic acid is the result of specific hybridization of a target-specific probe to its target.
  • signal is measured at no more than n + 1 different temperatures, wherein n is the number of unique target-specific probes in the reaction mixture.
  • steps are performed on multiple partitions in a dPCR reaction.
  • the first and second signals are normalized relative to the third signal by subtracting the third signal from the first and second signals.
  • the change between the first and second signals exceeds a predetermined threshold.
  • the present disclosure provides a method for determining the presence of at least one target nucleic acid sequence in a sample, the method comprising: a) contacting, under hybridization conditions, the sample with at least one cleavable, target- specific probe capable of specifically hybridizing to the target nucleic acid sequence if present in a reaction mixture; b) cleaving the probe that is specifically hybridized to the target nucleic acid sequence to form a truncated probe; c) providing conditions to cause the truncated probe to hybridize to a capture sequence; d) extending the truncated probe to form a duplex nucleic acid having a predetermined Tm and a signal-generating label; e) (performing a melt analysis by) measuring a first signal at a temperature below the predetermined Tm and a second signal at a temperature above the predetermined Tm without measuring a signal at the predetermined Tm; and f) determining the presence of the target nucleic acid sequence by detecting
  • the sample is contacted with at least two different cleavable probes, each different cleavable probe being specific for a different target nucleic acid sequence, wherein, in the presence of its specific target nucleic acid sequence, each different cleavable probe forms a duplex nucleic acid having a unique, predetermined Tm, and wherein the duplex nucleic acids having unique, predetermined Tms all have the same signal-generating label, further comprising the steps of, for each duplex nucleic acid having a unique, predetermined Tm, measuring a first signal at a temperature below the predetermined Tm and a second signal at a temperature above the predetermined Tm and determining the presence of the target nucleic acid sequence by detecting a change between the first and second signals.
  • signal is measured at no more than n + 1 different temperatures, wherein n is the number of different cleavable probes in the reaction mixture.
  • the unique, predetermined Tms of said different duplex nucleic acids are at least 2 degrees Celsius different. In some aspects, the unique, predetermined Tms of said different duplex nucleic acids are at least 5 degrees Celsius different. In some aspects, the unique, predetermined Tms of said different duplex nucleic acids are at least 10 degrees Celsius different.
  • the capture sequence and truncated probe are unimolecular. In other aspects, the capture sequence and truncated probe are bimolecular.
  • the target nucleic acid is determined to be present when the ratio between the first signal and the second signal exceeds a predetermined threshold.
  • the method is performed without measuring a signal at a temperature within 2 degrees Celsius of the predetermined Tm. In some aspects, the method is performed without measuring a signal at a temperature within 5 degrees Celsius of the predetermined Tm.
  • the at least one cleavable probe is labeled with a first member of a reporter-quencher pair and the at least one cleavable probe adopts a first conformation when hybridized to its target nucleic acid sequence.
  • strand extension includes incorporating a second member of a reporter-quencher pair that interacts with the first member of the reporter- quencher pair (resulting in a change in signal).
  • the first conformation is a linear conformation and the second conformation is a hairpin conformation.
  • the method further comprises the step of measuring a third signal at a third temperature at which all nucleic acids in the reaction mixture are denatured, and normalizing the first and second signals relative to the third signal.
  • the steps are performed on multiple partitions in a dPCR reaction.
  • the melt analysis is performed across multiple partitions in a dPCR reaction, further comprising prior to cleaving, measuring a signal from the label of the cleavable probe in the multiple partitions and setting a threshold using the signal measured prior to cleaving to distinguish partitions containing the target nucleic acid from partitions not containing the target nucleic acid.
  • the melt analysis is performed across multiple partitions in a dPCR reaction, further comprising after extending and prior to melt analysis, measuring multiple signals at a range of temperatures and using the measured signals to correct for light and temperature-dependent changes in signals measured during melt analysis.
  • the present disclosure provides a method of performing a melt analysis of a labeled duplex nucleic acid in a reaction mixture, the method comprising: a) measuring a first signal from the labeled duplex nucleic acid at a first temperature at which the labeled duplex nucleic acid is predominantly in a first conformation; (b) measuring a second signal from the labeled duplex nucleic acid at a second temperature at which the labeled duplex nucleic acid is predominantly in a second conformation, wherein signal is not measured at a temperature intermediate the first and second temperatures and at which about half the duplex nucleic acid is in the first conformation and half the duplex nucleic acid is in the second conformation; and (c) determining
  • a method comprises performing a melt analysis of a labeled duplex nucleic acid in a reaction mixture, the method comprising (a) measuring a first signal from the labeled duplex nucleic acid at a first temperature at which the labeled duplex nucleic acid is in a first conformation; (b) measuring a second signal from the labeled duplex nucleic acid at a second temperature at which the labeled duplex nucleic acid is in a second conformation, wherein signal is not measured at a temperature intermediate the first and second temperatures; and (c) determining if the labeled duplex nucleic acid is the result of specific hybridization of a target-specific probe to a target sequence by comparing the first signal and the second signal, wherein a change between the first signal and the second signal indicates that the labeled duplex nucleic acid is the result of specific hybridization of a target- specific probe to a target sequence.
  • the reaction mixture contains at least two different labeled duplex nucleic acids, each different labeled duplex nucleic acid being capable of adopting the second conformation at a unique temperature, and each different labeled nucleic acid having the same signal-generating label, further comprising the steps of, for each labeled duplex nucleic acid, measuring a first signal at a temperature at which the labeled duplex nucleic acid is predominantly in a first conformation and measuring a second signal at a temperature at which the labeled duplex nucleic acid is predominantly in a second conformation and comparing the first and second signals.
  • signal is measured at no more than n + 1 different temperatures, wherein n is the number of different duplex nucleic acids in the reaction mixture.
  • the first conformation is a hairpin conformation and the second conformation is a linear conformation.
  • the target- specific probe is a cleavable probe labeled with a first member of a reporter-quencher pair.
  • specific hybridization of the target-specific probe to its target sequence results in cleavage of the probe at a cleavage site to form a truncated probe, release of the truncated probe from the target nucleic acid sequence, to form a hairpin probe, and strand extension from the cleavage site.
  • strand extension includes incorporating a second member of a reporter-quencher pair that interacts with the first member of the reporter-quencher pair, resulting in a change in signal.
  • the method further comprises the step of measuring a third signal at a third temperature at which all nucleic acids in the reaction mixture are denatured, and normalizing the first and second signals relative to the third signal.
  • the steps are performed on multiple partitions in a dPCR reaction.
  • the present disclosure provides a method for detecting the presence of at least one target nucleic acid sequence in a sample, the method comprising: a) contacting the sample with at least one cleavable probe capable of specifically hybridizing to the target nucleic acid sequence if present, the cleavable probe comprising a first non-natural nucleotide labeled with a first member of a reporter-quencher pair; b) cleaving the probe that is specifically hybridized to the target nucleic acid sequence to form a truncated probe; c) providing conditions to cause the truncated probe to form a hairpin probe; d) extending the hairpin probe in the presence of a second non-natural nucleotide labeled with a second member of the reporter-quencher pair, the second non-natural nucleotide being capable of base-pairing with the first non-natural nucleotide to form a hairpin probe having a predetermined Tm; e)
  • the sample is contacted with two or more different cleavable probes, each specific for a different nucleic acid and each capable of forming, in the presence of its respective target nucleic acid, a hairpin probe having a unique predetermined Tm, and wherein each different hairpin probe includes the same reporter-quencher pair, further comprising the step of, for each different hairpin probe, measuring a first signal at a temperature below the predetermined Tm and a second signal at a temperature above the predetermined Tm of the hairpin probe, and comparing the first and second signals for each different hairpin probe.
  • the sample is contacted with two or more different cleavable probes in a single reaction compartment.
  • signal is measured at no more than n + 1 different temperatures, wherein n is the number of different cleavable probes in the reaction compartment.
  • the unique, predetermined Tms of said different hairpin probes are at least 2 degrees Celsius different. In some aspects, the unique, predetermined Tms of said different hairpin probes are at least 5 degrees Celsius different. In some aspects, the unique, predetermined Tms of said different hairpin probes are at least 10 degrees Celsius different.
  • the target nucleic acid is determined to be present when the ratio between the first signal and the second signal exceeds a predetermined threshold. In some aspects, melt analysis is performed without measuring a signal at a temperature within 2 degrees Celsius of the predetermined Tm.
  • melt analysis is performed without measuring a signal at a temperature within 5 degrees Celsius of the predetermined Tm.
  • the method further comprises the step of measuring a third signal at a third temperature at which all nucleic acids in the reaction mixture are denatured, and normalizing the first and second signals relative to the third signal.
  • the steps are performed on multiple partitions in a dPCR reaction.
  • the melt analysis is performed across multiple partitions in a dPCR reaction, further comprising prior to cleaving, measuring a signal from the label of the cleavable probe in the multiple partitions and setting a threshold using the signal measured prior to cleaving to distinguish partitions containing the target nucleic acid from partitions not containing the target nucleic acid.
  • the melt analysis is performed across multiple partitions in a dPCR reaction, further comprising after extending and prior to melt analysis, measuring multiple signals at a range of temperatures and using the measured signals to correct for light and temperature-dependent changes in signals measured during melt analysis.
  • the present disclosure provides a method for detecting the presence or absence of at least one target nucleic acid sequence in a sample, the method comprising: a) contacting the sample with at least one cleavable probe capable of specifically hybridizing to the target nucleic acid sequence if present, the cleavable probe including a signal-generating label; b) cleaving the probe that is specifically hybridized to the target nucleic acid sequence to form a truncated probe; c) providing conditions to cause the truncated probe to hybridize to a capture sequence that includes a sequence that is complementary to the truncated probe; d) extending the truncated probe using the capture sequence as a template, to form a double stranded probe having a predetermined Tm; and e) (performing a melt analysis by) measuring a first signal from the signal-generating label at a first temperature below the predetermined Tm and a second signal at a second temperature above the predetermined Tm, without
  • the sample is contacted with two or more different cleavable probes, each specific for a different target nucleic acid and each capable of forming, in the presence of its respective target nucleic acid, a double stranded probe having a unique predetermined Tm, and wherein each different double stranded probe includes the same reporter-quencher pair, further comprising for each different double stranded probe, the step of measuring a first signal from at a first temperature below the predetermined Tm and a second signal at a second temperature above the predetermined Tm, and comparing the first and second signals measured for each different double stranded probe.
  • the capture sequence and truncated probe are unimolecular.
  • the capture sequence and truncated probe are bimolecular.
  • the sample is contacted with two or more different cleavable probes in a single reaction compartment.
  • signal is measured at no more than n + 1 different temperatures, wherein n is the number of different cleavable probes in the reaction compartment.
  • the unique, predetermined Tms of said different double stranded probes are at least 2 degrees Celsius different. In some aspects, the unique, predetermined Tms of said different double stranded probes are at least 5 degrees Celsius different. In some aspects, the unique, predetermined Tms of said different double stranded probes are at least 8 degrees Celsius different.
  • the target nucleic acid is determined to be present when the ratio between the first signal and the second signal exceeds a predetermined threshold.
  • the method is performed without measuring a signal at a temperature within 2 degrees Celsius of the predetermined Tm. In some aspects, the method is performed without measuring a signal at a temperature within 5 degrees Celsius of the predetermined Tm.
  • the signal-generating label is a first member of a reporter-quencher pair and the double stranded probe includes a second member of the reporter- quencher pair that interacts with the first member of the reporter-quencher pair.
  • the duplex nucleic acid comprises a second non-natural nucleotide that hybridizes to the first non-natural nucleotide, and the second member of the reporter-quencher pair is attached to the second non-natural nucleotide.
  • the first member of the reporter-quencher pair is a fluorescent entity and the second member of the reporter-quencher pair is a quencher that quenches the fluorescence of the fluorescent entity.
  • the first and second non-natural nucleotides are one of iso-C and iso-G.
  • the method further comprises the step of measuring a third signal at a third temperature at which all nucleic acids in the reaction mixture are denatured, and normalizing the first and second signals relative to the third signal.
  • the steps are performed on multiple partitions in a dPCR reaction.
  • the melt analysis is performed across multiple partitions in a dPCR reaction, further comprising prior to cleaving, measuring a signal from the label of the cleavable probe in the multiple partitions and setting a threshold using the signal measured prior to cleaving to distinguish partitions containing the target nucleic acid from partitions not containing the target nucleic acid.
  • the melt analysis is performed across multiple partitions in a dPCR reaction, further comprising after extending and prior to melt analysis, measuring multiple signals at a range of temperatures and using the measured signals to correct for light and temperature-dependent changes in signals measured during melt analysis.
  • the present disclosure provides a method of performing a melt analysis on a plurality of labeled nucleic acid duplexes, the method comprising: (a) providing at least a first, a second, and a third labeled duplex nucleic acid, wherein each of the first, second, and third labeled duplex nucleic acids has a unique predetermined Tm, and the unique predetermined Tm of the second labeled duplex nucleic acid is higher than the unique, predetermined Tm of the first labeled duplex nucleic acid, and the unique, predetermined Tm of the third labeled duplex nucleic acid is higher than the unique, predetermined Tm of the second labeled duplex nucleic acid, and wherein the first, second, and third labeled duplex nucleic acids are labeled with the same label; (b) detecting a first signal from the first, second, and third labeled duplex nucleic acids at a first temperature that is lower than the unique, predetermined
  • signal is not detected at the unique, predetermined Tms of the first, second, and third labeled duplex nucleic acids.
  • the difference between the first temperature and the second temperature is greater than two degrees Celsius
  • the difference between the second temperature and the third temperature is greater than two degrees Celsius
  • the difference between the third temperature and the fourth temperature is greater than two degrees Celsius.
  • the steps are performed on multiple partitions in a dPCR reaction.
  • the first and second signals are normalized relative to the third signal by subtracting the third signal from the first and second signals.
  • a method comprises the step of measuring a third signal at a third temperature at which all duplex nucleic acids in the reaction mixture are denatured, and normalizing the first and second signals relative to the third signal.
  • a method for determining the presence of a target nucleic acid in a sample comprising the steps of: (a) providing a reaction mixture comprising the sample and a signal generating target-specific probe, wherein the target-specific probe generates a first signal when in a first, single-stranded conformation; (b) measuring the first signal from the target-specific probe in the reaction mixture; (c) providing conditions for the target-specific probe to hybridize to the target nucleic acid if present, and adopt a second conformation, the second conformation being a duplex nucleic acid having a predetermined Tm and being capable of generating a second signal at a temperature lower than the predetermined Tm; (d) measuring the second signal from the duplex nucleic acid at a temperature lower than the predetermined Tm without measuring a signal at the predetermined Tm; and (e) determining the presence of the target nucleic acid when there is a difference between the first signal and the second signal.
  • the target specific probe is a cleavable probe that is cleaved upon hybridization to the target nucleic acid to form a truncated probe and/or the truncated probe binds to a capture sequence and is extended to form the duplex nucleic acid.
  • the first and second signals are fluorescent signals.
  • the first signal is detected prior to hybridization of the target-specific probe to the target nucleic acid.
  • the first signal is detected after cleavage and extension under conditions at which the target-specific probe is in the first conformation.
  • the cleavable probe comprises a first non-natural nucleotide labeled with a first member of a reporter-quencher pair
  • the duplex nucleic acid comprises a second non-natural nucleotide capable of base-pairing with the first non-natural nucleotide and labeled with a second member of the reporter-quencher pair.
  • the first and second non-natural nucleotides are one of iso-C and iso-G.
  • the target-specific probe is labeled with a fluorophore prior to binding to the capture sequence, and wherein a quencher is incorporated into the duplex nucleic acid at a position that results in quenching of the fluorophore.
  • the reaction mixture is subjected to conditions for amplification of the target nucleic acid after step (b).
  • the capture sequence and truncated probe are unimolecular and hybridize to form a hairpin probe. In some cases, the capture sequence and truncated probe are bi-molecular.
  • method for detecting the presence of a target nucleic acid in a sample comprising the steps of: (a) providing a reaction mixture comprising the sample, at least one labeled, cleavable target-specific probe capable of specifically hybridizing to the target nucleic acid sequence if present in the reaction mixture, and the label being a first member of a reporter-quencher pair; (b) measuring a first signal from the labeled target-specific probe in the reaction mixture; (c) providing conditions to cause the labeled cleavable target-specific probe to hybridize to the target nucleic acid sequence if present in the reaction mixture; (d) cleaving the probe that is specifically hybridized to the target nucleic acid sequence to form a truncated probe; (e) providing conditions to cause the truncated probe to hybridize to a capture sequence; (f) extending the truncated probe to form a duplex nucleic acid having a second member of the reporter
  • the capture sequence and truncated probe are unimolecular and hybridize to form a hairpin probe. In certain cases, the capture sequence and truncated probe are bi-molecular.
  • the target specific probe comprises a first non-natural nucleotide to which the first member of the reporter-quencher pair is attached and the duplex nucleic acid comprises a second non natural nucleotide to which the second member of the reporter-quencher pair is attached, and the first and second non-natural nucleotides are capable of base-pairing with each other.
  • the first and second non-natural nucleotides are one or the other of isoC and isoG.
  • the first member of the reporter-quencher pair is a fluorophore and the second member of the reporter-quencher pair is a quencher.
  • a method for determining the presence of a target nucleic acid in a sample comprising the steps of: (a) providing a reaction mixture comprising the sample and a signal generating target-specific probe, wherein the target-specific probe generates a first signal when in a first, single-stranded conformation; (b) measuring the first signal from the target-specific probe in the reaction mixture; (c) subjecting the reaction mixture to conditions for amplification of the target nucleic acid, wherein during amplification, the target-specific probe is modified to form a modified target- specific probe comprising a duplex nucleic acid having a predetermined Tm and being capable of generating a second signal at a temperature lower than the predetermined Tm; (d) measuring the second signal at a temperature lower than the predetermined Tm without
  • the target specific probe is modified by being cleaved upon hybridization to the target nucleic acid to form a truncated probe which binds to a capture sequence and is extended to form the duplex nucleic acid.
  • the first and second signals are fluorescent signals.
  • the first signal is detected prior to hybridization of the target-specific probe to the target nucleic acid.
  • the first signal is detected after cleavage and extension under conditions at which the modified target-specific probe is in a single stranded conformation.
  • the target-specific probe comprises a first non-natural nucleotide labeled with a first member of a reporter-quencher pair
  • the modified target-specific probe comprises a second non-natural nucleotide capable of base-pairing with the first non-natural nucleotide and labeled with a second member of the reporter-quencher pair.
  • the first and second non-natural nucleotides are one of iso-C and iso-G.
  • the target-specific probe is labeled with a fluorophore prior to binding to the capture sequence, and wherein a quencher is incorporated into the duplex nucleic acid during extension at a position that results in quenching of the fluorophore.
  • a method of detecting the presence of a first and second target nucleic acid in a sample comprising the steps of: (a) forming an amplification reaction mixture comprising a first and second fluorescent signal generating target-specific probe and the sample potentially containing the first and second target nucleic acid; (b) partitioning the reaction mixture so that each partition contains, on average, zero or one of the first and/or second target nucleic acids; (c) acquiring a first, second and third set of fluorescent intensity values from images of at least a subset of partitions at preselected temperatures Tl, T2 and T3 and for each partition in the subset of partitions, determining a first fluorescent intensity value at the preselected temperature Tl, a second fluorescent intensity value at the preselected temperature T2 and a third fluorescent intensity value at the preselected temperature T3; (d) subjecting the partitions containing the amplification reaction mixture to conditions for amplification of the first and second target nucleic acids and modification of
  • the first and second fluorescent signal-generating probes have the same signal-generating label.
  • the signal generating label is a first member of a reporter-quencher pair and the first and second duplex nucleic acids comprise a second member of the reporter-quencher pair.
  • the first and second signal-generating probes comprise a first non-natural nucleotide to which the first member of the reporter-quencher pair is attached, and the first and second duplex nucleic acids comprise a second non-natural nucleotide to which the second member of the reporter- quencher pair is attached, and the first and second non-natural nucleotides are capable of base pairing with each other.
  • the non-natural nucleotides are one of iso-C or iso-G.
  • the first and second signal-generating probes are cleavable probes that are cleaved during amplification.
  • the change between the eighth intensity value and the seventh intensity value exceeds a predetermined threshold, and wherein the change between the ninth intensity value and the eighth intensity value exceeds a predetermined threshold
  • a method of detecting the presence of a target nucleic acid in a sample comprising the steps of: (a) forming an amplification reaction mixture comprising a fluorescent signal-generating target-specific probe and the sample containing the target nucleic acid; (b) partitioning the reaction mixture so that each partition contains, on average, zero or one of the target nucleic acid; (c) acquiring a first and second set of fluorescent intensity values from images of at least a subset of partitions at preselected temperatures Tl and T2, and for each partition in the subset of partitions, determining a first fluorescent intensity value at the preselected temperature Tl and a second fluorescent intensity value at the preselected temperature T2; (d) subjecting the partitions containing the amplification reaction mixture to conditions for amplification of the target nucleic acids and modification of the signal generating probe in the presence of its target nucleic acid to form a duplex nucleic acid having a predetermined Tm; (e)
  • the target nucleic acid is a first target nucleic acid
  • the signal generating target-specific probe is a first fluorescent signal-generating target-specific probe
  • the predetermined Tm is a first predetermined Tm
  • the method further comprising the steps of: (j) in step (b), partitioning the reaction mixture so that each partition contains, on average, zero or one of the first and/or second target nucleic acid; (k) in step (c), acquiring a fifth set of fluorescent intensity values from images of at least a subset of partitions at a preselected temperature T3, and for each partition in the subset of partitions, determining a seventh fluorescent intensity value at the preselected temperature T3; (1) in step (d) subjecting the partitions containing the amplification reaction mixture to conditions for amplification of the target nucleic acids and modification of the second signal generating probe in the presence of its target
  • the change between the sixth and fifth intensity values and the change between the ninth and the sixth intensity values exceeds a predetermined threshold.
  • the first and second fluorescent signal-generating probes have the same signal-generating label.
  • the signal generating label is a first member of a reporter-quencher pair and the first and second duplex nucleic acids comprise a second member of the reporter-quencher pair.
  • the first and second signal-generating probes comprise a first non-natural nucleotide to which the first member of the reporter-quencher pair is attached
  • the first and second duplex nucleic acids comprise a second non-natural nucleotide to which the second member of the reporter-quencher pair is attached
  • the first and second non-natural nucleotides are capable of base-pairing with each other.
  • the non-natural nucleotides are one of iso-C or iso-G.
  • the first and second signal-generating probes are cleavable probes that are cleaved during amplification.
  • any of the foregoing methods can be performed wherein the steps are performed across multiple partitions in a dPCR reaction, further comprising prior to determining the presence of the target nucleic acid, identifying partitions in which there is no change between the first and second signals as target-negative partitions, and using measured signals from target-negative partitions to normalize for light and temperature- dependent changes in first and second signals measured in each partition.
  • essentially free in terms of a specified component, is used to mean that none of the specified component has been purposefully formulated into a composition and/or is present only as a contaminant or in trace amounts.
  • the total amount of the specified component resulting from any unintended contamination of a composition is preferably below 0.01%. Most preferred is a composition in which no amount of the specified component can be detected with standard analytical methods.
  • “a” or“an” may mean one or more.
  • the words“a” or“an” when used in conjunction with the word “comprising”, the words“a” or“an” may mean one or more than one.
  • “another” or“a further” may mean at least a second or more.
  • the term“about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
  • FIG. 1 Exemplary plot of continuous melt analysis showing Relative Fluorescent Units (RFU) versus Temperature (A) and the negative derivative of RFU with respect to temperature (B) for a sample containing targets for 3 target-specific probes having melt temperatures of 65, 75, and 85 °C, respectively.
  • RFU measurements are taken with every 0.5- 1.0 temperature change.
  • FIG. 2 Example of melt analysis plots showing RFU versus Temperature (A, B) and negative derivative of RFU with respect to temperature (C, D) for a sample containing a target for a single target-specific probe (A, C) and a sample containing targets for 3 target- specific probes shown in FIG. 1 (B, D) using the method of the invention. Fluorescence images were acquired only at the temperatures denoted by X.
  • FIG. 3 Example of random distribution of targets for 3 target-specific probes shown in FIG. 1 in 36 partitions for dPCR applications. Each partition contains 0, 1, 2 or 3 targets.
  • FIG. 4 Fluorescence image of the system shown in FIG. 3 taken at Tl (60 °C in this example), with relative brightness indicating the number of uncleaved, unextended and unique probes in the partitions.
  • Tl 60 °C in this example
  • relative brightness indicating the number of uncleaved, unextended and unique probes in the partitions.
  • all target-negative partitions are bright due to fluorescence of uncleaved, unextended probes
  • all target- containing partitions are relatively darker depending on the number of targets in each partition.
  • FIG. 5 Fluorescence image of the system shown in Fig. 3 taken at T2 (70 °C), at which partitions containing target A show increased fluorescence as a result of target-A probes having denatured resulting in separation of fluor and quencher.
  • FIG. 6 Example of image comparison for the system shown in FIG. 3. Average fluorescence intensity calculated for each partition at T2 is divided by the average fluorescence intensity calculated for each partition at Tl to determine which partitions show a change in fluorescence intensity (A).
  • FIG. 6B represents a 1D amplitude plot showing 2 clusters (>l and 1) of partitions corresponding to partitions determined to be negative for a target (1) and partitions determined to be positive for a target (>l).
  • FIG. 7 Example of image comparisons of images taken at Tl, T2, T3 and T4 for the system shown in FIG. 3 to determine presence or absence of targets in each compartment (A). Comparison of fluorescence intensities calculated for each partition at T2 versus Tl, T3 versus T2, and T4 versus T3 to generate the accompanying 1D amplitude plots results in a cluster of partitions determined to be negative (1) for a target and a cluster of partitions determined to be positive (>l) for a target for each set of temperatures (B).
  • FIG. 8 Example of using image normalization to account for partition-specific, system-induced variations.
  • FIG 8A and 8B show raw data and normalized (with respect to image taken at 95°C) fluorescence images, respectively;
  • FIG 8C and 8D show the corresponding intensity histograms;
  • FIG 8E and 8F show the corresponding 1D amplitude plots.
  • FIG. 9 Example of using pre-amplification images to establish preliminary thresholds.
  • Pre-amplification image of partitioned sample (FIG 9A); Post-amplification image of partitioned sample (FIG 9B); Average droplet intensity histogram (FIG 9C) from pre- amplification (dark grey bars) and post-amplification (white bars) images; 1D amplitude plot (FIG 9D) from pre- and post-amplification images (black and white respectively) showing average droplet intensity.
  • the gray lines represent 3s from the mean of the pre-amplification average intensity.
  • FIG. 10 Example of correcting for temperature-and light dose-dependent changes in fluorescence intensity of probes. Plot of fluorescence v. temperature using raw, uncorrected data from a partition having 3 targets and 3 probes with distinct Tms (upper, solid trace) and from a partition having 0 targets and 3 probes (upper dashed trace); Plot of corrected fluorescence v. temperature data from the same sample is shown in the lower half of the figure. The correction is determined from the linear decay observed for the negative partition that results from fluorescence photobleaching and temperature-dependent changes in fluorescence.
  • FIG. 11 Singleplex Continuous Melt Analysis.
  • Left Fluorescence v. temperature plots from images taken at l°C intervals from partitions of a dPCR reaction containing a single-target sample and detected using a cleavable probe;
  • A raw, uncorrected data;
  • B 1D amplitude plot corresponding to A showing signal intensity per partition at 60°C;
  • C data shown in A normalized to fluorescence at 95°C to correct for system-induced partition variability;
  • D 1D amplitude plot corresponding to C showing signal intensity per partition at 60°C;
  • E data shown in C normalized to correct for light and temperature-dependent fluorescence variations of probes;
  • F 1D amplitude plot corresponding to E showing signal intensity per partition at 60°C;
  • H 1D amplitude plot corresponding to G showing integrated signal intensity across the target-specific melt window.
  • the expected number of copies per partition is calculated using Po
  • FIG. 12 Singleplex Discrete Melt Analysis.
  • A Fluorescence v. temperature plot for partitions of the sample shown in Fig. 11 measured at temperatures Tl and T2;
  • B 1D amplitude plot of fluorescence intensity per partition at T2/T1;
  • C Fluoresence v. temperature plot of the data from C after normalization to correct for system variability.
  • Target concentration is determined by calculating the average number of copies per partition.
  • FIG. 13 Multiplex Continuous Melt Analysis.
  • Left Panel Fluorescence v. temperature plots from 35 images taken at l°C temperature intervals for a sample containing 3 targets and 3 probes with distinguishable Tms. From top to botom: A: Average fluorescence per partition v.
  • FIG. 14 Multiplex Discrete Melt Analysis.
  • A Fluorescence v. temperature plot for partitions of the sample shown in Fig. 13 measured at temperatures Tl, T2, T3 and T4;
  • B Average fluorescence intensity per partition at 57°C normalized to average fluorescence intensity per partition at 95°C;
  • C Fluoresence v. temperature plot of the data from A after normalization to correct for system-induced partition variability;
  • D Ratio of fluorescence intensity per partition calculated for the first temperature interval (T2/T1);
  • E Fluoresence v.
  • FIG. 15 dPCR Workflow for Discrete Melt Analysis: Example of workflow for dPCR Melt Analysis using multiple target-specific probes in each partition.
  • melt analysis is performed at discrete melt temperatures below the Tm of a target-specific probe and above the Tm of a target-specific probe, but not at the Tm of the target-specific probe.
  • nucleic acid means either DNA or RNA, single-stranded or double-stranded, and any chemical modifications thereof. Modifications include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole.
  • nucleic acids described herein include not only the standard bases adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U) but also non-standard or non-natural nucleotides.
  • Non-standard or non-natural nucleotides, which form hydrogen-bonding base pairs, are described, for example, in U.S.
  • non-standard nucleotide or“non-natural nucleotide” it is meant a base other than A, G, C, T, or U that is susceptible to incorporation into an oligonucleotide and that is capable of base-pairing by hydrogen bonding, or by hydrophobic, entropic, or van der Waals interactions, with a complementary non-standard or non-natural nucleotide to form a base pair.
  • Some examples include the base pair combinations of iso-C/iso-G, K /X, K/P, H/J, and M/N, as illustrated in U.S. Pat. No. 6,037,120, incorporated herein by reference.
  • the hydrogen bonding of these non-standard or non-natural nucleotide pairs is similar to those of the natural bases where two or three hydrogen bonds are formed between hydrogen bond acceptors and hydrogen bond donors of the pairing non-standard or non-natural nucleotides.
  • One of the differences between the natural bases and these non-standard or non natural nucleotides is the number and position of hydrogen bond acceptors and hydrogen bond donors.
  • cytosine can be considered a donor/acceptor/acceptor base with guanine being the complementary acceptor/donor/donor base.
  • Iso-C is an acceptor/acceptor/donor base and iso-G is the complementary donor/donor/acceptor base, as illustrated in U.S. Pat. No.
  • Non-natural nucleotides for use in oligonucleotides include, for example, naphthalene, phenanthrene, and pyrene derivatives as discussed, for example, in Ren, el al, 1996 and McMinn el al, 1999, both of which are incorporated herein by reference. These bases do not utilize hydrogen bonding for stabilization, but instead rely on hydrophobic or van der Waals interactions to form base pairs.
  • sample is used in its broadest sense.
  • a sample may include a bodily tissue or a bodily fluid including but not limited to blood (or a fraction of blood, such as plasma or serum), lymph, mucus, tears, urine, and saliva.
  • a sample may include an extract from a cell, a chromosome, organelle, or a virus.
  • a sample may comprise DNA (e.g., genomic DNA), RNA (e.g., mRNA), and/or cDNA, any of which may be amplified to provide an amplified nucleic acid.
  • a sample may include nucleic acid in solution or bound to a substrate (e.g., as part of a microarray).
  • a sample may comprise material obtained from an environmental locus (e.g. , a body of water, soil, and the like) or material obtained from a fomite (i.e., an inanimate object that serves to transfer pathogens from one host to another).
  • source of nucleic acid refers to any sample that contains nucleic acids (RNA or DNA).
  • Particularly preferred sources of target nucleic acids are biological samples including, but not limited to, blood, plasma, serum, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum, and semen.
  • limit of detection refers to the lowest level or amount of an analyte, such as a nucleic acid, that can be detected and quantified. Limits of detection can be represented as molar values (e.g., 2.0 nM limit of detection), as gram measured values (e.g., 2.0 microgram limit of detection under, for example, specified reaction conditions), copy number (e.g., 1 c 10 5 copy number limit of detection), or other representations known in the art.
  • molar values e.g., 2.0 nM limit of detection
  • gram measured values e.g., 2.0 microgram limit of detection under, for example, specified reaction conditions
  • copy number e.g., 1 c 10 5 copy number limit of detection
  • nucleic acid molecule refers to a nucleic acid molecule that is separated from the organisms and biological materials (e.g., blood, cells, serum, plasma, saliva, urine, stool, sputum, nasopharyngeal aspirates and so forth) that are present in the natural source of the nucleic acid molecule.
  • An isolated nucleic acid molecule such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • nucleic acid molecules encoding polypeptides/proteins may also be isolated or purified. Methods of nucleic acid isolation are well known in the art and may include total nucleic acid isolation/purification methods, RNA-specific isolation/purification methods, or DNA-specific isolation/purification methods.
  • microarray refers to an arrangement of a plurality of polynucleotides, polypeptides, or other chemical compounds on a substrate.
  • element and“array element” refer to a polynucleotide, polypeptide, or other chemical compound having a unique and defined position on a microarray.
  • an oligonucleotide is understood to be a molecule that has a sequence of bases on a backbone comprised mainly of identical monomer units at defined intervals.
  • the bases are arranged on the backbone in such a way that they can enter into a bond with a nucleic acid having a sequence of bases that are complementary to the bases of the oligonucleotide.
  • the most common oligonucleotides have a backbone of sugar phosphate units.
  • Oligonucleotides also may include derivatives, in which the hydrogen of the hydroxyl group is replaced with an organic group, e.g., an allyl group.
  • An oligonucleotide is a nucleic acid that includes at least two nucleotides. Oligonucleotides used in the methods disclosed herein typically include at least about ten (10) nucleotides and more typically at least about fifteen (15) nucleotides. Preferred oligonucleotides for the methods disclosed herein include about 10-100 nucleotides.
  • An oligonucleotide may be designed to function as a“primer.”
  • A“primer” is a short nucleic acid, usually a ssDNA oligonucleotide, which may be annealed to a target polynucleotide by complementary base-pairing.
  • the primer may then be extended along the target DNA or RNA template strand by a polymerase enzyme, such as a DNA polymerase enzyme.
  • a polymerase enzyme such as a DNA polymerase enzyme.
  • Primer pairs can be used for amplification (and identification) of a nucleic acid sequence (e.g., by the polymerase chain reaction (PCR)).
  • An oligonucleotide may be designed to function as a “probe.”
  • A“probe” refers to an oligonucleotide, its complements, or fragments thereof, which are used to detect identical, allelic, or related nucleic acid sequences. Probes may include oligonucleotides that have been attached to a detectable label or reporter molecule.
  • Typical labels include fluorescent dyes, quenchers, radioactive isotopes, ligands, scintillation agents, chemiluminescent agents, and enzymes. Probes may also be extended by a polymerase, using a target nucleic acid or self-complementary regions as a template.
  • An oligonucleotide may be designed to be specific for a target nucleic acid sequence in a sample.
  • an oligonucleotide may be designed to include“antisense” nucleic acid sequence of the target nucleic acid.
  • the term“antisense” refers to any composition capable of base-pairing with the“sense” (coding) strand of a nucleic acid sequence.
  • An antisense nucleic acid sequence may be“complementary” to a target nucleic acid sequence.
  • “complementarity” describes the relationship between two single-stranded nucleic acid sequences that anneal by base-pairing.
  • primers or probes may be designed to include mismatches at various positions.
  • a“mismatch” means a nucleotide pair that does not include the standard Watson-Crick base pairs, or nucleotide pairs that do not preferentially form hydrogen bonds.
  • the mismatch may include a natural nucleotide or a non-natural or non-standard nucleotide substituted across from a particular base or bases in a target.
  • the probe or primer sequence 5'-AGT-3' has a single mismatch with the target sequence 3'-ACA-5'.
  • the 5'“A” of the probe or primer is mismatched with the 3'“A” of the target.
  • the target sequence 5'-AGA-3' has a single mismatch with the probe or primer sequence 3'-(iC)CT-5'.
  • an iso-C is substituted in place of the natural“T.”
  • the sequence 3'-(iC)CT-5' is not mismatched with the sequence 5'- (iG)GA-3'.
  • Oligonucleotides may also be designed as degenerate oligonucleotides.
  • “degenerate oligonucleotide” is meant to include a population, pool, or plurality of oligonucleotides comprising a mixture of different sequences where the sequence differences occur at a specified position in each oligonucleotide of the population.
  • Various substitutions may include any natural or non-natural nucleotide, and may include any number of different possible nucleotides at any given position.
  • Oligonucleotides typically are capable of forming hydrogen bonds with oligonucleotides having a complementary base sequence.
  • bases may include the natural bases, such as A, G, C, T, and U, as well as artificial, non-standard or non-natural nucleotides such as iso-cytosine and iso-guanine.
  • a first sequence of an oligonucleotide is described as being 100% complementary with a second sequence of an oligonucleotide when the consecutive bases of the first sequence (read 5'-to-3') follow the Watson-Crick rule of base pairing as compared to the consecutive bases of the second sequence (read 3'-to-5').
  • An oligonucleotide may include nucleotide substitutions.
  • an artificial base may be used in place of a natural base such that the artificial base exhibits a specific interaction that is similar to the natural base.
  • An oligonucleotide that is specific for a target nucleic acid also may be specific for a nucleic acid sequence that has“homology” to the target nucleic acid sequence.
  • “homology” refers to sequence similarity or, interchangeably, sequence identity, between two or more polynucleotide sequences or two or more polypeptide sequences.
  • the terms“percent identity” and“% identity” as applied to polynucleotide sequences refer to the percentage of residue matches between at least two polynucleotide sequences aligned using a standardized algorithm (e.g., BLAST).
  • hybridization or “hybridizing” refers to the process by which an oligonucleotide single strand anneals with a complementary strand through base pairing under defined hybridization conditions.
  • Specific hybridization is an indication that two nucleic acid sequences share a high degree of complementarity. Specific hybridization complexes form under permissive annealing conditions and remain hybridized after any subsequent washing steps.
  • Permissive conditions for annealing of nucleic acid sequences are routinely determinable by one of ordinary skill in the art and may occur, for example, at 65 °C in the presence of about 6* SSC.
  • Stringency of hybridization may be expressed, in part, with reference to the temperature under which the wash steps are carried out. Such temperatures are typically selected to be about 5 °C to 20 °C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
  • Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Equations for calculating Tm, for example, nearest-neighbor parameters, and conditions for nucleic acid hybridization are known in the art.
  • “target” or“target nucleic acid” refers to a nucleic acid molecule containing a sequence that has at least partial complementarity with an oligonucleotide, for example, a probe or a primer.
  • A“target” sequence may include a part of a gene or genome.
  • “nucleic acid,” “nucleotide sequence,” or “nucleic acid sequence” refer to a nucleotide, oligonucleotide, polynucleotide, or any fragment thereof and to naturally occurring or synthetic molecules.
  • RNA equivalent in reference to a DNA sequence, is composed of the same linear sequence of nucleotides as the reference DNA sequence with the exception that all occurrences of the nitrogenous base thymine are replaced with uracil, and the sugar backbone is composed of ribose instead of deoxyribose. RNA may be used in the methods described herein and/or may be converted to cDNA by reverse transcription for use in the methods described herein.
  • “amplification” or“amplifying” refers to the production of additional copies of a nucleic acid sequence. Amplification may be carried out using polymerase chain reaction (PCR) or other amplification technologies known in the art.
  • the term“amplification reaction system” refers to any in vitro means for producing at least a first complimentary copy of a target sequence of nucleic acid. In some aspects, amplification produces multiple copies of a target sequence of nucleic acid.
  • the term“amplification reaction mixture” refers to an aqueous solution comprising the various reagents used to amplify a target nucleic acid.
  • enzymes e.g., a thermostable polymerase
  • aqueous buffers e.g., aqueous buffers, salts, amplification primers, target nucleic acid, nucleoside triphosphates, and optionally, at least one labeled probe and/or optionally, at least one agent for determining the melting temperature of an amplified target nucleic acid (e.g., a fluorescent intercalating agent that exhibits a change in fluorescence in the presence of double-stranded nucleic acid).
  • enzymes e.g., a thermostable polymerase
  • aqueous buffers e.g., salts, amplification primers, target nucleic acid, nucleoside triphosphates, and optionally, at least one labeled probe and/or optionally, at least one agent for determining the melting temperature of an amplified target nucleic acid (e.g., a fluorescent intercalating agent that exhibits a change in fluorescence in the presence
  • Amplification of nucleic acids may include amplification of nucleic acids or subregions of these nucleic acids.
  • amplification may include amplifying portions of nucleic acids between 30 and 50, between 50 and 100, or between 100 and 300 bases long by selecting the proper primer sequences and using PCR.
  • amplification can be achieved using an isothermal amplification technique (i.e., without the need for thermal cycling).
  • isothermal nucleic acid amplification such as loop mediated isothermal amplification (LAMP), are provided in U.S. Patent 6,410,278, and US. Patent Publn. 20080182312, each of which is incorporated herein by reference in its entirety.
  • Amplification mixtures may include natural nucleotides (including A, C, G, T, and U) and non-natural or non-standard nucleotides (e.g. , including iC and iG).
  • DNA and RNA oligonucleotides include deoxyriboses or riboses, respectively, coupled by phosphodiester bonds. Each deoxyribose or ribose includes a base coupled to a sugar.
  • the bases incorporated in naturally-occurring DNA and RNA are adenosine (A), guanosine (G), thymidine (T), cytosine (C), and uridine (U).
  • Each of the bases includes two or three hydrogen bond donor(s) and hydrogen bond acceptor(s).
  • the hydrogen bonds of the base pair are each formed by the interaction of at least one hydrogen bond donor on one base with a hydrogen bond acceptor on the other base.
  • Hydrogen bond donors include, for example, heteroatoms (e.g., oxygen or nitrogen) that have at least one attached hydrogen.
  • Hydrogen bond acceptors include, for example, heteroatoms (e.g., oxygen or nitrogen) that have a lone pair of electrons.
  • the natural or non-natural nucleotides used herein can be derivatized by substitution at non-hydrogen bonding sites to form modified natural or non-natural nucleotides.
  • a natural nucleotide can be derivatized for attachment to a support by coupling a reactive functional group (for example, thiol, hydrazine, alcohol, amine, and the like) to a non hydrogen bonding atom of the nucleotide.
  • a reactive functional group for example, thiol, hydrazine, alcohol, amine, and the like
  • Other possible substituents include, for example, biotin, digoxigenin, fluorescent groups, alkyl groups (e.g, methyl or ethyl), and the like.
  • non-natural nucleotides can be recognized by many enzymes that catalyze reactions associated with nucleic acids. While a polymerase requires a complementary nucleotide to continue polymerizing and extending an oligonucleotide chain, other enzymes do not require a complementary nucleotide.
  • a polymerase will typically stall (or, in some instances, misincorporate a base when given a sufficient amount of time) when attempting to extend an elongating primer past the non-natural nucleotide.
  • other enzymes that catalyze reactions associated with nucleic acids such as ligases, kinases, nucleases, polymerases, topoisomerases, helicases, and the like can catalyze reactions involving non-natural nucleotides.
  • Such features of non-natural nucleotides can be taken advantage of, and are within the scope of the presently disclosed methods and kits.
  • nucleotides disclosed herein may be coupled to a label (e.g., a quencher or a fluorophore). Coupling may be performed using methods known in the art.
  • a label e.g., a quencher or a fluorophore
  • the oligonucleotides of the present methods may function as primers.
  • the oligonucleotides are labeled.
  • the oligonucleotides may be labeled with a reporter that emits a detectable signal (e.g., a fluorophore).
  • the oligonucleotides may include at least one non-natural nucleotide.
  • the oligonucleotides may include at least one nucleotide having a base that is not A, C, G, T, or U (e.g. , iC or iG).
  • the amplification mixture may include at least one nucleotide that is labeled with a quencher (e.g., Dabcyl).
  • the labeled nucleotide may include at least one non-natural or non-standard nucleotide.
  • the labeled nucleotide may include at least one nucleotide having a base that is not A, C, G, T, or U (e.g., iC or iG).
  • the oligonucleotide may be designed not to form an intramolecular structure, such as a hairpin.
  • the oligonucleotide may be designed to form an intramolecular structure, such as a hairpin.
  • the oligonucleotide may be designed to form a hairpin structure that is altered after the oligonucleotide hybridizes to a target nucleic acid, and optionally, after the target nucleic acid is amplified using the oligonucleotide as a primer.
  • the oligonucleotide may be designed to be cleaved upon hybridization to a target sequence and to adopt an intramolecular structure after cleavage.
  • the oligonucleotide may be labeled with a fluorophore that exhibits quenching when incorporated in an amplified product as a primer.
  • the oligonucleotide may emit a detectable signal after the oligonucleotide is incorporated in an amplified product as a primer (e.g., inherently, or by fluorescence induction or fluorescence dequenching).
  • primers are known in the art (e.g., LightCycler primers, AmplifluorTM primers, ScorpionTM primers, and LuxTM primers).
  • the fluorophore used to label the oligonucleotide may emit a signal when intercalated in double-stranded nucleic acid.
  • the fluorophore may emit a signal after the oligonucleotide is used as a primer for amplifying the nucleic acid.
  • the oligonucleotides that are used in the disclosed methods may be suitable as primers for amplifying at least one nucleic acid in the sample and as probes for detecting at least one nucleic acid in the sample.
  • the oligonucleotides are labeled with at least one fluorescent dye, which may produce a detectable signal.
  • the fluorescent dye may function as a fluorescence donor for fluorescence resonance energy transfer (FRET).
  • FRET fluorescence resonance energy transfer
  • the detectable signal may be quenched when the oligonucleotide is used to amplify a target nucleic acid.
  • the amplification mixture may include nucleotides that are labeled with a quencher for the detectable signal emitted by the fluorophore.
  • the oligonucleotides may be labeled with a second fluorescent dye or a quencher dye that may function as a fluorescence acceptor (e.g., for FRET).
  • a signal may be detected from the first fluorescent dye, the second fluorescent dye, or both. Signals may be detected at a gradient of temperatures (e.g., in order to determine melting profiles for duplex nucleic acids such as an amplicons, complexes that include probes hybridized to target nucleic acids, hairpin probes, or T probe complexes). Alternatively, signals may be detected at selected temperatures to determine melting profiles for duplex nucleic acids.
  • the disclosed methods may be performed with any suitable number of oligonucleotides.
  • a plurality of oligonucleotides e.g., two or more oligonucleotides
  • different oligonucleotides may be labeled with different fluorescent dyes capable of producing distinguishable detectable signals.
  • oligonucleotides are labeled with at least one of two different fluorescent dyes.
  • oligonucleotides are labeled with at least one of three different fluorescent dyes.
  • each different fluorescent dye emits a signal that can be distinguished from a signal emitted by any other of the different fluorescent dyes that are used to label the oligonucleotides.
  • the different fluorescent dyes may have wavelength emission maximums all of which differ from each other by at least about 5 nm (preferably by least about 10 nm).
  • each different fluorescent dye is excited by different wavelength energies.
  • the different fluorescent dyes may have wavelength absorption maximums all of which differ from each other by at least about 5 nm (preferably by at least about 10 nm).
  • the fluorescent dye may emit a signal that can be distinguished from a signal emitted by any other of the different fluorescent dyes that are used to label the oligonucleotides.
  • the fluorescent dye for determining the melting profile of a nucleic acid may have a wavelength emission maximum that differs from the wavelength emission maximum of any other fluorescent dye that is used for labeling an oligonucleotide by at least about 5 nm (preferably by least about 10 nm).
  • the fluorescent dye for determining the melting profile of a nucleic acid may be excited by different wavelength energy than any other of the different fluorescent dyes that are used to label the oligonucleotides.
  • the fluorescent dye for determining the melting profile of a nucleic acid may have a wavelength absorption maximum that differs from the wavelength absorption maximum of any fluorescent dye that is used for labeling an oligonucleotide by at least about 5 nm (preferably by least about 10 nm).
  • the methods may include determining the melting profile of at least one nucleic acid in a sample (e.g., an amplicon or a duplex nucleic acid that includes a probe hybridized to a target nucleic acid or a probe hybridized to self-complementary regions or a probe hybridized to a complementary capture sequence), which may be used to identify the nucleic acid.
  • Determining the melting profile may include exposing an amplicon or a duplex nucleic acid to a temperature gradient and observing a detectable signal from a fluorophore throughout the temperature gradient.
  • determining the melting profile may include exposing an amplicon or a duplex nucleic acid to select discrete temperatures and observing the detectable signal only at the selected discrete temperatures.
  • determining the melting profile of the detected nucleic acid may include observing a signal from a second fluorescent dye that is different from the first fluorescent dye.
  • the second fluorescent dye for determining the melting profile of the detected nucleic acid is an intercalating agent.
  • Suitable intercalating agents may include, but are not limited to SYBRTM Green 1 dye, SYBR dyes, Pico Green, SYTO dyes, SYTOX dyes, ethidium bromide, ethidium homodimer- 1, ethidium homodimer- 2, ethidium derivatives, acridine, acridine orange, acridine derivatives, ethidium-acridine heterodimer, ethidium monoazide, propidium iodide, cyanine monomers, 7-aminoactinomycin D, YOYO-l, TOTO-l, YOYO-3, TOTO-3, POPO-l, BOBO-l, POPO-3, BOBO-3, LOLO-l, JOJO-l, cyanine dimers, YO-PRO-l, TO-PRO-l, YO-PRO-3, TO-PRO-3, TO-PRO-5, PO- PRO-l, BO-PRO-l, PO-
  • each of the amplified target nucleic acids, reporter probe-template pairs or hybridized probes may have different melting temperatures or different melting profiles.
  • each of the amplified target nucleic acids, reporter probe- template pairs or hybridized probes may have melting temperatures that differ by 1-10 °C, for example, at least about 1 °C, more preferably by at least about 2 °C or 4°C, or even more preferably by at least about 5 °C from the melting temperature of any of the other amplified target nucleic acids, reporter probe-template pairs or hybridized probes.
  • labels or“reporter molecules” are chemical or biochemical moieties useful for labeling a nucleic acid.
  • “Labels” and“reporter molecules” include fluorescent agents, chemiluminescent agents, chromogenic agents, quenching agents, radionuclides, enzymes, substrates, cofactors, scintillation agents, inhibitors, magnetic particles, and other moieties known in the art.
  • “Labels” or“reporter molecules” are capable of generating a measurable signal and may be covalently or noncovalently joined to an oligonucleotide.
  • a“fluorescent dye” or a“fluorophore” is a chemical group that can be excited by light to emit fluorescence. Some suitable fluorophores may be excited by light to emit phosphorescence. Dyes may include acceptor dyes that are capable of quenching a fluorescent signal from a fluorescent donor dye.
  • Dyes that may be used in the disclosed methods include, but are not limited to, fluorophores such as, a red fluorescent squarine dye such as 2,4-Bis[l,3,3-trimethyl-2-indolinylidenemethyl]cyclobutenediylium-l,3-dio- xolate, an infrared dye such as 2,4 Bis[3,3-dimethyl-2-(lH- benz[e]indolinybdenemethyl)]cyclobutenediybum-l,- 3-dioxolate, or an orange fluorescent squarine dye such as 2,4-Bis[3,5-dimethyl-2-pyrrolyl]cyclobutenediylium-l,3-diololate.
  • fluorophores such as, a red fluorescent squarine dye such as 2,4-Bis[l,3,3-trimethyl-2-indolinylidenemethyl]cyclobutenediylium-l,3-dio- xolate,
  • fluorophores include quantum dots, Alexa FluorTM dyes, AMCA, BODIPYTM 630/650, BODIPYTM 650/665, BODIPYTM-FL, BODIPYTM-R6G, BODIPYTM-TMR, BODIPYTM-TRX, Cascade BlueTM, CyDyeTM, including but not limited to Cy2TM, Cy3TM, and Cy5TM, a DNA intercalating dye, 6-FAMTM, Fluorescein, HEXTM, 6-JOE, Oregon GreenTM 488, Oregon GreenTM 500, Oregon GreenTM 514, Pacific BlueTM, REG, phycobilliproteins including, but not limited to, phycoerythrin and allophycocyanin, Rhodamine GreenTM, Rhodamine RedTM, ROXTM, TAMRATM, TETTM. Tetramethylrhodamine, or Texas RedTM.
  • Fluorescent dyes or fluorophores may include derivatives that have been modified to facilitate conjugation to another reactive molecule.
  • fluorescent dyes or fluorophores may include amine-reactive derivatives, such as isothiocyanate derivatives and/or succinimidyl ester derivatives of the fluorophore.
  • the oligonucleotides and nucleotides of the disclosed methods may be labeled with a quencher.
  • Quenching may include dynamic quenching (e.g., by FRET), static quenching, or both.
  • Suitable quenchers may include Dabcyl.
  • Suitable quenchers may also include dark quenchers, which may include black hole quenchers sold under the trade name “BHQ” (e.g, BHQ-0, BHQ-l, BHQ-2, and BHQ-3, Biosearch Technologies, Novato, CA). Dark quenchers also may include quenchers sold under the trade name“QXLTM” (Anaspec, San Jose, CA). Dark quenchers also may include DNP-type non-fluorophores that include a 2,4-dinitrophenyl group.
  • the methods and compositions disclosed herein may be used in compartmentalized reactions.
  • One approach for compartmentalizing reactions is by using droplets, which are isolated volumes of a first fluid that are completely surrounded by a second fluid or by a second fluid and one or more surfaces.
  • the first and second fluids are two immiscible liquids.
  • Various embodiments disclosed herein employ a water-in- oil emulsion comprising a plurality of aqueous droplets in a non-aqueous continuous phase. All or a subset of the aqueous droplets may contain an analyte of interest.
  • Emulsions are formed by combining two immiscible phases (e.g., water and oil), often in the presence of one or more surfactants.
  • emulsions Basic types of emulsions are oil-in-water (o/w), water-in-oil (w/o), and bi-continuous.
  • the emulsion will typically be a water-in- oil emulsion with the assay reagents (e.g., PCR primers, salts, enzymes, etc.) contained in the aqueous phase.
  • The“oil” phase may be a single oil or a mixture of different oils.
  • Any suitable non-aqueous fluid may form the non-aqueous continuous phase of the emulsions disclosed herein.
  • the non-aqueous continuous phase comprises a mineral oil, a silicone oil, or a fluorinated oil (e.g., Fluorinert® FC-40 [Sigma- Aldrich]).
  • the droplets may be imaged using a variety of techniques.
  • the composition containing the droplets may be dispersed on a surface such that the droplets are disposed substantially in a monolayer on the surface.
  • the imaging surface may be, for example, on a slide or in a chamber, such as a glass or quartz chamber.
  • the droplets, as well as labeled analytes or reaction products (e.g., hairpin probes) within the droplets may be detected using an imaging system.
  • detection may comprise imaging fluorescent wavelengths and/or fluorescent intensities emitted from labeled hairpin probes.
  • the imaging may comprise taking a first, decoding image of the encoded particles and taking a second assay image to detect the probes in the droplets. A comparison of the decoding image and the assay image permits greater multiplex capabilities by using combinations of fluorophores.
  • the methods of the present invention may further comprise correlating the signal from directly or indirectly labeled amplification products with the concentration of DNA or RNA in a sample. Examples of imaging systems that could be adapted for use with the methods and compositions disclosed herein are described in U.S. Patent No. 8,296,088 and U.S. Pat. Publ. 2012/0288897, which are incorporated herein by reference. .
  • encoded microspheres might aid in droplet tracking. Randomly-distributed, uniquely-encoded microspheres included at sufficient concentration would give each droplet a distinctive signature in relation to adjacent droplets. This signature would be useful to track droplets should any movement occur during PCR amplification or post-amplification melt analysis.
  • the number of unique microsphere codes and the total number of microspheres in the assay can be optimized to insure minimal repetition of partition signatures.
  • compartments or partitions may be formed in a static array on a planar surface through, for example, the controlled etching of a silicon, metal or glass or through conventional or microinjection molding techniques.
  • static arrays or reaction chambers have been described, for example as in U.S. 9,039,993, PCT/US2003/041356, US6391559, EP2906348, US9643178 and Du. Et al. 2009 “SlipChip.” Lab on a Chip 9 (l6):2286, incorporated herein by reference.
  • partitions are packed in close proximity to decrease the overall surface area and can be connected by microfluidic channels to improve partition filling. In the latter embodiments, methods such as those described in U.S. 9,163,277 may be used to ensure complete separation of partitions after filling.
  • PCR polymerase chain reaction
  • partitions are useful in digital PCR (dPCR) techniques.
  • dPCR involves partitioning the sample such that individual nucleic acid molecules contained in the sample are localized in many separate regions, such as in individual wells in microwell plates or micropartitions, in the dispersed phase of an emulsion, or arrays of nucleic acid binding surfaces.
  • each partition will contain 0 or 1 copy of the target nucleic acid, providing a negative or positive reaction, respectively.
  • dPCR is not dependent on the number of amplification cycles to determine the initial amount of the target nucleic acid in the sample.
  • dPCR eliminates the reliance on exponential data to quantify target nucleic acids and provides absolute quantification.
  • Bead emulsion PCR which clonally amplifies nucleic acids on beads in an emulsion, is one example of a dPCR technique in which the reactions are portioned into droplets. See, e.g., U.S. Patent Nos. 8,048,627 and 7,842,457, which are hereby incorporated by reference.
  • the emulsion should be heat stable to allow it to withstand thermal cycling conditions.
  • a DNA sample is diluted to an appropriate concentration, mixed with PCR reagents (primers, dNTPs, etc.) and partitioned accordingly into a number of discrete reaction samples.
  • the partitions are subjected to PCR thermal cycling and the amplicons detected by florescence (or other suitable reporter) imaging as described above.
  • amplicons are detected by changes in florescence (or other suitable reporter) of the probes.
  • Thermal cycling of the partitions may be performed by any suitable technique known in the art.
  • partitions may be thermal cycled in a tube or chamber than can be heated and cooled.
  • the methods employ continuous-flow amplification to amplify the nucleic acid template.
  • Various methods of continuous flow amplification have been reported.
  • U.S. Patent No. 7,927,797 which is incorporated herein by reference, describes a water-in-oil emulsion used in conjunction with a continuous flow PCR.
  • droplets may be arranged in a 2D array and thermal cycled using a flat block thermal cycler as in methods used to thermal cycle in static array based digital PCR.
  • Isothermal reactions may also be performed in droplets or static array partitions.
  • the system may also be used to monitor droplets or partitions while increasing or decreasing the temperature to obtain melt profiles of probes within partitions, which allows for multiplexed detection and quantification.
  • the probes themselves may be used within droplets or partitions to isothermally amplify signal such that other forms of amplification such as PCR or other isothermal amplification reactions are not necessary to detect low copy numbers of target within a droplet or static array partition.
  • a melting curve charts the change in fluorescence observed when double-stranded DNA dissociates or “melts” into single-stranded DNA as the temperature of the reaction is raised. For example, when double-stranded DNA is slowly heated in the presence of intercalating dyes, a sudden decrease in fluorescence is detected as the melting point (Tm) is reached and the dye dissociates from the duplex. Because the Tm of nucleic acids is affected by length, GC content, and the presence of base mismatches, among other factors, different duplex nucleic acids can be distinguished by their different melting characteristics.
  • Post-amplification melting curve analysis can also be used to distinguish primer-dimer artifacts and non-target nucleic acids from target-derived amplicons to ensure reaction specificity.
  • the characterization of reaction products, e.g., primer-dimers vs. amplicons via melting curve analysis reduces the need for time-consuming gel electrophoresis.
  • the specificity of a real-time PCR assay is determined by the primers and reaction conditions used. However, there is always the possibility that even well designed primers may form primer-dimers or amplify a nonspecific product. There is also the possibility when performing qRT-PCR that the RNA sample contains genomic DNA, which may also be amplified. The specificity of the qPCR or qRT-PCR reaction products can be confirmed using melting curve analysis.
  • High-resolution melt curve (HRM) analysis is a homogeneous, post- amplification method for identifying single nucleotide differences, e.g., SNPs, novel mutations, and methylation patterns.
  • HRM analysis is a more sensitive approach to traditional melt curve profiling, in which double-stranded DNA is monitored for the temperature (Tm) at which it dissociates into single-stranded DNA.
  • Tm temperature
  • the amplification reaction is subjected to small, incremental temperature increases (typically 0.l-0.5°C per minute) while fluorescence is monitored continuously.
  • 1A and 1B show plots of RFU versus temperature and the negative derivative with respect to temperature from continuous monitoring of fluorescence as temperature increases in a sample containing 3 target probes with melt temperatures of 65°C, 75°C, and 85 °C, respectively.
  • a comparison of the measured Tm with the expected Tm for a particular probe or duplex nucleic acid is used to determine whether the target nucleic acid was amplified.
  • a threshold may be set for either or both the RFU plots and negative-derivative plots.
  • a signal threshold may be selected by using a percentage of the standard deviation of a slope-corrected control curve, e.g., 200%, 300%, 400%, 500%, 1000%, or 2000% of the standard deviation.
  • a signal threshold may be selected by using a percentage of the standard deviation of the negative derivative of the slope-corrected RFU curve for a control sample, e.g., 200%, 300%, 400%, 500%, 1000%, or 2000% of the standard deviation.
  • Threshold values can alternatively be set by considering historical data and using a fraction of typical magnitudes of the negative-derivative melt peaks. For example, a threshold might be set anywhere from 10% to 50% of the average negative-derivative melt peak magnitude for that specific target probe.
  • US2016/0310949 describes using unique melt signatures generated from traditional or high resolution melt analysis (HRM) in a digital microfluidic system to achieve quantitative multiplexing in dPCR.
  • HRM high resolution melt analysis
  • WO2015023616 describes a digital system in which target nucleic acids are non-specifically amplified using universal primers and HRM analysis is used to identify individual bacterial species. Melt signatures in individual wells containing target nucleic acids are compared to standard melt curves to identify the target sequence present. Accurate identification of individual bacterial species requires careful comparison of melt profiles among unique targets, and therefore relies on high resolution melt data, typically AT ⁇ l°C.
  • Discrete Melt Analysis provides an improved method for performing melt analysis that requires fewer measurements of fluorescence versus temperature and thus results in faster data collection and analysis, and consequently provides lower turnaround times for assays.
  • DMA represents an under-sampling of continuous melt or HRM analysis.
  • HRM high-sampling of continuous melt or HRM analysis.
  • DMA requires measurement of fluorescence at only 2 temperatures per target and does not require the calculation of a Tm to identify a target nucleic acid.
  • Fluorescence images for a particular target nucleic acid are acquired at (1) a temperature at which all probes or duplex nucleic acids representing the target are in a hybridized, duplex conformation and (2) a temperature at which all probes or duplex nucleic acids representing the target are in a single stranded conformation, or fully denatured.
  • Use of appropriate labeling schemes that distinguish these 2 conformations permits detection of changes of conformation at the two measurement temperatures in the presence of target. This concept is represented in FIG. 2 for a sample having a single target-specific probe (left) and a sample having 3 target-specific probes (right) that are distinguishable by having unique Tms.
  • DMA is particularly well suited to melt analysis performed using probes such as those described in U.S. Application No. 14/82,288, incorporated herein by reference, and provides an efficient and cost-effective means of multiplexing in digital amplification systems.
  • the present methods may use a cleavable probe that has a predetermined, unique melt signature to identify the presence of a specific, target nucleic acid in an individual partition in digital PCR.
  • the present methods concern the use of a discrete melt signature derived from fluorescence images acquired at only two temperatures, rather than multiple images acquired at numerous temperatures to confirm the presence of the target nucleic acid.
  • the use of DMA specifically does not require the acquisition of a fluorescence image at the Tm of the duplex nucleic acid or probe being detected.
  • target-specific cleavable melt probes provides two mechanisms of improving specificity, as target-specific probes can reduce the incidence of detecting non specific amplification products while discrete melt analysis enabled by such probes provides an efficient means of confirming presence and identity of detected targets. Further, the present methods can use target-specific cleavable probes to enhance multiplexing capabilities in dPCR applications.
  • the present methods may be used for detecting one or more targets in a reaction mixture.
  • the methods may be applied to both qPCR and dPCR reactions.
  • dPCR reactions three or more unique melt signatures may be detected in a single partition using a single fluorescence channel, meaning at a minimum, with four different fluorescence channels, 12 unique targets may be detected in a single partition.
  • the methods described herein provide a solution to time- consuming, melt analysis requiring numerous images to be acquired as incremental changes in temperature are made.
  • the method is considered particularly useful in dPCR applications where image acquisition and data processing from traditional and HRM melt curve analysis is time consuming and computationally intensive.
  • cleavable probes such as those described in U.S. Application Serial No. 14/823,288 are designed such that probes specific for a first target, after target hybridization-mediated cleavage, followed by hairpin formation that supports extension of the cleaved probe, exhibit a Tm that is at least 5°C different than probes specific for any other target nucleic acid in the reaction mixture.
  • a plot of the derivative of a melt profile for each set of probes in a multiplex detection scheme yields highly differentiated melt peaks that are distinguishable from each other.
  • different probe Tms are separated by about l0°C such that all probes that melt at the same Tm are fully denatured/single stranded before probes designed to melt at higher Tm’s begin to denature.
  • the probes are included in the amplification reaction mixture and after amplification, are used to determine a melt profile for modified probes in the reaction mixture.
  • the cleavable probes exhibit different fluorescent intensity depending on whether they have encountered their cognate target nucleic acids and been cleaved and extended or not.
  • the probes exhibit fluorescence in the absence of target as a result of having a fluorescent reporter coupled to the 5’ end of the probe and the fluorescence is quenched via incorporation of a quencher during extension.
  • probes having pre-determined Tms in DMA permits measuring fluorescence at temperatures intervals lower than and higher than pre-determined melt peaks to elucidate target presence after amplification.
  • the left panel of FIG 2 illustrates the acquisition of only 2 fluorescence images (taken at the temperatures denoted by X) during melt analysis of a single probe having a predetermined Tm. Note that image acquisition does not take place at the predicted Tm of the probe.
  • the first image is acquired at a temperature Tl that is at or slightly lower than the annealing temperature for primers used in PCR amplification and at which all probes that have encountered their corresponding target are in a hybridized, duplex state after amplification.
  • the second image is acquired at a temperature T2, at which Tml probes will be denatured, but probes having a Tm > Tml remain in the hybridized state.
  • the third image is acquired at T3, a temperature intermediate Tm2 and Tm3.
  • the fourth image is acquired at the denaturation temperature T4, which is greater than Tm3 and at which all probes will be denatured. In dPCR applications, average fluorescence intensity in individual partitions is measured for all four acquired images.
  • an initial image and associated fluorescence can be acquired prior to amplification, and represents maximal fluorescence of all probes in the reaction.
  • This fluorescence measurement is theoretically equivalent to the image acquired at temperature T4, in which all probes in the reaction are fully denatured and exhibit maximal fluorescence regardless of whether they have encountered their cognate targets or not.
  • subsequent images can be acquired at temperatures Tl, T2 and T3 for comparison to the image taken prior to amplification to measure changes in fluorescence as probes transition from a duplex conformation to a single stranded conformation as the temperature increases.
  • This substitution of the high temperature (T4) image at which all probes are fully denatured by the pre-amplification image can be applied to any assay format in which unmodified (pre-amplification) probes are maximally fluorescent and those same probes, once modified show a change in signal based on whether they have encountered target.
  • measurement temperatures can be based on prior clinical or laboratory data showing where the flattest regions of the RFU-versus-temperature plot occur on either side of the melt peak for each probe (i.e, , lower than the lowest melt temperature, and higher than the highest melt temperature).
  • the measurement temperatures can also be chosen based on the highest points (least negative values) flanking the peak of the negative derivative curve (Tm).
  • Tm negative derivative curve
  • measurement temperatures can still be chosen simply by choosing temperatures lower than, and higher than the predetermined melt temperatures for each probe in the reaction mixture. This process can be further supported with in silico modeling data. While Figure 2 shows the fluorescence images to be acquired at evenly spaced temperature intervals, this is not a requirement.
  • the fluorescence intensity plot shown in FIG. 2 has been idealized, where the fluorescence at temperatures lower and higher than the target melt temperatures show little change resulting in relatively shallow, nearly flat slopes (slopes approaching zero). In reality, however, photobleaching and/or temperature dependence of fluorescent reporter dyes can alter the slope of fluorescence over the relevant temperature range.
  • a slope correction and/or normalization can be applied to the raw data for fluorescence intensity versus temperature prior to melt analysis for clearer identification of melt signatures.
  • FIG. 3-7 illustrate an image-analysis process used to determine the number of input target copies using DMA in dPCR applications.
  • FIG. 3 shows the same three targets A, B, and C described for FIG 2 distributed in various combinations among 36 partitions, including 4 partitions having no target (empty partitions).
  • some partitions contain only target A, target B, or target C, some contain two targets (AB, BC, or AC), some contain three targets (ABC), and some contain no targets after amplification.
  • Targets can be detected using the same probes described for Figure 2, which are designed to have unique melt temperatures Tml, Tm2 and Tm3 wherein Tml ⁇ Tm2 ⁇ Tm3.
  • the image analysis process generally involves comparing two fluorescence images acquired at temperatures higher than and lower than an expected melt temperature for a given target probe or duplex following target amplification.
  • a starting fluorescence intensity image is acquired at a temperature Tl (in this example 60°C) that is lower than Tml .
  • FIG. 4 is illustrative of fluorescence intensities at Tl in individual partitions of the system shown in FIG. 3 after amplification is complete.
  • the image shown in FIG. 4 represents a condition at which all probes are in a duplex (hairpin) configuration, with only non-cleaved, non-extended probes (i.e. probes for which no target is present) emitting fluorescence.
  • the following image processing steps are performed: i) calculate average pixel intensity in individual partitions, defined as the integrated pixel intensity values in an individual partition divided by the number of pixels in the partition image; ii) determine a ratio of average fluorescence intensity at T2 versus Tl (FT2/TI); iii) Plot the results of the image comparison to identify partitions showing a change in fluorescence intensity across the temperature measurement window. Alternatively, one may subtract the fluorescence values taken at Tl from those acquired at T2 (FT2-TI) (using the average intensity values) rather than using a ratio. The average intensity value may also only interrogate a subset of pixels or region of interest (ROI) within the partition. Alternatively, the integrated intensity can be substituted for average intensity in all analyses described herein. Finally, ratios or subtractions can be performed directly between images on a pixel-by -pixel basis and partition intensity (average or integrated) can be determined from the resulting images.
  • the change in fluorescence represents an increase in fluorescence as hairpin probes containing a fluorophore and quencher at each end denature, thus separating the fluorophore and quencher molecules.
  • alternative detection chemistries and labeling schemes that result in a decrease in fluorescence intensity as the duplex denatures during melt analysis may also be used.
  • the image acquired at T2 also represents an image taken at a temperature lower than the predetermined Tm of target B whose melt temperature is Tm2.
  • the same general procedure can be performed for each target at temperatures higher than and lower than the predetermined Tm of each probe.
  • a feature of DMA is that a measurement taken at a temperature Tx that is higher than the predetermined Tm for a designated probe may also serve as the measurement taken at a temperature lower than the predetermined Tm of a probe having a Tm higher than Tx, therefore it is not necessary to take at least 2 measurements for each probe.
  • fluorescence images need only be acquired at n+l different temperatures.
  • FIG. 6 is an example of image comparison for the system shown in FIG. 3, where the average fluorescence intensity calculated at T2 (70°C) is divided by the intensity calculated at Tl (60°C) to determine which partitions show a change in intensity.
  • the resulting 1D amplitude plot (FIG. 6, bottom), contains clusters of partitions at two intensities, corresponding to partitions that are negative for a target (no distinguishable change in fluorescence intensity between successive images results in a ratio close to 1) or positive for a target (change in fluorescence intensity between successive images results in a ratio >1).
  • Classification of partitions into these two groups can be done by setting a manual threshold or by using an algorithm-based approach such as k- means clustering.
  • Equation 1 can be applied to each target individually. It is important to note that the distributions of targets A, B and C across partitions are assumed to be independent, and therefore, partitions that may be negative for target A in the calculation of Equation 1 , may be positive for targets B or C or both. This does not however, affect quantification of individual targets.
  • Equation 3 compares the span of the confidence interval to the average number of target copies per partition. Smaller values denote greater degrees of precision. While relative standard deviations and relative confidence intervals may increase dramatically at the limits of quantifiable detection (i.e.. very few target positive or very few target-negative partitions), the magnitude of error in those cases may still be acceptable. For example, when trying to detect an extremely rare target, the simple presence of the target may itself already be extremely valuable information regardless of the degree of error.
  • Such strategies include using an image acquired before or after amplification to normalize fluorescence intensities measured during melt analysis (See Example 2), and establishing a background (negative partition) threshold to distinguish positive and negative signals from background using pre-and-post-amplification images (See Example 3). Further embodiments (see Example 4) provide methods for correcting images acquired during melt analysis to account for temperature- and light-dose dependent changes in fluorescence intensity over the thermal profile.
  • FAM is known to be very photo sensitive, showing reduced fluorescence intensity with increased photo exposure, and many dyes such as FAM and HEX show decreased fluorescence at higher temperatures.
  • Example 5 provides methods for comparing pre- and post-amplification images for preliminary identification of partitions that contain 0 or 3 targets. It may be desirable to eliminate such partitions from further analysis to simplify and reduce the time needed for data analysis. Preliminary identification of partitions that will not be included in data analysis is also useful to limit the number of images acquired during the melt step, since no images need be acquired for these partitions. This method thus permits image acquisition only from partitions of interest as a result of being deemed suitable for yielding useful data. In certain experimental conditions, this might greatly reduce the melt acquisition time and subsequent data analysis.
  • the present methods provide improved classification of partitions as positive or negative for one or more targets which leads to improved quantification.
  • the present methods make use of melt analysis of target-specific probes to enhance specificity while retaining flexibility in assay design (e.g primer regions, amplicon length, etc.).
  • the described methods rely on the use of a low resolution digital melt profile to detect and identify target nucleic acids, which simplifies melt data acquisition and analysis and ultimately results in faster data acquisition and analysis of data.
  • DMA requires fewer data points than traditional continuous melt analysis, which reduces the time required for data acquisition, and results in fewer images to process and less photobleaching of photosensitive reporter probes. This is particularly useful in an imaging-based digital PCR scenario where many images of partitions (i.e. droplets or static array partitions) are processed at each melt temperature.
  • partitions i.e. droplets or static array partitions
  • Melt analysis of dPCR reactions typically requires images to be acquired across an array of partitions at each temperature of the melt profile. Depending on the number of partitions, the area over which images are acquired can be quite large. Additionally, images must be high enough in resolution to ensure robust partition identification and assignment as positive or negative for a target. This often requires acquiring multiple images per array of partitions.
  • DMA digital as well as bulk volume assays
  • DMA Use of DMA also provides an advantage in that samples are exposed to less potentially damaging light and high temperatures.
  • fluorophores e.g. FAM
  • FAM fluorophores
  • This photosensitivity is significant in digital PCR as the entire sample is interrogated for each fluorescence measurement in contrast to bulk volume PCR wherein a focal volume smaller than the total volume is typically interrogated. This difference is critical as fluorophores in the latter case are free to diffuse in and out of the focal volume and receive on average less excitation exposure and are thus less likely to experience photobleaching.
  • Fluorophores in digital PCR reactions are exposed to increased amounts of incident excitation, particularly if melt analysis is performed, and are therefore more likely to experience photobleaching.
  • DMA reduces the number of exposure events and thus the degree of photobleaching experienced by fluorophores. In some instances, repeated and continuous exposure of fluorescent probes to high temperatures also has adverse effects, which may be mitigated by DMA.
  • cleavable probes Another advantage to using DMA with cleavable probes, is that it provides enhanced specificity.
  • the cleavable probes described in U.S. Application no. 14/82,228 are cleaved and extended only in the presence of target DNA, but do not use target DNA as templates for extension. Therefore, such probes have very predictable Tms that do not vary even in the presence of target nucleic acid sequence variation.
  • nucleic acid duplexes and probe/target duplexes that have Tms that are at least partly determined by the composition of target nucleic acids or amplification products thereof, can show variations in Tm from sample to sample as a result of minor target sequence variations.
  • DMA requires fluorescence intensity values acquired only at a temperature lower than and a temperature higher than the expected Tm of the probe to determine the ratio or difference between the two values in order to discriminate positive from negative samples.
  • DMA may also include acquiring fluorescence intensity values at additional preselected temperatures, but does not require determination of a melt temperature to identify a target.
  • fluorescence intensity values may be acquired prior to amplification instead of at a temperature at which all probes in the reaction are denatured.
  • DMA is, however, not limited to dPCR embodiments. It is also readily applicable to real-time PCR and qPCR melt analysis applications to reduce time required for acquiring data for melt profiling. The method is also applicable to other probe-based detection methods such as Molecular Beacons (MB), TaqMan, TOCE technology and to particular uses of DNA intercalating dyes such as SYBR or EvaGreen.
  • MB Molecular Beacons
  • TaqMan TaqMan
  • TOCE to particular uses of DNA intercalating dyes
  • SYBR EvaGreen
  • Molecular Beacon probes can be designed to have unique, predetermined melt temperatures. However, since melt analysis using MB probes reflects the dissociation of the probe from a target sequence with which it has hybridized, the melt temperature is determined by the target sequence and is thus constrained in terms of design. As temperature is increased during MB probe melt analysis, fluorescence decreases as the MB probe dissociates from the target and adopts a random coil configuration. Similarly, for melt analysis using TaqMan probes, melt profiles are determined by the target sequence intended to be detected and probe design is thus constrained. Melt analysis using Molecular Beacon and TaqMan probes is described in Huang et al, PLoS One, 6(4) 2011, incorporated herein by reference. MB and Taqman probes designed to have predetermined melt profiles can be also used in DMA since DMA does not require determination of a specific duplex Tm, so small changes in target sequence would not have a significant deleterious effect.
  • DMA can also be used with TOCE probes, described in WO2012096523, incorporated herein by reference.
  • Hybridization and extension of an upstream primer in the presence of its target nucleic acid results in cleavage of a downstream hybridized pitcher oligonucleotide to release a tagging oligonucleotide.
  • the tagging oligonucleotide then hybridizes to a labeled probe or catcher oligonucleotide which serves as a template for extension of the tagging region to generate a duplex nucleic acid having a predetermined Tm.
  • Various labeling schemes may be used to support melt analysis of the duplex nucleic acid.
  • extension of the tagging region may cause separation of the quencher and fluorophore of a random coil labeled probe to result in fluorescence.
  • Amplification can thus be detected in real time by detecting an increase in fluorescence as the duplex forms, and melt analysis can be detected as a reduction in fluorescence as the random coil probe reassumes a random coil configuration. Since the catcher oligonucleotide is target- independent and can be designed to have a predetermined Tm, this detection method is well suited for use in DMA.
  • DMA may also be used with intercalating dyes such as SYBR or EvaGreen. Identification of targets can be achieved through amplification of target regions having different lengths or sequence composition, and thus different Tm values. Following amplification, the reaction mixture can be subjected to increasing temperatures in a discrete melt analysis to measure changes in fluorescent intensity corresponding to double-stranded amplicon or duplex dissociation. DMA is useful in intercalating dye and probe-based detection methods because signals can be detected at discrete temperatures higher than and lower than the predetermined Tm of the duplex of interest, which can be designed to be outside of the Tm ranges that include non-target amplification products such as primer dimers (which are typically lower in Tm than true target duplexes).
  • intercalating dyes such as SYBR or EvaGreen.
  • non-target spurious duplexes might have Tms in the temperature range of 60 to 75°C.
  • the target amplicon or duplex of interest may be designed to have a Tm of 83°C.
  • DMA could be performed at 78°C and 88°C, either in a bulk reaction or in a dPCR format. This method of analysis would avoid acquiring signals associated with non-target amplification events in a quick and efficient manner that would be superior in specificity compared to a single temperature measurement, and superior in speed and processing to a high-resolution melt analysis.
  • DMA can be applied to non-digital or homogenous assay chemistry methods such as closed-tube or real-time bulk PCR methods, it is particularly useful in digital amplification applications because it provides particular advantages for accurate counting of positive partitions for quantifying the starting concentration of target in the reaction.
  • closed-tube or real-time bulk PCR methods it is particularly useful in digital amplification applications because it provides particular advantages for accurate counting of positive partitions for quantifying the starting concentration of target in the reaction.
  • described herein are various methods for quantifying and improving the quantification of the target nucleic acid in dPCR using various analysis techniques.
  • a set of calibration dyes and probes can be utilized to generate a set of reference data by which instrument performance can be monitored at a suitable frequency.
  • This set of dyes and probes can include system-specific dyes labeled with short oligo sequences to render them soluble in water as well a variety of hairpin probes designed to exhibit a range of melt profiles (melt-calibration controls) for performing appropriate calibrations.
  • the set of calibration dyes can be used to ensure that the instrument is detecting and reporting the expected fluorescence intensities across all channels.
  • a different calibration dye for each channel can be included in a control sample, and the measured intensities can be compared to previously determined intensities at the lower and upper ends of the desired temperature range (such as 55 - 95 °C). If any of the measurements deviate beyond a predetermined acceptable range from the expected values, this could signify a problem with the instrument, the reagent mix, or operating conditions.
  • calibration dyes can be used to normalize and/or adjust raw measurement values so that measurements can be properly evaluated against the entire set of reference data (e.g., expected melt amplitudes and temperatures of targets or probes).
  • melt-calibration controls having known melt profiles and melt temperatures are included in the reaction mixture or in a separate partition.
  • One method of evaluating melt-calibration controls in dPCR applications is to perform a continuous melt analysis in order to identify melt peaks in plots of the derivative of fluorescence versus temperature. Once the precise observed melt temperature is identified, it is compared to the expected value, and any difference between the observed and expected value is used to apply a temperature correction to all measurements. If desired, more than one melt- calibration control can be included to ensure accurate temperature correction across the entire melt analysis temperature window.
  • melt-calibration controls for use in DMA should be designed to melt over a narrow temperature range bracketing (>90% melted within 5°C) the measurement temperatures used for the DMA analysis. Since DMA does not measure fluorescence at the Tm for a target-specific probe, having the Tm of the melt calibrator within a narrow range of the DMA measurement temperatures (Tl, T2, T3 and T4) ensures that fluorescence of the melt calibrator will be maximally sensitive to fluctuations in system thermals. Fluctuations in fluorescence intensity values compared to reference values derived for the melt calibrators will determine the degree of thermal variability. If the thermal variability is within a pre-determined tolerance specification, the melt analysis can be considered complete.
  • melt analysis can be repeated at appropriately adjusted temperatures or an appropriate correction factor may be applied.
  • melt-calibration controls can be evaluated either independently as part of system maintenance and calibration, or they may be included as on-board controls and processed alongside all samples if the desired number of melts in a channel or across channels are reserved.
  • melt-calibration control it is optimal to measure the melt-calibration control simultaneously alongside the sample measurement as individual experiment conditions can cause results to deviate from expectations.
  • concentrations of oligonucleotides and salts can alter melt temperatures by as much as 10-20 °C in extreme cases.
  • a melt- calibration control is included whose expected Tm is known. To avoid confusion with the targets being tested, the melt-calibration control can be selected so that the illumination channel and emission wavelength region will not coincide with the emission wavelengths of the targets.
  • a FAM-labeled control with an expected melt temperature of 84.1 °C could be included with the analyte being tested, or it could be measured separately.
  • An acceptable range could be identified, such as +/- 2.5 °C, or 81.6 to 86.6 °C.
  • raw melt data obtained, e.g., by taking measurements from 55 to 95 °C at 0.5 °C increments
  • the temperature correction, ATcon required to shift the set-point temperatures as needed.
  • melt-calibration control can be included to ensure not only proper temperature correction but also proper temperature difference between expected melt peaks.
  • a first melt-calibration control could be a FAM-labeled control oligonucleotide with an expected melt temperature of 84.1 °C
  • a second melt- calibration control could be an AP-593-labeled oligonucleotide with an expected melt temperature of 71.0 °C.
  • any substantial deviations from that value between observed melt peaks could signify a problem in the system, such as defective or improper ramping of temperatures— for example, a loose wire could be delivering less current than necessary to the thermo-electric heating/cooling unit, thereby delivering less heat and lower temperatures than expected from a given set point.
  • An alternative method for thermal calibration relies on the use of a well- characterized, temperature sensitive fluorescent dye.
  • Exemplary dyes for this use are Rhodamine and AP662. These dyes display robust, reproducible temperature-dependent fluorescence across the melt analysis range. Deviation from the expected dye performance is used to adjust system thermals accordingly.
  • One method comprises including a sample processing control having a reproducible, known concentration in the reaction mixture to determine sample preparation efficiency.
  • an appropriate correction can be applied to the concentration of unknown analyte calculated for the sample.
  • This correction can be obtained by dividing the expected input value of the control by the measured value obtained in the assay to obtain a multiplier value.
  • the multiplier value can be applied to the initial value obtained for each analyte after Poisson correction, to obtain a sample preparation efficiency corrected value that will more accurately reflect the true concentration of each analyte in the patient sample.
  • the sample processing control may be added at the same stage as the sample is typically added.
  • the method can include the addition of an amplification control comprising an oligonucleotide target sequence and corresponding, target-specific probe in the PCR master mix (post sample processing) to characterize the distribution of positive and negative partitions for a known concentration of control target.
  • an amplification control comprising an oligonucleotide target sequence and corresponding, target-specific probe in the PCR master mix (post sample processing) to characterize the distribution of positive and negative partitions for a known concentration of control target.
  • the expected fluorescence intensity of positive and negative partitions may be determined, and used to set preliminary thresholds for classifying unknown targets.
  • preliminary thresholds may be used as an initial classification threshold which is subsequently adjusted using manual thresholding or algorithm-based methods.
  • an exemplary ideal concentration to set the sample processing control or the amplification control would be one having a lambda (expected copies per partition) value of 1.59.
  • digital PCR achieves the highest precision in quantification (Majumdar el al, Digital PCR Modeling for Maximal Sensitivity, Dynamic Range 2 and Measurement Precision, PLOS One, 2015) which means variability due to sample processing would be most isolated from the inherent variability of the Poisson distribution.
  • These controls may be included at a single Tm in a single fluorescence channel or across all fluorescence channels. In the former case, the previously described verified set of data using calibration dyes will allow the user to extrapolate single fluorescence channel data to other fluorescence channels.
  • the distribution of positive and negative droplets and their intensities at the measurement temperature extremes for an unknown target can yield valuable information for optimal interpretation of results.
  • the fluorescence intensity of target-negative partition(s) can be used as an internal control.
  • the average intensity for target-negative partition(s) may be determined and compared to a reference or historical case. Differences between the measured and historical value can be indicative of a change in operating conditions, sample composition, or equipment issues.
  • the fluorescence intensity of target-positive partitions can similarly be compared to a reference or historical case to evaluate system performance.
  • Images may show some degree of variability due to non-uniformity in illumination or measurement of fluorescence across the two-dimensional array of partitions. This variability will have a larger impact when multiple images are stitched together to create an aggregate image of all partitions for a single sample.
  • an image acquired after partitioning but before nucleic acid amplification may be used to normalize images acquired post-amplification.
  • the average partition intensity across all partitions in the pre-amplification image is calculated and divided by the average intensity in individual partitions.
  • the resulting partition-specific ratios can be used to normalize the intensity across subsequently acquired images to account for any illumination or measurement- induced non-uniformity.
  • the same strategy may be used for each channel in the final instrumentation embodiment.
  • a passive reference dye is used to correct for non-uniformity of fluorescence.
  • the internal reference dye can be used as a channel-agnostic intensity normalization factor for all fluorescence measurements much as passive reference dyes are used in existing real-time or quantitative PCR instruments.
  • the passive reference dye can be used to aid in droplet identification since probe- based fluorescence measurements will be variable relative to amplification state and temperature depending on probe Tm.
  • a well/partition in a microfluidic device such as described in US9039993, can be reserved for fluorescence normalization and thermal calibration.
  • this well may contain a passive reference dye that can be used as a channel-agnostic intensity normalization factor for all fluorescence measurements.
  • melt calibrators can be included to account for any thermal variability. The measured peak of this or these melt calibrators can be used for thermal calibration through the determination of the difference between the known melt peak of the calibrator(s) and the measured melt peak of the calibrator(s). A simple translation along the temperature axis can account for small day-to-day variability.
  • Example 1 A method of normalizing images to improve partition classification using an image acquired pre- or post- nucleic acid amplification
  • This 95°C image can be acquired after partitioning but prior to nucleic acid amplification or during the course of melt analysis after nucleic acid amplification. Partitions are identified in the image, and the average pixel intensity per partition is determined. All partition average intensities acquired in the melt series at various temperatures can be normalized to the corresponding 95°C partition average intensity to account for partition-specific variations by subtracting the 95°C average intensity from the intensities measured during melt analysis.
  • FIG. 8 showcases the effect of this normalization on discrete melt data generated from partitions containing a single probe.
  • FIG. 8A shows a raw data image taken at Tl and
  • FIG. 8B shows the same data normalized using a 95°C image.
  • contrast is enhanced between positive and negative droplets in the normalized image.
  • Corresponding intensity histograms shown in FIG 8C and 8D illustrate that normalization results in clustering into the two expected populations (pixels associated with dark droplets and pixels associated with bright droplets). Prior to normalization, three distinct peaks are visible (FIG. 8C).
  • Example 2 A method of establishing a preliminary cutoff for negative and positive partitions using an image acquired after compartmentalization but prior to nucleic acid amplification
  • FIG. 9C shows an image of droplets post-amplification. Bright droplets are negative for the target and dim droplets are positive for the target.
  • a high degree of overlap in the negative populations demonstrates the feasibility of initial threshold setting in this manner.
  • classification algorithms such as A:- means clustering are used to identify positive and negative partitions
  • the data acquired through this image may be used as a training set for the classification algorithm.
  • the pre-amplification and post-amplification images should be acquired at the same temperature. Note that in detection schemes in which probe signal decreases as target amplification proceeds, partitions with intensity values that lie above the threshold post- amplification are classified as negative droplets. Partitions with intensity values that he below the threshold after amplification are classified as positive partitions.
  • Example 3 Methods for correcting post-amplification images for temperature- dependent and light dose-dependent changes in fluorescent intensity of the probes
  • melt analysis to identify specific targets is performed over a temperature range of 55°C to 95°C.
  • the intensity of fluorescence of some fluorescent dyes has been shown to be variable within this temperature range.
  • some dyes, such as FAM (a derivative of fluorescein) are known to exhibit photobleaching as a result of repeated light exposures such as those sustained during multiple image acquisitions (Song et al, Photobleaching Kinetics of Fluorescein in Quantitative Fluorescence Microscopy, Biophysical Journal, 68, 2588-2600 (1995)).
  • a series of images can be acquired subsequent to partitioning but prior to nucleic acid amplification at temperatures ranging between 55°C to 95°C.
  • a minimum of 3 images are acquired at equally spaced temperature intervals across the entire melt profile temperature range for each wavelength used in melt analysis.
  • the average intensity in individual partitions is determined using one of the methods described previously (entire partition vs. an ROI) and plot on the y-axis of a graph against the temperature at which the image was acquired. This collection of data points is fit with an appropriate model (linear or exponential) based on a priori knowledge about the probe’s sensitivity to both temperature and light using least-squares regression.
  • an exponential model or a mixed model of linear and exponential may fit the data best.
  • a linear model may fit the data best.
  • the goodness of fit is determined by either the standard error of the regression or the coefficient of determination, R.2.
  • Important metrics obtained from these fits can include the slope, time constant and/or the y-intercept. A unique set of metrics is determined for each fluorescence channel present.
  • the average intensity determined for each individual partition over the entire melt profile temperature range is corrected for any temperature- and light dose- dependent losses specific to each fluorescence channel.
  • the linear or exponential decay of fluorescent signal is corrected for in the series of post-amplification melt images by subtraction of the fit obtained from pre-amplification data from the post-amplification melt profile, to generate a corrected melt profile. Further analysis to identify and quantify the presence of probe-specific targets is now carried out using the corrected melt profile.
  • the correction for temperature- and light dose-dependent fluorescent loss is applied pixel-by-pixel to the entire image prior to calculation of the average intensity in an individual compartment or droplet.
  • probe intensities can vary in a linear or non-linear fashion, or even through a combination of linear and nonlinear relationships, over the course of melt measurements.
  • fluorescein intensity was shown to have a double-exponential photobleaching behavior in oxygen-poor conditions, while a single-exponential behavior was seen in oxygen-rich environments.
  • control samples For example, data from control samples is used, where the most appropriate curve is fit to control data (for example, a double-exponential curve fit) and the fitted curve from the experimental data is subtracted or normalized to control values.
  • control data for example, a double-exponential curve fit
  • the fitted curve from the experimental data is subtracted or normalized to control values.
  • sufficient negative-result partitions exist after amplification, they can act as controls and be used for curve-fitting purposes to adjust for slope changes due to temperature-and light- dependent fluorescence changes.
  • FIG. 10 illustrates how fluorescence intensities measured from a negative (target-free) control partition can be used to compensate/correct for temperature- dependent and/or light-dos e-dependent fluorescence variations in a test sample.
  • FIG. 10 shows the melt curve generated from raw data collected for a sample with three target-specific probes, each of which have distinct melt temperatures (Target) and a negative partition (Control), and corrected melt curves for the sample (Corrected Target) and negative control (Corrected Control). It is clear from the uncorrected (raw) data from the Control that a linear decay in fluorescent intensity occurs with increasing temperature in the negative control.
  • Example 4 Methods to determine the full range of values for total fluorescence change for initial partition classification.
  • Equation 5 Equation 5
  • An example of a 1D amplitude plot demonstrating initial droplet classification in a 3-plex assay in a single channel is shown in FIG 13B.
  • the distribution of partition intensities from the dissociation image is centered around intensities of 0 or 1, ARFUmax, (l/3)*ARFUmax, (2/3)*ARFUmax, where ARFU specifically refers to ARFU95-56.
  • ARFUmax should be a consistent value
  • initial thresholds may be set to classify partitions based on a reference data set. These thresholds may then be further refined manually or using algorithm- based means such as k-means clustering.
  • defmetherain that uses A:- means clustering has been made available by a third party through a web interface (definetherain.org.uk) for application to digital droplet data obtained using Bio-Rad systems.
  • a web interface defined by a third party through a web interface (definetherain.org.uk) for application to digital droplet data obtained using Bio-Rad systems.
  • additional classification or cluster analysis algorithms that can be applied to partition classification.
  • Partitions containing no targets or all three targets may be classified using the previously described process. These partitions can henceforth be excluded from further analysis (melt acquisition or data analysis) for simplicity. Eliminating these partitions from further analysis reduces the number of male analysis images required to be acquired to further reduce the time required for image acquisition and data analysis. However, if three target-specific probes are detectable in a single channel, and a partition contains only a single target, melt analysis may be used to distinguish the presence of the particular target within a partition.
  • the methods described for performing initial partition classification can also be applied to the use of a passive reference dye for normalization.
  • the AF value calculated in Eq 1 is normalized by the passive reference dye signal much in the way that Rn and ARn are calculated for real-time or quantitative real-time PCR.
  • Rn is the ratio of measured fluorescence and passive reference dye fluorescence while ARn is Rn after baseline correction.
  • the use of a passive reference dye does not eliminate the need to account for temperature- and light dose- dependent fluorescent intensity loss over the course of melt profile generation as the passive reference dye only accounts for this loss in a single channel and losses across channels are not expected to be uniform. Likewise, there may be variability in the temperature- and light dose- dependence of different fluorophores.
  • PCR samples were prepared in a buffer containing: lOmM Bis-Tris propane (pH 9.1), 0.3mg/mL BSA, IOOmM dNTPs, 90mM DTT, I mM Dabcyl-diGTP, lOmM Tris Base, 2.5mM MgCh. and 50mM KC1.
  • Enzymes included in the reaction include TiTaq (Clontech) at 4X and Hot Start RNase H2 at 16 mU/uL (Takara).
  • Forward primer B (for target B) (5’ GCAAGATACCATTTATCAATGAAG 3’; SEQ ID NO: 1) was included at a concentration of 480nM, reverse primer B (5’ GGTGTCAATTTTCTTATATCATAAT 3’; SEQ ID NO: 2) at a concentration of 120hM and probe B (5’ /56-HEX//iMe- isodC/TTCTCTTCTCTTTCATTCACATAACGCCAAA/iSpC3/AAACCCGTTATGTrCCT CCAGTTCCCATATTTG/3SpC3/ 3’; SEQ ID NO: 3) at a concentration of 300nM.
  • Ultramer B (5’
  • Partitioned reactions were thermal cycled on a ProFlex thermal cycler at an 11° incline (per QS3D manual) to end point using the following thermal cycling protocol: 96°C for 10 minutes, 45 cycles of 57°C for 2 minutes and 98°C for 30 seconds, and finally a 5 minute hold at 57°C.
  • melt analysis was performed using a LabView controlled custom melt reader consisting of a thermoelectric cooler (TEC) and imaging apparatus.
  • TEC thermoelectric cooler
  • the chip was heated from 60°C to 90°C in increments of l°C and images were acquired at each temperature using excitation (5l l/55nM) and emission filtering (549/15) appropriate for HEX. Images were analyzed in Matlab using custom software.
  • FIG. 11 shows raw fluorescence data from melt analysis (A) alongside a plot of the average intensity per partition at the probe annealing temp (B). Classification and subsequent calculation of partitions as positive or negative for the template is applied to Equation 1 below to determine the average number of template copies/partition, and thus the concentration of template present in the reaction.
  • This classification can be done manually or using a classification algorithm k-means classification results in a determination of 1,100 copies/pL, compared to the expected 907 copies/pL. Manual classification is expected to yield variable results depending on the user due to the presence of considerable“rain”. Normalizing individual partition melt profiles to the average partition intensity measured at 95°C reduces rain and simplifies manual classification of positive and negative droplets (FIG11.C&D). An additional correction can be applied to account for temperature- or light dose-dependent fluorescence decay across the melt profile (FIG11 E&F), though the impact of this correction will be dependent on whether the fluorescent dyes used in the experiment exhibit such decay. The derivative of the melt profile can also be used to quantify template presence.
  • the inverse derivative of the normalized melt curve is calculated and the intensity is integrated across the melt peak. Integrated partition intensity per partition is shown in FIG.11 G&H.
  • manual or algorithm-based classification can be applied to determine the number of template copies present in the reaction. Note that in the singleplex case, the quantification of template using k-means classification is identical for melt vs end point analysis and application of the correction factors discussed above appears to yield a value (1,038 copies/pL) closer to the expected value of 907 copies/pL. In a multiplex assay, the endpoint image will only be sufficient to determine the number of unique targets present in a given partition (0, 1, 2, or 3), however melt analysis will be necessary to identify which specific targets are present.
  • FIGs. l3A,C,E&G represent melt curves for raw data (A), 95°C normalized data, (C) temperature and fluorescence decay -corrected data (E) and the melt derivative (G).
  • Table 1 Calculated target concentrations using Continuous and Discrete Melt Analysis from partitions containing either single or multiple different targets.
  • This example provides an exemplary workflow for dPCR analysis using target-specific probes having predetermined melt profiles as described in U.S. Application Serial No. 14/823,288. Such probes exhibit distinguishable signals based on whether the probes are in duplex conformation as a result of encountering target nucleic acids, or whether they are in single stranded conformation. Note that for these probes, maximal fluorescence can be detected at any temperature prior to encountering target nucleic acid as a result of a fluorophore coupled to the probe, or after encountering target nucleic acid at temperatures above the predetermined Tm of the duplex, when the quencher incorporated into the probe is separated from the fluorophore as the intramolecular duplex is dissociated at these temperatures.
  • This workflow is not necessarily limited to these probes, and may be applied to other types of probes having similar labeling schemes.
  • Discrete melt image analysis for dPCR reactions requires 3 key steps to ensure accurate interpretation of melt data and optimal classification of partitions into negative or positive partitions: 1) Correct measured fluorescence values for variations in fluorescence intensity as a result of temperature dependence of fluorescence; 2) Normalize measured fluorescence values for system-dependent fluorescence variability (e.g. optical non-uniformity or partition volume variations); and 3) determine presence of targets by detecting fluorescence intensity changes at preselected temperatures that are higher than and lower than the preselected Tms of probes.
  • FIG. 15 provides an exemplary workflow for performing these steps.
  • images are acquired at a range of temperatures prior to thermal cycling to determine variations in fluorescence intensity due to temperature.
  • the temperatures can be selected to correspond to those that will be used for DMA after thermal cycling, or a larger range of temperatures (e.g. every degree between the lowest and highest temperatures used for DMA) can be selected, or a previously acquired set of images for each fluorescent dye can be used.
  • Corrections for temperature dependence of fluorescence can be applied to images acquired after thermal cycling in a number of ways: i) Fit a curve to the average intensity values calculated for partitions at the various temperatures prior to amplification and use that expression to correct post-amplification images at the relevant temperatures; ii) acquire images for partitions at the temperatures used for DMA prior to amplification and normalize each post-amplification image with the corresponding pre-amplification image; iii) derive appropriate correction expressions at selected temperatures from an exemplary set of data and apply these to images taken after amplification at the selected temperatures; and iv) use intensity values associated with negative partitions post-amplification to correct integrated intensity values in positive partitions.
  • negative partition intensities in an image acquired at a single temperature substitute for partition intensities determined from a pre-amplification image acquired at the same temperature.
  • the method described in (ii) is used as this method provides the advantage of simultaneously normalizing images for system-dependent fluorescence variability.
  • correction for temperature dependence of fluorescence is performed, followed by normalization using any image taken prior to amplification.
  • an image acquired at 95°C after amplification and corrected for temperature-dependent fluorescence variations can be used for normalization. It is also possible to substitute an image acquired for a passive reference dye such as ROX for normalization.
  • comparisons of fluorescence intensities from images acquired at a temperature lower than and a temperature higher than the predetermined Tm for each probe can be made to determine if a target is present.
  • comparisons of intensities may involve calculating ratios or differences in intensity measurements acquired at different temperatures.
  • calculations may be carried out using detected intensity values, or integrated or averaged intensities for each region of interest.
  • results are expected to cluster into one of two groups for each partition, positive partitions or negative partitions.
  • multiplex categories of positive partitions can be expected as some partitions will contain multiple targets. This clustering should allow a threshold for distinguishing positive and negative partitions to be determined manually or using classification algorithms.
  • the pre-amplification images acquired at various temperatures should aid in establishing statistics around the expected intensity (including mean and standard deviation) of negative partitions.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
PCT/US2019/014512 2018-01-22 2019-01-22 Methods and compositions for discrete melt analysis Ceased WO2019144107A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
KR1020207024174A KR20200115552A (ko) 2018-01-22 2019-01-22 별개의 용융 분석을 위한 방법 및 조성물
BR112020014412-6A BR112020014412A2 (pt) 2018-01-22 2019-01-22 Métodos e composições para análise de fusão discreta
CN201980009454.6A CN111629831A (zh) 2018-01-22 2019-01-22 用于离散解链分析的方法和组合物
CA3088250A CA3088250A1 (en) 2018-01-22 2019-01-22 Methods and compositions for discrete melt analysis
EP19741859.3A EP3743211A4 (en) 2018-01-22 2019-01-22 METHODS AND COMPOSITIONS FOR THE ANALYSIS OF DISCRETE MELT
JP2020540385A JP2021511056A (ja) 2018-01-22 2019-01-22 不連続融解分析のための方法および組成物
AU2019209444A AU2019209444A1 (en) 2018-01-22 2019-01-22 Methods and compositions for discrete melt analysis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862620298P 2018-01-22 2018-01-22
US62/620,298 2018-01-22

Publications (1)

Publication Number Publication Date
WO2019144107A1 true WO2019144107A1 (en) 2019-07-25

Family

ID=67298530

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/014512 Ceased WO2019144107A1 (en) 2018-01-22 2019-01-22 Methods and compositions for discrete melt analysis

Country Status (9)

Country Link
US (2) US11390902B2 (https=)
EP (1) EP3743211A4 (https=)
JP (1) JP2021511056A (https=)
KR (1) KR20200115552A (https=)
CN (1) CN111629831A (https=)
AU (1) AU2019209444A1 (https=)
BR (1) BR112020014412A2 (https=)
CA (1) CA3088250A1 (https=)
WO (1) WO2019144107A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023023533A1 (en) 2021-08-19 2023-02-23 Luminex Corporation Digital amplification assay analysis method
WO2023108014A1 (en) * 2021-12-07 2023-06-15 Luminex Corporation Methods and compositions for nucleic acid analysis

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2021511056A (ja) * 2018-01-22 2021-05-06 ルミネックス コーポレーション 不連続融解分析のための方法および組成物
US11039089B2 (en) * 2019-03-27 2021-06-15 Indian Institute Of Technology Ropar Thermal imaging for identifying a defect in a material
AU2020395229A1 (en) * 2019-12-03 2022-06-23 Biofire Diagnostics, Llc System and method for identifying analytes in assay using normalized Tm values
US20250131748A1 (en) * 2021-09-14 2025-04-24 Combinati Incorporated Systems and methods for polymerase chain reaction quantification
KR102750761B1 (ko) * 2021-12-29 2025-01-09 주식회사 한국인삼공사 배암차즈기를 판별하기 위한 단일염기다형성을 갖는 유전자 마커
WO2023235732A2 (en) * 2022-05-31 2023-12-07 Siemens Healthcare Diagnostics Inc. Methods and kits for determining antibiotic susceptibility
KR20260011156A (ko) * 2023-05-12 2026-01-22 라이프 테크놀로지스 코포레이션 다중 중합효소 연쇄반응 공정 및 데이터 분석을 위한 시스템 및 방법
WO2025179142A1 (en) * 2024-02-22 2025-08-28 Cepheid Maximizing optical channel capabilities for target detection

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130095479A1 (en) * 2004-10-18 2013-04-18 Brandeis University Primers, probes and methods for nucleic acid amplification
US20150308957A1 (en) * 2008-06-25 2015-10-29 Emergence Genomics, Llc Method and Apparatus for Melting Curve Analysis of Nucleic Acids in Microarray Format
WO2016184902A1 (en) * 2015-05-18 2016-11-24 Saga Diagnostics Ab Detection of target nucleic acid and variants
US20170226576A1 (en) * 2007-03-28 2017-08-10 Fluoresentric, Inc. Dynamic flux nucleic acid sequence amplification
US20170247750A1 (en) * 2014-03-28 2017-08-31 Seegene, Inc. Detection of target nucleic acid sequences using different detection temperatures
US20170321259A1 (en) * 2014-08-11 2017-11-09 Luminex Corporation Probes for improved melt discrimination and multiplexing in nucleic acid assays

Family Cites Families (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5200313A (en) * 1983-08-05 1993-04-06 Miles Inc. Nucleic acid hybridization assay employing detectable anti-hybrid antibodies
JP3963422B2 (ja) * 2000-08-03 2007-08-22 日鉄環境エンジニアリング株式会社 核酸の測定方法
US7058184B1 (en) 2003-03-25 2006-06-06 Robert Hickling Acoustic measurement method and apparatus
US20050053950A1 (en) 2003-09-08 2005-03-10 Enrique Zudaire Ubani Protocol and software for multiplex real-time PCR quantification based on the different melting temperatures of amplicons
CN102112632A (zh) 2008-08-08 2011-06-29 史密斯探测公司 用于pcr分析的检测算法
US9156010B2 (en) 2008-09-23 2015-10-13 Bio-Rad Laboratories, Inc. Droplet-based assay system
US9417190B2 (en) 2008-09-23 2016-08-16 Bio-Rad Laboratories, Inc. Calibrations and controls for droplet-based assays
CN102301007A (zh) 2008-12-10 2011-12-28 史密斯探测公司 使用随温度而变的杂交对核酸序列进行鉴定与区分
US8039215B2 (en) * 2009-03-10 2011-10-18 Roche Molecular Systems, Inc. Multiplex quantitative nucleic acid amplification and melting assay
WO2010132813A2 (en) * 2009-05-15 2010-11-18 Idaho Technology, Inc. Systems and methods for automated melting curve analysis
GB201017978D0 (en) * 2010-10-25 2010-12-08 Oxitec Ltd Multiplex amplification and detection
CN103459612A (zh) * 2010-12-03 2013-12-18 布兰代斯大学 用于检测野生型群体中的核酸突变体的方法和试剂盒
MX352460B (es) * 2011-01-11 2017-11-24 Seegene Inc Detección de secuencias de ácido nucleico objetivo mediante ensayo de escisión y extensión del pto.
EP2885431A4 (en) 2012-08-17 2016-07-13 Bio Nems Corp CLASSIFICATION OF A NUCLEIC ACID
WO2015023616A2 (en) 2013-08-12 2015-02-19 The Johns Hopkins University Method for comprehensive, quantitative, and highly sensitive discrimination of nucleic acid sequences in homogeneous and heterogeneous populations
WO2015031842A1 (en) * 2013-08-30 2015-03-05 University Of Utah Research Foundation A quantum method for fluorescence background removal in dna melting analysis
DK3237636T3 (da) * 2014-12-22 2021-01-25 Anapa Biotech As Dobbelt-quenching analyse til multiplex detektion af målnukleinsyrer
WO2016108954A1 (en) * 2014-12-30 2016-07-07 Telomere Diagnostics, Inc. Multiplex quantitative pcr
EP3957398A1 (en) 2015-09-29 2022-02-23 Life Technologies Corporation Systems and methods for performing digital pcr
CN108368547B (zh) * 2015-12-15 2022-04-05 Seegene株式会社 与靶核酸序列有关的信号提取
US11232851B2 (en) 2016-06-23 2022-01-25 Canon Information And Imaging Solutions, Inc. System and method for modeling and subtracting background signals from a melt curve
ES2893411T3 (es) 2016-09-15 2022-02-09 Hoffmann La Roche Procedimientos para realizar PCR multiplexada
EP3299470B1 (en) 2016-09-23 2019-10-30 Roche Diagniostics GmbH A method for reducing quantification errors caused by reaction volume deviations in digital polymerase chain reaction
AU2017363076B2 (en) 2016-11-17 2021-04-29 Combinati Incorporated Methods and systems for nucleic acid analysis and quantification
JP2021511056A (ja) * 2018-01-22 2021-05-06 ルミネックス コーポレーション 不連続融解分析のための方法および組成物

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130095479A1 (en) * 2004-10-18 2013-04-18 Brandeis University Primers, probes and methods for nucleic acid amplification
US20170226576A1 (en) * 2007-03-28 2017-08-10 Fluoresentric, Inc. Dynamic flux nucleic acid sequence amplification
US20150308957A1 (en) * 2008-06-25 2015-10-29 Emergence Genomics, Llc Method and Apparatus for Melting Curve Analysis of Nucleic Acids in Microarray Format
US20170247750A1 (en) * 2014-03-28 2017-08-31 Seegene, Inc. Detection of target nucleic acid sequences using different detection temperatures
US20170321259A1 (en) * 2014-08-11 2017-11-09 Luminex Corporation Probes for improved melt discrimination and multiplexing in nucleic acid assays
WO2016184902A1 (en) * 2015-05-18 2016-11-24 Saga Diagnostics Ab Detection of target nucleic acid and variants

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP3743211A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023023533A1 (en) 2021-08-19 2023-02-23 Luminex Corporation Digital amplification assay analysis method
WO2023108014A1 (en) * 2021-12-07 2023-06-15 Luminex Corporation Methods and compositions for nucleic acid analysis

Also Published As

Publication number Publication date
BR112020014412A2 (pt) 2020-12-29
CN111629831A (zh) 2020-09-04
JP2021511056A (ja) 2021-05-06
CA3088250A1 (en) 2019-07-25
EP3743211A1 (en) 2020-12-02
US11390902B2 (en) 2022-07-19
US20190226008A1 (en) 2019-07-25
AU2019209444A1 (en) 2020-07-30
KR20200115552A (ko) 2020-10-07
EP3743211A4 (en) 2021-11-24
US20220364148A1 (en) 2022-11-17

Similar Documents

Publication Publication Date Title
US20220364148A1 (en) Methods and compositions for discrete melt analysis
US20260055440A1 (en) Probes for improved melt discrimination and multiplexing in nucleic acid assays
US11261481B2 (en) Probes for improved melt discrimination and multiplexing in nucleic acid assays
AU2016263457B2 (en) Detection of target nucleic acid and variants
US20250257389A1 (en) Methods and probes for performing pcr with melt analysis for increased multiplexing
JP2025537801A (ja) 色の組合せを使用するマルチプレックスデジタルpcrのためのデータ分析方法
HK40029658A (en) Methods and compositions for discrete melt analysis
US20150315634A1 (en) Calibration of High Resolution Melting
US20200208207A1 (en) Methods for detecting variant nucleotides
HK1236579A1 (en) Probes for improved melt discrimination and multiplexing in nucleic acid assays

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19741859

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3088250

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020540385

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019209444

Country of ref document: AU

Date of ref document: 20190122

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20207024174

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019741859

Country of ref document: EP

Effective date: 20200824

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020014412

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112020014412

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200715