WO2019132631A1 - 줄기세포를 이용한 노화 조절 유효인자 구축 방법, 및 그를 이용하여 노화 조절 물질을 스크리닝 하는 방법, 및 그에 의해 도출된 항노화 물질 - Google Patents

줄기세포를 이용한 노화 조절 유효인자 구축 방법, 및 그를 이용하여 노화 조절 물질을 스크리닝 하는 방법, 및 그에 의해 도출된 항노화 물질 Download PDF

Info

Publication number
WO2019132631A1
WO2019132631A1 PCT/KR2018/016978 KR2018016978W WO2019132631A1 WO 2019132631 A1 WO2019132631 A1 WO 2019132631A1 KR 2018016978 W KR2018016978 W KR 2018016978W WO 2019132631 A1 WO2019132631 A1 WO 2019132631A1
Authority
WO
WIPO (PCT)
Prior art keywords
aging
stem cells
black ginseng
protein
expression
Prior art date
Application number
PCT/KR2018/016978
Other languages
English (en)
French (fr)
Inventor
문지숙
Original Assignee
차의과학대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 차의과학대학교 산학협력단 filed Critical 차의과학대학교 산학협력단
Publication of WO2019132631A1 publication Critical patent/WO2019132631A1/ko

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5073—Stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/88—Liliopsida (monocotyledons)
    • A61K36/896—Liliaceae (Lily family), e.g. daylily, plantain lily, Hyacinth or narcissus
    • A61K36/8962—Allium, e.g. garden onion, leek, garlic or chives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00—General protective or antinoxious agents
    • A61P39/06—Free radical scavengers or antioxidants
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/62—Detectors specially adapted therefor
    • G01N30/72—Mass spectrometers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/62—Detectors specially adapted therefor
    • G01N30/72—Mass spectrometers
    • G01N30/7233—Mass spectrometers interfaced to liquid or supercritical fluid chromatograph
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/88—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/88—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86
    • G01N2030/8809—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86 analysis specially adapted for the sample
    • G01N2030/8813—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86 analysis specially adapted for the sample biological materials
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • a method for constructing an aging regulating effect factor using stem cells a method for screening an aging regulating substance using the aging regulating substance, and an anti-aging substance (triple or black ginseng extract) derived thereby.
  • the homeostasis begins to break, which means that each element of the human body is degraded, unable to overcome the morbid conditions and conditions.
  • body protein levels decrease, energy metabolism changes, and DNA becomes damaged. That is, the amount of hormone in the body is changed, the cell aging proceeds, and the regenerative capacity of the tissue is decreased, so that the ability to maintain the homeostasis of the human body is decreased. Therefore, the answer may be to prevent the aging of the body stem cells through health supplements that affect the stem cell activity in order to restore the regeneration ability of the human tissue and maintain the homeostasis.
  • anti-aging products using stem cells have been emerging in order to prevent aging due to the growing interest in 'anti-aging'. Therefore, anti-aging products of stem cells can not only prevent facial aging like cosmetics, but also provide energy for aging and helpless life of the body, and can be a countermeasure against aging which makes younger and healthier daily life .
  • One aspect is to provide a method for constructing an effective senescence regulating factor using stem cells.
  • Another aspect relates to a method of screening for aging modulators using stem cells.
  • Another aspect of the present invention is to provide an anti-aging or anti-inflammatory composition
  • an anti-aging or anti-inflammatory composition comprising a triple sheath or a black ginseng extract as an active ingredient.
  • Another aspect is to provide a method for preventing, treating or ameliorating an aging or inflammation comprising administering to a patient a therapeutically effective amount of a composition comprising as an active ingredient a triple or a black ginseng extract.
  • Another aspect is to provide a use of a composition comprising, as an active ingredient, triple or black ginseng extract for the manufacture of a medicament for preventing, treating or ameliorating aging or inflammation.
  • Another aspect is to provide a composition for increasing Sirt6 (Sirtuin6) comprising as an active ingredient a triple or black ginseng extract
  • Another aspect is to provide a method for increasing the expression or activity of Sirt6 in a cell or an individual, comprising treating the cell with a triple or black ginseng extract or administering it to an individual.
  • One aspect includes obtaining a culture of a stem cell; Performing LC-MS (liquid chromatography-mass spectrometry) analysis on the culture medium of the obtained stem cells to obtain LC-MS data for the culture medium of the stem cells; Matching the obtained LC-MS data with mass information of a human metabolism database; And a step of selecting the metabolically significant increase in the stem cell culture fluid as a result of the matching, thereby providing a method for constructing an anti-aging effective factor using stem cells.
  • LC-MS liquid chromatography-mass spectrometry
  • stem cell is an undifferentiated cell capable of differentiating into various types of body tissues.
  • stem cells are extracted from a human placenta, and mesenchymal stem cells stem cells.
  • the stem cells may be passage 1 to 100 stem cells.
  • the stem cells may be adult stem cells of passage 1 to passage 30, or embryonic stem cells of passage 1 to passage 100.
  • the stem cells may be extracted from bone marrow, umbilical cord blood, bone marrow, blood or fat.
  • the method further comprises: obtaining interaction information between the selected metabolite and protein; Identifying a metabolic pathway in which proteins on the interaction network aggregate statistically significantly through an over-representation analysis (ORA) analysis on a list of proteins selected from the protein interaction information with the metabolites; And selecting a metabolic pathway among the metabolic pathway, the protein associated with cell proliferation or cell senescence and the metabolism expected to react with the protein.
  • ORA over-representation analysis
  • the step of selecting the metabolites may be selected based on the biological functions of the metabolites.
  • the biological function can be obtained by confirming the biological function of the protein expected to interact with the metabolite from the information obtained from the metabolism and protein interaction using a biological pathway analysis method.
  • Sirtuin6 protein is a protein involved in anti-aging, including cell proliferation, which is expected to be affected by stem cell-derived metabolites.
  • the protein predicted to interact with the selected metabolites belongs to a specific metabolic pathway, and may influence metabolic pathways through interaction with proteins.
  • anti-aging effective factor means an anti-aging-related gene, and by increasing or decreasing the expression of the gene, resistance to various stresses can be increased, and thus, it has an anti-aging activity.
  • the anti-aging effective factors may be any one selected from the group of genes shown in Table 3 below:
  • the anti-senescence-effective factor may be increased in senescent cells treated with triplicate or black ginseng extract.
  • the triple or black ginseng extract has anti-aging activity by increasing the expression of anti-aging effective factors in aging cells.
  • Another aspect is a method for producing stem cells comprising the steps of: obtaining a culture medium of stem cells; Performing LC-MS (liquid chromatography-mass spectrometry) analysis on the culture medium of the obtained stem cells to obtain LC-MS data for the culture medium of the stem cells; Matching the obtained LC-MS data with mass information of a human metabolism database; Selecting the metabolites increased in the stem cell culture as statistically significant as a result of the matching; Confirming whether the selected metabolite is changed from the treated stem cells to the control group; And selecting the senescence-regulating substance when the candidate substance changes the selected metabolism relative to the control group.
  • the present invention also provides a method for screening a senescence-regulating substance using stem cells.
  • the method of one embodiment may further include the step of confirming that the expression of one or more genes selected from the group of genes shown in Table 3 below is regulated after treatment of the candidate substance,
  • the expression of SirT6 gene was significantly increased in senescent cells treated with triplicate or black ginseng extract compared to the control.
  • the triple or black ginseng extract changes the expression of the SirT6 gene, which is expected to interact with stem cell-derived metabolites, and thus it is an aging regulator.
  • compositions comprising a triple sheath or a black ginseng extract as an active ingredient.
  • the composition may be a pharmaceutical composition or a health functional food composition.
  • the term "anti-aging” includes delaying or preventing aging of a cell or an individual, or converting a senescent cell into a younger cell.
  • “senescence of cell” refers to a decrease in cell proliferation ability, decrease in expression of PCNA or SirT1 protein, increase in expression of P53 protein, and increase in expression of P16 and P21 genes, compared with standard cells .
  • “Young cell” indicates that it contains at least one of an increase in cell proliferation capacity, an increase in expression of PCNA or SirT1 protein, a decrease in expression of P53 protein, and a decrease in expression of P16 and P21 genes.
  • the composition may be for the treatment of symptoms associated with aging.
  • the symptoms associated with aging may be skin wrinkles, wound regeneration, muscle weakness, Hutchinson-Gilford progeria syndrome, memory impairment, muscle weakness, or a combination thereof.
  • anti-inflammation means prevention of induction of inflammation through regulation of pro-inflammatory factors and regulation of anti-inflammatory factors in inflammation-induced cells , And promoting inflammation inhibition.
  • iNOS nitric oxide synthase
  • TNF- ⁇ tumor necrosis factor- ⁇
  • IL- interleukin-1 ⁇
  • TGF- ⁇ transfection growth factor- ⁇
  • IL-6 interleukin-6
  • composition may further comprise a pharmaceutically acceptable additive other than the active ingredient, trivalent or black ginseng, and may be formulated into a unit dosage form suitable for intracorporeal administration of a patient according to a conventional method in the pharmaceutical field .
  • Formulations suitable for this purpose include oral dosage forms and include parenteral dosage forms such as injections or topical formulations.
  • parenteral dosage forms such as injections or topical formulations.
  • it may be used parenterally in the form of an aseptic solution or suspension in the form of injection using water or other pharmaceutically acceptable solvent, if necessary.
  • a pharmaceutically acceptable carrier or medium such as sterilized water, physiological saline, vegetable oil, emulsifier, suspending agent, surfactant, stabilizer, adipate, vehicle, preservative, By unit dosage form.
  • the preparation may be administered orally or parenterally according to a conventional method, specifically, parenterally.
  • the parenteral administration includes local or systemic administration. Such topical administration may be by direct administration to the lesion or its vicinity, for example, directly to the lesioned brain or spinal cord, its periphery, or the opposite site.
  • the systemic administration includes administration to the spinal fluid, vein or artery.
  • the spinal fluid comprises cerebrospinal fluid.
  • the artery may be a site for supplying blood to a lesion.
  • the daily dose of the composition may be from 1 ng / kg to 100 g / kg, for example from 0.5 g / kg to 1 g / kg, depending on body weight.
  • the administration frequency can be administered once or several times.
  • the actual dose of the composition may be increased or decreased in consideration of various factors such as the disease to be treated, the severity of the disease, the route of administration, the weight of the patient, age and sex.
  • the dosage form of the composition may be used in a suitable combination as well as in combination with other pharmaceutically active compounds, either alone or in combination.
  • the above-mentioned triple or black ginseng extract when used as an additive for a health functional food, it can be used as it is, or it can be used together with other food or food ingredients, and can be suitably used according to a conventional method.
  • the amount of the active ingredient to be mixed may be suitably determined according to each use purpose such as prevention, health, or treatment.
  • Formulations of health functional foods may be in the form of powders, granules, pills, tablets, capsules, as well as in the form of ordinary foods or beverages.
  • examples of the food to which the above substance can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, , Various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and may include foods in a conventional sense.
  • the above-mentioned triplets or black ginseng extract may be added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on 100 parts by weight of the raw material.
  • the amount may be less than the above range.
  • the present invention uses fractions from natural products, there is no problem in terms of safety, Or more.
  • beverages may contain various flavors or natural carbohydrates as additional components such as ordinary beverages.
  • the above-mentioned natural carbohydrates may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol.
  • sweeteners include natural sweeteners such as tau martin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like.
  • the ratio of the natural carbohydrate may be about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the beverage according to the present invention.
  • composition may contain flesh for the production of natural fruit juices, fruit juice drinks and vegetable drinks. These components may be used independently or in combination.
  • the ratio of such additives is not limited, but is generally selected in the range of 0.01 to 0.1 parts by weight based on 100 parts by weight of the health functional food of the present invention.
  • compositions for increasing SirT6 comprising as an active ingredient a triple or black ginseng extract.
  • the contents of the above-mentioned triple or black ginseng extract are as described above.
  • the SirT6 has been known to have functions of DNA damage repair, metabolic homeostasis (glucose metabolism and lipid oxidation), inflammatory response, cell proliferation and various mechanisms of lifelong regulation.
  • the treatment of aged stem cells with either triple or black ginseng extracts showed increased expression of SirT6 protein.
  • the expression of SirT6 protein was significantly higher in aged cells than in young cells.
  • the composition of one embodiment can prevent aging by increasing the amount of protein expression of SirT6 in senescent cells.
  • Another aspect is a method of treating cells comprising treating a cell with a triple sheath or a black ginseng extract in vitro; Or SirT6 (Sirtuin 6) in a cell, or a method for increasing the expression or activity of SirT6 (Sirtuin 6) in a subject, which comprises administering a triple or black ginseng extract to an animal other than a human.
  • the contents of the above-mentioned triple or black ginseng extract are as described above.
  • the administration may be local or systemic administration.
  • it may be oral, rectal, intravenous, nasal, intraperitoneal, subcutaneous, or topical administration; topical administration may be, for example, administration to the lesion directly or around the lesion.
  • the administration may be administration of an effective amount to prevent or treat the disease. Such an effective amount can be easily selected by those skilled in the art depending on the condition of the disease to be selected.
  • the pharmaceutical composition of the present invention can be administered using any device capable of delivering an effective ingredient to a target cell.
  • the method for constructing an anti-aging effective factor includes a step of selecting a statistically significantly increased metabolite in human placental stem cells. Since the placental stem cell ability is excellent, stem cell depletion is prevented, Selection of anti-aging effective factors is easy. In addition, the triple or black ginseng extract has an excellent effect of preventing aging by changing the expression of the selected effective factor by the above method.
  • FIG. 1 is a graph showing cytotoxicity of microorganism strains of triplicate or black ginseng extract according to one embodiment.
  • FIG. 2 is a graph showing the anti-inflammatory activity of microorganism strains of triplicate or black ginseng extract according to one embodiment.
  • FIG. 3 is a graph showing Caspase 3 analysis in the microsomal cell line of the triple or black ginseng extract according to one embodiment.
  • FIG. 4 is a photograph showing the aging step of stem cells according to one embodiment.
  • FIG. 5 is a graph showing changes in the expression of senescence-related factors according to the aging stage of stem cells according to one embodiment.
  • FIG. 6 is a graph showing the results of analysis of antioxidant activity of stem cells or black ginseng extract in stem cells according to one embodiment.
  • FIG. 7 is a graph showing the influence of the aging marker P16 on the stem cells of triplets or black ginseng according to one embodiment.
  • FIG. 8 is a graph showing the influence of aging marker P21 on the stem cells of a triplex or a black ginseng according to an embodiment.
  • FIG. 9 is a diagram illustrating an effective metabolite screening process by stem cells according to an embodiment.
  • FIG. 10 is a diagrammatic representation of a method of constructing an interactive network according to one embodiment.
  • FIG. 11 is a graph showing an interaction network analysis result of a metabolite and a protein according to an embodiment.
  • FIG. 12 is a graph showing the effect of the triple or black ginseng extract on Sirt6 in stem cells according to one embodiment.
  • the lyophilized sample of frozen and dried black and white ginseng samples was dissolved in DPBS to be 1 g / ml at 60 ° C for 30 minutes, centrifuged at 1000 rpm for 3 minutes, and filtered to remove impurities.
  • the cytotoxicity of the triple and black ginseng samples was measured using the Ez-cytox cell viability assay kit based on Dozen's method. Specifically, a mouse brain-derived fine glial state BV2 cells to 96-well plates (Nunclon Surface, Denmark) in cell number 5 X 10 3 cell / well is to be dispensed by 10% FBS and 1% P / S penicillin / streptomycin ( Gibco) in DMEM high glucose medium for 24 hours at 37 ° C and 5% CO 2 . Subsequently, the samples were treated with concentrations (100 mg to 1 ng / ml) and cultured again at 37 ° C and 5% CO 2 for 12 hours.
  • the cells were treated with Ez-Cytox 10 ⁇ l / well for 2 hours, and the absorbance at 450 nm was measured.
  • the cell viability of the treated group was confirmed on the basis of the control group cultured in the absence of triplicate or black ginseng The results are shown in Fig.
  • LPS lipopolysaccharide
  • BV2 cells were seeded in a 6-well plate (FALCON) so that the number of cells became 1 ⁇ 10 5 cells / well and cultured at 37 ° C. and 5% CO 2 for 24 hours. Subsequently, the three-and three-sample cultures were further treated with concentrations (100 mg ⁇ 1 ng / ml) for additional 16 hours. After removing the culture medium, the culture medium was replaced with fresh DMEM medium, and LPS (lipopolysaccharide) (Sigma Aldrich, USA) (1 ⁇ M / mL) was treated and cultured for 6 hours to induce the inflammatory environment.
  • FALCON 6-well plate
  • RNA was isolated from the cultured cells by adding Trizol for 3 minutes, adding chloroform, and centrifuging at 12,000 rpm for 15 minutes. Next, the supernatant was collected, mixed with isopropanol, and precipitated by centrifugation at 12,000 rpm for 15 minutes. The supernatant was dissolved in 100 ⁇ l of DEPC (diethyl pyrocarbonate) -DW and used for RT-PCR. 1 ⁇ g of RNA was reacted with cDNA using Oligo dT Primer (Intron, Korea) at 45 ° C for 60 minutes and 95 ° C for 5 minutes.
  • DEPC diethyl pyrocarbonate
  • FIG. 1 is a graph showing cytotoxicity of microorganism strains of triplicate or black ginseng extract according to one embodiment.
  • FIG. 2 is a graph showing the anti-inflammatory activity of microorganism strains of triplicate or black ginseng extract according to one embodiment.
  • FIG. 3 is a graph showing Caspase 3 analysis in the microsomal cell line of the triple or black ginseng extract according to one embodiment.
  • Caspase 3 which is a cell death enzyme, was inhibited when the triple and black ginseng samples were treated.
  • the triple or black ginseng extract had no cytotoxicity in microglial cell line, and had anti - inflammatory activity and cell death inhibitory effect.
  • Human placenta - derived stem cells were used to culture placenta - derived stem cells. Specifically, stem cells isolated from human placenta were cultured in a culture medium containing 10% FBS, 1% penicillin / streptomycin, 1 ⁇ g / ml heparin, 25 ng / ml fibroblast growth factor-4 (FGF4) -MEM medium at 37 ° C and 5% CO 2 incubation. Stem cells were counted at 6000 to 7000 cells per cm < 2 > and cultured for about 3 to 4 days while changing the medium every other day.
  • FGF4 fibroblast growth factor-4
  • the stem cells are 80% or more in the flask, the cells are washed with phosphate buffered saline (PBS), treated with 0.25% trypsin / EDTA for 2 min, and then the fetal bovine serum After centrifugation at 1,200 rpm for approximately 5 minutes, the supernatant was removed and cells were harvested. The harvested cells were counted again at 6000 to 7000 cells per cm < 2 > and subcultured in the same manner. In the subsequent experiments, these stem cells were used.
  • PBS phosphate buffered saline
  • culturing is started separately from human, and early stages of P1 to P5, which are cell stabilization periods, followed by periods where cell proliferation is active, for example, middle stage of cultured cells of P7, aging starts with a decrease in cell proliferation rate
  • the point of time is defined as the Late step.
  • the aged cells can be identified by the presence of ⁇ -galactosidase activity, which can be detected at pH 6.0 in aged cells in the campisi lab, and the method for measuring the activity of ⁇ -galactosidase is an easy and clear method Is widely used.
  • the activity of ⁇ -galactosidase can be determined by observing the reaction of the enzyme that degrades x-gal by blue staining after adding a PBS of pH 6.0 containing x-gal to the cultured cells for a predetermined period of time. Is useful for identification of senescent cells as it shows a positive reaction not only in the senescence of the cultured cells but also in the cells in the tissues.
  • PCNA known as a cell proliferative factor
  • SirT1 an anti - senescence factor
  • P53 an aging marker
  • PCNA, SirT1, P53, and GAPDH antibodies were reacted overnight at 4 ° C and HRP-conjugated secondary And reacted with the antibody at room temperature for 1 hour.
  • the immune response was measured using an ECL Western blotting system (Millipore) and an Ez-Capture MG (ATTO) instrument, and the results are shown in FIG.
  • FIG. 5 is a graph showing changes in the expression of senescence-related factors according to the aging stage of stem cells according to one embodiment.
  • Example 2.2 Based on the results of Example 2.2, it was confirmed that the triple and black ginseng extract had antioxidative activity in stem cells.
  • FIG. 6 is a graph showing the results of analysis of antioxidant activity of stem cells or black ginseng extract in stem cells according to one embodiment.
  • the proliferation factor PCNA decreased protein expression in senescent stem cells but increased expression in cells treated with triplicate and black ginseng.
  • the expression of SirT1 protein, an anti-senescence factor, in senescent stem cells was decreased, but the expression of SirT1 protein was increased in tuberous and black ginseng-treated cells.
  • P53 which is increased in senescent stem cells, .
  • Real-time PCR was performed using a SYBR-green (enzynomics) reaction kit using a CFX Connect (Bio-rad) instrument according to the manufacturer's instructions and the target gene expression values were normalized corresponding to the housekeeping gene (RPL22).
  • FIG. 7 is a graph showing the influence of the aging marker P16 on the stem cells of triplets or black ginseng according to one embodiment.
  • FIG. 8 is a graph showing the influence of aging marker P21 on the stem cells of a triplex or a black ginseng according to an embodiment.
  • Stem cells are cells that are active in cell proliferation, and cells that actively differentiate between P1 and P20 are called young cells.
  • the young cells secrete a number of factors that are involved in the developmental stage of the culture and secrete a number of factors that are effective in regenerating senescence and damage. Therefore, it is a suitable time to select the anti-aging effective factor candidates related to cell proliferation, differentiation and regeneration, which are opposite to aging.
  • the metabolite of the stem cells secreted by the stem cells was compared with the control group without the secretion of the tubercle cells, and then the metabolite analysis was performed. Then, the candidates of the effective factors related to the cell proliferation were selected using the public database.
  • the human placenta-derived stem cells were cultured in confluency at a concentration of 80 to 90% for the selection of a candidate effective factor through analysis of samples and quantitative statistical analysis of the stem cells prepared in Example 2.2. Lt; / RTI > Thereafter, the cells were cultured in? -MEM supplemented with IxP / S for 24 hours to obtain a culture solution containing factors secreted from the stem cells. The resulting culture was centrifuged and filtered to completely remove the cells, and lyophilized to obtain a stem cell culture fluid. ⁇ -MEM supplemented with 1 ⁇ P / S was used as a control for stem cell culture. After that, as shown in FIG. 8, an effective metabolite analysis was carried out.
  • FIG. 9 is a diagram illustrating an effective metabolite screening process by stem cells according to an embodiment.
  • a lyophilized powdered stem cell culture solution was dissolved in distilled water at a concentration of 10 mg / ml to prepare a sample for mass spectrometry.
  • ⁇ -MEM powder was dissolved in distilled water at a concentration of 10 mg / ml.
  • Samples were analyzed by LC-MS (liquid chromatography-mass spectrometry) method and positive mode was used.
  • LC-MS raw data was analyzed using xcms and CAMERA package (bioconductor) using R-program.
  • the peak of the LC-MS raw data was selected using the matchedFilter algorithm provided in the xcms package and annotated the pseudospectra and isotope of the raw data using the CAMERA package. Subsequently, metabolic mass information was retrieved from the human metabolite database (http://www.hmdb.ca/) and matched with the analyzed LC-MS data. The LC-MS data was estimated with neutral mass in consideration of isotope, adduct, etc., and had an m / z error of 0.005 or less. Statistical analysis was performed using only annotated features of the metabolites. Only metabolites increased in the stem cell culture were selected statistically using the welch's t-test. The results are shown in Table 3 below.
  • An interaction network was established by examining proteins known to interact with statistically significantly increased metabolites in the culture medium containing the factors secreted from the stem cells of Example 3.1. Specifically, the subnetwork is configured as shown in FIG.
  • FIG. 10 is a diagrammatic representation of a method of constructing an interactive network according to one embodiment.
  • the interaction between the metabolite and the protein was carried out by invoking the interaction information between the metabolites and the enzyme registered in the KEGG reaction database. Enzymes predicted to interact with metabolites are assumed to be involved in a specific metabolic pathway and affect metabolic pathways through interaction with matched metabolites.
  • the DAVID https: //david.ncifcrf
  • a subnetwork was constructed by re-extracting an enzyme associated with cell proliferation and a metabolite expected to react with the enzyme, and the result was shown in Fig. 11 Respectively.
  • FIG. 11 is a graph showing an interaction network analysis result of a metabolite and a protein according to an embodiment.
  • candidate effective factors that are influenced by stem cell metabolism and expected to participate in cell proliferation were derived.
  • Sirt6 an aging-related candidate factor derived from Examples 3.1 and 3.2, was analyzed for the effect of Sambach or black ginseng extract.
  • FIG. 12 is a graph showing the effect of Satsuma mandarin or black ginseng extract on Sirt6 in stem cells according to one embodiment.
  • Sirt6 together with SirT1, is known to be an anti-aging factor related to cell proliferation and aging. As shown in FIG. 12, it was found that the expression of Sirt6 was increased in senescent cells treated with triplicate and black ginseng compared to senescent cells with less Sirt6 expression. Especially, black ginseng showed higher expression than young cells. As a result, the Sirt6 gene was found to be an effective anti - senescence - regulating factor regulated by Sirt1 or black ginseng.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Medical Informatics (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Botany (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Food Science & Technology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

줄기세포를 이용한 노화 조절 유효인자 구축 방법, 및 그를 이용하여 노화 조절 물질을 스크리닝 하는 방법, 및 그에 의해 도출된 항노화 물질(삼채 또는 흑삼채 추출물)에 관한 것으로서, 줄기세포의 고갈이 방지될 수 있으므로, 항노화 유효인자의 선별이 용이하다. 또한, 삼채 또는 흑삼채 추출물은 상기 방법에 의해 선별된 유효인자의 발현을 변화시키는 바, 노화 방지에 탁월한 효과가 있다.

Description

줄기세포를 이용한 노화 조절 유효인자 구축 방법, 및 그를 이용하여 노화 조절 물질을 스크리닝 하는 방법, 및 그에 의해 도출된 항노화 물질
줄기세포를 이용한 노화 조절 유효인자 구축 방법, 및 그를 이용하여 노화 조절 물질을 스크리닝 하는 방법, 및 그에 의해 도출된 항노화 물질(삼채 또는 흑삼채 추출물)에 관한 것이다.
우리 몸은 항상 일정한 상태를 유지하고자 한다. 그러나, '노화'를 거치면서 항상성이 깨지기 시작하는데, 여기서 노화란 병적인 조건과 상태를 이겨낼 수 없게 인체의 각 요소가 퇴화하는 것을 의미한다. 노화가 진행되면 체내 단백질 수치가 감소하고 에너지 대사를 변화시키며 DNA에 손상을 입게 된다. 즉, 체내 호르몬 양에 변화가 생겨 세포 노화가 진행되고, 조직의 재생 능력이 감소하므로 인체의 항상성을 유지하는 능력이 감소하게 된다. 따라서, 인체 조직의 재생능력을 되돌리고 항상성을 유지하기 위해 줄기세포 활성에 영향을 주는 건강 보조 식품을 통해 체내 줄기세포의 노화를 방지하는 것이 답이 될 수 있다. 최근 들어, '안티에이징(anti-aging)'에 대한 관심이 증대하면서 노화를 방지하고자 줄기세포를 이용한 항노화 제품이 새롭게 떠오르고 있다. 따라서, 줄기세포 항노화 제품은 단순히 화장품과 같이 얼굴의 노화만 막아주는 것이 아니라, 신체의 노화 및 무기력한 삶에 에너지를 불어넣는 치료로서 한층 젊어지고 건강한 일상을 만들어 주는 노화 대응책이 될 수 있을 것이다.
일 양상은 줄기세포를 이용한 노화 조절 유효인자 구축 방법을 제공하는 것이다.
다른 양상은 줄기세포를 이용한 노화 조절 물질을 스크리닝하는 방법에 관한 것이다.
또 다른 양상은 삼채 또는 흑삼채 추출물을 유효성분으로 포함하는 항노화 또는 항염증용 조성물을 제공하는 것이다.
또 다른 양상은 삼채 또는 흑삼채 추출물을 유효성분으로 포함하는 조성물의 치료학적 유효량을 환자에게 투여하는 단계를 포함하는 노화 또는 염증을 예방, 치료 또는 개선시키는 방법을 제공하는 것이다.
또 다른 양상은 노화 또는 염증을 예방, 치료 또는 개선시키기 위한 약제의 제조를 위한, 삼채 또는 흑삼채 추출물을 유효성분으로 포함하는 조성물의 용도를 제공하는 것이다.
또 다른 양상은 삼채 또는 흑삼채 추출물을 유효성분으로 포함하는 Sirt6(Sirtuin6) 증가용 조성물을 제공하는 것이다
또 다른 양상은 삼채 또는 흑삼채 추출물을 세포에 처리하거나, 개체에 투여하는 단계를 포함하는 세포 내 또는 개체 내의 Sirt6의 발현 또는 활성을 증가시키는 방법을 제공하는 것이다.
일 양상은 줄기세포의 배양액을 수득하는 단계; 상기 수득된 줄기세포의 배양액에 대해 LC-MS(Liquid chromatography-mass spectrometry) 분석을 수행하여 상기 줄기세포의 배양액에 대한 LC-MS 데이터를 획득하는 단계; 상기 획득된 LC-MS 데이터를 인간 대사체 데이터베이스의 질량 정보와 매칭하는 단계; 및 상기 매칭 결과, 줄기세포 배양액에서 통계적으로 유의하게 증가한 대사체를 선별하는 단계를 포함하는 줄기세포를 이용한 항노화 유효인자를 구축하는 방법을 제공한다.
본 명세서에서 용어 "줄기세포(stem cell)"는 여러 종류의 신체 조직으로 분화할 수 있는 능력을 가진 미분화 세포로서, 일 구체예에서는 인간 태반으로부터 줄기세포를 추출하였는 바, 중간엽 줄기세포(mesenchymal stem cell)의 의미한다. 또한, 상기 줄기세포는 계대 1(passage 1) 내지 계대 100의 줄기세포일 수 있다. 구체적으로, 상기 줄기세포는 계대 1 내지 계대 30의 성체줄기세포(adult stem cell)일 수 있고, 계대 1 내지 계대 100의 배아줄기세포(embryonic stem cell)일 수 있다. 또한, 상기 줄기세포는 골수, 제대혈, 골수, 혈액 또는 지방에서 추출해낸 것일 수 있다.
또한, 일 구체예의 방법은 상기 선별된 대사체와 단백질 사이의 상호작용 정보를 획득하는 단계; 상기 대사체와 단백질 상호작용 정보에서 선택된 단백질의 리스트에 ORA(Over-representation analysis) 분석을 통해 통계적으로 유의하게 상호작용 네트워크 상의 단백질이 모이는 대사 경로를 확인하는 단계; 및 상기 대사 경로 중, 세포 증식 또는 세포 노화와 관련된 단백질과, 상기 단백질과 반응할 것으로 예상되는 대사체를 선별하는 단계를 포함할 수 있다. 구체적으로, 상기 대사체를 선별하는 단계는 상기 대사체의 생물학적 기능을 중심으로 선별되는 것일 수 있다. 이때, 상기 생물학적 기능은 생물학적 경로분석 방법을 이용하여 상기 대사체 및 단백질 상호작용에서 획득한 정보로부터 상기 대사체와 상호작용할 것으로 예상되는 단백질의 생물학적 기능을 확인함으로써 획득할 수 있다. 예를 들어, Sirtuin6 (SirT6) 단백질은 줄기세포 유래 대사체에 영향을 받을 것으로 예상되면서, 세포 증식(cell proliferation)을 포함하여 항노화에 관여하는 단백질에 해당된다. 또한, 상기 선별된 대사체와 상호작용이 예측되는 단백질은 특정 대사경로에 속하는 것으로서, 단백질과의 상호작용을 통하여 대사 경로에 영향을 끼칠 수 있다.
본 명세서에서 용어 "항노화 유효인자"는 항노화 관련 유전자를 의미하며, 상기 유전자의 발현을 증가 또는 감소시킴으로써 여러 가지 스트레스에 대한 저항성을 높일 수 있는 바, 항노화 활성을 갖는다. 상기 항노화 유효인자는 하기 표 3에 기재된 유전자 군으로부터 선택된 어느 하나 일 수 있다:
[표 3]
Figure PCTKR2018016978-appb-I000001
또한, 상기 항노화 유효인자는 삼채 또는 흑삼채 추출물을 처리한 노화 세포에서 발현이 증가할 수 있다. 즉, 삼채 또는 흑삼채 추출물은 노화 세포에서 항노화 유효 인자의 발현을 증가시킴으로써, 항노화 활성을 가짐을 알 수 있다.
다른 양상은 줄기세포의 배양액을 수득하는 단계; 상기 수득된 줄기세포의 배양액에 대해 LC-MS(Liquid chromatography-mass spectrometry) 분석을 수행하여 상기 줄기세포의 배양액에 대한 LC-MS 데이터를 획득하는 단계; 상기 획득된 LC-MS 데이터를 인간 대사체 데이터베이스의 질량 정보와 매칭하는 단계; 상기 매칭 결과 통계적으로 유의하게 줄기세포 배양액에서 증가한 대사체를 선별하는 단계; 상기 선별된 대사체가 후보 물질이 처리된 줄기세포에서 대조군 대비 변화하는지 여부를 확인하는 단계; 및 상기 후보 물질이 대조군 대비 상기 선별된 대사체를 변화시키는 경우 노화 조절 물질로 선별하는 단계를 포함하는 줄기세포를 이용한 노화 조절 물질을 스크리닝 하는 방법을 제공한다.
일 구체예의 방법은 후보 물질을 처리 후 세포 내 하기 표 3에 기재된 유전자 군으로부터 선택된 어느 하나 이상의 유전자의 발현이 조절되는지 확인하는 단계를 추가로 포함할 수 있다:
[표 3]
Figure PCTKR2018016978-appb-I000002
일 실시예에서는, 삼채 또는 흑삼채 추출물을 처리한 노화 세포에서 SirT6 유전자의 발현이 대조군에 비해 유의적으로 증가함을 확인하였다. 즉, 삼채 또는 흑삼채 추출물은 줄기세포 유래 대사체와 상호작용을 할 것으로 예상되는 SirT6 유전자의 발현을 변화시키는 바, 노화 조절 물질임을 알 수 있다.
다른 양상은 삼채 또는 흑삼채 추출물을 유효성분으로 포함하는 항노화 또는 항염증용 조성물을 제공한다. 상기 조성물은 약학적 조성물 또는 건강기능성 식품 조성물일 수 있다.
본 명세서에서 용어 "항노화"란 세포 또는 개체의 노화를 지연 또는 방지하거나, 노화된 세포(senescent cell)를 그보다 젊은 세포(young cell)로 전환시키는 것을 포함한다. 구체적으로 "세포의 노화(senescence of cell)"는 표준 세포(reference cell)에 비하여 세포 증식능의 감소, PCNA 또는 SirT1 단백질의 발현 감소, P53 단백질의 발현 증가, P16 및 P21 유전자의 발현 증가 중 하나 이상을 포함하는 것을 나타낸다. "젊은 세포"란 표준 세포에 비하여 세포 증식능의 증가, PCNA 또는 SirT1 단백질의 발현 증가, P53 단백질의 발현 감소, P16 및 P21 유전자의 발현 감소 중 하나 이상을 포함하는 것을 나타낸다.
구체적으로, 상기 조성물은 노화와 연관된 증상의 치료를 위한 것일 수 있다. 이때, 상기 노화와 연관된 증상은 피부주름, 상처 재생 저하, 근감소증, 조기노화증(Hutchinson-Gilford progeria syndrome), 기억력 저하, 근육 저하, 또는 그 조합인 것일 수 있다.
또한, 본 명세서에서 용어, "항염증"이란 염증 유도된 세포에서의 염증유도 인자(pro-inflammatory factor)의 조절 및 염증 억제 인자(anti-inflammatory factor)의 조절 효능 여부를 통해 염증 유도를 방지하거나, 염증 억제를 증진시키는 것을 포함한다. 일 실시예에서는 삼채 또는 흑삼채 추출물과 함께 배양된 세포에 LPS로 염증 유도한 결과, 대조군에 비하여 inducible nitric oxide synthase (iNOS), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6)의 발현이 감소하였고, interleukin-10(IL-10), Transforming growth factor-β(TGF-β)의 발현이 증가하였음을 확인하였다.
상기 조성물은 유효성분인 삼채 또는 흑삼채 이외에 약학적으로 허용되는 첨가제를 추가로 포함할 수 있으며, 약학적 분야에서 통상의 방법에 따라 환자의 신체 내 투여에 적합한 단위 투여형의 제제로 제형화시킬 수 있다. 이러한 목적에 적합한 제형으로는 경구투여 제제를 포함하며, 비경구투여 제제로서 주사제 또는 국소 투여용 제제 등이 포함된다. 예를 들면, 필요에 따라서 물 혹은 그 이외의 약제학적으로 허용할 수 있는 용매를 사용한 무균성 용액 또는 현탁액제의 주사제의 형태로 비경구적으로 사용할 수 있다. 예를 들면, 약제학적으로 허용되는 담체 혹은 매체, 예를 들어 멸균수, 생리식염수, 식물유, 유화제, 현탁제, 계면활성제, 안정제, 부형체, 비히클, 방부제, 결합제 등과 적당히 조합하여, 일반적으로 인정되는 단위 용량 형태로 혼화하는 것에 의해 제제화할 수 있다. 상기 제제는 통상의 방법에 따라 경구 또는 비경구적으로 투여될 수 있으며, 구체적으로는 비경구적으로 투여될 수 있다. 상기 비경구 투여는 국부적 또는 전신적 투여를 포함한다. 상기 국부적 투여는, 직접적으로 병변 또는 그 주변에 투여하는 것, 예를 들면 병변인 뇌 또는 척수, 그 주변 또는 그 반대쪽 부위에 직접 투여하는 것일 수 있다. 상기 전신적 투여는 척수액, 정맥 또는 동맥에 투여하는 것을 포함한다. 상기 척수액은 뇌척수액을 포함한다. 상기 동맥은 병변에 혈액을 공급하는 부위일 수 있다. 상기 조성물의 1일 투여량은 체중에 따라 1 ng/㎏ 내지 100 g/㎏, 예를 들면 0.5 g/㎏ 내지 1 g/㎏일 수 있다. 투여 횟수는 1회 또는 수회로 나누어 투여할 수 있다. 상기 조성물의 실제 투여량은 치료하고자 하는 질환, 질환의 중증도, 투여 경로, 환자의 체중, 연령 및 성별 등의 여러 관련 인자를 고려하여 증감이 가능하다. 상기 조성물의 투여 형태는 조성물의 투여 형태는 단독으로 또는 다른 약학적 활성 화합물과 결합뿐만 아니라 적당한 집합으로 사용될 수 있다. 또한 포유동물에 투여된 후 활성 성분의 신속, 지속 또는 지연된 방출을 제공할 수 있도록 당업계에 잘 알려진 방법을 사용하여 약학적 제형으로 제조될 수 있다. 제형의 제조에 있어서, 활성 성분을 담체와 함께 혼합 또는 희석하거나, 용기 형태의 담체 내에 봉입시키는 것이 바람직하다.
건강기능식품에 있어서, 상기 삼채 또는 흑삼채 추출물을 건강기능식품의 첨가물로 사용하는 경우 이를 그대로 첨가하거나 다른 식품 또는 식품성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효 성분의 혼합양은 예방, 건강 또는 치료 등의 각 사용 목적에 따라 적합하게 결정할 수 있다.
건강기능식품의 제형은 산제, 과립제, 환, 정제, 캡슐제의 형태뿐만 아니라 일반 식품 또는 음료의 형태 어느 것이나 가능하다.
상기 식품의 종류에는 특별히 제한은 없고, 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 쵸콜렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 식품을 모두 포함할 수 있다.
일반적으로, 식품 또는 음료의 제조시에 상기 삼채 또는 흑삼채 추출물은 원료 100 중량부에 대하여 15 중량부 이하, 바람직하게는 10 중량부 이하의 양으로 첨가할 수 있다. 그러나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있으며, 또한 본 발명은 천연물로부터의 분획물을 이용하는 점에서 안전성 면에서 문제가 없으므로 상기 범위 이상의 양으로도 사용할 수 있다.
상기 건강기능식품 중 음료는 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로 함유할 수 있다. 상술한 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드, 말토스, 슈크로스와 같은 디사카라이드 및 덱스트린, 사이클로덱스트린과 같은 폴리사카라이드, 자일리톨, 소르비톨, 에리트리톨 등의 당알콜일 수 있다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명에 따른 음료 100 mL당 약 0.01 ~ 0.04 g, 바람직하게는 약 0.02 ~ 0.03 g일 수 있다.
상기 외에 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산음료에 사용되는 탄산화제를 함유할 수 있다. 그 밖에 상기 조성물은 천연 과일쥬스, 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 혼합하여 사용할 수 있다. 이러한 첨가제의 비율은 제한되지 않으나 본 발명의 건강기능식품 100 중량부 대비 0.01 ~ 0.1 중량부의 범위에서 선택되는 것이 일반적이다.
다른 양상은 삼채 또는 흑삼채 추출물을 유효성분으로 포함하는 SirT6(Sirtuin6) 증가용 조성물을 제공한다. 상기 삼채 또는 흑삼채 추출물의 구체적인 내용은 전술한 바와 같다.
상기 SirT6는 DNA damage repair, 대사항상성 조절 (포도당 대사 및 지방대 사), 염증반응 조절, 세포 증식 및 다양한 수명관련 기전 조절의 기능을 갖고 있는 것으로 알려져 있으며, Sirtuin 멤버들 중 특히 노화 및 노화 관련 질환과의 밀접한 연관성을 나타내는 단백질이다. 일 실시예에서는 노화된 줄기세포에 삼채 또는 흑삼채 추출물을 처리한 결과, SirT6 단백질의 발현이 증가한 것을 확인할 수 있었다. 특히, 흑삼채를 처리한 경우, 노화된 세포에서 젊은 세포보다 SirT6 단백질의 발현이 유의적으로 높은 것을 확인할 수 있었다. 따라서, 일 구체예의 조성물은 노화 세포에서 SirT6의 단백질 발현량을 증가시킴으로써, 노화 방지를 방지할 수 있다.
다른 양상은 인 비트로(in vitro)에서 삼채 또는 흑삼채 추출물을 세포에 처리하는 단계; 또는 삼채 또는 흑삼채 추출물을 인간을 제외한 동물에 투여하는 단계를 포함하는 세포 내 또는 개체 내 SirT6(Sirtuin 6)의 발현 또는 활성을 증가시키는 방법을 제공한다. 상기 삼채 또는 흑삼채 추출물의 구체적인 내용은 전술한 바와 같다.
상기 투여는 국소 또는 전신 투여일 수 있다. 예를 들면, 경구, 직장, 정맥, 비강, 복강, 피하 또는 국소 투여일 수 있으며, 국소 투여는 예를 들면 병변에 직접, 또는 병변 주위에 투여 일 수 있다. 상기 투여는 상기 질환을 예방 또는 치료하기 위한 유효량을 투여하는 것일 수 있다. 이러한 유효한 양은 선택되는 질환의 조건에 따라 당업자가 용이하게 선택할 수 있다. 또한, 본 발명의 약학적 조성물은 유효성분을 표적 세포로 전달할 수 있는 임의의 장치를 이용해 투여될 수 있다.
일 양상에 따른 항노화 유효인자를 구축하는 방법은 인간 태반 줄기세포에서 통계적으로 유의하게 증가한 대사체를 선별하는 단계를 포함하는 것으로서, 상기 태반의 줄기세포 능력이 뛰어나 줄기세포의 고갈이 방지되므로, 항노화 유효인자의 선별이 용이하다. 또한, 삼채 또는 흑삼채 추출물은 상기 방법에 의해 선별된 유효인자의 발현을 변화시키는 바, 노화 방지에 탁월한 효과가 있다.
도 1은 일 구체예에 따른 삼채 또는 흑삼채 추출물의 미세교세포주에서의 세포독성을 분석한 그래프이다.
도 2는 일 구체예에 따른 삼채 또는 흑삼채 추출물의 미세교세포주에서의 항염증 활성을 분석한 그래프이다.
도 3은 일 구체예에 따른 삼채 또는 흑삼채 추출물의 미세교세포주에서의 Caspase 3를 분석한 그래프이다.
도 4는 일 구체예에 따른 줄기세포의 노화 단계를 나타낸 사진이다.
도 5는 일 구체예에 따른 줄기세포의 노화 단계에 따른 노화 관련 인자의 발현 변화를 나타낸 그래프이다.
도 6은 일 구체예에 따른 삼채 또는 흑삼채 추출물의 줄기세포에서의 항노화 효능을 분석한 결과이다.
도 7은 일 구체예에 따른 삼채 또는 흑삼채의 줄기세포에서의 노화 마커 P16에의 영향을 나타낸 그래프이다.
도 8은 일 구체예에 따른 삼채 또는 흑삼채의 줄기세포에서의 노화 마커 P21에의 영향을 나타낸 그래프이다.
도 9은 일 구체예에 따른 줄기세포에 의한 유효 대사체 선별 과정을 도식화하여 나타낸 도면이다.
도 10은 일 구체예에 따른 상호작용 네트워크 구축의 방법을 도식화하여 나타낸 도면이다.
도 11은 일 구체예에 따른 대사체와 단백질의 상호작용 네트워크 분석결과를 나타낸 도면이다.
도 12은 일 구체예에 따른 삼채 또는 흑삼채 추출물의 줄기세포에서의 Sirt6에 미치는 영향을 나타낸 그래프이다.
이하 본 발명을 실시예에 의해 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 의해 제한되는 것은 아니다.
실시예 1. 삼채 및 흑삼채의 미세교세포주를 이용한 효능 분석
본 명세서의 실시예에 있어서, 삼채 및 흑삼채는 ㈜다움푸드앤케어로부터 동결 건조된 샘플을 제공받아 사용하였다. 미세교세포주에서 삼채 및 흑삼채의 항염증 또는 항산화 효능을 분석은 다음과 같이 수행하였다.
먼저, 삼채 및 흑삼채 동결건조 샘플을 1 g/㎖가 될 수 있게 DPBS 넣고 60℃에 30분간 녹이며, 1000 rpm에서 3분간 원심분리 한 후 필터를 통해 불순물을 제거하여 사용하였다.
삼채 및 흑삼채 시료에 대한 세포독성은 Dozen사의 방법에 기준하여 Ez-cytox cell viability assay kit를 이용하여 측정하였다. 구체적으로, 마우스 뇌 유래 미세교세포주 BV2 세포를 96-웰 플레이트(Nunclon Surface, Denmark)에 세포수가 5 X 103 cell/well이 되게 분주하여 10% FBS와 1% P/S페니실린/스트렙토마이신(Gibco)을 포함한 DMEM 고글루코오스 배지(high glucose medium) 배지에서 37℃, 5% CO2 조건하에 24시간 배양하였다. 이후에, 시료를 농도별 (100 ㎎ ~ 1 ng/㎖)로 처리하여 다시 12시간 동안 37℃, 5% CO2 조건하에서 배양하였다. 다음으로, Ez-Cytox 10 ㎕/well 처리하여 2 시간 반응 시킨 후 450 nm 흡광도 변화를 측정하였고, 삼채 및 흑삼채 처리되지 않은 조건에서 배양한 대조군을 기준으로 처리군의 세포생존율을 확인 하였으며, 그 결과를 도 1에 나타내었다.
삼채 및 흑삼채 시료에 대한 항염증 활성 분석을 위해, 면역세포주인 미세교세포주에 삼채 또는 흑삼채 추출물이 포함된 배지에 배양 후 염증 환경 유도를 위해 LPS(lipopolysaccharide)(Sigma Aldrich, USA)를 처리하고, quantitative polymerase chain reaction (qPCR)을 통해 염증관련 인자인 iNOS(inducible nitric oxide synthase), TNF-α(tumor necrosis factor-α), IL-1β(interleukin-1β), IL-6(interleukin-6), 및 카스파아제 3(Caspase 3)를 확인하였다.
구체적으로, BV2 세포를 6-웰 플레이트(FALCON)에 세포수가 1 X 105 cell/well이 되게 분주하여 37℃, 5% CO2 조건하에 24시간 배양하였다. 이후에, 삼채 및 흑삼채 시료 배양액를 농도별 (100 ㎎ ~ 1 ng/㎖)로 처리하여 16시간 동안 추가적으로 배양하였다. 배양액을 제거한 후 새로운 DMEM 배지로 교환하여 LPS(lipopolysaccharide)(Sigma Aldrich, USA)(1 μM/mL)를 처리하고 6시간 동안 배양하여 염증 환경을 유도하였다. 이후에, 배양세포로부터 RNA 분리는 트리졸(Trizol)을 넣고 3분 동안 방치한 후 클로로포름(chloroform)을 넣고 12,000 rpm에서 15분간 원심분리 하였다. 다음으로, 상층액을 얻어 이소프로판올(isopropanol)을 혼합하여 12,000 rpm에서 15분간 원심분리 하여 침전시킨 후 DEPC (diethyl pyrocarbonate)-DW 100 ㎕에 녹여 RT-PCR에 사용하였다. 1 ㎍의 RNA를 Oligo dT Primer (Intron, Korea)를 이용하여 45℃에서 60분, 95℃에서 5분간 반응시켜 cDNA로 역전사 하였다. 이후에, PCR kit (Bioneer, Korea)와 PCR machine (Bioneer, ExicyclerTM 96 Real-Time Quantitative Thermal Block, Korea)을 사용하여 유전자 발현 레벨을 분석하였고, 각각의 프라이머 염기서열을 하기 표 1에 나타내었으며, 그 결과를 도 2 및 도 3에 나타내었다.
유전자 프라이머 서열
iNOS 정방향(서열번호 1) CACCTTGGAGTTCACCCAGT
역방향(서열번호 2) ACCACTCGTACTTGGGATGC
TNF-α 정방향(서열번호 3) GCTCCAGTGAATTCGGAAAG
역방향(서열번호 4) GATTATGGCTCAGGGTCCAA
IL-1β 정방향(서열번호 5) CTGTTCTGTGTAATGAAAGACGG
역방향(서열번호 6) GCTCTGCTTGTGAGGTGCTGA
IL-6 정방향(서열번호 7) TTCCATCCAGTTGCCTTCTT
역방향(서열번호 8) ATTTCCACGATTTCCCAGAG
caspase3 정방향(서열번호 9) CTTCTTCAGAGGCGACTACTGCC
역방향(서열번호 10) CCAGGAATAGTAACCAGGTGCTG
TGF-β 정방향(서열번호 11) ACCAACTATTGCTTCAGCTC
역방향(서열번호 12) GGGTTGTGTTGGTGTAGAG
IL-10 정방향(서열번호 13) CAGTGGAGCAGGTGAAGAGTG
역방향(서열번호 14) CAAGGAGTTGTTTCCGTTAGC
GAPDH 정방향(서열번호 15) TCACTGCCACCCAGAAGA
역방향(서열번호 16) GACGGACACATTGGGGGTAG
도 1은 일 구체예에 따른 삼채 또는 흑삼채 추출물의 미세교세포주에서의 세포독성을 분석한 그래프이다.
도 2는 일 구체예에 따른 삼채 또는 흑삼채 추출물의 미세교세포주에서의 항염증 활성을 분석한 그래프이다.
도 3은 일 구체예에 따른 삼채 또는 흑삼채 추출물의 미세교세포주에서의 Caspase 3를 분석한 그래프이다.
도 1에 나타낸 바와 같이, 삼채, 흑삼채 두 시료 모두 농도에 따른 세포 생존율이 정상 대조군에 비해 감소를 보이지 않아 세포독성이 나타나지 않는 것으로 확인하였다.
또한, 도 2에 나타낸 바와 같이, 삼채 및 흑삼채 시료를 처리 하였을 때, 농도에 따라 대조군 대비 염증 유도 인자가 감소하고, 염증 억제 인자는 증가하는 경향을 나타내었다.
또한, 도 3에 나타낸 바와 같이, 삼채 및 흑삼채 시료를 처리하였을 때, 세포 사멸 효소인 Caspase 3가 억제되는 것을 알 수 있었다.
이상의 결과로, 삼채 또는 흑삼채 추출물은 미세교세포주에서 세포독성이 없으며, 항염증 활성 및 세포 사멸 억제 효능이 있음을 알 수 있었다.
실시예 2. 줄기세포를 이용한 항노화 또는 항산화 활성 분석
2.1. 줄기세포의 배양
태반 유래 줄기세포를 배양하기 위하여 인간 태반에서 분리한 인간 줄기세포를 사용하였다. 구체적으로, 인간 태반에서 분리한 줄기세포를 10% FBS, 1% penicillin/streptomycin, 1㎍/㎖ 헤파린, 25ng/㎖의 섬유아세포성장인자-4(fibroblast growth factor-4, FGF4)가 첨가된 alpha-MEM 배지를 사용하여 37℃, 5% CO2 배양 조건에서 배양하였다. 줄기세포는 ㎠당 6000 내지 7000 세포를 계수하여 접종하고, 이틀에 한 번씩 배지를 교체하면서 약 3~4일 정도 배양하였다. 플라스크에 줄기세포가 80% 이상 자라면 인산완충액(phosphate-buffered saline, PBS)을 사용하여 세척한 후, 0.25%의 트립신/EDTA를 이용해 2분간 효소 처리한 다음, 소 태아혈청을 가하여 효소반응을 정지시키고, 1,200rpm에서 약 5분 동안 원심 분리한 뒤 상층액을 제거하여 세포들을 수확하였다. 수확된 세포는 다시 ㎠당 6000 내지 7000 세포로 계수하여 동일한 방법을 계대배양을 수행하였고, 이후의 실험에서 이 줄기세포를 사용하였다.
2.2. 줄기세포의 노화 관련 인자 분석
먼저 줄기세포에서의 항노화 인자를 확인하기 위해, 상기 실시예 2.1.의 줄기세포를 3개의 단계로 나누어 노화 관련 마커의 발현을 확인하였다.
구체적으로, 인간으로부터 분리하여 배양을 시작하여 세포 안정화 시기인 P1~P5을 Early 단계, 이후 세포 증식이 활발한 시기, 예를 들어, P7의 배양세포를 Middle 단계, 세포의 증식률이 떨어지면서 노화가 시작되어 시점을 Late 단계로 정의한다. 노화된 세포는 campisi lab에서 노화된 세포에서 pH 6.0에서 감지될 수 있는 β-galactosidase의 활성의 존재를 통해 확인할 수 있으며, β-galactosidase의 활성을 측정하는 방법은 노화된 세포임을 표지 하는 쉽고 확연한 방법으로 널리 쓰이고 있다. β-galactosidase의 활성 측정법은 x-gal을 포함한 pH6.0의 PBS를 배양된 세포에 가하고 일정시간 반응시킨 뒤 x-gal을 분해하는 효소의 반응을 푸른 염색의 침착 여부로 확인할 수 있으며, 이 방법은 배양된 세포의 노화뿐만 아니라 조직 내 세포에서도 양성 반응을 보이므로 노화세포의 확인에 유용하다.
구체적으로 3 개의 단계는 하기 표 2과 같다.
Young Early 세포 분리 후 안정화 시기
Middle 세포 증식이 활발한 시기
Old Late 노화가 시작되는 세포
이후에 3개의 단계의 줄기세포에 대해 세포증식인자로 알려져 있는 PCNA와 항노화 인자로 알려진 SirT1, 및 노화 마커인 P53의 발현을 면역 블랏팅을 통해 확인하였다. 구체적으로, PBS에 세척하여 수확한 세포에 단백질 분해효소 억제제(protease inhibitor)가 포함된 라이시스 버퍼를 이용하여 세포를 용해 시켰다. 이후에, 세포의 용해액을 Bradford (bio-red)용액을 이용하여 제조사에 지시에 따라 단백질의 양을 정량화 하였다. 20ug의 단백질을 10~15% SDS-PAGE gel에 전기영동기를 사용하여 단백질을 전개하였고 PVDF 막에 단백질을 전달 후 PCNA, SirT1, P53, GAPDH 항체를 4℃에서 밤새 반응시킨 후 HRP-접합된 이차 항체와 함께 실온에서 1시간 반응시켰다. 다음으로, ECL Western Blotting system (Millipore)와 Ez-Capture MG (ATTO)기기를 사용하여 면역반응을 측정하였고, 그 결과를 도 4에 나타내었다.
도 5는 일 구체예에 따른 줄기세포의 노화 단계에 따른 노화 관련 인자의 발현 변화를 나타낸 그래프이다.
도 5에 나타낸 바와 같이, 줄기세포는 노화가 진행될수록, PCNA 및 SirT1의 단백질 발현은 줄어들었고 노화 마커인 P53의 발현은 증가되었음을 확인할 수 있었다.
2.3. 삼채 및 흑삼채의 항노화 효능 분석
상기 실시예 2.2의 결과에 기초하여 삼채 및 흑삼채 추출물이 줄기세포에서 항산화 활성을 갖는지 확인하였다.
구체적으로, 상기 실시예 2.1.의 줄기세포 배양액에 100㎎ ~ 1ng/㎖ 의 삼채, 흑삼채를 첨가한 후 36일간 계대 배양 하였고, 상기 실시예 2.2.와 동일한 방법으로 면역 블랏팅을 수행하였다. 이상의 결과는 도 5에 나타내었다.
도 6은 일 구체예에 따른 삼채 또는 흑삼채 추출물의 줄기세포에서의 항노화 효능을 분석한 결과이다.
도 6에 나타낸 바와 같이, 증식인자인 PCNA은 노화된 줄기세포에서 단백질 발현이 감소하지만 삼채 및 흑삼채가 처리된 세포 내에서는 증가된 발현을 보였다. 또한, 항노화 인자인 SirT1 단백질도 노화된 줄기세포에서는 발현이 감소하지만 그와 비교하여 삼채와 흑삼채 처리 세포에서는 발현이 증가되었으며, 노화된 줄기세포에서 증가하는 P53은 흑삼채 처리 세포에서 발현이 감소되는 것을 확인할 수 있었다. 이상의 결과는 삼채 또는 흑삼채 추출물의 줄기세포에서 항노화 효능을 나타낸다는 것을 의미한다.
추가적으로, 삼채 또는 흑삼채가 노화마커로 알려진 P16, 및 P21의 발현에 미치는 영향을 분석하였다. 구체적으로, TRIzol 을 이용하여 세포로부터 RNA를 추출하였고, 1㎍의 정제된 총 RNA를 SuperScriptTMIII (Invitrogen), Oligo-d(T) 12-18 primer, DTT, 및 dNTPs를 이용하여 cDNA로 합성하였다. SYBR-green (enzynomics) 반응 키트를 이용하여 제조사의 지시에 따라 CFX Connect　(Bio-rad)기기를 이용하여 실시간 PCR을 수행하였으며 표적 유전자 발현 값을 하우스키핑 유전자 (RPL22)에 대응하여 정규화 하였다. 대조군의 발현 값을 표준으로 부여하고 다른 조건의 샘플들의 상대적 발현 수준을 계산하였고, 그 결과를 도 7 및 도 8에 나타내었다.
도 7은 일 구체예에 따른 삼채 또는 흑삼채의 줄기세포에서의 노화 마커 P16에의 영향을 나타낸 그래프이다.
도 8은 일 구체예에 따른 삼채 또는 흑삼채의 줄기세포에서의 노화 마커 P21에의 영향을 나타낸 그래프이다.
도 7 및 도 8에 나타낸 바와 같이, 노화된 줄기세포에서 P16, 및 P21의 유전자 발현이 증가되나 삼채 또는 흑삼채 처리 세포 내에서 P16 및 P21의 유전자 발현이 노화세포와 비교하여 줄어들었음을 확인할 수 있다.
실시예 3. 줄기세포를 이용한 대사체 분석 및 라이브러리 구축
3.1. 시료의 분석과 정량적 통계분석을 통한 적절한 유효인자 후보군의 선정
줄기세포는 세포 증식이 활발한 시기로 P1~P20 사이의 분화가 활발하게 진행되는 세포를 젊은 세포라고 한다. 상기 젊은 세포는 배양시 발생 단계에 관련이 있는 인자를 많이 배출하며, 노화 및 손상을 재생하는데 유효한 인자를 많이 분비한다. 따라서, 노화와 반대되는 세포 증식 및 분화, 재생 등에 관련된 항노화 유효인자 후보군을 선정하기에 적합한 시기이다. 실시예 3.1에서는 줄비세포 분비물이 없는 대조군 대비 줄기세포가 분비한 대사체를 1차적으로 선정하여 대사체 분석을 하고, 이후 공공 데이터 베이스를 이용하여 세포 증식과 관련된 유효인자 후보군을 선정하였다. 구체적으로, 상기 실시예 2.2.에서 제조한 줄기세포에 대하여 시료의 분석과 정량적 통계분석을 통한 적절한 유효인자 후보군의 선정을 위해 인간 태반 유래 줄기세포를 80 내지 90%의 콘플루언시(confluency)로 배양하였다. 이후에, 상기 세포를 1xP/S만 보충한 α-MEM에 24시간 배양하여 줄기세포에서 분비되는 인자가 포함된 배양액을 수득하였다. 얻어낸 배양액을 원심분리 및 필터링을 통하여 세포를 완전히 제거하고, 동결건조하여 줄기세포 배양액의 분말을 수득하였다. 줄기세포 배양액의 대조군으로 1xP/S만 보충된 α-MEM을 사용하였다. 이후에 유효 대사체 분석을 위해 도 8과 같이 수행하였다.
도 9은 일 구체예에 따른 줄기세포에 의한 유효 대사체 선별 과정을 도식화하여 나타낸 도면이다.
도 9를 참조하여 구체적으로 설명하면, 동결건조분말 상태의 줄기세포 배양액을 10㎎/㎖의 농도로 증류수(distilled water)에 녹여 질량분석용 시료를 제조하였다. 비교군으로 α-MEM 분말을 똑같이 10㎎/㎖의 농도로 증류수(distilled water)에 녹여 사용하였다. 시료는 LC-MS(Liquid chromatography-mass spectrometry) 방법을 이용해 분석하였으며, positive mode를 사용하였다. LC-MS raw data는 R-program을 이용해 xcms와 CAMERA package(bioconductor)를 이용해 분석하였다. LC-MS raw data의 피크는 xcms package에서 제공하는 matchedFilter 알고리즘을 이용해 선택되었으며, CAMERA package를 이용해 raw data의 pseudospectra와 isotope를 주석(annotation)하였다. 이후에, 인간 대사체 데이터베이스(Human metabolite Database)(http://www.hmdb.ca/)로부터 대사체의 질량정보를 불러와 상기 분석된 LC-MS data와 매칭하였다. LC-MS data는 isotope, adduct 등을 고려해 neutral mass를 추정하였으며 0.005 이하의 m/z값 오차를 가진다. 대사체가 주석(annotation)된 특징만 가지고 통계적 분석을 수행하였으며, welch's t-test를 이용해 통계적으로 유의하게 줄기세포 배양액에서 증가한 대사체만 선택하였고, 그 결과를 하기 표 3에 나타내었다.
세포 증식 유전자 ID 유전자 이름
1178 Charcot-Leyden crystal galectin(CLC)
218 aldehyde dehydrogenase 3 family member A1(ALDH3A1)
231 aldo-keto reductase family 1 member B(AKR1B1)
8644 aldo-keto reductase family 1 member C3(AKR1C3)
247 arachidonate 15-lipoxygenase, type B(ALOX15B)
382 arginase 1(ARG1)
2683 beta-1,4-galactosyltrasferase 1(B4GALT1)
11285 beta-1,4-galactosyltrasferase 7(B4GALT7)
586 branched chain amino acid transaminase 1(BCAT1)
23529 cardiotrophin-like cytokine factor 1(CLCF1)
1312 catechol-O-methyltransferase(COMT)
10498 coactivator associated arginine methyltransferase 1(CARM1)
1543 cytochrome P450 family 1 subfamily A member 1(CYP1A1)
1545 cytochrome P450 family 1 subfamily B member 1(CYP1B1)
339221 ectonucleotide pyrophosphatase/phosphodiesterase 7(ENPP7)
2876 glutathione peroxidase 1(GPX1)
3988 lipase A, lysosomal acid type(LIPA)
4846 nitric oxide synthase 3(NOS3)
10400 phosphatidylethanolamine N-metheyltrasnferase(PEMT)
5319 phospholipase A2 group IB(PLA2G1B)
26279 phospholipase A2 group IID(PLA2G2D)
64600 phospholipase A2 group IIF(PLA2G2F)
10728 prostaglandin E synthase 3(PTGES3)
9536 prostaglandin E synthase(PTGES)
5743 prostaglandin-endoperoxide synthase 2(PTGS2)
4860 purine nucleoside phosphorylase(PNP)
8566 pyridoxal (pyridoxine, vitamin B6) kinase(PDXK)
51548 sirtuin 6(SIRT6)
7453 tryptophanyl-tRNA synthetase(WARS)
7299 tyrosinase(TYR)
3.2. 공공 데이터베이스를 이용한 상호작용 네트워크의 구축과 대사경로 분석
상기 실시예 3.1.의 줄기세포로부터 분비된 인자들을 포함한 배양액에서 통계적으로 유의하게 증가한 대사체들과 상호작용한다고 알려진 단백질을 조사하여 상호작용 네트워크를 구축하였다. 구체적으로 도 9에 나타낸 바와 같은 방법으로 서브네트워크를 구성하였다.
도 10은 일 구체예에 따른 상호작용 네트워크 구축의 방법을 도식화하여 나타낸 도면이다.
도 10을 참조하여 설명하면, 대사체와 단백질의 상호작용은 KEGG reaction database에 등록된 대사체와 효소 사이의 상호작용 정보를 불러 들어와 처리하였다. 대사체와 상호작용이 예측되는 효소들은 특정 대사경로에 속하며 매칭된 대사체와의 상호작용을 통해 속한 대사경로에 영향을 끼칠 것으로 가정하였다. 줄기세포로부터 분비된 인자들을 포함한 배양액에서 증가한 줄기세포 유래 대사체가 어떠한 생물학적 경로에 영향을 끼쳤는지 검증하기 위해, 대사체-단백질 상호작용 네트워크에서 선택된 효소들의 리스트에 DAVID (https://david.ncifcrf.gov)를 사용해 Over-representation analysis를 실행하여 통계적으로 유의하게 상호작용 네트워크 상의 단백질들이 모이는 대사경로를 확인하였다. 통계적으로 유의한 대사경로 중, 세포 노화와 관련된 세포 증식(Cell proliferation)을 타겟으로 연관된 효소와, 그 효소와 반응할 것으로 예상되는 대사체를 다시 추출하여 서브네트워크를 구성하였고, 그 결과를 도 11에 나타내었다.
도 11은 일 구체예에 따른 대사체와 단백질의 상호작용 네트워크 분석결과를 나타낸 도면이다.
상기 표 2 및 도 11에 나타낸 바와 같이, 줄기세포 대사체에 의해 영향을 받으며 세포 증식에 관여할 것으로 예상되는 후보 유효 인자를 도출하였다.
3.3. 대사체 분석을 통해 발굴된 항노화 유효 인자를 삼채 및 흑삼채를 처리한 줄기세포에서 변화 확인
상기 실시예 3.1 및 3.2를 통해 도출된 노화 관련 후보인자인 Sirt6에 대해 삼채 또는 흑삼채 추출물이 미치는 영향을 분석하였다.
구체적으로, 상기 실시예 2.3.과 동일한 방법으로 Sirt6의 발현을 변화를 분석하였고, 그 결과를 도 12에 나타내었다.
도 12는 일 구체예에 따른 삼채 또는 흑삼채 추출물의 줄기세포에서의 Sirt6에 미치는 영향을 나타낸 그래프이다.
Sirt6는 SirT1과 함께 세포 증식, 노화 등에 관련되어 항노화 인자로 알려져 있다. 도 12에 나타낸 바와 같이, 삼채와 흑삼채를 처리한 노화세포에서 Sirt6의 발현이 떨어진 노화 세포와 비교하여 발현이 증가되었음을 알 수 있었다. 특히 흑삼채의 경우 젊은 세포보다 높은 발현양을 보였다. 이 결과로 Sirt6 유전자는 Sirt1과 함께 삼채 또는 흑삼채에 의해 조절되는 항노화 관련 효능을 보이는 유효인자임을 알 수 있었다.
이상의 결과로 일 구체예에 따른 줄기세포를 이용한 효능평가 방법에 의하면, 항노화와 관련된 유효 인자를 도출할 수 있고, 이의 변화를 확인함으로써, 항노화 물질의 개발에 유용하게 사용될 수 있다.

Claims (18)

  1. 줄기세포의 배양액을 수득하는 단계;
    상기 수득된 줄기세포의 배양액에 대해 LC-MS(Liquid chromatography-mass spectrometry) 분석을 수행하여 상기 줄기세포의 배양액에 대한 LC-MS 데이터를 획득하는 단계;
    상기 획득된 LC-MS 데이터를 인간 대사체 데이터베이스의 질량 정보와 매칭하는 단계; 및
    상기 매칭 결과, 줄기세포 배양액에서 통계적으로 유의하게 증가한 대사체를 선별하는 단계;를 포함하는 줄기세포를 이용한 항노화 유효인자를 구축하는 방법.
  2. 청구항 1에 있어서, 상기 줄기세포는 계대 1(passage 1) 내지 계대 100의 줄기세포인 것인 방법.
  3. 청구항 1에 있어서, 상기 선별된 대사체와 단백질 사이의 상호작용 정보를 획득하는 단계;
    상기 대사체와 단백질 상호작용 정보에서 선택된 단백질의 리스트에 ORA(Over-representation analysis) 분석을 통해 통계적으로 유의하게 상호작용 네트워크 상의 단백질이 모이는 대사 경로를 확인하는 단계; 및
    상기 대사 경로 중, 세포 증식 또는 세포 노화와 관련된 단백질과, 상기 단백질과 반응할 것으로 예상되는 대사체를 선별하는 단계를 포함하는 것인 방법.
  4. 청구항 1에 있어서, 상기 항노화 유효인자는 하기 표 3에 기재된 유전자 군으로부터 선택된 어느 하나인 것인 방법;
    [표 3]
    Figure PCTKR2018016978-appb-I000003
  5. 청구항 3에 있어서, 상기 대사체를 선별하는 단계는 상기 대사체의 생물학적 기능을 중심으로 선별되는 것인 방법.
  6. 청구항 3에 있어서, 상기 선별된 대사체는 특정 대사 경로에 속하며 단백질과의 상호작용을 통해 속한 대사 경로에 영향을 끼치는 것인 방법.
  7. 청구항 6에 있어서, 상기 단백질은 상기 선별된 대사체와 상호작용을 통하여 항노화 활성을 가지는 것인 방법.
  8. 청구항 4에 있어서, 상기 항노화 유효인자는 삼채 또는 흑삼채 추출물을 처리한 노화세포에서 발현이 증가하는 것인 방법.
  9. 줄기세포의 배양액을 수득하는 단계;
    상기 수득된 줄기세포의 배양액에 대해 LC-MS(Liquid chromatography-mass spectrometry) 분석을 수행하여 상기 줄기세포의 배양액에 대한 LC-MS 데이터를 획득하는 단계;
    상기 획득된 LC-MS 데이터를 인간 대사체 데이터베이스의 질량 정보와 매칭하는 단계;
    상기 매칭 결과 통계적으로 유의하게 줄기세포 배양액에서 증가한 대사체를 선별하는 단계;
    상기 선별된 대사체가 후보 물질이 처리된 줄기세포에서 대조군 대비 변화하는지 여부를 확인하는 단계; 및
    상기 후보 물질이 대조군 대비 상기 선별된 대사체를 변화시키는 경우 노화 조절 물질로 선별하는 단계를 포함하는 줄기세포를 이용한 노화 조절 물질을 스크리닝 하는 방법.
  10. 청구항 9에 있어서, 후보 물질을 처리 후 세포 내 하기 표 3에 기재된 유전자 군으로부터 선택된 어느 하나 이상의 유전자의 발현이 조절되는지 확인하는 단계를 추가로 포함하는 방법:
    [표 3]
    Figure PCTKR2018016978-appb-I000004
  11. 삼채 또는 흑삼채 추출물을 유효성분으로 포함하는 항노화 또는 항염증용 조성물.
  12. 청구항 11에 있어서, 상기 삼채 또는 흑삼채 추출물은 PCNA 또는 SirT1 단백질의 발현을 증가시키거나 P53 단백질의 발현을 감소시키는 것인 조성물.
  13. 청구항 11에 있어서, 상기 삼채 또는 흑삼채 추출물은 P16 또는 P21 유전자의 발현을 감소시키는 것인 조성물.
  14. 삼채 또는 흑삼채 추출물을 유효성분으로 포함하는 SirT6(Sirtuin6) 증가용 조성물.
  15. 인 비트로(in vitro)에서 삼채 또는 흑삼채 추출물을 세포에 처리하는 단계; 또는 삼채 또는 흑삼채 추출물을 인간을 제외한 동물에 투여하는 단계를 포함하는 세포 내 또는 개체 내 SirT6(Sirtuin 6)의 발현 또는 활성을 증가시키는 방법.
  16. 청구항 15에 있어서, 인간을 제외한 동물의 항노화 또는 항염증 효과를 위한 것인 방법.
  17. 삼채 또는 흑삼채 추출물을 유효성분으로 포함하는 조성물의 치료학적 유효량을 환자에게 투여하는 단계를 포함하는 노화 또는 염증을 예방, 치료 또는 개선시키는 방법.
  18. 노화 또는 염증을 예방, 치료 또는 개선시키기 위한 약제의 제조를 위한, 삼채 또는 흑삼채 추출물을 유효성분으로 포함하는 조성물의 용도.
PCT/KR2018/016978 2017-12-29 2018-12-31 줄기세포를 이용한 노화 조절 유효인자 구축 방법, 및 그를 이용하여 노화 조절 물질을 스크리닝 하는 방법, 및 그에 의해 도출된 항노화 물질 WO2019132631A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2017-0184815 2017-12-29
KR1020170184815A KR20190081938A (ko) 2017-12-29 2017-12-29 줄기세포를 이용한 노화 조절 유효인자 구축 방법, 및 그를 이용하여 노화 조절 물질을 스크리닝 하는 방법, 및 그에 의해 도출된 항노화 물질

Publications (1)

Publication Number Publication Date
WO2019132631A1 true WO2019132631A1 (ko) 2019-07-04

Family

ID=67064024

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/016978 WO2019132631A1 (ko) 2017-12-29 2018-12-31 줄기세포를 이용한 노화 조절 유효인자 구축 방법, 및 그를 이용하여 노화 조절 물질을 스크리닝 하는 방법, 및 그에 의해 도출된 항노화 물질

Country Status (2)

Country Link
KR (1) KR20190081938A (ko)
WO (1) WO2019132631A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150113717A (ko) * 2014-03-31 2015-10-08 연세대학교 산학협력단 삼채 추출물을 유효성분으로 함유하는 피부노화 개선용 조성물
KR20160069919A (ko) * 2014-12-09 2016-06-17 목포대학교산학협력단 삼채 추출물을 포함하는 항염증제
KR20160096931A (ko) * 2015-02-06 2016-08-17 한국과학기술원 분비 대사체 분석을 통한 간독성 약물 스크리닝 방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150113717A (ko) * 2014-03-31 2015-10-08 연세대학교 산학협력단 삼채 추출물을 유효성분으로 함유하는 피부노화 개선용 조성물
KR20160069919A (ko) * 2014-12-09 2016-06-17 목포대학교산학협력단 삼채 추출물을 포함하는 항염증제
KR20160096931A (ko) * 2015-02-06 2016-08-17 한국과학기술원 분비 대사체 분석을 통한 간독성 약물 스크리닝 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHOI, YU RI ET AL: "Stem Cell Aging and Effect of Natural Products on Aging", BIT'S 5TH ANNUAL WORLD CONGRESS OF GEROATRICS AND GERONTOLOGY, 4 December 2017 (2017-12-04), pages 172 *
LEE, SEUL JI: "Study on Alterations Endogenous Metabolites Based on Senescence of Human Bone Marrow-derived Clonal Mesenchymal Stem Cells", THESIS, August 2014 (2014-08-01), Seul University *

Also Published As

Publication number Publication date
KR20190081938A (ko) 2019-07-09

Similar Documents

Publication Publication Date Title
WO2019199094A1 (ko) 비만의 예방 또는 치료 효과를 가지는 신규 비피도박테리움 롱검 균주 또는 락토바실러스 람노서스 균주 및 이의 용도
US11879138B2 (en) Method for preparing mesenchymal stem cell-derived exosomes and culture solution produced from the same
WO2016137164A2 (ko) 바실러스 속 세균 유래 세포밖 소포체를 포함하는 임신관련 질환 치료용 조성물
WO2018105926A1 (ko) 유산균 발효 복합생약추출물을 유효성분으로 하는 항알레르기 조성물
WO2016175136A1 (ja) 筋脂肪化抑制用組成物
WO2021230581A1 (ko) 신규한 아커만시아 뮤시니필라 ak32 균주의 발견 및 장 손상의 예방 또는 치료를 위한 응용
KR20210054741A (ko) 진토닌을 포함하는 희소돌기아교세포 분화용 조성물 및 탈수초성 질환의 예방 또는 치료용 조성물
WO2013176327A1 (ko) 황련해독탕의 유산균 발효물을 유효성분으로 함유하는 골질환의 예방 또는 치료용 약학적 조성물 및 건강기능식품
WO2019132631A1 (ko) 줄기세포를 이용한 노화 조절 유효인자 구축 방법, 및 그를 이용하여 노화 조절 물질을 스크리닝 하는 방법, 및 그에 의해 도출된 항노화 물질
WO2019031729A2 (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 조성물의 비알콜성 단순 지방간 또는 비알콜성 지방간염의 개선 용도
WO2023140657A1 (ko) 간이식환자 장내균총 분석과 이를 통한 이식상태 모니터링과 면역조절 테라그노시스 조성물
WO2017030383A2 (ko) 바쿠치올을 유효성분으로 포함하는 근육위축증 예방 또는 치료용 약학적 조성물
WO2019216450A1 (ko) 항염증 성분을 분비하는 줄기세포 배양방법 및 그 줄기세포 배양액을 포함하는 항염증 조성물
WO2023096087A1 (ko) 사이클로아스트라제놀을 유효성분으로 함유하는 퇴행성 뇌질환의 예방, 개선 또는 치료용 조성물
WO2018093233A1 (ko) 지방줄기세포유래 엑소좀을 유효성분으로 포함하는 간 섬유증 예방 또는 치료용 조성물
WO2021045595A1 (ko) 치아 주변조직 유래 다분화능 줄기세포를 포함하는 비만 또는 비알코올성 지방간의 예방 또는 치료용 약학적 조성물
WO2022103128A1 (ko) GRO-α를 발현하는 줄기세포 또는 GRO-α를 포함하는 근육 질환의 예방 또는 치료용 조성물
KR102197325B1 (ko) 흑삼채 추출물을 포함하는 항염증 또는 항노화용 조성물
KR20230017894A (ko) 줄기세포를 이용한 노화 조절 유효인자 구축 방법, 및 그를 이용하여 노화 조절 물질을 스크리닝 하는 방법, 및 그에 의해 도출된 항노화 물질
WO2023128197A1 (ko) 우도 땅콩 새싹 추출물을 유효성분으로 함유하는 근감소증의 개선, 예방 또는 치료용 조성물
KR20090116063A (ko) 돼지태반 추출물을 함유하는 조성물
WO2023075346A1 (ko) 항산화 기전 조절을 통한 자연살해세포의 항암 기능 향상
WO2024085623A1 (ko) 항염증 효능이 있는 락티플랜티바실러스 플란타룸 km2 균주 발효 배양상등액의 마이크로바이옴 조성물
WO2023153902A1 (ko) 엔테로코커스 패칼리스, 이의 배양액 또는 이의 사균체를 유효성분으로 포함하는 지방전구세포 분화 및 지질축적 억제용 조성물
WO2015080376A1 (ko) 태반의 융모막 또는 와튼제대교질 유래 간엽줄기세포로부터 신경세포 및 유모세포를 분화시키는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18893374

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18893374

Country of ref document: EP

Kind code of ref document: A1