WO2019066519A1 - 결합 조직 성장 인자를 표적으로 하는 rna 복합체를 함유하는 노인성 황반변성의 예방 또는 치료용 약학 조성물 - Google Patents

결합 조직 성장 인자를 표적으로 하는 rna 복합체를 함유하는 노인성 황반변성의 예방 또는 치료용 약학 조성물 Download PDF

Info

Publication number
WO2019066519A1
WO2019066519A1 PCT/KR2018/011482 KR2018011482W WO2019066519A1 WO 2019066519 A1 WO2019066519 A1 WO 2019066519A1 KR 2018011482 W KR2018011482 W KR 2018011482W WO 2019066519 A1 WO2019066519 A1 WO 2019066519A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
antisense strand
composition
nos
rna complex
Prior art date
Application number
PCT/KR2018/011482
Other languages
English (en)
French (fr)
Inventor
이동기
김영희
홍선우
Original Assignee
올릭스 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 올릭스 주식회사 filed Critical 올릭스 주식회사
Publication of WO2019066519A1 publication Critical patent/WO2019066519A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides

Definitions

  • the present invention relates to a pharmaceutical composition for the prevention or treatment of senile AMD (AMD) comprising, as an active ingredient, an RNA complex targeting a connective tissue growth factor (CTGF), and more particularly, Wherein the antisense strand and the sense strand form a blunt end at the 5 'end of the antisense strand and at the 3' end of the sense strand, wherein the antisense strand and the sense strand form a complementary bond to the antisense strand, And a pharmaceutical composition for preventing or treating AMD comprising the RNA complex as an active ingredient.
  • ATD senile AMD
  • CTGF connective tissue growth factor
  • Age-related macular degeneration is the third most common cause of blindness worldwide (Vision 2020: The Right to Sight. (See “Facts About Age-Related Macular Degeneration", National Eye Institute, June 2015. Retrieved 21 December 2015).
  • AMD Age-related macular degeneration
  • the number of patients with AMD is rapidly increasing as it enters the aging society, with the number of patients reaching 200 million by 2020 and about 300 million by 2040 .
  • the analysis of the data from the National Health Insurance Review and Assessment Service showed that the number of patients treated by AMD increased by about 36.6% from about 110,000 in 2009 to about 150,000 in 2009. Total medical expenses in 2009 were about 22.4 billion won To about 55.6 billion won in 2013.
  • AMD is a geriatric degenerative disease that occurs in ages older than 60 years, the incidence rate in middle-aged people in their 40s or older has increased by about 9 times compared to 10 years ago in recent years. These radical episodes of AMD warn the need for a new paradigm for understanding and treating geriatric degenerative diseases.
  • AMD AMD is divided into early, intermediate, and advanced stages according to the progress of AMD. Most of the patients with intermediate stage AMD develop into terminal stage and rapidly become blind. Approximately 80% of intermediate stage AMD develops into a geographic atrophy (GA) with giant progressive atrophy in the central macula, resulting in blindness, with the remaining 10-20% It develops into neovascular / exudative AMD (NVAMD, wet AMD) with blood vessel leakage with neovascularization, leading to blindness.
  • GA geographic atrophy
  • NVAMD neovascular / exudative AMD
  • AMD AMD is classified as wet AMD, which is a characteristic of exudates through blood vessel leakage, and dry AMD (dry AMD), which is all other early and intermediate stages of AMD, including GA. All early AMD occurs in the form of dry AMD and develops into wet AMD and GA in the terminally progressive degradation phase.
  • VEGF Vascular endothelial growth factor
  • Lucentis, Eylea, Avastin, etc. have been used as therapeutic agents for typical anti-VEGF therapy, and intravitreal injection (IVT) therapy has been used once a month.
  • Anti-VEGF therapy is not only a costly treatment for patients with long-term treatment, but also increases the burden of patients due to side effects, such as decreased visual acuity, more severe recurrence of wet AMD, increased incidence of GA (within 1-2 years), bleeding, And optic nerve inhibition, pain, etc. have been reported.
  • siRNA small-interfering RNA
  • siRNA small-interfering RNA
  • the technology using siRNA has attracted attention as a breakthrough new drug development technology to overcome disadvantages of existing therapeutic agents.
  • siRNA is a short-length (19 to 21 bp) double-stranded RNA capable of inhibiting the expression of a target gene in a nucleotide sequence-specific manner.
  • the siRNA is effective in inhibiting cancer, virus infection, and the like, And genetic diseases.
  • RNA interference is the most efficient gene regulation technology known to date. Unlike conventional anti-VEGF therapies, RNA interference can directly inhibit the causative genes in the onset of the disease, thereby enabling the development of therapeutic agents that can be treated from the earliest stages of AMD.
  • Conventional antibody therapeutics and small molecule therapeutics are mechanisms that inhibit the activity of already synthesized disease-related proteins.
  • siRNA therapeutic agents complementarily bind to the mRNA of the target protein, There is no limit to the target that can be targeted because it is controlled. Despite the excellent therapeutic efficacy and wide range of applications of siRNA, existing RNAi technology has side effects such as no effective delivery system, nonspecific induction of immune response, and off-target effect.
  • Asymmetric RNAi is an asymmetric RNAi-inducible structure with shorter double strand lengths and higher gene suppression efficiency than conventional siRNAs. It has the side effects of non-specific immune reactions and off-target effects found in existing siRNA structure technology.
  • Cp-asiRNA with intracellular penetrating ability can be chemically and structurally modified to RNA, allowing self-transfer into the cell without the aid of a delivery system, and selective inhibition of the gene in the cell Do.
  • CTGF Conjugate Tissue Growth Factor
  • CCN2 Conjugate Tissue Growth Factor
  • the inventors of the present invention have developed a pharmaceutical composition for the prevention or treatment of AMD using cp-asiRNA technology in order to develop a new safe drug capable of treating wet AMD patients.
  • CGF connective tissue growth factor
  • CNV choroidal neovascularization
  • the present invention provides a method for preventing or treating age-related macular degeneration (AMD) comprising an RNA complex targeting CTGF as an active ingredient, A pharmaceutical composition is provided.
  • AMD age-related macular degeneration
  • the present invention also provides a method of preventing or treating senile AMD (AMD) comprising administering said RNA complex.
  • AMD senile AMD
  • the present invention also provides the use of said RNA complex for the prevention or treatment of senile AMD (AMD).
  • AMD senile AMD
  • the invention also provides the use of said RNA complex for the manufacture of a medicament for the prevention or treatment of senile AMD (AMD).
  • AMD senile AMD
  • FIG. 1 is a graph showing gene suppression efficiency of siRNA, asiRNA, and lasiRNA constructs of 24 kinds of sequences targeting CTGF of Table 1.
  • FIG. 1 is a graph showing gene suppression efficiency of siRNA, asiRNA, and lasiRNA constructs of 24 kinds of sequences targeting CTGF of Table 1.
  • FIG. 2 is a fluorescence microscope photograph showing an increase in intracellular absorption efficiency of lasiRNA according to cholesterol deformation.
  • FIG. 3 is a fluorescence microscope photograph showing an increase in the absorption efficiency of chol-lasiRNA into cells according to phosphorothioate (PS) modification.
  • FIG. 4 is a graph comparing the gene reduction effect of chol-lasiRNA with phosphorothioate (PS) modification (each graph represents the mean of three repeated experiments and SD).
  • Figure 5 is a graph comparing the gene inhibition efficiency of various cell penetrating lasiRNAs (cp-lasiRNA) (CTGF or MyD88 in parentheses represents the target gene of cp-lasiRNA).
  • FIG. 6 is a graph showing the CTGF expression efficiency according to the antisense strand length.
  • FIG. 7 (a) is a graph showing CTGF mRNA levels in rat skin infused with CTGF cp-asiRNA, (b) is a graph showing CTGF protein reduction in samples treated with cp-asiRNA, The distribution of cp-asiRNA in the skin was analyzed by laser scanning confocal microscopy (Scale bar 1 ⁇ 4 1 mm, ** P ⁇ 0.01 compared to the untreated skin sample).
  • FIG. 8 is a graph showing that protein expression of the target gene CTGF is inhibited by the treatment of CTGF cp-asiRNA.
  • FIG. 9 is a graph (using ImageJ software) and graph showing significant inhibition of CNV generation when CTGF cp-asiRNA was treated in mouse wet AMD model.
  • FIG. 10 is a photograph (using ImageJ software) and a graph showing significant inhibition of CNV generation when CTGF cp-asiRNA was treated in a rat wet AMD model.
  • Fig. 11 is a photograph and a graph showing that the increase of hypofibrillosis is significantly inhibited by administration of CTGF cp-asiRNA.
  • Figure 12 is a graph showing that the CNV volume is significantly reduced by treatment of CTGF cp-asiRNA in the haptic macular degeneration model.
  • RNAi RNA interference
  • dsRNA double-stranded RNA
  • siRNA small interfering RNA
  • dsRNA short double stranded RNA
  • an “antisense strand” is a polynucleotide that is substantially or 100% complementary to a target nucleic acid of interest, eg, mRNA (messenger RNA), a non-mRNA RNA sequence (eg, microRNA, piwiRNA , tRNA, rRNA and hnRNA) or a coding or noncoding DNA sequence as a whole or in part.
  • mRNA messenger RNA
  • non-mRNA RNA sequence eg, microRNA, piwiRNA , tRNA, rRNA and hnRNA
  • a coding or noncoding DNA sequence as a whole or in part.
  • a “sense strand” is a polynucleotide having the same nucleic acid sequence as a target nucleic acid, and includes mRNA (messenger RNA), RNA sequence (eg, microRNA, piwiRNA, tRNA, rRNA and hnRNA) refers to polynucleotides that are identical in whole or in part to DNA sequences.
  • mRNA messenger RNA
  • RNA sequence eg, microRNA, piwiRNA, tRNA, rRNA and hnRNA
  • the term "gene” should be regarded as the broadest possible meaning, and it is possible to encode a structural or regulatory protein.
  • the regulatory protein comprises a transcription factor, a heat shock protein or a protein involved in DNA / RNA replication, transcription and / or translation.
  • the target gene to be suppressed in expression is inherent to the viral genome, and may be integrated into an animal gene or exist as an extrachromosomal component.
  • the target gene may be a gene on the HIV genome.
  • siRNA molecules are useful for inactivating translation of HIV genes in mammalian cells.
  • asymmetric siRNA having intracellular penetrating ability targeting the connective tissue growth factor inhibits the development of CNV, which is known to cause the reduction of visual acuity due to senile AMD.
  • the present invention in one aspect comprises an antisense strand comprising a region complementary to mRNA encoding a connective tissue growth factor (CTGF), and a sense strand forming a complementary bond with said antisense strand , wherein the antisense strand and the sense strand form blunt ends at the 5 'end of the antisense strand and the 3' end of the sense strand.
  • CTGF connective tissue growth factor
  • AMD Age-related macular degeneration
  • the antisense strand may be 16 to 121 nt (nucleotide), preferably 24 to 121 nt long.
  • the antisense strand comprises a partial region complementary to the mRNA encoding CTGF, wherein the length of the region comprising a portion complementary to the mRNA encoding CTGF is 16 to 31 nt, 19 to 31 nt or 19 to 21 nt can do.
  • the sense strand may have a length of 13 to 25 nt, 13 to 21 nt, or 16 to 21 nt.
  • the RNA complex comprises an antisense strand having a length of 24 to 121 nt including a partial region complementary to mRNA encoding CTGF, a partial region complementary to mRNA encoding CTGF of the antisense strand, And a sense strand having a length of 13 to 21 nt having a region forming a complementary bond. More preferably, the length of the antisense strand is 21 to 31 nt, and the length of the sense strand is 16 to 21 nt.
  • siRNAs having such a structure were produced on sequences targeting CTGF, and as a result, it was confirmed that there was a tendency that overall gene expression suppression efficiency was higher than that of existing siRNAs.
  • the present inventors named siRNA having a double-stranded nucleic acid molecule, i.e., a long antisense strand, which induces RNAi having a long single-stranded region that does not form a complementary bond with a sense strand as described above, as 'lasiRNA'.
  • lasiRNA is an asymmetric RNAi inducing structure with a shorter double strand length and a higher gene inhibition efficiency than conventional siRNAs.
  • siRNA or asiRNA due to the antisense role of long overhang structure, it is expected to be used for the development of therapeutic agents, replacing existing structures with the maximum gene suppression efficiency, which is higher than siRNA or asiRNA.
  • it has a longer overhang length than other structures and maintains high activity over various modifications of overhang. Therefore, it is possible to introduce a relatively large number of chemical modifications and thus, various functions can be added.
  • the lasiRNA may be characterized in that the length of a partial region complementary to the mRNA encoding CTGF of the antisense strand is 19 to 21 nt.
  • the antisense strand comprises a single strand region that is not associated with a sense strand, and preferably the antisense strand comprises a nucleic acid oligonucleotide selected from the group consisting of antisense DNA, antisense RNA, ribozymes and DNAzymes in a single strand region And may further include the additional information.
  • siRNA molecule consisting of an antisense strand of 19 to 21 nt in length and a sense strand of 13 to 16 nt in length, wherein the 5 'direction end of the antisense strand is a blunt end, is an off-target effect (Korean Patent Laid-Open No. 10-2009-0065880), when the structure according to the present invention is applied to such siRNAs, it is possible to minimize the off-target effect
  • the above effect by the nucleic acid oligonucleotide contained in the single strand region of the antisense strand can be simultaneously exhibited.
  • the siRNA In the case where degradation of other mRNA occurs due to the sense strand of the siRNA, the antisense strand of the siRNA is paired with the wrong target and the degradation of other mRNA And the effect of degrading other mRNA by the generated antisense strand and suppressing the expression of the gene.
  • the single-stranded region which does not form a complementary bond with the sense strand of the antisense strand may be directly or linked to a region forming a complementary bond with the sense strand by the linker, chemical linker).
  • the chemical linker may be a nucleic acid moiety, a PNA moiety, a peptide moiety, a disulfide bond, or a polyethylene glycol moiety. But is not limited thereto.
  • the antisense strand may be characterized in that the single strand region further contains a sequence complementary to or complementary to the mRNA encoding the CTGF, and in a complementary case, May be located consecutively with a region complementary to the mRNA encoding CTGF of the siRNA according to the invention and may be located remotely.
  • the sequence targeted by the siRNA and the sequence of the single-stranded region ribozyme or the DNAzyme target may be located continuously or remotely.
  • the single strand region of the antisense strand has a sequence complementary to the target gene of the siRNA
  • the sequence of the siRNA and the target gene of the siRNA are about , More preferably 70-80% or more, preferably about 80-90% or more, and more preferably about 95-99% or more.
  • the single-stranded region is a ribozyme or a DNAzyme, and the sequence of the target gene of the siRNA is complementary to that of about 50-60% or more.
  • the single stranded region may be from 5 to 100 nt. If it is less than 5 nt, the effect of suppressing the gene expression is insufficient, and when it is more than 100 nt, the synthesis efficiency of the RNA molecule is lowered.
  • the single stranded region may preferably have a length of 9 to 100 nt, or a length of 50 nt or less, and more preferably 10 to 15 nt.
  • the sense strand is selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, , 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89 , 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139 , 141, and 143, respectively. More preferably, it is characterized in that it is selected from the group consisting of SEQ ID NOS: 49, 51 and 53.
  • the antisense strand may be any one of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, , 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, , 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140 , 142 and 144, respectively. More preferably, it may be characterized in that it is selected from the group consisting of SEQ ID NOS: 50, 52 and 54.
  • the RNA complex comprises a nucleotide sequence of SEQ ID NOS: 49 and 50; A base sequence pair of SEQ ID NOS: 51 and 52; And a nucleotide sequence of SEQ ID NO: 53 and SEQ ID NO: 54.
  • the RNA complex may include a chemical modification.
  • the chemical modification is such that at the 2'carbon position of the sugar structure in the nucleotide, the -OH group is replaced by -CH3 (methyl), -OCH3 (methoxy), -NH2, -F (fluorine), -O- (propyl), -O-2-methylthioethyl, -O-3-aminopropyl or -O-3-dimethylaminopropyl;
  • the oxygen of the sugar structure in the nucleotide is replaced by sulfur;
  • the nucleotide linkage is transformed into phosphorothioate, boranophosphate, or methyl phosphonate; PNA (peptide nucleic acid), LNA (locked nucleic acid) or UNA (unlocked nucleic acid); And one or more members selected from the group consisting of a cholesterol or a cell penetration peptide bond, but the present invention is not limited thereto.
  • the chemical modification may be characterized in that at least one kind of nucleotide is substituted with any one of LNA (locked nucleic acid), UNA (unlocked nucleic acid) and PNA (peptide nucleic acid) RNA complex is combined with at least one selected from the group consisting of lipids, cell penetrating peptides, and cell targeting ligands.
  • LNA locked nucleic acid
  • UNA locked nucleic acid
  • PNA peptide nucleic acid
  • the RNA complex according to the present invention preferably comprises 1 to 48, preferably 1 to 31, more preferably 2 to 17, more preferably 4 to 17 or 12 to 17 nucleotide phosphoprotein backbones Is substituted with phosphorothioate.
  • the phosphate backbone of the nucleotide contained in the antisense strand may be replaced with a phosphorothioate.
  • the phosphate backbone of the nucleotide in a region other than the region complementary to CTGF in the antisense strand may be replaced by a phosphate And is substituted with phosphorothioate.
  • a phosphate backbone of 1 to 31, preferably 1 to 17, more preferably 2 to 17, more preferably 4 to 17, or 12 to 17 nucleotides contained in the antisense strand is expressed by a phosphate And is substituted with phosphorothioate.
  • the phosphate backbone of 1 to 21, preferably 1 to 17, more preferably 2 to 17, more preferably 4 to 17, or 12 to 17 nucleotides contained in the sense strand Is substituted with phosphorothioate.
  • the chemical modification is characterized in that the nucleotide phosphate backbone in the sense strand is substituted with at least one phosphorothioate, the -OH group is substituted with at least one O-alkyl at the 2'carbon position of the sugar structure in the nucleotide, And a lipophilic compound is bound to the 3 'terminus.
  • the lipophilic compound brings hydrophobic modification, and lipids, lipophilic peptides or lipophilic proteins can be exemplarily used.
  • the lipid may be cholesterol, tocopherol, stearic acid, palmitic acid or the like, or a long chain fatty acid having 10 or more carbon atoms.
  • the lipophilic compound such as cholesterol may be bound to the 5 'end or 3' end of the antisense strand or sense strand.
  • At least one of the bases constituting the single stranded region in the antisense strand may comprise a bulky base analogue.
  • enriched base analogs such as deoxyadenosine derivatives with phenyl groups
  • mRNA strands that are complementary to this extension sequence will cleavage at the position of a large base analogue. Any giant base analog that induces such cleavage can be included in the present invention without limitation.
  • the 5 'end portion functions as an RNAi mechanism while the 3' end portion functions as an antisense mechanism or the 5 ' And to induce target mRNA.
  • the sequence complementary to the mRNA at the 3 'end of the antisense is DNA, RNase H-dependent mRNA cleavage can be induced.
  • the bases constituting the single-stranded region of the antisense 3 'end contains a bulky base analog or when the single-stranded region binds to the mRNA to form a bulge structure And also to induce cleavage.
  • synergistic cleavage could be induced in the case of nucleic acid molecules in which ribozyme or DNAzyme was introduced into the single strand region of the antisense strand.
  • the RNA complex comprising the chemical modification includes a nucleotide sequence pair of SEQ ID NOS: 149 and 150; A base sequence pair of SEQ ID NOS: 151 and 152; The nucleotide sequence pair of SEQ ID NOS: 153 and 154; A base sequence pair of SEQ ID NOS: 155 and 156; The nucleotide sequence pair of SEQ ID NOS: 157 and 158; A nucleotide sequence pair of SEQ ID NOS: 159 and 160; A base sequence pair of SEQ ID NOS: 163 and 164; A base sequence pair of SEQ ID NOS: 163 and 165; The nucleotide sequence pair of SEQ ID NOS: 166 and 167; And a double-stranded nucleic acid molecule having a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOS: 168 and 169.
  • the present invention is not limited thereto.
  • RNA complex according to the present invention can be efficiently used in in vitro and in vivo delivery by being used with various carriers and delivery methods such as liposome, cationic polymer, antibody, aptamer, and nanoparticles known to effectively transfer oligonucleotides into cells. . ≪ / RTI > Therefore, in the present invention, the RNA complex may have a cell-penetrating ability.
  • the RNA complex may be characterized by inhibiting the development of choroidal neovascularization (CNV) or subretinal fibrosis.
  • CNV choroidal neovascularization
  • the RNA complex may inhibit the generation of CNV.
  • AMD is a serious degenerative ocular disease that causes blindness in the eye following aging. It is not known exactly what causes the macula between retinal pigment epithelium (RPE) and Bruch's membrane. Drusen, a protein-lipid complex, has been deposited and has been shown to cause irreversible denaturation of RPE degeneration and choroidal neovascularization (CNV).
  • RPE retinal pigment epithelium
  • CNV choroidal neovascularization
  • the pathogenesis of human CNV is manifested by the destruction and damage of Bruch's membrane between the sub-RPE or sub-retinal space, the RPE and the choroidal vascular layer, and the abnormal secretion of VEGF associated with subsequent inflammatory cytokines, The increase itself is not sufficient for the generation of CNV, and the rupture of Bruch's membrane and the change of constituent play a key role in CNV formation.
  • wet AMD therapeutic agents are anti-VEGF therapeutic agents that inhibit angiogenic growth factors, while the pharmaceutical compositions according to the present invention demonstrate that they do not follow the typical VEGF signaling pathway, suggesting a new direction of wet AMD treatment.
  • the RNA complex may inhibit the development of subretinal fibrosis.
  • CTGF cp-asiRNA was injected into the vitreous of a sub-retinal fibrosis-induced mouse as a laser-induced CNV model to inhibit the development of subretinal fibrosis.
  • the AMD may be characterized by wet AMD (wet AMD).
  • AMD AMD is divided into wet AMD and dry AMD (dry macular degeneration) characterized by neovascularization and hemorrhage. All AMD early disease begins with dry AMD, but in the late stage of progressive degeneration, approximately 10-20% , And more than 80% of them develop into progressive dry macular degeneration (GA) characterized by map atrophy, eventually leading to blindness.
  • G progressive dry macular degeneration
  • the present invention relates to a method of preventing or treating senile AMD (AMD), which comprises administering the RNA complex to a patient in need of such treatment or prevention.
  • AMD senile AMD
  • the present invention relates to the use of said RNA complex for the prevention or treatment of senile AMD.
  • the present invention relates to the use of said RNA complex for the manufacture of a medicament for the prevention or treatment of senile AMD.
  • the pharmaceutical composition according to the present invention may be provided as a pharmaceutical composition comprising the RNA complex alone or in combination with one or more pharmaceutically acceptable carriers, excipients or diluents.
  • the RNA complex may be used for the treatment of diseases and their severity, May be included in the pharmaceutical composition in an appropriate pharmacologically effective amount depending on the age, body weight, health condition, sex, administration route and treatment period, and the like.
  • pharmaceutically acceptable refers to a composition that is physiologically acceptable and does not normally cause an allergic reaction such as a gastrointestinal disorder, dizziness, or the like when administered to a human.
  • the carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, Polyvinyl pyrrolitone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • the pharmaceutical composition may further include a filler, an anti-coagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifier, and an antiseptic agent.
  • the pharmaceutical compositions of the present invention may also be formulated using methods known in the art so as to provide rapid, sustained or delayed release of the active ingredient after administration to the mammal.
  • the formulation may be in the form of a sterile injectable solution or the like.
  • composition of the present invention can be administered to mammals including humans by any method.
  • it can be administered orally or parenterally.
  • Parenteral administration methods include but are not limited to intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, intraocular, intravitreal, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, Topical, sublingual, or rectal administration.
  • the pharmaceutical composition When the pharmaceutical composition is formulated and administered, it can be administered in the form of an agent produced by a conventional method.
  • Dosage forms may be, for example, eye drops, ointments, powders, granules, tablets, capsules, injections, ointments and the like, with eye drops and ointments being preferred.
  • Such formulations may be prepared according to conventional methods in the art.
  • As an ophthalmic topical dosage form it can be in the form of drops, sprays or gels, or it can be administered to the eye using liposomes in another way. It can also be injected into the tear film through a pump-catheter system.
  • it may be included in a contact lens of the eye, carried by it or attached to it.
  • a form contained in a sponge or swab that may be applied to the ocular surface may be used, and a liquid spray that may be applied to the ocular surface may also be used.
  • the pharmaceutical composition of the present invention is prepared in any form selected from the group consisting of an oral preparation, an injection, an eye drop and an ointment.
  • CTGF-targeted RNA complex according to the present invention or a pharmaceutical composition containing it as an active ingredient can be used for prevention or treatment of AMD.
  • RNA complex or pharmaceutical composition comprising the same as an active ingredient according to the present invention.
  • the RNA complex or pharmaceutical composition may be administered to the eyes of a patient and self-administered by the patient.
  • a form such as a nucleic acid containing a carrier-free nucleic acid (e.g., cp-asiRNA and cp-lasiRNA), a nucleic acid containing a delivery reagent, and / or a sequence expressing an RNA complex according to the present invention ≪ / RTI >
  • any of the nucleic acid delivery methods known in the art may be used for the treatment method.
  • Suitable delivery reagents include, but are not limited to, for example, Mirus Transit TKO lipophilic reagent, lipofectin, lipofectamine, cellfectin, polycations (e.g., polylysine), atelocollagen, nanoplexes and liposomes.
  • the use of atelocollagen as a delivery vehicle for nucleic acid molecules is described by Minakuchi et al. Nucleic Acids Res., 32 (13): e109 (2004); Hanai et al. Ann NY Acad Sci., 1082: 9-17 (2006); and Kawata et al. Mol Cancer Ther., 7 (9): 2904-12 (2008).
  • Exemplary interference nucleic acid delivery systems are provided in U.S. Patent Nos. 8,283,461, 8,313,772, and 8,501,930.
  • the liposomes are used to deliver the RNA complex according to the invention to the patient.
  • Liposomes suitable for use in the method may be formed from standard vesicle-forming lipids, including sterols such as phospholipids and cholesterol, which are generally neutral or negatively charged. The choice of lipid generally considers factors such as the desired liposome size and the half-life of the liposomes in the blood stream.
  • Various methods for making liposomes are known, see for example Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9: 467 or U.S. Patent Nos. 4,235,871, 4,501,728, 4,837,028 and 5,019,369.
  • the pharmaceutical compositions according to the present invention may be delivered by any suitable route of administration including topical, intravitreal, oral and parenteral administration.
  • the pharmaceutical composition is delivered locally via direct administration to the eye.
  • the actual dosage level of the RNA complex in the pharmaceutical composition may vary. The selected dosage level will depend upon a variety of factors including the activity of the particular agent employed, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound employed, the duration of treatment, age, sex, weight, overall health and prior medical history of the patient, Can be influenced by various factors such as well known factors. One skilled in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required.
  • an appropriate daily dose of an RNA complex according to the invention will be that amount of RNA complex which is the minimum dose effective to produce a therapeutic effect. Such an effective amount is determined by the above factors.
  • target sequences for CTGF were designed and screened to obtain double-stranded nucleic acid molecules that induce high efficiency RNAi targeting CTGF .
  • siRNA, asiRNA, and lasiRNA constructs were synthesized as shown in Table 1.
  • Table 1 is the nucleotide sequence information of siRNA, asiRNA, and lasiRNA constructs for 24 kinds of sequences for CTGF (uppercase: RNA, lowercase: DNA).
  • HaCat cells were cultured in Dulbecco's modified Eagle's medium (Gibco) supplemented with 10% fetal bovine serum (Gibco) and 100 ⁇ g / ml penicillin / streptomycin in a 100-mm petri dish. In the case of Hacat, 8 ⁇ 10 4 cells were seeded in a 12-well plate immediately before transfection. Meanwhile, siRNA, asiRNA, and lasiRNA were diluted at a concentration appropriate for 1X siRNA duplex buffer (BioWorld), and incubated at 90 ° C for 2 minutes and at 37 ° C for 1 hour.
  • siRNAs were electrophoresed on 10% polyacrylamide gel, stained for 5 minutes on EtBr, and the band was confirmed by UV transiluminator. They transfected siRNAs based on the manual provided by Lipofectamine 2000 (Invitrogen) and measured mRNA levels 24 hours later.
  • lasiRNA showed an increased activity compared to siRNA (lasiRNA showed 20% ).
  • siRNA showed higher gene inhibition efficiency than lasiRNA, indicating that lasiRNA exhibited higher overall gene expression suppression efficiency than conventional siRNAs.
  • IC50 of siRNA and lasiRNA showing 90% or more gene inhibition efficiency showed that lasiRNA targeting 9 and 16 nucleotide sequences had the lowest IC50, and modification and self-delivery experiments
  • the 9th base sequence was selected as the final candidate group for the present invention, as shown in Table 2 below.
  • the 5 'end of the asiRNA sense strand was labeled with cy3 and the uptake difference with or without cholesterol was confirmed by fluorescence microscopy.
  • HeLa cells were incubated with cy3-labeled asiRNA constructs at 1 ⁇ M, and after 3 hours, they were observed under a fluorescence microscope to compare the degree of delivery into cells
  • HeLa cells were cultured in Dulbecco's modified Eagle's medium (Gibco) supplemented with 10% fetal bovine serum (Gibco) and 100 ⁇ g / ml penicillin / streptomycin in a 100 mm petri dish.
  • Cholesterol-modified lasiRNA was diluted to the appropriate concentration for each single strand Accell siRNA delivery medium (Thermo scientific), and cholesterol single strand was used after incubation at 90 ° C for 20-30 seconds before annealing.
  • Sense strand and antisense strand were mixed and incubated at 90 ° C for 30 seconds and at 37 ° C for 1 hour.
  • the annealed siRNAs were electrophoresed on 10% polyacrylamide gel, stained for 5 minutes on EtBr, Respectively.
  • the cells were washed twice with 1X DPBS (Gibco), and the fluorescence of the cells was observed with Opti-MEM media using a microscope (Olympus IX81, software - MetaMorph).
  • PS phosphorothioate
  • chol-lasiRNA-PS (N) PS modified lasiRNA
  • chol-lasiRNA-PS (N) structures were transfected into HeLa cells at 10 nM, and the expression level of CTGF mRNA was measured by real-time PCR 48 hours later. Twenty-four hours before the experiment, 2.5X10 4 HeLa cells were seeded in a 24-well plate, and each lasiRNA was transfected using lipofectamine 2000 according to the protocol. The cells were cultured in a 5% CO 2 incubator for 48 hours, and mRNA levels were measured by the method of Example 1.
  • chol-lasiRNA-PS (N) structures with various PS modifications were incubated with HeLa and CTGF mRNA level was measured to compare the gene suppression efficiency .
  • each lasiRNA was treated at a concentration of 0.1 ⁇ M, 0.3 ⁇ M, and 1 ⁇ M, and chol-lasiRNA-PS7 (Table 4) targeting MyD88 was used as a control. That is, the expression of CTGF mRNA was measured by real-time PCR 48 hours after incubation of chol-lasiRNA-PS (N) constructs targeting CTGF or MyD88 in HeLa cells.
  • chol-lasiRNA-PS4 showed only about 55% of the gene inhibition efficiency even at 1 ⁇ M, which is the highest concentration, and chol-lasiRNA-PS7 and chol-lasiRNA-PS12 The expression of CTGF was inhibited by about 95% at 1 ⁇ M.
  • the results of CTGF mRNA levels after incubation of each construct at lower concentrations showed that PS12 inhibited CTGF gene expression most efficiently at low concentrations.
  • Chol-lasiRNA-PS17 showed only about 50% inhibition of gene expression even when incubated at a high concentration (1 ⁇ M) as in the case of transfection. it is necessary to optimize the number of PS modifications according to the reduction of silencing activity.
  • chol-lasiRNA-PS7 targeting MyD88 there was no gene-inhibiting efficiency against CTGF, and it was confirmed that the gene expression inhibition by cp-lasiRNA constructs was nucleotide sequence-specific.
  • cp-lasiRNA was prepared by combining 31 nt antisense or 21 nt antisense with the same 16 nt sense strand and then treated with A549 cell line.
  • CTGF cp-lasiRNA
  • CTGF cp-lasiRNA
  • CTGF cp-lasiRNA
  • CTGF cp-lasiRNA
  • CTGF cp-lasiRNA
  • CTGF cp-lasiRNA
  • the nucleic acid molecules were transfected into the A549 cell line (ATCC) in the same manner as in Example 1, or incubated in the same manner as in Example 2, and the expression level of the target gene mRNA was measured by real-time PCR 24 hours later.
  • the mean and SD of the two repeated experiments are shown in Fig. 6 (A) shows the gene inhibition efficiency of CTGF-targeted cp-lasiRNA with 21 mer antisense and (B) shows the gene suppression efficiency of CTGF-targeted cp-lasiRNA with 31 mer antisense.
  • the primer of Example 1 was used.
  • the nucleic acid molecule according to the present invention is capable of designing a nucleic acid molecule having an antisense strand having a variable length of 19 nt to 31 nt, and can efficiently suppress the target gene.
  • the 31 nt length is more efficient than the 21 nt antisense And that the target gene inhibition is possible.
  • Example 5 In vivo efficacy of cp-asiRNA targeting CTGF
  • target gene silencing was performed according to the injection amount of different CTGF cp-asiRNA in the rat skin.
  • Four different amounts of cp-asiRNA of 1.0, 0.7, 0.4, or 0.1 mg per injection were injected into the rats and 24 hours later, skin biopsy samples were collected at the injection site.
  • Quantitative real-time reverse transcription PCR (qRT-PCR) analysis was performed to identify CTGF mRNA levels.
  • cp-asiRNA As a result, as shown in Fig. 7A, it was confirmed that intracutaneous injection of cp-asiRNA induces strong target gene silencing in a dose-dependent manner.
  • scrambled (SC) cp-asiRNA (cp-asiRNA with scrambled sequence used as negative control) (1 mg / injection) did not decrease CTGF mRNA levels.
  • Specific knockdown by cp-asiRNA was also confirmed in the target protein analysis 72 hours after intradermal injection.
  • Figure 7b a significant reduction in CTGF protein was observed in samples treated with cp-asiRNA as compared to samples treated with SC cp-asiRNA (1 mg / injection).
  • Western blot analysis was quantified with ImageJ software (National Institutes of Health, Bethesda, MD), and GAPDH was labeled as loading control.
  • Example 6 Effect of cp-asiRNA targeting CTGF on target gene inhibitory effect in eye tissue
  • CTGF cp-asiRNA nucleotide sequence pairs of SEQ ID NOS: 151 and 152
  • CTGF cp-asiRNA 8 ⁇ g was administered intravitreal injection (IVT) and the protein expression of target gene CTGF was analyzed by separating retinal pigment epithelium (RPE) after 2 or 4 weeks.
  • RPE retinal pigment epithelium
  • the laser-induced CNV model of rat and rodents has been used as a standard model for animal CNV experiments despite the shortness of eyes and shortness of onset compared to humans, and it is easy to manufacture and low cost , High reproducibility and efficacy of the drug.
  • the advantage of the Rabbit laser CNV model is that CNV size and onset period are appropriate, but it is difficult to obtain reproducible results with animals with the lowest similarity to human retinal vessels.
  • the advantage of the pig laser CNV model is that it is most similar to human retinal vessels and is beneficial to long-term experiments of drugs, but it is difficult to obtain reproducible experimental results using long-term experimental models.
  • the primer laser CNV model has a relatively small CNV size and it is difficult to show advantages of the laser CNV model as compared with other animals due to price and human problems and it is difficult to obtain reproducible experimental results by using a long term experimental model (PS Bora et al., "Immunotherapy for choroidal neovascularization in a laser-induced mouse model simulating exudative (wet) macular degeneration," Proc. Natl Acad. Sci. USA, vol. 100, no. 5, pp. 2679-84, 2003. and HE Grossniklaus, SJ Kang, and L. Berglin, "Animal models of choroidal and retinal neovascularization," Progress in Retinal and Eye Research, vol. 29, No. 6, pp. 500-519, 2010.).
  • the present inventors selected a laser-induced CNV model of mice and rats.
  • Example 8 Effect of CTGF-targeted cp-asiRNA on mouse CNV model
  • Example 9 Effect of cp-asiRNA targeting CTGF on rat CNV model
  • CTGF-targeted cp-asiRNA was immediately subjected to laser photocoagulation (150 mW, 100 ms, 125 ⁇ m) using BN rats 1 ⁇ l was injected intravitreally (IVT). After 14 days (day 14), CNV staining was performed using isolectin B4 and confocal images of all CNVs were measured using ImageJ software.
  • CTGF subretinal fibrosis
  • SF subretinal fibrosis
  • cp-asiRNA targeting CTGF into the vitreous of sub- SEQ ID NOS: 151 and 152 to confirm that the subretinal fibrosis was protected by CTGF cp-asiRNA.
  • Subretinal fibrosis was induced by a laser-induced choroid neovascularization (CNV) model.
  • CNV laser-induced choroid neovascularization
  • CTGF cp-asiRNA was injected intravitreal injection (IVT) 4 ⁇ g 1 or 7 days after induction of the pathology After 2 weeks, the change of subretinal fibrosis area was confirmed.
  • Collagen IV staining of the retinal pigmented epithelium (RPE) layer to detect subretinal fibrosis developed around CNV resulted in subretinal fibrosis 1 week after CNV induction and increased up to 3 weeks.
  • CTGF cp -asiRNA significantly inhibited the increase of subretinal fibrosis (Fig. 11).
  • Example 11 Treatment efficacy of cp-asiRNA targeting CTGF in a haplotype macular degeneration mouse model
  • CNV volume was significantly decreased by treatment with CTGF cp-asiRNA (FIG. 12).
  • the pharmaceutical composition according to the present invention is a new drug that can be used as an effective and safe wet AMD therapeutic agent including siRNA capable of inhibiting a selective gene in a cell.
  • siRNA capable of inhibiting a selective gene in a cell.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 결합 조직 성장 인자(CTGF)를 표적으로 하는 RNA 복합체를 유효성분으로 포함하는 노인성 황반변성(AMD)의 예방 또는 치료용 약학 조성물에 관한 것으로, 보다 상세하게는 결합 조직 성장 인자를 코딩하는 mRNA와 상보적인 영역을 포함하는 안티센스 가닥과, 상기 안티센스 가닥과 상보적 결합을 형성하는 센스 가닥을 포함하고, 상기 안티센스 가닥과 센스 가닥은 안티센스 가닥의 5' 말단 및 센스 가닥의 3' 말단에서 블런트 말단을 형성하는 것을 특징으로 하는 RNA 복합체를 유효성분으로 포함하는 노인성 황반변성의 예방 또는 치료용 약학 조성물에 관한 것이다. 본 발명에 따른 약학 조성물은 효과적이고 안전한 AMD 치료제로 활용될 수 있으며, 많은 AMD 환자들이 시력을 잃지 않게 하여 삶의 질을 높이고, 막대한 사회적 비용을 절감할 수 있어 유용하다.

Description

결합 조직 성장 인자를 표적으로 하는 RNA 복합체를 함유하는 노인성 황반변성의 예방 또는 치료용 약학 조성물
본 발명은 결합 조직 성장 인자(CTGF)를 표적으로 하는 RNA 복합체를 유효성분으로 포함하는 노인성 황반변성(AMD)의 예방 또는 치료용 약학 조성물에 관한 것으로, 더욱 상세하게는 CTGF를 코딩하는 mRNA와 상보적인 영역을 포함하는 안티센스 가닥과, 상기 안티센스 가닥과 상보적 결합을 형성하는 센스 가닥을 포함하고, 상기 안티센스 가닥과 센스 가닥은 안티센스 가닥의 5' 말단 및 센스 가닥의 3' 말단에서 블런트 말단을 형성하는 것을 특징으로 하는 RNA 복합체를 유효성분으로 포함하는 AMD의 예방 또는 치료용 약학 조성물에 관한 것이다.
노인성 황반변성(Age-related macular degeneration, AMD)은 전 세계적으로 실명 원인 질환의 세 번째를 차지하고 있다(Vision 2020 The Right to Sight. Global initiative for the elimination of avoidable blindness. WHO. 2008). 발병빈도가 높은 안과 질환으로 50대 이상 연령에서 발생하는 실명의 주원인으로 파악되고 있다("Facts About Age-Related Macular Degeneration". National Eye Institute. June 2015. Retrieved 21 December 2015). 2014년 싱가포르 안과연구협회(Singapore Eye Research Institute)의 연구 집계결과에 따르면, 고령화 사회로 진입함에 따라 AMD 환자는 급속히 증가하여 2020년에는 환자 수가 약 2억 명, 2040년에는 약 3억 명에 육박할 것으로 예측된다. 우리나라의 경우 건강보험심사평가원의 자료를 분석한 결과, AMD 진료인원의 추이를 보면, 2009년 약 11만 명에서 2013년 약 15만 명 이상으로 36.6% 증가하였으며, 총 진료비는 2009년 약 224억원에서 2013년 556억으로 2.5배 정도 증가하였다.
AMD는 60대 이상 연령대에서 많이 발생하는 노인성 퇴화질환이지만, 최근 몇 년 사이에 40대 이상의 중 장년층에서의 발병률이 10년 전에 비해 약 9배 가량 증가하는 등 현재 지속적으로 젊은 연령대의 발병 빈도가 높아지고 있어, 이러한 AMD의 급진적 발병은 노인성 퇴화질환의 이해와 치료를 위한 새로운 패러다임의 필요성을 경고하고 있다.
AMD는 진행 상태에 따라 초기단계(early), 중간단계(intermediate), 말기진행단계(advanced)로 구분되는데, 중간단계 AMD가 진행된 환자들의 대부분이 말기진행단계로 발전하여 급속히 실명에 이르게 된다. 중간단계 AMD의 약 80% 이상은 중심황반부에 거대한 진행성 위축현상이 나타나는 geographic atrophy(GA; 지도모양위축증, 진행성 건성 황반변성)로 발전해 실명에 이르게 되고, 그 나머지 약 10-20%는 중심황반부에 신생혈관을 동반한 혈관누출 현상이 나타나는 neovascular/exudative AMD(NVAMD, wet AMD; 습성 황반변성)로 발전해 실명에 이르게 된다.
AMD는 혈관누출을 통한 삼출물이 발생하는 특징인 wet AMD와, GA를 포함한 그 외의 초기, 중간단계의 모든 AMD인 dry AMD(건성 황반변성)로 분류된다. 초기 모든 AMD는 dry AMD 형태로 발생하며, 말기 진행성 퇴화단계에서 wet AMD와 GA로 발전된다. Vascular endothelial growth factor(VEGF; 혈관내피세포성장인자)는 생리적/병적 혈관생성을 주도하는 가장 유력한 인자로 알려져 있어 항VEGF 치료제들이 현재 모든 wet AMD 환자들에게 사용되고 있다. 대표적인 항VEGF 치료제로 루센티스(Lucentis), 아일리아(Eylea), 아바스틴(Avastin) 등이 있고 이들을 한 달에 한 번씩 직접 유리체 내로 투여(intravitreal injection: IVT)하는 치료법이 사용되고 있다. 기존의 항VEGF 치료제들은 단기간에는 wet AMD 환자들의 시력의 악화를 막는 것으로 알려져 있으나 문제는 장기간 치료 시 그 부작용과 인체 저항성 등이 보고되고 있어 wet AMD와 같은 지속적인 치료를 해야 하는 진행성 퇴화병변을 위한 완전한 치료제는 아니다. 항VEGF 치료제는 장기간의 투여 시 고가의 치료비용으로 환자부담이 커질 뿐 아니라, 부작용으로 시력저하, 더 심각한 wet AMD로의 재발, GA의 발생률 높임(1-2년 이내), 출혈, 감염, 망막세포 및 시신경저해, 통증 등이 보고되고 있다.
AMD가 진행되어 시력을 잃어 가는 단계로 접어들면 시력을 회복시키기는 어렵다. AMD 환자의 비역가성 실명을 막기 위해서는 AMD의 발병 원인을 이해하고 중요 역할을 담당하는 선택적 유전자 스크리닝과 그들의 억제를 통해 근원적인 병의 진행을 막는 안전한 치료법의 개발이 필요하다.
유전자 발현을 특이적으로 억제하는 siRNA(small-interfering RNA)를 이용한 기술이 기존의 치료제의 단점을 극복하기 위한 획기적인 신약 개발 기술로 새롭게 주목 받고 있다. siRNA는 염기서열 특이적으로 표적 유전자의 발현을 억제할 수 있는 짧은 길이(19~21bp)의 이중가닥 RNA로, 효과적인 유전자 억제 효율성과 표적 특이성에 기인하여 현재 치료가 어려운 암, 바이러스의 감염, 및 유전병 등 다양한 질병에 대한 치료제로 각광 받고 있다.
RNAi(RNA interference)는 현재까지 알려진 가장 효율적인 유전자 조절 기술로, 기존 항VEGF 치료법들과 달리 발병 과정에서 작용하는 원인유전자를 직접 억제함으로써 AMD의 초기 단계부터의 치료가 가능한 치료제를 개발할 수 있다. 기존의 항체치료제나 저분자 화합물 치료제들은 이미 합성된 질병 관련 단백질들의 활성을 억제하는 메커니즘으로 효력범위의 한계가 있으나 siRNA 치료제는 표적하는 단백질의 mRNA와 상보적으로 결합하여 서열 특이적으로 유전자의 발현을 조절하기 때문에 표적으로 할 수 있는 대상에 제한이 없다. siRNA의 뛰어난 치료 효과 및 다양한 적용범위에도 불구하고 기존 RNAi 기술에는 효과적인 전달 시스템의 부재, 비특이적인 면역반응 유도, 오프-타겟 효과 등의 부작용을 갖고 있다.
본 발명자들은 기존 siRNA의 문제점들을 완전히 극복한 cp-asiRNA 기술을 독자적으로 개발하였다(한국특허공개 제1020130130653호 및 제1020150118061호). asiRNA(비대칭 RNA)는 기존의 siRNA보다 더 짧은 이중가닥 길이를 가지면서도 높은 유전자 억제 효율을 갖는 비대칭형 RNAi 유도 구조로, 기존 siRNA 구조 기술에서 발견되었던 비특이적 면역반응, 오프-타겟 효과와 같은 부작용을 완화시킬 수 있는 특징이 있으며, 세포 내 관통능을 가진 cp-asiRNA는 RNA에 화학적, 구조적 변형을 적용하여 전달 시스템의 도움 없이 세포 내로 자가 전달이 가능하며, 세포 내에서 선택적인 유전자의 억제가 가능하다.
한편, 결합 조직 성장 인자(Connective tissue growth factor, CTGF/CCN2)는 matricelluar protein의 하나로 세포의 분화, 성장, migration, ECM production, adhesion 등에서 중요한 역할을 하는 것으로 알려져 있다. 다양한 장기에서 fibrosis를 유도하여 장기의 기능에 손상을 일으키는 chronic fibrotic disorders의 경우, fibrotic disorder가 일어나는 조직에서 CTGF가 과 발현 되는 것으로 확인되었으며, 피부의 경우에는 CTGF와 fibrosis의 관계가 비교적 잘 연구되어 있다. 병리학적으로는, 전장 CTGF 분자는 결합 조직 세포의 과다증식 및 세포외 매트릭스의 과다침착이 있는 상태에 관여하는 것으로 보고되어 있다. CTGF는 또한 혈관 내피세포 이동 및 증식 및 혈관신생에 관련된 상태와도 연관이 있는 것으로 당업계에 알려져 있다.
이에 본 발명자들은 wet AMD 환자를 치료할 수 있는 새로운 안전한 약물을 개발하고자 예의 연구 노력한 결과, cp-asiRNA 기술을 이용한 AMD 예방 또는 치료용 약학 조성물을 개발하였다. 결합 조직 성장 인자(CTGF)를 표적으로 하는 cp-asiRNA가 wet AMD의 주된 현상인 맥락막신생혈관(choroidal neovascularization, CNV) 발생을 억제함을 확인하고, 본 발명을 완성하였다.
본 배경기술 부분에 기재된 상기 정보는 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것이며, 이에 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 있어 이미 알려진 선행기술을 형성하는 정보를 포함하지 않을 수 있다.
발명의 요약
본 발명의 목적은 유전자 발현을 특이적으로 억제하는 siRNA를 이용하여 기존 치료제의 단점을 극복한 노인성 황반변성의 예방 또는 치료용 약학 조성물을 제공하는 데 있다.
상기 목적을 달성하기 위하여, 본 발명은 결합 조직 성장 인자(Connective tissue growth factor, CTGF)를 표적으로 하는 RNA 복합체를 유효성분으로 포함하는 노인성 황반변성(Age-related macular degeneration, AMD)의 예방 또는 치료용 약학 조성물을 제공한다.
본 발명은 또한, 상기 RNA 복합체를 투여하는 단계를 포함하는 노인성 황반변성(AMD)의 예방 또는 치료 방법을 제공한다.
본 발명은 또한, 노인성 황반변성(AMD)의 예방 또는 치료를 위한 상기 RNA 복합체의 용도를 제공한다.
본 발명은 또한, 노인성 황반변성(AMD)의 예방 또는 치료용 약제 제조를 위한 상기 RNA 복합체의 사용을 제공한다.
도 1은 표 1의 CTGF를 표적으로 하는 24종의 서열에 대한 siRNA, asiRNA, lasiRNA 구조체들의 유전자 억제 효율을 나타내는 그래프이다.
도 2는 콜레스테롤 변형에 따른 lasiRNA의 세포 내 흡수 효율 증가를 나타내는 형광 현미경 관찰 사진이다.
도 3은 Phosphorothioate(PS) 변형에 따른 chol-lasiRNA의 세포 내로의 흡수 효율 증가를 나타내는 형광 현미경 관찰 사진이다.
도 4는 Phosphorothioate(PS) 변형에 따른 chol-lasiRNA의 유전자 감소 효과를 비교한 그래프이다(각 그래프는 3회 반복 실험의 평균과 SD를 나타냄).
도 5는 다양한 cell penetrating lasiRNA(cp-lasiRNA)들의 유전자 억제 효율 비교한 그래프이다(괄호 안의 CTGF 또는 MyD88은 cp-lasiRNA들의 표적 유전자를 나타냄).
도 6은 안티센스 가닥 길이에 따른 CTGF 발현 효율을 나타내는 그래프이다.
도 7은 (a)는 CTGF cp-asiRNA를 주입한 랫 피부의 CTGF mRNA 수준을 나타내는 그래프이며, (b)는 cp-asiRNA를 처리한 샘플에서 CTGF 단백질 감소를 나타내는 그래프이며, (c)는 랫 피부에서의 cp-asiRNA의 분포를 Laser scanning confocal microscopy로 분석한 결과이다(Scale bar ¼ 1 mm, **P < 0.01 compared to the untreated skin sample).
도 8은 CTGF cp-asiRNA의 처리에 의해 표적 유전자 CTGF의 단백질 발현이 억제되는 것을 보여주는 그래프이다.
도 9는 마우스 wet AMD model에서 CTGF cp-asiRNA를 처리하였을 때, CNV 발생을 유의적으로 방어하는 것을 보여주는 사진(ImageJ software를 이용) 및 그래프이다.
도 10은 랫 wet AMD model에서 CTGF cp-asiRNA를 처리하였을 때, CNV 발생을 유의적으로 방어하는 것을 보여주는 사진(ImageJ software를 이용) 및 그래프이다.
도 11은 CTGF cp-asiRNA 투여에 의해 망막하 섬유증 증가가 유의적으로 방어되는 것을 보여주는 사진 및 그래프이다.
도 12는 습성 황반변성 모델에서 CTGF cp-asiRNA의 처리에 의해 CNV volume이 유의적으로 감소하는 것을 보여주는 그래프이다.
발명의 상세한 설명 및 바람직한 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명의 상세한 설명 등에서 사용되는 주요 용어의 정의는 다음과 같다.
"RNAi(RNA interference)"란, 목적유전자의 mRNA와 상동인 서열을 가지는 가닥과 이것과 상보적인 서열을 가지는 가닥으로 구성되는 이중가닥 RNA(dsRNA)를 세포 등에 도입하여 목적유전자 mRNA의 분해를 유도함으로써 목적유전자의 발현을 억제하는 메카니즘을 의미한다.
"siRNA(small interfering RNA)"란, 서열 특이적으로 효율적인 유전자 발현 억제(gene silencing)를 매개하는 짧은 이중 가닥의 RNA(dsRNA)를 의미한다.
"안티센스 가닥(antisense strand)"이란 관심 있는 목적 핵산(target nucleic acid)에 실질적으로 또는 100% 상보적인 폴리뉴클레오티드로서, 예를 들어 mRNA(messenger RNA), mRNA가 아닌 RNA 서열(e.g.,microRNA, piwiRNA, tRNA, rRNA 및 hnRNA) 또는 코딩 또는 비코딩 DNA 서열과 전체로서 또는 일부로서 상보적일 수 있다.
"센스 가닥(sense strand)"이란 목적 핵산과 동일한 핵산 서열을 갖는 폴리뉴클레오티드로서, mRNA(messenger RNA), mRNA가 아닌 RNA 서열(e.g., microRNA, piwiRNA, tRNA, rRNA 및 hnRNA) 또는 코딩 또는 비코딩 DNA 서열과 전체로서 또는 일부로서 동일한 폴리뉴클레오티드를 말한다.
"유전자"란 최광의의 의미로 간주되어야 하며, 구조 단백질 또는 조절 단백질을 암호화할 수 있다. 이때, 조절단백질은 전사인자, 열 충격단백질 또는 DNA/RNA 복제, 전사 및/또는 번역에 관여하는 단백질을 포함한다. 본 발명에 있어서, 발현 억제의 대상이 되는 목적유전자는 바이러스 게놈에 내재된 것으로, 동물유전자로 통합되거나 염색체 외 구성요소로서 존재할 수 있다. 예컨대, 목적유전자는 HIV 게놈상의 유전자일 수 있다. 이 경우, siRNA 분자는 포유동물 세포 내 HIV 유전자의 번역을 불활성화시키는데 유용하다.
본 발명의 구체적 실시예에서 결합 조직 성장 인자를 표적으로 하는 세포 내 관통능을 가진 비대칭 siRNA가 노인성 황반변성에 따른 시력 감소의 원인으로 알려진 맥락막신생혈관(CNV) 발생을 억제시키는 것을 확인하였다.
따라서, 본 발명은 일 관점에서 결합 조직 성장 인자(Connective tissue growth factor, CTGF)를 코딩하는 mRNA와 상보적인 영역을 포함하는 안티센스 가닥과, 상기 안티센스 가닥과 상보적 결합을 형성하는 센스 가닥을 포함하고, 상기 안티센스 가닥과 센스 가닥은 안티센스 가닥의 5' 말단 및 센스 가닥의 3' 말단에서 블런트 말단을 형성하는 것을 특징으로 하는 RNA 복합체를 유효성분으로 포함하는 노인성 황반변성(Age-related macular degeneration, AMD)의 예방 또는 치료용 약학 조성물에 관한 것이다.
본 발명에 있어서, 상기 안티센스 가닥은 16 내지 121nt(뉴클레오티드), 바람직하게는 24 내지 121nt 길이일 수 있다. 안티센스 가닥은 CTGF를 코딩하는 mRNA와 상보적인 일부 영역을 포함하며 이때, CTGF를 코딩하는 mRNA와 상보적인 일부 영역을 포함하는 영역의 길이는 16 내지 31nt, 19 내지 31nt 또는 19 내지 21nt인 것을 특징으로 할 수 있다. 아울러, 센스 가닥은 13 내지 25nt, 13 내지 21nt 또는 16 내지 21nt의 길이를 갖는 것을 특징으로 할 수 있다.
본 발명에 있어서, 바람직하게는, 상기 RNA 복합체는 CTGF를 코딩하는 mRNA와 상보적인 일부 영역을 포함하는 24 내지 121nt 길이의 안티센스 가닥과, 상기 안티센스 가닥의 CTGF를 코딩하는 mRNA와 상보적인 일부 영역과 상보적 결합을 형성하는 영역을 갖는 13 내지 21nt 길이의 센스 가닥으로 구성되는 것을 특징으로 할 수 있다. 더 바람직하게는, 상기 안티센스 가닥의 길이는 21 내지 31nt이고, 상기 센스 가닥의 길이는 16 내지 21nt 인 것을 특징으로 할 수 있다.
본 발명의 일 실시예에서는 이와 같은 구조를 갖는 siRNA를 CTGF를 표적으로 하는 서열에 대하여 제작한 결과, 기존의 siRNA에 비하여 전반적으로 더 높은 유전자 발현 억제 효율을 나타내는 경향성이 있음을 확인하였다. 본 발명자들은 상기와 같이 센스 가닥과 상보적 결합을 형성하지 않는 긴 단일가닥 영역을 갖는 RNAi를 유도하는 이중 가닥의 핵산 분자, 즉 긴 안티센스 가닥을 가지는 siRNA를 'lasiRNA'로 명명하였다.
lasiRNA는 기존의 siRNA보다 더 짧은 이중가닥 길이를 가지면서도 높은 유전자 억제 효율을 갖는 비 대칭형 RNAi 유도 구조이다. 또한 긴 overhang 구조의 antisense 역할에 기인하여, siRNA나 asiRNA에 비하여 증가된 최대 유전자 억제 효율을 가져, 기존의 구조들을 대체하여 치료제 개발에 이용될 것으로 기대되고 있다. 또한 다른 구조들에 비하여 더 긴 overhang의 길이를 가지며, overhang의 다양한 modification에도 높은 활성을 유지하는 특성이 있어 비교적 많은 chemical modification의 자유로운 도입이 가능하여 다양한 기능을 추가할 수 있는 특징이 있다.
이러한, lasiRNA는 상기 안티센스 가닥의 CTGF를 코딩하는 mRNA와 상보적인 일부 영역의 길이는 19 내지 21nt인 것을 특징으로 할 수 있다. 따라서, 상기 안티센스 가닥은 센스 가닥과 결합하지 않는 단일 가닥 영역을 포함하며, 바람직하게는 안티센스 가닥은 단일 가닥 영역에 안티센스 DNA, 안티센스 RNA, 라이보자임 및 DNAzyme으로 구성된 군에서 선택되는 핵산올리고뉴클레오티드를 추가로 포함하는 것을 특징으로 할 수 있다.
19 내지 21nt 길이의 안티센스 가닥 및 13 내지 16nt 길이의 센스 가닥으로 구성된 siRNA 분자로서, 안티센스 가닥의 5' 방향의 말단이 블런트 말단(blunt end)인 siRNA 구조체는 siRNA의 센스 가닥에 의한 오프-타겟 효과의 발생이나 타 RNAi 기작을 저해함 없이 우수한 목적 유전자 발현 억제 효율을 제공하는 것으로(대한민국 공개특허 10-2009-0065880), 이러한 siRNA에 본 발명에 따른 구조를 적용시키는 경우 오프-타겟 효과를 최소화하면서 안티센스 가닥의 단일가닥 영역에 포함되는 핵산올리고뉴클레오티드에 의한 상기와 같은 효과를 동시에 나타낼 수 있다.
"오프-타겟 효과(Off-target effect)"란 본래 siRNA는 안티센스 가닥과 상보적인 서열을 갖는 mRNA의 분해를 유도하여 해당 mRNA의 유전자 발현을 억제하는 효과를 얻기 위하여 사용하는 것임에 불구하고, siRNA의 센스 가닥에 의해 타 mRNA의 분해가 발생하게 되는 경우 센스 가닥에 의해 발생하는 이러한 예상치 못한 타 mRNA의 분해 내지 해당 유전자의 발현 억제 효과 및 siRNA의 안티센스 가닥이 잘못된 타겟과 페어링하여 타 mRNA의 분해가 발생하는 안티센스 가닥에 의한 타 mRNA의 분해 내지 해당 유전자의 발현 억제효과를 모두 포함하는 것이다.
본 발명에 있어서, 상기 안티센스 가닥 중 센스 가닥과 상보적 결합을 형성하지 않는 단일 가닥 영역은 직접 또는 링커에 의하여 상기 센스 가닥과 상보적 결합을 형성하는 영역에 연결될 수 있으며, 이때 링커는 화학적 링커(chemical linker)임을 특징으로 할 수 있다. 이때, 상기 화학적 링커는 핵산(a nucleic acid moiety), PNA(a PNA moiety), 펩타이드(a peptide moiety), 다이설파이드 결합(a disulfide bond) 또는 폴리에틸렌 글리콜(a polyethylene glycol moiety)인 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 안티센스 가닥은 단일 가닥 영역에 상기 CTGF를 코딩하는 mRNA와 상보적인 서열을 추가로 함유하거나 상보적이지 않은 서열을 함유하는 것을 특징으로 할 수 있고, 상보적인 경우에 있어서, 본 발명에 따른 siRNA의 CTGF를 코딩하는 mRNA에 상보적인 영역과 연속적으로 위치할 수 있고, 멀리 떨어져 위치할 수도 있다. 마찬가지로, siRNA가 표적하는 sequence와 상기 단일가닥 영역의 ribozyme이나 DNAzyme이 표적하는 sequence는 연속적으로 위치할 수도 있고, 멀리 떨어져 위치할 수도 있다. 또한, 상기 안티센스 가닥의 단일 가닥 영역이 상기 siRNA의 목적유전자와 상보적인 서열을 갖는 경우에 있어서, 단일가닥 영역에 포함되는 서열이 안티센스 DNA 또는 안티센스 RNA이면 그 서열과 siRNA의 목적유전자의 서열이 약 70-80% 이상, 바람직하게는 약 80-90% 이상, 보다 더 바람직하게는 약 95-99% 이상 서로 상보적인 것을 특징으로 할 수 있고, 단일가닥 영역이 라이보자임 또는 DNAzyme이면 그 서열과 siRNA의 목적유전자의 서열이 약 50-60% 이상 서로 상보적인 것을 특징으로 할 수 있다.
상기 단일 가닥 영역은 5 내지 100nt일 수 있다. 5nt 이하이면 유전자 발현 억제 효율의 증가 효과가 미비하며, 100nt이상인 경우 RNA 분자의 합성효율이 저하된다. 또한, 상기 단일가닥 영역은 바람직하게는 9 내지 100nt일 수 있으며, 또는 50nt이하의 길이를 갖는 것을 특징으로 할 수 있으며, 더욱 바람직하게는 10 내지 15nt의 길이를 갖는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 센스 가닥은 서열번호 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141 및 143으로 구성된 군에서 선택되는 것을 특징으로 할 수 있다. 더욱 바람직하게는, 서열번호 49, 51 및 53으로 구성된 군에서 선택되는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 안티센스 가닥은 서열번호 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142 및 144로 구성된 군에서 선택되는 것을 특징으로 할 수 있다. 더욱 바람직하게는, 서열번호 50, 52 및 54로 구성된 군에서 선택되는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 RNA 복합체는 서열번호 49 및 50의 염기서열쌍; 서열번호 51 및 52의 염기서열쌍; 및 서열번호 53 및 54의 염기서열쌍으로 구성된 군에서 선택된 염기서열쌍을 갖는 이중가닥 핵산 분자로 이루어진 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 RNA 복합체는 화학적 변형을 포함하는 것을 특징으로 할 수 있다.
상기 화학적 변형은 뉴클레오티드 내 당 구조의 2' 탄소 위치에서 -OH기가 -CH3(메틸), -OCH3(methoxy), -NH2, -F(불소), -O-2-메톡시에틸 -O-프로필(propyl), -O-2-메틸티오에틸(methylthioethyl), -O-3-아미노프로필 또는 -O-3-디메틸아미노프로필로 치환; 뉴클레오티드 내 당(sugar) 구조의 산소가 황으로 치환; 뉴클레오티드 결합이 포스포로티오에이트(phosphorothioate), 보라노포페이트(boranophosphate), 또는 메틸포스포네이트(methyl phosphonate)로 변형; PNA(peptide nucleic acid), LNA(locked nucleic acid) 또는 UNA(unlocked nucleic acid) 형태로의 변형; 및 콜레스테롤 또는 세포 침투 펩타이드 결합으로 구성된 군에서 선택된 하나 이상을 포함하는 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다. 핵산 분자의 전달능을 높이기 위해서 2' 탄소 위치에서 -OH기가 -Br, -Cl, -R, -R'OR, -SH, -SR, -N3 및 -CN(R= alkyl, aryl, alkylene) 중 어느 하나로도 치환될 수 있다.
상기 화학적 변형은 적어도 1종의 뉴클레오티드가 LNA(locked nucleic acid), UNA(unlocked nucleic acid), PNA(peptide nucleic acid) 중 어느 하나로 치환된 것임을 특징으로 할 수 있으며, 상기 화학적 변형은 본 발명에 다른 RNA 복합체가 지질, 세포 침투 펩타이드(cell penetrating peptide) 및 세포 표적 리간드로 구성된 군에서 선택되는 하나 이상과 결합되는 것을 특징으로 할 수 있다.
본 발명의 일 실시예에서는, 콜레스테롤 변형 및 PS(Phosphorothioate) 변형을 수행하여, 콜레스테롤의 결합이 lasiRNA의 세포 투과능을 높이는 것이 확인되었지만, 충분한 수의 PS가 도입되지 않는 경우 콜레스테롤만으로는 별도의 세포 전달체 없이 효과적인 표적 유전자 억제를 유도하기에 충분하지 않음을 확인하였다. 이때 PS 변형의 도입은 그 도입 개수에 비례하여 세포 투과능을 높이는 것으로 나타났는데, PS 변형이 너무 많아지는 경우에는 lasiRNA가 RNAi에 의한 유전자 억제를 유도하지 못하는 것으로 확인되었다. 따라서, 세포와 함께 incubation한 뒤 유전자 억제 효율의 비교를 통하여 최적화된 PS modification의 개수를 확립하였다. 즉, 본 발명에 따른 RNA 복합체는 1 내지 48개, 바람직하게는 1 내지 31개, 더욱 바람직하게는 2 내지 17개, 더욱 바람직하게는 4 내지 17개 또는 12 내지 17개의 뉴클레오티드의 포스포페이트 백본이 포스포로티오에이트로 치환되어 있는 것을 특징으로 할 수 있다.
이때, 상기 안티센스 가닥에 포함되어 있는 뉴클레오티드의 포스페이트 백본이 포스포로티오에이트로 치환되어 있는 것을 특징으로 할 수 있으며, 또한, 상기 안티센스 가닥 중 CTGF와 상보적인 영역 이외의 영역의 뉴클레오티드의 포스페이트 백본이 포스포로티오에이트로 치환되어 있는 것을 특징으로 할 수 있다. 상기 안티센스 가닥에 포함되어 있는 1 내지 31개, 바람직하게는 1 내지 17개, 더욱 바람직하게는 2 내지 17개, 더욱 바람직하게는 4 내지 17개, 또는 12개 내지 17개의 뉴클레오티드의 포스페이트 백본이 포스포로티오에이트로 치환되어 있는 것을 특징으로 할 수 있다. 아울러, 상기 센스 가닥에 포함되어 있는 1 내지 21개, 바람직하게는1 내지 17개, 더욱 바람직하게는 2 내지 17개, 더욱 바람직하게는 4 내지 17개, 또는 12개 내지 17개의 뉴클레오티드의 포스페이트 백본이 포스포로티오에이트로 치환되어 있는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 화학적 변형은 센스 가닥 중 뉴클레오티드 포스페이트 백본이 하나 이상의 포스포로티오에이트로 치환되어 있으며, 뉴클레오티드내 당 구조의 2' 탄소 위치에서 -OH기가 하나 이상의 O-알킬로 치환되고, 추가로 3'말단에 친유성 화합물이 결합된 것을 특징으로 할 수 있다.
상기 친유성 화합물은 소수성 변형을 가져오는 것으로서, 예시적으로 지질, 친유성 펩타이드 또는 친유성 단백질 등을 이용할 수 있다. 이에 제한되는 것은 아니나, 지질로는 콜레스테롤, 토코페롤 및 스테아린산, 팔미트산 등과 같은 탄소수 10개 이상의 장쇄 지방산 등을 이용하는 것을 특징으로 할 수 있다.
상기 콜레스테롤 등의 친유성 화합물은 상기 안티센스 가닥 또는 센스 가닥의 5' 말단 또는 3'말단에 결합될 수 있다.
본 발명에 있어서, 상기 안티센스 가닥에서 단일 가닥 영역을 구성하는 염기 중 적어도 하나 이상이 거대한(bulky) 염기 유사체(base analog)를 포함하는 것을 특징으로 할 수 있다. 페닐 그룹을 가지는 deoxyadenosine 유도체와 같은 거대한 염기 유사체가 확장 서열에 포함되어 있으면, 이 확장 서열과 상보적으로 결합하는 mRNA 가닥은 거대한 염기 유사체의 위치에서 cleavage가 일어나게 된다. 이러한 cleavage를 유도하는 거대한 염기 유사체라면 제한 없이 본 발명에 포함될 수 있다.
본 발명에서는, siRNA의 안티센스 가닥을 표적 mRNA 서열과 상보적으로 길게 늘인 핵산 구조체의 경우, 5'말단 부분은 RNAi 기작으로 작용하며 동시에 3'말단 부분은 안티센스 메커니즘으로 작용하거나 5'말단 siRNA 부분을 표적 mRNA로 유도하는 작용을 할 것으로 예측하였다. 이때, 안티센스 3' 말단의 mRNA에 상보적인 서열이 DNA일 경우에는 RNase H 의존적 mRNA 절단을 유도할 수 있다. 또한, 안티센스 3'말단의 단일가닥 영역을 구성하는 염기 중 적어도 하나 이상이 거대한(bulky) 염기 유사체(base analog)를 포함하거나, 단일가닥 영역이 mRNA와 결합하여 벌지(bulge) 구조를 형성하는 경우에도 cleavage를 유도할 수 있을 것으로 예측하였다. 또한, 안티센스 가닥의 단일가닥 영역에 ribozyme이나 DNAzyme을 도입한 핵산 분자의 경우에는 synergistic cleavage를 유도할 수 있을 것으로 예측하였다.
본 발명에 있어서, 상기 화학적 변형을 포함하는 RNA 복합체는 서열번호 149 및 150의 염기서열쌍; 서열번호 151 및 152의 염기서열쌍; 서열번호 153 및 154의 염기서열쌍; 서열번호 155 및 156의 염기서열쌍; 서열번호 157 및 158의 염기서열쌍; 서열번호 159 및 160의 염기서열쌍; 서열번호 163 및 164의 염기서열쌍; 서열번호 163 및 165의 염기서열쌍; 서열번호 166 및 167의 염기서열쌍; 및 서열번호 168 및 169의 염기서열쌍으로 구성된 군에서 선택된 염기서열쌍을 갖는 이중가닥 핵산 분자로 이루어진 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 따른 RNA 복합체는, 기존에 올리고뉴클레오티드를 세포 내로 효과적으로 전달하는 것으로 알려진, liposome, cationic polymer, antibody, aptamer, nanoparticles 등의 다양한 전달체 및 전달 방법과 함께 사용되어 효율적으로 in vitro 및 in vivo 전달을 위하여 사용될 수 있다. 따라서 본 발명에 있어서, 상기 RNA 복합체는 세포 내 관통능(cell-penetrating ability)을 가지는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 RNA 복합체는 맥락막신생혈관(choroidal neovascularization, CNV) 또는 망막하 섬유증(subretinal fibrosis) 발생을 억제하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 RNA 복합체는 CNV 발생을 억제할 수 있다. AMD는 노화에 따라 안구에 발생하여 실명에 이르게 되는 중대한 퇴행성 안질환으로, 시력유지에 핵심 역할을 하는 황반부의 망막색소상피(RPE, retinal pigment epithelium)와 Bruch's membrane 사이에 발생원인이 정확히 밝혀져 있지 않은 단백질-지질 복합체인 드루센(drusen)이 침착되어 망막색소상피퇴화(RPE degeneration)와 맥락막신생혈관(CNV) 등의 비가역적 변성을 발생시키는 것으로 밝혀져 있다. RPE 층에서의 CNV 발생은 3 가지 역동적인 진행과정인 initiation, maintenance, involution 을 따른다. 사람의 CNV의 병적 발생은 sub-RPE 또는 sub-retinal space 즉, RPE와 choroid 혈관층 사이에 있는 Bruch's membrane의 파괴 및 손상과 연속적인 염증성 사이토카인들과 연계된 VEGF의 비정상적 분비에 의해 나타나지만 VEGF의 증가 자체로는 CNV의 발생에 충분하지 않으며, Bruch's membrane의 파열과 구성물의 변화가 CNV 형성의 핵심적 역할을 한다.
본 발명의 일 실시예에서, wet AMD의 동물모델로 널리 쓰이고 있는 레이져 광응고-유도 맥락막신생혈관(laser-induced CNV)의 마우스와 랫 모델을 이용하여, 상기 약학 조성물의 유리체 투여에 의한 CNV 발생의 억제를 확인하였다. 시판되고 있는 wet AMD의 모든 치료제는 혈관성장인자를 억제하는 항VEGF 치료제이나, 본 발명에 따른 약학 조성물은 전형적인 VEGF 신호기전을 따르지 않고 있다는 것을 증명하여 새로운 wet AMD 치료방향을 제시한다.
본 발명에 있어서, 상기 RNA 복합체는 망막하 섬유증 발생을 억제할 수 있다. 본 발명의 일 실시예에서, 레이져-유도 맥락막신생혈관(laser-induced CNV) 모델로 망막하 섬유증을 유도한 마우스의 유리체 내로 CTGF cp-asiRNA를 투여하여 망막하 섬유증 발생을 억제하는 것을 확인하였다.
본 발명에 있어서, 상기 AMD는 습성 노인성 황반변성(wet AMD)인 것을 특징으로 할 수 있다.
AMD는 신생혈관과 출혈을 특징으로 하는 wet AMD와 dry AMD(건성 황반변성)로 구분되어 있으며, 모든 AMD 초기 병증은 dry AMD 형태로 시작되지만 말기 진행성퇴화단계가 되면 약 10-20%가 wet AMD로 발전하고, 약 80%이상이 지도모양위축증을 특징으로 하는 진행성 건성 황반변성(GA; geographic atrophy)으로 발전하게 되며 결국 모두 실명에 이르게 된다.
본 발명은 다른 관점에서, 상기 RNA 복합체를 예방 또는 치료가 필요한 환자에게 투여하는 것을 특징으로 하는 노인성 황반변성(AMD)의 예방 또는 치료 방법에 관한 것이다.
본 발명은 또 다른 관점에서, 노인성 황반변성(AMD)의 예방 또는 치료를 위한 상기 RNA 복합체의 용도에 관한 것이다.
본 발명은 또 다른 관점에서, 노인성 황반변성(AMD)의 예방 또는 치료용 약제 제조를 위한 상기 RNA 복합체의 사용에 관한 것이다.
본 발명에 따른 약학 조성물은 상기 RNA 복합체를 단독으로 포함하거나 하나 이상의 약학적으로 허용되는 담체, 부형제 또는 희석제를 포함하는 약학 조성물로 제공될 수 있으며, 상기 RNA 복합체는 질환 및 이의 중증정도, 환자의 연령, 체중, 건강상태, 성별, 투여 경로 및 치료 기간 등에 따라 적절한 약학적으로 유효한 양으로 약학 조성물에 포함될 수 있다.
상기에서 "약학적으로 허용되는"이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 조성물을 말한다. 상기 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 폴리비닐피롤리톤, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
상기 약학 조성물은 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다. 또한 본 발명의 약학 조성물은 포유동물에 투여된 후 활성 성분의 신속, 지속 또는 지연된 방출을 제공할 수 있도록 당업계에 공지된 방법을 사용하여 제형화될 수 있다. 제형은 멸균 주사 용액 등의 형태일 수 있다.
본 발명의 조성물은 인간을 비롯한 포유동물에 어떠한 방법으로도 투여할 수 있다. 예를 들면, 경구 또는 비경구적으로 투여할 수 있다. 비경구적인 투여 방법으로는 이에 한정되지는 않으나, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 안구 내, 유리체강 내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장내 투여일 수 있다.
상기 약학 조성물이 제형화되어 투여될 경우, 통상적인 방법에 의해 생성된 제제의 형태로서 투여될 수 있다. 투여 형태는 예를 들어 점안제(eye drop), 안 연고, 분말, 과립, 정제, 캡슐, 주사제, 연고 등일 수 있으며, 바람직한 것은 점안제 및 안 연고이다. 이러한 제제는 해당 분야의 일반적인 방법에 따라 제조될 수 있다. 안과적 국소 투여 형태로서, 점적, 스프레이 또는 겔 형태가 가능하며, 또 다른 방법으로 리포좀을 이용하여 눈에 투여할 수 있다. 또한, 펌프-카테테르(pump-catheter) 시스템을 통해 눈물막에 주입될 수 있다. 부가적인 구체예로써, 눈위의 콘택트렌즈에 포함될 수 있으며, 그에 의해 운반되거나 그에 부착될 수 있다. 다른 구현예로, 안구 표면에 가해질 수 있는 스펀지 또는 면봉에 함유된 형태가 이용될 수 있으며, 안구 표면에 가해질 수 있는 액체 스프레이도 이용될 수 있다.
바람직하게는, 본 발명의 상기 약학 조성물은 경구제, 주사제, 점안제 및 연고제로 구성된 군에서 선택되는 어느 하나의 형태로 제조되는 것을 특징으로 할 수 있다.
본 발명에 따른 CTGF를 표적으로 하는 RNA 복합체 또는 이를 유효성분으로 포함하는 약학 조성물은 AMD의 예방 또는 치료에 사용될 수 있다.
본 발명에 따른 RNA 복합체 또는 이를 유효성분으로 포함하는 약학 조성물을 환자에게 투여하는 것을 포함하는 AMD(예를 들어, wet AMD 또는 GA) 치료 방법을 제공한다. 상기 RNA 복합체 또는 약학 조성물은 환자의 눈에 투여되고, 환자에 의해 자가 투여되는 것을 특징으로 할 수 있다. 상기 치료 방법에서, 전달 운반체가 없는 핵산(예를 들어, cp-asiRNA 및 cp-lasiRNA), 전달 시약을 포함한 핵산, 및/또는 본 발명에 따른 RNA 복합체를 발현하는 서열을 포함하는 핵산과 같은 형태로 환자에 투여될 수 있다.
일부 실시 양태에서, 상기 치료 방법에 당업계에 공지된 임의의 핵산 전달 방법이 사용될 수 있다. 이에 제한되는 것은 아니나, 적합한 전달 시약은 예를 들어, Mirus Transit TKO lipophilic reagent, lipofectin, lipofectamine, cellfectin, polycations(예를 들어, polylysine), atelocollagen, nanoplexes 및 리포좀이 있다. 핵산 분자의 전달 운반체로서 아테로콜라겐(atelocollagen)의 사용은 Minakuchi et al. Nucleic Acids Res., 32(13):e109 (2004); Hanai et al. Ann NY Acad Sci., 1082:9-17 (2006); and Kawata et al. Mol Cancer Ther., 7(9):2904-12 (2008)에 기술되어 있다. 예시적인 간섭 핵산 전달 시스템은 미국 특허 제8,283,461호, 제8,313,772호, 제8,501,930호에 제공된다.
상기 치료 방법의 일부 구체 예에서, 리포좀은 본 발명에 따른 RNA 복합체를 환자에게 전달하는데 사용된다. 상기 방법에서 사용하기에 적합한 리포좀은 일반적으로 중성 또는 음전하인 인지질 및 콜레스테롤과 같은 스테롤을 포함하는 표준 소포-형성 지질로부터 형성될 수 있다. 지질의 선택은 일반적으로 원하는 리포좀 크기 및 혈류 중의 리포좀의 반감기와 같은 인자를 고려한다. 리포좀을 제조하기 위한 다양한 방법이 공지되어 있는데, 예를 들어, Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9:467 또는 미국 특허 제4,235,871호, 제4,501,728호, 제4,837,028호 및 제5,019,369호에 개시되어 있다.
본 발명에 따른 약학 조성물은 국소적, 유리체내, 경구적 및 비경구적 투여를 포함하는 임의의 적합한 투여 경로에 의해 전달될 수 있다. 일 구체 예에서, 상기 약학 조성물은 눈에 직접 투여를 통해 국소적으로 전달된다. 약학 조성물 중 RNA 복합체의 실제 투여 수준은 다양할 수 있다. 선택된 투여량 레벨은 사용된 특정 작용제의 활성, 투여 경로, 투여 시간, 사용되는 특정 화합물의 배설 또는 대사 속도, 치료 기간, 나이, 성별, 체중, 환자의 전반적인 건강 및 이전의 병력, 및 의학 분야에서 잘 알려진 인자와 같은 다양한 요인에 좌우될 수 있다. 당업자는 필요한 약학 조성물의 유효량을 쉽게 결정하고 처방할 수 있다. 예를 들어, 의사 또는 수의사는 원하는 치료 효과를 달성하고 원하는 효과가 달성될 때까지 점차적으로 투여량을 증가시키기 위해, 약학 조성물에 사용된 약제의 투여량을 요구되는 수준보다 낮은 수준으로 처방 및/또는 투여할 수 있다. 일반적으로, 본 발명에 따른 RNA 복합체의 적절한 하루 투여량은 치료 효과를 발생시키는데 효과적인 최소 투여량인 RNA 복합체의 양일 것이다. 이러한 유효량은 상기 요인들에 의해 결정된다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: CTGF를 표적으로 하는 RNAi를 유도하는 이중 가닥의 핵산 분자의 스크리닝
효과적인 self-delivery 구조를 위한 다양한 chemical modification의 도입에 앞서, CTGF를 표적으로 하는 고효율의 RNAi를 유도하는 이중 가닥의 핵산 분자를 확보하기 위하여, CTGF에 대한 50종의 표적 서열을 디자인 한 뒤 screening을 진행하였다.
lasiRNA와 기존 RNAi 유도 구조체들과의 CTGF 유전자 억제 효율을 비교하기 위하여, 표 1과 같이, 각 염기 서열을 표적으로 하는 siRNA, asiRNA, lasiRNA 구조체들을 합성하였다. 표 1은 CTGF에 대한 24종의 서열에 대한 siRNA, asiRNA, lasiRNA 구조체들의 염기서열 정보이다(대문자: RNA, 소문자: DNA). 각 염기 서열 및 구조들의 CTGF mRNA발현 억제 효과를 test하기 위하여, 각 구조들을 HaCaT(ATCC)에 10nM로 transfection 한 뒤 Real-time PCR로 CTGF mRNA 발현 정도를 측정하였다.
Figure PCTKR2018011482-appb-T000001
Figure PCTKR2018011482-appb-I000001
Figure PCTKR2018011482-appb-I000002
Figure PCTKR2018011482-appb-I000003
Figure PCTKR2018011482-appb-I000004
Figure PCTKR2018011482-appb-I000005
Figure PCTKR2018011482-appb-I000006
Figure PCTKR2018011482-appb-I000007
Figure PCTKR2018011482-appb-I000008
Figure PCTKR2018011482-appb-I000009
HaCat 세포를 100mm petri dish에 10% fetal bovine serum(Gibco), 100μg/ml penicillin/streptomycin을 첨가한 Dulbecco's modified Eagle's medium(Gibco)에서 배양하였다. Hacat의 경우 transfection하기 직전에 12-well plate에 8X10⁴개의 세포를 seeding하였다. 한편, 상기 siRNA, asiRNA, lasiRNA의 경우 1X siRNA duplex buffer(바이오세상)에 알맞은 농도로 희석하여 90℃에서 2분, 37℃에서 1시간 incubation하였다. Annealing된 siRNA들은 10% polyacrylamide gel에 전기영동 한 후, EtBr에서 5분 staining하여 UV transiluminator를 통해 밴드를 확인하였다. 이들은 Lipofectamine 2000(Invitrogen)에서 제공하는 manual에 기초하여 siRNA를 transfection한 뒤 24시간 후에 mRNA level을 측정하였다.
이때, Transfection 후 Isol-RNA lysis reagent(5PRIME)를 사용하여 total RNA를 추출하였고, 그 중 500ng의 RNA를 cDNA합성에 사용하였다. cDNA는 High-capacity cDNA reverse transcription kit(Applied Biosystems)을 이용하여 제공된 프로토콜에 따라 합성되었다. 합성된 cDNA는 dilution을 통해 농도를 낮춘 후, step one realtime PCR system(Applied Biosystems)을 이용하여 제공된 프로토콜에 따라 정량적인 real-time PCR에 이용하였다. 표적유전자는 유전자에 특이적인 primer와 함께 power SYBR green PCR master Mix(Applied Biosystems)를 이용하여 확인하였다. 실험에 사용된 primer 염기서열은 다음과 같다.
GAPDH-forward 5’-GAG TCA ACG GAT TTG GTC GT-3’(서열번호 145)
GAPDH-reverse 5’-GAC AAG CTT CCC GTT CTC AG-3’(서열번호 146)
CTGF-forward 5’-CAA GGG CCT CTT CTG TGA CT-3’(서열번호 147)
CTGF-reverse 5’-ACG TGC ACT GGT ACT TGC AG-3’(서열번호 148)
24개의 염기 서열에 대한 screening결과, 도 1에 나타난 바와 같이, 총 24개의 염기 서열 중 14개의 서열에서 lasiRNA가 siRNA에 비하여 증가된 activity(lasiRNA가 siRNA 대비 20%이상 증가된 유전자 억제 효율을 나타내는 경우)를 갖는 것으로 확인되었으며, 5종의 서열에서는 siRNA가 lasiRNA에 비하여 더 높은 유전자 억제 효율을 보이는 것으로 나타나, lasiRNA가 기존의 siRNA에 비하여 전반적으로 더 높은 유전자 발현 억제 효율을 나타내는 경향성을 확인할 수 있었다.
특히, 90% 이상의 유전자 억제 효율을 보이는 siRNA와 lasiRNA에 대한 IC50 측정 결과, 9번과 16번 염기서열을 표적으로 하는 lasiRNA가 가장 낮은 IC50를 갖는 것으로 확인 되었고, 이 중 modification과 self-delivery 실험을 위한 최종 후보군으로 9번 염기 서열을 선정하였으며, 이는 하기 표 2와 같다.
Figure PCTKR2018011482-appb-T000002
실시예 2: CTGF를 표적으로 하는 cp-asiRNA의 제조 및 세포 내 uptake 수율 측정
2-1: 콜레스테롤 변형에 따른 영향
콜레스테롤 변형이 asiRNA의 delivery에 미치는 영향을 알아보기 위하여, asiRNA sense strand의 5' 말단을 cy3로 표지한 다음 콜레스테롤 유무에 따른 uptake 차이를 형광 현미경으로 확인하였다. 즉, HeLa 세포에 cy3로 표지된 asiRNA 구조체들을 1μM로 incubation 한 뒤 3시간 후에 형광 현미경으로 관찰하여 세포 내에 전달된 정도를 비교하였다
먼저, HeLa 세포(ATCC)를 100mm petri dish에 10% fetal bovine serum(Gibco), 100μg/ml penicillin/streptomycin을 첨가한 Dulbecco's modified Eagle's medium(Gibco)에서 배양하였다.
콜레스테롤 변형시킨 lasiRNA는 각각의 single strand Accell siRNA delivery media(Thermo scientific)에 알맞은 농도로 희석하여 사용하며, 콜레스테롤이 적용된 single strand는 annealing전에 90℃에서 20~30초간 incubation 후 사용하였다. Sense strand와 antisense strand를 혼합한 후 90℃에서 30초, 37℃에서 1시간 incubation하고, Annealing된 siRNA들은 10% polyacrylamide gel에 전기영동 한 후, EtBr에서 5분 staining 후 UV transiluminator를 통해 밴드를 확인하였다.
Incubation test를 위해서 lasiRNA를 처리하기 24시간 전에 Coverglass-bottom dish(SPL)에 2X105개의 의 HeLa 세포를 seeding하였다. 준비된 dish의 culture media 제거 후 2 ml of 1X DPBS로 두 번 washing해주었다. 37℃ water-bath에서 미리 데워놓은 Accell siRNA delivery media(Thermo scientific) 100μL에 희석해서 준비해 두었던 siRNA를 넣고 배양하였다. 3시간 후 Accell media 제거하고 1X DPBS로 두 번 washing 후, 1μg/ml of Hoechst 33343(Sigma) in Opti-MEM(gibco)으로 37℃에서 10분간 incubation하여 핵을 염색하였다. Hoechst 제거 후 1X DPBS(Gibco)로 두 번 washing 후 Opti-MEM media 넣고 현미경(Microscope - Olympus IX81, software - MetaMorph)으로 세포의 형광을 관찰하였다.
그 결과, 도 2에 나타나 바와 같이, 콜레스테롤 변형에 의한 lasiRNA의 세포 내로의 흡수 효율을 확인한 결과, 콜레스테롤이 없는 경우에는 세포 내에서 cy3 형광이 거의 관찰 되지 않았으나, lasiRNA에 콜레스테롤을 conjugation한 lasiRNA-chol의 경우에는 매우 강한 형광을 나타내는 것을 알 수 있었다.
이는 lasiRNA 구조가 콜레스테롤 변형을 통하여 intracellular delivery가 증가하는 것을 나타낸다.
2-2: PS modification에 따른 영향
추가로, 포스포로티오에이트(PS)를 직접 siRNA에 도입하는 변형을 수행하는 경우, lasiRNA의 uptake 효율을 증가시켜 주는지 확인하기 위하여, 콜레스테롤을 결합시킨 chol-lasiRNA의 안티센스 가닥의 3' overhang에 PS modification을 도입하고 PS modification에 따른 chol-lasiRNA의 uptake효율 변화를 test하였다. HeLa 세포에 cy3로 표지된 chol-lasiRNA-PS(N) 구조체들을 1μM로 incubation한 뒤 3시간 후에 형광 현미경으로 관찰하여 세포 내에 전달된 정도를 비교하였다. 구조체들 간의 세포 투과능의 정확한 비교를 위하여 chollasiRNA-PS0이 최소한의 형광을 보이는 조건을 세팅 후 다른 구조체들의 형광 세기를 비교하였다.
이를 위하여 표 3과 같이, Chol-lasiRNA의 antisense 3' 말단을 시작으로, 0, 4, 7, 12, 17의 PS modification을 도입한 뒤 HeLa 세포와 함께 incubation 또는 transfection하여 실시예 2-1과 같이 형광현미경에서 PS modification의 개수에 따른 delivery 효율의 차이를 관찰하였다.
Figure PCTKR2018011482-appb-T000003
그 결과, 도 3에 나타난 바와 같이, PS modification이 없는 chol-lasiRNA-PS0의 경우 HeLa 세포에서 형광이 거의 관찰되지 않았으며, 다른 샘플들에 비하여 낮은 uptake효율을 보이는 것으로 확인되었다.
아울러, lasiRNA의 안티센스 가닥에 PS modification이 증가함에 따라 점점 밝은 형광을 보이는 것으로 확인 되었으며, 전체 sample들 중 PS가 각 12, 17개 modification 된 chol-lasiRNA-PS12, chollasiRNA-PS17이 가장 밝은 형광을 나타내는 것으로 확인되어, chol-lasiRNA에 PS modification개수를 증가시킴에 따라 internalized 된 lasiRNA의 양이 증가하는 것으로 확인되었다.
실시예 3: CTGF 발현 억제 효율 측정
실시예 2에서 Cy3-labeld lasiRNA를 이용한 internalization 실험 결과, lasiRNA 구조에 cholesterol과 PS modification을 직접 도입하여 delivery vehicle이나 추가적인 시약 없이도 lasiRNA의 효과적인 세포 내 전달이 가능함이 확인되었다. 하지만 siRNA에 다양한 chemical modification을 도입하는 경우, siRNA의 활성을 다소 감소 시키거나 modification에 따라 siRNA의 활성이 급격히 감소하는 것으로 알려져 있는바, 각 modification이 lasiRNA의 활성에 미치는 영향을 알아보기 위하여, 다양한 구조의 lasiRNA를 HeLa cell에 transfection 한 뒤 CTGF mRNA의 expression 변화를 측정하여 각 modification이 lasiRNA의 유전자 발현 억제에 미치는 영향을 측정하였다.
PS modification이 lasiRNA의 유전자 억제 효율에 미치는 영향을 확인하기 위하여, 다양한 구조의 PS modified lasiRNA [chol-lasiRNA-PS(N)]을 HeLa cell에 transfection 한 후 CTGF 유전자의 발현 억제 효율을 측정하였다. 즉, HeLa cells에 chol-lasiRNA-PS(N) 구조체들을 10nM 로 transfection 한 뒤 48시간 후에 real-time PCR로 CTGF mRNA 의 발현 정도를 측정하였다. 그 다음, 실험 수행 24시간 전에 24 well-plate에 2.5X104개의 HeLa 세포를 seeding한 뒤 프로토콜에 따라 lipofectamine 2000을 이용하여 각 lasiRNA들을 transfection하였다. 이 후 48시간 동안 5% CO2 incubator에서 배양한 뒤 실시예 1의 방법에 따라 mRNA level의 발현을 측정하였다.
그 결과, 도 4에 나타난 바와 같이, antisense 가닥에 PS modification이 증가함에 따라 유전자 억제 효율이 감소하는 경향을 보였으며, antisense에 12개 이상의 PS modification을 도입한 경우 약간의 silencing activity의 감소가 관찰 되었다. antisense에 17개의 modification을 도입한 chol-lasiRNA-PS17의 경우 유전자 억제 효율이 급격히 감소하여, CTGF에 대한 발현 억제 효과를 거의 나타내지 못하는 것으로 확인되어 antisense에 PS는 최대 17개 이하로 사용하는 것이 바람직하며 antisense strand에 그 이상의 PS modification은 self-delivery를 위한 modification으로는 적당하지 않음을 확인할 수 있었다. 도 4에서, 각 그래프는 3회 반복 실험의 평균과 SD를 나타낸다.
추가로, PS modification의 증가는 chol-lasiRNA의 자가 세포 전달 효율을 증가시켜주지만, 동시에 그 정도에 따라 lasiRNA의 silencing activity를 감소시키는 문제점이 있다. Vehicle 없이 최적의 silencing을 유도하는 modification 구조를 확립하기 위하여, 다양한 개수의 PS modification을 갖는 chol-lasiRNA-PS(N) 구조들을 HeLa와 함께 incubation 한 뒤 CTGF mRNA level을 측정하여 유전자 억제 효율을 비교하였다. 이때, 0.1 μM, 0.3 μM, 및 1 μM의 농도로 각 lasiRNA들을 처리하였으며, MyD88을 표적으로 하는 chol-lasiRNA-PS7(표 4)를 대조군으로 함께 사용하였다. 즉, HeLa cells에 CTGF 또는 MyD88을 표적으로 하는 chol-lasiRNA-PS(N) 구조체들을 함께 incubation 한 뒤 48시간 후에 real-time PCR로 CTGF mRNA 의 발현 정도를 측정하였다.
Figure PCTKR2018011482-appb-T000004
그 결과, 도 5에 나타난 바와 같이, chol-lasiRNA-PS4 의 경우에는 가장 높은 농도인 1μM 에서도 약 55% 정도의 유전자 억제 효율 밖에 나타내지 못하는 것으로 나타났으며 chol-lasiRNA-PS7, chol-lasiRNA-PS12의 경우 1μM 에서 CTGF의 발현을 약 95% 이상 억제하는 것을 확인할 수 있었다. 더 정확한 유전자 억제 효율 비교를 위해, 더 낮은 농도에서 각 구조체 들을 incubation 한 뒤 CTGF mRNA level을 측정한 결과에서는, PS12가 낮은 농도에서도 가장 효율적으로 CTGF 유전자의 발현을 억제하는 것으로 나타났다. chol-lasiRNA-PS17은 transfection 한 경우와 마찬가지로 높은 농도(1μM)에서 incubation 한 경우에서도 50% 정도의 유전자 발현 억제 효과 밖에 갖지 못하는 것으로 확인되어 너무 많은 수의 PS modification을 도입하는 것보다는 delivery의 증가와 silencing activity의 감소에 따른 적당한 PS modification 개수의 최적화가 필요함을 확인할 수 있었다. 또한, MyD88을 표적으로 하는 chol-lasiRNA-PS7의 경우에는 CTGF에 대한 유전자 억제 효율이 전혀 나타나지 않아, cp-lasiRNA 구조체들에 의한 유전자 발현 억제가 염기 서열 특이적으로 일어남을 확인할 수 있었다.
실시예 4: 안티센스 가닥 길이에 따른 CTGF 발현 억제 효율 조사
본 발명에 따른 핵산 분자의 안티센스 가닥의 길이에 따른 CTGF 발현 억제 효율을 조사하기 위하여, 동일한 16nt의 센스 가닥에 31nt 안티센스 또는 21 nt의 안티센스를 조합하여 cp-lasiRNA를 만든 후 A549 세포주에 처리하였다.
<cp-lasiRNA (CTGF) 31mer>
cp-lasiRNA (CTGF) Sense : 5' CUUACCGACUGGAA*G*A*chol. 3'(서열번호 163)
cp-lasiRNA (CTGF) Antisense 31nt : 5' UCUUCCAGUCGGUAAGCCGCGAGGGCA*G*G*C*C 3' (서열번호 164)
<cp-lasiRNA (CTGF) 21mer>
cp-lasiRNA (CTGF) Sense : 5' CUUACCGACUGGAA*G*A*chol. 3'(서열번호 163)
밑줄: OMe 변형, *: PS (phosphorothioate bond)
cp-lasiRNA (CTGF) Antisense 21nt : 5' UCUUCCAGUCGGUAAGC*C*G*C*G 3' (서열번호 165)
즉, A549 세포주(ATCC)에 상기 핵산분자들을 각각 실시예 1과 같은 방법으로 transfection하거나, 실시예 2와 같이 incubation 한 후, 24시간 후에 real-time PCR로 표적 유전자 mRNA의 발현 정도를 측정하였다. 각 2회 반복 실험의 평균과 SD를 도 6에 나타내었다. 도 6 (A)는 21 mer 안티센스를 갖는 CTGF 표적 cp-lasiRNA의 유전자 억제 효율을, (B)는 31 mer 안티센스를 갖는 CTGF 표적 cp-lasiRNA의 유전자 억제효율을 나타낸다. 실시예 1의 프라이머를 이용하였다.
도 6에 나타난 바와 같이, transfection과 incubation 모두에서 31nt antisense를 갖는 경우가 21nt antisense를 갖는 경우보다 더 높은 표적 유전자 억제 효율을 나타냈다. 즉, 본 발명에 따른 핵산분자는 19nt 내지 31nt의 다양한 길이의 antisense 가닥을 갖는 핵산 분자의 디자인이 가능하고 이를 이용하여 효과적으로 표적 유전자 억제가 가능하지만, 31nt길이를 갖는 경우가 21nt의 antisense 보다 더 효율적으로 표적 유전자 억제가 가능함이 확인되었다.
실시예 5: CTGF를 표적으로 하는 cp-asiRNA의 in vivo 효능
CTGF를 표적으로 하는 cp-asiRNA의 in vivo 분석을 수행하였다. 몇몇 연구는 랫 피부에서 전달 시약의 도움 없이 올리고뉴클레오타이드의 피부 내 주입에 의한 표적 유전자 knockdown을 설명한다(Karen et al., 2014; Sisco et al.,2008).
본 실시예에서는 랫 피부 내에 서로 다른 CTGF cp-asiRNA의 주입량에 따른 표적 유전자 silencing을 실험하였다. 1회 주사 당 1.0, 0.7, 0.4 또는 0.1 mg의 4가지 다른 양의 cp-asiRNA를 랫 피부에 주입하고, 24시간 후, 주사 부위에서 피부 생체검사 샘플을 수집하였다. CTGF mRNA 수준을 확인하기 위해 quantitative real-time reverse transcription PCR(qRT-PCR) 분석을 수행하였다.
그 결과, 도 7a에 나타난 바와 같이, cp-asiRNA의 피부 내 주입은 용량 의존적으로 강력한 표적 유전자 silencing을 유도하는 것을 확인하였다. 반면, 스크램블(SC)된 cp-asiRNA(음성 대조군으로 사용된 스크램블된 서열을 가진 cp-asiRNA)(1 mg/injection)는 CTGF mRNA 수준을 감소시키지 못했다. cp-asiRNA에 의한 특이적 knockdown은 피부 내 주사 72시간 후 표적 단백질 분석에서도 확인되었다. 도 7b에 나타난 바와 같이, SC cp-asiRNA를 처리한 샘플(1 mg/injection)과 비교하여, cp-asiRNA를 처리한 샘플에서 CTGF 단백질의 현저한 감소가 관찰되었다. Western blot 분석은 ImageJ software(National Institutes of Health, Bethesda, MD)로 정량화하였고, GAPDH는 로딩 컨트롤로 표시되었다.
피부 내 주사 후 cp-asiRNA의 분포를 시각화하기 위하여, Cy5.5가 표지된 cp-asiRNA(100 ml from 0.1 mg/ml solution)를 랫 피부 내 주입하였고, 6시간 뒤, 랫 피부에서의 cp-asiRNA의 분포를 Laser scanning confocal microscopy로 분석하였다(Scale bar ¼ 1 mm, **P < 0.01 compared to the untreated skin sample). 그 결과, 도 7c에 나타난 바와 같이, 주사 부위에서 형광 신호의 광범위한 분포가 나타났으며, 이는 cp-asiRNA가 세포로 효과적으로 전달되고, in vivo에서 강력한 표적 유전자 silencing이 뒤따른다는 것을 의미한다.
실시예 6: CTGF를 표적으로 하는 cp-asiRNA의 안구조직에서의 표적 유전자 억제 효과 검증
안구조직에서 CTGF를 표적으로 하는 cp-asiRNA의 표적 유전자 억제효과를 확인하기 위해 랫에 CTGF cp-asiRNA(서열번호 151 및 152의 염기서열쌍)을 처리하고 표적 유전자 억제 효과를 분석하였다. CTGF cp-asiRNA 8μg을 유리체내 주사(intravitreal injection: IVT)로 투여하고 2주 또는 4주 후에 망막 색소 상피(RPE, retinal pigment epithelium)를 분리하여 표적 유전자 CTGF의 단백질 발현을 분석하였다. 분석 결과, CTGF cp-asiRNA의 처리에 의해 표적 유전자 CTGF의 단백질 발현이 억제되는 것이 확인되었다(도 8).
실시예 7: Choroidal Neovascularization(CNV) 모델 선정
사람의 CNV의 전반적인 생물학적 발병 및 진행과 일치하는 이상적인 황반부가 존재하는 동물 CNV 모델은 없으나, CNV 발병의 주요인인 Bruch's membrane의 파열을 유도한 세가지 동물 CNV 모델(laser induced, surgically induced, genetically engineering)이 주로 사용되고 있다.
랫과 마우스(rodents)의 laser-induced CNV 모델은 인간과 비교해 눈의 크기가 작고 발병 시기가 짧은 단점에도 불구하고 꾸준히 동물 CNV 실험의 표준 모델로 이용되고 있으며, 제작이 간편하고, 비용이 저가이며, 높은 재현성과 약물의 효율성 등의 면에서 가장 광범위하게 인정받고 있다. 래빗 laser CNV 모델의 장점은 CNV 크기와 발병 기간이 적당하다는 점이나, 사람 망막 혈관과의 유사성이 가장 낮은 동물로 재현성 있는 실험 결과 확보가 어려운 단점이 있다. 돼지 laser CNV 모델의 장점은 사람의 망막 혈관과 가장 유사하고 약물의 장기실험으로 유익하다는 데 있으나, 장기간 실험 모델을 사용하여 재현성 있는 실험 결과 확보가 어려운 단점이 있다. 영장류 laser CNV 모델은 CNV 크기가 상대적으로 작고, 가격과 인류적인 문제들로 인해 다른 동물들과 비교해서 laser CNV 모델로의 장점을 제시하기 어렵고, 장기간 실험 모델을 사용하여 재현성 있는 실험 결과 확보가 어려운 단점이 있어 랫과 마우스의 CNV 모델과 비교해 큰 장점이 없다(P. S. Bora et al., "Immunotherapy for choroidal neovascularization in a laser-induced mouse model simulating exudative (wet) macular degeneration.," Proc. Natl. Acad. Sci. U. S. A., vol. 100, no. 5, pp. 2679-84, 2003. 및 H. E. Grossniklaus, S. J. Kang, and L. Berglin, "Animal models of choroidal and retinal neovascularization," Progress in Retinal and Eye Research, vol. 29, no. 6. pp. 500-519, 2010.).
따라서, 본 발명에서는 CTGF를 표적으로 하는 cp-asiRNA가 CNV에 미치는 영향을 확인하기 위해, 마우스와 랫의 laser-induced CNV 모델을 선정하였다.
실시예 8: CTGF를 표적으로 하는 cp-asiRNA의 마우스 CNV model에서의 효능
CTGF를 표적으로 하는 cp-asiRNA의 wet AMD 치료효과를 확인하기 위해 마우스에 레이저 광응고 기술을 이용한 laser-induced CNV 모델을 사용하여 효력시험을 수행하였다.
8주령 된 수컷 C57BL/6 마우스를 이용하여 레이저 광응고(150 mW, 100 ms, 125 um)를 실시한 후(day 0) 즉시 CTGF cp-asiRNA(서열번호 151 및 152의 염기서열쌍)을 2μg과 4μg 두 가지 용량으로 각 1μl를 유리체내 주사(intravitreal injection: IVT)하였다. 대조군으로는 어떠한 유전자도 타겟하지 않는 cpLuc을 주사한 그룹을 사용하였다. 7일 후(day 7)에 isolectin B4를 이용해서 CNV 염색을 수행하였고, 모든 CNV의 confocal image들을 ImageJ software를 이용해서 CNV volume을 측정하여 비교하였다. 그 결과, 도 9에 나타난 바와 같이, 마우스 wet AMD 모델에서 CTGF cp-asiRNA을 처리한 모든 그룹에서 laser에 의한 CNV 발달이 효과적으로 저해되었다.
실시예 9: CTGF를 표적으로 하는 cp-asiRNA의 랫 CNV 모델에서의 효능
CTGF를 표적으로 하는 cp-asiRNA의 wet AMD 치료효과를 질병 모델의 기간이 긴 동물에서 확인하기 위해 8주령 수컷 Brwon-Norway(BN) 랫에 레이저 광응고 CNV를 유도하였다. BN 랫을 이용하여 레이저 광응고(150 mW, 100 ms, 125 um)를 실시한 후(day 0) 즉시 CTGF cp-asiRNA(서열번호 151 및 152의 염기서열쌍)를 5μg과 10μg 두 가지 용량으로 각 1μl를 유리체내 주사(intravitreal injection: IVT)하였다. 14일 후(day 14)에 isolectin B4를 이용해서 CNV 염색을 수행하였고, 모든 CNV의 confocal image들을 ImageJ software를 이용해서 CNV volume을 측정하였다. 대조군으로는 10μg siLuc을 1회 주사한 그룹을 이용하였다. 그 결과, 도 10에 나타난 바와 같이, 랫 wet AMD 모델에서 CTGF cp-asiRNA을 처리한 그룹에서 약 52% 이상의 CNV 발달 저해가 확인되었으며, 해당 수치는 CNV 저해 효과를 보이는 타 약물의 효력 수준 범위에 해당한다.
실시예 10: CTGF를 표적으로 하는 cp-asiRNA의 망막하 섬유증에 대한 방어효과 확인
신생혈관 및 혈관누출 이후 나타나는 실명의 원인 중 하나인 망막하 섬유증(subretinal fibrosis: SF)과 CTGF의 연관성을 증명하기 위해 망막하 섬유증을 유도한 마우스의 유리체 내로 CTGF를 표적으로 하는 cp-asiRNA(서열번호 151 및 152의 염기서열쌍)를 투여하여 CTGF cp-asiRNA에 의해 망막하 섬유증이 방어되는지를 확인하였다. 망막하 섬유증은 레이져-유도 맥락막신생혈관(laser-induced choroid neovascularization: CNV) 모델로 유도하였고 CTGF cp-asiRNA는 병증 유도 1일 또는 7일 후 4μg을 단 회 유리체 내 주사(intravitreal injection: IVT)하였으며 2주 후에 망막하 섬유증 면적의 변화를 확인하였다. CNV 주변에 발달한 망막하 섬유증을 확인하기 위해 망막색소상피세포(retinal pigmented epithelium: RPE)층에 collagen IV 염색을 수행한 결과 CNV 유도 1주 후 망막하 섬유증이 발생하고 3주까지 증가하였으나 CTGF cp-asiRNA의 투여에 의해 망막하 섬유증 증가가 유의적으로 방어됨을 확인하였다(도 11).
실시예 11: CTGF를 표적으로 하는 cp-asiRNA의 습성 황반변성 마우스 모델에서 치료 효력 검증
CTGF cp-asiRNA(표 5의 서열번호 166 및 167의 염기서열쌍 또는 서열번호 168 및 169의 염기서열쌍)의 습성 황반변성 치료효과를 확인하기 위해 마우스에 레이져 광응고 기술을 이용한 choroidal neovascularization(laser-induced CNV) 모델을 사용하여 효능시험을 수행하였다.
Figure PCTKR2018011482-appb-T000005
8주령 된 수컷 B6 마우스를 이용하여 레이저광응고(150mW, 125um, 100ms)를 실시한 후, 즉시 0.25μg의 CTGF cp-asiRNA-1과 CTGF cp-asiRNA-2를 1회 유리체 주사하였다. CNV 유도 7일 후, Isolectin B4 염색을 통해 CNV를 확인하였고 Image J software를 이용해서 CNV volume을 측정하여 비교 분석하였다.
분석 결과, CTGF cp-asiRNA의 처리에 의해 CNV volume이 유의적으로 감소하는 것이 확인되었다(도 12).
본 발명에 따른 약학 조성물은 세포 내에서 선택적인 유전자의 억제가 가능한 siRNA를 포함하여, 효과적이고 안전한 wet AMD 치료제로 활용될 수 있는 새로운 약물로서, 많은 AMD 환자들이 시력을 잃지 않고 삶의 질을 향상시킬 수 있도록 할 것이며, 나아가 이들에게 필요한 막대한 사회적 비용을 절감할 수 있어 유용하다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.

Claims (29)

  1. 결합 조직 성장 인자(Connective tissue growth factor, CTGF)를 표적으로 하는 RNA 복합체를 유효성분으로 포함하는 노인성 황반변성(Age-related macular degeneration, AMD)의 예방 또는 치료용 약학 조성물로,
    상기 RNA 복합체는 결합 조직 성장 인자를 코딩하는 mRNA와 상보적인 영역을 포함하는 안티센스 가닥과, 상기 안티센스 가닥과 상보적 결합을 형성하는 센스 가닥을 포함하고,
    상기 안티센스 가닥과 센스 가닥은 안티센스 가닥의 5' 말단 및 센스 가닥의 3' 말단에서 블런트 말단을 형성하는 것을 특징으로 하는 조성물.
  2. 제1항에 있어서, 상기 안티센스 가닥의 길이는 16 내지 121nt(뉴클레오티드)인 것을 특징으로 하는 조성물.
  3. 제1항에 있어서, 상기 안티센스 가닥의 결합 조직 성장 인자를 코딩하는 mRNA와 상보적인 일부 영역을 포함하는 영역의 길이는 16 내지 31nt인 것을 특징으로 하는 조성물.
  4. 제1항에 있어서, 상기 센스 가닥의 길이는 13 내지 25nt인 것을 특징으로 하는 조성물.
  5. 제1항에 있어서, 상기 RNA 복합체는 CTGF를 코딩하는 mRNA와 상보적인 일부 영역을 포함하는 24 내지 121nt 길이의 안티센스 가닥과, 상기 안티센스 가닥의 CTGF를 코딩하는 mRNA와 상보적인 일부 영역과 상보적 결합을 형성하는 영역을 갖는 13 내지 21nt 길이의 센스 가닥으로 구성되는 것을 특징으로 하는 조성물.
  6. 제5항에 있어서, 상기 안티센스 가닥의 길이는 21 내지 31nt이고, 상기 센스 가닥의 길이는 16 내지 21nt 인 것을 특징으로 하는 조성물.
  7. 제1항에 있어서, 상기 RNA 복합체는 상기 안티센스 가닥의 CTGF를 코딩하는 mRNA와 상보적인 영역의 길이가 19 내지 21nt이고, 센스 가닥과 결합하지 않는 단일 가닥 영역을 포함하는 것을 특징으로 하는 조성물.
  8. 제1항에 있어서, 상기 센스 가닥은 서열번호 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141 및 143으로 구성된 군에서 선택되는 것을 특징으로 하는 조성물.
  9. 제8항에 있어서, 상기 센스 가닥은 서열번호 49, 51 및 53으로 구성된 군에서 선택되는 것을 특징으로 하는 조성물.
  10. 제1항에 있어서, 상기 안티센스 가닥은 서열번호 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142 및 144로 구성된 군에서 선택되는 것을 특징으로 하는 조성물.
  11. 제10항에 있어서, 상기 안티센스 가닥은 서열번호 50, 52 및 54로 구성된 군에서 선택되는 것을 특징으로 하는 조성물.
  12. 제1항에 있어서, 상기 RNA 복합체는 서열번호 49 및 50의 염기서열쌍; 서열번호 51 및 52의 염기서열쌍; 및 서열번호 53 및 54의 염기서열쌍으로 구성된 군에서 선택된 염기서열쌍을 갖는 이중가닥 핵산 분자로 이루어진 것을 특징으로 하는 조성물.
  13. 제1항 내지 제12항 중 어느 한 항에 있어서, 상기 RNA 복합체는 화학적 변형을 포함하는 것을 특징으로 하는 조성물.
  14. 제13항에 있어서,
    상기 화학적 변형은 다음으로 구성된 군에서 선택된 하나 이상을 포함하는 것을 특징으로 하는 조성물:
    뉴클레오티드 내 당 구조의 2' 탄소 위치에서 -OH기가 -CH3(메틸), -OCH3(methoxy), -NH2, -F(불소), -O-2-메톡시에틸 -O-프로필(propyl), -O-2-메틸티오에틸(methylthioethyl), -O-3-아미노프로필 또는 -O-3-디메틸아미노프로필로 치환;
    뉴클레오티드 내 당(sugar) 구조의 산소가 황으로 치환;
    뉴클레오티드 결합이 포스포로티오에이트(phosphorothioate), 보라노포페이트(boranophosphate), 또는 메틸포스포네이트(methyl phosphonate)로 변형;
    PNA(peptide nucleic acid), LNA(locked nucleic acid) 또는 UNA(unlocked nucleic acid) 형태로의 변형; 및
    콜레스테롤 또는 세포 침투 펩타이드 결합.
  15. 제13항에 있어서, 상기 화학적 변형은 상기 RNA 복합체에서 2 내지 17개의 뉴클레오티드의 포스포페이트 백본이 포스포로티오에이트로 치환되어 있는 것을 특징으로 하는 조성물.
  16. 제13항에 있어서, 상기 화학적 변형은 상기 RNA 복합체에서 4 내지 17개의 뉴클레오티드의 포스포페이트 백본이 포스포로티오에이트로 치환되어 있는 것을 특징으로 하는 조성물.
  17. 제13항에 있어서, 상기 화학적 변형은 상기 RNA 복합체에서 12 내지 17개의 뉴클레오티드의 포스포페이트 백본이 포스포로티오에이트로 치환되어 있는 것을 특징으로 하는 조성물.
  18. 제13항에 있어서, 상기 화학적 변형은 안티센스 가닥 중 2 내지 17개의 뉴클레오티드 포스페이트 백본이 포스포로티오에이트로 치환되어 있는 것을 특징으로 하는 조성물.
  19. 제13항에 있어서, 상기 화학적 변형은 안티센스 가닥 중 12개 내지 17개의 뉴클레오티드 포스페이트 백본이 포스포로티오에이트로 치환되어 있는 것을 특징으로 하는 조성물.
  20. 제13항에 있어서, 상기 화학적 변형은 안티센스 가닥 중 결합 조직 성장 인자를 코딩하는 mRNA와 상보적인 영역 이외의 영역의 뉴클레오티드의 포스페이트 백본이 포스포로티오에이트로 치환되어 있는 것을 특징으로 하는 조성물.
  21. 제13항에 있어서, 상기 화학적 변형은 센스 가닥 중 2 내지 17개의 뉴클레오티드의 포스페이트 백본이 포스포로티오에이트로 치환되어 있는 것을 특징으로 하는 조성물.
  22. 제13항에 있어서, 상기 화학적 변형은 센스 가닥 중 12개 내지 17개의 뉴클레오티드 포스페이트 백본이 포스포로티오에이트로 치환되어 있는 것을 특징으로 하는 조성물.
  23. 제13항에 있어서, 상기 화학적 변형은 센스 가닥 중 뉴클레오티드 포스페이트 백본이 하나 이상의 포스포로티오에이트로 치환되어 있으며, 뉴클레오티드내 당 구조의 2' 탄소 위치에서 -OH기가 하나 이상의 O-알킬로 치환되고, 추가로 3'말단에 친유성 화합물의 결합인 것을 특징으로 하는 조성물.
  24. 제23항에 있어서, 상기 친유성 화합물은 콜레스테롤, 토코페롤 및 탄소수 10개 이상의 장쇄지방산으로 구성되는 군에서 선택된 것을 특징으로 하는 조성물.
  25. 제1항에 있어서, 상기 안티센스 가닥에서 단일 가닥 영역을 구성하는 염기 중 적어도 하나 이상이 거대한(bulky) 염기 유사체(base analog)를 포함하는 것을 특징으로 하는 조성물.
  26. 제13항에 있어서, 상기 화학적 변형을 포함하는 RNA 복합체는 서열번호 149 및 150의 염기서열쌍; 서열번호 151 및 152의 염기서열쌍; 서열번호 153 및 154의 염기서열쌍; 서열번호 155 및 156의 염기서열쌍; 서열번호 157 및 158의 염기서열쌍; 서열번호 159 및 160의 염기서열쌍; 서열번호 163 및 164의 염기서열쌍; 서열번호 163 및 165의 염기서열쌍; 서열번호 166 및 167의 염기서열쌍; 및 서열번호 168 및 169의 염기서열쌍으로 구성된 군에서 선택된 염기서열쌍을 갖는 이중가닥 핵산 분자로 이루어진 것을 특징으로 하는 조성물.
  27. 제1항에 있어서, 상기 RNA 복합체는 세포 내 관통능(cell-penetrating ability)을 가지는 것을 특징으로 하는 조성물.
  28. 제1항에 있어서, 상기 RNA 복합체는 맥락막신생혈관(choroidal neovascularization, CNV) 또는 망막하 섬유증(subretinal fibrosis) 발생을 억제하는 것을 특징으로 하는 조성물.
  29. 제1항에 있어서, 상기 노인성 황반변성은 습성 노인성 황반변성(wet AMD)인 것을 특징으로 하는 조성물.
PCT/KR2018/011482 2017-09-28 2018-09-28 결합 조직 성장 인자를 표적으로 하는 rna 복합체를 함유하는 노인성 황반변성의 예방 또는 치료용 약학 조성물 WO2019066519A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20170126387 2017-09-28
KR10-2017-0126387 2017-09-28

Publications (1)

Publication Number Publication Date
WO2019066519A1 true WO2019066519A1 (ko) 2019-04-04

Family

ID=65902996

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/011482 WO2019066519A1 (ko) 2017-09-28 2018-09-28 결합 조직 성장 인자를 표적으로 하는 rna 복합체를 함유하는 노인성 황반변성의 예방 또는 치료용 약학 조성물

Country Status (2)

Country Link
KR (1) KR20190037166A (ko)
WO (1) WO2019066519A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102421750B1 (ko) * 2020-05-26 2022-07-19 올릭스 주식회사 MyD88을 표적으로 하는 RNAi 제제 및 이의 용도
JP7479475B2 (ja) * 2020-06-25 2024-05-08 韓国科学技術院 Ｐｒｏｘ１移動抑制剤を有効成分として含む網膜神経退行性疾患の予防又は治療用薬学的組成物

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7622454B2 (en) * 2004-12-23 2009-11-24 Alcon, Inc. RNAi inhibition of CTGF for treatment of ocular disorders
US20120238017A1 (en) * 2007-12-18 2012-09-20 Dong Ki Lee Novel sirna structure for minimizing off-target effects and relaxing saturation of rnai machinery and the use thereof
US9095504B2 (en) * 2010-03-24 2015-08-04 Rxi Pharmaceuticals Corporation RNA interference in ocular indications
KR101581655B1 (ko) * 2012-05-22 2015-12-31 올릭스 주식회사 세포 내 관통능을 가지고 ｒｎａ 간섭을 유도하는 핵산 분자 및 그 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7622454B2 (en) * 2004-12-23 2009-11-24 Alcon, Inc. RNAi inhibition of CTGF for treatment of ocular disorders
US20120238017A1 (en) * 2007-12-18 2012-09-20 Dong Ki Lee Novel sirna structure for minimizing off-target effects and relaxing saturation of rnai machinery and the use thereof
US9095504B2 (en) * 2010-03-24 2015-08-04 Rxi Pharmaceuticals Corporation RNA interference in ocular indications
KR101581655B1 (ko) * 2012-05-22 2015-12-31 올릭스 주식회사 세포 내 관통능을 가지고 ｒｎａ 간섭을 유도하는 핵산 분자 및 그 용도

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CAUWENBERGH, G.: "Age-Related Macular Degeneration: On the Rise as Baby Boomers Age", THE WESTERN PA HEALTHCARE NEWS TEAM, 11 October 2016 (2016-10-11), pages 1 - 2, XP055586003, Retrieved from the Internet <URL:http://www.rxipharma.com/wp-content/uploads/2016/10/Age-Related-Macular- Degeneration-On-the-Rise-as-Baby-Boomers-Age- 11OCT2016.pdf> *
GUZMAN-ARANGUEZ, A. ET AL.: "Small-interfering RNAs (siRNAs) as a Promising Tool for Ocular Therapy", BRITISH JOURNAL OF PHARMACOLOGY, vol. 170, 2013, pages 730 - 747, XP002754892, DOI: doi:10.1111/bph.12330 *

Also Published As

Publication number Publication date
KR20190037166A (ko) 2019-04-05

Similar Documents

Publication Publication Date Title
WO2013176477A1 (ko) 세포 내 관통능을 가지는 rna 간섭을 유도하는 핵산 분자 및 그 용도
WO2018139819A1 (ko) 마이크로 rna를 이용한 뇌 질환 예방 또는 치료 용도
JP7089763B2 (ja) トリヌクレオチドリピート伸長が関与する遺伝的疾患の予防または治療における一本鎖アンチセンスオリゴヌクレオチドの使用
WO2019050071A1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
KR20080018858A (ko) 녹내장 치료용 플리즐 관련 단백질―１의 ＲＮＡⅰ－중재저해
WO2013103249A1 (ko) 고효율 나노입자형 이중나선 올리고 rna 구조체 및 그의 제조방법
WO2022065919A1 (ko) 펩티드 핵산 복합체를 유효성분으로 함유하는 치매 예방 또는 치료용 조성물
WO2019066519A1 (ko) 결합 조직 성장 인자를 표적으로 하는 rna 복합체를 함유하는 노인성 황반변성의 예방 또는 치료용 약학 조성물
WO2020149702A1 (ko) Nrl(neural retina leucine zipper)의 발현을 억제하는 비대칭 sirna
WO2013125878A1 (ko) 메탈로프로테이즈에 의한 도파민성 신경세포로의 분화조절
JP2023144029A (ja) ＮＲＡＲＰ遺伝子の発現を阻害するためのｓｉＲＮＡ、並びにそのための方法及び組成物におけるそれらの使用
WO2009151304A2 (ko) 에이케이에이피일이를 함유하는 조성물 및 동물 모델로서 에이케이에이피일이 돌연변이 제브라피쉬의 용도
WO2021125762A1 (ko) 혈뇌장벽 투과능을 가지는 펩티드 핵산 복합체를 유효성분으로 함유하는 치매 예방 또는 치료용 조성물
WO2018155890A1 (ko) 남성형 탈모 표적 유전자의 발현을 억제하는 비대칭 siRNA
WO2019035690A1 (ko) 근육 질환 및 신경근육 질환 예방, 치료 또는 진단을 위한 miR-18b의 용도
US20210386714A1 (en) Drug and gene therapy to treat high myopia and other ocular disorders with enlarged eye globes
WO2022124739A1 (ko) ROR-beta의 발현을 억제하는 비대칭 RNAi 유도용 핵산 분자
CA3175691A1 (en) Compositions and methods for inhibiting tdp-43 and fus aggregation
WO2021141368A2 (ko) 세포 투과성 핵산 복합체를 유효성분으로 함유하는 황반변성의 예방 또는 치료용 조성물
WO2021241802A1 (ko) 연결 조직 성장 인자를 표적으로 하는 RNAi 제제 및 이의 용도
WO2023132674A1 (ko) 핵산 복합체를 포함하는 퇴행성 뇌질환의 예방 또는 치료용 조성물
WO2023163562A1 (ko) 핵산 복합체를 포함하는 알츠하이머병의 예방 또는 치료용 조성물
WO2023132673A1 (ko) 핵산 복합체를 포함하는 퇴행성 뇌질환의 예방 또는 치료용 조성물
WO2024096707A1 (ko) 모야모야 병 예방 또는 치료용 조성물
WO2022045763A1 (ko) 세포 투과성 핵산 복합체를 유효성분으로 함유하는 류마티스 관절염의 예방 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18863105

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18863105

Country of ref document: EP

Kind code of ref document: A1