WO2018139819A1 - 마이크로 rna를 이용한 뇌 질환 예방 또는 치료 용도 - Google Patents

마이크로 rna를 이용한 뇌 질환 예방 또는 치료 용도 Download PDF

Info

Publication number
WO2018139819A1
WO2018139819A1 PCT/KR2018/000948 KR2018000948W WO2018139819A1 WO 2018139819 A1 WO2018139819 A1 WO 2018139819A1 KR 2018000948 W KR2018000948 W KR 2018000948W WO 2018139819 A1 WO2018139819 A1 WO 2018139819A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
disease
pharmaceutical composition
preventing
elavl2
Prior art date
Application number
PCT/KR2018/000948
Other languages
English (en)
French (fr)
Inventor
류진협
조현정
Original Assignee
주식회사 바이오오케스트라
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 바이오오케스트라 filed Critical 주식회사 바이오오케스트라
Publication of WO2018139819A1 publication Critical patent/WO2018139819A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Definitions

  • the present invention relates to the prevention or treatment of brain diseases using miR-485-3p, and more particularly, the pharmaceutical composition for preventing or treating brain diseases, including miR-485-3p inhibitor, and the expression amount of miR-485-3p. It relates to a screening method for preventing or treating a brain disease comprising the step of measuring the.
  • Alzheimer's disease is the most common form of dementia and 75% of dementia patients have Alzheimer's disease. In most cases, Alzheimer's disease develops beyond age 65, but rarely can occur earlier. In the United States, about 3% of people aged 65-74, about 19% of people aged 75-84, and 50% of people over 85 years of age have the disease. In Korea, a recent research report focusing on a rural area shows that about 21% of people over 60 years old have dementia, and 63% of them have Alzheimer's disease. It is a disease of 26.6 million people worldwide in 2006. In 2050, one out of 85 people is expected to develop.
  • Alzheimer's disease is caused by impaired cholinergic signaling and transmission in the cerebral cortex and hippocampus (Bartus et al. , Science. 217 (4558): 408-14 (1982) and Coyle et al., Science. 219 (4589): 1184-90 (1983).
  • NFTs neurofibrillary tangles
  • amyloid beta amyloid beta
  • Alzheimer's disease drugs and therapies that increase the amount of acetylcholine to suppress damage to cholinergic neurotransmission, allow acetylcholine to exist for a long time, or make acetylcholine work more effectively in the delivery of neurons
  • various compounds that increase the acetylcholine activity of Alzheimer's disease patients have been used.
  • some compounds aim to improve the general state of health of the nerves to maintain normal cell function as they age.
  • some drugs such as NGF and estrogen, play a neuroprotective role in slowing nerve degeneration, while others, such as antioxidants, reduce the oxidation of cells and inhibit the growth of harmful cells that result from normal aging.
  • amyloid precursor protein APP
  • amyloid precursor protein APP
  • amyloid beta accumulates abnormal neuronal signal transmission
  • APP is abnormally cleaved and many amyloid beta is generated and accumulated in neuritis space
  • plaque formation is induced.
  • cleavage reaction eg inflammatory reactions
  • NFTs and paired helical filaments (PHFs) increase the phosphorylation of the Tau protein
  • PHFs paired helical filaments
  • ELAVL2 (ELAV like RNA binding protein 2) is an ELAV like neuron-specific RNA binding protein 2, one form of nELAVL2.
  • nELAVL2 is a brain-specifically expressed RNA binding protein and is known to be involved in neurodegenerative disease. After post-mortem examination of Alzheimer's disease patients, a high-throughput RNA sequence was performed using brain tissue, indicating that ELAVL2 is low.
  • US Patent No. 5,532,219 discloses a composition for treating Alzheimer's disease, including 4,4'-diaminodiphenyl sulfone
  • US Patent No. 5,506,097 discloses para-amidinophenylmethanesulfonyl fluorine.
  • Disclosed is a composition for treating Alzheimer's disease, including Reed or Eberlactone A.
  • US Pat. No. 6,136,861 discloses a composition for treating Alzheimer's disease comprising bicyclo [2.2.1] heptane.
  • WO 2013/045652 discloses the treatment of epilepsy using an inhibitor of miR-134
  • WO 2015/025995 treats the epilepsy using an inhibitor of miR-203. Is disclosed.
  • EP 2436784 discloses the diagnosis and treatment of colorectal cancer using miR-203.
  • Alzheimer's disease develops a progressive improvement of symptoms.
  • current Alzheimer's disease treatment focuses on improving the symptoms of the disease, rather than reversing the course of the disease, and knows more about the biological knowledge of the disease. not.
  • the present inventors have made efforts to develop a prophylactic or therapeutic agent for cerebral neurological diseases, including Alzheimer's disease. Confirmation of inhibition of production, inhibition of expression of APP or inhibition of Tau protein phosphorylation confirmed that it can be used in the treatment of brain diseases, and completed the present invention.
  • An object of the present invention to provide a pharmaceutical composition for preventing or treating brain diseases using micro RNA.
  • the present invention provides a method for screening a preventive or therapeutic agent for brain diseases by measuring the expression level of micro RNA.
  • the present invention provides a pharmaceutical composition for preventing or treating brain diseases, including miR-485-3p inhibitor.
  • the present invention also provides a method for preventing or treating brain diseases comprising administering a pharmaceutically effective amount of a miR-485-3p inhibitor.
  • the invention also provides the use of miR-485-3p inhibitors for the prevention or treatment of brain diseases.
  • the present invention also provides the use of miR-485-3p inhibitors for the manufacture of a medicament for the prevention or treatment of brain diseases.
  • the present invention also comprises the steps of (A) treating the candidate substance to the cell expressing miR-485-3p, and measuring the expression level of miR-485-3p; And (B) when the expression level of miR-485-3p measured in step (A) is inhibited compared to the control group not treated with the candidate, the brain comprising the step of selecting a candidate as a brain disease prevention or treatment
  • Figure 2 (A) is a graph showing a miRNA expression pattern analysis (volcano blot) of the patient group compared to the control group, (B) is a graph showing a miRNA expression pattern analysis (scatter blot) of the patient group compared to the control group.
  • Figure 3 is a graph comparing the expression of miR-485-3p in hippocampus and cortex.
  • Figure 5 is a quantitative comparative analysis of A ⁇ 42 in the cerebral cortex of 5xFAD, (B) is a quantitative comparative analysis of A ⁇ 42 in the hippocampus.
  • Figure 6 is a comparison of the expression of ELAVL2 in the cerebral cortex and hippocampus of 5xFAD.
  • Figure 7 is a graph comparing the expression of ELAVL2 and A ⁇ according to Antagomir (AM) -485-3p transfection in Hippocampal primary cells.
  • FIG. 9 is a graph showing the results of quantitative comparative analysis of ELAVL2 and A ⁇ in 5 ⁇ FAD treated with AM-485-3p intranasally.
  • Figure 10 is a comparison of the expression of APP, Tau and p-Tau according to AM-485-3p transfection in Hela cells.
  • 11 is a graph of a result of cognitive function comparison of 5xFAD intranasally treated with AM-485-3p.
  • the expression of miR-485-3p in Alzheimer's patients is increased, the expression level of ELAVL2 is restored through oligonucleotides that inhibit the expression or activity of miR-485-3p, A ⁇ 42 It has been shown that reducing the production of can improve the behavioral disorders and cognitive decline, which are the main symptoms of Alzheimer's disease.
  • the present invention relates to a pharmaceutical composition for preventing or treating brain disease, including a miR-485-3p inhibitor.
  • the 'miR' or 'microRNA (miRNA)' means 21 to 23 non-coding RNAs that regulate gene expression after transcription by promoting degradation of target RNA or inhibiting their translation. .
  • the mature sequence of the miRNA can be obtained from the miRNA database (http://www.mirbase.org). According to the miRNA database (19th edition, miRBase) as of August 2012, 25,141 mature miRNAs from 193 species are registered.
  • miRNAs are transcribed into precursors of about 70 to 80 nt in length having a hairpin structure called pre-miRNA, and are then cut and matured by Dicer, an RNAse III enzyme. miRNA forms a ribonucleocomplex called miRNP to cleave or inhibit translation of the target gene through complementary binding to the target site. More than 30% of human miRNAs are present in clusters, transcribed into one precursor, and cleaved to form the final mature miRNA.
  • the miR-485-3p is not limited thereto, but may be characterized in that it is expressed in the brain, particularly the hippocampus and the cortex. It binds to the 3 ′ untranslated site of ELAVL2 mRNA encoding ELAVL2 (ELAV like RNA binding protein 2) and inhibits its expression, thereby reducing the concentration of ELAVL2 protein in the brain.
  • the sequence of miR-485-3p may be derived from a mammal, for example, human, mouse or rat.
  • the sequence of human derived miR-485-3p was used, which was the mature sequence [5'-GUCAUACACGGCUCUCCUCUCU-3 '(SEQ ID NO: 1)] as well as the precursor sequence [5'-ACUUGGAGAGAGGCUGGCCGUGAUGAAUUCGAUUCAUCAAAGCGAGUCAUACACGGCUCUCUCU '(SEQ ID NO: 2)].
  • the miR-485-3p inhibitor may be characterized by inhibiting the expression of miR-485-3p.
  • miR-485-3p and ELAVL2 ELAV like neuron-specific RNA binding protein 2
  • ELAVL2 ELAV like neuron-specific RNA binding protein 2
  • the miR-485-3p inhibitor may be characterized in that it inhibits or interferes with the intracellular action or function of miR-485-3p. Inhibiting the miR-485-3p includes directly inhibiting the binding of miR-485-3p to an mRNA molecule encoding its target, eg, ELAVL2 protein. Or directly inhibit the function of miR-485-3p using a small molecule inhibitor, an antibody or a fragment of an antibody, or indirectly using a small interfering RNA molecule.
  • the miR-485-3p inhibitor may be a nucleic acid molecule that binds to all or part of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • the length of the nucleic acid molecule that binds to a part of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 is 7 to 50 nt (nucleotides), preferably 10 to 40 nt, more preferably 15 to 30 nt Even more preferably 15 to 25 nt, in particular 16 to 19 nt, but is not limited thereto.
  • the nucleic acid molecule is not limited thereto, and may bind to the base sequence of the first or second to seventh or eighth sequences of the nucleotide sequence of SEQ ID NO: 1.
  • the nucleic acid molecule may be selected from the group consisting of DNA, RNA, antagomiR (antisense oligonucleotide of miRNA), siRNA, shRNA and oligonucleotide.
  • the activity of the precursor sequence (SEQ ID NO: 2) and mature sequence (SEQ ID NO: 1) was directly or indirectly inhibited to inhibit or inhibit the activity of the miR-485-3p.
  • inhibition of the activity of miR-485-3p includes lowering its intracellular concentration by inhibiting transcription of miR-485-3p and / or binding of miR-485-3p with a target mRNA.
  • the miR-485-3p inhibitor includes any substance capable of inhibiting the expression and / or activity of miR-485-3p, but is not limited thereto, low molecular weight compounds, antagomiR, antisense molecules, It may include antibodies that recognize small hairpin RNA molecules (shRNA), fire-fighting RNA molecules (siRNA), seed target Locked Nucleic Acid (LNA) oligonucleotides, decoyoligonucleotides, aptamers, ribozymes or DNA: RNA hybrids. .
  • shRNA small hairpin RNA molecules
  • siRNA fire-fighting RNA molecules
  • LNA seed target Locked Nucleic Acid
  • the miR-485-3p inhibitor is an antisense oligonucleotide capable of complementarily binding to all or a portion of the precursor and / or mature sequence of miR-485-3p, particularly the seed sequence, thereby inhibiting its activity. It can be characterized by.
  • the nucleic acid molecule may be characterized in that it is an antisense oligonucleotide comprising a sequence partially or entirely complementary to the nucleotide sequence of SEQ ID NO: 1.
  • the antisense oligonucleotides may be represented by a nucleotide sequence selected from the group consisting of SEQ ID NO: 3 to SEQ ID NO: 7.
  • the antisense oligonucleotide is not limited thereto, but may include a sequence which is partially or completely complementary to the base sequence of the first or second to seventh or eighth sequences of SEQ ID NO: 1.
  • the antisense oligonucleotides are 5'-GUGUAUGAC-3 '(SEQ ID NO: 3), 5'-UGUAUGAC-3' (SEQ ID NO: 4), 5'-GUGUAUGA-3 '(SEQ ID NO: 5), 5'-UGUAUGA-3 It may be characterized by being represented by a nucleotide sequence selected from the group consisting of '(SEQ ID NO: 6) or 5'-AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 7).
  • the antisense oligonucleotide encompasses nucleic acid-based molecules having a sequence complementary to all or a portion of the miRNA, in particular the seed sequence of the miRNA, to form a duplex with the miRNA.
  • the antisense oligonucleotides can be represented as complementary nucleic acid-based inhibitors.
  • the antisense oligonucleotide includes various molecules, for example ribonucleic acid (RNA), deoxyribonucleic acid (DNA), antagomiR, 2'-0-modified oligonucleotide, phosphorothioate-backbone deoxyribonucleotide, phosphorophore Thioate-backbone ribonucleotides, peptide nucleic acid (PNA) oligonucleotides or locked nucleic acid (LNA) oligonucleotides, preferably ribonucleic acid.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • antagomiR 2'-0-modified oligonucleotide
  • PNA peptide nucleic acid
  • LNA locked nucleic acid
  • the ribonucleic acid includes double stranded small hairpin RNA molecules (shRNA), fire-fighting RNA molecules (siRNA), and ribozymes.
  • the locked nucleic acid has a locked form by adding an additional modification between 2 ′ to 4 ′ carbons of the ribose sugar site as compared to conventional oligonucleotides, thereby securing thermal stability.
  • the peptide nucleic acid comprises a peptide-based backbone instead of a sugar-phosphate backbone.
  • the 2'-0-modified oligonucleotide is preferably a 2'-0-alkyl oligonucleotide, more preferably a 2'-0-C1-3 alkyl oligonucleotide, most preferably a 2'-0-methyl oligonucleotide. Nucleotides.
  • the antisense oligonucleotides include narrow sense antisense oligonucleotides, antagomiR and inhibitory RNA molecules.
  • the antagomiR is a single-strand chemically modified oligonucleotide, which is used for the silencing of endogenous microRNAs.
  • antagomiR may comprise sequences that are not complementary at the Arganoute 2 (Ago 2) cleavage site.
  • a base is modified, for example, 2 'methoxy group, 3' cholesterol group, phosphorothioate to inhibit Ago2 cleavage, and has a complementary sequence to the target sequence.
  • the antagomiR has a sequence that is at least partially or completely complementary to miR-485-3p.
  • the antagomiR may comprise one or more modifications (eg 2′-O-methyl-sugar modifications or 3 ′ cholesterol modifications). Or one or more phosphorothioate linkages, at least partially having a phosphorothioate backbone.
  • suitable length of antagomiR for inhibiting the expression of miR-485-3p is 7 to 50 nt (nucleotides), preferably 10 to 40 nt, more preferably 15 to 30 nt, even more preferably Is 15 to 25 nt, in particular 16 to 19 nt, but is not limited thereto.
  • the term "complementary" means that the antisense oligonucleotides are sufficiently complementary to selectively hybridize to miR-485-3p targets under certain hybridization or annealing conditions, preferably physiological conditions. It is meant to encompass both partially or partially substantially complementary and perfectly complementary, and preferably means completely complementary. Substantially complementary means, but not completely complementary, complementary enough to bind to the target sequence and have a sufficient effect to interfere with the activity of miR-485-3p according to the invention.
  • nucleic acid' includes oligonucleotides, DNA, RNA, and polynucleotides, analogs and derivatives thereof, and includes, for example, PNA or mixtures thereof.
  • nucleic acids may be single or double stranded, and may encode molecules including mRNA, microRNA, siRNA or polypeptides, and the like.
  • the antisense oligonucleotide is 1) modified in the form of a locked nucleic acid (LNA) or peptide nucleic acid (PNA); 2) the —OH group is substituted with —CH 3 (methyl) at the 2 ′ carbon position of the sugar structure in the nucleotide; And 3) a nucleotide bond may include any one or more modifications selected from the group consisting of modifications with phosphorothioate.
  • LNA locked nucleic acid
  • PNA peptide nucleic acid
  • a nucleotide bond may include any one or more modifications selected from the group consisting of modifications with phosphorothioate.
  • the antisense oligonucleotide has one or more nucleotides constituting it may be LNA or PNA, a sugar of one or more nucleotides constituting it may be 2'-O-methylated or medoxylethylated, or a backbone linking nucleotides ( Backbone) may include, but is not limited to, one or more phosphothioates.
  • the miR-485-3p inhibitor comprises: 1) recovery of expression level of ELAVL2; 2) inhibition of production of amyloid beta 42 (A ⁇ 42); 3) inhibition of expression of amyloid precursor protein (APP; And 4) a property of inhibiting phosphorylation of the Tau protein.
  • the present invention is based on the discovery that miR-485-3p excessively inhibits the expression of ELAVL2 and is involved in the development of Alzheimer's disease and various brain diseases.
  • miR-485-3p inhibitor of ELAVL2 using 5xFAD mouse which is an animal model of Alzheimer's disease, which overexpresses the mutant forms of APP and PSEN1 and shows severe accumulation of intraneuronal A ⁇ 42 from about 6 weeks. It was confirmed that the expression level recovery, A ⁇ 42 accumulation inhibition, APP expression inhibition or Tau protein phosphorylation inhibitory properties.
  • Reduced ELAVL2 expression levels are known to be associated with Alzheimer's disease, autism spectrum disorders, mental retardation, and atrophic lateral sclerosis.
  • stimulants such as kainic acid, NMDA, quisulate, AMPA, glutamate, which cause excitatory toxicity, reduce ELAVL2 protein levels and neuronal cell death, and induce brain dysfunction, resulting in spasm, stroke, Parkinson's disease, and spinal cord injury. It is known to cause various brain diseases such as (Kaminska, B. et al., Acta Biochim Pol. 44: 781-789).
  • ELAVL2 protein through inhibition of miR-485-3p activity has been associated with a number of brain diseases such as Alzheimer's disease and / or autism spectrum disorders, mental retardation, amyotrophic lateral sclerosis, convulsions, stroke, Parkinson's disease, spinal cord injury, It can be used for treatment.
  • brain diseases such as Alzheimer's disease and / or autism spectrum disorders, mental retardation, amyotrophic lateral sclerosis, convulsions, stroke, Parkinson's disease, spinal cord injury, It can be used for treatment.
  • the brain disease may be selected from the group consisting of Alzheimer's disease, autism spectrum disorder, mental retardation, amyotrophic lateral sclerosis, convulsions, stroke, Parkinson's disease and spinal cord injury, but is not limited thereto. It is not.
  • the pharmaceutical composition in addition to the miR-485-3p inhibitor, at least one active ingredient having the same, similar or synergistic function for the treatment of related diseases, or solubility of the miR-485-3p inhibitor and the active ingredient and / Or compounds that maintain / increase absorbency. It may also optionally further comprise immunomodulators and / or chemotherapeutic agents.
  • the pharmaceutical composition may comprise one or more pharmaceutically acceptable diluents, carriers and / or adjuvants.
  • Pharmaceutically acceptable carriers may be used in combination with saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposomes, and one or more of these components, as necessary.
  • other conventional additives such as buffers and bacteriostatic agents can be added.
  • diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable formulations, pills, capsules, granules, or tablets, such as aqueous solutions, suspensions, emulsions, and the like, which will act specifically on target organs.
  • Target organ specific antibodies or other ligands can be used in combination with the carriers.
  • each disease or component may be preferably formulated according to each disease or component by a suitable method in the art or using a method disclosed in Remington's Pharmaceutical Science (Recent Edition, Mack Publishing Company, Easton PA).
  • it may be formulated as a suspension, liposome formulation, emulsion, tablet, capsule, gel, syrup or suppository.
  • the pharmaceutical composition may be prepared in suspension with an aqueous, non-aqueous or mixed medium.
  • the aqueous suspension may further comprise substances which increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol and / or dextran.
  • the pharmaceutical composition may be formulated in any one of intranasal administration, intravenous administration, subcutaneous injection, intrathecal injection, inhalation administration or oral administration.
  • the administration method of the pharmaceutical composition according to the present invention is not particularly limited, and known administration methods of inhibitors may be applied.
  • Parenteral administration eg, intranasal, intravenous, subcutaneous, intraperitoneal or topical
  • oral administration may be carried out according to the desired method, or administration by intranasal infusion is preferred for obtaining a rapid therapeutic effect.
  • the pharmaceutical composition can be delivered by a variety of routes and can be administered, for example, via infusion or bolus injection, epidermis or mucosa (oral mucosa, anal mucosa, intestinal mucosa, etc.). It can be administered systemically or locally.
  • the pharmaceutical composition may be characterized in that it is delivered to the brain.
  • the pharmaceutical composition is preferably introduced into the central or peripheral nerve through a suitable route. Suitable routes include intraventricular or intrathecal administration. Such administration can be accomplished using a catheter connected to the reservoir. In addition, administration through the lungs, formulated with aerosols, via inhalers or nebulizers can be used. Formulations for intravenous administration, subcutaneous injection, intrathecal injection, inhalational administration, or oral administration are not excluded as long as the effect according to the invention occurs.
  • the pharmaceutical composition may be prepared in various unit dosage forms.
  • Such forms include, but are not limited to, nasal drops, nasal sprays, nasal gels, nasal ointments, and nasal powders.
  • the composition was capable of nasal administration.
  • nasal administration is delivered to the brain along the olfactory pathway, the effect of the pharmaceutical composition can be enhanced.
  • Nasal refers to the space of the nasal cavity, separated by left and right by the nasal septum
  • intranasal administration means delivering the composition of the present invention to any tissue of the nasal epithelium.
  • It may comprise a nasal acceptable carrier for intranasal administration, which comprises one or more suitable solid or filler diluents or encapsulating materials suitable for administration to any part of the nasal epithelium of a mammal, preferably a human. it means.
  • the carrier may be a liquid, solution, suspension, gel, ointment, lotion, or a combination thereof.
  • the carrier is a pharmaceutically acceptable aqueous carrier.
  • the carrier may include a delivery enhancer, intranasal delivery enhancers, aggregation inhibitors, dose modifiers, pH control agents, degrading enzyme inhibitors, mucolytic or mucus removers, ciliary stabilizing agents, membrane permeation promoters, Surfactants, bile salts, phospholipids or fatty acid additives, mixed micelles, liposomes, or carriers, alcohols, enamines, nitric oxide donor mixtures, long-chain amphiphilic molecules, small hydrophobic penetration enhancers , Sodium or salicylic acid derivatives, glycerol esters of acetoacetic acid, cyclodextrins or beta-cyclodextrin derivatives, medium chain fatty acids, chelating reagents, amino acids or salts thereof, N-acetylamino acids or salts thereof, degrading enzymes for selected membrane components, fatty acids Synthetic inhibitors, cholesterol synthesis inhibitors, or nitric oxide stimulants, chi
  • the pharmaceutical composition may be administered in a pharmaceutically or therapeutically effective amount.
  • the pharmaceutically or therapeutically effective amount means an amount sufficient to treat the disease at a reasonable benefit / risk ratio applicable to the medical treatment, and the effective dose level is the type of disease, the severity, the activity of the drug. , Sensitivity to the drug, time of administration, route of administration and rate of release, duration of treatment, factors including concurrent use of the drug, and other factors well known in the medical arts.
  • the pharmaceutical composition may be administered as a separate therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be single or multiple administrations. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, which can be easily determined by those skilled in the art.
  • the dosage varies widely depending on the patient's weight, age, sex, health condition, diet, time of administration, method of administration, excretion rate and severity of the disease, and the appropriate dosage is the amount of drug accumulated in the patient's body. And / or the degree of specific efficacy of the polynucleotides used. In general, it can be calculated based on an EC50 determined to be effective in in vivo animal models and in vitro, for example from 0.01 ⁇ g to 1 g per kg of body weight. Unit periods of daily, weekly, monthly or yearly, may be administered once or several times per unit period, or may be administered continuously for a long time using an infusion pump. The number of repeated doses is determined in consideration of the time the drug stays in the body, the drug concentration in the body, and the like. Even after treatment according to the course of the disease treatment, the composition may be administered for relapse.
  • the active ingredient of the pharmaceutical composition such as antisense oligonucleotide
  • Pharmaceutically acceptable salts are those which minimize the undesirable toxicity while maintaining the biological activity of the oligonucleotides according to the invention.
  • Such salts are, for example, base addition salts formed with metal cations such as zinc, calcium, bisbus, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium, potassium and the like and salts formed with organic amino acids, or ammonia, N It may include, but is not limited to, salts formed with cations derived from N-dibenzylethylene-diamine, D-glucosamine, tetraethylammonium, or ethylenediamine. no.
  • the antisense oligonucleotide which is the active ingredient of the pharmaceutical composition may be characterized in that it is negatively charged due to the nature of the nucleotides constituting it. Because of the lipophilic nature of cell membranes, uptake of antisense oligonucleotides into cell membranes may be reduced. Absorption disturbances due to this polarity can be solved through the prodrug approach described below (Crooke, RM (1998) in Crooke, ST Antisense research and Application.Springer-Verlag, Berlin, Germany, vol. 131, pp. 103-140).
  • the term 'treatment', 'mitigation' or 'improvement' means any action that improves or advantageously alters the symptoms of a related disease by administration of a composition according to the present invention.
  • Those skilled in the art to which the present invention pertains will be able to know the exact criteria of the disease, and to determine the degree of improvement, improvement and treatment, with reference to the data presented by the Korean Medical Association.
  • prevention refers to any action that inhibits or delays the development of related diseases.
  • the pharmaceutical composition can prevent related symptoms when administered before the initial symptoms or symptoms appear.
  • the expression of miR-485-3p is increased in Alzheimer's patients, and behavioral disorders and cognition which are the main symptoms of Alzheimer's disease through oligonucleotides that inhibit the expression or activity of miR-485-3p. It was confirmed that the functional degradation can be improved.
  • the present invention relates to a method for preventing or treating brain disease, comprising administering a pharmaceutically effective amount of a miR-485-3p inhibitor.
  • the method for preventing or treating brain diseases may be characterized in that the method through the inhibition of the activity of miR-485-3p in cells or tissues, in particular brain cells or brain tissues of the subject.
  • the invention relates to the use of miR-485-3p inhibitors for the prevention or treatment of brain diseases.
  • the present invention relates to the use of a miR-485-3p inhibitor for the manufacture of a medicament for the prevention or treatment of brain diseases.
  • the regulation or inhibition of miR-485-3p activity may be referred to the foregoing.
  • the present invention provides a method for treating miR-485-3p, comprising: (A) processing a candidate substance to a cell expressing miR-485-3p and measuring the expression level of miR-485-3p; And (B) when the expression level of miR-485-3p measured in step (A) is inhibited compared to the control group not treated with the candidate, the brain comprising the step of selecting a candidate as a brain disease prevention or treatment
  • the present invention relates to a method for screening an agent for preventing or treating a disease.
  • the activity of the miR-485-3p is determined by the analysis of the interaction between the miR-485-3p and ELAVL2 (ELAV like neuron-specific RNA binding protein 2) 3'-UTR Can be.
  • the brain disease may be selected from the group consisting of Alzheimer's disease, autism spectrum disorder, mental retardation, amyotrophic lateral sclerosis, convulsions, stroke, Parkinson's disease and spinal cord injury.
  • the screening method after contacting a cell expressing miR-485-3p with a candidate substance, compares the change in the expression level of miR-485-3p with the control cells before or without contact, and expresses the expression. It may be characterized by the fact that the amount of the fluctuation, especially a decrease, is selected as an agent for preventing or treating brain diseases.
  • Expression measurement of miR-485-3p used in the screening method can be performed using known methods such as Northern blot, RT-PCR, hybridization method using a micro array.
  • the miR-485-3p is provided in the form of cells expressing it, and the activity is determined by analysis of the interaction of the miR-485-3p with its target 3'-UTR of ELAVL2 protein. .
  • the degree of interaction between 3'-UTR and miR-485-3p of the ELAVL2 protein is compared with control cells before or without contact.
  • it may be characterized in that there is a change in the interaction, in particular a decrease, in the prevention or treatment of brain diseases.
  • the type of cells used in the screening method and the amount and type of candidate materials vary depending on the specific test method used and the types of candidate materials, and those skilled in the art will know appropriate types, amounts, and / or conditions of cells. You will be able to choose. Substances that result in a decrease in the activity of miR-485-3p in the presence of the candidates are selected for treatment as compared to the control group not in contact with the candidates.
  • RNA-RNA interaction detection method used in the screening method is known in the art, for example, RNA Walk (Lusting et al., Nucleic Acids Res. 2010; see 38 (1): e5) or Yeat two hybrid system (Piganeau et al., RNA 2006; 12: 177-184), and the like, and can refer to RNA: A Laboratory Manual (Cold Spring Harbor Laboratory Press 2011).
  • the candidate means a substance which is expected to inhibit the activity of miR-485-3p, such as a low molecular weight compound, a high molecular weight compound, a mixture of compounds (eg, a natural extract or a cell or tissue culture), or a biopharmaceutical ( Eg, proteins, antibodies, peptides, DNA, RNA, antisense oligonucleotides, RNAi, aptamers, RNAzyme and DNAzyme), or sugars and lipids, and the like.
  • the candidate may be a polypeptide having two or more amino acid residues, such as 6, 10, 12, 20 or less or more than 20 such as 50 amino acid residues.
  • the candidates can be obtained from a library of synthetic or natural compounds, and methods of obtaining libraries of such compounds are known in the art.
  • Synthetic compound libraries are available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA) or Sigma-Aldrich (USA), and libraries of natural compounds are available from Pan Laboratories (USA) or Available from MycoSearch (USA).
  • Candidates can be obtained by a variety of combinatorial library methods known in the art, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution Required synthetic library methods, 1-bead 1-compound library methods, and synthetic library methods using affinity chromatography screening. Methods for the synthesis of molecular libraries are described in DeWitt et al., Proc. Natl.
  • a compound having a low molecular weight therapeutic effect for the purpose of the screening of the therapeutic agent for brain disease, a compound having a low molecular weight therapeutic effect can be used.
  • compounds of about 1000 Da in weight such as 400 Da, 600 Da or 800 Da can be used.
  • such compounds may form part of a compound library, and the number of compounds constituting the library may vary from tens to millions.
  • Such compound libraries include peptides, peptoids and other cyclic or linear oligomeric compounds, and low molecular compounds based on templates such as benzodiazepines, hydantoin, biaryls, carbocycles and polycycle compounds (such as naphthalene, phenoty) Azine, acridine, steroids, etc.), carbohydrates and amino acid derivatives, dihydropyridine, benzhydryl, and heterocycles (such as triazine, indole, thiazolidine, etc.), but are not limited thereto. .
  • templates such as benzodiazepines, hydantoin, biaryls, carbocycles and polycycle compounds (such as naphthalene, phenoty) Azine, acridine, steroids, etc.), carbohydrates and amino acid derivatives, dihydropyridine, benzhydryl, and heterocycles (such as triazine, indole, thiazolidine, etc
  • Biologics can also be used for screening.
  • the biologics refers to cells or biomolecules
  • biomolecules refer to proteins, nucleic acids, carbohydrates, lipids or substances produced using cellular systems in vivo and ex vivo.
  • Biomolecules may be provided alone or in combination with other biomolecules or cells.
  • Biomolecules include, for example, proteins or biological organics found in polynucleotides, peptides, antibodies, or other plasma.
  • Table 1 shows the characteristics of the patients used in the study. Sod. About 3 ml of blood was drawn into a blood tube (c. Backton Dickinson, Germany) to which citrate (3.2% w / v) was added. Healthy adults who matched four ages ( ⁇ 4 years) were included as controls.
  • RNA extraction was extracted using miRNAeasy Serum / Plasma kit (Qiagen, USA) as recommended by the manufacturer. The extracted RNA was analyzed for concentration and purity using Bioanalyzer2100 (Agilent, USA). Eight groups, including the control group, were used in the study in accordance with the quality criteria.
  • Table 2 shows a list of genes used for microarray analysis.
  • the mature sequence of each miRNA can be obtained from the miRNA database (http://www.mirbase.org).
  • the extracted RNA was screened using a miRNA array containing 84 different miRNAs known to be involved in the progression of Human Neurological Development and Neurological Disease.
  • FIG. 1 summarizes the cDNA synthesis and detection process
  • Quantitative PCR assay method can be summarized as follows.
  • Mature miRNAs are generally 22nt, noncoding RNAs and are responsible for post-transcriptional regulation.
  • Oligo-dT primers have a 3 'degenerate anchor and a universal tag sequence at the 5' end, enabling mature miRNA amplification during Real-time PCR.
  • Mature miRNA was quantified during real-time PCR using miScript SYBR Green PCR Kit (Qiagen).
  • Figure 2 (A) shows the analysis of the miRNA expression pattern (volcano blot) of the patient group compared to the control group
  • Figure 2 (B) shows the miRNA expression pattern analysis (scatter blot) of the patient group compared to the control group
  • 84 miRNA expression patterns of the patient group compared to the control group was analyzed.
  • the x-axis represents the fold change and the y-axis represents the p-value of -log10.
  • Horizontal black lines show p-values less than 0.05.
  • Volcano blot analysis shows hsa-miR-105-5p, hsa-miR-98-5p, hsa-miR-15a-5p, hsa-miR-134-5p, hsa-miR-409-3p, hsa-miR-19b -3p, hsa-miR-92a-3p, hsa-miR-28-5p, hsa-miR-30d-5p, hsa-miR-212-3p, hsa-miR-93-5p, hsa-miR-342-3p , hsa-miR-381-3p, hsa-miR-431-5p, hsa-miR-130a-3p, h
  • hsa-miR-485-3p may be an expected indicator for treating Alzheimer's disease.
  • Table 3 shows the nucleotide sequence of hsa-miR485-3p.
  • the 5xFAD transgenic mouse is an animal model of Alzheimer disease that overexpresses the mutant APP and PSEN1 and shows severe accumulation of intraneuronal A ⁇ 42 from about 6 weeks.
  • RT-qPCR was performed to confirm the expression of miR-485-3p in the animal model of dementia.
  • 5xFAD transgenic mice and Wild type (WT) mice were deeply anesthetized and sacrificed with the head. The brain was immediately removed and the hippocampus and cerebral cortex were excised from the remaining brain structures.
  • Total miRNA was isolated from hippocampus using PAXgene Tissue miRNA Kit (Qiagen, USA) according to the manufacturer's method.
  • cDNA was synthesized using miScript II RT Kit (Qiagen, USA) and qPCR was performed using mmu_miR-485-3p miScript Primer Assay and miScript SYBR Green PCR Kit. miRNA levels were normalized according to snoRNA202 (mouse control).
  • Figure 3 is a comparison of the expression of miR-485-3p in hippocampus and cortex, RT-PCR was performed to confirm the expression pattern of miR-485-3p in the hippocampus and cerebral cortex of 5xFAD. As a result, miR-485-3p expression was increased in 5xFAD hippocampus compared to WT. Therefore, with the result of Example 1, it can be confirmed that the expression of miR-485-3p in Alzheimer's dementia is elevated. Therefore, we tried to identify neuronal target mRNA or protein that miR-485-3p may affect.
  • the 3 'terminal untranslated region (UTR) of human-derived ELAVL2 was targeted to hsa-miR-485-3p. Confirmed. It was confirmed that the seed sequence confirmed here was also conserved in mmu-miR-485-3p and mouse-derived ELAVL2 3 / terminal untranslated site.
  • ELAVL2 3′-untranslated site (UTR) mRNAs showing the target ELAVL2 3′-untranslated site (UTR) mRNA of miR-485-3p.
  • the 5 ′ seed sequence (ELAVL2) of miR-485-3p is indicated in blue.
  • Table 4 shows the nucleotide sequence and target position analysis of mmu-miR485-3p, and the 3'-untranslated region (UTR) of mouse ELAVL2 was determined by using target prediction software (TargetScan, PicTar and microT). The target of -3p was confirmed.
  • Example 4 Expression of amyloid beta (A ⁇ ) 42 and ELAVL2 in the cerebral cortex and hippocampus of 5xFAD mice
  • Example 3 it was intended to confirm the expression of A ⁇ 42 and ELAVL2 in the cerebral cortex and hippocampus of 5xFAD.
  • Anesthetized mice were sacrificed with the head and immediately brain extracted. Homogenates of brain regions (cerebral cortex, hippocampus) were prepared, and western blot was performed using antibodies against ELAVL2 (abcam, USA). Immune response proteins were visualized with chemiluminescent reagents (GE health care, UK) and measured and quantified with a chemical imager (Fusion SL). Cortical and hippocampal A ⁇ 42 was quantified using a mouse / rat amyloid beta (1-42) ELISA kit (IBL). For details, refer to the manufacturer's instructions.
  • FIG. 5 is a quantitative comparative analysis of A ⁇ 42 in 5xFAD, and compared the A ⁇ 42 expression of the cerebral cortex (Fig. 5 (A)) and hippocampus (Fig. 5 (B)) of 5xFAD. In 5xFAD, A ⁇ 42 was significantly increased compared to WT in both cerebral cortex and hippocampus.
  • FIG. 6 shows the expression results of ELAVL2 in the cerebral cortex and hippocampus of 5xFAD.
  • ELAVL2 is an ELAV-like RNA-binding protein known as a protein that regulates neuronal function, such as neuronal excitability or synaptic transmission, which is directly linked to cognitive and behavioral functions.
  • ELAVL2 is also a neural-specific RNA-binding protein that recognizes the GAAA motif of RNA and is responsible for post-transcriptional gene regulation.
  • Example 5 Hippocampal primary cell line construction and in vitro transfection of Antagomir (AM) -485-3p
  • Immune response proteins were visualized with chemiluminescent reagents (GE health care, UK) and measured and quantified using a chemical imager (Fusion SL). A ⁇ 42 was measured using a mouse / rat amyloid beta (1-42) assay kit (IBL), and the manufacturer's instructions were referenced.
  • Figure 7 is a graph showing the comparison of ELAVL2 and A ⁇ expression according to AM-485-3p transfection in Hippocampal primary cells.
  • ELAVL2 is expressed in the hippocampus primary cells of 5xFAD, and it was confirmed that the expression of ELAVL2 was increased compared to the control in the cells transfected with Antagomir (AM) -485-3p (FIG. 7 (A)). This means that miRNA-485-3p inhibits the expression of ElAVL2, and demonstrated this in cells treated with antagomir. Since ELAVL2 is an important factor involved in neuronal excitability and affects cognitive function, the development of drugs or compositions such as miR-485-3p inhibitors that elevate ELAVL2 may be a key strategy in preventing or treating Alzheimer's disease.
  • AMD Antagomir
  • Inhibition of miR-485-3p was induced by nasal administration of sequence-specific entagomeres.
  • Intranasal administration of entagomeres was performed according to the method of targeting the brain without anesthetizing mice (Leah RT, et al. (2013) Intranasal Administration of CNS Therapeutics to Awake Mice. J Vis Exp. 2013; (74) ): 4440).
  • mice received an equivalent volume of Vehicle.
  • the anesthetized mice were sacrificed with the head and immediately brain extracted. Brain tissue sliced into sagittal sections was fixed and treated with DAPI to stain DNA. Stained samples were taken with confocal laster-scanning microsope (LSM510).
  • Example 7 Quantitative Comparative Analysis of ELAVL2 and A ⁇ in 5xFAD with Antagomir (AM) -485-3p Nasal Treatment
  • AM-485 (2'-O-Methylated-5'-GAGAGGAGAGCCGUGUAUGACU-3 '(SEQ ID NO: 9); 5 nmol in 24 ⁇ l of 0.1% v / v diethylpyrocarbonate-treated distilled water; Bioneer, Korea) Each nostril was changed every 2 minutes, and 4 ⁇ l of a pipette was administered (total 6 fractions). Control mice received an equivalent volume of Vehicle. Seven days after the nasal administration, anesthetized mice were sacrificed with the head and immediately brain extracted. Homogenates were prepared in the brain region (hippocampus and cortex) and Western blot was performed using ELAVL2 antibody (abcam, UK).
  • Immune response proteins were visualized with chemiluminescent reagents (GE health care, UK) and measured and quantified using a chemical imager (Fusion SL).
  • a ⁇ 42 was measured using a mouse / rat amyloid beta (1-42) assay kit (IBL) and referring to the manufacturer's instructions.
  • FIG. 9 is a quantitative comparative analysis of ELAVL2 and A ⁇ in 5xFAD treated with AM-485-3p intranasally. Since AM-485-3p treatment induced changes in ELAVL2 and A ⁇ in the mouse primary cell line (Example 5), AM-485-3p was treated nasal to 5xFAD to act as AM-485-3p in vivo. I wanted to check.
  • the expression of ELAVL2 in the AM-485-3p group was increased compared to the control group (Fig. 9 (A)). This means that the expression of ELAVL2 decreases with increasing expression of miR-485-3p, and the treatment of miR-485-3p inhibitors such as AM-485-3p may increase the decreased ELAVL2 level.
  • Immune response proteins were visualized with chemiluminescent reagents (GE health care, UK) and measured and quantified using a chemical imager (Fusion SL).
  • APP, Tau and p-Tau expression according to transfection of AM-485-3p in Hela cells were compared (FIG. 10).
  • the expression of APP was reduced by concentration compared to the control.
  • Hela cells treated with AM-485-3p 50nM also reduced phosphorylation of Tau protein, another cause of Alzheimer's disease.
  • the development of drugs or compositions, such as miR-485-3p inhibitors may be a key strategy in the prevention or treatment of Alzheimer's disease by simultaneously inhibiting the phosphorylation of Tau protein and the precursor of Amyloid beta, a major etiology of Alzheimer's disease. Can be.
  • the Y-maze test device consists of a closed maze of Y-shaped blocks made of black acrylic plates (10 cm wide, 41 cm wide and 25 cm high), and each maze is arranged at a constant angle of 120 ° to each other. After each maze is defined as A, B, and C areas, the animals are carefully placed in one area, allowed to move freely for 8 minutes, and the number and order of entry into each maze is measured to determine the spontaneous alteration (%). Evaluated. One point (sequential change: ABC, BCA, CAB, etc.) was accepted if entered into three different areas sequentially. In the case of not entering consecutively, the score was not recognized. % Spontaneous alteration was calculated by the following equation.
  • the passive avoidance test which is widely used to measure learning and memory, is a measure of the working memory ability of rodents.
  • the passive evacuation experiment device is a shuttle box divided into two compartments. One light bulb is installed in one room to create a bright environment that the experimental animal dislikes. Made me feel. After 2 hours of stress, the passive avoidance reaction was tested (training test). In the dark room, aluminum bars are spread at regular intervals, which can be used to shock the animal's paws. The animals tended to enter the dark room, so when placed in the dark room they were given an electric shock (5V, 0.5 mA, 10 sec) to remind the animal. Immediately thereafter, after 24 hours, the latency time into the dark room without electric shock was measured up to 90 seconds (retention test 1, 2, 3).
  • Figure 11 shows the results of cognitive function comparison of 5xFAD intranasally treated AM-485-3p, the behavioral test results showed that the change behavior and retention time in both 5xFAD-control compared to WT was reduced. Since the main symptoms of Alzheimer's dementia are behavioral impairment and memory deterioration, the behavioral impairment of 5xFAD appears to be due to excessive accumulation and pathology of A ⁇ . However, in the nasal treatment of AM-485-3p, both altered behavioral power (FIG. 11A) and retention time (FIG. 11B) increased compared to 5xFAD. This means that the treatment of AM-485-3p can mitigate pathological symptoms such as behavioral disorders and memory loss caused by stimulation of A ⁇ 42 production and improve major symptoms of Alzheimer's disease. Thus, the development of drugs or compositions that modulate miR-485-3p may be a new strategy to improve behavioral disorders and cognitive function, which are major symptoms of Alzheimer's dementia.
  • the composition for treating brain diseases comprising a miR-485-3p inhibitor can restore the ELAVL2 protein, unlike conventional Alzheimer's treatment agents limited to alleviating symptoms by inducing a decrease in the expression of amyloid beta 42.
  • Various diseases such as Alzheimer's disease, autism spectrum disorder, mental retardation, amyotrophic lateral sclerosis, etc. due to the decrease in ELAVL2 expression level can be treated. Therefore, according to the present invention, it is useful for fundamentally treating brain diseases including Alzheimer's disease.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 miR-485-3p를 이용한 뇌 질환 예방 또는 치료용 약학 조성물에 관한 것으로, 더욱 상세하게는 miR-485-3p 억제제를 포함하는 뇌 질환 예방 또는 치료용 약학 조성물 및 miR-485-3p의 발현량을 측정하는 단계를 포함하는 뇌 질환 예방 또는 치료제의 스크리닝 방법에 관한 것이다. 본 발명에 따르면, miR-485-3p 억제제를 포함하는 뇌 질환 치료용 조성물은 아밀로이드베타 42의 발현 감소를 유도하여 증상을 완화시키는 데 국한된 기존의 알츠하이머병 치료제들과는 달리, ELAVL2 단백질을 회복시킬 수 있어 ELAVL2 발현량 저하에 의한 각종 질환, 예를 들면 알츠하이머병, 자폐 스펙트럼 장애, 정신지체, 근위축성 측색 경화증 등을 근본적으로 치료할 수 있다. 따라서, 본 발명에 따르면, 알츠하이머병을 포함한 뇌 질환을 근본적으로 치료하는 데 유용하다.

Description

마이크로 RNA를 이용한 뇌 질환 예방 또는 치료 용도
본 발명은 miR-485-3p를 이용한 뇌 질환 예방 또는 치료 용도에 관한 것으로, 더욱 상세하게는 miR-485-3p 억제제를 포함하는 뇌 질환 예방 또는 치료용 약학 조성물 및 miR-485-3p의 발현량을 측정하는 단계를 포함하는 뇌 질환 예방 또는 치료제의 스크리닝 방법에 관한 것이다.
알츠하이머병은 치매의 가장 흔한 형태이며 75%의 치매 환자가 알츠하이머병이다. 대부분의 경우 알츠하이머병은 65세가 넘어 발병하지만, 드물게 그 이전에 발병할 수 있다. 미국에서는 65~74세 인구의 약 3%, 75~84세 인구의 약 19%, 85세 이상 인구의 50%가 이 병을 앓고 있다. 한국에서는 최근 한 농촌 지역을 중심으로 한 연구 보고에 의하면, 농촌 지역 60세 이상의 인구에서 약 21%가 치매 양상을 보이고, 이 중 63%가 알츠하이머형 치매인 것으로 보고되고 있다. 2006년 전 세계 26.6만명이 가진 질병이다. 2050년에는 85명중 1명꼴로 발병될 것으로 예측된다.
알츠하이머병에 대한 최근 치료 기조는 대뇌피질(cerebral cortex)과 해마(hippocampus)에서 기능이 손상된 콜린성 시그널링 및 전달(cholinergic signaling and transmission)에 의해 알츠하이머병이 유래 된다는 가능성에 중심을 두고 있다(Bartus et al., Science. 217(4558): 408-14(1982) 및 Coyle et al., Science. 219(4589):1184-90(1983)).
이런 뇌의 영역은 기억 및 지능과 연결되어 있으므로, 뇌의 이들 부분의 기능적인 결함은 기억 및 판단에 대한 손상을 주고 지적 능력을 상실케 한다. 신경 신호전달(neuronal signaling)에 손상이 이루어지는 정확한 과정이 논쟁 대상이 되고 있지만, 노인성 플라크(senile plaque) 및 신경원 섬유 농축체(neurofibrillary tangle: NFT)가 병리학적으로 주 현상으로 여겨진다.
특히, 아밀로이드베타(Aβ)의 축적으로 인한 노인성 플라크는 알츠하이머병의 가장 큰 특징이며, 이 병은 사후 부검으로 확진이 가능하다(Khachaturian, Arch. Neurol. 42(11):1097-105(1985)).
알츠하이머병의 경우, 콜린성 신경 전달의 손상을 억제할 수 있도록 아세틸콜린의 양을 증가시키거나, 아세틸콜린이 장기간 존재할 수 있도록 하거나, 또는 신경세포의 전달에 아세틸콜린이 더욱 효과적으로 작용하게 하는 약물과 치료법이 제시되고 있어서, 알츠하이머병 환자들의 아세틸콜린 활성도를 높이는 다양한 화합물들이 사용되고 있다.
현재 가장 효과적인 접근 방법은 시냅스에서 아세틸콜린을 빠르게 분해하여 신경 신호 전달을 막는 아세틸콜린에스테라아제의 활성을 억제하는 방법이다. 실제로 이런 저해제(예를 들어, tacrine, donepezil, galantamine 및 rivastigmine)들은 현재 FDA에서 인정한 알츠하이머병 치료 약물로, 시장에서 유통되고 있으며 병의 진행을 완화하는데 유효하나, 많은 경우 완치에는 잘 적용되지 않고 있다.
또한, 일부 화합물들은 신경의 일반적인 건강 상태를 개선하여 나이가 들어감에 따른 세포의 기능을 정상적으로 유지하는데 목적을 두고 있다. 예를 들어, NGF와 에스트로겐 같은 몇몇 약물들은 신경의 퇴화를 늦추어 주는 신경보호 역할을 하며, 항산화제와 같은 다른 약물들은 세포의 산화를 감소시켜 정상적인 노화의 결과로 나타나는 해로운 세포의 증가를 억제시킨다.
아밀로이드베타 펩타이드가 축적되는 정도가 많으면 알츠하이머병이 심각해지는데, 신경염 공간(neuritic space)에 아밀로이드베타의 축적을 낮추면 알츠하이머병의 진행을 늦추게 될 것으로 생각되고 있다. 또한, 아밀로이드 전구체 단백질(APP; amyloid precursor protein)이 α-, β-, γ-세크레타아제와 같은 세포 내 단백질 분해효소와의 조합으로 많은 다양한 형태들로 진행되는 것으로 생각된다. 하지만, 아밀로이드베타의 형성 과정이 실제 과학적으로 완전히 규명되지 않았기 때문에, 아밀로이드베타의 형성을 조절하는 것은 아직은 가능하지 않다.
아밀로이드베타의 축적이 신경신호 전달에 이상을 주는 과정은 명확하지 않으며, APP이 이상하게 절단되어 아밀로이드베타가 많이 생성되어 신경염 공간에 축적되게 되면, 플라크 형성이 유발된다. 따라서 이런 절단 반응에 관여하는 많은 다른 요인들(예를 들어, 염증반응 등)은 타우(Tau) 단백질의 인산화를 증가시키고, NFT와 쌍나선형 필라멘트(paired helical filament: PHF)의 축적을 증가시켜서 결국 신경의 손상을 증가시킨다. 이런 요인들 모두 신경의 기능 장애를 유발하고 궁극적으로 알츠하이머병의 치매로 진행을 가속시킨다.
ELAVL2(ELAV like RNA binding protein 2)는 ELAV like neuron-specific RNA binding protein 2로 nELAVL2의 1가지 형태이다. nELAVL2는 뇌-특이적으로 발현되는 RNA binding protein으로, Neurodegenerative disease에 관련이 있다고 알려져 있다. 알츠하이머병 환자의 사후부검 후 뇌 조직을 이용해 high-throughput RNA sequence를 실시한 결과, ELAVL2가 저발현되어 있는 것이 알려져 있다.
이와 관련하여 미국등록특허 제5,532,219호는 4,4'-디아미노디페닐술폰 등을 포함하는 알츠하이머병 치료용 조성물을 개시하고 있고, 미국등록특허 제5,506,097호는 파라-아미디노페닐메탄술포닐 플루오리드 또는 에베락톤 A를 포함하는 알츠하이머병 치료용 조성물을 개시하고 있으며, 미국등록특허 제6,136,861호는 비시클로[2.2.1]헵탄을 포함하는 알츠하이머병 치료용 조성물을 개시하고 있다.
한편, 최근 마이크로 RNA 억제자를 이용한 치료제의 개발이 시도되고 있다. 국제특허공개공보 WO 2013/045652(2013.04.04)에는 miR-134의 억제자를 이용한 뇌전증 치료에 대하여 개시되어 있고, WO 2015/025995(2015.02.26)에는 miR-203의 억제자를 이용한 뇌전증 치료에 대하여 개시되어 있다. 또한, 유럽등록특허 제2436784호(2013.09.11)에는 miR-203을 이용한 대장암의 진단 및 치료에 대하여 개시되어 있다.
알츠하이머병의 치료 방법 개발이 활발히 진행되고 있으나, 현재로는 일시적인 증상의 개선을 제공하는 것에 불과하다. 결론적으로, 현재 알츠하이머병 치료는 병의 진행 과정을 되돌리는 것이 아니라 병의 증상을 개선하는데 초점을 두고 있으며, 병의 생물학적인 지식에 대하여 보다 많이 알고 있으나, 임상에의 적용 결과는 아직 성공적이지는 않다.
이에, 본 발명자들은 알츠하이머병을 포함한 뇌신경 질환의 예방 또는 치료제를 개발하고자 예의 노력한 결과, miR-485-3p의 발현을 억제하거나, miR-485-3p와 ELAVL2의 상호작용을 억제하는 경우, Aβ42의 생성 억제, APP의 발현 억제 또는 Tau 단백질 인산화 억제를 확인하여, 뇌 질환 치료에 이용될 수 있음을 확인하고, 본 발명을 완성하였다.
본 배경기술 부분에 기재된 상기 정보는 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것이며, 이에 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 있어 이미 알려진 선행기술을 형성하는 정보를 포함하지 않을 수 있다.
발명의 요약
본 발명의 목적은 마이크로 RNA를 이용한 뇌 질환 예방 또는 치료용 약학 조성물을 제공하는 데 있다. 또한, 마이크로 RNA의 발현량 측정을 통한 뇌 질환 예방 또는 치료제의 스크리닝 방법을 제공하는 데 있다.
상기 목적을 달성하기 위하여, 본 발명은 miR-485-3p 억제제를 포함하는 뇌 질환 예방 또는 치료용 약학 조성물을 제공한다.
본 발명은 또한, 약학적으로 유효한 양의 miR-485-3p 억제제를 투여하는 단계를 포함하는 뇌 질환의 예방 또는 치료 방법을 제공한다.
본 발명은 또한, 뇌 질환의 예방 또는 치료를 위한 miR-485-3p 억제제의 용도를 제공한다.
본 발명은 또한, 뇌 질환의 예방 또는 치료용 약제 제조를 위한 miR-485-3p 억제제의 사용을 제공한다.
본 발명은 또한, (A) miR-485-3p를 발현하는 세포에 후보물질을 처리하고, miR-485-3p의 발현량을 측정하는 단계; 및 (B) 상기 (A) 단계에서 측정된 miR-485-3p의 발현량이 후보물질을 처리하지 않은 대조군과 비교하여 억제된 경우, 후보물질을 뇌 질환 예방 또는 치료제로 선별하는 단계를 포함하는 뇌 질환 예방 또는 치료제의 스크리닝 방법을 제공한다.
도 1은 cDNA 합성 및 검출 과정을 요약한 것이다.
도 2는 (A)는 대조군 대비 환자군의 miRNA 발현 패턴 분석(volcano blot), (B)는 대조군 대비 환자군의 miRNA 발현 패턴 분석(scatter blot)을 나타낸 그래프이다.
도 3은 hippocampus 및 cortex에서 miR-485-3p의 발현을 비교한 그래프이다.
도 4는 ELAVL2의 3’-비번역 부위(UTR) mRNA를 나타낸 목록이다.
도 5는 (A)는 5xFAD의 대뇌피질에서 Aβ 42의 정량 비교 분석 그래프이며, (B)는 해마에서 Aβ 42의 정량 비교 분석 그래프이다.
도 6은 5xFAD의 대뇌피질 및 해마에서 ELAVL2의 발현 비교 결과이다.
도 7은 Hippocampal primary cell에서 Antagomir(AM)-485-3p transfection에 따른 ELAVL2 및 Aβ의 발현 비교 그래프이다.
도 8은 Cy3-AM-485-3p의 비강 투여 후 약물 전달 이미징 분석 결과이다.
도 9는 AM-485-3p를 비강 내 처리한 5xFAD에서 ELAVL2 및 Aβ의 정량 비교 분석 결과 그래프이다.
도 10은 Hela cells에서 AM-485-3p transfection에 따른 APP, Tau 및 p-Tau의 발현을 비교한 결과이다.
도 11은 AM-485-3p를 비강 내 처리한 5xFAD의 인지 기능 비교 결과 그래프이다.
발명의 상세한 설명 및 바람직한 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명의 일 실시예에서, 알츠하이머 환자에게서 miR-485-3p의 발현이 증가됨을 확인하고, miR-485-3p의 발현 또는 활성을 억제하는 올리고뉴클레오타이드를 통해 ELAVL2의 발현량을 회복시키고, Aβ 42의 생성을 감소시켜 알츠하이머병의 주요 증상인 행동 장애 및 인지기능 저하를 개선시킬 수 있음을 확인하였다.
따라서, 본 발명은 일 관점에서, miR-485-3p 억제제를 포함하는 뇌 질환 예방 또는 치료용 약학 조성물에 관한 것이다.
본 발명에 있어서, 상기 ‘miR’ 또는 ‘마이크로 RNA(miRNA)’는 표적 RNA의 분해(degradation)를 촉진하거나 그들의 번역을 억제함으로써 유전자 발현을 전사 후에 조절하는 21 내지 23개의 비코딩 RNA를 의미한다.
본 발명에 있어서, 상기 miRNA의 성숙 서열은 miRNA 데이터베이스(http://www.mirbase.org)에서 얻을 수 있다. 2012년 8월 기준 miRNA 데이터베이스(19판, miRBase)에 의하면 193개 종에서 유래한 25,141개의 성숙 miRNA가 등록되어 있다.
일반적으로 miRNA는 pre-miRNA라 불리는 헤어핀 구조를 갖는 약 70 내지 80nt(nucleotide) 길이의 전구체로 전사된 후, RNAse III 효소인 Dicer에 의해 잘려 성숙된 형태로 생성된다. miRNA는 miRNP라 불리는 리보뉴클레오복합체를 형성하여 표적 부위에 상보적 결합을 통해 표적 유전자를 절단하거나, 번역을 억제한다. 30% 이상의 인간 miRNA는 클러스터로 존재하며, 하나의 전구체로 전사된 후, 절단과정을 거쳐 최종 성숙 miRNA가 형성된다.
본 발명에 있어서, 상기 miR-485-3p는 이에 제한되는 것은 아니나, 뇌, 특히 해마 및 피질에서 발현되는 것을 특징으로 할 수 있다. ELAVL2(ELAV like RNA binding protein 2)를 코딩하는 ELAVL2 mRNA의 3’ 비번역 부위에 결합하여 이의 발현을 억제하여, 뇌에서 ELAVL2 단백질 농도를 감소시킨다.
본 발명에 있어서, 상기 miR-485-3p의 서열은 포유류 유래 예를 들면, 인간, 마우스 또는 래트 유래인 것을 특징으로 할 수 있다. 본 발명의 일 실시예에서, 인간 유래 miR-485-3p의 서열을 이용하였으며, 이는 성숙된 서열 [5’-GUCAUACACGGCUCUCCUCUCU-3’(서열번호 1)]은 물론 전구 서열 [5’-ACUUGGAGAGAGGCUGGCCGUGAUGAAUUCGAUUCAUCAAAGCGAGUCAUACACGGCUCUCCUCUCUUUUAGU-3’(서열번호 2)]을 포함한다.
본 발명에 있어서, 상기 miR-485-3p 억제제는 miR-485-3p의 발현을 억제하는 것을 특징으로 할 수 있다. 또는 miR-485-3p와 ELAVL2(ELAV like neuron-specific RNA binding protein 2)의 3’-UTR과의 상호작용을 억제하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 miR-485-3p 억제제는 miR-485-3p의 세포 내 작용 또는 기능을 억제 또는 방해하는 것을 특징으로 할 수 있다. 상기 miR-485-3p를 억제하는 것은 miR-485-3p가 이의 표적, 예를 들면 ELAVL2 단백질을 코딩하는 mRNA 분자와의 결합을 직접적으로 억제하는 것을 포함한다. 또는 저분자 억제제, 항체 또는 항체의 단편을 이용하여 miR-485-3p의 기능을 직접적으로 억제하거나, small interfering RNA 분자를 이용하여 간접적으로 조절되는 것을 포함한다.
본 발명에 있어서, 상기 miR-485-3p 억제제는 서열번호 1 또는 서열번호 2의 염기서열의 전부 또는 일부에 결합하는 핵산 분자인 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 서열번호 1 또는 서열번호 2의 염기서열의 일부에 결합하는 핵산 분자의 길이는 7 내지 50 nt(뉴클레오타이드), 바람직하게는 10 내지 40 nt, 더욱 바람직하게는 15 내지 30 nt, 더더욱 바람직하게는 15 내지 25 nt, 특히 16 내지 19 nt이나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 핵산 분자는 이에 제한되는 것은 아니나, 서열번호 1의 염기서열 중 1번째 또는 2번째부터 7번째 또는 8번째까지의 염기서열에 결합할 수 있다.
본 발명에 있어서, 상기 핵산 분자는 DNA, RNA, antagomiR(miRNA의 안티센스 올리고뉴클레오티드), siRNA, shRNA 및 올리고뉴클레오타이드로 구성된 군에서 선택되는 것을 특징으로 할 수 있다.
본 발명의 일 실시예에서, 상기 miR-485-3p의 활성 방해 또는 억제를 위하여 직접 또는 간접적으로 전구서열(서열번호 2) 및 성숙서열(서열번호 1)의 활성을 억제하였다. 또한, 상기 miR-485-3p의 활성 억제는 miR-485-3p의 전사 및/또는 miR-485-3p의 표적 mRNA와의 결합을 억제하여 이의 세포 내 농도를 낮추는 것을 포함한다.
본 발명에 있어서, 상기 miR-485-3p 억제제는 miR-485-3p의 발현 및/또는 활성을 억제할 수 있는 임의의 물질을 포함하며, 이에 제한되는 것은 아니나, 저분자 화합물, antagomiR, 안티센스 분자, 소헤어핀 RNA 분자(shRNA), 소방해 RNA 분자(siRNA), 시드 표적 LNA(Locked Nucleic Acid) 올리고뉴클레오타이드, 데코이올리고뉴클레오타이드, 앱타머, 리보자임 또는 DNA:RNA 하이브리드를 인지하는 항체를 포함할 수 있다.
본 발명에 있어서, 상기 miR-485-3p 억제제는 miR-485-3p의 전구 및/또는 성숙 서열의 전부 또는 일부, 특히 씨드 서열에 상보적으로 결합하여, 이의 활성을 억제할 수 있는 안티센스 올리고뉴클레오타이드인 것을 특징으로 할 수 있다.
‘씨드 서열’은 miRNA의 표적분자의 인지에 매우 중요한 다양한 종에서 보존된 서열이다(Krenz, M. et al., J. Am. Coll. Cardiol. 44:2390-2397(2004); H. Kiriazis, et al., Annu. Rev. Physiol. 62:321(2000)). miRNA는 씨드 서열을 통해 표적과 결합하기 때문에, 씨드 서열의 표적과의 상호작용을 억제하는 경우, 표적 mRNA의 번역 등을 효과적으로 억제할 수 있다.
본 발명에 있어서, 상기 핵산 분자는 서열번호 1의 염기서열에 일부 또는 전부가 상보적인 서열을 포함하는 안티센스 올리고뉴클레오타이드인 것을 특징으로 할 수 있다. 상기 안티센스 올리고뉴클레오타이드는 서열번호 3 내지 서열번호 7로 구성된 군에서 선택되는 염기서열로 표시되는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 안티센스 올리고뉴클레오타이드는 이에 제한되는 것은 아니나, 서열번호 1의 염기서열 중 1번째 또는 2번째부터 7번째 또는 8번째까지의 염기서열에 전부 또는 부분적으로 상보적인 서열을 포함할 수 있다. 상기 안티센스 올리고뉴클레오타이드는 5’-GUGUAUGAC-3’(서열번호 3), 5’-UGUAUGAC-3’(서열번호 4), 5’-GUGUAUGA-3’(서열번호 5), 5’-UGUAUGA-3’(서열번호 6) 또는 5’-AGAGAGGAGAGCCGUGUAUGAC-3’(서열번호 7)로 구성된 군에서 선택되는 염기서열로 표시되는 것을 특징으로 할 수 있다.
상기 안티센스 올리고뉴클레오타이드는 표적으로 하는 miRNA, 특히 miRNA의 씨드 서열의 전부 또는 일부와 상보적인 서열을 가지고 있어 miRNA와 이합체(duplex)를 형성할 수 있는 핵산-기반 분자를 포괄하는 것이다. 따라서 상기 안티센스 올리고뉴클레오타이드는 상보적 핵산-기반 억제제로 나타낼 수 있다.
또한, 상기 안티센스 올리고뉴클레오타이드에는 다양한 분자가 포함되며, 예를 들면 리보핵산(RNA), 디옥시리보핵산(DNA), antagomiR, 2’-O-변형 올리고뉴클레오타이드, 포스포로티오에이트-백본 디옥시리보뉴클레오타이드, 포스포로티오에이트-백본 리보뉴클레오타이드, PNA(peptide nucleic acid) 올리고뉴클레오타이드 또는 LNA(locked nucleic acid) 올리고뉴클레오타이드일 수 있으며, 바람직하게는 리보핵산이다.
상기 리보핵산은 이중가닥 소헤어핀 RNA 분자(shRNA), 소방해 RNA 분자(siRNA) 및 라이보자임을 포함한다.
상기 LNA(locked nucleic acid)는 기존 올리고뉴클레오타이드에 비해 리보오스 당 부위의 2’내지 4’ 탄소 사이에 추가적인 변형을 가하여 잠금(locked)형태를 가지게 되어 열 안정성을 확보한다.
상기 PNA(peptide nucleic acid)는 당-포스페이트 백본 대신에 펩타이드-기반 백본을 포함한다.
2’-O-변형 올리고뉴클레오타이드는 바람직하게는 2’-O-알킬 올리고뉴클레오타이드이고, 보다 바람직하게는 2’-O-C1-3 알킬 올리고뉴클레오타이드이며, 가장 바람직하게는 2’-O-메틸 올리고뉴클레오타이드이다.
상기 안티센스 올리고뉴클레오타이드는, 좁은 의미의 안티센스 올리고뉴클레오타이드, antagomiR 및 억제 RNA 분자를 포함한다.
상기 antagomiR는 단일-가닥의 화학적으로 변형된 올리고뉴클레오타이드로서, 내인성 microRNA의 침묵(silence)에 사용된다. antagomiR는 Arganoute 2(Ago 2) 절단 부위에서 상보적이지 않는 서열을 포함할 수 있다. 또는 Ago2 절단이 억제되도록 예를 들면 2’ 메톡시기, 3’ 콜레스테롤기, 포스포로티오에이트로 염기가 변형되어 있으며, 표적서열에 상보적 서열을 가진다.
본 발명에 있어서, 상기 antagomiR는 miR-485-3p에 적어도 부분적으로 또는 완전하게 상보적인 서열을 갖는다. 상기 antagomiR는 하나 이상의 변형(예컨대, 2’-O-메틸-당 변형 또는 3’ 콜레스테롤 변형)을 포함할 수 있다. 또는 하나 이상의 포스포로티오에이트 결합을 포함하며, 적어도 부분적으로 포스포로티오에이트 백본을 갖는다.
본 발명에 있어서, 상기 miR-485-3p의 발현을 억제하기 위하여 적합한 antagomiR의 길이는 7 내지 50 nt(뉴클레오타이드), 바람직하게는 10 내지 40 nt, 더욱 바람직하게는 15 내지 30 nt, 더더욱 바람직하게는 15 내지 25 nt, 특히 16 내지 19 nt이나, 이에 제한되는 것은 아니다.
본 발명에서 사용된 용어 ‘상보적’은 소정의 혼성화 또는 어닐링 조건, 바람직하게는 생리학적 조건하에서 안티센스 올리고뉴클레오타이드가 miR-485-3p 표적에 선택적으로 혼성화 할 정도로 충분히 상보적인 것을 의미한다. 일부 또는 부분적으로 실질적으로 상보적(substantially complementary) 및 완전히 상보적 (perfectly complementary)인 것을 모두 포괄하는 의미를 가지며, 바람직하게는 완전히 상보적인 것을 의미한다. 실질적으로 상보적이란, 완전히 상보적인 것은 아니지만, 표적 서열에 결합하여 본 발명에 따른 효과 즉, miR-485-3p의 활성을 방해하기에 충분한 효과를 낼 정도의 상보성을 의미한다.
상기 ‘핵산’은 올리고뉴클레오타이드, DNA, RNA, 및 폴리뉴클레오타이드, 그 유사체 및 그 유도체를 포함하는 것으로 예를 들면 PNA 또는 그 혼합물을 포함한다. 또한, 핵산은 단일 또는 이중 가닥일 수 있으며, mRNA, microRNA, siRNA 또는 폴리펩타이드 등을 포함하는 분자를 코딩할 수 있다.
본 발명에 있어서, 상기 안티센스 올리고뉴클레오타이드는 1) LNA(locked nucleic acid) 또는 PNA(peptide nucleic acid) 형태로의 변형; 2) 뉴클레오타이드 내 당 구조의 2’탄소 위치에서 -OH기가 -CH3(메틸)로 치환; 및 3) 뉴클레오타이드 결합이 포스포로티오에이트(phosphorothioate)로 변형으로 구성된 군에서 선택되는 어느 하나 이상의 변형을 포함하는 것을 특징으로 할 수 있다.
상기 안티센스 올리고뉴클레오타이드는 이를 구성하는 하나 이상의 뉴클레오타이드가 LNA 또는 PNA일 수 있으며, 이를 구성하는 하나 이상의 뉴클레오타이드의 당이 2’-O-메틸화 또는 메독실에틸화 될 수 있으며, 또는 뉴클레오타이드를 연결하는 백본(골격)에 하나 이상의 포스포티오에이트를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 miR-485-3p 억제제는 1) ELAVL2의 발현량 회복; 2) 아밀로이드 베타 42(Aβ42)의 생성 억제; 3) 아밀로이드 전구체 단백질(APP; amyloid precursor protein)의 발현 억제; 및 4) Tau 단백질의 인산화 억제의 특성 중 어느 하나 이상을 갖는 것을 특징으로 할 수 있다.
본 발명은 miR-485-3p가 ELAVL2의 발현을 과도하게 억제하여 알츠하이머병 및 여러 가지 뇌 질환 발병에 관여한다는 발견에 근거한 것이다.
본 발명의 일 실시예에서, 돌연변이 형태의 APP와 PSEN1를 over expression시켜 6주 정도부터 intraneuronal Aβ42의 축적이 심하게 나타나는 Alzheimer disease의 동물모델인 5xFAD 마우스를 이용하여, miR-485-3p 억제제가 ELAVL2의 발현량 회복, Aβ42 축적 억제, APP의 발현 억제 또는 Tau 단백질의 인산화 억제 특성을 갖는 것을 확인하였다.
ELAVL2 발현량 감소는 알츠하이머병, 자폐 스펙트럼 장애, 정신지체, 근위축성 측색 경화증발병과 관련이 있다고 알려져 있다. 특히 흥분독성을 유발하는 kainic acid, NMDA, quisulate, AMPA, glutamate 등의 물질에 의해 ELAVL2 단백질 레벨 감소 및 뇌신경 세포 죽음을 초래하고, 뇌 기능의 장애를 유발하여 경련, 뇌졸중, 파킨슨씨 병, 척수손상 등과 같은 여러 가지 뇌 질환을 일으킨다는 것이 알려져 있다(Kaminska, B. et al., Acta Biochim Pol. 44:781-789). 따라서, miR-485-3p 활성 억제를 통한 ELAVL2 단백질의 회복은 알츠하이머병 및/또는 자폐 스펙트럼 장애, 정신지체, 근위축성 측색 경화증, 경련, 뇌졸중, 파킨슨씨 병, 척수손상 등과 같은 여러 가지 뇌 질환의 치료에 사용될 수 있다.
본 발명에 있어서, 상기 뇌 질환은 알츠하이머병, 자폐 스펙트럼 장애, 정신지체, 근위축성 측색 경화증, 경련, 뇌졸중, 파킨슨씨 병 및 척수손상으로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 약학 조성물은 miR-485-3p 억제제 이외에, 관련질환의 치료를 위해 동일, 유사 또는 시너지 기능을 나타내는 유효성분 1종류 이상 또는 miR-485-3p 억제제 및 유효성분의 용해성 및/또는 흡수성을 유지/증가시키는 화합물을 추가로 포함할 수 있다. 또한, 선택적으로 면역조절제 및/또는 화학치료제를 추가로 포함할 수 있다.
상기 약학 조성물은 약학적으로 허용 가능한 희석제, 담체 및/또는 아주번트를 1종 이상 포함할 수 있다. 약학적으로 허용 가능한 담체는 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 에탄올, 리포좀 및 이들 성분 중 하나 이상의 성분을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다.
또한, 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있으며, 표적 기관에 특이적으로 작용할 수 있도록 표적 기관 특이적 항체 또는 기타 리간드를 상기 담체와 결합시켜 사용할 수 있다.
나아가 해당 기술분야의 적정한 방법으로 또는 레밍턴의 문헌(Remington's Pharmaceutical Science(최근판), Mack Publishing Company, Easton PA)에 개시되어 있는 방법을 이용하여 각 질환에 따라 또는 성분에 따라 바람직하게 제형화할 수 있다. 예를 들면 현탁액, 리포좀 제형, 에멀젼, 정제, 캡슐, 젤, 시럽 또는 좌제 중 어느 한 가지로 제형화 할 수 있다.
상기 약학 조성물은 수성, 비수성 또는 혼합 매질을 이용한 현탁액으로 제조될 수 있다. 수성 현탁액은 소디움 카르복시메틸셀룰로스, 소르비톨 및/또는 덱스트란과 같은 현탁액의 점도를 높이는 물질을 추가로 포함할 수 있다.
본 발명에 있어서, 상기 약학 조성물은 비강 내 투여, 정맥 내 투여, 피하 주사, 뇌척수강 내 주사, 흡입 투여 또는 경구 투여용 제형 중 어느 하나로 제형화된 것을 특징으로 할 수 있다.
본 발명에 따른 약학 조성물의 투여방법은 특별히 제한되는 것은 아니며, 공지된 억제제의 투여방법을 적용할 수 있다. 목적하는 방법에 따라 비경구 투여(예를 들어 비강 내, 정맥 내, 피하, 복강 내 또는 국소에 적용)하거나 경구 투여할 수 있으며, 신속한 치료 효과를 얻기 위해서는 비강 내 주입에 의한 투여가 바람직하다.
상기 약학 조성물은 다양한 경로로 전달될 수 있으며, 예를 들면 인퓨전 또는 볼러스 주사, 표피 또는 점막(경구점막, 항문 점막, 장 점막 등)을 통해 투여될 수 있다. 전신 또는 국소투여 될 수 있다.
본 발명에 있어서, 상기 약학 조성물은 뇌로 전달되는 것을 특징으로 할 수 있다. 상기 약학 조성물은 적절한 경로를 통해 중추신경 또는 말초신경으로 도입하는 것이 바람직하다. 적절한 경로는 뇌실내(intraventricular) 또는 수막내(intrathecal) 투여를 포함한다. 이러한 투여는 저장고에 연결된 카테터를 이용하여 달성될 수 있다. 또한, 에어로졸로 제형화되어 흡입기 또는 분무기를 통해 폐를 통한 투여가 사용될 수 있다. 본 발명에 따른 효과가 발생하는 한, 정맥 내 투여, 피하 주사, 뇌척수강 내 주사, 흡입 투여, 또는 경구 투여용 제형을 제외하는 것은 아니다.
본 발명에 있어서, 상기 약학 조성물은 여러 가지 단위 투여 형태로 제조될 수 있다. 이러한 형태로는 점비액(nasal drop), 비강용 스프레이, 비강용 겔, 비강용 연고, 및 비강용 분말이 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 실시예에서, 상기 조성물은 비강 투여가 가능하였다. 비강 투여 시, 후각신경경로를 따라 뇌로 전달됨에 따라 상기 약학 조성물의 효과를 높일 수 있다. 비강은 비중격에 의해 좌우로 구분되는 콧속의 공간을 지칭하며, 비강 내 투여는 본 발명의 조성물을 비강 상피의 어느 조직으로 전달하는 것을 의미한다. 비강 내 투여를 위해 비강용으로 허용 가능한 담체를 포함할 수 있는데, 상기 담체는 포유동물, 바람직하게는 인간의 비강 상피의 어느 부분에 투여하기에 적당한 한 종 이상의 적절한 고상 또는 필러 희석제 또는 캡슐화 물질을 의미한다. 대표적으로, 상기 담체는 액체, 용액, 현탁액, 겔, 연고, 로션, 또는 이들의 조합일 수 있다. 바람직하게, 상기 담체는 약학적으로 허용 가능한 수성 담체이다.
또한, 상기 담체에는 전달 강화제를 포함할 수 있는데, 비강 내 전달 강화제에는, 응집 저해제, 투여량 변경제, pH 제어제, 분해 효소 저해제, 점액질 용해 또는 점액 제거제, 섬모안정 시약들, 막투과 촉진제, 계면 활성제, 담즙산염, 인지질 또는 지방산 첨가제, 혼합 미셀(micelle), 리포솜, 또는 담체, 알콜, 에나민(enamine), 산화질소 공여체 혼합물, 긴 사슬(long-chain) 양친매성 분자, 소형 소수성 침투 강화제, 나트륨 또는 살리실산 유도체, 아세토아세트산의 글리세롤 에스테르, 시클로덱스트린 또는 베타-시클로덱스트린 유도체, 중간 사슬 지방산, 킬레이트 시약, 아미노산 또는 그의 염, N-아세틸아미노산 또는 그의 염, 선택된 막 성분에 대한 분해 효소, 지방산 합성 저해제, 콜레스테롤 합성 저해제 또는 산화질소 자극 물질, 키토산, 그리고 키토산 유도체와 같은 상피 접합 생리학의 조절 약제, 혈관 확장제, 선택적 운반 촉진제 등이 포함될 수 있으며, 비내 점막 전달을 강화하기 위해, 본 발명의 조성물이 효과적으로 조합, 결합 및 보관되고, 캡슐화되거나 활성 약제를 안정시킬 수 있게 해주는, 안정적 운송체, 담체, 지지 물질 또는 착물 생성종(complex-forming species) 등이 포함될 수 있다.
본 발명에 있어서, 상기 약학 조성물은 약학적 또는 치료적으로 유효한 양으로 투여할 수 있다. 본 발명에 있어, 약학적 또는 치료적으로 유효한 양은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
또한, 상기 약학 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고, 종래의 치료제와 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
상기 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설률 및 질환의 중증도 등에 따라 그 범위가 매우 다양하며, 적정한 투여량은 환자의 체내에 축적된 약물의 양 및/또는 사용되는 폴리뉴클레오타이드의 구체적 효능 정도에 따라 달라질 수 있다. 일반적으로 인 비보 동물모델 및 인 비트로에서 효과적인 것으로 측정된 EC50을 기초로 계산될 수 있으며, 예를 들면 체중 1kg당 0.01μg 내지 1g 일 수 있다. 일별, 주별, 월별 또는 연별의 단위 기간으로, 단위 기간당 일 회 내지 수회 나누어 투여될 수 있으며, 또는 인퓨전 펌프를 이용하여 장기간 연속적으로 투여될 수 있다. 반복투여 횟수는 약물이 체내 머무는 시간, 체내 약물 농도 등을 고려하여 결정된다. 질환 치료 경과에 따라 치료가 된 후라도, 재발을 위해 조성물이 투여될 수 있다.
본 발명에 있어서, 상기 약학 조성물의 유효성분, 예를 들면 안티센스 올리고뉴클레오타이드는 그 자체로 또는 약학적으로 허용 가능한 염의 형태로 조성물에 사용될 수 있다. 약학적으로 허용 가능한 염이란, 본 발명에 따른 올리고뉴클레오타이드의 생물학적 활성은 유지하면서, 바람직하지 않는 독성은 최소화된 것이다. 이러한 염은 예를 들면 아연, 칼슘, 비스부스, 바륨, 마그네슘, 알루미늄, 코퍼, 코발트, 니켈, 카드뮴, 소디움, 포타슘 등과 같은 금속 양이온과 형성된 염기 부가염 및 유기 아미노산과 형성된 염, 또는 암모니아, N,N-디벤질에틸렌디아민(dibenzylethylene-diamine), D-클루코사민(glucosamine), 테트라에틸암모늄(tetraethylammonium), 또는 에틸렌디아민(ethylenediamine) 유래의 양이온과 형성된 염을 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 약학 조성물의 유효성분인 안티센스 올리고뉴클레오타이드는 이를 이루는 뉴클레오타이드의 특성상 음으로 하전되어 있는 것을 특징으로 할 수 있다. 세포막은 친지질성 성질로 인해, 안티센스 올리고뉴클레오타이드의 세포막으로의 흡수가 감소될 수 있다. 이러한 극성으로 인한 흡수 방해는 하기에 기재된 전구약물 접근방식을 통해 해결될 수 있다(Crooke, R. M. (1998) in Crooke, S. T. Antisense research and Application. Springer-Verlag, Berlin, Germany, vol. 131, pp. 103-140).
본 발명에서 사용된 용어 ‘치료’, ‘완화’ 또는 ‘개선’이란 본 발명에 따른 조성물의 투여로 관련 질환의 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다. 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자라면, 대한의학협회 등에서 제시된 자료를 참조하여 질환의 정확한 기준을 알고, 개선, 향상 및 치료된 정도를 판단할 수 있을 것이다.
본 발명에서 사용된 용어 ‘예방’은 관련 질환의 발병을 억제 또는 지연시키는 모든 행위를 의미한다. 본 발명에 있어서 상기 약학 조성물은 초기 증상, 또는 나타나기 전에 투여할 경우 관련 질환을 예방할 수 있다는 것은 당업자에게 자명할 것이다.
본 발명의 일 실시예에서, 알츠하이머 환자에게서 miR-485-3p의 발현이 증가됨을 확인하고, miR-485-3p의 발현 또는 활성을 억제하는 올리고뉴클레오타이드를 통해 알츠하이머병의 주요 증상인 행동 장애 및 인지기능 저하를 개선시킬 수 있음을 확인하였다.
따라서, 본 발명은 다른 관점에서, 약학적으로 유효한 양의 miR-485-3p 억제제를 투여하는 단계를 포함하는 뇌 질환의 예방 또는 치료 방법에 관한 것이다.
본 발명에 있어서, 상기 뇌 질환의 예방 또는 치료 방법은 대상체의 세포 또는 조직, 특히 뇌세포 또는 뇌조직에서 miR-485-3p의 활성 억제를 통한 방법인 것을 특징으로 할 수 있다.
본 발명은 또 다른 관점에서, 뇌 질환의 예방 또는 치료를 위한 miR-485-3p 억제제의 용도에 관한 것이다.
본 발명은 또 다른 관점에서, 뇌 질환의 예방 또는 치료용 약제 제조를 위한 miR-485-3p 억제제의 사용에 관한 것이다.
miR-485-3p 억제제, miR-485-3p 활성 조절 또는 억제, 투여 방법, 치료 가능한 질환의 종류 등에 대하여는 앞서 설명한 것을 참조할 수 있다.
본 발명은 또 다른 관점에서, (A) miR-485-3p를 발현하는 세포에 후보물질을 처리하고, miR-485-3p의 발현량을 측정하는 단계; 및 (B) 상기 (A) 단계에서 측정된 miR-485-3p의 발현량이 후보물질을 처리하지 않은 대조군과 비교하여 억제된 경우, 후보물질을 뇌 질환 예방 또는 치료제로 선별하는 단계를 포함하는 뇌 질환 예방 또는 치료제의 스크리닝 방법에 관한 것이다.
본 발명에 있어서, 상기 miR-485-3p의 활성은 상기 miR-485-3p와 ELAVL2(ELAV like neuron-specific RNA binding protein 2)의 3'-UTR과의 상호작용 분석으로 결정되는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 뇌 질환은 알츠하이머병, 자폐 스펙트럼 장애, 정신지체, 근위축성 측색 경화증, 경련, 뇌졸중, 파킨슨씨 병 및 척수손상으로 구성된 군에서 선택되는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 스크리닝 방법은 miR-485-3p를 발현하는 세포를 후보물질과 접촉시킨 후, miR-485-3p의 발현량의 변화를 접촉 전 또는 접촉되지 않은 대조군 세포와 비교하여, 발현량에 변동, 특히 감소가 있는 것을 뇌 질환 예방 또는 치료제로 선별하는 것을 특징으로 할 수 있다.
상기 스크리닝 방법에 사용되는 miR-485-3p의 발현량 측정은 노던블랏, RT-PCR, 마이크로 어레이를 이용한 혼성화 방법 등과 같은 공지된 방법을 이용하여 수행될 수 있다.
본 발명에 있어서, 상기 miR-485-3p는 이를 발현하는 세포의 형태로 제공되며, 상기 활성은 상기 miR-485-3p와 이의 표적인 ELAVL2 단백질의 3’-UTR 과의 상호작용 분석으로 결정된다. 예를 들어, 상기 miR-485-3p를 발현하는 세포를 후보물질과 접촉시킨 후, ELAVL2 단백질의 3’-UTR과 miR-485-3p의 상호작용 정도를 접촉 전 또는 접촉되지 않은 대조군 세포와 비교하여, 상호작용에 변동, 특히 감소가 있는 것을 뇌 질환 예방 또는 치료제로 선별하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 스크리닝 방법에서 사용되는 세포의 종류 및 후보물질의 양 및 종류 등은 사용하는 구체적인 실험방법 및 후보물질의 종류에 따라 달라지며, 당업자라면 적절한 세포의 종류, 양 및/또는 조건을 선택할 수 있을 것이다. 후보물질과 접촉되지 않은 대조군과 비교하여 후보물질의 존재 하에서 miR-485-3p의 활성의 감소를 가져오는 물질을 치료제로 선별한다. 대조군과 비교하여 약 99% 이하 감소, 약 95% 이하 감소, 약 90% 감소, 약 85% 감소, 약 80% 감소, 약 75% 감소, 약 70% 감소, 약 65% 이하 감소, 약 60% 이하 감소, 약 55% 감소, 약 50% 이하 감소, 약 45% 이하 감소, 약 40% 이하 감소, 약 30% 이하 감소 또는 약 20% 이하 감소를 의미하나, 이를 벗어나는 범위를 제외하는 것은 아니다.
상기 스크리닝 방법에 사용되는 RNA-RNA 상호작용 검출 방법은 당업계의 공지된 것, 예를 들면 RNA Walk(Lusting et al., Nucleic Acids Res. 2010; 38(1):e5 참조) 또는 Yeat two hybrid system(Piganeau et al., RNA 2006; 12: 177-184) 등을 이용하여 검출할 수 있으며, RNA: A Laboratory Manual(Cold Spring Harbor Laboratory Press 2011)을 참조할 수 있다.
상기 후보물질은 miR-485-3p의 활성을 억제할 것으로 기대되는 물질을 의미하여, 저분자량 화합물, 고분자량 화합물, 화합물들의 혼합물(예컨대, 천연 추출물 또는 세포 또는 조직 배양물), 또는 바이오의약품(예컨대, 단백질, 항체, 펩타이드, DNA, RNA, 안티센스 올리고뉴클레오타이드, RNAi, 앱타머, RNAzyme 및 DNAzyme), 또는 당 및 지질 등을 포함하나, 이로 제한되는 것은 아니다. 상기 후보물질은 2개 이상의 아미노산 잔기, 예컨대 6개, 10개, 12개, 20개 이하 또는 20개 초과 예컨대 50개 아미노산 잔기를 갖는 폴리펩타이드일 수 있다. 상기 후보물질은 합성 또는 천연 화합물의 라이브러리로부터 얻을 수 있으며, 이러한 화합물의 라이브러리를 얻는 방법은 당업계에 공지되어 있다. 합성 화합물 라이브러리는 Maybridge Chemical Co.(UK), Comgenex(USA), Brandon Associates(USA), Microsource(USA) 또는 Sigma-Aldrich(USA)에서 구입 가능하며, 천연 화합물의 라이브러리는 Pan Laboratories(USA) 또는 MycoSearch(USA)에서 구입 가능하다. 후보물질은 당업계에 공지된 다양한 조합 라이브러리 방법에 의해 얻을 수 있으며, 예를 들어, 생물학적 라이브러리, 공간 어드레서블 패러럴 고상 또는 액상 라이브러리(spatially addressable parallel solid phase or solution phase libraries), 디컨볼루션이 요구되는 합성 라이브러리 방법, 1-비드 1-화합물 라이브러리 방법, 그리고 친화성 크로마토그래피 선별을 이용하는 합성 라이브러리 방법에 의해 얻을 수 있다. 분자 라이브러리의 합성 방법은 DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994 등에 개시되어 있다.
본 발명에 있어서, 뇌 질환 치료제의 스크리닝 목적을 위해서 화합물은 저분자량의 치료 효과를 갖는 것이 사용될 수 있다. 예를 들면 중량이 400 Da, 600 Da 또는 800 Da과 같은 약 1000 Da 내외의 화합물이 사용될 수 있다. 목적에 따라 이러한 화합물은 화합물 라이브러리의 일부를 구성할 수 있으며, 라이브러리를 구성하는 화합물의 숫자도 수십 개부터 수백만 개까지 다양할 수 있다. 이러한 화합물 라이브러리는 펩타이드, 펩토이드 및 기타 환형 또는 선형의 올리고머성 화합물, 및 주형을 기본으로 하는 저분자 화합물, 예컨대 벤조디아제핀, 하이단토인, 바이아릴, 카보사이클 및 폴리사이클 화합물(예컨대 나프탈렌, 페노티아진, 아크리딘, 스테로이드 등), 카보하이드레이트 및 아미노산 유도체, 디하이드로피리딘, 벤즈하이드릴 및 헤테로사이클(예컨대 트리아진, 인돌, 티아졸리딘 등)을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
또한, 바이올로직스가 스크리닝에 사용될 수 있다. 상기 바이올로직스는 세포 또는 바이오분자를 일컫는 것으로, 바이오분자란, 단백질, 핵산, 탄수화물, 지질 또는 생체내 및 생체외에서 세포 시스템 등을 이용하여 생산된 물질을 일컫는 것이다. 바이오분자를 단독으로 또는 다른 바이오분자 또는 세포와 조합으로 제공될 수 있다. 바이오분자는 예를 들면, 폴리뉴클레오타이드, 펩타이드, 항체, 또는 기타 혈장에서 발견되는 단백질 또는 생물학적 유기물질을 포함하는 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: Microarray를 이용한 알츠하이머 환자의 miRNA 발현 패턴 분석
(1) 환자 및 샘플 제조
표 1은 연구에 이용된 환자의 특징으로, 의사로부터 알츠하이머 치매 진단을 받은 4인의 환자로부터 Sod. citrate(3.2% w/v)가 첨가된 혈액 튜브(백톤 디킨슨(Becton Dickinson), 독일)에 약 3ml의 혈액을 채혈하였다. 4인의 연령 (±4년)을 매칭한 건강한 성인을 대조군으로 포함시켰다.
Figure PCTKR2018000948-appb-T000001
혈액은 3,500rpm에 10분간 원심분리 하여 혈장을 분리하였으며, RNA 추출 전까지 -80℃에 보관하였다. 제조업자의 권장에 따라 miRNAeasy Serum/Plasma 키트(퀴아젠(Qiagen), USA)를 사용하여 miRNA를 추출하였다. 추출된 RNA는 농도와 순도를 Bioanalyzer2100(Agilent, USA)을 이용하여 분석하였다. 대조군을 포함한 8개 군이 품질 기준에 적합하여 연구에 사용하였다.
(2) Microarray screening
표 2는 microarray 분석에 이용된 gene list로서 각 miRNA의 성숙 서열은 miRNA 데이터베이스(http://www.mirbase.org)에서 얻을 수 있다. 추출된 RNA는 Human Neurological Development 및 Neurological Disease의 진행과 연관되어 있다고 알려진 84개의 다른 miRNA를 함유하는 miRNA array를 사용하여 스크리닝 하였다.
Figure PCTKR2018000948-appb-T000002
Figure PCTKR2018000948-appb-I000001
Figure PCTKR2018000948-appb-I000002
도 1은 cDNA 합성 및 검출 과정을 요약한 것으로, Quantitative PCR assay 방법은 다음과 같이 요약할 수 있다. Mature한 miRNA는 일반적으로 22nt, noncoding RNA이며 전사 후 조절을 담당한다. Mature한 miRNA는 poly(A) polymerase에 의해 polyadenylation을 유도하고 oligo-dT primers로 cDNA로 합성하였다. oligo-dT primers는 3’ degenerate anchor를 갖고 있고 5’ 말단에 universal tag sequence를 갖고 있어 Real-time PCR 과정에서 mature miRNA 증폭을 가능하게 한다. miScript SYBR Green PCR Kit(퀴아젠)을 이용해 real-time PCR 과정에서 mature한 miRNA를 정량하였다.
(3) Volcano blot을 통한 miRNA 발현 패턴 분석
도 2(A)는 대조군 대비 환자군의 miRNA 발현 패턴 분석(volcano blot), 도 2(B)는 대조군 대비 환자군의 miRNA 발현 패턴 분석(scatter blot)을 나타낸 것으로, 대조군 대비 환자군의 84종 miRNA 발현 패턴을 분석하였다.
x축은 Fold change를 나타내고 y축은 -log10의 p-value 값을 나타낸다. 가로 검은색 줄은 p-value가 0.05 이하를 나타낸다. Volcano blot 분석 결과, hsa-miR-105-5p, hsa-miR-98-5p, hsa-miR-15a-5p, hsa-miR-134-5p, hsa-miR-409-3p, hsa-miR-19b-3p, hsa-miR-92a-3p, hsa-miR-28-5p, hsa-miR-30d-5p, hsa-miR-212-3p, hsa-miR-93-5p, hsa-miR-342-3p, hsa-miR-381-3p, hsa-miR-431-5p, hsa-miR-130a-3p, hsa-miR-146b-5p, hsa-miR-29a-3p, hsa-miR-132-3p, hsa-miR-376b-3p, hsa-miR-22-3p, hsa-miR-509-3p, hsa-miR-139-5p, hsa-miR-499a-5p, hsa-miR-203a-3p, hsa-miR-95-3p, hsa-miR-128-3p, hsa-miR-487a-3p, hsa-miR-485-3p, hsa-miR-195-5p, hsa-miR-433-3p, hsa-miR-133b, hsa-miR-191-5p, hsa-miR-489-3p, hsa-miR-432-5p, hsa-miR-29c-3p, hsa-miR-485-5p, hsa-miR-652-3p, hsa-miR-126-5p, hsa-miR-328-3p, hsa-let-7b-5p, hsa-miR-539-5p, hsa-miR-106b-5p, hsa-miR-101-3p, hsa-miR-302a-5p, hsa-miR-484, hsa-miR-518b, hsa-miR-148b-3p, hsa-miR-181d-5p, hsa-miR-7-5p, hsa-miR-512-3p, hsa-miR-151a-3p, hsa-miR-15b-5p, hsa-let-7e-5p, hsa-miR-135b-5p, hsa-miR-181a-5p, hsa-miR-138-5p, hsa-miR-34a-5p, hsa-miR-346, hsa-miR-511-5p, hsa-miR-485-3p, hsa-miR-485-5p, hsa-miR-487a-3p, hsa-miR-489-3p, hsa-miR-499a-5p, hsa-miR-509-3p, hsa-miR-511-5p, hsa-miR-512-3p, hsa-miR-518b, hsa-miR-539-5p, hsa-miR-652-3p, hsa-miR-7-5p, hsa-miR-92a-3p, hsa-miR-93-5p hsa-miR-95-3p, hsa-miR-98-5p가 환자군에서 발현이 상승하는 것을 확인하였다. 그러나 has-miR-485-3p를 제외한 miRNA의 조절은 통계적으로 유의하지 않았다. has-485-3p의 경우, p-value가 0.00439을 나타내어 알츠하이머 환자에서 대조군 대비 유의적으로 증가한다고 보여진다. 따라서, hsa-miR-485-3p는 알츠하이머병을 치료하기 위한 기대 지표가 될 수 있다.
표 3은 hsa-miR485-3p의 염기서열로서, 상기의 결과에 따라 has-miR-485-3p가 세포에 미치는 기능을 연구하고자 sequence를 합성하여 Functional study를 진행하였다.
Figure PCTKR2018000948-appb-T000003
실시예 2: 5xFAD 마우스의 해마 및 대뇌피질에서 miR-485-3p 발현 분석(RT-qPCR)
(1) 연구 방법
5xFAD transgenic mouse는 돌연변이 형태의 APP와 PSEN1를 over expression시켜 6주 정도부터 intraneuronal Aβ42의 축적이 심하게 나타나는 Alzheimer disease의 동물모델이다.
실시예 1의 결과에 따라, 치매 동물 모델에서 miR-485-3p의 발현 여부를 확인하고자 RT-qPCR를 진행하였다. 5xFAD transgenic mouse와 Wild type(WT) mouse를 깊이 마취시킨 후 단두로 희생시켰다. 뇌를 즉시 적출하였고 해마 및 대뇌피질을 잔류 뇌구조에서 절개하였다. PAXgene Tissue miRNA Kit(Qiagen, USA)을 제조자의 방법대로 사용하여 해마에서 total miRNA를 분리하였다. miScript II RT Kit(Qiagen, USA)를 사용하여 cDNA를 합성하였고 mmu_miR-485-3p miScript Primer Assay 및 miScript SYBR Green PCR Kit 사용하여 qPCR을 진행하였다. miRNA level은 snoRNA202(mouse control)에 따라 normalize하여 정량하였다.
(2) 연구 결과
도 3은 hippocampus 및 cortex에서 miR-485-3p의 발현 비교 결과로서, 5xFAD의 해마 및 대뇌피질에서 miR-485-3p의 발현 패턴을 확인하고자 RT-PCR을 진행하였다. 그 결과, WT대비 5xFAD의 해마에서 miR-485-3p의 발현이 증가된 것으로 나타났다. 따라서, 실시예 1의 결과와 함께, 알츠하이머성 치매에서 miR-485-3p의 발현이 상승하는 것을 확인할 수 있다. 이에 따라 miR-485-3p가 영향을 미칠 수 있는 neuronal target mRNA 또는 protein을 확인해보고자 하였다.
실시예 3: miR-485-3p의 표적 유전자 예측
hsa-miR-485-3p의 염기서열 및 표적 위치 분석을 위해 표적 예측 소프트웨어(miRDB)를 이용하여 사람 유래 ELAVL2의 3’ 말단 비번역 부위(UTR)가 hsa-miR-485-3p의 표적인 것을 확인하였다. 여기서 확인된 시드 서열은 mmu-miR-485-3p와 마우스 유래 ELAVL2 3/ 말단 비번역 부위에도 보존되어 있는 것을 확인하였다.
도 4는 ELAVL2 3’-비번역 부위(UTR) mRNA를 나타낸 목록으로, miR-485-3p의 표적 ELAVL2 3’-비번역 부위(UTR) mRNA를 보여준다. miR-485-3p의 5’ 씨드 서열(ELAVL2)은 파란색으로 표시하였다. 표 4에 mmu-miR485-3p의 염기서열 및 표적 위치 분석을 나타내었으며, 표적 예측 소프트웨어(TargetScan, PicTar 및 microT)를 이용하여 마우스 ELAVL2의 3’-비번역 부위(UTR)가 mmu-miR-485-3p의 표적인 것을 확인하였다.
Figure PCTKR2018000948-appb-T000004
실시예 4: 5xFAD 마우스의 대뇌피질 및 해마에서 amyloid beta(Aβ) 42 및 ELAVL2의 발현 확인
(1) 연구 방법
실시예 3의 결과에 따라, 5xFAD의 대뇌피질 및 해마에서 Aβ 42 및 ELAVL2의 발현 여부를 확인하고자 하였다. 마취한 마우스를 단두로 희생시키고 즉시 뇌를 적출하였다. 뇌 부위(대뇌피질, 해마)의 균질화물을 제조하여 ELAVL2에 대한 항체(abcam, USA)를 사용하여 western blot을 진행하였다. 면역반응 단백질을 화학발광 시약(GE health care, UK)으로 가시화시키고 화학이미지분석기(Fusion SL)로 측정 및 정량하였다. 대뇌피질 및 해마의 Aβ 42는 mouse/rat amyloid beta(1-42) ELISA kit(IBL)를 이용하여 정량하였으며, 세부 사항은 제조사의 설명서를 참조하였다.
(2) 연구 결과
1) 대뇌피질 및 해마에서 Aβ 42 발현 비교
도 5는 5xFAD에서 Aβ 42 정량 비교 분석 결과로서, 5xFAD의 대뇌피질(도 5(A)) 및 해마(도 5(B))의 Aβ 42 발현을 비교 분석 하였다. 5xFAD에서 대뇌피질 및 해마 모두 Aβ 42가 WT대비 유의적으로 증가함을 확인하였다.
2) 대뇌피질 및 해마에서 ELAVL2 발현 확인
도 6은 5xFAD의 대뇌피질 및 해마에서 ELAVL2의 발현 결과이다. ELAVL2는 ELAV-like RNA-binding protein으로, 인지 및 행동 기능과 직접적으로 연관되어 있는 뉴런 흥분 또는 시냅스 전달과 같은 신경 기능을 조절하는 단백으로 알려져 있다. 또한, ELAVL2는 neural-specific RNA-binding protein으로서, RNA의 GAAA motif를 인식하여 post-transcriptional gene regulation을 담당한다. 도 5에서 5xFAD의 해마 및 대뇌 피질의 ELAVL2의 발현을 비교하였을 때, WT 대비 5xFAD에서 발현이 감소하는 것을 확인하였다. 이는 5xFAD에서 유도된 치매가 ELAVL2 감소에 따른 유도된 인지 및 행동 기능 저하와 연관이 있음을 의미한다.
실시예 5: Hippocampal primary cell line 제작 및 Antagomir(AM)-485-3p의 in vitro transfection
(1) 연구 방법
5xFAD embryo에서 적출한 해마와 대뇌피질의 조직에서 추출한 primary cell을 배양하였다. 제작 및 배양 방법인 종전의 연구를 참조하였다(Seibenhener, M.L & Woonten M.W, Isolation and culture of Hippocampal Neurons from Prenatal Mice, Jove, 2012). In Vitro Transfection Lipofectamine 2000을 사용하여 Primary cells에 50nM의 miR-485-3p duplex(또는 scrambled miRNA duplex; Bioneer, Daejon, South Korea)와 50nM의 Antagomir(AM)-485-3p를 transfection 시켰다. transfection 후 48시간 이후부터 얻어진 cell homogenates을 제조하였고, ELAVL2 antibody(abcam,UK)를 사용하여 western blot을 진행하였다. 면역반응 단백질은 화학발광 시약(GE health care, UK)으로 가시화시키고, 화학 이미지분석기(Fusion SL)를 이용하여 측정 및 정량하였다. Aβ 42는 mouse/rat amyloid beta(1-42) assay kit(IBL)를 이용하여 측정하였으며, 제조사의 설명서를 참조하였다.
(2) 연구 결과
도 7은 Hippocampal primary cell에서 AM-485-3p transfection에 따른 ELAVL2 및 Aβ 발현 비교 결과를 나타낸 그래프이다.
5xFAD의 hippocampus primary cell 내에 ELAVL2가 발현되며, Antagomir(AM)-485-3p를 transfection시킨 cell에서 control 대비 ELAVL2의 발현이 증가함을 확인하였다(도 7(A)). 이는 miRNA-485-3p가 ElAVL2의 발현을 억제시키는 것을 의미하며, antagomir를 처리한 cell에서 이를 증명하였다. ELAVL2는 뉴런 흥분에 관여하여 인지 기능에 영향을 미치는 중요 인자이므로 ELAVL2를 상승시키는 miR-485-3p 억제제와 같은 약물 또는 조성물의 개발은 알츠하이머 질환을 예방 또는 치료하는데 핵심 전략이 될 수 있다.
또한, AM-485-3p를 transfection시킨 cell에서 Aβ 42의 발현이 감소하는 것을 확인하였다(도 7(B)). 이는 miR-485-3p가 Aβ 42의 생성에 영향을 미치는 것을 의미하며, miR-485-3p를 억제시킬 수 있는 약물 또는 조성물의 개발에 의해 알츠하이머 질환에서 Aβ 축적을 억제시켜 병리 증상을 해소할 수 있음을 알 수 있다.
실시예 6: Cy3-AM-485-3p의 비강 투여 후 약물 전달 이미징 분석
(1) 연구 방법
miR-485-3p의 억제는 서열-특이적 엔타고미어의 비강 투여로 유도하였다. 엔타고미어의 비강 내 투여는 마우스를 마취시키지 않고 뇌를 표적으로 하는 방법에 따라 실시하였다(Leah R.T., et al. (2013) Intranasal Administration of CNS Therapeutics to Awake Mice. J Vis Exp. 2013; (74): 4440). 상기 논문에 개시된 적응 단계를 끝낸 마우스에 비강 내 흡입을 위한 고정(Intranasal grip)을 하고 복부를 위로 향하게 위치 시킨 다음 한쪽 비강 앞에 파이펫을 위치시킨다. 6㎕를 파이펫으로 2번을 흡입시키는데 drop형태로 흡입시킨다(1drop = 3㎕). 15초 자세유지 후에 오른쪽 비강 내에 똑같이 흡입시킨다. 2분후 똑 같은 과정을 반복하고 총 24㎕를 흡입시킨다(AM-485 (2'-O-Methylated)-5'- GAGAGGAGAGCCGUGUAUGACU-3'(서열번호 9); 24㎕의 0.1% v/v 디에틸피로카르보네이트-처리된 증류수 중 5nmol; 바이오니어, 한국). 대조군 마우스에게는 Vehicle을 동등한 부피만큼 투여하였다. 비강 투여 한 시점(7개월)에서 12주 6시간 뒤, 마취한 마우스를 단두로 희생시키고, 즉시 뇌를 적출하였다. Sagittal 단면으로 슬라이스한 뇌 조직을 고정 후에 DNA를 염색하는 DAPI를 처리하였다. 염색이 된 샘플을 confocal laster-scanning microsope (LSM510)으로 촬영하였다.
(2) 연구 결과
AM-485-3p에 Cy3 형광을 붙여서 합성하여 비강 투여를 한 결과, DAPI로 염색이 되어 있는 뉴런에 타켓팅 되는 것을 확인하였다(도 8).
실시예 7: Antagomir(AM)-485-3p를 비강 내 처리한 5xFAD에서 ELAVL2 및 Aβ 정량 비교 분석
(1) 연구 방법
AM-485-3p의 비강 내 투여는 실시예 6에 기재된 바와 같이 수행하였다(Lee, S.T.,et al. (2012) miR-206 regulates brain-derived neurotrophic factor in Alzheimer disease model. Ann Neurol, 72, 269-277). antagomiR를 비강 내 투여하기 위하여, 마취시킨 마우스의 머리를 똑바로 세운 자세로 하여 앙와위(supine position)로 두었다. AM-485(2’-O-Methylated-5’- GAGAGGAGAGCCGUGUAUGACU-3’(서열번호 9); 24㎕의 0.1% v/v 디에틸피로카르보네이트-처리된 증류수 중 5nmol; 바이오니어, 한국)를 2분마다 각 콧구멍을 바꿔가며, 피펫으로 4㎕씩 투여하였다(총 6 분획). 대조군 마우스에게는 Vehicle을 동등한 부피만큼 투여하였다. 비강 투여 한 시점에서 7일 뒤, 마취한 마우스를 단두로 희생시키고, 즉시 뇌를 적출하였다. 뇌 부위(해마 및 피질)의 균질화물을 제조하여 이를 ELAVL2 antibody(abcam, UK)를 이용하여 western blot을 진행하였다. 면역반응 단백질은 면역반응 단백질을 화학발광 시약(GE health care, UK)으로 가시화시키고, 화학 이미지분석기 (Fusion SL)를 이용하여 측정 및 정량하였다. Aβ 42는 mouse/rat amyloid beta(1-42) assay kit(IBL)를 이용하고 제조사의 설명서를 참조하여 측정하였다.
(2) 연구 결과
도 9는 AM-485-3p를 비강 내 처리한 5xFAD에서 ELAVL2 및 Aβ의 정량 비교 분석 결과이다. mouse primary cell line에서 AM-485-3p의 처리가 ELAVL2 및 Aβ를 변화를 유도하였기 때문에(실시예 5), 5xFAD에 AM-485-3p를 비강 처리하여 in vivo에서 AM-485-3p의 역할을 확인해보고자 하였다. AM-485-3p군에서 ELAVL2의 발현이 control군 대비 증가하였다(도 9(A)). 이는 miR-485-3p의 발현 증가에 따라 ELAVL2의 발현이 감소하고, AM-485-3p와 같은 miR-485-3p 억제제를 처리하면 감소한 ELAVL2 level을 상승시켜줄 수 있음을 의미한다.
또한, 동물 모델에서 AM-485-3p의 처리가 Aβ 42의 생성 억제에 영향을 미치는 것을 확인하였으므로(도 9(B)), 관련 억제제 또는 약물 처리가 알츠하이머 치매의 병리 증상을 해소할 수 있음을 알 수 있다.
실시예 8: Hela cells stably transfected with Swedish mutant form of AβPP (AβPPsw)에 AM-485-3p를 처리한 경우, APP 발현, Tau 및 p-Tau 양상
(1) 연구 방법
AβPPsw가 안정적으로 발현이 되어있는 Hela cells에 In Vitro Transfection Lipofectamine 2000을 사용하여 5 내지 500 또는 50nM의 miR-485-3p duplex(or scrambled miRNA duplex; Bioneer, Daejon, South Korea)와 50nM의 Antagomir(AM)-485-3p를 transfection 시켰다. transfection 후 48시간 이후부터 얻어진 cell homogenates을 제조하였고, 이를 APP antibody(cell signaling, USA), Tau(Thermofisher SCIENTIFIC) 및 p-Tau(Thermofisher SCIENTIFIC)를 이용하여 western blot을 진행하였다. 면역반응 단백질은 면역반응 단백질을 화학발광 시약(GE health care, UK)으로 가시화시키고, 화학 이미지분석기(Fusion SL)를 이용하여 측정 및 정량하였다.
(2) 연구 결과
Hela cells에서 AM-485-3p의 transfection에 따른 APP, Tau 및 p-Tau 발현을 비교하였다(도 10). AM-485-3p를 transfection시킨 cell에서 control 대비 농도 별로 APP의 발현이 감소됨을 확인하였다. 또한, AM-485-3p 50nM을 처리한 Hela cell 내에서는 알츠하이머병의 또 다른 원인이라고 알려져 있는 Tau 단백질의 인산화 역시 감소시키는 결과가 도출되었다. miR-485-3p 억제제와 같은 약물 또는 조성물의 개발이 알츠하이머 질환의 주요 병인으로 알려져 있는 Amyloid beta의 전구체와 Tau 단백질의 인산화를 동시에 억제함으로써 알츠하이머병의 예방 또는 치료에 핵심 전략이 될 수 있음을 알 수 있다.
실시예 9: Antagomir(AM)-485-3p를 비강 내 처리한 5xFAD 마우스에서 인지 기능 개선 확인
(1) 연구 방법
AM-485-3p를 비강 처리한 5xFAD의 인지 기능 개선 여부를 확인하고자 Y-maze 및 passive avoidance test를 진행하였다.
1) Y-maze 실험
Y- maze 실험 장치는 검은 아크릴 판(가로 10cm, 세로 41cm, 높이 25cm)으로 제작한 Y자 모양의 사방이 막힌 미로로 구성되어 있으며, 각 미로는 서로 120°의 일정한 각도로 배치되어 있다. 각각의 미로를 A, B, C 영역으로 정한 후 하나의 영역에 실험동물을 조심스럽게 놓고 8분간 자유롭게 움직이도록 한 다음, 각 미로에 들어간 횟수 및 순서를 측정하여 변경 행동력(spontaneous alteration, %)을 평가하였다. 세 곳의 다른 영역에 순차적으로 들어간 경우 1점(실제변경: actual alteration, 즉 ABC, BCA, CAB 등의 순서)으로 인정하였다. 연속되게 들어가지 않은 경우는 점수로 인정하지 않았다. % 변경 행동력(% spontaneous alteration)은 다음과 같은 수식으로 계산하였다.
% 변경 행동력(% spontaneous alteration) = 총 alteration 수 / (총 입장 횟수 - 2) × 100
2) Passive avoidance test(수동회피실험)
학습 및 기억력 측정을 위하여 널리 이용하고 있는 Passive avoidance test(수동회피실험)는 설치류의 working memory ability를 측정하는 방법이다. 수동회피실험 장치는 두 칸의 방으로 나뉘어 있는 shuttle box로 한쪽 방에는 밝은 전구가 설치되어 있어 실험동물이 싫어하는 밝은 환경을 조성할 수 있게 하였으며, 다른 한쪽 방에는 빛이 들어오지 않게 하여 실험동물이 편안함을 느끼게 하였다. 2시간의 스트레스 부과가 끝나고 난 뒤, 수동회피반응을 시험하였다(training test). 어두운 방의 바닥에는 알루미늄 막대가 일정한 간격으로 깔려 있어서 이를 통해 동물의 발바닥에 전기충격을 가할 수 있다. 실험동물은 어두운 방에 들어가려는 경향이 있어, 밝은 방에 두었다가 어두운 방에 들어가게 되면 전기 쇼크(5V, 0.5 mA, 10 sec)를 주어 동물이 이를 기억하게 하였다. 이후 곧바로, 24시간 후에 전기쇼크 없이, 어두운 방으로 들어가는 시간(latency time)을 90초까지 측정하였다 (retention test 1, 2, 3).
(2) 연구 결과
도 11은 AM-485-3p를 비강 내 처리한 5xFAD의 인지 기능 비교 결과를 나타낸 것으로, 행동실험 결과 WT 대비 5xFAD-control에서 변경 행동력 및 머무름 시간이 모두 감소하였다. 알츠하이머성 치매의 주 증상이 행동 장애 및 기억력 저하이므로, 5xFAD의 행동 장애는 Aβ의 과도한 축적 및 병리현상에 의한 것으로 보여진다. 그러나 AM-485-3p를 비강 처리한 군에서는 변경 행동력(도 11(A)) 및 머무름 시간(도 11(B))이 모두 5xFAD 대비 증가하였다. 이는 AM-485-3p의 처리를 통하여 miR-485-3p이 Aβ42 생성을 촉진시켜 나타나는 행동 장애, 기억력 저하와 같은 병리 증상을 해소시키고 알츠하이머의 주요 증상을 개선시킬 수 있음을 의미한다. 따라서, miR-485-3p를 조절하는 약물 또는 조성물 개발은 알츠하이머 치매의 주요 증상인 행동 장애 및 인지 기능을 개선할 수 있는 새로운 전략이 될 수 있다.
실시예 10: 통계 분석
Student's-t 테스트를 사용하여 두 그룹을 비교하였고, 분산에 대한 Krushall-Wallis 분석을 사용하여 3개 이상의 그룹을 비교하였다. Krushall-Wallis 테스트에서 얻은 P-수치가 <0.05 일때, Mann-Whitney U 테스트를 사용하여 그룹 사이 비교의 사후 검정(post-hoc)을 하였다. 0.05 이하의 양측 검증된(two-tailed) P-수치가 통계적으로 유의한 것으로 하였다.
본 발명에 따르면, miR-485-3p 억제제를 포함하는 뇌 질환 치료용 조성물은 아밀로이드베타 42의 발현 감소를 유도하여 증상을 완화시키는 데 국한된 기존의 알츠하이머병 치료제들과는 달리, ELAVL2 단백질을 회복시킬 수 있어 ELAVL2 발현량 저하에 의한 각종 질환, 예를 들면 알츠하이머병, 자폐 스펙트럼 장애, 정신지체, 근위축성 측색 경화증 등을 근본적으로 치료할 수 있다. 따라서, 본 발명에 따르면, 알츠하이머병을 포함한 뇌 질환을 근본적으로 치료하는 데 유용하다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.

Claims (13)

  1. miR-485-3p 억제제를 포함하는 뇌 질환 예방 또는 치료용 약학 조성물.
  2. 제1항에 있어서, 상기 miR-485-3p 억제제는 miR-485-3p의 발현을 억제하거나 또는 miR-485-3p와 ELAVL2(ELAV like RNA binding protein 2)의 3’-UTR과의 상호작용을 억제하는 것을 특징으로 하는 뇌 질환 예방 또는 치료용 약학 조성물.
  3. 제1항에 있어서, 상기 miR-485-3p 억제제는 서열번호 1 또는 서열번호 2의 염기서열의 전부 또는 일부에 결합하는 핵산 분자인 것을 특징으로 하는 뇌 질환 예방 또는 치료용 약학 조성물.
  4. 제3항에 있어서, 상기 핵산 분자는 DNA, RNA, antagomiR, siRNA, shRNA 및 올리고뉴클레오타이드로 구성된 군에서 선택되는 것을 특징으로 하는 뇌 질환 예방 또는 치료용 약학 조성물.
  5. 제3항에 있어서, 상기 핵산 분자는 서열번호 1의 염기서열에 일부 또는 전부가 상보적인 서열을 포함하는 안티센스 올리고뉴클레오타이드인 것을 특징으로 하는 뇌 질환 예방 또는 치료용 약학 조성물.
  6. 제5항에 있어서, 상기 안티센스 올리고뉴클레오타이드는 서열번호 3 내지 서열번호 7로 구성된 군에서 선택되는 염기서열로 표시되는 것을 특징으로 하는 뇌 질환 예방 또는 치료용 약학 조성물.
  7. 제5항에 있어서, 상기 안티센스 올리고뉴클레오타이드는 하기의 군에서 선택되는 어느 하나 이상의 변형을 포함하는 것을 특징으로 하는 뇌 질환 예방 또는 치료용 약학 조성물:
    1) LNA(locked nucleic acid) 또는 PNA(peptide nucleic acid) 형태로의 변형;
    2) 뉴클레오타이드 내 당 구조의 2’탄소 위치에서 -OH기가 -CH3(메틸)로 치환; 및
    3) 뉴클레오타이드 결합이 포스포로티오에이트(phosphorothioate)로 변형.
  8. 제1항에 있어서, 상기 miR-485-3p 억제제는 하기 특성 중 어느 하나 이상을 갖는 것을 특징으로 하는 뇌 질환 예방 또는 치료용 약학 조성물:
    1) ELAVL2의 발현량 회복;
    2) 아밀로이드 베타 42(Aβ42)의 생성 억제;
    3) 아밀로이드 전구체 단백질(APP; amyloid precursor protein)의 발현 억제; 및
    4) Tau 단백질의 인산화 억제.
  9. 제1항에 있어서, 상기 뇌 질환은 알츠하이머병, 자폐 스펙트럼 장애, 정신지체, 근위축성 측색 경화증, 경련, 뇌졸중, 파킨슨씨 병 및 척수손상으로 구성된 군에서 선택되는 것을 특징으로 하는 뇌 질환 예방 또는 치료용 약학 조성물.
  10. 제1항에 있어서, 상기 조성물은 비강내 투여, 정맥내 투여, 피하 주사, 뇌척수강내 주사, 흡입 투여 또는 경구 투여용 제형 중 어느 하나로 제형화된 것을 특징으로 하는 뇌 질환 예방 또는 치료용 약학 조성물.
  11. 다음의 단계를 포함하는 뇌 질환 예방 또는 치료제의 스크리닝 방법:
    (A) miR-485-3p를 발현하는 세포에 후보물질을 처리하고, miR-485-3p의 발현량을 측정하는 단계; 및
    (B) 상기 (A) 단계에서 측정된 miR-485-3p의 발현량이 후보물질을 처리하지 않은 대조군과 비교하여 억제된 경우, 후보물질을 뇌 질환 예방 또는 치료제로 선별하는 단계.
  12. 제11항에 있어서, 상기 miR-485-3p의 활성은 상기 miR-485-3p와 ELAVL2(ELAV like RNA binding protein 2)의 3’-UTR과의 상호작용 분석으로 결정되는 것을 특징으로 하는 뇌 질환 예방 또는 치료제의 스크리닝 방법.
  13. 제11항에 있어서, 상기 뇌 질환은 알츠하이머병, 자폐 스펙트럼 장애, 정신지체, 근위축성 측색 경화증, 경련, 뇌졸중, 파킨슨씨 병 및 척수손상으로 구성된 군에서 선택되는 것을 특징으로 하는 뇌 질환 예방 또는 치료제의 스크리닝 방법.
PCT/KR2018/000948 2017-01-26 2018-01-22 마이크로 rna를 이용한 뇌 질환 예방 또는 치료 용도 WO2018139819A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2017-0012723 2017-01-26
KR20170012723 2017-01-26

Publications (1)

Publication Number Publication Date
WO2018139819A1 true WO2018139819A1 (ko) 2018-08-02

Family

ID=62978603

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/000948 WO2018139819A1 (ko) 2017-01-26 2018-01-22 마이크로 rna를 이용한 뇌 질환 예방 또는 치료 용도

Country Status (1)

Country Link
WO (1) WO2018139819A1 (ko)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108795934A (zh) * 2018-05-23 2018-11-13 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) 日本血吸虫SjELAV-like 2基因的siRNA及其应用
US10844380B1 (en) * 2019-06-17 2020-11-24 Biorchestra Co., Ltd. Uses for prevention or treatment of brain diseases using microrna
WO2021156831A1 (en) * 2020-02-07 2021-08-12 Biorchestra Co., Ltd. Mirna-485 inhibitor for gene upregulation
WO2021156832A1 (en) * 2020-02-07 2021-08-12 Biorchestra Co., Ltd. Use of mirna-485 inhibitors for treating amyotrophic lateral sclerosis (als)
WO2021156833A1 (en) * 2020-02-07 2021-08-12 Biorchestra Co., Ltd. Use of mirna-485 inhibitors for treating tauopathy
WO2021181364A1 (en) * 2020-03-13 2021-09-16 Biorchestra Co., Ltd. Diagnostic methods using pgc-1α expression
WO2021181365A1 (en) * 2020-03-13 2021-09-16 Biorchestra Co., Ltd. Diagnostic methods using sirt1 expression
US11198908B2 (en) 2019-06-17 2021-12-14 Biorchestra Co., Ltd. Method for diagnosis of Alzheimer's disease using microRNA
WO2022003609A1 (en) * 2020-07-01 2022-01-06 Biorchestra Co., Ltd. Snp diagnostic methods
WO2022003608A1 (en) * 2020-07-01 2022-01-06 Biorchestra Co., Ltd. Mirna-485 inhibitor for huntington's disease
CN114225035A (zh) * 2020-09-09 2022-03-25 上海交通大学医学院 环状RNA Cwc27下调剂在制备预防和/或治疗阿尔茨海默病的药物中的应用
EP3983549A4 (en) * 2019-06-17 2023-06-28 Biorchestra Co., Ltd. Compositions and methods for preparing an alzheimer's disease animal model using microrna
EP4139488A4 (en) * 2020-04-23 2024-05-22 Biorchestra Co., Ltd. DIAGNOSTIC METHODS USING MIR-485-3P EXPRESSION

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150095349A (ko) * 2014-02-13 2015-08-21 서울대학교산학협력단 마이크로알엔에이를 표적으로 하는 신경변성 질환 예방 또는 치료용 약학 조성물 및 방법

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150095349A (ko) * 2014-02-13 2015-08-21 서울대학교산학협력단 마이크로알엔에이를 표적으로 하는 신경변성 질환 예방 또는 치료용 약학 조성물 및 방법

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
COHEN, J. E. ET AL.: "MicroRNA Regulation of Homeostatic Synaptic Plasticity", PNAS, vol. 108, no. 28, 12 July 2011 (2011-07-12), pages 11650 - 11655, XP055534712 *
KALRA, J. ET AL.: "Reducing Aβ load and tau phosphorylation: Emerging perspective for treating Alzheimer's disease", EUROPEAN JOURNAL OF PHARMACOLOGY, vol. 764, 2015, pages 571 - 581, XP029295170 *
LOU, C. ET AL.: "MiR-485-3p and MiR-485-5p Suppress Breast Cancer Cell Metastasis by Inhibiting PGC-1alpha Expression", CELL DEATH & DISEASE, vol. 7, no. 3, March 2016 (2016-03-01), pages e2159, XP055534725 *
SCHECKEL, C. ET AL.: "Regulators Consequences of Neuronal ELAV-like Protein Binding to Coding and Non-coding RNAs in Human Brain", ELIFE, vol. 5, 19 February 2016 (2016-02-19), pages e10421, XP055534720 *

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108795934B (zh) * 2018-05-23 2022-06-21 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) 日本血吸虫SjELAV-like 2基因的siRNA及其应用
CN108795934A (zh) * 2018-05-23 2018-11-13 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) 日本血吸虫SjELAV-like 2基因的siRNA及其应用
US20220170095A1 (en) * 2019-06-17 2022-06-02 Biorchestra Co., Ltd. Method for diagnosis of alzheimer's disease using microrna
US10844380B1 (en) * 2019-06-17 2020-11-24 Biorchestra Co., Ltd. Uses for prevention or treatment of brain diseases using microrna
EP3983549A4 (en) * 2019-06-17 2023-06-28 Biorchestra Co., Ltd. Compositions and methods for preparing an alzheimer's disease animal model using microrna
US11542503B2 (en) 2019-06-17 2023-01-03 Biorchestra Co., Ltd. Uses for prevention or treatment of brain diseases using microRNA
US12084718B2 (en) * 2019-06-17 2024-09-10 Biorchestra Co., Ltd. Method for diagnosis of Alzheimer's disease using microrna
US11198908B2 (en) 2019-06-17 2021-12-14 Biorchestra Co., Ltd. Method for diagnosis of Alzheimer's disease using microRNA
WO2021156832A1 (en) * 2020-02-07 2021-08-12 Biorchestra Co., Ltd. Use of mirna-485 inhibitors for treating amyotrophic lateral sclerosis (als)
EP4100068A4 (en) * 2020-02-07 2024-03-20 Biorchestra Co., Ltd. USE OF MIRNA-485 INHIBITORS TO TREAT AMYOTROPHIC LATERAL SCLERosis (ALS)
EP4100067A4 (en) * 2020-02-07 2024-03-06 Biorchestra Co., Ltd. MIARN-485 INHIBITOR FOR UP-REGULATION OF GENES
EP4100065A4 (en) * 2020-02-07 2024-03-27 Biorchestra Co., Ltd. USE OF MIARN-485 INHIBITORS FOR THE TREATMENT OF TAUOPATHY
WO2021156833A1 (en) * 2020-02-07 2021-08-12 Biorchestra Co., Ltd. Use of mirna-485 inhibitors for treating tauopathy
WO2021156831A1 (en) * 2020-02-07 2021-08-12 Biorchestra Co., Ltd. Mirna-485 inhibitor for gene upregulation
WO2021181364A1 (en) * 2020-03-13 2021-09-16 Biorchestra Co., Ltd. Diagnostic methods using pgc-1α expression
WO2021181365A1 (en) * 2020-03-13 2021-09-16 Biorchestra Co., Ltd. Diagnostic methods using sirt1 expression
EP4139488A4 (en) * 2020-04-23 2024-05-22 Biorchestra Co., Ltd. DIAGNOSTIC METHODS USING MIR-485-3P EXPRESSION
WO2022003608A1 (en) * 2020-07-01 2022-01-06 Biorchestra Co., Ltd. Mirna-485 inhibitor for huntington's disease
WO2022003609A1 (en) * 2020-07-01 2022-01-06 Biorchestra Co., Ltd. Snp diagnostic methods
CN114225035B (zh) * 2020-09-09 2022-12-16 上海交通大学医学院 环状RNA Cwc27下调剂在制备预防和/或治疗阿尔茨海默病的药物中的应用
CN114225035A (zh) * 2020-09-09 2022-03-25 上海交通大学医学院 环状RNA Cwc27下调剂在制备预防和/或治疗阿尔茨海默病的药物中的应用

Similar Documents

Publication Publication Date Title
WO2018139819A1 (ko) 마이크로 rna를 이용한 뇌 질환 예방 또는 치료 용도
US11542503B2 (en) Uses for prevention or treatment of brain diseases using microRNA
Sun et al. Neuroprotective effects of miR-27a against traumatic brain injury via suppressing FoxO3a-mediated neuronal autophagy
JP7089763B2 (ja) トリヌクレオチドリピート伸長が関与する遺伝的疾患の予防または治療における一本鎖アンチセンスオリゴヌクレオチドの使用
Liang et al. MicroRNA-153 negatively regulates the expression of amyloid precursor protein and amyloid precursor-like protein 2
JP7416852B2 (ja) Ｈｔｒａ１の発現を調節するためのアンチセンスオリゴヌクレオチド
JP2018505676A (ja) タウアンチセンスオリゴマー及びその使用
WO2018139759A1 (ko) 마이크로 rna를 이용한 알츠하이머병 진단방법
EP3253871A1 (en) Lna oligonucleotides with alternating flanks
US20180312839A1 (en) Methods and compositions for increasing smn expression
JP2015518714A (ja) 遺伝子発現を調節するための組成物及び方法
JP2016528873A (ja) 遺伝子発現を調節するための組成物及び方法
CN105264091A (zh) 用于调节tau表达的组合物和方法
JP6683978B2 (ja) 福山型筋ジストロフィー治療用アンチセンス核酸
WO2019050071A1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
US20210054383A1 (en) Oligonucleotides for modulating tmem106b expression
CN110691849A (zh) 用于调节htra1表达的反义寡核苷酸
WO2015025995A1 (ko) 마이크로 rna를 표적으로 하는 뇌전증 또는 발작 관련 질환의 예방 또는 치료용 약학 조성물 및 방법
WO2020213982A1 (ko) Cd9을 이용한 퇴행성 신경질환의 예방 또는 치료용 조성물과 퇴행성 신경질환 치료제 스크리닝 방법
WO2019066519A1 (ko) 결합 조직 성장 인자를 표적으로 하는 rna 복합체를 함유하는 노인성 황반변성의 예방 또는 치료용 약학 조성물
WO2016178519A1 (ko) 근육 노화 억제용 또는 근육 노화 관련 질환 치료용 조성물
US9458458B2 (en) Manipulating microRNA for the management of neurological diseases or conditions and compositions related thereto
KR102074407B1 (ko) miR-485-3p를 이용한 알츠하이머병 진단 방법
AU2019204230A1 (en) Uses for prevention or treatment of brain diseases using microRNA
EP3362565A1 (en) Methods for identifying and targeting non-coding rna scaffolds

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18744282

Country of ref document: EP

Kind code of ref document: A1

WA Withdrawal of international application
NENP Non-entry into the national phase

Ref country code: DE