WO2019035690A1 - 근육 질환 및 신경근육 질환 예방, 치료 또는 진단을 위한 miR-18b의 용도 - Google Patents

근육 질환 및 신경근육 질환 예방, 치료 또는 진단을 위한 miR-18b의 용도 Download PDF

Info

Publication number
WO2019035690A1
WO2019035690A1 PCT/KR2018/009461 KR2018009461W WO2019035690A1 WO 2019035690 A1 WO2019035690 A1 WO 2019035690A1 KR 2018009461 W KR2018009461 W KR 2018009461W WO 2019035690 A1 WO2019035690 A1 WO 2019035690A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
muscle
expression
cells
disease
Prior art date
Application number
PCT/KR2018/009461
Other languages
English (en)
French (fr)
Inventor
성정준
김기윤
Original Assignee
서울대학교병원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020180092805A external-priority patent/KR102177130B1/ko
Application filed by 서울대학교병원 filed Critical 서울대학교병원
Priority to CN201880053697.5A priority Critical patent/CN111032058A/zh
Priority to JP2020531407A priority patent/JP6928179B2/ja
Priority to EP18846646.0A priority patent/EP3669880A4/en
Publication of WO2019035690A1 publication Critical patent/WO2019035690A1/ko
Priority to US16/791,185 priority patent/US11286484B2/en
Priority to US17/554,285 priority patent/US11891604B2/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present invention relates to the use of miR-18b for the prevention, treatment or diagnosis of a muscle disease or neuromuscular disease, and more particularly to a pharmaceutical composition for preventing or treating muscle diseases containing miR-18b as an active ingredient and a pharmaceutical composition And a method for diagnosing a muscle disease.
  • Muscle disease is a disease that complains of weakness of the upper limb or lower extremity due to hereditary and degenerative, inflammatory, endocrine, and metabolic causes, resulting in general atrophy, decreased muscle tension, muscle cramps, Especially, due to hereditary and degenerative causes, muscular dystrophy, amyotrophic lateral sclerosis (ALS), spinal muscular amyotrophy, spinobular muscular atrophy, charcoal maritus disease Charcot Marie Tooth disease (CMT), Pompe disease, sacopenia, Canavan disease, dystonia, sacopenia, and muscle degeneration.
  • ALS amyotrophic lateral sclerosis
  • CMT charcoal maritus disease
  • Pompe disease sacopenia
  • Canavan disease dystonia
  • sacopenia and muscle degeneration.
  • amyotrophic lateral sclerosis is caused by the following mutations: SOD1 (Cu / Zn superoxide dismutase 1), TAF15 (TATA-Box Binding Protein Associated Factor 15), EWSR1 (Ewing sarcoma breakpoint region 1) (Fused in Sarcoma) and TDP-43 (TAR DNA-binding protein 4).
  • SOD1 Cu / Zn superoxide dismutase 1
  • TAF15 TATA-Box Binding Protein Associated Factor 15
  • EWSR1 Ewing sarcoma breakpoint region 1
  • TDP-43 TAR DNA-binding protein 4
  • Dyshiene-type and Becker-type muscular dystrophy are caused by abnormality of Dystrophin gene existing on X chromosome, about one-third of them are caused by natural mutation, and the other is caused by the genetic inheritance, muscle weakness and myocardial dysfunction.
  • spinal muscular atrophy is caused by SMN1 gene mutation that encodes the survival motor neuron (SMN) protein in eukaryotes, resulting in impaired motor nerve cell function between the spinal cord and the brain stem due to a decrease in SMN protein Muscles are left untreated because they do not receive signals to command muscle motion, resulting in muscle weakness, muscle atrophy, and fibrous spasm.
  • SNS survival motor neuron
  • microRNAs are small non-coding single-stranded RNA molecules that regulate protein synthesis through gene regulation after RNA-dependent transcription.
  • MiRNAs are produced in two steps. Specifically, they are made into miRNAs precursors (pre-miRNA) from the original transcript miRNA (pri-miRNA) by Drosha and DGCR8 in the nucleus, and the pre-miRNA is exported to the cytoplasm and made into miRNA by Dicer.
  • miRNAs have also been implicated in cellular processes such as mitochondrial gene expression, calcium signaling, cell differentiation, and apoptosis, and it has been known that gene mutations regulate miRNA biosynthesis, so that in the pathogenesis of disease caused by gene mutations
  • the role of miRNA in the diagnosis and treatment of diseases has been studied.
  • the specific mechanism of interaction between miRNAs and gene mutations in muscle diseases due to genetic causes has not yet been fully elucidated.
  • miRNAs that can be used for the diagnosis and treatment of muscle diseases
  • the present inventors have found that gene mutation in the muscle mutation-induced muscle disease model decreases miR-18b expression, , And it is suggested that miR-18b can be used as a target agent for diagnosis and treatment of muscle diseases induced by gene mutation such as ALS and DMD by confirming that it induces calcium signaling, inhibits cell differentiation and induces apoptosis
  • the present invention has been completed.
  • microRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing. Mol Cell. 2007 Aug 3; 27 (3): 435-48.
  • Another object of the present invention is to provide a method for diagnosing muscle diseases using miR-18b.
  • Yet another object of the present invention is to provide a method for preventing or treating a muscle disorder comprising administering to a subject a pharmaceutically effective amount of miR-18b.
  • Another object of the present invention is to provide a use of miR-18b for use as a pharmaceutical composition for preventing or treating muscle diseases.
  • the present invention provides a pharmaceutical composition for preventing or treating muscle diseases, which comprises miR-18b as an active ingredient.
  • the present invention also provides a method for diagnosing a muscle disorder, comprising measuring the expression level of miR-18b in a sample isolated from a subject and comparing with a normal control.
  • the present invention also provides a method for preventing or treating a muscle disorder comprising administering to a subject a pharmaceutically effective amount of miR-18b.
  • the present invention provides the use of miR-18b for use as a pharmaceutical composition for the prevention or treatment of muscle disorders.
  • the present invention relates to a method for inhibiting miR-18b signal transduction pathway, comprising the steps of: (i) inhibiting miR-18b expression in a gene mutation-induced muscle disorder model; Respectively. In addition, it was confirmed that miR-18b expression was increased, cell death induced by gene mutation was inhibited, and calcium signaling and cell differentiation were restored. Therefore, miR-18b of the present invention can be used as a target agent for diagnosing and treating muscle diseases caused by gene mutations such as ALS and DMD.
  • FIG. 1 is a graph showing the effect of the NSC-34 motor neuron (mtNSC-34 cell) expressing human SOD1 (G93A) and the NSC-34 motor neuron expressing human SOD1 ), Four genes with different mtNSC-34 and wtNSC-34 cell expressions, Hif1 ⁇ (hypoxia inducible factor 1 alpha), Mef2c (myocyte specific enhancer factor 2c), multiple C2 domains transmembrane protein 1) and Rarb (retinoic acid receptor beta) expression.
  • Hif1 ⁇ hyperoxia inducible factor 1 alpha
  • Mef2c myocyte specific enhancer factor 2c
  • multiple C2 domains transmembrane protein 1 multiple C2 domains transmembrane protein 1
  • Rarb retinoic acid receptor beta
  • FIG. 2 is a graph showing intracellular calcium signal transduction, cell differentiation and apoptosis changes in mtNSC-34 cells, wtNSC-34 cells, and motor neurons expressing mouse SOD1 (NSC-34 cont cells) according to an embodiment of the present invention It is also confirmed.
  • Figure 3 shows miR-206 as a target miRNA that regulates miR-18b and Mctp1 and Rarb as a target miRNA that regulates Hif1a.
  • FIG. 4 shows changes in HIF1 ⁇ , Mef2c, Mctp1, Rarb and miR-206 expression and LDH release in NSC-34 cont cells in which miR-18b expression was decreased according to an embodiment of the present invention.
  • FIG. 5 shows changes in cell death in neural stem cells (NSC) with reduced miR-18b expression according to the examples.
  • FIG. 5 shows changes in HIF1 ⁇ , Mef2c, Mctp1, Rarb, and miR-206 expression, intracellular calcium signaling, cell differentiation, and apoptosis in mtNSC-34 cells expressing miR-18b according to an embodiment of the present invention It is also confirmed.
  • FIG. 6 is a graph showing changes in Mef2c, Mctp1, Rarb, and miR-206 expression and cell death in mtNSC-34 cells in which Hif1 ⁇ expression was reduced according to an embodiment of the present invention.
  • FIG. 7 is a graph showing changes in Mctp1 and Rarb expression in NSC-34 cont cells in which miR-206 expression was increased according to an embodiment of the present invention.
  • FIG. 8 shows intracellular calcium signaling, cell differentiation in NSC-34 cont cells that increased miR-206 expression according to one embodiment of the present invention and increased miR-206 expression according to one embodiment of the present invention
  • FIG. 3 shows changes in apoptosis in NSC-34 cont cells and NSCs, respectively.
  • FIG. 9 is a graph showing changes in Mctp1 and Rarb expression and apoptosis in mtNSC-34 cells in which miR-206 expression was reduced according to an embodiment of the present invention.
  • FIG. 10 is a graph showing changes in intracellular calcium signaling and cell differentiation in NSC-34 cont cells in which Mctp1 and / or Rarb expression is reduced according to an embodiment of the present invention.
  • FIG. 11 is a diagram showing cell death changes in NSC-34 cont cells and neural stem cells in which Mctp1 and / or Rarb expression is reduced according to an embodiment of the present invention.
  • FIG. 12 is a graph showing intracellular calcium signal transduction, cell differentiation and apoptosis changes in mtNSC-34 cells in which Mctp1 and / or Rarb expression is increased according to an embodiment of the present invention.
  • Figure 13 shows the changes in expression of Hif1a, Mef2c, Mctp1, Rarb, miR-18b, and miR-206 in NSC-34 cont cells increased mutant SOD1 (G85R) and SOD1 (D90A) expression according to one embodiment of the present invention and And the change in cell death was confirmed.
  • FIGS. 14 and 15 are graphs showing the effects of HIF1 ⁇ , Mef2c, and Hif1 ⁇ on spinal cord tissue samples and ALS (f86S) patient spinal cord samples of a mouse model of amyotrophic lateral sclerosis (ALS) disease according to an embodiment of the present invention.
  • hNSCs neural stem cells
  • G17S SOD1
  • MN motor neurons
  • 17 is a graph showing changes in expression of Hif1 ⁇ , Mef2c, Mctp1, Rarb, miR-18b and miR-206 in hiPSC-derived MN of SOD1 (G17S) fALS patients according to an embodiment of the present invention, intracellular calcium signaling, It is a figure which confirms the change of death.
  • FIG. 18 is a graph showing changes in miR-18b expression in myofibroblasts with reduced dystrophin expression according to an embodiment of the present invention.
  • FIG. 19 is a graph showing changes in miR-18b expression in a Duchenne muscular dystrophy (DMD) mouse model according to an embodiment of the present invention.
  • 20 is a schematic diagram showing a regulation disorder of the miR-18b signaling pathway by gene mutation.
  • the present invention provides a pharmaceutical composition containing miR-18b as an active ingredient for preventing or treating muscle diseases.
  • the miR-18b may be derived from an animal including a human, for example, a monkey, a chimpanzee, a pig, a horse, a cattle, a sheep, a dog, a cat, a mouse, a rabbit and the like.
  • the nucleic acid molecule constituting the miR-18b may have a nucleotide length of 18 to 100 nt.
  • the nucleic acid molecule may be in the form of a mature miRNA having a length of 19 to 25 nt, more specifically 21, 22 or 23 nt.
  • the nucleic acid molecule may also be in the form of a precursor miRNA of 50-100 nt, more specifically 65-95 nt in length.
  • miR-18b in the mature miRNA form may specifically be miR-18b-5p or miR-18b-3p, and more specifically miR-18b-5p.
  • MiR-18b in the form of mature miRNA or precursor miRNA can be obtained by confirming the nucleotide sequence information of the nucleic acid molecule in a known gene database such as NIH GenBank and miRBASE (http://www.mirbase.org/) .
  • NIH GenBank NIH GenBank
  • miRBASE http://www.mirbase.org/
  • the nucleotide sequence of the mature form of human miR-18b is registered with the gene registration number MIMAT0001412 (SEQ ID NO: 1) or MIMAT0004751 (SEQ ID NO: 2) and the precursor form is the MI0001518 (SEQ ID NO: 3).
  • MiR-18b used in the present invention is a functional equivalent of the nucleic acid molecule constituting it, for example, even if some base sequence of the miRNA nucleic acid molecule is modified by deletion, substitution or insertion, miR-18b is functionally equivalent to the miRNA nucleic acid molecule It is a concept that includes mutants that can function.
  • miR-18b of the present invention may exhibit at least 80% homology with the nucleotide sequence of each corresponding SEQ ID NO, and specifically at least 90%, more specifically at least 95% homology. Such homology can be readily determined by comparing the sequence of the nucleotide with the corresponding portion of the target gene using computer algorithms well known in the art, for example Align or BLAST algorithms.
  • miR-18b used in the present invention may exist in single-stranded or double-stranded form. Although mature miRNA molecules are predominantly single stranded, precursor miRNA molecules may contain a partial self-complementary structure (e.g., a stem-loop structure) that can form double strands.
  • the nucleic acid molecule of the present invention may be configured in the form of RNA or PNA (peptide nucleic acids).
  • miR-18b used in the present invention may be isolated or prepared using standard molecular biology techniques such as chemical synthesis methods or recombinant methods, or commercially available miR-18b may be used.
  • the miR-18b may include the miR-18b itself, but may include a functionally equivalent fragment thereof, and the fragment of the miRNA may be a polynucleotide including a seed sequence of the miRNA.
  • a seed sequence is a nucleotide sequence of a region of a miRNA that binds with complete complementarity when the miRNA recognizes the target, which is an essential part of the miRNA required to bind to the target.
  • miR-18b can be used in the form of various miRNA mimics that produce its biological equivalent effect, and modified miRNAs containing miRNA sequences containing the same seed region can be used .
  • the miRNA derivative for the miRNA may partially include a phosphorothiolate structure in which a phosphate backbone structure is replaced with another element such as sulfur, and DNA and PNA ( petide nucleic acids, and it can also be used in a form in which 2 'hydroxyl groups per RNA are replaced with various functional structures, including methylation, methoxylation, fluorination and the like. But is not limited to these variations.
  • miR-18b may be contained in a vector or introduced into a cell.
  • miR-18b may be provided as an expression vector for intracellular delivery.
  • the expression vector can be used as both a viral vector and a non-viral vector.
  • the viral vector for example, lentivirus, retrovirus, adenovirus, herpes virus or avipox virus vector can be used. However, But is not limited thereto.
  • the expression vector may further comprise a selection marker to facilitate screening of the transduced cells.
  • Markers conferring selectable phenotypes such as, for example, drug resistance, resistance to nutritional requirements, cytotoxic agents or expression of surface proteins, such as green fluorescent protein, puromycin, neomycin, hygromycin, Histidine dehydrogenase (hisD) and guanine phosphoribosyltransferase (Gpt).
  • miR-18b may be provided in a form introduced into a cell. These cells are able to express miR-18b at high levels. Examples of the method for introducing into cell include G-fectin, Mirus TrasIT-TKO lipophilic reagent, lipofectin, lipofectamine, cellfectin, cationic phospholipid nanoparticles, cationic polymer, cationic micelle , A cationic emulsion or liposome, or may be conjugated with a biocompatible polymer such as polyethylene glycol to increase intracellular absorption.
  • a biocompatible polymer such as polyethylene glycol to increase intracellular absorption.
  • the muscle disease may be, but is not limited to, a muscle disorder caused by a gene mutation.
  • muscle diseases can be classified into various diseases such as myasthenia gravis, progressive muscular dystrophy, myotonic muscular dystrophy, Duchenne muscular dystrophy, Backer muscular dystrophy, It is well known that the lesions are caused by the muscular atrophy of the spinal cord and the muscular atrophy of the spinal muscles, and the muscular atrophy of the spinal cord.
  • CNS spinobulbar muscular atrophy
  • Charcot Marie Tooth disease (CMT) Charcot Marie Tooth disease
  • Pompe disease canavan disease
  • dystonia dystonia
  • sacopenia or muscle degeneration But is not limited thereto.
  • a gene mutation-induced muscle disorder model causes a mutation in miR-18b expression in amyotrophic axons, resulting in a regulation disorder of the miR-18b signaling pathway
  • Modulatory disorder induces upregulation of Hif1a
  • upregulated Hif1a upregulates Mef2c
  • Mef2c induces miR-206 expression
  • miR-206 is directly involved in post-transcriptional regulation of Mctp1 and Rarb, Inhibiting neuronal differentiation and inducing apoptosis.
  • miR-18b expression was increased, cell death induced by gene mutation was inhibited, and calcium signaling and cell differentiation were restored.
  • the present inventors have confirmed that a mutation in the miR-18b signaling pathway is caused by a mutation in the Duchenne muscular dystrophy as a muscle disease model due to gene mutation.
  • miR-18b of the present invention can be used for prevention or treatment of muscle diseases.
  • compositions of the present invention may further comprise a pharmaceutically acceptable carrier and may be formulated with a carrier.
  • the pharmaceutically acceptable carrier means a carrier or diluent which does not irritate the organism and does not interfere with the biological activity and properties of the administered compound.
  • examples of the pharmaceutical carrier which is acceptable for the composition to be formulated into a liquid solution include sterilized and sterile water, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, Glycerol, ethanol, and one or more of these components may be mixed and used. If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added. Can also be formulated in the form of solutions or suspensions (e. G., Microparticles, liposomes, or integrated with cells).
  • composition of the present invention can be applied to any formulation containing it as an active ingredient, and can be manufactured and administered as oral or parenteral formulations.
  • Administration refers to the introduction of a composition of the present invention to a patient in any suitable manner and includes delivery of the nucleic acid molecule by viral or non-viral techniques, or transplantation of cells expressing the nucleic acid molecule.
  • the route of administration of the composition of the present invention can be administered through various routes of oral or parenteral administration as long as it can reach the target tissues. For example, oral administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, intranasal administration, intrapulmonary administration, intrathecal administration, intraperitoneal administration, intraperitoneal administration, But is not limited thereto.
  • compositions and methods of treatment of the present invention are applicable to any animal in which muscle disorders can occur and the animals include human and primate as well as livestock such as cows, pigs, sheep, horses, dogs and cats.
  • the range of the effective amount of the composition of the present invention or the appropriate total daily dosage may be determined by the treatment within the scope of sound medical judgment.
  • the specific therapeutically effective amount for a particular patient will depend upon a variety of factors, including the type and extent of the response to be achieved, the specific composition, including whether or not other agents are used, the age, weight, general health status, sex and diet, The route of administration and the fraction of the composition, the duration of the treatment, and the amount of radiation to be irradiated, and the similar factors well known in the medical arts. For example, it may be used at a dose of 0.001 ⁇ ⁇ / kg to 100 mg / kg (body weight) per day, but is not limited thereto.
  • the effective amount of the pharmaceutical composition suitable for the purpose of the present invention is preferably determined in consideration of the above-mentioned matters.
  • the present invention also provides a method for providing diagnostic information of a muscle disorder, comprising measuring the expression level of miR-18b in a sample isolated from a subject and comparing the expression level with a normal control.
  • the sample may be tissue, cells, plasma, serum, blood, saliva, or urine, but is not limited thereto.
  • the level of expression can be measured using RT-PCR, quantitative RT-PCR, real-time RT-PCR, Northern blotting or transcriptome analysis But are not limited thereto.
  • the expression level of miR-18b is decreased in the sample as compared with the normal control, so that it can be diagnosed as a muscle disease.
  • the expression levels of Hif1a, Mef2c, Mctp1, Rarb, or miR-206 can be further measured in the sample, and muscle diseases can be diagnosed in comparison with a normal control group. Specifically, it was confirmed that the expression level of Hif1 ⁇ , Mef2c or miR-206 was increased in the sample as compared with the normal control, so that the muscle disease could be diagnosed and the expression level of Mctp1 or Rarb was decreased as compared with the normal control It is possible to diagnose muscle diseases by checking.
  • the muscle disorder may be, but is not limited to, a muscle disorder caused by a genetic mutation.
  • muscle diseases can be classified into various diseases such as myasthenia gravis, progressive muscular dystrophy, myotonic muscular dystrophy, Duchenne muscular dystrophy, Backer muscular dystrophy, It is well known that the lesions are caused by the muscular atrophy of the spinal cord and the muscular atrophy of the spinal muscles, and the muscular atrophy of the spinal cord.
  • CNS spinobulbar muscular atrophy
  • Charcot Marie Tooth disease (CMT) Charcot Marie Tooth disease
  • Pompe disease canavan disease
  • dystonia dystonia
  • sacopenia or muscle degeneration But is not limited thereto.
  • the present inventors have shown that gene mutation in a mutation-induced muscle disease model decreases miR-18b expression, induces a regulatory disorder of miR-18b signaling pathway, miR-18b regulatory disorder induces upregulation of Hif1a, Hif1 ⁇ up-regulates Mef2c, Mef2c induces miR-206 expression, and miR-206 is directly involved in post-transcriptional regulation of Mctp1 and Rarb, leading to calcium signaling, neuronal differentiation inhibition, and apoptosis.
  • miR-18b and miR-18b of the present invention can be used as target agents for the diagnosis of muscle disorders.
  • the present invention also provides a method for preventing or treating a muscle disorder comprising administering to a subject a pharmaceutically effective amount of miR-18b.
  • the present invention provides the use of miR-18b for use as a pharmaceutical composition for the prevention or treatment of muscle disorders.
  • the miR-18b may be derived from an animal including a human, for example, a monkey, a chimpanzee, a pig, a horse, a cattle, a sheep, a dog, a cat, a mouse, a rabbit and the like.
  • the nucleic acid molecule constituting the miR-18b may have a nucleotide length of 18 to 100 nt.
  • the nucleic acid molecule may be in the form of a mature miRNA having a length of 19 to 25 nt, more specifically 21, 22 or 23 nt.
  • the nucleic acid molecule may also be in the form of a precursor miRNA of 50-100 nt, more specifically 65-95 nt in length.
  • miR-18b in the mature miRNA form may specifically be miR-18b-5p or miR-18b-3p, and more specifically miR-18b-5p.
  • miR-18b used in the present invention may exist in single-stranded or double-stranded form.
  • miR-18b used in the present invention may be isolated or prepared using standard molecular biology techniques such as chemical synthesis methods or recombinant methods, or commercially available miR-18b may be used.
  • the miR-18b may include the miR-18b itself, but may include a functionally equivalent fragment thereof, and the fragment of the miRNA may be a polynucleotide including a seed sequence of the miRNA.
  • miR-18b can be used in the form of various miRNA mimics that produce its biological equivalent effect, and modified miRNAs containing miRNA sequences containing the same seed region can be used .
  • miR-18b may be contained in a vector or introduced into a cell.
  • miR-18b may be provided in a form introduced into a cell. These cells are able to express miR-18b at high levels.
  • the muscle disease may be, but is not limited to, a muscle disorder caused by a gene mutation.
  • muscle diseases can be classified into various diseases such as myasthenia gravis, progressive muscular dystrophy, myotonic muscular dystrophy, Duchenne muscular dystrophy, Backer muscular dystrophy, It is well known that the lesions are caused by the muscular atrophy of the spinal cord and the muscular atrophy of the spinal muscles, and the muscular atrophy of the spinal cord.
  • CNS spinobulbar muscular atrophy
  • Charcot Marie Tooth disease (CMT) Charcot Marie Tooth disease
  • Pompe disease canavan disease
  • dystonia dystonia
  • sacopenia or muscle degeneration But is not limited thereto.
  • the present inventors have found that a mutation in a muscle disease caused by a gene mutation decreases miR-18b expression and thus regulates the miR-18b signaling pathway, thereby inducing calcium signaling, cell differentiation inhibition and cell death, Since miR-18b expression is increased, cell death induced by gene mutation is inhibited, and calcium signal transduction and cell differentiation are restored, miR-18b of the present invention can be used for prevention or treatment of muscle diseases.
  • ALS amyotrophic lateral sclerosis
  • NSC-34 cont cells expressing mouse SOD1, NSC-34 hSOD1 cells expressing human SOD1 (wtNSC-34) expressing human SOD1, and SOD1 mutant motor neurons expressing human SOD1 G93A mutant NSC-34 hSOD1 (G93A) cells were obtained from Korea Institute of Science and Technology (KIST). The cells were then cultured in DMEM medium (Hyclone) supplemented with 10% FBS (Gibco), 100 U / ml penicillin, 100 ⁇ g / ml streptomycin (Invitrogen Life Tech). It was further differentiated in DMEM medium (Hyclone) supplemented with 1% FBS, 100 U / ml penicillin, 100 ⁇ g / ml streptomycin and 20 uM all-trans-RA (Sigma).
  • NSC Neural stem cells
  • Brain tissue of the subventricular zone of the 9-week-old mouse was extracted and then disrupted in a plate containing HBSS, and cells were cultured at 37 ° C for 15 minutes after trypsinization.
  • DMD Duchenne muscular dystrophy
  • Dystrophin expressing myofibroblast was prepared and cultured as follows.
  • mouse muscle myoblasts (C2C12 cell line) were cultured in DMEM medium (supplemented with 10% FBS) supplemented with antibiotics.
  • SiDystrophin (5'-GGCCUUACAGGGCAAAAACTT-3 ', SEQ ID NO: 4) for mouse produced by COSMO GENETECH was transfected into cultured C2C12 cells according to the manufacturer's procedure using an RNAiMax transfection reagent (Invitrogen) to inhibit Dystrophin expression Cells were prepared and cultured.
  • RNA biosynthesis Because gene mutations are related to RNA biosynthesis, miRNAs involved in RNA biosynthesis can be used as target genes for ALS diagnosis and therapy as gene mutation-induced muscle disorders.
  • SOD1 mutation mtNSC-34 cells were fractionated into nuclear and cytoplasm and transcriptome analysis was performed using nuclear fraction and cytoplasmic fraction. Then, mtNSC-34 cells Expression of genes with different expression between nuclei and cytoplasm was confirmed by RT-PCR and qRT-PCR.
  • mtNSC-34 cells and wtNSC-34 cells obtained in Example ⁇ 1-1> were cultured in three sets of 10 cm dishes, and then 450 ⁇ l of cold buffer A (10 mM HEPES (pH 7.9) , 10 mM KCl, 1 mM DTT and 0.1 mM EDTA (pH 8.0)).
  • cold buffer A 10 mM HEPES (pH 7.9) , 10 mM KCl, 1 mM DTT and 0.1 mM EDTA (pH 8.0)
  • Each of mtNSC-34 and wtNSC-34 cells were resuspended and reacted on ice for 25 minutes.
  • 5 ⁇ l of 10% NP-40 was added, reacted for 2 minutes on ice, and then centrifuged at 4 ° C for 3 minutes at 5000 rpm.
  • the nuclear fraction was obtained by separating the pellet, and the supernatant was separated to obtain the cytoplasmic fraction.
  • Hif1a hyperoxia inducible factor 1 alpha
  • Mef2c myocyte specific enhancer factor 2c
  • Mctp1 multiple C2 domains transmembrane protein 1 (retinoic acid receptor beta) mRNA expression was confirmed by RT-PCR and quantitative RT-PCR (qRT-PCR).
  • qRT-PCR was performed according to the manufacturer's procedure using the primers shown in Table 3 and SYBR Green Real-time PCR Master Mix (Toyobo). Mouse GAPDH was used as a control (Fig. 1C and Fig. 1D).
  • Fig. 1A Mef2c regulated by Hif1? And Hif1? Increased in nucleus and cytoplasm of mtNSC-34 cells
  • Mctp1 which is known to be involved in calcium signaling in mtNSC-34 cells, and Rarb levels associated with cell differentiation were changed, and in particular, Mctp1 and Rarb mRNA were up-regulated in the nucleus but significantly down-regulated in the cytoplasm 1B).
  • mtNSC-34 cells showed increased levels of Hif1a and Mef2c mRNA expression and decreased levels of Mctp1 and Rarb mRNA expression (Fig. 1C and Fig. 1D).
  • Mctp1 is known to be involved in calcium signal transduction. Intracellular Ca 2 + assay was performed to examine the effect of SOD1 mutation on Mctp1 expression on intracellular calcium signaling. Specifically, the mtNSC-34 cells and the wtNSC-34 cells obtained in Example ⁇ 1-1> were each treated at 4 ⁇ 10 4 to 8 ⁇ 10 4 cells / well in a 96-well plate and cultured in a growth medium for one day Respectively. After 48 hours, the FLUOFORTE Dye-Loading Solution was added to each well and incubated at 37 ° C for 45 minutes and at room temperature for 15 minutes. Fluorescence was then measured at 490/525 nm using a fluorescence meter (Fig. 2A, right, top).
  • Rarb is known to be involved in cell differentiation
  • axonal formation analysis was performed to investigate the effect of SOD1 mutation on Rarb expression and SOD1 mutation on cell differentiation.
  • the mtNSC-34 cells and the wtNSC-34 cells obtained in Example ⁇ 1-1> were each treated at 4 ⁇ 10 4 to 8 ⁇ 10 4 cells / well in a 96-well plate and cultured in a growth medium for one day Respectively. Then, axonal production was visualized after immunofluorescence staining and confocal microscopy (Fig. 2A, right, bottom).
  • mtNSC-34 cells, wtNSC-34 cells and NSC-34 cont cells obtained in Example ⁇ 1-1> were dissolved in ice-water for 30 minutes in lysis buffer (10 mM Tris , 1 mM EDTA at pH 8.0, 500 mM NaCl and 0.5% TritonX-100), and the protein lysate of the cells was subjected to electrophoresis by SDS-PAGE.
  • the cell culture medium of mtNSC-34 cells and wtNSC-34 cells obtained in Example ⁇ 1-1> was recovered and centrifuged to obtain a supernatant. - transferred to a well plate.
  • the same amount of LDH assay substrate (SIGMA), enzyme and dye solution were mixed. One half volume of the mixture was added to one volume of the medium supernatant. After 30 minutes of reaction at room temperature, the reaction was terminated by adding 1/10 volume of 1N HCl to each well. Then, the absorbance was measured at a wavelength of 490nm / 690nm using a spectrophotometer (Fig. 2D).
  • the protein levels of Hif1 ⁇ and Mef2c were significantly increased in mtNSC-34 cells, and the protein levels of Mctp1 and Rarb were significantly decreased (FIG. 2B).
  • the protein and mRNA levels of Bax were decreased, the protein and mRNA levels of Bcl2 were decreased (Fig. 2B and Fig. 2C), mTNSC-34 cells were increased and the LDH release was increased Respectively.
  • miRNAs are well known as one of the most representative post-transcriptional regulators.
  • Hif1 ⁇ which is an upper regulator of Mef2c
  • Mctp1 and Rarb miRNAs capable of regulating Mctp1 and Rarb
  • miRNAs having a common base sequence with Hif1 ⁇ were analyzed using TargetScan (http://www.targetscan.org) (FIGS. 3A and 3B).
  • mtNSC-34 cells, wtNSC-34 cells and NSC-34 cells were cultured in the same manner as described in Example 2, in order to confirm the expression of target miRNAs expressed by TargetScan in mtNSC-34 cells and wtNSC- RNA was extracted from each of the 34 cont cells and qRT-PCR was performed using each of the primers (GenoSensor) for mmu-miR-18b and mmu-miR-206 (Fig. 3C and Fig. 3D).
  • miR-206 could become a post-transcriptional regulator of Mctp1 and Rarb (Fig. 3A), as shown in Fig. 3, confirming that miR-206 was significantly up-regulated in mtNSC-34 cells 3C). Furthermore, it was confirmed that miR-18b could target Hif1a (Fig. 3B), and miR-18b was significantly reduced in mtNSC-34 cells (Fig. 3D).
  • Mef2c acts as a transcription factor of miR-206.
  • miR-18b regulatory disorder causing miR-18b expression is induced by SOD1 mutation, and Hif1 ⁇ , Mef2c , miR-206, Mctp1 and Rarb can be sequentially regulated.
  • miRNA-18b was reduced in wtNSC-34 cells using a LNA (locked nucleic acid inhibitor) And qRT-PCR were performed to confirm the expression of the relevant factors, and the change in apoptosis was confirmed.
  • LNA locked nucleic acid inhibitor
  • miRNA-18b LNA anti-18b, COSMOGENTECH
  • NSC-34 cont cells obtained in Example ⁇ 1-1> according to the manufacturer's procedure using an RNAiMax transfection reagent (Invitrogen) , And recovered after 48 hours. Then, Western blotting (Fig. 4A), qRT-PCR (Fig. 4B to Fig. 4G, Fig. 4I and Fig. 4J), LDH release analysis (Fig. 4H). NSC-34 cont cells were used as a control.
  • Annexin V-FITC and PI assays were further performed to confirm cell death. Specifically, NSCs cultured in Example ⁇ 1-2> were seeded on a 6-well tissue culture plate, treated with miRNA-18b LNA (anti-18b), and after 48 hours, the adhered cells were separated by Triple Express The culture medium was added to inactivate trypsin. The supernatant was then removed by centrifugation at 1,500 x g for 5 minutes. Cells were stained with Annexin-V-FITC and PI Apoptosis Detection Kit (BD Bisosciences) according to the manufacturer's instructions. After staining, they were analyzed using FACSCalibur (BD Biosciences). Fluorescence used a green or red channel, and the data was analyzed using Flowwing Software (Version 2.5.1, Unversity of Turku, Filand) ( Figure 4K).
  • Fig. 4 As a result, as shown in Fig. 4, it was confirmed that the LNA (anti-18b) of miR-18b increased protein and mRNA expression of Hif1 ⁇ and Mef2c and decreased protein and mRNA expression of Mctp1 and Rarb 4E). It was also confirmed that miR-206 was rapidly induced under miR-18b deficiency (Fig. 4I and Fig. 4J). In addition, it was confirmed that cell death was increased under miR-18b deficiency (Fig. 4A, Fig. 4F to Fig. 4H, Fig. 4K).
  • cDNA was obtained from the NSC-34 cont cells obtained in Example ⁇ 1-1>, and PCR was performed using the cDNA as a template and the primers shown in Table 5 to amplify miR-18b.
  • the amplified miR-18b PCR product was cloned into pCDNA3 vector (Invitrogen) with restriction sites of BamH I and Xho I ( NEW ENGLAND BioLabs) to produce the miR-18b plasmid construct.
  • the miR-18b plasmid construct was transfected into mtNSC-34 cells according to the manufacturer's procedure using Lipofectamine 2000 (Invitrogen) Respectively. Then, the ⁇ Example 2> to ⁇ Example 4> Western blotting (Fig. 5A), qRT-PCR (Fig. 5B to Fig. 5F) by the same method as that described in intracellular Ca 2 + analysis (Fig. 5H , Right, upper), axon production assay (FIG. 5H, right, bottom) and LDH release assay (FIG. 5G). As a result, mtNSC-34 cells were used as a control. As shown in FIG.
  • Mctp1 and Rarb were increased while the expression of Hif1 ⁇ and Mef2c was decreased by miR-18b overexpression in mtNSC-34 cells ( Figures 5A-5C).
  • miR-206 was down-regulated by over-expressed miR-18b (Fig. 5E and Fig. 5F).
  • overexpressed miR-18b inhibited cell death in mtNSC-34 cells (Fig. 5A, Fig. 5D, Fig. 5G).
  • SOD1 aggregation was observed in mtNSC-34 cells, it was confirmed that intracellular Ca 2+ level was decreased by overexpressed miR-18b and neuronal differentiation was activated (Fig. 5H).
  • miR-18b overexpression inhibited cell death induced by SOD-1 mutation and thus miR-18b could be used for ALS prevention and treatment.
  • siHif1 ⁇ (5'-AAGCAUUUCUCUCAUUUCCUCAUGG-3 ', SEQ ID NO: 33) for mouse produced by COSMO GENETECH, which was obtained in Example ⁇ 1-1>, was inoculated into mtNSC-34 cells using RNAiMax transfection reagent (Invitrogen) And transfected according to the manufacturer's procedure, and recovered after 48 hours. Then, Western blotting (Fig. 6A), qRT-PCR (Fig. 6B to Fig. 6H) and LDH release analysis (Fig. 6I) were carried out in the same manner as in the methods described in Examples 2 to 4 Respectively. MtNSC-34 cells were used as a control.
  • Fig. 6 As a result, as shown in Fig. 6, it was confirmed that the level of Mef2c protein and mRNA decreased (Fig. 6A to Fig. 6C) and the level of Mctp1 and Rarb protein and mRNA increased in Ht1 ⁇ deficiency in mtNSC-34 cells , Fig. 6D, Fig. 6E). In addition, it was confirmed that inhibition of Mef2c expression by Hif1 ⁇ deficiency decreased miR-206 levels (FIG. 6H). In addition, it was confirmed that cell death was inhibited in the Hif1? Deficient state (Fig. 6F, Fig. 6G, Fig. 61).
  • luciferase reporter assays were performed using Mctp1 and Rarb 3'UTR in miR-206 overexpressing NSC-34 cont cells.
  • Western blotting and qRT-PCR were performed to confirm the expression of the relevant factors.
  • intracellular calcium signaling, cell differentiation and apoptosis changes were confirmed.
  • cDNA was obtained from the NSC-34 cont cells obtained in Example ⁇ 1-1> and miR-206 was amplified by PCR using the cDNA as a template using the primers shown in Table 7 below.
  • the miR-206 PCR product was cloned into pCDNA3 vector (Invitrogen) with BamH I and Xhol I ( NEW ENGLAND BioLabs) restriction sites to produce the miR-206 plasmid construct.
  • PCR was performed using the primers shown in Table 6 below to amplify each of the 3'UTRs of Mctp1 and Rarb.
  • Mctp1 3'UTR and Rarb 3'UTR PCR products were cloned into pmirGLO double-luciferase vector (Promega) with restriction sites of Xho I and Xba I ( NEW ENGLAND BioLabs), and the Mctp1 3'UTR plasmid construct And Rarb 3'UTR plasmids were prepared.
  • the miR-206 plasmid construct, Mctp1 3'UTR plasmid construct and Rarb 3'UTR plasmid construct were ligated to NSC-34 cont cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer's procedure Infected and recovered after 48 hours to measure the luciferase activity (Fig. 7A and Fig. 7C). 7E), qRT-PCR (Fig. 7B, Fig. 7D, Fig. 7F, Fig. 8C), intracellular Ca 2 + analysis was performed (Fig. 8A, right, above), the axon generation assay ( Figure 8A, right, down), LDH release assay (Fig. 8D).
  • the miR-206 plasmid construct was transfected into NSC cultured in Example ⁇ 1-2>, and the expression of the miR-206 plasmid construct described in Example ⁇ 5-1> And Annexin-V-FITC and PI assay (Fig. 8E) were performed in the same manner as in Example 1. NSC was used as a control.
  • miRNA expression was reduced in mtNSC-34 cells using the LNA method, Western blotting and qRT-PCR were performed to confirm the expression of the relevant factors , And cell death was observed.
  • miRNA-206 LNA anti-206, COSMOGENTECH
  • mtNSC-34 cells obtained in Example ⁇ 1-1> according to the manufacturer's procedure using an RNAiMax transfection reagent (Invitrogen) And recovered after 48 hours.
  • Western blotting Fig. 9A
  • qRT-PCR Fig. 9B to Fig. 9E, Fig. 9G
  • LDH release analysis Fig. 9F
  • FIG. 9 it was confirmed that the amount of protein and mRNA of Mctp1 and Rarb was significantly increased by inhibition of miR-206 expression in mtNSC-34 cells (FIGS. 9A to 9C). In addition, it was confirmed that cell death was inhibited by inhibition of miR-206 expression (FIGS. 9D to 9F).
  • siMctp1 (5'-GCCACUAUAUAUCAAGGUATT-3 ', SEQ ID NO: 40) for mouse and / or siRarb (SEQ ID NO: 40) for mice prepared in accordance with COSMO GENETECH were added to the NSC-34 cont cells obtained in Example ⁇ 1-1>5'-GGAGCCUUCAAAGCAGGAATT-3', SEQ ID NO: 41) was transfected using RNAiMax transfection reagent (Invitrogen) according to the manufacturer's protocol and recovered after 48 hours. Then, Western blotting (Fig. 10A), qRT-PCR (Fig. 10B, Fig. 10C, Fig. 11A and Fig. 11B), intracellular Ca 2 + analysis (Fig. 10D, left, above), the axon generated analysis (Fig. 10D, left, below), and LDH release assay ( Figure 11C) was performed. NSC-34 cont cells were used as a control.
  • siMctp1 and siRarb were transfected into NSC cultured in Example ⁇ 1-2>, and analyzed by Annexin-V-FITC and PI (FIG. 11D ) Were performed. NSC was used as a control.
  • Mctp1 expression is inhibition of intracellular Ca 2 +, while the concentration is increased, Bax and Bcl2 expression has no effect.
  • Rarb expression was inhibited and cell differentiation was inhibited, but Bax and Bcl2 expression were not significantly changed.
  • Mctp1 and Rarb when the expression of Mctp1 and Rarb was simultaneously inhibited, it was confirmed that Bax expression was increased, Bx12 expression was decreased, and LDH release was increased to induce apoptosis (FIGS. 10A to 10D and 11A to 11D).
  • mtNSC-34 cells were overexpressed with Mctp1 and / or Rarb, followed by Western blotting and qRT-PCR to confirm the expression of related factors . In addition, intracellular calcium signaling, cell differentiation and apoptosis changes were observed.
  • cDNA was obtained from the NSC-34 cont cells obtained in Example ⁇ 1-1> and Mctp1 and Rarb were amplified by PCR using the cDNA as a template using the primers shown in Table 7 below.
  • the amplified Mctp1 PCR product was cloned into mCherry C1 (Clontech) with restriction site of HindIII ( NEW ENGLAND BioLabs) to produce the Mctp1 plasmid construct.
  • the amplified Rarb PCR products were Nhe I and Age I ( NEW ENGLAND BioLabs) restriction sites were cloned with eGFP N1 (Clontech) to produce Rarb plasmid constructs.
  • the Mctp1 plasmid construct and / or the Rarb plasmid construct were ligated to mtNSC-34 cells using Lipofectamine 2000 (Invitorgen) according to the manufacturer's procedure Transfected, and recovered after 48 hours. 12A), qRT-PCR (Fig. 12B, Fig. 12C, Fig. 12E, right, Fig. 12F, right) in the same manner as in the methods described in Examples 2 to 4, , cells were performed in Ca 2 + analysis (Fig. 12E, left), and axon generated analysis ( Figure 12F, left), and LDH release assay (Fig. 12D).
  • mtNSC-34 cells were used as a control. As shown in FIG. 12, when Mctp1 and Rarb were simultaneously overexpressed, cell death was reduced (FIGS. 12A to 12D). Further, it was confirmed that Mctp1 decrease in Ca 2 + levels cell by increased expression in mtNSC-34 cells, and nerve cell differentiation is activated by Rarb increased expression (Fig. 12E to Fig. 12G).
  • Mctp1 and Rarb are regulated by transcriptional regulation of miR-18b due to SOD1 mutation, resulting in a decrease in Mctp1 and Rarb, thereby inhibiting calcium signaling and neuronal differentiation and inducing apoptosis Respectively.
  • plasmid construct containing SOD1 (G85R) mutation gene and plasmid construct containing SOD1 (D90A) mutant gene were inserted into NSC-34 cont cells cultured in Example ⁇ 1-1> with Lipofectamine 2000 (Invitorgen) In accordance with the manufacturer's procedure, and recovered after 48 hours. Then, Western blotting (Fig. 13A) and qRT-PCR (Fig. 13B to Fig. 13G) analysis were carried out in the same manner as in the methods described in Example 2 to Example 4 above. NSC-34 cont cells were used as a control.
  • ALS mutation induces a regulatory disorder of the miR-18b signaling pathway
  • samples of ALS mouse model and familial ALS (fALS) patients were collected and subjected to Western blotting and qRT-PCR to detect miR-18b Expression of signal transduction pathway related factors and apoptosis changes were confirmed.
  • a SOD1-G93A transgenic mouse (B6SJL-Tg (SOD1-G93A) 1 Gur / J) expressing the human G93A mutant SOD1 gene was supplied and received from Jsackson Laboratory, Bar Harbor, Me, USA.
  • Normal (B6) normal mice (WT) were used as a control.
  • Spinal cord tissue of each of the WT and SOD1-G93A transgenic mice was harvested at day 120 postnatally to obtain spinal cord tissue samples of mice.
  • each spinal cord sample from normal and familial ALS (fALS (G86S)) patients was received from NBB. Then, using the above spinal cord tissue sample (Fig. 14) and spinal cord sample (Fig. 15), Western blotting (Figs.
  • qRT-PCR was performed using the primers shown in Table 8 below.
  • qRT-PCR was performed using each of hsa-miR-18b and hsa-miR-206 primers (GenoSensor).
  • fALS familial ALS
  • hiPSC human neural stem cells
  • hNSCs human neural stem cells
  • qRT-PCR was performed to confirm the expression of miR-18b signaling pathway related factors Respectively.
  • intracellular calcium signaling, cell differentiation and apoptosis changes were observed.
  • PBMCs peripheral blood mononuclear cells
  • the transduced cells were cultured in a medium containing cytokine-free StemPro-34 medium and seeded with 20 ⁇ g / ml mitomycin C-treated HFF (Human Scrotum foreskin fibrin) at a concentration of 1.5 ⁇ 10 5 cells / Treated on a start-coated 35 mm dish and the medium was changed daily until hiPSC began to metastasize.
  • HFF Human Scrotum foreskin fibrin
  • iPSC medium was changed daily. At or after 30 days, the colonies were harvested and hiPSCs were propagated by subculture to new mitotically inactivated HFFs. In addition, immunocytochemical staining and RT-PCR analysis were performed using a versatile marker to confirm that normal hiPSC and fALS SOD1 (G17S) hiPSC were induced (FIGS. 16A and 16B).
  • the colonies were then separated using a 2 mg / ml dispase (Gibco) to produce neuron stem cells (NSC), treated with a 60-mm incoated bacterial plate and incubated for 5-7 days Were replaced daily with EB (embryoid body) medium containing Essential 6 medium containing 15% knockout SR (Gibco), 50 U / ml penicillin, 50 ug / ml streptomycin at 37 ⁇ . The formed EBs were then transferred to a Cell Start coated 35 mm culture dish.
  • EB embryonic SR
  • DMEM / F12 1% non-essential amino acid, 50 U / ml penicillin, 50 ug / ml streptomycin and 0.1 (1% non-essential amino acid, 50 U / ml penicillin, 50 ug / ml streptomycin and 0.1 mM 2-mercaptoethanol (supplemented with 1% N2 supplement and 40 bFGF in DMEM / F12 )
  • DMEM / F12 1% non-essential amino acid, 50 U / ml penicillin, 50 ug / ml streptomycin and 0.1 mM 2-mercaptoethanol
  • Obtained neurons were fragmented, cultured in Cell start-coated culture dishes for 1 day, and treated with Accutase (Gibco) for 1 hour at 37 ° C.
  • NSC was diluted in DMEM / F12 containing 1% nonessential amino acid, 50 U / ml penicillin, 50 ug / ml streptomycin and 0.1 mM 2-mercaptoethanol and 0.5% N2 supplement and 40 ng / ml b- Lt; / RTI >
  • immunocytochemical staining was performed using NSC marker to confirm that normal NSC and fALS SOD1 (G17S) NSC were produced (FIG. 16C).
  • NSCs were cultured for 2 days in Cell Start containing 1 / / ml laminin and 5 ug / ml heparin coated plates with nonessential amino acids, penicillin / streptomycin, 2-mercaptoethanol N2 and b-FGF and then cultured in DMEM / F12 medium containing 0.1 mM 2-mercaptoethanol, 0.5% N2 supplement and 40 ng / ml bFGF, and cultured in DMEM / F12 medium And neural fiber medium (0.1 mM 2-mercaptoethanol, 0.5% N2 supplement, 40 ng / ml bFGF, 10 ng / ml neural growth factor, 10 ng / ml sonic hedgehog, R & D Systems ), 10 ⁇ M forskolin (Sigma) and 1 ⁇ M retinoic acid (Sigma), 10 ng / ml glial cell-derived neurotrophic factor,
  • FIG. 17A to Fig. 17D and Fig. 17F intracellular Ca ⁇ 2 + & gt ;
  • FIG. 17C axonal production assay
  • Fig. 17G LDH release assay
  • fALS SOD1 (G17S) MN fALS SOD1 MN
  • Mctp1 and Rarb miRNA levels of Mctp1 and Rarb
  • miR-18b and miR-206 levels were measured in fALS SOD1 (G17S) MNs, and miR-18b was significantly decreased and miR-206 was significantly increased (Fig. 17D).
  • fALS SOD1 (G17S) was Ca 2 + has been accumulated in the MNs, and inhibit the nerve cell differentiation, it was confirmed that cell death was induced (Fig. 17C, Fig. 17E to Fig. 17G).
  • Example 11 Duchen type Muscular dystrophy Duchenn muscular dystrophy; DMD ) To confirm miR-18 control disorder
  • miR-18b regulatory disorder is induced by gene mutation in DMD as another muscle mutation-induced muscle disorder
  • qRT-PCR was performed by expressing miR-18 in dystrophin-expressing myoblasts.
  • Example ⁇ 1-3> the dystrophin expression-inhibiting C2C12 cells obtained in Example ⁇ 1-3> were recovered and subjected to qRT-PCR in the same manner as described in ⁇ Example 2> (FIG. 18). C2C12 cells transfected with siControl were used as controls.
  • miR-18b regulatory disorder was induced by gene mutation in DMD
  • miR-18 expression was confirmed by qRT-PCR in an animal model of DMD.
  • mice 2-4 weeks of age
  • an animal model of DMD were received from the Jackson laboratory.
  • the muscle tissue was extracted from the mdx mouse, and qRT-PCR was performed in the same manner as described in Example 2 (Fig. 19).
  • miR-18b can be used as a target miRNA for the diagnosis of DMD and can be used for the prevention and treatment of DMD by controlling the miR-18b signaling pathway in Dystrophin mutant DMD. Respectively.
  • Examples 1 to 11 demonstrate that gene mutations reduce miR-18b expression and cause miRNA regulation of the miR-18b signaling pathway, and miR-18b regulation disorder Hif1 ⁇ up-regulated, up-regulated Hif1 ⁇ upregulates Mef2c, Mef2c induces miR-206 expression, and miR-206 is directly involved in post-transcriptional regulation of Mctp1 and Rarb, Inhibition of differentiation and cell death.
  • miR-18b can be used as a target in the diagnosis and treatment of muscle disorders caused by genetic mutations such as ALS and DMD.
  • MiR-18b of the present invention can be used as a target agent for diagnosing and treating muscle diseases induced by gene mutations such as ALS and DMD.

Abstract

본 발명은 근육 질환 또는 신경근육 질환 예방, 치료 또는 진단을 위한 miR-18b의 용도에 관한 것으로, 구체적으로 유전자 돌연변이에 의한 근육 질환 모델에서 유전자 돌연변이가 miR-18b 발현을 감소시켜 miR-18b 신호전달경로의 조절 장애를 유발하고, 이로 인해 칼슘 신호전달과 세포 분화 억제 및 세포사멸을 유도함을 확인하였다. 따라서, 본 발명의 miR-18b를 ALS, DMD와 같이 유전자 돌연변이에 의해 유발되는 근육 질환 진단 및 치료를 위한 표적 인자로 이용할 수 있다.

Description

근육 질환 및 신경근육 질환 예방, 치료 또는 진단을 위한 miR-18b의 용도
본 발명은 근육 질환 또는 신경근육 질환 예방, 치료 또는 진단을 위한 miR-18b의 용도에 관한 것으로, 구체적으로 miR-18b를 유효성분으로 함유하는 근육 질환 예방 또는 치료용 약학조성물 및 miR-18b를 이용한 근육 질환 진단 방법에 관한 것이다.
근육 질환은 유전성 및 퇴행성, 염증성, 내분비성, 대사성 원인 등에 의해 상지 또는 하지의 근력 약화, 이로 이한 전반적 근위축, 근의 긴장성 감소, 근경련, 근의 삼한 통증 등을 호소하는 질환이다. 특히 유전성 및 퇴행성 원인에 의해 근이영양증(muscular dystrophy), 근위축성 측삭 경화증(amyotrophic lateral sclerosis, ALS), 척수성 근위축(spinal muscular amyotrophy), 척수구근 근위축(spinobular muscular atrophy), 샤르코 마리 투스 질환(Charcot Marie Tooth disease, CMT), 폼페병(Pompe disease), 근육감소증(sacopenia), 카나반병(Canavan disease), 근육긴장이상(dystonia), 근육감소증(sacopenia), 근육퇴화증 등이 나타난다.
예를 들어, 근위축성 측삭 경화증은 다음의 유전자 돌연변이에 의해 발생한다: SOD1(Cu / Zn superoxide dismutase 1), TAF15(TATA-Box Binding Protein Associated Factor 15), EWSR1(Ewing sarcoma breakpoint region 1), FUS(Fused in Sarcoma) 및 TDP-43(TAR DNA-binding protein 4). 또한, 근위축성 측삭경화증(ALS)은 초기에는 근기능 장애를 진행시키고 궁극적으로 근육 마비를 초래하는 상위 및 하위 운동 뉴런의 퇴행성 질환으로, 불행하게도 ALS 환자의 질병 진행을 늦추거나 삶의 질을 향상시키는 옵션은 거의 없다.
또한, 듀시엔형 및 베커형 근이영양증의 경우 X염색체에 존재하는 Dystrophin 유전자의 이상에 의해 발생하며 1/3 정도는 자연 돌연변이, 나머지는 반성유전에 기인하며, 근력저하, 심근 기능 장애 등이 나타난다.
또한, 척수성 근위축증의 경우 진핵생물에서 SMN(survival motor neuron) 단백질을 암호화하는 SMN1 유전자 돌연변이에 의해 발생하며, SMN 단백질의 감소로 인해 척수와 뇌간 사이에 존재하는 운동신경세포의 기능손상을 야기시켜 근육의 동작을 명령하는 신호를 받지못해 근육이 방치되며, 근력저하, 근위축 및 섬유속성 연축 등을 일으킨다.
이러한 근육 질환 발병의 원인이 되는 유전자 돌연변이는 자가소화작용(autophagy), 단백질 응집, 미토콘드리아 스트레스 및 RNA 대사와 같은 다양한 세포 과정과 관련이 있다.
한편, 마이크로 RNA(microRNA 또는 miRNA)는 RNA-의존적 전사후 유전자 조절을 통해 단백질 합성을 조절하는 작은 비-코딩 단일 가닥 RNA 분자로, miRNA는 두 단계의 과정을 거쳐 생성된다. 구체적으로, 핵 내에서 Drosha와 DGCR8에 의해 최초의 전사체 miRNA(pri-miRNA)에서 miRNAs 전구체(pre-miRNA)로 만들어지고, pre-miRNA는 세포질로 내보내진 후 Dicer에 의해 miRNA로 만들어진다. 최근, miRNA 또한 미토콘드리아 유전자 발현, 칼슘 신호전달, 세포 분화, 세포 사멸과 같은 세포 과정과 관련이 있고, 유전자 돌연변이가 miRNA 생합성을 조절한다는 것이 알려지면서, 유전자 돌연변이에 의해 유발되는 질환의 발병 기전에 있어서 miRNA의 역할을 밝혀 이를 질환의 진단 또는 치료에 이용하고자 하는 연구가 이루어지고 있다. 그러나, 아직까지 유전적 원인에 기인한 근육 질환에서 유전자 돌연변이와 miRNA의 특이적 상호작용 메커니즘은 완전히 밝혀지지 않았다.
이에, 본 발명자들은 근육 질환 진단 및 치료에 이용할 수 있는 miRNA를 발굴하기 위해 노력한 결과, 유전자 돌연변이에 의한 근육 질환 모델에서 유전자 돌연변이가 miR-18b 발현을 감소시켜 miR-18b 신호전달경로의 조절 장애를 유발하고, 이로 인해 칼슘 신호전달과 세포 분화 억제 및 세포사멸을 유도함을 확인하여, miR-18b를 ALS, DMD와 같이 유전자 돌연변이에 의해 유발되는 근육 질환 진단 및 치료를 위한 표적 인자로 이용할 수 있음을 밝힘으로써, 본 발명을 완성하였다.
[선행기술문헌]
[비특허문헌]
Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, Donaldson D, Goto J, O'Regan JP, Deng HX, et al. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature. 1993 Mar 4;362(6415):59-62.
Narozna B, Langwinski W, Szczepankiewicz A. Non-Coding RNAs in Pediatric Airway Diseases. Genes (Basel). 2017 Nov 27;8(12).
Chen Z, Li Y, Zhang H, Huang P, Luthra R. Hypoxia-regulated microRNA-210 modulates mitochondrial function and decreases ISCU and COX10 expression. Oncogene. 2010 Jul 29;29(30):4362-8.
Choi E, Cha MJ, Hwang KC. Roles of Calcium Regulating MicroRNAs in Cardiac Ischemia-Reperfusion Injury. Cells. 2014 Sep 11;3(3):899-913.
Makeyev EV, Zhang J, Carrasco MA, Maniatis T. The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing. Mol Cell. 2007 Aug 3;27(3):435-48.
본 발명의 목적은 miR-18b를 유효성분으로 함유하는, 근육 질환 예방 또는 치료용 약학조성물을 제공하는 것이다.
본 발명의 다른 목적은 miR-18b를 이용한 근육 질환의 진단 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 약학적으로 유효한 양의 miR-18b를 개체에 투여하는 단계를 포함하는 근육 질환 예방 또는 치료방법을 제공하는 것이다.
본 발명의 또 다른 목적은 근육 질환 예방 또는 치료용 약학적 조성물로 사용하기 위한 miR-18b의 용도를 제공하는 것이다.
본 발명의 목적을 달성하기 위하여, 본 발명은 miR-18b를 유효성분으로 함유하는, 근육 질환 예방 또는 치료용 약학조성물을 제공한다.
또한, 본 발명은 피검체로부터 분리된 시료에서 miR-18b의 발현 수준을 측정하고 정상 대조군과 비교하는 단계를 포함하는, 근육 질환의 진단 방법을 제공한다.
또한, 본 발명은 약학적으로 유효한 양의 miR-18b를 개체에 투여하는 단계를 포함하는 근육 질환 예방 또는 치료방법을 제공한다.
아울러, 본 발명은 근육 질환 예방 또는 치료용 약학적 조성물로 사용하기 위한 miR-18b의 용도를 제공한다.
본 발명은 유전자 돌연변이에 의한 근육 질환 모델에서 유전자 돌연변이가 miR-18b 발현을 감소시켜 miR-18b 신호전달경로의 조절 장애를 유발하고, 이로 인해 칼슘 신호전달과 세포 분화 억제 및 세포사멸을 유도함을 확인하였다. 또한, miR-18b 발현을 증가시켜 유전자 돌연변이에 의해 유도된 세포사멸이 억제되고, 칼슘 신호전달과 세포 분화가 회복됨을 확인하였다. 따라서, 본 발명의 miR-18b를 ALS, DMD와 같이 유전자 돌연변이에 의해 유발되는 근육 질환 진단 및 치료를 위한 표적 인자로 이용할 수 있다.
도 1은 본 발명의 일 실시예에 따른 인간 SOD1(G93A)를 발현하는 NSC-34 운동신경세포(mtNSC-34 세포) 및 대조군으로 인간 SOD1를 발현하는 NSC-34 운동신경세포(wtNSC-34 세포)에서 RNA 생합성 변화, mtNSC-34 세포 및 wtNSC-34 세포 간 발현 차이가 있는 4종의 유전자, Hif1α(hypoxia inducible factor 1 alpha), Mef2c(myocyte specific enhancer factor 2c), Mctp1(multiple C2 domains transmembrane protein 1) 및 Rarb(retinoic acid receptor beta) 발현 변화를 확인한 도이다.
도 2는 본 발명의 일 실시예에 따른 mtNSC-34 세포, wtNSC-34 세포 및 마우스 SOD1을 발현하는 운동신경세포(NSC-34 cont 세포)에서 세포 내 칼슘 신호전달, 세포 분화 및 세포 사멸 변화를 확인한 도이다.
도 3은 Hif1α를 조절하는 표적 miRNA로 miR-18b 및 Mctp1과 Rarb를 조절하는 표적 miRNA로 miR-206을 확인한 도이다.
도 4는 본 발명의 일 실시예에 따라 miR-18b 발현을 감소시킨 NSC-34 cont 세포에서 Hif1α, Mef2c, Mctp1, Rarb 및 miR-206 발현 변화, LDH 방출 변화를 확인하고, 본 발명의 일 실시예에 따른 miR-18b 발현을 감소시킨 신경줄기세포(Neural stem cell, NSC)에서 세포 사멸 변화를 확인한 도이다.
도 5는 본 발명의 일 실시예에 따라 miR-18b 발현을 증가시킨 mtNSC-34 세포에서 Hif1α, Mef2c, Mctp1, Rarb 및 miR-206 발현 변화, 세포 내 칼슘 신호전달, 세포 분화 및 세포 사멸 변화를 확인한 도이다.
도 6은 본 발명의 일 실시예에 따라 Hif1α 발현을 감소시킨 mtNSC-34 세포에서 Mef2c, Mctp1, Rarb 및 miR-206 발현 변화 및 세포 사멸 변화를 확인한 도이다.
도 7은 본 발명의 일 실시예에 따라 miR-206 발현을 증가시킨 NSC-34 cont 세포에서 Mctp1 및 Rarb 발현 변화를 확인한 도이다.
도 8은 본 발명의 일 실시예에 따라 miR-206 발현을 증가시킨 NSC-34 cont 세포에서 세포 내 칼슘 신호전달, 세포 분화를 확인하고, 본 발명의 일 실시예에 따라 miR-206 발현을 증가시킨 NSC-34 cont 세포 및 NSC 각각에서 세포 사멸 변화를 확인한 도이다.
도 9는 본 발명의 일 실시예에 따라 miR-206 발현을 감소시킨 mtNSC-34 세포에서 Mctp1 및 Rarb 발현 변화 및 세포 사멸 변화를 확인한 도이다.
도 10은 본 발명의 일 실시예에 따라 Mctp1 및/또는 Rarb 발현을 감소시킨 NSC-34 cont 세포에서 세포 내 칼슘 신호전달 및 세포 분화 변화를 확인한 도이다.
도 11은 본 발명의 일 실시예에 따라 Mctp1 및/또는 Rarb 발현을 감소시킨 NSC-34 cont 세포 및 신경줄기세포 각각에서 세포 사멸 변화를 확인한 도이다.
도 12는 본 발명의 일 실시예에 따라 Mctp1 및/또는 Rarb 발현을 증가시킨 mtNSC-34 세포에서 세포 내 칼슘 신호전달, 세포 분화 및 세포 사멸 변화를 확인한 도이다.
도 13은 본 발명의 일 실시예에 따라 돌연변이된 SOD1 (G85R) 및 SOD1 (D90A) 발현을 증가시킨 NSC-34 cont 세포에서 Hif1α, Mef2c, Mctp1, Rarb, miR-18b 및 miR-206 발현 변화 및 세포 사멸 변화를 확인한 도이다.
도 14 및 도 15는 본 발명의 일 실시예에 따른 근위축성 측삭 경화증(ALS) 질환 마우스 모델의 척수(spinal cord) 조직 샘플 및 가족성 ALS (fALS (G86S)) 환자 척수 샘플에서 Hif1α, Mef2c, Mctp1, Rarb, miR-18b 및 miR-206 발현 변화 및 세포 사멸 변화를 확인한 도이다.
도 16은 본 발명의 일 실시예에 따라 SOD1 (G17S) fALS 환자의 혈액 샘플에서 유도된 hiPSC로부터 신경줄기세포(hNSCs)를 분화하고, 상기 분화된 hNSCs부터 유도된 운동뉴런(motor neuron, MN)을 확인한 도이다.
도 17은 본 발명의 일 실시예에 따른 SOD1 (G17S) fALS 환자의 hiPSC 유래 MN에서 Hif1α, Mef2c, Mctp1, Rarb, miR-18b 및 miR-206 발현 변화, 세포 내 칼슘 신호전달, 세포 분화 및 세포 사멸 변화를 확인한 도이다.
도 18은 본 발명의 일 실시예에 따라 Dystrophin 발현을 감소시킨 근아세포에서 miR-18b 발현 변화를 확인한 도이다.
도 19는 본 발명의 일 실시예에 따른 듀시엔형 근이영양증(DMD) 마우스 모델에서 miR-18b 발현 변화를 확인한 도이다.
도 20은 유전자 돌연변이에 의한 miR-18b 신호전달경로의 조절 장애를 모식화한 도이다.
이하, 본 발명을 보다 상세히 설명한다.
본 발명은 miR-18b를 유효성분으로 함유하는, 근육 질환 예방 또는 치료용 약학조성물을 제공한다.
본 발명에서, 상기 miR-18b는 인간을 포함한 동물, 예를 들어 원숭이, 침팬지, 돼지, 말, 소, 양, 개, 고양이, 생쥐, 토끼 등으로부터 유래할 수 있다.
본 발명에서, 상기 miR-18b를 구성하는 핵산 분자는 18 내지 100 nt(nucleotide) 길이를 가질 수 있다. 구체적으로, 상기 핵산 분자는 19 내지 25nt 길이, 보다 구체적으로 21, 22 또는 23nt 길이의 성숙 miRNA 형태일 수 있다. 또한, 상기 핵산 분자는 50 내지 100nt, 보다 구체적으로 65 내지 95nt 길이의 전구체 miRNA 형태일 수도 있다.
또한, 상기 성숙 miRNA 형태의 miR-18b는 구체적으로 miR-18b-5p 또는 miR-18b-3p일 수 있고, 보다 구체적으로 miR-18b-5p일 수 있다.
상기 성숙 miRNA 또는 전구체 miRNA 형태의 miR-18b는 핵산 분자의 염기서열 정보는 미국국립보건원 유전자은행(NIH GenBank) 및 miRBASE(http://www.mirbase.org/) 등의 공지된 유전자데이터베이스에서 확인할 수 있다. 예를 들어, 인간 miR-18b의 성숙 형태의 염기서열은 유전자 등록번호 MIMAT0001412(서열번호 1) 또는 MIMAT0004751(서열번호 2), 전구체 형태는 MI0001518(서열번호 3)로 등록되어 있다.
유전자 서열정보
hsa-miR-18b 성숙 형태 miR-18b-5p UAAGGUGCAUCUAGUGCAGUUAG(서열번호 1)
miR-18b-3p UGCCCUAAAUGCCCCUUCUGGC(서열번호 2)
전구체 형태 UGUGUUAAGGUGCAUCUAGUGCAGUUAGUGAAGCAGCUUAGAAUCUACUGCCCUAAAUGCCCCUUCUGGCA(서열번호 3)
또한, 본 발명에서 사용되는 miR-18b는 이를 구성하는 핵산 분자의 작용성 등가물, 예를 들어, miRNA 핵산 분자의 일부 염기서열이 결실, 치환 또는 삽입에 의해 변형되더라도 상기 miRNA 핵산 분자와 기능적으로 동등한 작용을 할 수 있는 변이체를 포함하는 개념이다. 예를 들어, 본 발명의 miR-18b는 각 해당 서열번호의 염기서열과 80% 이상의 상동성을 나타낼 수 있으며, 구체적으로 90%, 보다 구체적으로 95% 이상의 상동성을 나타내는 것을 포함할 수 있다. 이러한 상동성은 당 분야에 널리 공지된 컴퓨터 알고리즘, 예를 들어 Align 또는 BLAST 알고리즘을 이용하여 뉴클레오티드의 서열을 표적 유전자의 상응하는 부분과 비교하여 용이하게 결정할 수 있다.
또한, 본 발명에서 사용되는 miR-18b는 단일 가닥 또는 이중 가닥 형태로 존재할 수 있다. 성숙 miRNA 분자는 주로 단일 가닥으로 존재하지만, 전구체 miRNA 분자는 이중가닥을 형성할 수 있는 부분적인 자가-상보적인 구조(예를 들어 스템-루프 구조)를 포함할 수 있다. 또한, 본 발명의 핵산 분자는 RNA 또는 PNA(peptide nucleic acids) 같은 형태로 구성될 수 있다.
또한, 본 발명에서 사용되는 miR-18b는 표준 분자 생물학 기술, 예를 들어 화학적 합성 방법 또는 재조합 방법을 이용하여 분리 또는 제조하거나, 시판되는 것을 사용할 수 있다.
본 발명에서, 상기 miR-18b 자체를 포함할 수도 있으나 이와 기능적으로 동등한 단편을 포함할 수도 있으며, 상기 miRNA 의 단편은 상기 miRNA 의 종자 서열(seed sequence)을 포함하는 폴리뉴클레오티드일 수 있다. 종자 서열(seed sequence)은 miRNA가 타겟을 인식할 때 완전한 상보성을 가지고 결합하는 miRNA 내 일부 영역의 뉴클레오타이드 서열을 의미하며, 이는 miRNA가 타겟에 결합하기 위해 필수적으로 요구되는 부분이다.
또한, 상기 miR-18b는 이의 생물학적 등가 효능을 발생시키는 다양한 miRNA 유도체(miRNA mimic)의 형태로 사용할 수 있는데, 동일한 씨앗 부분 (seed region)을 포함하는 miRNA 서열을 포함하는 변형된 miRNA를 사용할 수 있다. 상기 miRNA에 대한 miRNA 유도체로서는 RNA 인산 뼈대 구조 (phosphate backbone structure)를 황 등의 다른 원소로 치환한 형태인 포스포로사이오에이트 (phosphorothiolate) 구조를 부분적으로 포함할 수 있으며, RNA 대신 DNA 및 PNA(petide nucleic acids) 분자로의 전체 또는 부분적으로 치환한 형태로 사용 가능하고, 또한, RNA 당의 2'수산화기를 다양한 기능성 구조로 치환한 형태로 사용이 가능한데, 이는 메틸화, 메톡시화, 플르오르화 등을 포함하나 이러한 변형에 제한되는 것은 아니다.
본 발명에서, 상기 miR-18b는 벡터에 포함되거나 세포에 도입된 형태로 제공될 수 있다.
구체적으로, 상기 miR-18b는 세포 내 전달을 위한 발현 벡터에 포함되어 제공될 수 있다. 상기 발현 벡터는 바이러스 벡터 및 비바이러스 벡터 모두 사용 가능하다. 바이러스 벡터(viral vector)로서 예를 들면, 렌티바이러스(lentivirus), 레트로바이러스(retrovirus), 아데노바이러스(adenovirus), 허피스바이러스(herpes virus) 또는 아비폭스바이러스(avipox virus) 벡터 등을 사용할 수 있으나, 이에 제한되는 것은 아니다.
상기 발현 벡터는, 형질도입된 세포의 선별을 용이하게 하기 위하여 선별마커를 추가로 포함할 수 있다. 예를 들어, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들, 예를 들어 녹색 형광 단백질, 퓨로마이신, 네오마이신, 하이그로마이신, 히스티디놀디하이드로게나제(hisD) 및 구아닌 포스포리보실트랜스퍼라제(Gpt) 등을 예시할 수 있다.
또한, 상기 miR-18b는 세포에 도입된 형태로 제공될 수 있다. 이러한 세포는 miR-18b를 높은 수준으로 발현할 수 있게 된다. 세포 내로 도입하는 방법으로는, 예를 들어 G-fectin, Mirus TrasIT-TKO 지질친화성 시약, 리포펙틴, 리포펙타민, 셀펙틴(cellfectin), 양이온성 인지질 나노입자, 양이온성 고분자, 양이온성 미셀, 양이온성 에멀젼 또는 리포좀을 포함하는 전달시약과 함께 세포 내로 도입되거나, 폴리에틸렌글리콜과 같은 생체적합성 고분자를 접합하여 세포 내 흡수를 증가시킬 수 있다.
본 발명에서, 상기 근육 질환은 유전자 돌연변이에 의해 유발된 근육 질환일 수 있으나 이에 제한되는 것은 아니다.
또한, 상기 근육 질환은 중증근무력증(myasthenia gravis), 진행성 근이영양증(progressive muscular dystrophy), 근긴장성 근이영양증(myotonic muscular dystrophy), 듀시엔형 근이영양증(Duchenne muscular dystrophy), 베커형 근이영양증(Backer muscular dystrophy), 지대형 근이영양증(Limb Girdle muscular dystrophy), 안면견갑상완형 근이영양증(facioscapulohumeral muscular dystrophy), 척수성 근위축(spinal muscular amyotrophy), 근위축증(muscular atrophy), 근위축성 축삭 경화증(amyotrophic lateral sclerosis), 척수구근 근위축(spinobulbar muscular atrophy), 샤르코 마리 투스 질환(Charcot Marie Tooth disease, CMT), 폼페병(Pompe disease), 카나반병(Canavan disease), 근육긴장이상(dystonia), 근육감소증(sacopenia) 또는 근육퇴화증일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 구체적인 실시예에서, 본 발명자들은 유전자 돌연변이에 의한 근육 질환 모델로 근위축성 축삭 경화증에서 유전자 돌연변이가 miR-18b 발현을 감소시켜 miR-18b 신호전달경로의 조절 장애를 유발하고, miR-18b 조절 장애가 Hif1α의 상향 조절을 유도하며, 상향 조절된 Hif1α가 Mef2c를 상향 조절하고, Mef2c가 miR-206 발현을 유도하며, miR-206이 Mctp1과 Rarb의 전사후 조절에 직접 관여하여 칼슘 신호전달과 신경세포 분화 억제 및 세포사멸을 유도함을 확인하였다. 또한, miR-18b 발현을 증가시켜 유전자 돌연변이에 의해 유도된 세포사멸이 억제되고, 칼슘 신호전달과 세포 분화가 회복됨을 확인하였다.
또한, 본 발명자들은 유전자 돌연변이에 의한 근육 질환 모델로 듀시엔형 근이영양증에서 유전자 돌연변이에 의해 miR-18b 신호전달 경로의 조절 장애가 유발됨을 확인하였다.
따라서, 본 발명자들은 유전자 돌연변이에 의한 근육 질환 모델에서 유전자 돌연변이가 miR-18b 발현을 감소시켜 miR-18b 신호전달경로의 조절 장애를 유발하고, 이로 인해 칼슘 신호전달과 세포 분화 억제 및 세포사멸을 유도되고, miR-18b 발현을 증가시켜 유전자 돌연변이에 의해 유도된 세포사멸이 억제되고, 칼슘 신호전달과 세포 분화가 회복됨을 확인하였으므로, 본 발명의 miR-18b를 근육 질환 예방 또는 치료에 이용할 수 있다.
본 발명의 조성물은 약학적으로 허용가능한 담체를 추가로 포함할 수 있으며, 담체와 함께 제제화될 수 있다.
상기 약학적으로 허용가능한 담체란, 생물체를 자극하지 않고 투여 화합물의 생물학적 활성 및 특성을 저해하지 않는 담체 또는 희석제를 말한다. 예를 들어, 액상 용액으로 제제화되는 조성물에 있어서 허용되는 약제학적 담체로는, 멸균 및 생체에 적합한 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사용액, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 용액 또는 현탁액(예를 들어, 마이크로입자, 리포솜, 또는 세포와 통합된) 형태로 제제화될 수 있다.
본 발명의 조성물은 이를 유효성분으로 포함하는 어떠한 제형으로도 적용가능하며, 경구용 또는 비경구용 제형으로 제조되어 투여될 수 있다. 투여는 어떠한 적절한 방법으로 환자에게 본 발명의 조성물을 도입하는 것을 의미하며, 핵산 분자의 바이러스성 또는 비바이러스성 기술에 의한 운반 또는 핵산 분자를 발현하는 세포의 이식을 포함한다. 본 발명의 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있다. 예를 들어, 경구 투여, 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 투여, 피내 투여, 비내 투여, 폐내 투여, 직장내 투여, 강내 투여, 복강 내 투여, 경막 내 투여가 이루어질 수 있으나, 이에 제한되지는 않는다.
본 발명의 조성물 및 치료 방법은 근육 질환이 발생할 수 있는 임의의 동물에 적용가능하며, 동물은 인간 및 영장류뿐만 아니라, 소, 돼지, 양, 말, 개 및 고양이 등의 가축을 포함한다.
본 발명의 조성물의 유효량의 범위 또는 적합한 총 1일 사용량은 올바른 의학적 판단범위 내에서 처치의에 의해 결정될 수 있다는 것은 당업자에게 자명한 일이다. 특정 환자에 대한 구체적인 치료적 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는지의 여부를 비롯한 구체적 조성물, 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 및 조사되는 방사선량을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용하는 것이 바람직하다. 예를 들어, 1일 당 0.001 ㎍/kg-100 mg/kg(체중)으로 사용될 수 있으나, 이에 제한되는 것은 아니다. 본 발명의 목적에 적합한 약학 조성물의 유효량은 전술한 사항을 고려하여 결정하는 것이 바람직하다.
또한, 본 발명은 피검체로부터 분리된 시료에서 miR-18b의 발현 수준을 측정하고 정상 대조군과 비교하는 단계를 포함하는, 근육 질환의 진단 정보를 제공하는 방법을 제공한다.
본 발명의 방법에 있어서, 상기 시료는 조직, 세포, 혈장, 혈청, 혈액, 타액 또는 소변일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 방법에 있어서, 상기 발현 수준은 RT-PCR(Reverse transcription polymerase chain reaction), 정량적 RT-PCR, 실시간 RT-PCR, 노던 블럿팅(Northern blotting) 또는 전사체(transcriptome) 분석 방법을 이용하여 측정할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 방법에 있어서, 상기 시료에서 miR-18b의 발현 수준이 정상 대조군과 비교하여 감소하는 것을 확인하여 근육 질환으로 진단할 수 있다.
또한, 상기 시료에서 추가적으로 Hif1α, Mef2c, Mctp1, Rarb 또는 miR-206의 발현 수준을 측정하고 정상 대조군과 비교하여 근육 질환을 진단할 수 있다. 구체적으로, 상기 시료에서 Hif1α, Mef2c 또는 miR-206의 발현 수준이 정상 대조군과 비교하여 증가하는 것을 확인하여 근육 질환을 진단할 수 있고, Mctp1 또는 Rarb의 발현 수준이 정상 대조군과 비교하여 감소하는 것을 확인하여 근육 질환을 진단할 수 있다.
본 발명의 방법에 있어서, 상기 근육 질환은 유전자 돌연변이에 의해 유발된 근육 질환일 수 있으나 이에 제한되는 것은 아니다.
또한, 상기 근육 질환은 중증근무력증(myasthenia gravis), 진행성 근이영양증(progressive muscular dystrophy), 근긴장성 근이영양증(myotonic muscular dystrophy), 듀시엔형 근이영양증(Duchenne muscular dystrophy), 베커형 근이영양증(Backer muscular dystrophy), 지대형 근이영양증(Limb Girdle muscular dystrophy), 안면견갑상완형 근이영양증(facioscapulohumeral muscular dystrophy), 척수성 근위축(spinal muscular amyotrophy), 근위축증(muscular atrophy), 근위축성 축삭 경화증(amyotrophic lateral sclerosis), 척수구근 근위축(spinobulbar muscular atrophy), 샤르코 마리 투스 질환(Charcot Marie Tooth disease, CMT), 폼페병(Pompe disease), 카나반병(Canavan disease), 근육긴장이상(dystonia), 근육감소증(sacopenia) 또는 근육퇴화증일 수 있으나, 이에 제한되는 것은 아니다.
본 발명자들은 유전자 돌연변이에 의한 근육 질환 모델에서 유전자 돌연변이가 miR-18b 발현을 감소시켜 miR-18b 신호전달경로의 조절 장애를 유발하고, miR-18b 조절 장애가 Hif1α의 상향 조절을 유도하며, 상향 조절된 Hif1α가 Mef2c를 상향 조절하고, Mef2c가 miR-206 발현을 유도하며, miR-206이 Mctp1과 Rarb의 전사후 조절에 직접 관여하여 칼슘 신호전달과 신경세포 분화 억제 및 세포사멸을 유도함을 확인하였으므로, 본 발명의 miR-18b 및 miR-18b에 의해 조절되는 상기 인자들을 근육 질환 진단을 위한 표적 인자로 이용할 수 있다.
또한, 본 발명은 약학적으로 유효한 양의 miR-18b를 개체에 투여하는 단계를 포함하는 근육 질환 예방 또는 치료방법을 제공한다.
아울러, 본 발명은 근육 질환 예방 또는 치료용 약학적 조성물로 사용하기 위한 miR-18b의 용도를 제공한다.
본 발명에서, 상기 miR-18b는 인간을 포함한 동물, 예를 들어 원숭이, 침팬지, 돼지, 말, 소, 양, 개, 고양이, 생쥐, 토끼 등으로부터 유래할 수 있다.
본 발명에서, 상기 miR-18b를 구성하는 핵산 분자는 18 내지 100 nt(nucleotide) 길이를 가질 수 있다. 구체적으로, 상기 핵산 분자는 19 내지 25nt 길이, 보다 구체적으로 21, 22 또는 23nt 길이의 성숙 miRNA 형태일 수 있다. 또한, 상기 핵산 분자는 50 내지 100nt, 보다 구체적으로 65 내지 95nt 길이의 전구체 miRNA 형태일 수도 있다.
또한, 상기 성숙 miRNA 형태의 miR-18b는 구체적으로 miR-18b-5p 또는 miR-18b-3p일 수 있고, 보다 구체적으로 miR-18b-5p일 수 있다.
또한, 본 발명에서 사용되는 miR-18b는 단일 가닥 또는 이중 가닥 형태로 존재할 수 있다.
또한, 본 발명에서 사용되는 miR-18b는 표준 분자 생물학 기술, 예를 들어 화학적 합성 방법 또는 재조합 방법을 이용하여 분리 또는 제조하거나, 시판되는 것을 사용할 수 있다.
본 발명에서, 상기 miR-18b 자체를 포함할 수도 있으나 이와 기능적으로 동등한 단편을 포함할 수도 있으며, 상기 miRNA 의 단편은 상기 miRNA 의 종자 서열(seed sequence)을 포함하는 폴리뉴클레오티드일 수 있다.
또한, 상기 miR-18b는 이의 생물학적 등가 효능을 발생시키는 다양한 miRNA 유도체(miRNA mimic)의 형태로 사용할 수 있는데, 동일한 씨앗 부분 (seed region)을 포함하는 miRNA 서열을 포함하는 변형된 miRNA를 사용할 수 있다.
본 발명에서, 상기 miR-18b는 벡터에 포함되거나 세포에 도입된 형태로 제공될 수 있다.
또한, 상기 miR-18b는 세포에 도입된 형태로 제공될 수 있다. 이러한 세포는 miR-18b를 높은 수준으로 발현할 수 있게 된다.
본 발명에서, 상기 근육 질환은 유전자 돌연변이에 의해 유발된 근육 질환일 수 있으나 이에 제한되는 것은 아니다.
또한, 상기 근육 질환은 중증근무력증(myasthenia gravis), 진행성 근이영양증(progressive muscular dystrophy), 근긴장성 근이영양증(myotonic muscular dystrophy), 듀시엔형 근이영양증(Duchenne muscular dystrophy), 베커형 근이영양증(Backer muscular dystrophy), 지대형 근이영양증(Limb Girdle muscular dystrophy), 안면견갑상완형 근이영양증(facioscapulohumeral muscular dystrophy), 척수성 근위축(spinal muscular amyotrophy), 근위축증(muscular atrophy), 근위축성 축삭 경화증(amyotrophic lateral sclerosis), 척수구근 근위축(spinobulbar muscular atrophy), 샤르코 마리 투스 질환(Charcot Marie Tooth disease, CMT), 폼페병(Pompe disease), 카나반병(Canavan disease), 근육긴장이상(dystonia), 근육감소증(sacopenia) 또는 근육퇴화증일 수 있으나, 이에 제한되는 것은 아니다.
본 발명자들은 유전자 돌연변이에 의한 근육 질환 모델에서 유전자 돌연변이가 miR-18b 발현을 감소시켜 miR-18b 신호전달경로의 조절 장애를 유발하고, 이로 인해 칼슘 신호전달과 세포 분화 억제 및 세포사멸을 유도되고, miR-18b 발현을 증가시켜 유전자 돌연변이에 의해 유도된 세포사멸이 억제되고, 칼슘 신호전달과 세포 분화가 회복됨을 확인하였으므로, 본 발명의 miR-18b를 근육 질환 예방 또는 치료에 이용할 수 있다.
이하, 본 발명을 실시예에 의하여 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의하여 한정되는 것은 아니다.
<실시예 1> 세포 배양
<1-1> SOD1 돌연변이 운동신경세포 배양
유전자 돌연변이에 의한 근육 질환으로 근위축성측삭경화증(ALS)은 SOD1 돌연변이에 의해 발병하고 운동신경세포가 소실되는 것으로 잘 알려져 있다. 이에 ALS 진단 및 치료에 이용할 수 있는 표적 miRNA를 알아보기 위하여, SOD1 돌연변이 운동신경세포를 하기와 같이 배양하였다.
구체적으로, 마우스 SOD1을 발현하는 운동신경세포주인 NSC-34 cont 세포, 인간 SOD1을 발현하는 운동신경세포주인 NSC-34 hSOD1 세포(wtNSC-34) 및 인간 SOD1 G93A 돌연변이를 발현하는 SOD1 돌연변이 운동신경세포주인 NSC-34 hSOD1(G93A) 세포(mtNSC-34)를 한국과학기술연구원(KIST)로부터 입수하였다. 그 다음, 10% FBS(Gibco), 100 U/ml 페니실린, 100 μg/ml 스트렙토마이신(Invitrogen Life Tech)이 첨가된 DMEM 배지(Hyclone)에서 배양하였다. 또한, 1% FBS, 100 U/ml 페니실린, 100 μg/ml 스트렙토마이신 및 20 uM all-trans-RA(Sigma)가 첨가된 DMEM 배지(Hyclone)에서 분화하였다.
<1-2> 신경줄기세포 분리 및 배양
ALS 진단 및 치료에 이용할 수 있는 표적 miRNA를 알아보기 위하여, 신경줄기세포(Neural stem cell, NSC)를 하기와 같이 분리 및 배양하였다.
구체적으로, 동물 실험은 실험 동물 보호 및 사용을 위한 서울 대학교의 IACUC(Institutional Animal Care and Use Committee) 지침에 따라 수행되었다. 9 주된 마우스의 뇌실 영역(subventricular zone)의 뇌 조직을 적출한 후, HBSS를 함유하는 플레이트에서 파쇄하고, 트립신 처리 후 37℃에서 15 분간 세포를 배양하였다. 그 후, 원심분리 및 1% PSA(페니실린-스트렙토마이신-암포테리신, Invitrogen), 2% B27 보충제(Gibco BRL), 10 ng/mL EGF(Invitrogen) 및 10 ng/mL bEGF(Invitrogen)를 포함하는 DMEM/F12(Invitrogen) 배지로 재현탁한 다음, 6-웰 플레이트에 세포를 씨딩하여 NSC를 배양하였다. 세포분화를 유도하기 위하여, 세포가 직경이 약 50-100 μm 크기의 신경구(neurosphere)를 형성할 때, 재현탁하고 멸균된 15-ml 튜브로 옮겼다. 실온에서 5 분간 100 x g로 원심 분리하여 신경구가 포함된 펠렛(pellet)을 획득하고, 상기 펠렛을 분화배양배지(DMEM/F12, 1 % PSA, 2 % B27 및 5 % FBS)로 재현탁하여 배양하였다.
<1-3> Dystrophin 발현 억제 근아세포의 배양
유전자 돌연변이에 의한 근육 질환으로 Duchenne 근이영양증(Duchenn muscular dystrophy; DMD)은 Dystrophin 유전자 변이에 의한 Dystrophin 결핍에 의해 발병하는 것으로 잘 알려져 있다. 이에, 근이영양증 진단 및 치료에 이용할 수 있는 표적 miRNA를 알아보기 위하여, Dystrophin 발현 억제 근아세포를 하기와 같이 제작 및 배양하였다.
구체적으로, 마우스 근아세포(C2C12 cell line)을 항생제가 첨가된 DMEM 배지(10% FBS 첨가)에 배양하였다. 배양한 C2C12 세포에 COSMO GENETECH에 의뢰하여 제작한 마우스용 siDystrophin(5'-GGCCUUACAGGGCAAAAACTT-3', 서열번호 4)을 RNAiMax transfection reagent (Invitrogen)를 이용하여 제조사의 절차에 따라 형질도입하여 Dystrophin 발현 억제 C2C12 세포를 제작 및 배양하였다.
<실시예 2> SOD1 돌연변이 운동신경세포에서 비정상적인 유전자 발현 확인
유전자 돌연변이는 RNA 생합성과 관련이 있으므로, RNA 생합성에 관여하는 miRNA를 유전자 돌연변이에 의한 근육 질환으로서 ALS 진단 및 치료를 위한 표적 인자로 이용할 수 있다. 이에 SOD1 돌연변이에 의한 RNA 생합성 변화를 알아보기 위하여, mtNSC-34 세포를 핵 및 세포질로 분획화하고, 핵 분획 및 세포질 분획을 이용하여 전사체(transcriptome) 분석을 수행한 후, mtNSC-34 세포의 핵과 세포질 간 발현 차이가 있는 유전자의 발현을 RT-PCR 및 qRT-PCR을 수행하여 확인하였다.
구체적으로, 상기 실시예 <1-1>에서 획득한 mtNSC-34 세포 및 wtNSC-34 세포 각각을 3 세트로 10 cm 디쉬에서 배양한 후, 450 ㎕의 차가운 버퍼A(10 mM HEPES(pH 7.9), 10 mM KCl, 1 mM DTT 및 0.1 mM EDTA(pH 8.0))를 이용하여 회수하였다. mtNSC-34 세포 및 wtNSC-34 세포 각각을 재현탁하고, 얼음 위에서 25 분 동안 반응하였다. 그 다음 5 ㎕의 10% NP-40을 첨가하고 얼음 위에서 2 분 동안 반응한 후, 4℃에서 3 분간 5000 rpm으로 원심분리하였다. 펠렛을 분리하여 핵 분획을 획득하였고, 상등액을 분리하여 세포질 분획을 획득하였다. Macrogen Inc.에 의뢰하여 상기 총 12 샘플의 전사체(transcriptome)를 이용하여 RNA-seq 분석을 수행하였다(도 1A).
또한, mtNSC-34 세포 및 wtNSC-34 세포 간 발현 차이가 있는 4종의 유전자, Hif1α(hypoxia inducible factor 1 alpha), Mef2c(myocyte specific enhancer factor 2c), Mctp1(multiple C2 domains transmembrane protein 1) 및 Rarb(retinoic acid receptor beta) mRNA 발현을 RT-PCR 및 정량적 RT-PCR(qRT-PCR)로 확인하였다. 구체적으로, 핵과 세포질 간 발현 차이가 있는 2 종의 유전자, Mctp1 및 Rarb mRNA 발현 변화를 확인하기 위하여, 상기와 동일한 방법으로 mtNSC-34 세포 및 wtNSC-34 세포 각각에서 핵 분획 및 세포질 분획을 획득한 후, TRIzol 시약(MRC)을 이용하여 총 RNA를 추출하고 하기 표 2의 프라이머를 이용하여 RT-PCR을 수행하였다(도 1B). 또한, mtNSC-34 세포에서 Hif1α, Mef2c, Mctp1 및 Rarb mRNA 발현 변화를 확인하기 위하여, mtNSC-34 세포 및 wtNSC-34 세포 각각을 TRIzol 시약(MRC)을 이용하여 총 RNA를 추출하고, 50 ng RNA를 주형으로 하고 하기 표 3의 프라이머 및 SYBR Green Real-time PCR Master Mix (Toyobo)를 이용하여 제조사의 절차에 따라 qRT-PCR을 수행하였다. 마우스 GAPDH를 대조군으로 사용하였다(도 1C 및 도 1D).
유전자 마우스용 프라이머(5'→3')
Mctp1 intron 정방향 GACTCCAACATACCCATTTCTG(서열번호 5)
역방항 TAATATCTCTTCCCGCTCCTTC(서열번호 6)
Mctp1 exon 정방향 TCATCCTTACGCCTAAGGAAG(서열번호 7)
역방향 CCGGAACTTCACATATGGATC(서열번호 8)
Rarb intron 정방향 CACCTGAAGGTGAATGTTGG(서열번호 9)
역방향 CACTTGAACTTGGGGTCAAG(서열번호 10)
Rarb exon 정방향 GATCTACACTTGCCATCGAGA(서열번호11)
역방향 CTTTCCGGATCTTCTCAGTGA(서열번호 12)
GAPDHintron 정방향 TGGTGCAACAGTATTCCACT(서열번호 13)
역방향 CTGGAACATGTAGACCATGTAG(서열번호 14)
GAPDHexon 정방향 CATGTTTGTGATGGGTGTGA(서열번호 15)
역방향 GATGCAGGGATGATGTTCTG(서열번호 16)
유전자 마우스용 프라이머(5'→3')
Hif1α 정방향 GTTCACCAAAGTTGAATCAGAGG(서열번호 17)
역방항 CGATGAAGGTAAAGGAGACATTG(서열번호 18)
Mef2c 정방향 AGGATAATGGATGAGCGTAACAG(서열번호 19)
역방항 AGCAACACCTTATCCATGTCAGT(서열번호 20)
Mctp1 정방향 CGTTGTGTCATAGTGCTTGTAAA(서열번호 21)
역방항 ATCATGTAGAGCTCAAAGTTCCA(서열번호 22)
Rarb 정방향 TTTCTCTGATGGCCTTACACTAA(서열번호 23)
역방향 AGATTAAACAGATGGCACTGAGA(서열번호 24)
GAPDH 정방향 ATAGCTGATGGCTGCAGGTT(서열번호 25)
역방향 AATCTCCACTTTGCCACTGC(서열번호 26)
그 결과, 도 1에 나타낸 바와 같이, Hif1α 및 Hif1α에 의해 조절되는 Mef2c가 mtNSC-34 세포의 핵 및 세포질에서 증가함을 확인하였다(도 1A). 또한, mtNSC-34 세포에서 칼슘 신호전달과 관련된 것으로 알려진 Mctp1 및 세포 분화와 관련된 Rarb 수준이 변화하고, 특히 Mctp1 및 Rarb mRNA가 핵에서 상향 조절되었지만 세포질에서는 현저히 하향 조절됨을 확인하였다(도 1A 및 도 1B). 또한, mtNSC-34 세포에서 Hif1α와 Mef2c mRNA 발현 수준이 증가하고, Mctp1과 Rarb mRNA 발현 수준이 감소함을 확인하였다(도 1C 및 도 1D).
상기 결과를 통해 SOD1 돌연변이에 의해 Hif1α 및 Mef2c가 상향 조절되고, Mctp1과 Rarb가 하향 조절되며, 특히 Mctp1 및 Rarb는 세포질에서 전사후 조절됨을 확인하였다.
< 실시예 3> SOD1 돌연변이 운동신경세포에서 SOD1 돌연변이가 세포에 미치는 영향 확인
SOD1 돌연변이가 세포에 미치는 영향을 알아보기 위하여, mtNSC-34 세포에서 세포 내 칼슘 신호전달, 세포 분화 및 세포 사멸 변화를 확인하였다.
Mctp1이 칼슘 신호전달과 관련된 것으로 알려져 있는 바, SOD1 돌연변이에 의한 Mctp1 발현 변화가 세포 내 칼슘 신호전달에 미치는 영향을 알아보기 위해 세포 내 Ca2 + 분석을 수행하였다. 구체적으로, 상기 실시예 <1-1>에서 획득한 mtNSC-34 세포 및 wtNSC-34 세포 각각을 4×104 내지 8×104 세포/웰로 96-웰 플레이트에 처리하고 성장 배지로 하루 동안 배양하였다. 48 시간 후 FLUOFORTE Dye-Loading Solution을 각 웰에 처리하고, 37℃에서 45 분간, 실온에서 15 분간 배양하였다. 그 다음, 형광 측정기를 이용하여 490/525 nm에서 형광을 측정하였다(도 2A, 오른쪽, 위).
또한, Rarb가 세포 분화와 관련된 것으로 알려져 있는 바, SOD1 돌연변이에 의한 Rarb 발현 변화가 SOD1 돌연변이가 세포 분화에 미치는 영향을 알아보기 위해 축삭생성 분석을 수행하였다. 구체적으로, 상기 실시예 <1-1>에서 획득한 mtNSC-34 세포 및 wtNSC-34 세포 각각을 4×104 내지 8×104 세포/웰로 96-웰 플레이트에 처리하고 성장 배지로 하루 동안 배양하였다. 그 다음, 면역형광염색법과 공초점 현미경을 사용하여 시각화한 후 축삭생성을 확인하였다(도 2A, 오른쪽, 아래).
아울러, SOD1 돌연변이가 세포 사멸에 미치는 영향을 알아보기 위해 웨스턴 블럿팅 및 qRT-PCR을 수행하여 세포 사멸 관련 인자의 발현을 확인하고, LDH(Lactate dehydrogenase) 방출 변화를 확인하였다. 구체적으로, 웨스턴 블럿팅을 수행하기 위해 상기 실시예 <1-1>에서 획득한 mtNSC-34 세포, wtNSC-34 세포 및 NSC-34 cont 세포를 얼음에서 30 분 동안 용해버퍼(pH 7.4의 10mM Tris, pH 8.0의 1mM EDTA, 500 mM NaCl 및 0.5 % TritonX-100)를 처리하여 용해하고, 상기 세포의 단백질 용해물을 SDS-PAGE로 전기영동한 후, 니트로셀룰로오스 막(nitrocellulose membranes)(PALL Life Sciences)으로 전달시켰다. 그 다음, 일차 항체로 마우스 항-Hif1α 항체(NOVUS), 토끼 항-Mef2c 항체(LSBio), 마우스 항-Mctp1 항체(abcam), 토끼 항-Rarb 항체(LSBio), 토끼 항-Bax 항체(Cell signaling), 토끼 항-Bcl2 항체(abcam), 및 마우스 항-β-actin (Millipore), 토끼 항-SOD1 (Enzo) 항체를 처리하여 반응시킨 후, 상기 막에 붙은 일차 항체에 HRP-접합 이차 항체를 붙이고, 이를 ECL(Pierce chemical co, USA)을 이용하여 확인하였다(도 2B). 또한, 상기 <실시예 2>에 기재된 방법과 동일한 방법으로 mtNSC-34 세포, wtNSC-34 세포 및 NSC-34 cont 세포 각각에서 RNA를 추출하고, 하기 표 4의 프라이머를 이용하여 qRT-PCR을 수행하였다(도 2C).
유전자 마우스용 프라이머(5'→3')
Bax 정방향 AAGCTGAGCGAGTGTCTCCG(서열번호 27)
역방향 GGAGGAAGTCCAGTGTCCAG(서열번호 28)
Bcl2 정방향 AACCCAATGCCCGCTGTGCA(서열번호 29)
역방향 ACCGAACTCAAAGAAGGCCACAA(서열번호 30)
또한, LDH(Lactate dehydrogenase) 방출 변화를 확인하기 위하여, 상기 실시예 <1-1>에서 획득한 mtNSC-34 세포 및 wtNSC-34 세포의 세포 배양 배지를 회수 및 원심분리하여 상등액을 획득한 후 96-웰 플레이트에 옮겼다. 동량의 LDH 분석 기질 (SIGMA), 효소 및 염료 용액을 혼합하였다. 상기 혼합물의 절반 부피를 1 부피의 배지 상등액에 첨가하였다. 실온에서 30 분 동안 반응한 후, 각 웰에 1/10 부피의 1N HCl을 첨가하여 반응을 종결하였다. 그 다음, 분광 광도계를 이용하여 파장 490nm/690nm에서 흡광도를 측정하였다(도 2D).그 결과, 도 2에 나타낸 바와 같이, mtNSC-34 세포에서 세포 내 Ca2 + 수준이 증가하고, 총 신경돌기 성장은 SOD1 (G93A) 단백질의 응집과 함께 유의하게 감소함을 확인하였다(도 2A). 또한, mtNSC-34 세포에서 Hif1α및 Mef2c의 단백질 수준이 유의하게 상승하고, Mctp1 및 Rarb의 단백질 수준이 유의하게 감소함을 확인하였다(도 2B). 아울러, mtNSC-34 세포에서 Bax의 단백질 및 mRNA 수준이 증가하고, Bcl2의 단백질 및 mRNA 수준이 감소하며(도 2B 및 도 2C), LDH 방출이 증가하여(도 2D), 세포 사멸이 유도됨을 확인하였다.
상기 결과를 통해 SOD1 돌연변이에 의해 세포 사멸이 유도되고, Mctp1과 Rarb 수준의 하향 조절 되어 각각 칼슘 신호전달과 세포 분화의 변화를 유발함을 확인하였다.
<실시예 4> Hif1α, Mef2c, Mctp1 및 Rarb를 조절하는 표적 miRNA 확인
miRNA는 가장 대표적인 전사후 조절자(post-transcriptional regulator) 중 하나로 잘 알려져 있다. 이에 mtNSC-34 세포에서 Hif1α및 Mef2c가 상향 조절되고, Mctp1과 Rarb가 하향 조절됨을 확인하였는바, Mef2c의 상위 조절자인 Hif1α를 조절할 수 있는 miRNA 및 Mctp1과 Rarb를 조절할 수 있는 miRNA를 알아보기 위하여, TargetScan 분석을 수행하였다.
구체적으로, Hif1α와 공통염기서열을 갖는 miRNA, Mctp1 및 Rarb와 공통염기서열을 갖는 miRNA를 TargetScan(http://www.targetscan.org)을 이용하여 분석하였다(도 3A 및 도 3B).
또한, mtNSC-34 세포 및 wtNSC-34 세포에서 TargetScan으로 확인한 표적 miRNA의 발현 변화를 확인하기 위하여, 상기 <실시예 2>에 기재된 방법과 동일한 방법으로 mtNSC-34 세포, wtNSC-34 세포 및 NSC-34 cont 세포 각각에서 RNA를 추출하고, mmu-miR-18b 및 mmu-miR-206에 대한 프라이머(GenoSensor) 각각을 이용하여 qRT-PCR을 수행하였다(도 3C 및 도 3D).
그 결과, 도 3에 나타낸 바와 같이, miR-206이 Mctp1 및 Rarb의 전사후 조절자가 될 수 있음을 확인하였고(도 3A), miR-206이 mtNSC-34 세포에서 현저하게 상향 조절됨을 확인하였다(도 3C). 또한, miR-18b가 Hif1α를 표적 할 수 있음을 확인하였고(도 3B), mtNSC-34 세포에서 miR-18b가 현저하게 감소되었음을 확인하였다(도 3D).
Mef2c는 miR-206의 전사조절인자로 작용함이 알려져 있는바, 상기 결과를 통해 SOD1 돌연변이에 의해 miR-18b 발현이 감소하는 miR-18b 조절 장애가 유발되고, miR-18b 조절 장애에 의해 Hif1α, Mef2c, miR-206, Mctp1 및 Rarb 발현을 순차적으로 조절될 수 있음을 확인하였다.
<실시예 5> miR-18b에 의한 Hif1α 조절 및 세포사멸 변화 확인
<5-1> miR-18b 발현 억제에 의한 Hif1α 상향 조절 및 세포사멸 유도 확인
SOD1 돌연변이에 의한 miR-18b 조절 장애가 하위 기전 조절 및 세포사멸과 관련이 있는지 알아 보기 위하여, LNA(locked nucleic acid inhibitor) 방법을 사용하여 wtNSC-34 세포에서 miR-18b를 감소시킨 후, 웨스턴 블럿팅 및 qRT-PCR을 수행하여 관련 인자의 발현을 확인하고, 세포 사멸 변화를 확인하였다.
구체적으로, 상기 실시예 <1-1>에서 획득한 NSC-34 cont 세포에 miR-18b의 LNA(anti-18b, COSMOGENTECH)을 RNAiMax transfection reagent (Invitrogen)를 이용하여 제조사의 절차에 따라 형질감염하고, 48 시간 후 회수하였다. 그 다음, 상기 <실시예 2> 내지 <실시예 4>에 기재된 방법과 동일한 방법으로 웨스턴 블럿팅(도 4A), qRT-PCR(도 4B 내지 도 4G, 도 4I 및 도 4J), LDH 방출 분석(도 4H)을 수행하였다. 대조군으로 NSC-34 cont 세포를 사용하였다.
또한, 세포사멸 변화를 확인하기 위하여 추가로 Annexin V-FITC 및 PI 분석을 수행하였다. 구체적으로, 상기 실시예 <1-2>에서 배양한 NSC를 6-웰 조직 배양 플레이트에 씨딩하고, miR-18b의 LNA(anti-18b)를 처리하고 48시간 후 부착된 세포를 TripleExpress로 분리하고 배양 배지를 첨가하여 트립신을 비활성화하였다. 그 다음, 1,500 x g에서 5 분간 원심 분리하고 상등액을 제거하였다. 세포를 Annexin-V-FITC 및 PI Apoptosis Detection Kit(BD Bisosciences)를 이용하여 제조자의 절차에 따라 Annexin V-FITC 및 PI로 염색하였다. 염색 후 FACSCalibur(BD Biosciences)를 사용하여 분석하였다. 형광은 녹색 또는 적색 채널을 사용하였고, 데이터는 Flowwing Software(Version 2.5.1, Unversity of Turku, Filand)를 사용하여 분석하였다(도 4K).
그 결과, 도 4에 나타낸 바와 같이, miR-18b의 LNA(anti-18b)는 Hif1α 및 Mef2c의 단백질 및 mRNA 발현을 증가시키고, Mctp1 및 Rarb의 단백질 및 mRNA 발현을 감소시킴을 확인하였다(도 4A 내지 도 4E). 또한, miR-206이 miR-18b 결핍 하에서 신속하게 유도됨을 확인하였다(도 4I 및 도 4J). 아울러, miR-18b 결핍 하에 세포사멸이 증가함을 확인하였다(도 4A, 도 4F 내지 도 4H, 도 4K).
상기 결과를 통해 SOD1 돌연변이에 의한 miR-18b 조절 장애로 Hif1α가 상향 조절되고, 이후 하위 기전에 의해 세포사멸이 유도됨을 확인하였고, 따라서 miR-18b를 ALS 진단을 위한 표적 miRNA로 이용할 수 있음을 확인하였다.
<5-2> miR-18b 과발현에 의한 Hif1α 하향 조절 및 세포사멸 억제 확인
miR-18b의 과발현이 SOD-1 돌연변이에 의해 유발된 Hif1α 상향 조절 및 세포사멸을 억제할 수 있는지 알아보기 위해, mtNSC-34 세포에 miR-18b를 과발현시킨 후, 웨스턴 블럿팅 및 qRT-PCR을 수행하여 관련 인자의 발현을 확인하였다. 또한, 세포 내 칼슘 신호전달, 세포 분화 및 세포 사멸 변화를 확인하였다.
구체적으로, 상기 실시예 <1-1>에서 획득한 NSC-34 cont 세포로부터 cDNA를 획득하고, 상기 cDNA를 주형으로 하여 하기 표 5의 프라이머를 이용해 PCR을 수행하여 miR-18b를 증폭하였다. 증폭한 miR-18b PCR 산물은 BamH I 및 Xho I (NEW ENGLAND BioLabs) 제한효소 부위를 갖는 pCDNA3 벡터(Invitrogen)로 클로닝하여, miR-18b 플라스미드 컨스트럭트를 제조하였다.
유전자 마우스용 프라이머(5'→3')
miR-18b 정방향 CGCGGATCCACCATGGTGATTTAATCAGA(서열번호 31)
역방향 CCGCTCGAGCCGTTCAAATCATTTCTCAA(서열번호 32)
miR-18b를 과발현하는 mtNSC-34 세포를 제조하기 위하여, mtNSC-34 세포에 상기 miR-18b 플라스미드 컨스트럭트를 Lipofectamine 2000 (Invitorgen)을 이용하여 제조사의 절차에 따라 형질감염하고, 48 시간 후 회수하였다. 그 다음, 상기 <실시예 2> 내지 <실시예 4>에 기재된 방법과 동일한 방법으로 웨스턴 블럿팅(도 5A), qRT-PCR(도 5B 내지 도 5F), 세포 내 Ca2 + 분석(도 5H, 오른쪽, 위), 축삭생성 분석(도 5H, 오른쪽, 아래), LDH 방출 분석(도 5G)을 수행하였다. 대조군으로 mtNSC-34 세포를 사용하였다.그 결과, 도 5에 나타낸 바와 같이, mtNSC-34 세포에서 miR-18b 과발현에 의해 Hif1α와 Mef2c 발현이 감소하는 반면, Mctp1과 Rarb 발현이 증가함을 확인하였다(도 5A 내지 도 5C). 또한, miR-206은 과발현된 miR-18b에 의해 하향 조절됨을 확인하였다(도 5E 및 도 5F). 또한, 과발현된 miR-18b는 mtNSC-34 세포에서 세포사멸을 억제함을 확인하였다(도 5A, 도 5D, 도 5G). 한편, mtNSC-34 세포에서 SOD1 응집이 나타남에도 불구하고, 과발현된 miR-18b에 의해 세포 내 Ca2+ 수준이 감소하고, 신경세포 분화가 활성화됨을 확인하였다(도 5H).
상기 결과를 통해 miR-18b의 과발현을 통해 SOD-1 돌연변이에 의해 유발된 세포사멸이 억제됨을 확인하였고, 따라서 miR-18b를 ALS 예방 및 치료에 이용할 수 있음을 확인하였다.
<실시예 6> Hif1α에 의한 Mef2c 조절 및 세포사멸 변화 확인
miR-18b가 Hif1α의 표적 miRNA로 작용하고, miR-18b 조절 장애에 의해 Hif1α 발현이 상향 조절됨을 확인하였는바, miR-18b 경로에서 Hif1α가 상향 조절된 다음의 기전을 알아보기 위하여, RNAi를 이용하여 mtNSC-34 세포에서 Hif1α 발현을 감소시킨 후, 웨스턴 블럿팅 및 qRT-PCR을 수행하여 관련 인자의 발현 및 세포 사멸 변화를 확인하였다.
구체적으로, 상기 실시예 <1-1>에서 획득한 mtNSC-34 세포에 COSMO GENETECH에 의뢰하여 제작한 마우스용 siHif1α(5'-AAGCAUUUCUCUCAUUUCCUCAUGG-3', 서열번호 33)을 RNAiMax transfection reagent(Invitrogen)를 이용하여 제조사의 절차에 따라 형질감염하고, 48 시간 후 회수하였다. 그 다음, 상기 <실시예 2> 내지 <실시예 4>에 기재된 방법과 동일한 방법으로 웨스턴 블럿팅(도 6A), qRT-PCR(도 6B 내지 도 6H), LDH 방출 분석(도 6I)을 수행하였다. 대조군으로 mtNSC-34 세포를 사용하였다.
그 결과, 도 6에 나타낸 바와 같이, mtNSC-34 세포에서 Hif1α 결핍 하에 Mef2c 단백질 및 mRNA 수준이 감소하고(도 6A 내지 도 6C), Mctp1과 Rarb 단백질 및 mRNA 수준이 증가함을 확인하였다(도 6A, 도 6D, 도 6E). 또한, Hif1α 결핍에 의한 Mef2c 발현 억제가 miR-206 수준을 감소시킴을 확인하였다(도 6H). 아울러, Hif1α 결핍 상태에서 세포사멸이 억제됨을 확인하였다(도 6F, 도 6G, 도 6I).
상기 결과를 통해 SOD1 돌연변이에 의한 miR-18b 조절 장애가 Hif1α의 상향 조절을 유도하고, 상향 조절된 Hif1α가 Mef2c를 상향 조절하여 세포사멸이 유도됨을 확인하였다.
< 실시예 7> miR -206에 의한 Mctp1과 Rarb의 전사후 조절 및 세포사멸 변화 확인
<7-1> miR -206 과발현에 의한 Mctp1과 Rarb 하향 조절 및 세포사멸 유도 확인
SOD1 돌연변이 조건 하에서 miR-206의 역할을 알아보기 위하여, miR-206이 과발현되는 NSC-34 cont 세포에서 Mctp1과 Rarb의 3'UTR을 사용하여 루시퍼라제 리포터 분석을 수행하였다. 또한, 웨스턴 블럿팅 및 qRT-PCR을 수행하여 관련 인자의 발현을 확인하였다. 아울러, 세포 내 칼슘 신호전달, 세포 분화 및 세포 사멸 변화를 확인하였다.
구체적으로, 상기 실시예 <1-1>에서 획득한 NSC-34 cont 세포로부터 cDNA를 획득하고, 상기 cDNA를 주형으로 하여 하기 표 7의 프라이머를 이용하여 PCR을 수행하여 miR-206을 증폭하였다. miR-206 PCR 산물은 BamH I 및 Xho I(NEW ENGLAND BioLabs) 제한효소 부위를 갖는 pCDNA3 벡터(Invitrogen)로 클로닝하여, miR-206 플라스미드 컨스트럭트를 제조하였다. 또한, 하기 표 6의 프라이머를 이용하여 PCR을 수행하여 Mctp1과 Rarb의 3'UTR 각각을 증폭하였다. 증폭한 Mctp1 3'UTR, Rarb 3'UTR PCR 산물 각각은 Xho I 및 Xba I(NEW ENGLAND BioLabs) 제한효소 부위를 갖는 pmirGLO 이중-루시퍼라제 벡터(Promega)로 클로닝하여, Mctp1 3'UTR 플라스미드 컨스트럭트 및 Rarb 3'UTR 플라스미 컨스트럭트를 제조하였다.
유전자 마우스용 프라이머(5'→3')
miR-206 정방향 CGCGGATCCATTCTTCACACTTCTCACTT(서열번호 34)
역방향 CCGCTCGAG ACGAAGAAGTCAACAGCATA(서열번호 35)
Mctp1 3'UTR 정방향 CCGCTCGAGAAAGCTTGAATAATAGAAAT(서열번호 36)
역방향 CTAGTCTAGAATACATGGGTTTTTTGTTTG(서열번호 37)
Rarb 3'UTR 정방향 CCGCTCGAGAACGTGTAATTACCTTGAAA(서열번호 38)
역방향 CTAGTCTAGACAAAGTCTTCAGAAACTTAA(서열번호 39)
그 다음, 상기 miR-206 플라스미드 컨스트럭트, Mctp1 3'UTR 플라스미드 컨스트럭트 및 Rarb 3'UTR 플라스미드 컨스트럭트를 NSC-34 cont 세포에 Lipofectamine 2000 (Invitorgen)을 이용하여 제조사의 절차에 따라 형질감염하고, 48 시간 후 회수하여 루시퍼라제 활성을 측정하였다(도 7A 및 도 7C). 또한, 상기 <실시예 2> 내지 <실시예 4>에 기재된 방법과 동일한 방법으로 웨스턴 블럿팅(도 7E), qRT-PCR(도 7B, 도 7D, 도 7F, 도 8C), 세포 내 Ca2 + 분석(도 8A, 오른쪽, 위), 축삭생성 분석(도 8A, 오른쪽, 아래), LDH 방출 분석(도 8D)을 수행하였다. 대조군으로 NSC-34 cont 세포를 사용하였다.또한, 상기 miR-206 플라스미드 컨스트럭트를 상기 실시예 <1-2>에서 배양한 NSC에 형질감염하고, 상기 실시예 <5-1>에 기재된 방법과 동일한 방법으로 Annexin-V-FITC 및 PI 분석(도 8E)을 수행하였다. 대조군으로 NSC를 사용하였다.
그 결과, 도 7 및 도 8에 나타낸 바와 같이, 과발현된 miR-206에 의해 Mctp1 수준이 감소하고, 세포 내 Ca2 + 수준이 증가하는 것을 확인하였다. 또한, 과발현된 miR-206에 의해 Rarb 수준이 감소하고, 신경세포 분화가 억제됨을 확인하였다(도 7A 내지 도 7E, 도 8A). 아울러, miR-206의 과발현에 의해 세포사멸이 유도됨을 확인하였다(도 8B 내지 도 8E).
<7-2> miR -206 발현 억제에 의한 Mctp1과 Rarb 상향 조절 및 세포사멸 억제 확인
SOD1 돌연변이 조건 하에서 miR-206의 역할을 알아보기 위하여, LNA 방법을 사용하여 mtNSC-34 세포에서 miR-206 발현을 감소시킨 후, 웨스턴 블럿팅 및 qRT-PCR을 수행하여 관련 인자의 발현을 확인하고, 세포 사멸 변화를 확인하였다.
구체적으로, 상기 실시예 <1-1>에서 획득한 mtNSC-34 세포에 miR-206의 LNA(anti-206, COSMOGENTECH)을 RNAiMax transfection reagent(Invitrogen)를 이용하여 제조사의 절차에 따라 형질감염하고, 48 시간 후 회수하였다. 그 다음, 상기 <실시예 2> 내지 <실시예 4>에 기재된 방법과 동일한 방법으로 웨스턴 블럿팅(도 9A), qRT-PCR(도 9B 내지 도 9E, 도 9G), LDH 방출 분석(도 9F)을 수행하였다. 대조군으로 mtNSC-34 세포를 사용하였다.
그 결과, 도 9에 나타낸 바와 같이, mtNSC-34 세포에서 miR-206 발현 억제에 의해 Mctp1과 Rarb의 단백질 및 mRNA의 양이 유의하게 증가하는 것을 확인하였다(도 9A 내지 도 9C). 또한, miR-206 발현 억제에 의해 세포사멸이 억제됨을 확인하였다(도 9D 내지 도 9F).
상기 결과를 통해 SOD1 돌연변이에 의한 miR-18b 조절 장애가 Hif1α의 상향 조절을 유도하고, 상향 조절된 Hif1α가 Mef2c를 상향 조절하며, Mef2c가 miR-206의 전자조절이자로 작용하여 miR-206 발현을 유도하고, miR-206이 Mctp1과 Rarb의 전자후조절에 직접 관여하여 세포사멸을 유도함을 확인하였다.
<실시예 8> Mctp1 및 Rarb의 전사후 조절이 세포에 미치는 영향 확인
<8-1> Mctp1 및 Rarb 발현 감소에 의한 세포사멸 유도 확인
상기의 실시예를 통해 miR-18b의 조절 장애에 의해 Hif1α의 발현이 유도되고, Hif1α에 의해 Mef2c 발현이 유도되며, Mef2c에 의해 miR-206 발현이 유도되고, miR-206에 의해 Mctp1 및 Rarb가 전사후 조절됨을 확인하였다. 이에 Mctp1 및 Rarb 결핍이 세포사멸을 직접 유도하는지 알아보기 위하여, RNAi를 이용하여 NSC-34 cont 세포에서 Mctp1 및/또는 Rarb 발현을 감소시킨 후 웨스턴 블럿팅 및 qRT-PCR을 수행하여 관련 인자의 발현을 확인하였다. 또한, 세포 내 칼슘 신호전달, 세포 분화 및 세포 사멸 변화를 확인하였다.
구체적으로, 상기 실시예 <1-1>에서 획득한 NSC-34 cont 세포에 COSMO GENETECH에 의뢰하여 제작한 마우스용 siMctp1(5'-GCCACUAUAUAUCAAGGUATT-3', 서열번호 40) 및/또는 마우스용 siRarb(5'-GGAGCCUUCAAAGCAGGAATT-3', 서열번호 41)를 RNAiMax transfection reagent(Invitrogen)를 이용하여 제조사의 절차에 따라 형질감염하고, 48 시간 후 회수하였다. 그 다음, 상기 <실시예 2> 내지 <실시예 4>에 기재된 방법과 동일한 방법으로 웨스턴 블럿팅(도 10A), qRT-PCR(도 10B, 도 10C, 도 11A, 도 11B), 세포 내 Ca2 + 분석(도 10D, 왼쪽, 위), 축삭생성 분석(도 10D, 왼쪽, 아래) 및 LDH 방출 분석(도 11C)을 수행하였다. 대조군으로 NSC-34 cont 세포를 사용하였다.
또한, 상기 siMctp1 및 siRarb를 상기 실시예 <1-2>에서 배양한 NSC에 형질감염하고, 상기 실시예 <5-1>에 기재된 방법과 동일한 방법으로 Annexin-V-FITC 및 PI 분석(도 11D)을 수행하였다. 대조군으로 NSC를 사용하였다.
그 결과, 도 10 및 도 11에 나타낸 바와 같이, Mctp1 발현이 억제되어 세포 내 Ca2 + 농도가 증가하는 반면, Bax와 Bcl2 발현에는 영향을 미치지 않음을 확인하였다. 또한, Rarb 발현이 억제되어 세포 분화가 억제되는 반면, Bax 및 Bcl2 발현의 유의적 변화는 나타나지 않음을 확인하였다. 한편, Mctp1 및 Rarb 발현이 동시에 억제된 경우, Bax 발현이 증가하고 Bx12의 발현이 감소하며, LDH 방출이 증가하여 세포사멸이 유도됨을 확인하였다(도 10A 내지 도 10D, 도 11A 내지 도 11D).
<8-2> Mctp1 및 Rarb 발현 증가에 의한 세포사멸 억제 확인
Mctp1과 Rarb 발현 유도에 의해 세포사멸이 직접적으로 억제되는지 알아보기 위하여, mtNSC-34 세포에 Mctp1 및/또는 Rarb를 과발현시킨 후, 웨스턴 블럿팅 및 qRT-PCR을 수행하여 관련 인자의 발현을 확인하였다. 또한, 세포 내 칼슘 신호전달, 세포 분화 및 세포 사멸 변화를 확인하였다.
구체적으로, 상기 실시예 <1-1>에서 획득한 NSC-34 cont 세포로부터 cDNA를 획득하고, 상기 cDNA를 주형으로 하여 하기 표 7의 프라이머를 이용하여 PCR을 수행하여 Mctp1 및 Rarb를 증폭하였다. 증폭한 Mctp1 PCR 산물은 Hind III(NEW ENGLAND BioLabs) 제한효소 부위를 갖는 mCherry C1(Clontech)로 클로닝하여, Mctp1 플라스미드 컨스트럭트를 제조하였다. 증폭한 Rarb PCR 산물은 Nhe I 및 Age I(NEW ENGLAND BioLabs) 제한효소 부위를 eGFP N1(Clontech)로 클로닝하여, Rarb 플라스미드 컨스트럭트를 제조하였다.
유전자 마우스용 프라이머(5'→3')
Mctp1 정방향 CCCAAGCTTATGTACCAGTTGGATATCACACTA(서열번호 42)
역방향 CCCAAGCTTGCCAAGGTTGTTTTTTCTTCC(서열번호 43)
Rarb 정방향 CCGCTAGCATGAGCACCAGCAGCCACGC(서열번호 44)
역방향 CCACCGGTCTGCAGCAGTGGTGACTGAC(서열번호 45)
Mctp1 및/또는 Rarb를 과발현하는 mtNSC-34 세포를 제조하기 위하여, mtNSC-34 세포에 상기 Mctp1 플라스미드 컨스트럭트 및/또는 Rarb 플라스미드 컨스트럭트를 Lipofectamine 2000 (Invitorgen)을 이용하여 제조사의 절차에 따라 형질감염하고, 48 시간 후 회수하였다. 그 다음, 상기 <실시예 2> 내지 <실시예 4>에 기재된 방법과 동일한 방법으로 웨스턴 블럿팅(도 12A), qRT-PCR(도 12B, 도 12C, 도 12E, 오른쪽, 도 12F, 오른쪽), 세포 내 Ca2 + 분석(도 12E, 왼쪽), 축삭생성 분석(도 12F, 왼쪽), LDH 방출 분석(도 12D)을 수행하였다. 대조군으로 mtNSC-34 세포를 사용하였다.그 결과, 도 12에 나타낸 바와 같이, Mctp1 및 Rarb를 동시에 과발현된 경우 세포 사멸이 감소함을 확인하였다(도 12A 내지 도 12D). 또한, mtNSC-34 세포에서 Mctp1 발현 증가에 의해 세포 내 Ca2 + 수준이 감소하고, Rarb 발현 증가에 의해 신경세포 분화가 활성화됨을 확인하였다(도 12E 내지 도 12G).
상기 결과를 통해 SOD1 돌연변이에 의한 miR-18b 조절 장애로 Mctp1과 Rarb의 전사후 조절이 유도되어 Mctp1과 Rarb가 감소하고, 이로 인해 칼슘 신호전달과 신경세포 분화가 억제되며, 세포사멸이 유도됨을 확인하였다.
<실시예 9> SOD1 돌연변이에 의한 miR-18b 신호전달 경로의 조절 장애 확인
돌연변이 종류에 상관없이 SOD1 돌연변이가 miR-18b 신호전달 경로 조절 장애에 중추적인 역할을 하는지 알아보기 위하여, NSC-34 cont 세포에서 돌연변이된 SOD1 (G85R) 및 SOD1 (D90A) 각각을 과발현한 후 웨스턴 블럿팅 및 qRT-PCR을 수행하여 관련 인자의 발현 및 세포 사멸 변화를 확인하였다.
구체적으로, 상기 실시예<1-1>에서 배양한 NSC-34 cont 세포에 SOD1(G85R) 돌연변이 유전자 포함 플라스미드 컨스트럭트 및 SOD1(D90A) 돌연변이 유전자 포함 플라스미드 컨스트럭트 각각을 Lipofectamine 2000(Invitorgen)을 이용하여 제조사의 절차에 따라 형질감염하고, 48 시간 후 회수하였다. 그 다음, 상기 <실시예 2> 내지 <실시예 4>에 기재된 방법과 동일한 방법으로 웨스턴 블럿팅(도 13A), qRT-PCR(도 13B 내지 도 13G) 분석을 수행하였다. 대조군으로 NSC-34 cont 세포를 사용하였다.
그 결과, 도 13에 나타낸 바와 같이, 돌연변이된 SOD1이 과발현된 NSC-34 cont 세포에서 Hif1α와 Mef2c의 단백질 및 mRNA 수준이 증가하고, Mctp1과 Rarb의 단백질 및 mRNA 수준이 감소함을 확인하였다(도 13A 내지 도 13C). 또한, 돌연변이된 SOD1이 과발현된 NSC-34 cont 세포에서 miR-18b가 감소하고, 이에 의해 miR-206이 상향 조절됨을 확인하였다(도 13E 내지 도 13G). 아울러, 돌연변이된 SOD1이 과발현된 NSC-34 cont 세포에서 세포사멸이 증가함을 확인하였다(도 13D).
상기 결과를 통해 SOD1 돌연변이 종류에 상관없이 SOD1 돌연변이가 miR-18b 신호전달경로의 조절 장애가 유발하고, miR-18b 조절 장애가 Hif1α의 상향 조절을 유도하며, 상향 조절된 Hif1α가 Mef2c를 상향 조절하고, Mef2c가 miR-206의 전자조절이자로 작용하여 miR-206 발현을 유도하며, miR-206이 Mctp1과 Rarb의 전사후 조절에 직접 관여하여 칼슘 신호전달과 신경세포 분화 억제 및 세포사멸을 유도함을 확인하였다.
<실시예 10> ALS에서 miR-18b 신호전달 경로의 조절 장애 확인
<10-1> ALS 동물 모델 및 가족성 ALS 환자에서 miR -18b 신호전달 경로의 조절 장애확인
ALS에서 유전자 돌연변이에 의해 miR-18b 신호전달 경로의 조절 장애가 유발되는지 알아보기 위하여, ALS 마우스 모델 및 가족성 ALS(fALS) 환자 샘플을 채취하고, 웨스턴 블럿팅 및 qRT-PCR을 수행하여 miR-18b 신호전달 경로 관련 인자의 발현 및 세포 사멸 변화를 확인하였다.
구체적으로, 인간 G93A 돌연변이 SOD1 유전자를 발현하는 SOD1-G93A 형질전환 마우스(B6SJL-Tg(SOD1-G93A)1Gur/J)를 Jsackson Laboratory, Bar Harbor, Me, USA에서 제공받아 사용하였다. 대조군으로 일반 (B6) 정상 마우스(WT)를 사용하였다. 출생 후 120일에 상기 WT 및 SOD1-G93A 형질전환 마우스 각각의 척수(spinal cord) 조직을 적출하여 마우스의 척수 조직 샘플을 획득하였다. 또한, 정상인 및 가족성 ALS(fALS (G86S)) 환자의 척수 샘플 각각을 NBB로부터 제공받았다. 그 다음, 상기 척수 조직 샘플(도 14) 및 척수 샘플(도 15) 각각을 이용하여 상기 <실시예 2> 내지 <실시예 4>에 기재된 방법과 동일한 방법으로 웨스턴 블럿팅(도 14A, 도 15A) 및 qRT-PCR(도 14B, 도 14C, 도 15B, 도 15C)을 수행하였다. 척수 샘플의 경우 하기 표 8의 프라이머를 이용하여 qRT-PCR을 수행하였다. 또한, hsa-miR-18b 및 hsa-miR-206에 대한 프라이머(GenoSensor) 각각을 이용하여 qRT-PCR을 수행하였다.
유전자 인간용 프라이머(5'→3')
Hif1α 정방향 AGATAGCAAGACTTTCCTCAGTC(서열번호 46)
역방항 CTGTGGTGACTTGTCCTTTAGTA(서열번호 47)
Mef2c 정방향 CTACTTTACCAGGACAAGGAATG(서열번호 48)
역방향 CTGAGATAAATGAGTGCTAGTGC(서열번호 49)
Mctp1 정방향 AGGAATAGTCAGCATCACCTTGA(서열번호 50)
역방향 CAATGACTCCTCCTCTTTCTTCA(서열번호 51)
Rarb 정방향 CTTCTCAGTGCCATCTGCTTAAT(서열번호52)
역방향 AATTACACGCTCTGCACCTTTAG(서열번호 53)
Bax 정방향 AAGCTGAGCGAGTGTCTCAA(서열번호 54)
역방향 AGTAGAAAAGGGCGACAACC(서열번호 55)
Bcl2 정방향 ACGCCCCATCCAGCCGCATC(서열번호 56)
역방향 CACACATGACCCCACCGAACTCA(서열번호 57)
GAPDH 정방향 CTGCATTCGCCCTCTTAATG(서열번호 58)
역방향 TGAGGTCAATGAAGGGGTCA(서열번호 59)
SOD1 정방향 GTGGGGAAGCATTAAAGGACTGAC(서열번호 60)
역방향 CAATTACACCACAAGCCAAACGAC(서열번호 61)
그 결과, 도 14 및 도 15에 나타낸 바와 같이, ALS 마우스 모델에서 Hif1α 및 Mef2c의 단백질 및 mRNA 발현은 G93A Tg 마우스에서 유의하게 증가하는 반면, Mctp1 및 Rarb의 단백질 및 mRNA 발현은 유의하게 감소함을 확인하였다. 또한, 증가된 Bax 및 감소된 Bcl2 발현을 통해 G93A Tg 마우스에서 세포사멸이 유도됨을 확인하였다(도 14A 및. 도 14B). 아울러, miR-18b가 G93A Tg 마우스에서 하향 조절되고, miR-206이 상향 조절됨을 확인하였다(도 14C). fALS (G86S) 환자 척수 샘플에서도 상기와 동일한 결과를 확인하였다(도 15A 내지 도 15C).
<10-2> SOD1 ( G17S ) fALS 환자의 hiPSC 유래 운동뉴런(motor neuron)에서 miR-18b 신호전달 경로의 조절 장애 확인
miR-18b 신호 전달 경로가 인간 운동뉴런(motor neuron, MN)에 중추적인 역할을 하는지 알아보기 위하여, 가족성 ALS(fALS (G17S)) 환자 혈액을 채취하고, 혈액으로부터 인간 유도만능줄기세포(human Induced pluripotent stem cell, hiPSC)를 유도하고, 상기 hiPSC로부터 신경줄기세포(human neural stem cells, hNSCs) 분화 후 운동뉴런으로 분화시키고, qRT-PCR을 수행하여 miR-18b 신호전달 경로 관련 인자의 발현을 확인하였다. 또한, 세포 내 칼슘 신호전달, 세포 분화 및 세포 사멸 변화를 확인하였다.
구체적으로, 혈액으로부터 hiPSC를 유도하기 위하여, 정상인 및 fALS SOD1(G17S) 환자의 혈액 샘플 각각을 서울대 병원 신경과(IRB number 1009-059-332)에서 기증받았다. 그 다음, Ficoll-Paque(GE Healthcare Life Sciences)를 사용하여 전혈로부터 말초혈액단핵세포(Peripheral blood mononuclear cell, PBMC)를 분리하고, 1 % 페니실린-스트렙토마이신, hSCF 100 ng/mL, hFLT-3 100 ng/mL, hIL-3 20 ng/mL, 및 hIL-6 20 ng/mL이 포함된 StemPro-34 배지에서 배양 및 증식하였다. 1×106 PBMC를 Oct3/4, Sox2, Klf4 및 cMyc(CytoTune®-iPS Sendai Reprogramming Kit, Life technologies)를 함유한 센다이 바이러스(Sendai virus) (MOI(multiplicity of infection) = 5)를 이용하여 형질도입하였다. 3 일 후, 형질도입된 세포를 사이토카인 불포함 StemPro-34 배지가 포함되고, 디쉬에 1.5×105 세포/디쉬 농도의 20 ug/ml mitomycin C 처리된 HFF(Human Scrotum foreskin fibrin)가 씨딩된 Cell Start-coated 35 mm 디쉬에 처리하고, hiPSC가 전이되기 시작할 때까지 매일 배지를 교체하였다. 그 다음, 15% 녹아웃 SR, 40 ng/ml bFGF, 1 % 비필수 아미노산, 50 U/ml 페니실린, 50 ㎍/㎖ 스트렙토 마이신 및 0.1 mM 2- 머캅토 에탄올이 포함된 DMEM F / 12를 기반으로 하는 iPSC 배지와 1/2 부피의 사이토카인 불포함 StemPro-34 배지로 교체하였다. 전이를 완료하기 위하여, iPSC 배지를 매일 교체하였다. 30 일 또는 그 이후에, 콜로니를 수거하고, 새로운 mitotically inactivated HFFs에 계대배양하여 hiPSC를 증식하였다. 또한, 다능성 마커를 이용해 면역세포화학염색법 및 RT-PCR 분석을 수행하여 정상 hiPSC 및 fALS SOD1(G17S) hiPSC가 유도됨을 확인하였다(도 16A 및 도 16B).
그 다음, 신경줄기세포(Neuron stem cell, NSC)를 생성하기 위하여, 상기 콜로니를 2 mg/ml 디스파제(dispase, Gibco)를 이용하여 분리하고, 60-mm incoated 박테리아 플레이트에 처리하고 5 ~ 7 일 동안 37℃에서 15% 녹아웃 SR(Gibco), 50 U/ml 페니실린, 50 ug/ml 스트렙토마이신이 포함된 Essential 6 배지를 함유하는 EB(embryoid body) 배지로 매일 교체하였다. 그 다음, 형성된 EB를 Cell Start coated 35mm 배양 디쉬로 옮겼다. 2 ~ 3 일 후 EB가 디쉬에 부착되면, 신경 구조가 나타날 때까지, 0.5 % N2 보충제가 포함된 DMEM/F12(1% 비필수 아미노산, 50 U/ml 페니실린, 50 ug/ml 스트렙토마이신 및 0.1 mM 2-머캅토에탄올 포함) 배지에서 1 % N2 보충제와 40 bFGF가 포함된 DMEM/F12(1% 비필수 아미노산, 50 U/ml 페니실린, 50 ug/ml 스트렙토마이신 및 0.1 mM 2-머캅토에탄올 포함) 배지로 하루에 두 번씩 교체하였다. 그 다음, 신경 구조를 분리하고, 부유한 상태에서 배양하여 신경구를 획득하였다. 획득한 신경구를 단편화하고, 1 일 동안 Cell start-coated 배양 디쉬에서 하루 동안 배양하고, 37℃에서 1 시간 동안 Accutase(Gibco)를 처리하였다. NSC를 1 % 비필수 아미노산, 50 U/ml 페니실린, 50 ug/ml 스트렙토마이신 및 0.1 mM 2-머캅토에탄올과 0.5 % N2 보충제 및 40 ng/ml b- 섬유아세포 성장인자가 포함된 DMEM/F12 배지에서 배양하였다. 또한, NSC 마커를 이용해 면역세포화학염색법을 수행하여 정상 NSC 및 fALS SOD1(G17S) NSC가 생성됨을 확인하였다(도 16C).
NSC에서 운동뉴런(MN)으로 분화하기 위하여, NSC를 1 ㎍/ml 라미닌 및 5 ug/ml 헤파린 코팅 플레이트를 포함하는 Cell Start에서 2 일 동안 비필수 아미노산, 페니실린/스트렙토마이신, 2- 머캅토에탄올, N2 및 b-FGF를 첨가 한 DMEM/F12에서 배양 한 다음, 0.1 mM 2- 머 캅토 에탄올, 0.5 % N2 보충제 및 40 ng/ml bFGF가 포함된 DMEM/F12 배지로 배양하고, DMEM/F12 배지 및 신경섬유 배지(0.1 mM 2-머캅토에탄올, 0.5% N2 보충제, 40 ng/ml bFGF, 10 ng/ml 신경성장인자(neural growth factor), 10 ng/ml 소닉헤지호그(sonic hedgehog, R&D Systems), 10 μM 포스콜린(forskolin, Sigma) 및 1 μM 레티노산(retinoic acid, Sigma), 10 ng/ml GDNF(glial cell-derived neurotrophic factor), 10 ng/ml BDNF(brain-derived neurotrophic factor), 10 ng/ml 섬모 향신경성 인자(ciliary neurotrophic factor), 10 ng/ml 인슐린 유사 성장 인자 1(insulin-like growth factor 1) 및 10 ng/ml NT3(neurotrophin-3))의 혼합물을 매일 또는 일주일 동안 매일 투여하였다. 또한, MN 마커를 이용해 면역세포화학염색법을 수행하여 정상 MN 및 fALS SOD1(G17S) MN으로 분화됨을 확인하였다(도 16D).
상기 분화된 정상 MN 및 fALS SOD1(G17S) MN 각각을 이용하여 상기 실시예 <10-1>에 기재된 방법과 동일한 방법으로 qRT-PCR(도 17A 내지 도 17D, 도 17F), 세포 내 Ca2 + 분석(도 17C), 축삭생성 분석(도 17D), LDH 방출 분석(도 17G)을 수행하였다.
그 결과, 도 17에 나타낸 바와 같이, fALS SOD1(G17S) MN에서 Hif1α 및 Mef2c의 mRNA 발현이 유의하게 증가하는 반면, Mctp1과 Rarb의 mRNA 수준은 현저하게 감소함을 확인하였다(도 17A 및 도 17B). 또한, fALS SOD1(G17S) MNs에서 miR-18b와 miR-206 수준을 측정하였고, miR-18b는 유의하게 감소하고 miR-206은 유의적으로 증가함을 확인하였다(도 17D). 또한, fALS SOD1(G17S) MNs에서 Ca2 +가 축적되었고 신경세포 분화가 억제되며, 세포 사멸이 유도됨을 확인하였다(도 17C, 도 17E 내지 도 17G).
상기 결과를 통해 miR-18b 신호 전달 경로가 SOD1 돌연변이 연관 ALS에 관여하고, SOD1 돌연변이 연관 ALS에서 miR-18b 신호 전달 경로의 조절 장애에 의해 세포 사멸을 유도됨을 확인하였다.
< 실시예 11> 듀시엔형 근이영양증( Duchenn muscular dystrophy; DMD )에서 miR-18 조절 장애 확인
<11-1> Dystrophin 발현 억제 근아세포에서 miR-18 조절 장애 확인
또 다른 유전자 돌연변이에 의한 근육 질환으로서 DMD에서 유전자 변이에 의해 miR-18b 조절 장애가 유발되는지 알아보기 위하여, Dystrophin 발현 억제 근아세포에서 miR-18 발현을 qRT-PCR을 수행하였 확인하였다.
구체적으로, 상기 실시예 <1-3>에서 획득한 Dystrophin 발현 억제 C2C12 세포를 회수하여 상기 <실시예 2>에 기재된 방법과 동일한 방법으로 qRT-PCR을 수행하였다(도 18). 대조군으로 siControl을 형질도입한 C2C12 세포를 사용하였다.
그 결과, 도 18에 나타낸 바와 같이, Dystrophin 발현 억제 C2C12 세포에서 miR-18 발현이 감소하는 것을 확인하였다(도 18).
<11-2> DMD 동물 모델에서 miR-18 조절 장애 확인
DMD에서 유전자 변이에 의해 miR-18b 조절 장애가 유발되는지 알아보기 위하여, DMD 동물 모델에서 miR-18 발현을 qRT-PCR을 수행하였 확인하였다.
구체적으로, DMD 동물 모델인 mdx 마우스(생후 2~4주)를 Jackson laboratory로부터 제공받았다. mdx 마우스에서 근육 조직을 적출하고, 상기 <실시예 2>에 기재된 방법과 동일한 방법으로 qRT-PCR을 수행하였다(도 19).
그 결과, 도 19에 나타낸 바와 같이 DMD 마우스에서 miR-18 발현이 감소하는 것을 확인하였다(도 19).
상기 결과를 통해 Dystrophin 돌연변이 연관 DMD에서 miR-18b 신호 전달 경로의 조절 장애에 유발됨을 확인하였고, 따라서 miR-18b를 DMD 진단을 위한 표적 miRNA로 이용할 수 있고, DMD의 예방 및 치료에 이용할 수 있음을 확인하였다.
상기 <실시예 1> 내지 <실시예 11>의 결과를 통해 도 20의 모식도와 같이 유전자 돌연변이가 miR-18b 발현을 감소시켜 miR-18b 신호전달경로의 조절 장애를 유발하고, miR-18b 조절 장애가 Hif1α의 상향 조절을 유도하며, 상향 조절된 Hif1α가 Mef2c를 상향 조절하고, Mef2c가 miR-206 발현을 유도하며, miR-206이 Mctp1과 Rarb의 전사후 조절에 직접 관여하여 칼슘 신호전달과 신경세포 분화 억제 및 세포사멸을 유도함을 확인하였다. 따라서, ALS, DMD와 같이 유전자 돌연변이에 의해 유발되는 근육 질환 진단 및 치료에 있어서 miR-18b를 표적 인자로 이용할 수 있다.
본 발명의 miR-18b는 ALS, DMD와 같이 유전자 돌연변이에 의해 유발되는 근육 질환 진단 및 치료를 위한 표적 인자로 이용될 수 있다.

Claims (14)

  1. miR-18b를 유효성분으로 함유하는, 근육 질환 예방 또는 치료용 약학조성물.
  2. 제 1항에 있어서, 상기 miR-18b는 벡터에 포함되거나 세포에 도입된 형태로 제공되는 것을 특징으로 하는, 근육 질환 예방 또는 치료용 약학조성물.
  3. 제 1항에 있어서, 상기 miR-18b는 성숙 형태의 miR-18b 또는 전구체 형태의 miR-18b인 것을 특징으로 하는, 근육 질환 예방 또는 치료용 약학조성물.
  4. 제 3항에 있어서, 상기 성숙 형태의 miR-18b는 서열번호 1 또는 서열번호 2로 표시되고, 상기 전구체 형태의 miR-18b는 서열번호 3으로 표시되는 것을 특징으로 하는, 근육 질환 예방 또는 치료용 약학조성물.
  5. 제 1항에 있어서, 상기 근육 질환은 유전자 돌연변이에 의해 유발된 근육 질환인 것을 특징으로 하는, 근육 질환 예방 또는 치료용 약학조성물.
  6. 제 1항에 있어서, 상기 근육 질환은 중증근무력증(myasthenia gravis), 진행성 근이영양증(progressive muscular dystrophy), 근긴장성 근이영양증(myotonic muscular dystrophy), 듀시엔형 근이영양증(Duchenne muscular dystrophy), 베커형 근이영양증(Backer muscular dystrophy), 지대형 근이영양증(Limb Girdle muscular dystrophy), 안면견갑상완형 근이영양증(facioscapulohumeral muscular dystrophy), 척수성 근위축(spinal muscular amyotrophy), 근위축증(muscular atrophy), 근위축성 축삭 경화증(amyotrophic lateral sclerosis), 척수구근 근위축(spinobulbar muscular atrophy), 샤르코 마리 투스 질환(Charcot Marie Tooth disease, CMT), 폼페병(Pompe disease), 카나반병(Canavan disease), 근육긴장이상(dystonia), 근육감소증(sacopenia) 및 근육퇴화증으로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 근육 질환 예방 또는 치료용 약학조성물.
  7. 피검체로부터 분리된 시료에서 miR-18b의 발현 수준을 측정하고 정상 대조군과 비교하는 단계를 포함하는, 근육 질환의 진단 정보를 제공하는 방법.
  8. 제 7항에 있어서, 상기 시료는 조직, 세포, 혈장, 혈청, 혈액, 타액 및 소변으로 구성된 군으로부터 선택되는 어느 하나인 것을 특징으로 하는, 근육 질환의 진단 정보를 제공하는 방법.
  9. 제 7항에 있어서, 상기 발현 수준은 RT-PCR(Reverse transcription polymerase chain reaction), 정량적 RT-PCR, 실시간 RT-PCR, 노던 블럿팅(Northern blotting), 전사체(transcriptome) 분석으로 구성된 군으로부터 선택되는 어느 하나 이상의 방법으로 측정하는 것을 특징으로 하는, 근육 질환의 진단 정보를 제공하는 방법.
  10. 제 7항에 있어서, 상기 시료에서 Hif1α(hypoxia inducible factor 1 alpha), Mef2c(myocyte specific enhancer factor 2c), Mctp1(multiple C2 domains transmembrane protein 1) Rarb(retinoic acid receptor beta) 및 miR-206으로 구성된 군으로부터 선택되는 어느 하나 이상의 발현 수준을 측정하고 정상 대조군과 비교하는 단계를 추가적으로 포함하는, 근육 질환의 진단 정보를 제공하는 방법.
  11. 제 7항에 있어서, 상기 근육 질환은 유전자 돌연변이에 의해 유발된 근육 질환인 것을 특징으로 하는, 근육 질환의 진단 정보를 제공하는 방법.
  12. 제 7항에 있어서, 상기 근육 질환은 중증근무력증(myasthenia gravis), 진행성 근이영양증(progressive muscular dystrophy), 근긴장성 근이영양증(myotonic muscular dystrophy), 듀시엔형 근이영양증(Duchenne muscular dystrophy), 베커형 근이영양증(Backer muscular dystrophy), 지대형 근이영양증(Limb Girdle muscular dystrophy), 안면견갑상완형 근이영양증(facioscapulohumeral muscular dystrophy), 척수성 근위축(spinal muscular amyotrophy), 근위축증(muscular atrophy), 근위축성 축삭 경화증(amyotrophic lateral sclerosis), 척수구근 근위축(spinobulbar muscular atrophy), 샤르코 마리 투스 질환(Charcot Marie Tooth disease, CMT), 폼페병(Pompe disease), 카나반병(Canavan disease), 근육긴장이상(dystonia), 근육감소증(sacopenia) 및 근육퇴화증으로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 근육 질환의 진단 정보를 제공하는 방법.
  13. 약학적으로 유효한 양의 miR-18b를 개체에 투여하는 단계를 포함하는 근육 질환 예방 또는 치료방법.
  14. 근육 질환 예방 또는 치료용 약학적 조성물로 사용하기 위한 miR-18b의 용도.
PCT/KR2018/009461 2017-08-18 2018-08-17 근육 질환 및 신경근육 질환 예방, 치료 또는 진단을 위한 miR-18b의 용도 WO2019035690A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CN201880053697.5A CN111032058A (zh) 2017-08-18 2018-08-17 用于预防、治疗或诊断肌肉疾病及神经肌肉疾病的miR-18b的用途
JP2020531407A JP6928179B2 (ja) 2017-08-18 2018-08-17 筋肉疾患および神経筋肉疾患の予防、治療または診断のためのｍｉＲ−１８ｂの用途
EP18846646.0A EP3669880A4 (en) 2017-08-18 2018-08-17 USE OF miR-18b IN THE PREVENTION, TREATMENT, OR DIAGNOSIS OF MUSCLE AND NEUROMUSCULAR DISEASE
US16/791,185 US11286484B2 (en) 2017-08-18 2020-02-14 Use of miR-18b for prevention, treatment, or diagnosis of muscle disease and neuromuscular disease
US17/554,285 US11891604B2 (en) 2017-08-18 2021-12-17 Use of miR-18b for prevention, treatment, or diagnosis of muscle disease and neuromuscular disease

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20170105029 2017-08-18
KR10-2017-0105029 2017-08-18
KR1020180092805A KR102177130B1 (ko) 2017-08-18 2018-08-09 근육 질환 및 신경근육 질환 예방, 치료 또는 진단을 위한 miR-18b의 용도
KR10-2018-0092805 2018-08-09

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/791,185 Continuation-In-Part US11286484B2 (en) 2017-08-18 2020-02-14 Use of miR-18b for prevention, treatment, or diagnosis of muscle disease and neuromuscular disease

Publications (1)

Publication Number Publication Date
WO2019035690A1 true WO2019035690A1 (ko) 2019-02-21

Family

ID=65362201

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/009461 WO2019035690A1 (ko) 2017-08-18 2018-08-17 근육 질환 및 신경근육 질환 예방, 치료 또는 진단을 위한 miR-18b의 용도

Country Status (1)

Country Link
WO (1) WO2019035690A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120088009A (ko) * 2010-09-13 2012-08-08 서울대학교산학협력단 ｍｉＲＮＡ를 타겟으로 한 신경퇴행성 질환 치료
WO2014047267A1 (en) * 2012-09-19 2014-03-27 Sutter West Bay Hospitals Mir-18b for use as a marker of cancer progression and target for therapies to treat cancer
KR20140130562A (ko) * 2005-12-12 2014-11-10 더 유니버시티 오브 노쓰 캐롤라이나 엣 채플 힐 마이크로 ｒｎａ를 이용한 근육 세포 증식 및 분화 조절 방법과 근육 세포 치료방법 및 유전자 발현 억제방법 그리고 마이크로 ｒｎａ 분자의 발현용 벡터와 이를 이용한 키트 및 미오사이트
KR20160139849A (ko) * 2015-05-29 2016-12-07 가톨릭대학교 산학협력단 ｍｉＲ－７, ｍｉＲ－１８ａ 또는 ｍｉＲ－１８ｂ를 유효성분으로 포함하는 대사성 질환의 예방 또는 치료용 약학적 조성물

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140130562A (ko) * 2005-12-12 2014-11-10 더 유니버시티 오브 노쓰 캐롤라이나 엣 채플 힐 마이크로 ｒｎａ를 이용한 근육 세포 증식 및 분화 조절 방법과 근육 세포 치료방법 및 유전자 발현 억제방법 그리고 마이크로 ｒｎａ 분자의 발현용 벡터와 이를 이용한 키트 및 미오사이트
KR20120088009A (ko) * 2010-09-13 2012-08-08 서울대학교산학협력단 ｍｉＲＮＡ를 타겟으로 한 신경퇴행성 질환 치료
WO2014047267A1 (en) * 2012-09-19 2014-03-27 Sutter West Bay Hospitals Mir-18b for use as a marker of cancer progression and target for therapies to treat cancer
KR20160139849A (ko) * 2015-05-29 2016-12-07 가톨릭대학교 산학협력단 ｍｉＲ－７, ｍｉＲ－１８ａ 또는 ｍｉＲ－１８ｂ를 유효성분으로 포함하는 대사성 질환의 예방 또는 치료용 약학적 조성물

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
CHEN ZLI YZHANG HHUANG PLUTHRA R: "Hypoxia-regulated microRNA-210 modulates mitochondrial function and decreases ISCU and COX10 expression", ONCOGENE, vol. 29, no. 30, 29 July 2010 (2010-07-29), pages 4362 - 8
CHOI ECHA MJHWANG KC: "Roles of Calcium Regulating MicroRNAs in Cardiac Ischemia-Reperfusion Injury", CELLS, vol. 3, no. 3, 11 September 2014 (2014-09-11), pages 899 - 913
LIU, X.: "miR-18b inhibits TGF-bl-induced differentiation of hair follicle stem cells into smooth muscle cells by targeting SMAD2", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, 2013, pages 551 - 556, XP028699999, DOI: 10.1016/j.bbrc.2013.07.090 *
MAKEYEV EVZHANG JCARRASCO MAMANIATIS T: "The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing", MOL CELL, vol. 27, no. 3, 3 August 2007 (2007-08-03), pages 435 - 48, XP002521939, DOI: 10.1016/J.MOLCEL.2007.07.015
NAROZNA BLANGWINSKI WSZCZEPANKIEWICZ A: "Non-Coding RNAs in Pediatric Airway Diseases", GENES (BASEL, vol. 8, no. 12, 27 November 2017 (2017-11-27)
ROSEN DRSIDDIQUE TPATTERSON DFIGLEWICZ DASAPP PHENTATI ADONALDSON DGOTO JO'REGAN JPDENG HX ET AL.: "Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis", NATURE, vol. 362, no. 6415, 4 March 1993 (1993-03-04), pages 59 - 62, XP008153951, DOI: 10.1038/362059a0
See also references of EP3669880A4 *

Similar Documents

Publication Publication Date Title
Staahl et al. Kinetic analysis of npBAF to nBAF switching reveals exchange of SS18 with CREST and integration with neural developmental pathways
Yao et al. Wnt regulates proliferation and neurogenic potential of Müller glial cells via a Lin28/let-7 miRNA-dependent pathway in adult mammalian retinas
Raitano et al. Restoration of progranulin expression rescues cortical neuron generation in an induced pluripotent stem cell model of frontotemporal dementia
Braga et al. Testosterone inhibits transforming growth factor-β signaling during myogenic differentiation and proliferation of mouse satellite cells: potential role of follistatin in mediating testosterone action
Kaur et al. let-7 MicroRNA-mediated regulation of Shh signaling and the gene regulatory network is essential for retina regeneration
WO2014163425A1 (ko) Hmga2를 이용하여 비신경 세포로부터 리프로그래밍된 유도 신경줄기세포를 제조하는 방법
WO2019050071A1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
WO2011096728A2 (en) Method for proliferating stem cells by activating c-met/hgf signaling and notch signaling
WO2011122889A2 (ko) miRNA의 발현 억제를 이용한 성체줄기세포의 노화 억제 방법
Shi et al. ZDHHC17 promotes axon outgrowth by regulating TrkA–tubulin complex formation
WO2019147036A1 (ko) 뇌유래-신경영양인자를 발현하는 중간엽줄기세포 및 이의 용도
WO2019035690A1 (ko) 근육 질환 및 신경근육 질환 예방, 치료 또는 진단을 위한 miR-18b의 용도
Guo et al. Regulation of chondrocyte differentiation by IRE1α depends on its enzymatic activity
US11891604B2 (en) Use of miR-18b for prevention, treatment, or diagnosis of muscle disease and neuromuscular disease
WO2016204562A1 (ko) 마이크로 rna와 nmda 수용체의 상관관계를 이용한 해마의 기능감소 판단 방법, 기능감소 억제 방법 및 기능감소 억제제 스크리닝 방법
Wang et al. Temporal control of a dendritogenesis-linked gene via REST-dependent regulation of nuclear factor I occupancy
WO2016178519A1 (ko) 근육 노화 억제용 또는 근육 노화 관련 질환 치료용 조성물
WO2019066519A1 (ko) 결합 조직 성장 인자를 표적으로 하는 rna 복합체를 함유하는 노인성 황반변성의 예방 또는 치료용 약학 조성물
WO2016140552A1 (ko) 항암제 내성 유방암의 항암제 민감성 진단용 바이오마커 조성물
Fujimoto et al. RBP-J promotes neuronal differentiation and inhibits oligodendroglial development in adult neurogenesis
Li et al. The protective effects of miR-128-3p on sevoflurane-induced progressive neurotoxicity in rats by targeting NOVA1
WO2011087343A2 (ko) Ｈｐｖ 감염과 관련된 암의 치료용 조성물
US11685919B2 (en) Composition for preventing or treating neurodegenerative disease
WO2019245269A1 (ko) Flt3 억제제를 유효성분으로 포함하는 만성 골수성 백혈병 약물 내성 억제용 조성물
WO2019235876A1 (ko) C-src의 발현 또는 활성 억제제를 포함하는 시누클레인병증의 예방 또는 치료용 약학 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18846646

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2020531407

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018846646

Country of ref document: EP

Effective date: 20200318