WO2019054782A1 - Fc 감마 수용체 변이체들 - Google Patents

Fc 감마 수용체 변이체들 Download PDF

Info

Publication number
WO2019054782A1
WO2019054782A1 PCT/KR2018/010783 KR2018010783W WO2019054782A1 WO 2019054782 A1 WO2019054782 A1 WO 2019054782A1 KR 2018010783 W KR2018010783 W KR 2018010783W WO 2019054782 A1 WO2019054782 A1 WO 2019054782A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
igg antibody
gamma receptor
polypeptide
seq
Prior art date
Application number
PCT/KR2018/010783
Other languages
English (en)
French (fr)
Inventor
정상택
조미경
고상환
황보라
Original Assignee
국민대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020170118769A external-priority patent/KR101986250B1/ko
Priority claimed from KR1020170118770A external-priority patent/KR101986252B1/ko
Priority claimed from KR1020170118771A external-priority patent/KR101987272B1/ko
Priority claimed from KR1020170132864A external-priority patent/KR101987292B1/ko
Priority claimed from KR1020170132862A external-priority patent/KR101987268B1/ko
Priority claimed from KR1020170132863A external-priority patent/KR101987279B1/ko
Priority to JP2019571392A priority Critical patent/JP7055434B2/ja
Priority to EP18856285.4A priority patent/EP3632928B1/en
Priority to BR112020000098-1A priority patent/BR112020000098A2/pt
Priority to CN201880045076.2A priority patent/CN111183150B/zh
Application filed by 국민대학교 산학협력단 filed Critical 국민대학교 산학협력단
Priority to US16/628,427 priority patent/US11650209B2/en
Priority to AU2018332475A priority patent/AU2018332475B2/en
Publication of WO2019054782A1 publication Critical patent/WO2019054782A1/ko

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • G01N33/6857—Antibody fragments
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
    • A61K38/1774—Immunoglobulin superfamily (e.g. CD2, CD4, CD8, ICAM molecules, B7 molecules, Fc-receptors, MHC-molecules)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70535—Fc-receptors, e.g. CD16, CD32, CD64 (CD2314/705F)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46—Hybrid immunoglobulins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/94—Stability, e.g. half-life, pH, temperature or enzyme-resistance
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/24—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a MBP (maltose binding protein)-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/31—Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/43—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/50—Fusion polypeptide containing protease site
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor

Definitions

  • the present invention relates to Fc gamma receptor variants with enhanced binding to IgG antibodies.
  • Fc gamma receptors (Fc ⁇ RI, Fc ⁇ RIIa, Fc ⁇ RIIb, and Fc ⁇ RIIIa) expressed in human immune cells bind to the IgG antibody Fc region (lower hinge region and upper CH2 region), and among these Fc gamma receptors, It has the highest affinity, but its thermostability is not very good and its expression rate is low, making it difficult to develop for medical use or for industrial application.
  • the autoantibody recognizing the autologous cell as the antigen can be injected into the immune cell surface (Fc gamma receptor), which is an autoantibody that accumulates in organs and recognizes autologous cells as external antigens and causes inflammation.
  • Fc gamma receptor an autoantibody that accumulates in organs and recognizes autologous cells as external antigens and causes inflammation.
  • Antibody IgG is characterized by the fact that it enters the cells randomly by pinocytosis and then is retained in the body for about 3 weeks by binding to FcRn in a weakly acidic pH condition, , And Fc gamma receptor can be developed as a fusion partner that increases the half-life of the protein drug by using the process of binding to the antibody IgG.
  • PEG polyethylene glycol
  • Fc-fusion protein drugs fused with antibody Fc have been developed to improve the half-life of protein drugs with pharmacological effects.
  • the Fc fusion protein is fused to a therapeutic protein and expressed by binding to the FcRn receptor Mechanisms can be used.
  • a technique to link interferon- ⁇ and Fc fragments to peptide linkers was developed.
  • a fusion protein was developed that links human erythropoietin to Fc as a peptide linker.
  • etanercept is a TNF- ⁇ inhibitor, a major cytokine that causes arthritis.
  • Fc fusion proteins are licensed to the US FDA and used clinically.
  • protein therapeutic agents with Fc intercept fused have a problem to overcome the cytotoxicity problem due to the immune cell activation function, which is an inherent function of Fc, and there is a disadvantage that the half-life is not remarkably increased by receptor-mediated clearance.
  • Fc fragment since it has to be fused with an Fc fragment as a homodimer, it is always expressed in a dimer form, thereby changing the pharmacological activity of a target protein.
  • albumin as a fusion partner as well as antibody Fc fragments at high concentrations in human serum.
  • Human genome science which has albumin fusion technology, is currently in clinical trials by fusing albumin to protein drugs such as human growth hormone and interferon. Because albumin is a large protein with a large molecular weight (molecular weight: 66.5 kDa), it has the potential to inhibit the activity of the target protein during fusion protein formation.
  • the technique using the Fc ⁇ R variant can greatly improve the half-life of blood by applying the Fc ⁇ R variant discovered as a new approach which has not been attempted so far to various protein therapeutics and candidate drug candidates used in clinical practice.
  • the Fc ⁇ R mutant fusion which has pharmacological efficacy but has a low half-life and short duration in the body, has also been found in the development of numerous peptide drugs that are difficult to be clinically applied. Therefore, by enabling long-term efficacy in drug target tissues, dosage and frequency can be drastically reduced, and the cost of drug development and the development of new drugs are expected to be greatly improved.
  • autoimmune disease is an autoimmune disease in which an antibody produced in the body recognizes an autologous cell and attacks an autologous cell that causes an immune response.
  • the immune cells have an Fc ⁇ Rs capable of binding to the antibody, An immune response such as ADCC or ADCP occurs. Therefore, the soluble Fc ⁇ RIIa binds to an antibody recognizing an autologous cell. Even if the autologous cell is recognized, it can be prevented from binding to the immune cell. Therefore, it can be developed as an autoimmune disease therapeutic agent.
  • the present inventors have sought to find an Fc gamma receptor variant capable of prolonging the blood half-life of a number of peptide drug treatments which are difficult to be clinically applied due to their low half-life and short duration in the body.
  • the present invention has been completed by confirming an Fc gamma receptor whose IgG binding ability is remarkably extended as compared with the wild type by optimizing substitution of some amino acid sequences with other amino acid sequences.
  • polypeptide comprising an Fc gamma receptor variant.
  • the present inventors have sought to find an Fc gamma receptor variant capable of prolonging the blood half-life of a number of peptide drug treatments which are difficult to be clinically applied due to their low half-life and short duration in the body.
  • an Fc gamma receptor having an IgG binding capacity remarkably extended as compared with the wild type was identified by optimizing substitution of some amino acid sequences with other amino acid sequences.
  • the term " Fc gamma receptor variant " means that the polypeptide of the Fc gamma receptor is different from the wild type Fc gamma receptor. These differences include immunoglobulin binding capacity, differences in therapeutic potential, amino acid composition or solubility, and the like. Refers to a modification of one or more amino acid sequences in an Fc gamma receptor, preferably consisting of a natural or synthetic amino acid capable of binding to an immunoglobulin or its Fc region, Deleted or inserted.
  • the immunoglobulin may be any one of IgG, IgE, IgA, IgM or IgD, preferably IgG.
  • the immunoglobulin may be derived from any animal, including human, rat, mouse, cattle, sheep, goat and chicken, ostrich or camel, preferably human.
  • the Fc gamma receptor variants of the present invention have improved properties compared to the wild type Fc gamma receptor.
  • the term " enhanced properties " means that desirable characteristics can be obtained over gamma Fc receptors of the wild type. This property may be achieved by increasing or enhancing the binding capacity to immunoglobulin or Fc, by binding to the Fc of an immunoglobulin to modulate or inhibit immune function, to increase the half-life in the serum of a polypeptide or protein used as a therapeutic agent, May be to detect or enhance the detection accuracy of the desired polypeptide or protein (e. G., Immunoglobulin).
  • the term " change in binding ability to immunoglobulin " means that the Fc gamma receptor mutant of the present invention has an activity different from the immunoglobulin binding activity of the wild-type Fc gamma receptor.
  • These include the ability of the receptor to bind to the immunoglobulin, that is, the ability of the receptor to bind to the immune complex, aggregate, dimer, or monomeric immunoglobulin when compared to the wild type Fc gamma receptor.
  • the term " modification of one or more amino acids that affect binding ability to immunoglobulin " means that the region of the amino acid residue or amino acid residue involved in the binding of the immunoglobulin to the wild type Fc gamma receptor is altered in the Fc gamma receptor .
  • the amino acid involved in the binding of immunoglobulin may function directly as a binding of immunoglobulin or may be generated indirectly by maintaining structural integrity of the receptor so that binding occurs. Such a change may be a result of substitution, deletion or insertion.
  • the Fc gamma receptor mutant of the present invention has enhanced binding capacity to the Fc region of the IgG antibody or IgG antibody as compared to the wild type Fc gamma receptor.
  • the mutated Fc gamma receptor mutant is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% More than 2 times, 3 times or more, 4 times or more, 5 times or more, 6 times or more, 7 times or more, 8 times or more, 9 times or more, 10 times as much as wild type Fc gamma receptor , 20 times, or 30 times or more (Examples 2, 8, 10, 11, 13, 15 to 17, and 19).
  • the mutant has three times or more of the binding ability of the IgG antibody or the IgG antibody to the Fc region as compared with the wild-type Fc gamma receptor.
  • the Fc receptor of the invention has the form of an isolated preparation, meaning that it is purified to the extent that other proteins and / or non-proteinaceous molecules have been removed.
  • the purity of the preparation is at least 40% or more, preferably 60% or more, more preferably 60% or more, more preferably 60% or more, and most preferably 60% or more, 75% or more, and even more preferably 85% or more.
  • the polypeptide comprising an Fc receptor of the invention may be attached to a cell membrane or support means, or may have a soluble form. When it is intended to be used as a pharmaceutical composition, the polypeptide is preferably soluble.
  • the polypeptide may be labeled with a reporter molecule that forms a detectable signal under appropriate conditions.
  • reporter molecules include radio-nucleotides, chemiluminescent molecules, bioluminescent molecules, fluorescent molecules or enzymes.
  • enzymes peroxidase, glucose oxidase,? -Galactosidase, and alkaline phosphatase, such as horseradish peroxidase, are among others.
  • the Fc receptor variants of the invention include natural or artificial mutants, variants or derivatives of the amino acids of the wild-type Fc receptor.
  • the wild-type Fc receptor that forms the basis of the mutant, variant or derivative may be of human or animal origin.
  • animal species are preferably mammalian species such as mouse, rat, rabbit, cattle, sheep, camel or chlorine species.
  • Amino acid modifications, i.e., deletion, insertion or substitution, to produce the Fc receptor variants of the present invention are carried out by conventional means.
  • the nucleic acid encoding the molecule may be introduced into the sequence of appropriate codes for insertion or substitution of one or more amino acids, or may be appropriately deleted in the coding sequence.
  • the desired amino acid sequence may be introduced.
  • the mutant is a modification of the 117th amino acid and the 159th amino acid in the sequence of wild-type Fc gamma receptor of SEQ ID NO: 43 or SEQ ID NO: 49.
  • the mutant is a variant of the 117th amino acid, the 119th amino acid and the 159th amino acid in the sequence of wild type Fc gamma receptor of SEQ ID NO: 43 or SEQ ID NO: 49 sequence; And further variants of one or more amino acids selected from the group consisting of 86th amino acid, 127th amino acid and 171th amino acid.
  • the mutant comprises a sequence in which the 117th amino acid in SEQ ID NO: 43 or SEQ ID NO: 49 is substituted with asparagine (N) and the 159th amino acid is replaced with glutamine (Q) Fc gamma receptor mutants.
  • the mutant further comprises, in addition to the 117th amino acid and the 159th amino acid substitution, the 55th amino acid, the 86th amino acid, the 119th amino acid, 127th amino acid, and 171th amino acid.
  • the mutant is selected from the group consisting of SEQ ID NO: 43 or SEQ ID NO: 49 in which the 86th amino acid is aspartic acid (D), the 117th amino acid is asparagine (N), the 119th amino acid is methionine (E) in which the 127th amino acid is substituted with leucine (L), the 159th amino acid is replaced with glutamine (Q), and the 171st amino acid is replaced with glutamic acid (E) will be.
  • SEQ ID NO: 43 or SEQ ID NO: 49 in which the 86th amino acid is aspartic acid (D), the 117th amino acid is asparagine (N), the 119th amino acid is methionine (E) in which the 127th amino acid is substituted with leucine (L), the 159th amino acid is replaced with glutamine (Q), and the 171st amino acid is replaced with glutamic acid (E) will be.
  • the mutant in addition to the 117th amino acid and the 159th amino acid substitution in the 43th sequence or the 49th sequence of the sequence listing, further comprises an amino acid at position 55 in which histidine (H) (D), wherein the 119th amino acid is replaced by methionine (M) or valine (V), the 127th amino acid is leucine (L), and the 171th amino acid is replaced by glutamic acid (E) Or more amino acids are substituted.
  • H histidine
  • M methionine
  • V valine
  • E glutamic acid
  • the mutant comprises the sequence of SEQ ID NO: 44.
  • the mutant comprises the sequence of SEQ ID NO: 45.
  • the mutant comprises the sequence of SEQ ID NO: 46.
  • said variant comprises the sequence of SEQ ID NO: 47.
  • the mutant comprises the sequence of SEQ ID NO: 48.
  • said variant comprises the sequence of SEQ ID NO: 50.
  • the Fc gamma receptor mutants encompassed by the present invention include mutants of various kinds of Fc gamma receptors (Fc? RI, Fc? RIIa, Fc? RIIb, Fc? RIIa, etc.), preferably Fc gamma receptor IIa mutants or Fc gamma receptor IIb mutants.
  • nucleic acid molecule encoding the polypeptide, a vector comprising the nucleic acid molecule, or a host cell comprising the vector.
  • the present invention provides a method for producing a polypeptide comprising an Fc gamma receptor variant comprising the steps of:
  • the nucleic acid molecules of the present invention may be isolated or recombinant, and include DNA and RNA in single and double stranded form as well as corresponding complementary sequences.
  • &Quot; Isolated nucleic acid " is a nucleic acid isolated from a peripheral genetic sequence present in the genome of an isolated nucleic acid, in the case of a nucleic acid isolated from a naturally occurring source.
  • the nucleic acid generated from such a procedure can be understood as an isolated nucleic acid molecule.
  • the isolated nucleic acid molecule represents a nucleic acid molecule as a separate fragment or as a component of a larger nucleic acid construct.
  • a nucleic acid is " operably linked " when placed in a functional relationship with another nucleic acid sequence.
  • the DNA of a full-length or secretory leader is operably linked to the DNA of the polypeptide when expressed as a preprotein in the form before secretion of the polypeptide, and the promoter or enhancer comprises a polypeptide sequence
  • the ribosome binding site is operably linked to a coding sequence when it is placed to facilitate translation.
  • &quot operably linked " means that the DNA sequences to be ligated are located adjacent to each other, and in the case of a secretory leader, it means that the DNA sequences are adjacent to each other in the same reading frame.
  • the enhancer need not be located contiguously. Linking is accomplished by ligation at convenient restriction sites. If such sites are not present, synthetic oligonucleotide adapters or linkers are used according to conventional methods.
  • the term " vector " means a carrier capable of inserting a nucleic acid sequence for introduction into a cell capable of replicating a nucleic acid sequence.
  • the nucleic acid sequence may be exogenous or heterologous.
  • Vectors include, but are not limited to, plasmids, cosmids, and viruses (e.g., bacteriophage). Those skilled in the art can establish a vector by standard recombinant techniques (Maniatis, et al, Molecular Cloning , A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY, 1988; and Ausubel et al, In:.. Current Protocols in Molecular Biology , John, Wiley & Sons, Inc, NY, 1994).
  • the term " expression vector " means a vector comprising a nucleic acid sequence encoding at least a portion of the gene product to be transcribed. In some cases, the RNA molecules are then translated into proteins, polypeptides, or peptides.
  • the expression vector may contain various regulatory sequences. Vectors and expression vectors may also include nucleic acid sequences that provide another function, as well as regulatory sequences that regulate transcription and translation.
  • the term " host cell " refers to any transgenic organism that includes eukaryotes and prokaryotes and is capable of replicating the vector or expressing the gene encoded by the vector.
  • the host cell may be transfected or transformed by the vector, which means that the exogenous nucleic acid molecule is transferred or introduced into the host cell.
  • the present invention provides a method for identifying the presence of an IgG antibody or an Fc region of an IgG antibody contained in a sample comprising the steps of:
  • the present invention provides a method of purifying an Fc region of an IgG antibody or an IgG antibody contained in a sample comprising the steps of:
  • the Fc gamma receptor mutant of the present invention has an enhanced binding ability to the Fc region of the IgG antibody or the IgG antibody as compared with the wild-type Fc gamma receptor, the IgG antibody or the IgG antibody And can be usefully used for detecting the presence, detecting it, or refining it.
  • the isolation and purification of the polypeptides can be performed by any of several known techniques. But are not limited to, for example, ion exchange chromatography, gel filtration chromatography and affinity chromatography, high performance liquid chromatography (HPLC), reverse phase high performance liquid chromatography, and production disk gel electrophoresis. Techniques for the isolation and purification of the polypeptides may require modification of the polypeptide by conventional methods. For example, a histidine tag can be added to a protein when a nickel column is purified. Other variations may result in higher or lower activity, permit higher protein production, or simplify purification of the protein. Other tags may also include flag-tags. These tags are preferably used in eukaryotic hosts.
  • ammonium sulfate precipitation method is included in a protein purification method through a change in solubility. This method is more specific than a general technique such as salting out.
  • Ammonium sulfate is generally used because it has a high solubility and can accept a salt solution of high ionic strength. The solubility of the polypeptide depends on the ionic strength of the solution, and therefore varies with the salt concentration.
  • the salting out method is a very useful method to aid in the purification of certain polypeptides.
  • the addition of cosmotropic ammonium sulfate precipitates impurities and polypeptides such as cell wall components from host cells as well as folding byproducts such as loose and abnormal folding types.
  • the precipitation effect increases with increasing precipitation concentration, so that a high purity Fc receptor variant preparation material can be obtained while the Fc receptor variant is resistant to the same precipitation as in ammonium sulfate at high concentration.
  • the precipitated polypeptide is removed by centrifugation, and while the maximum amount of polypeptide contaminants still remains in the solution, the ammonium sulfate concentration increases to the value at which most of the polypeptide of interest precipitates.
  • the precipitated polypeptide of interest is recovered by centrifugation and dissolved in a fresh buffer.
  • the present invention provides a method of screening for an Fc gamma receptor variant having enhanced binding to the Fc region of an IgG antibody or an IgG antibody comprising the steps of:
  • an Fc gamma receptor mutant library comprising the sequence of SEQ ID NO: 43 or SEQ ID NO: 49 in which the 117th amino acid is substituted with asparagine (N) and the 159th amino acid is replaced with glutamine (Q);
  • the present invention provides a method of screening for an Fc gamma receptor variant having enhanced binding to the Fc region of an IgG antibody or an IgG antibody comprising the steps of:
  • the present invention provides a method of screening Fc gamma receptor variants with enhanced binding capacity to the Fc region of an IgG antibody or IgG antibody comprising the steps of:
  • the amino acid at position 55 is substituted with histidine (H) at position 55, the amino acid at position 117 is asparagine (N), the amino acid at position 119 is valine (V), the amino acid at position 159 is glutamine Q), constructing an Fc gamma receptor mutant library comprising a sequence in which the 171st amino acid is substituted with glutamic acid (E); And
  • an Fc gamma receptor mutant having an improved binding capacity to an Fc region of an IgG antibody or an IgG antibody can be advantageously selected as compared with an Fc gamma receptor mutant.
  • Variants selected by the screening method of the present invention may additionally comprise the following amino acid modifications: sequence 55 or amino acid 55, amino acid 86, amino acid 119, amino acid 127, And one or more amino acids selected from the group consisting of 171th amino acid.
  • the 55th amino acid further comprises histidine (H), the 86th amino acid is aspartic acid (D), the 119th amino acid is methionine (M) or valine (V) Leucine (L), and one or more amino acids selected from the group in which the 171st amino acid is replaced with glutamic acid (E).
  • the Fc gamma receptor mutants having improved binding capacity to the Fc region of the IgG antibody or IgG antibody were selected through the screening method (Examples 7 and 8).
  • the screening method of the present invention can use fluorescence labeled cell separation (FACS) screening or other automated flow cell analysis techniques.
  • FACS fluorescence labeled cell separation
  • Devices for conducting flow cytometry analyzers are well known to those skilled in the art. Examples of such devices include FACSAria, FACS Star Plus, FACScan and FACSort instruments (Becton Dickinson, Foster City, CA), Epics C (Coulter Epics Division, Hialeah, FL), MOFLO (Cytomation, Colorado Springs, Colo. XDP (Beckman Coulter, Indianapolis, Ind.).
  • Flow cytometry techniques generally involve the separation of cells or other particles in a liquid sample.
  • a flow cytometer typically, the purpose of a flow cytometer is to analyze the discrete particles for one or more of their properties (e.g., the presence of a labeled ligand or other molecule). Particles are passed one by one by the sensor and are classified based on size, refraction, light scattering, opacity, roughness, shape, fluorescence and the like.
  • composition comprising said polypeptide, nucleic acid molecule or vector.
  • the composition of the present invention is for detecting an IgG antibody contained in a sample or an Fc region of an IgG antibody.
  • &quot refers to a substance that is likely to comprise an IgG antibody or an Fc region of an IgG antibody.
  • feces, cells, blood, plasma, serum, hair or urine which are separated naturally or artificially from the subject and separated from the body can be used.
  • &quot includes mammals such as humans, primates including chimpanzees, pets such as dogs and cats, livestock such as cows, horses, sheep, goats, It is interpreted as meaning.
  • composition can also be included in a kit and can be used to detect IgG antibodies or IgG antibody Fc sites contained in a sample, quantify the amount of a subject's IgG antibody, or quantify the amount of IgG antibody in a patient (for example, an immunosuppressive, Or a change in immune status due to organ transplantation).
  • a protein or a peptide fused body in which the polypeptide is conjugated with a physiologically active protein or a physiologically active peptide.
  • the protein or peptide fused product according to the present invention is characterized in that a physiologically active protein or a physiologically active peptide is bound to the Fc gamma receptor mutant to increase the half-life of the body by maintaining persistence in the body.
  • &quot refers to a protein fusion having a novel molecular structure in which a protein having one or more physiological activities is bound to the N-terminal or C-terminal of an Fc gamma receptor mutant .
  • &Quot; Peptide fusion " means a peptide fusion having a novel molecular structure in which a low molecular weight peptide having at least one physiological activity is bound to the N-terminal or C-terminal of an Fc gamma receptor mutant.
  • physiologically active protein or physiologically active peptide may be directly or indirectly bound to an Fc gamma receptor mutant using a linker composed of an amino acid.
  • the physiologically active protein or the physiologically active peptide and the Fc gamma receptor mutant are bound using a gene recombination technique.
  • a cross-linking agent known in the art to bind the Fc gamma receptor mutant at the N-terminal, C- .
  • the physiologically active proteins may include hormones and their receptors, biological response modifiers and their receptors, cytokines and their receptors, enzymes, antisera, antibody fragments, and the like.
  • the physiologically active protein may be selected from the group consisting of human growth hormone (hGH), insulin, follicle-stimulating hormone (FSH), human chorionic gonadotropin, parathyroid hormone (PTH) (GPO), granulocyte macrophage colony stimulating factor (GM-CSF), interferon alpha, interferon beta, interferon gamma, interleukin Tumor necrosis factor, tissue plasminogen activator, blood clotting factors VII, VIIa, VIII, human bone morphogenic protein 2 (hBMP2), KGF keratinocyte growth factor, platelet-derived growth factor (PDGF), glucocerebrosidase,?
  • hGH human growth hormone
  • FSH follicle-stimulating hormone
  • FSH human chorionic gonadotropin
  • the physiologically active peptides include glucagon-like peptide-1 (GLP-1) and analogs thereof, exendins and analogs thereof, somatostatin and analogs thereof, luteinizing hormone-releasing hormone (LHRH) And antagonist, adrenocorticotropic hormone, growth hormone-releasing hormone, oxytocin, thymosin alpha-1, corticotropin-releasing factor but are not limited to, corticotropin-releasing factor, calcitonin, bivalirudin, vasopressin analogues, and fragments of bioactive proteins.
  • GLP-1 glucagon-like peptide-1
  • exendins and analogs thereof exendins and analogs thereof
  • somatostatin and analogs thereof luteinizing hormone-releasing hormone (LHRH) And antagonist
  • LHRH luteinizing hormone-releasing hormone
  • adrenocorticotropic hormone adrenocorticotropic hormone
  • growth hormone-releasing hormone oxytocin
  • the peptide of the present invention can be usefully used to increase the half-life of other physiologically active proteins or peptides, and the half-life of the protein or peptide fused body can be increased by maintaining persistence in the body.
  • the composition of the present invention is a pharmaceutical composition for immunosuppression.
  • the pharmaceutical composition of the present invention comprises (a) a nucleic acid molecule encoding the polypeptide, or a vector comprising the nucleic acid molecule; And (b) a pharmaceutically acceptable carrier.
  • the composition of the present invention is a pharmaceutical composition for preventing or treating an organ transplantation reaction inhibition or an autoimmune disease.
  • a method of inhibiting an immune or organ transplantation reaction comprising administering the pharmaceutical composition.
  • a method of preventing or treating an autoimmune disease comprising administering the pharmaceutical composition.
  • autoimmune disease is used interchangeably with the term "autoimmune disorder " and refers to a cell, tissue, organ or organ Means the state of the object specified by the user.
  • inflammatory disease is used interchangeably with the term “inflammatory disorder” and refers to conditions characterized by inflammation, preferably chronic inflammation. Autoimmune diseases may or may not be associated with inflammation. In addition, inflammation may or may not cause autoimmune disease.
  • autoimmune diseases that can be prevented or treated by the pharmaceutical compositions of the present invention include, but are not limited to, alopecia greata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune diseases of the adrenal glands, Celiac sprue-dermatitis, atopic dermatitis, asthma, rhinitis, chronic sinusitis, autoimmune thrombocytopenia, autoimmune thrombocytopenia, schizophrenia, hemolytic anemia, autoimmune hepatitis, Chronic inflammatory dyslipidemic neuropathy, Churg-Strauss syndrome, scarring pheochromocytoma, CREST syndrome, cold agglutinin disease, Crohn's disease, dyspepsia, metachromatic complex cold globulinemia, fibromyalgia-fibrosis, glomerulonephritis, Graves disease, Guillain-Barré syndrome, Hashimoto thyroiditis, idiopathic pulmonary fibros,
  • the pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not.
  • the pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components.
  • a lubricant e.g., a talc, a kaolin, a kaolin, a kaolin, a kaolin, a kaolin, kaolin, kaolin, kaolin, sorbiol, sorbitol, etc.
  • Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).
  • the pharmaceutical composition of the present invention can be administered orally or parenterally, preferably parenterally, and can be administered, for example, by intravenous injection, local injection, and intraperitoneal injection.
  • the appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate and responsiveness of the patient, Usually, a skilled physician can readily determine and prescribe dosages effective for the desired treatment or prophylaxis.
  • the daily dosage of the pharmaceutical composition of the present invention is 0.0001-100 mg / kg.
  • the pharmaceutical composition of the present invention may be formulated into a unit dose form by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container.
  • the formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.
  • the pharmaceutical composition of the present invention may be used alone, but may be used in combination with other conventional chemotherapy or biological therapies, and when such concurrent therapy is performed, the immune related disease can be more effectively treated .
  • the present invention provides a polypeptide comprising an Fc gamma receptor mutant.
  • the present invention also provides a method for producing the polypeptide.
  • the Fc gamma receptor mutant of the present invention can be obtained by optimizing the substitution of some amino acid sequences of the Fc gamma receptor with other amino acid sequences, thereby enhancing the selective binding ability to immunoglobulin, thereby increasing the half-life of the body, detecting and purifying immunoglobulins, Inhibitory use, or prevention or treatment of autoimmune diseases.
  • Fig. 1 shows a schematic diagram of the construction of the Fc ⁇ RIIa mutant library of the present invention.
  • Figure 2 shows the screening process for SH2A40 variants showing high affinity for human serum IgG.
  • Fig. 3 shows the result of confirming that Fc ⁇ RIIa protein (32 kDa) was purified with high purity on SDS-PAGE.
  • FIG. 4 is a graph comparing the binding ability of SH2A40 to Fc with N-linked canonical glycosylation motif added to the wild type.
  • FIG. 5 is a schematic diagram showing the process for obtaining purified SH2A40.
  • FIG. 6 shows the results of ELISA for the activity of SH2A40 digested after expression purification.
  • FIG. 7 is a schematic diagram of a process for preparing an Fc ⁇ RIIa mutant library so that an N-linked canonical glycosylation motif is not formed.
  • FIG. 8 is a graph comparing the binding capacities of Fc variants (MG2A28 and MG2A45) selected using the constructed library and flow cytometry analyzer to Fc.
  • Fig. 9 shows the results of purifying the mutants.
  • FIG. 10 shows ELISA results for analyzing the binding ability to Fc of excavated mutants.
  • Figure 11 shows the results of measuring the K D value of Fc gamma receptor mutants and rituximab via Biolayer interferometry.
  • FIG. 12 is a graph comparing the affinities of Fc of mutants (MG2A28.1 and MG2A45.1) screened using the constructed library and flow cytometry analyzer to Fc.
  • Fig. 13 shows the results of purifying the mutants.
  • FIG. 14 shows ELISA results for analyzing the binding force to Fc of excavated mutants.
  • FIG. 16 shows the results of ELISA analysis of binding capacity of Fc gamma receptor mutants to mouse serum IgG.
  • Fig. 17 shows the affinity comparison results of wild-type Fc ⁇ RIIb and MG2A45.1 mutant-introduced Fc ⁇ RIIb (MG2B45.1) to human serum IgG-FITC.
  • Fig. 18 shows Bevacizumab scFv, Bevacizumab scFv-Fc ⁇ RIIa wild type, Bevacizumab scFv-MG2A45.1 expressed in animal cells.
  • Figure 19 shows the results of ELISA assay-Bevacizumab scFv, Bevacizumab scFv-Fc ⁇ RIIa wild type, and Bevacizumab scFv-MG2A45.1 VEGF binding activity assay for bevacizumab scFv.
  • FIG. 20 shows the results of ELISA assay-Bevacizumab scFv, Bevacizumab scFv-Fc ⁇ RIIa wild type, and IgG1 Fc (Rituximab) binding activity assay for Fc ⁇ RIIa of Bevacizumab scFv-MG2A45.1.
  • Escherichia coli Jude1 ((F '[Tn 10 (Tet r) proAB + lacI q ⁇ (lacZ) M15] mcrA ⁇ (mrr - hsdRMS - mcrBC) ⁇ 80d lac Z ⁇ M15 ⁇ lacX74 deoR recA1 araD139 ⁇ (ara leu) 7697 galU galKrpsLendA1nupG )
  • Fc ⁇ RIIa mutant library library size: 2.2x10 9
  • primer # sequence (5 ' 3 ') P788 (SEQ ID No. 1) GCGGGGTTTGCAGCACCAGMNNMNNMNNAAGCACGGTCAGATGCACCG P789 (SEQ ID No. 2) CGGTGCATCTGACCGTGCTTNNKNNKNNKCTGGTGCTGCAAACCCCGC P790 (SEQ ID No.
  • Gt P791 (Sequence Listing 4) CTGCGTTGCCATAGCTGGAAAGATNNKNNKCTGNNKAAAGTGACCTTTTTTCAGAATGGCAAAAGC P792 (Sequence Listing 5 sequence) Gt P793 (SEQ ID NO: 6) GGTGAAAGTGACCTTTTTTCAGAATGGCAAANNKCAGAAANNKTCTNNKCTGGATCCGACCTTTAGCATTCCGC IIa Fw NdeI (SEQ ID NO: 7 sequence) GCGGAATTCCATATGCAGGCTGCCCCACCGAAAG IIa Rv HindIII (SEQ ID No.
  • 1 ml of the constructed Fc ⁇ RIIa mutant library was added to Terrific Broth (TB) medium containing chloramphenicol (40 ⁇ g / ml) in 2% (w / v) glucose at 37 ° C and shaking at 250 rpm for 4 hours .
  • the cultured library cells were inoculated at 1: 100 in TB medium and cultured at 37 ° C and 250 rpm shaking until OD 600 reached 0.6. After that, the cells were incubated at 25 ° C for 20 minutes for cooling, and the expression was induced by adding 1 mM isopropyl-1-thio- ⁇ -D-galactopyranoside (IPTG).
  • IPTG isopropyl-1-thio- ⁇ -D-galactopyranoside
  • Cells were harvested by centrifugation at 14,000 rpm for 1 minute, followed by OD 600 normalization. The cells were resuspended in 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 min. The wash procedure was repeated twice. The cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] and the extracellular membrane was removed by rotation at 37 ° C for 30 minutes.
  • STE 0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)
  • Solution A [0.5 M sucrose, 20 mM MgCl 2 , 10 mM MOPS pH 6.8] was added and centrifuged with resuspension. 1 ml of Solution A and 20 ⁇ l of 50 mg / ml lysozyme solution was added to 1 ml of the solution. The solution was then resuspensioned and the peptidoglycan layer was removed by rotation at 37 ° C for 15 minutes. After centrifugation, the supernatant was removed and resuspension in 1 ml of PBS.
  • Example 4 ELISA performed using rituximab consisting of IgG1 subclass for activity and binding assay of Fc ⁇ RIIa protein produced by animal cell culture
  • the rituximab diluted to 4 ⁇ g / ml in 0.05 M Na 2 CO 3 ( pH 9.6) was immobilized in a flat bottom polystyrene High Bind 96-well microplate (Costar) at 4 ° C for 16 hours, and then 100 ⁇ l of 5% BSA in 0.05% PBST) for 2 hours at room temperature. After washing four times with 180 ⁇ l of 0.05% PBST, serially diluted Fc ⁇ RIIa proteins were added to each well of 50 ⁇ l of blocking solution and reacted at room temperature for 1 hour. After washing, 50 ⁇ l of anti-His-HRP conjugate (Sigma-Aldrich) was reacted at room temperature for 1 hour and washed.
  • the gene was subjected to PCR using IIa_Fw_NdeI and IIa_Rv_HindIII primers and Nde I and Hind III (New England Biolab). After ligation with Nde I, Hind III pET22b-MBP-TEV site-His vector, it was transformed into BL21 (DE3) cell.
  • the cells were cultured in TB medium containing ampicillin (100 ⁇ g / ml) in 2% (w / v) glucose at 37 ° C and shaking at 250 rpm.
  • the cultured cells were inoculated at 1: 100 in TB medium and cultured at 37 ° C at 250 rpm shaking until an OD 600 reached 0.6.
  • the cells were incubated at 18 ° C for 20 minutes for cooling, followed by incubation with 1 mM IPTG for 14 hours. After the incubation, the cells were harvested by centrifugation at 7,000 rpm for 10 minutes. The cells were sonicated (5 sec on / 10 sec off, 100 repetitions) and centrifuged at 15,000 rpm for 30 min. The supernatant was filtered with a 0.45 ⁇ m syringe filter. The filtered supernatant was bound to Ni-NTA resin, washed with 100 ml of 10 mM imidazole buffer, 100 ml of 20 mM imidazole buffer, and eluted with 4 ml of 50 mM imidazole buffer. MBP-SH2A40 was cleaved with MBP and SH2A40 using TEV-GST, and TEV-GST and MBP proteins were removed with GST resin and amylose resin to obtain pure SH2A40 (Fig. 5).
  • ELISA was performed to examine the activity of SH2A40 digested after expression purification.
  • 0.05 M Na 2 CO 3 Rituximab diluted to 4 ⁇ g / ml in pH 9.6 was immobilized in a flat bottom polystyrene High Bind 96-well microplate (Costar) at 4 ° C for 16 hours, and then 100 ⁇ l of 4% skim milk GenomicBase) (0.05% PBST) for 2 hours at room temperature.
  • the cells were washed four times with 0.05% PBST (180 ⁇ l), and serially diluted WT Fc ⁇ RIIa and SH2A40 in 1% skim milk (0.05% PBST) were added to each well and reacted at room temperature for 1 hour.
  • a library was constructed to detect Fc ⁇ RIIa variants with high affinity for IgG Fc while eliminating the N-linked canonical glycosylation motif (N-X-S / T) formed in Fc ⁇ RIIa variants (SH2A40: K117N, L159Q).
  • This library was constructed by focusing on the positions of V116, K117, and T119 where N-linked canonical glycosylation motifs were formed in SH2A40.
  • the template of the library was prepared using SH2A40 as a template, and a reduced codon was used so as not to cause Cys to prevent unpaired Cyc (FIG. 7).
  • Sub-library-1 Produce Asn and Cys at position 117
  • NNK degenerate codon was used to encode 20 amino acids at positions 116 and 119, 13 amino acids were codonized using NNG reduced codon at position 117 and 5 amino acids were codonized using NNG reduced codon at positions 117 and 119, respectively, using pMopac12-NlpA-Fc ⁇ RIIa (SH2A40)
  • the primers coding for the remaining amino acids were prepared and used in the same amounts.
  • MJ # 113-MJ # 118 was used to amplify the fragment-1 upstream of Fc ⁇ RIIa gene and the downstream fragment-2 using primers MJ # 160 and MJ # 112 and Vent polymerase (New England Biolab) Mixture and MJ # 161 mixed at the same amino acid ratio were used. Prepared two fragment were assemble with Vent polymerase, it was treated with Sfi I (New England Biolab) restriction enzymes.
  • Sub-library-2 Produce Ser, Thr, Cys at position 119
  • NNK degenerate codon was used to encode 20 amino acids at positions 116 and 117, and 12 amino acids were codonized at position 119 using the NWK reduced codon and pMOPac12-NlpA-Fc ⁇ RIIa (SH2A40) -FLAG as a template.
  • the primers coding for the remaining amino acids (Ala, Gly, Pro, Arg, and Trp) were prepared and used in the same amounts.
  • MJ # 119-MJ # 124 was used to amplify the fragment-1 upstream of Fc ⁇ RIIa gene and the downstream fragment-2 using primers MJ # 160 and MJ # 112 and Vent polymerase (New England Biolab) Mixture and MJ # 161 mixed at the same amino acid ratio were used. Prepared two fragment were assemble with Vent polymerase, it was treated with Sfi I (New England Biolab) restriction enzymes.
  • Example 8 Screening of the constructed library and flow cytometry and selection of variants such as MG2A28 and MG2A45 (affinity analysis for human serum IgG)
  • the cells were resuspended in 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 min. The wash procedure was repeated twice.
  • the cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] and the extracellular membrane was removed by rotation at 37 ° C for 30 minutes. After centrifugation, the supernatant was removed and 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl 2 , 10 mM MOPS pH 6.8] was added and centrifuged with resuspension.
  • the cells were washed once with 1 ml of PBS, diluted 20-fold with PBS, and only the cells with the highest 3% fluorescence signal were isolated using S3 cell sorter (Bio-rad). For more efficient screening, sorted cells were resorted to sorting once more. Filtered out cells were prepared for the sub-library genes to amplify a MJ # 1, MJ # 2 primer and amplifying the gene by PCR using Taq polymerase (Biosesang) and a cell sorting via the Sfi I restriction enzyme treatment ligation, transformation process . After repeating this process for a total of 3 rounds, variants showing high affinity with the Fc portion of human serum IgG were selected through sequencing of 50 individual clones (Fig. 8).
  • MG2A28 SEQ ID NO: 37 and SEQ ID NO: 45
  • MG2A45 SEQ ID NO: 38 and SEQ ID NO: 46
  • the gene was ligated with Vent polymerase and primers MJ # 162, MJ # 163 And then ligated with BssH II and Xba I (New England Biolab) to obtain pMAZ-Fc ⁇ RIIa variant (MG2A28) and pMAZ-Fc ⁇ RIIa variant (MG2A45).
  • Genes cloned in pMAZ an expression vector for animal cells, were transfected into HEK293F cells and transiently expressed at a size of 300 ml.
  • the cultured medium was centrifuged at 2000 rpm for 10 minutes to remove the cells, and the supernatant was taken and the equilibrium was adjusted with 25 ⁇ PBS. and filtered with a 0.2 ⁇ m filter (Merck Millipore) using a bottle top filter. 1 ml slurry of Ni-NTA agarose (Qiagen) equilibrated with PBS was added, and the mixture was stirred at 4 ° C for 16 hours and then poured into a polypropylene column (Thermo Fisher Scientific).
  • Example 10 ELISA for analyzing the binding ability of mutants to Fc using IgG1 subclass rituximab
  • the rituximab diluted to 4 ⁇ g / ml in 0.05 M Na 2 CO 3 ( pH 9.6) was immobilized in a flat bottom polystyrene High Bind 96-well microplate (Costar) at 4 ° C for 16 hours, and then 100 ⁇ l of 5% BSA in 0.05% PBST) for 2 hours at room temperature. After washing four times with 180 ⁇ l of 0.05% PBST, serially diluted Fc ⁇ RIIa variants with blocking solution were dispensed in 50 ⁇ l of each well and reacted at room temperature for 1 hour. After washing, 50 ⁇ l of anti-His-HRP conjugate (Sigma-Aldrich) was reacted at room temperature for 1 hour and washed.
  • Fc ⁇ RIIa mutants The affinity of Fc ⁇ RIIa mutants was measured using rituximab to measure the binding capacity of IgG1, an IgG subclass mainly used in various antibody drugs, to Fc, which accounts for more than 70% of human serum.
  • the binding of Fc [gamma] RIIA mutants was measured using Blitz (Fortebio).
  • Example 12 Establishment of Fc ⁇ RIIa error-prone PCR library based on MG2A28 and MG2A45 for affinity maturation
  • Example 13 Screening of constructed libraries and flow cytometry and selection of mutants such as MG2A28.1 and MG2A45.1 (affinity analysis for human serum IgG)
  • the cells were resuspended in 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 min. The wash procedure was repeated twice.
  • the cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] and the extracellular membrane was removed by rotation at 37 ° C for 30 minutes. After centrifugation, the supernatant was removed and 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl 2 , 10 mM MOPS pH 6.8] was added and centrifuged with resuspension.
  • MG2A28.1 (SEQ ID NO: 39 and SEQ ID NO: 47) and MG2A45.1 (SEQ ID NO: 40 and SEQ ID NO: 48) in the HEK293F cells
  • the gene was ligated with Vent polymerase and primer MJ # 162 , MJ # 163, and ligated with BssH II and Xba I (New England Biolab) to produce pMAZ-Fc ⁇ RIIa variant (MG2A28.1) and pMAZ-Fc ⁇ RIIa variant (MG2A45.1) .
  • Genes cloned in pMAZ an expression vector for animal cells, were transfected into HEK293F cells and transiently expressed at a size of 300 ml.
  • the cultured medium was centrifuged at 2000 rpm for 10 minutes to remove the cells, and the supernatant was taken and the equilibrium was adjusted with 25 ⁇ PBS. and filtered with a 0.2 ⁇ m filter (Merck Millipore) using a bottle top filter. 1 ml slurry of Ni-NTA agarose (Qiagen) equilibrated with PBS was added, and the mixture was stirred at 4 ° C for 16 hours and then poured into a polypropylene column (Thermo Fisher Scientific).
  • Example 15 ELISA for analyzing the binding ability of mutants to Fc using IgG1 subclass rituximab
  • the rituximab diluted to 4 ⁇ g / ml in 0.05 M Na 2 CO 3 ( pH 9.6) was immobilized in a flat bottom polystyrene High Bind 96-well microplate (Costar) at 4 ° C for 16 hours, and then 100 ⁇ l of 5% BSA in 0.05% PBST) for 2 hours at room temperature. After washing four times with 180 ⁇ l of 0.05% PBST, serially diluted Fc ⁇ RIIa variants with blocking solution were dispensed in 50 ⁇ l of each well and reacted at room temperature for 1 hour. After washing, 50 ⁇ l of anti-His-HRP conjugate (Sigma-Aldrich) was reacted at room temperature for 1 hour and washed.
  • Fc ⁇ RIIa mutants The affinity of Fc ⁇ RIIa mutants was measured using rituximab to measure the binding capacity of IgG1, an IgG subclass mainly used in various antibody drugs, to Fc, which accounts for more than 70% of human serum.
  • the binding of Fc [gamma] RIIA mutants was measured using Blitz (Fortebio).
  • rituximab antibody diluted to 40 ug / ml was immobilized in sodium acetate pH 5.0 solution to an Amine reactive 2 nd generation (AR2G) biosensor (Fortebio) and Fc ⁇ RIIa variants serially diluted with 1x kinetics buffer (fortebio) .1, MG2A45.1) were respectively reacted to analyze binding force (Fig. 15).
  • AR2G Amine reactive 2 nd generation
  • Fc ⁇ RIIa variants serially diluted with 1x kinetics buffer fortebio
  • Fig. 15 Blitz Pro 1.2 software
  • K D equilibrium binding constant
  • Example 17 Analysis of binding force with mouse serum IgG for ELISA using mouse model by ELISA
  • mice serum IgG diluted to 4 ⁇ g / ml in 0.05 M Na 2 CO 3 ( pH 9.6) in a flat bottom polystyrene High Bind 96 well microplate (Costar) at 4 ° C for 16 hours, 100 ⁇ l of 5% And blocked with BSA (0.05% PBST) at room temperature for 2 hours.
  • Example 19 Comparison of affinity of human wild-type Fc ⁇ RIIb and MG2A45.1 mutant-introduced Fc ⁇ RIIb (MG2B45.1) to human serum IgG-FITC
  • the Fc ⁇ RIIb mutant (MG2B45.1) (SEQ ID No. 42 and 50 sequence) compared the affinity for human serum IgG-FITC with the wild type Fc ⁇ RIIb.
  • 1 mM IPTG was added and overexpressed at 25 ° C and 250 rpm for 5 hours. After overexpression, the OD 600 value was measured and the cells were recovered by centrifugation at 14000 rpm for 1 minute.
  • the cells were resuspended in 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 min. The wash procedure was repeated twice.
  • the cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] and the extracellular membrane was removed by rotation at 37 ° C for 30 minutes. After centrifugation, the supernatant was removed and 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl 2 , 10 mM MOPS pH 6.8] was added and centrifuged with resuspension.
  • Example 20 Bevacizumab scFv and Bevacizumab scFv-Fc ⁇ RIIa mutant cloning for verifying serum half-life increase
  • VH gene was amplified using vent polymerase and primers BR # 1 and BR # 2 as a template of heavy chain of Bevacizumab, and VL gene was amplified using primers BR # 4 and BR # 5 as light chain template.
  • the amplified gene was assembled using GS linker introduced in primer BR # 3, and ligated with BssH II and Xba I (New England Biolab), followed by cloning into a pMAZ vector, an expression vector for animal cells, to obtain bevacizumab scFv.
  • Fc ⁇ RIIa wild type and Fc ⁇ RIIa variant were amplified using primers BR # 6 and BR # 7, respectively.
  • the amplified Fc ⁇ RIIa gene was assembled using GS linker introduced in BR # 6 to amplify the bevacizumab scFv-Fc ⁇ RIIa wild type and bevacizumab scFv-MG2A45.1 gene respectively.
  • the amplified gene was ligated with restriction enzymes BssH II and Xba I (New England Biolab) and cloned into pMAZ vector, which is an expression vector for animal cells, to obtain pMAZ-bevacizumab scFv, pMAZ-bevacizumab scFv-Fc ⁇ RIIa wild type, pMAZ-bevacizumab scFv -MG2A45.1 were prepared.
  • Table 2 shows the information on the primers used in this example.
  • BR # 1 (Sequence Listing 51 sequence) CGCAGCGAGCGCGCACTCCGAGGTGCAGCTGGTGGAGAGC BR # 2 (SEQ ID NO: 52) ACTAGAGACAGTCACCAGTGTACCCT BR # 3 (SEQ ID NO: 53) AGGGTACACTGGTGACTGTCTCTAGTGGTGGAGGCGGATCAGGCGGTGGCGGCAGTGGAGGGGTGGTAGCGGCGGAGGAGGTTCCGACATCCAGATGACTCAATCACCCAGT BR # 4 (SEQ ID NO: 54 sequence) CCCTAAAATCTAGATCACTAGTGATGGTGATGATGATGTGATCCGCCGGTCCGCTTAATCTCCACTTTGGTTC BR # 5 (SEQ ID NO: 55 sequence) GGTCCGCTTAATCTCCACTTTGGTTC BR # 6 (SEQ ID NO: 56) GAACCAAAGTGGAGATTAAGCGGACCGGCGGAGGCGGGAGTCAGGCTGCCCC
  • the prepared genes were transiently expressed in Expi 293F cells at a size of 300 ml. After the incubation, the cells were removed by centrifugation at 7500 rpm for 15 minutes. The supernatant was taken and equilibrium was adjusted with 25 ⁇ PBS. The mixture was filtered with a 0.2 ⁇ m filter (Merck Millipore) using a bottle top filter. 1 ml slurry of Ni-NTA agarose (Qiagen) equilibrated with PBS was added, and the mixture was stirred at 4 ° C for 16 hours and then poured into a polypropylene column (Thermo Fisher Scientific).
  • Example 22 Bevacizumab scFv produced by animal cell culture, Bevacizumab scFv-Bovacizumab scFv-Fc ⁇ RIIa mutant, an ELISA performed using VEGF for activity and binding assay of Bevacizumab scFv
  • VEGF (Genscript) diluted to 500 ng / ml in 0.05 M Na 2 CO 3 pH 9.6 was immobilized in a flat bottom polystyrene high-bind 96-well microplate (Costar) at 4 ° C for 16 hours, and then 100 ⁇ l And blocked with 5% BSA (0.05% PBST) at room temperature for 1 hour. After washing four times with 0.05% PBST (180 ⁇ l), 50 ⁇ l of serially diluted bevacizumab scFv, bevacizumab scFv-Fc ⁇ RIIa - wild type and bevacizumab scFv-MG2A45.1 proteins were added to each well as a blocking solution.
  • Fc ⁇ RIIa has a property of forming a dimer due to non-covalent binding (Maxwell, KF, MS Powell, MD Hulett, PA Barton, IF McKenzie, TP Garrett, and PM Hogarth 1999. Crystal structure of the human leukocyte Fc receptor, Fc ⁇ RIIa .... Nat Struct Biol 6: 437-442) on the Fc ⁇ RIIa the fusion protein ELISA were confirmed to appear more cohesive by high avidity.
  • Example 23 Fc ⁇ RIIa activity of bevacizumab scFv, bevacizumab scFv-Fc ⁇ RIIa mutant produced through animal cell culture and ELISA performed using rituximab for binding assay
  • the rituximab diluted to 4 ⁇ g / ml in 0.05 M Na 2 CO 3 pH 9.6 was immobilized in a flat bottom polystyrene High Bind 96-well microplate (Costar) at 4 ° C for 16 hours, and then 100 ⁇ l of 5% BSA (in 0.05% PBST) for 1 hour at room temperature. After washing with 0.05 ⁇ l of 0.05% PBST for 4 times, 50 ⁇ l of serially diluted bevacizumab scFv, bevacizumab scFv-Fc ⁇ RIIa wild type and bevacizumab scFv-MG2A45.1 proteins were added to each well as a blocking solution.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Food Science & Technology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Transplantation (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 Fc 감마 수용체 변이체를 포함하는 폴리펩타이드에 관한 것이다. 본 발명의 Fc 감마 수용체 변이체는 Fc 감마 수용체의 일부 아미노산 서열을 다른 아미노산 서열로 치환하여 최적화함으로써 면역글로불린에 대한 선택적 결합력이 우수하여 약물의 체내 반감기 증가, 면역글로블린의 검출 및 정제, 장기이식반응 억제 또는 자가면역질환의 예방 또는 치료용도로 유용하게 활용될 수 있다.

Description

Fc 감마 수용체 변이체들
본 발명은 IgG 항체에 대해 결합력이 향상된 Fc 감마 수용체 변이체에 관한 것이다.
인체 면역세포들에서 발현되는 Fc감마 수용체들(FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa)은 IgG 항체 Fc영역(lower hinge region 및 upper CH2 region)에 결합을 하는데, 이들 Fc감마 수용체들 중 FcγRI은 혈중 IgG에 가장 높은 친화도를 가지고 있지만 열적안정성(thermostability)이 매우 좋지 않고 발현율이 낮아서 의료용으로 개발하거나 산업적 적용을 목적으로 개발하기가 어려움이 있다.
반면, FcγRIIa는 대식세포(macrophage)와 단핵구(monocyte), 호중구(neutrophil) 등의 다양한 면역세포들 표면 발현되어 있는 세포막 단백질로써 IgG와의 친화도는 낮은 편에 속는 수용체이다(KD = ~10-6). FcγRIIa는 IgG 항체 Fc 영역의 위쪽 부분 (lower hinger region과 upper CH2 region)에 결합하고 세포 내부의 신호전달 메커니즘을 통해 해당 면역세포를 활성화시킨다.
체내에 존재하는 야생형 Fc감마 수용체보다 IgG에 대해 월등히 높은 친화도를 갖는 세포 바깥영역에 존재하는 Fc감마 수용체를 soluble 하게 생산하여 주입할 수 있다면, 자가세포를 항원으로 인지한 자가항체가 면역세포 표면의 Fc감마 수용체에 결합하는 것을 효과적으로 저해하여, 자가 항체(Auto-antibody)가 장기에 축적되어 자가 세포를 외부의 항원으로 인지하고 염증을 일으키는 질환인 자가면역질환을 치료하는데, 결정적인 도움을 줄 수 있다.
또한, 일반적으로 항체를 제외한 대부분의 단백질 의약품들은 체내에서 지속시간이 짧고 혈중 반감기가 24시간을 넘지 못한다. 항체 IgG는 음세포작용(pinocytosis)에 의해 무작위로 세포 내로 들어간 뒤, 약산성 pH 조건인 엔도좀에서 FcRn과 결합하여 분해되지 않고 중성 pH인 혈중으로 반출됨으로써 약 3주 동안 체내에서 유지되는 특징이 있는데, Fc감마 수용체가 항체 IgG과 결합하는 과정을 이용하여 단백질 의약품의 혈중 반감기를 증가시키는 융합 파트너로 개발이 가능하다.
타깃 질병에 높은 특이성과 낮은 부작용을 보이는 단백질 의약에 대한 수요가 꾸준히 증가하고 있고, 이에 발맞추어 단백질의약의 효능 및 안정성을 개선하기 위한 연구들이 전 세계적으로 활발히 진행되고 있다. 특히 단백질 의약의 혈중 반감기(serum half-life)는 해당 단백질의 작용기작, 부작용 정도, 치료 효능, 생산 비용, 투여 횟수 등에 결정적인 역할을 하기 때문에 세계적 선두 제약기업들과 단백질 공학 선도 연구 그룹들을 중심으로 단백질 의약의 반감기 증가를 위한 연구들이 활발하게 수행되고 있다.
대표적으로 PEG(polyethylene glycol) 고분자를 이용하여 단백질을 수식하거나 목적 단백질을 항체 Fc나 알부민(albumin)에 융합시켜 혈중 반감기를 증가시키는 기술들이 이용되고 있다.
PEG와 같은 생체 친화적 고분자로 목적 단백질의 특정 부위에 접합(conjugation)시키거나 혹은 여러 부위에 비특이적으로 결합시킬 경우 단백질 분해 효소에 의한 분해를 줄이고, 분자량 증가를 통해 신장에서 배설이 감소되고 혈중 유지 시간이 증가될 수 있다. 1990년 Enzon사에 의해 개발된 PEG로 수식된 adenosine deaminase가 US FDA에서 허가를 얻어 시판된 이후 현재까지 10개 이상의 제품이 시판되어 임상에 이용되고 있다. Roche사는 C형 간염의 치료제로 사용되는 Interferon-α를 PEG 고분자로 수식(Pegylation)하여 PEGASYS라는 상품명으로 상업화하였고, Amgen사에서는 백혈구 감소증을 치료하기 위해 개발한 Filgrastim (Neupogen)의 N-말단에 20 kDa PEG를 수식한 지속형 제형인 Neulasta를 상업화하여 기존시장을 확대하였다. 그러나 많은 양의 단백질을 주사할 경우 체내에서 PEG moiety 제거가 늦어지게 되고 분자량이 큰 PEG를 장기적으로 주사할 경우에 부작용 문제가 야기되는 것으로 보고되고 있다. 혈중 안정성은 PEG 분자량 크기와 밀접한 관계가 있는데, 분자량 40,000 Da 이상의 PEG 제조가 쉽지 않고, 분자량이 증가할수록 단백질과의 반응성이 낮아 수율이 낮아지며, 단백질 자체 역가도 급격히 떨어지는 것으로 알려져 있다. 또한 PEG 고분자는 다양한 분자량 분포를 가진 중합체의 혼합물이기 때문에 PEG로 접합된 단백질 치료제는 비균질성 (heterogeniety)을 가지게 되고 생산과 품질관리의 어려움을 발생시킨다. 따라서 단백질 의약품의 혈중 반감기 증가를 위해서는 PEG와 같은 고분자 수식과 차별화 되는 새로운 단백질 공학기술 개발이 절실히 요구되고 있는 상황이다.
약리 효과가 있는 단백질 의약품의 혈중 반감기 향상을 위해 항체 Fc와 융합한 다양한 Fc-융합단백질 의약품이 연구 개발되고 있으며, 치료용 단백질에 인간항체 Fc 영역을 융합하여 발현함으로써 FcRn 수용체의 결합을 통해 세포 재순환 기작을 이용할 수 있다. 1998년 interferon-α와 Fc 절편을 펩타이드 링커로 연결하는 기술이 개발되었으며, 2003년에는 인간 erythropoietin을 펩타이드 링커로 Fc와 연결하는 융합단백질이 개발되었다. 대표적인 예로 etanercept(Enbrel®)는 관절염을 일으키는 주된 사이토카인(cytokine)인 TNF-α 저해제로 TNF-α 수용체 중 세포 바깥쪽 부분에 존재하는 부분을 면역글로불린 Fc 단편과 융합시킨 단백질 의약품이고, etanercept를 포함해 현재 10개의 Fc 융합 단백질들이 US FDA에 허가를 받아 임상에 이용되고 있다. 그러나 Fc 절편이 융합된 단백질 치료제들은 Fc 고유의 기능인 면역세포 활성화 기능에 의한 세포독성 문제를 극복해야 하는 과제가 대두되었으며, receptor-mediated clearance에 의해 반감기가 현저하게 증가하지 않는다는 단점이 있다. 또한 상동이중체(homodimer)로 존재하는 Fc 단편과 융합되어 발현되어야 하므로 항상 dimer 형태로 발현이 되어 목적 단백질의 약리 활성을 변화 시킨다는 문제점이 있다.
항체 Fc 절편뿐만 아니라 인간 혈청에서 높은 농도로 존재하는 알부민(albumin)을 융합 파트너로 사용하여 목적 단백질 치료제의 혈중 반감기를 증가시키는 연구들도 수행되고 있다. 알부민 융합기술을 보유하고 있는 Human genome science사는 인간성장 호르몬, 인터페론 등의 단백질 의약에 알부민을 융합하여 현재 임상진행 중에 있다. 알부민은 분자량이 큰 거대단백질(분자량: 66.5 kDa)이기 때문에 융합단백질 형성 시 목적 단백질의 활성을 저해할 가능성을 내재하고 있다.
FcγR 변이체를 이용하는 기술은 현재까지 시도되지 않은 새로운 접근방법으로써 발굴되는 FcγR 변이체를 임상에 이용되고 있는 다양한 단백질 치료제와 신약 후보 단백질들에 적용함으로써 혈중 반감기를 크게 향상 시킬 수 있을 것으로 예상된다. 또한 약리학적 효능은 가지고 있지만 체내에서 낮은 반감기와 짧은 체내 유지시간 때문에 임상 적용이 어려운 수많은 펩타이드 의약품 치료제 개발에도 발굴된 FcγR 변이체 융합을 통해 혈중 반감기를 크게 증가시킬 수 있다. 따라서 약물 타깃 조직에서 오랜 시간동안 효능 발휘를 가능하게 함으로써, 투여 용량과 빈도를 획기적으로 줄일 수 있고, 신약개발 비용 감소와 신약개발 가능성을 크게 향상시킬 수 있을 것으로 보인다.
추가적으로, 자가면역질환은 체내에서 생성되는 항체가 자가의 세포를 인식하여 면역반응을 일으키는 면역세포들이 자가 세포를 공격하는 질병인데, 면역세포들은 항체와 결합할 수 있는 FcγRs이 존재하는데 항체와 결합하게 되면 ADCC나 ADCP와 같은 면역 반응이 일어나게 된다. 따라서 soluble한 FcγRIIa을 투여함으로써 자가 세포를 인식하는 항체와 결합하게 되어 자가세포를 인식하더라도 면역세포와 결합하지 못하게 차단할 수 있기 때문에 자가면역질환 치료제로도 개발이 가능한 장점을 가질 수 있다. 이러한 목적으로 IgG 친화도가 높지 않은 야생형 soluble한 FcγRIIb을 이용하여 자가면역질환을 억제하는 약물이 현재 인간을 대상으로 한 임상 2상 시험 중이다(참고문헌, Sondermann et. al., Curr Opin Immunol, 2016).
상기한 배경기술로서 설명된 사항들은 본 발명의 배경에 대한 이해 증진을 위한 것일 뿐, 이 기술분야에서 통상의 지식을 가진 자에게 이미 알려진 종래기술에 해당함을 인정하는 것으로 받아들여져서는 안 될 것이다.
본 발명자들은 체내에서 낮은 반감기와 짧은 체내 유지시간 때문에 임상 적용이 어려운 수많은 펩타이드 의약품 치료제의 혈중 반감기를 연장할 수 있는 Fc 감마 수용체 변이체를 찾고자 노력하였다. 그 결과, 일부 아미노산 서열을 다른 아미노산 서열로 치환하여 최적화함으로써 야생형과 비교하여 IgG 결합력이 획기적으로 연장된 Fc 감마 수용체를 확인함으로써 본 발명을 완성하였다.
따라서, 본 발명의 목적은 Fc 감마 수용체 변이체를 포함하는 폴리펩타이드를 제공하는데 있다.
본 발명의 다른 목적은 상기 폴리펩타이드를 코딩하는 핵산분자를 제공하는데 있다.
본 발명의 또 다른 목적은 상기 핵산분자를 포함하는 벡터를 제공하는데 있다.
본 발명의 또 다른 목적은 상기 벡터를 포함하는 숙주세포를 제공하는데 있다.
본 발명의 또 다른 목적은 상기 폴리펩타이드, 핵산분자 또는 벡터를 포함하는 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 폴리펩타이드 또는 핵산분자를 포함하는 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 폴리펩타이드를 포함하는 IgG 항체 또는 IgG 항체의 Fc 부위를 검출하기 위한 키트를 제공하는데 있다.
본 발명의 또 다른 목적은 상기 폴리펩타이드와 생리활성 단백질 또는 생리활성 펩타이드가 결합된 단백질 또는 펩타이드 융합체를 제공하는데 있다.
본 발명의 또 다른 목적은 Fc 감마 수용체 변이체를 포함하는 폴리펩타이드의 제조방법을 제공하는데 있다.
본 발명의 또 다른 목적은 시료에 포함된 IgG 항체 또는 IgG 항체의 Fc 부위의 존재를 확인하는 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 시료에 포함된 IgG 항체 또는 IgG 항체의 Fc 부위를 정제하는 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 IgG 항체 또는 IgG 항체의 Fc 부위에 대한 결합력이 향상된 인간 Fc 감마 수용체 변이체를 스크리닝하는 방법을 제공하는데 있다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명의 일 양태에 따르면, 본 발명은 Fc 감마 수용체 변이체를 포함하는 폴리펩타이드를 제공한다.
본 발명자들은 체내에서 낮은 반감기와 짧은 체내 유지시간 때문에 임상 적용이 어려운 수많은 펩타이드 의약품 치료제의 혈중 반감기를 연장할 수 있는 Fc 감마 수용체 변이체를 찾고자 노력하였다. 그 결과, 일부 아미노산 서열을 다른 아미노산 서열로 치환하여 최적화함으로써 야생형과 비교하여 IgG 결합력이 획기적으로 연장된 Fc 감마 수용체를 확인하였다.
본 명세서에서 용어, “Fc 감마 수용체 변이체”는 Fc 감마 수용체의 폴리펩타이드가 야생형(wild type) Fc 감마 수용체와는 다른 것을 의미한다. 이러한 차이로서는 면역 글로불린의 결합능 차이, 치료 능력의 차이, 아미노산 조성 또는 용해성 등을 들 수 있다. 바람직하게는 면역 글로불린 또는 이의 Fc 부위(Fc region)에 결합할 수 있는 천연의 또는 합성 아미노산으로 구성되는 Fc 감마 수용체에서 1 또는 그 이상의 아미노산 서열이 변형된 것을 의미하며, 상기 변형은 아미노산이 치환, 결실 또는 삽입된 형태를 포함한다.
면역 글로불린은 IgG, IgE, IgA, IgM 또는 IgD 중 어느 하나일 수 있으며, 바람직하게는 IgG인 것이다. 면역 글로불린은 인간, 래트, 마우스, 소, 양, 염소 및 닭, 타조나 낙타를 포함한 어느 동물 유래일 수 있으며, 바람직하게는 인간 유래이다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 Fc 감마 수용체 변이체는 야생형의 Fc 감마 수용체와 비교하여 향상된 특성을 갖는다.
본 명세서에서 용어, “향상된 특성”이라는 말은 야생형의 감마 Fc 수용체에 비해 바람직한 특성을 얻을 수 있는 것을 의미한다. 이 특성은 면역글로블린 또는 Fc에 대한 결합능을 증가 또는 촉진시키거나, 면역글로블린의 Fc에 결합하여 면역기능을 조절 또는 억제시키거나, 치료제로서 사용되는 폴리펩타이드 또는 단백질의 혈청 중의 반감기를 증가시키거나, 목적하는 폴리펩타이드 또는 단백질(예를 들어, 면역글로블린)의 검출 가능하게 하거나 이에 대한 검출 정확도를 향상시키는 것일 수 있다.
본 명세서에서 용어, “면역 글로불린과의 결합능의 변화”라는 것은 본 발명의 Fc 감마 수용체 변이체가 야생형의 Fc 감마 수용체의 면역 글로불린 결합 활성과는 다른 활성을 가지는 것을 의미한다. 이러한 것으로서는 면역 글로불린과의 수용체의 결합능, 즉 수용체가 야생형의 Fc 감마 수용체와 비교한 경우 면역 복합체, 응집체, 이량체 또는 단량체 면역 글로불린과의 결합능이 변화하는 것을 들 수 있다.
본 명세서에서 용어, “면역 글로불린과의 결합능에 영향을 주는 1 또는 그 이상의 아미노산의 변형”은 야생형의 Fc 감마 수용체와 면역 글로불린의 결합에 관련된 아미노산 잔기 또는 아미노산 잔기의 영역이 Fc 감마 수용체 내에서 변화하는 것을 의미한다. 면역 글로불린의 결합에 관련된 아미노산은 직접 면역 글로불린의 결합으로 기능하는 것이라도 또는 결합이 발생하도록 수용체의 구조상의 일체성을 유지하는 것 등에 의해 간접적으로 발생하는 것일 수 있다. 이러한 변화는 치환, 결실 또는 삽입된 결과일 수 있다.
본 발명의 일 실시예에 따르면, 본 발명의 Fc 감마 수용체 변이체는 야생형(wild type) Fc 감마 수용체와 비교하여 IgG 항체 또는 IgG 항체의 Fc 부위에 대한 결합력이 향상된다. 상기 변이된 Fc 감마 수용체 변이체는 야생형 Fc 감마 수용체와 비교하여 10% 이상, 20% 이상, 30% 이상, 40% 이상, 50% 이상, 60% 이상, 70% 이상, 80% 이상 또는 90% 이상 결합력이 향상되거나, 야생형(wild type) Fc 감마 수용체와 비교하여 2배 이상, 3배 이상, 4배 이상, 5배 이상, 6배 이상, 7배 이상, 8배 이상, 9배 이상, 10배 이상, 20배 이상 또는 30 배 이상 증가될 수 있다(실시예 2, 8, 10, 11, 13, 15 내지 17 및 19).
본 발명의 바람직한 구현예에 따르면, 상기 변이체는 야생형(wild type) Fc 감마 수용체와 비교하여 IgG 항체 또는 IgG 항체의 Fc 부위에 대한 결합력이 3배 이상 향상된 것이다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 Fc 수용체는 단리된 조제물의 형태를 가지며, 이것은 다른 단백질 및/또는 비단백질성 분자가 제거되어 있을 정도 정제되는 것을 의미한다.
조제물의 순도는 중량, 활성, 아미노산의 유사성, 항체의 반응성 또는 다른 기존의 수단에 의해 측정되었을 때의 비-Fc 수용체형 분자에 대해서 적어도 40％ 이상, 바람직하게는 60％ 이상, 보다 바람직하게는 75％ 이상, 보다 더 바람직하게는 85％ 이상의 Fc 수용체 특성을 나타내는 것이다.
본 발명의 Fc 수용체를 포함하는 폴리펩타이드는 세포막 또는 지지체 수단에 결합시키거나, 또는 가용성 형태를 가지는 것일 수 있다. 약제학적 조성물로서 사용하려고 할 때는 상기 폴리펩타이드는 가용성인 것이 바람직하다.
상기 폴리펩타이드는 적당한 조건 하에서 검출 가능한 시그널을 형성하는 리포터 분자로 표지될 수 있다. 이러한 리포터 분자로서는 방사성 뉴클레오타이드(radio-nucleotide), 화학 발광 분자, 생물 발광 분자, 형광 분자 또는 효소를 들 수 있다. 일반적으로 사용되는 효소로서는 다른 것 중 서양 고추냉이의 퍼옥시다제, 포도당 산화효소, β-갈락토시다아제 및 알칼리 포스파타아제 등을 들 수 있다.
바람직하게는, 본 발명의 Fc 수용체 변이체는 야생형의 Fc 수용체의 아미노산의 자연적 또는 인공적 돌연변이체(mutant), 변이체(variant) 또는 유도체를 포함한다. 상기 돌연변이체, 변이체 또는 유도체의 기초를 형성하는 야생형의 Fc 수용체는 사람 또는 동물종 유래일 수 있다. 이러한 동물종은 마우스, 래트, 토끼, 소, 양, 낙타 또는 염소종 등의 포유동물종인 것이 바람직하다.
본 발명의 Fc 수용체 변이체를 제조하기 위한 아미노산 변형, 즉, 결손, 삽입 또는 치환은 기존의 수단에 의해 수행된다. Fc 수용체 변이체가 재조합체 유래일 때는 이 분자를 코드화하는 핵산은 1 이상의 아미노산의 삽입 혹은 치환에 관하는 적당한 코드를 그 배열 중에 도입하거나 코딩 배열에서 적당하게 결손시킬 수도 있다. 수용체형 분자를 denovo 펩타이드 합성에 의해 제조할 때는 목적으로 하는 아미노산 서열을 도입할 수도 있다.
본 발명의 바람직한 구현예에 따르면, 상기 변이체는 서열목록 제43서열 또는 서열목록 제49서열의 야생형(wild type) Fc 감마 수용체의 서열에서 117번째 아미노산 및 159번째 아미노산이 변형된 것이다.
본 발명의 바람직한 구현예에 따르면, 상기 변이체는 서열목록 제43서열 또는 서열목록 제49서열의 야생형(wild type) Fc 감마 수용체의 서열에서 117번째 아미노산, 119번째 아미노산 및 159번째 아미노산이 변형; 및 추가적으로 86번째 아미노산, 127번째 아미노산 및 171번째 아미노산으로 구성된 군으로부터 선택되는 1 또는 그 이상의 아미노산 변형;된 것이다.
본 발명의 바람직한 구현예에 따르면, 상기 변이체는 서열목록 제43서열 또는 서열목록 제49서열에서 117번째 아미노산이 아스파라긴(N)으로 치환되고 159번째 아미노산이 글루타민(Q)으로 치환된 서열을 포함하는 Fc 감마 수용체 변이체인 것이다.
본 발명의 바람직한 구현예에 따르면, 상기 변이체는 상기 서열목록 제43서열 또는 서열목록 제49서열에서 상기 117번째 아미노산 및 159번째 아미노산 치환과 더불어, 추가적으로 55번째 아미노산, 86번째 아미노산, 119번째 아미노산, 127번째 아미노산 및 171번째 아미노산으로 구성된 군으로부터 선택되는 1 또는 그 이상의 아미노산이 치환된 것이다.
본 발명의 바람직한 구현예에 따르면, 상기 변이체는 서열목록 제43서열 또는 서열목록 제49서열에서 86번째 아미노산이 아스파르트산(D)으로, 117번째 아미노산이 아스파라긴(N)으로, 119번째 아미노산이 메티오닌(M) 또는 발린(V)으로, 127번째 아미노산이 류신(L)으로, 159번째 아미노산이 글루타민(Q)으로, 171번째 아미노산이 글루탐산(E)으로 치환된 서열을 포함하는 Fc 감마 수용체 변이체인 것이다.
본 발명의 바람직한 구현예에 따르면, 상기 변이체는 상기 제43서열 또는 서열목록 제49서열에서 117번째 아미노산 및 159번째 아미노산 치환과 더불어, 추가적으로 55번째 아미노산이 히스티딘(H)으로, 86번째 아미노산이 아스파르트산(D)으로, 119번째 아미노산이 메티오닌(M) 또는 발린(V)으로, 127번째 아미노산이 류신(L)으로, 그리고 171번째 아미노산이 글루탐산(E)으로 치환된 군으로부터 선택되는 1 또는 그 이상의 아미노산이 치환된 것이다.
본 발명의 바람직한 구현예에 따르면, 상기 변이체는 서열목록 제44서열을 포함하는 것이다.
본 발명의 바람직한 구현예에 따르면, 상기 변이체는 서열목록 제45서열을 포함하는 것이다.
본 발명의 바람직한 구현예에 따르면, 상기 변이체는 서열목록 제46서열을 포함하는 것이다.
본 발명의 바람직한 구현예에 따르면, 상기 변이체는 서열목록 제47서열을 포함하는 것이다.
본 발명의 바람직한 구현예에 따르면, 상기 변이체는 서열목록 제48서열을 포함하는 것이다.
본 발명의 바람직한 구현예에 따르면, 상기 변이체는 서열목록 제50서열을 포함하는 것이다.
본 발명이 포함하는 Fc 감마 수용체 변이체는 다양한 종류의 Fc 감마 수용체(FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa 등)의 변이체를 포함하며, 바람직하게는 Fc 감마 수용체 IIa 변이체 또는 Fc 감마 수용체 IIb 변이체인 것이다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 폴리펩타이드를 코딩하는 핵산분자, 상기 핵산분자를 포함하는 벡터 또는 상기 벡터를 포함하는 숙주세포를 제공한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 하기의 단계를 포함하는 Fc 감마 수용체 변이체를 포함하는 폴리펩타이드의 제조방법을 제공한다:
a) 상기의 폴리펩타이드를 코딩하는 핵산분자를 포함하는 벡터를 포함하는 숙주세포를 배양하는 단계; 및
b) 상기 숙주세포에 의해 발현된 폴리펩타이드를 회수하는 단계.
본 발명의 핵산분자는 단리된 것이거나 재조합된 것일 수 있으며, 단일쇄 및 이중쇄 형태의 DNA 및 RNA뿐만 아니라 대응하는 상보성 서열이 포함된다. “단리된 핵산”은 천연 생성 원천에서 단리된 핵산의 경우, 핵산이 단리된 개체의 게놈에 존재하는 주변 유전 서열로부터 분리된 핵산이다. 주형으로부터 효소적으로 또는 화학적으로 합성된 핵산, 예컨대 PCR 산물, cDNA 분자, 또는 올리고뉴클레오타이드의 경우, 이러한 절차로부터 생성된 핵산이 단리된 핵산분자로 이해될 수 있다. 단리된 핵산분자는 별도 단편의 형태 또는 더 큰 핵산 구축물의 성분으로서의 핵산 분자를 나타낸다. 핵산은 다른 핵산 서열과 기능적 관계로 배치될 때 “작동가능하게 연결”된다. 예를 들면, 전서열 또는 분비 리더(leader)의 DNA는 폴리펩타이드가 분비되기 전의 형태인 전단백질(preprotein)로서 발현되는 경우 폴리펩타이드의 DNA에 작동가능하게 연결되고, 프로모터 또는 인핸서는 폴리펩타이드 서열의 전사에 영향을 주는 경우 코딩 서열에 작동가능하게 연결되며, 또는 리보솜 결합 부위는 번역을 촉진하도록 배치될 때 코딩 서열에 작동가능하게 연결된다. 일반적으로 “작동가능하게 연결된”은 연결될 DNA 서열들이 인접하여 위치함을 의미하며, 분비 리더의 경우 인접하여 동일한 리딩 프레임 내에 존재하는 것을 의미한다. 그러나 인핸서는 인접하여 위치할 필요는 없다. 연결은 편리한 제한 효소 부위에서 라이게이션에 의해 달성된다. 이러한 부위가 존재하지 않는 경우, 합성 올리고뉴클레오타이드 어댑터 또는 링커를 통상적인 방법에 따라 사용한다.
본 명세서에서 용어 “벡터”는 핵산 서열을 복제할 수 있는 세포로의 도입을 위해서 핵산 서열을 삽입할 수 있는 전달체를 의미한다. 핵산 서열은 외생(exogenous) 또는 이종(heterologous)일 수 있다. 벡터로서는 플라스미드, 코스미드 및 바이러스(예를 들면 박테리오파지)를 들 수 있으나, 이에 제한되지 않는다. 당업자는 표준적인 재조합 기술에 의해 벡터를 구축할 수 있다(Maniatis, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1988; 및 Ausubel et al., In: Current Protocols in Molecular Biology, John, Wiley & Sons, Inc, NY, 1994 등).
본 명세서에서 용어 “발현 벡터”는 전사되는 유전자 산물 중 적어도 일부분을 코딩하는 핵산 서열을 포함한 벡터를 의미한다. 일부의 경우에는 그 후 RNA 분자가 단백질, 폴리펩타이드, 또는 펩타이드로 번역된다. 발현 벡터에는 다양한 조절서열을 포함할 수 있다. 전사 및 번역을 조절하는 조절서열과 함께 벡터 및 발현 벡터에는 또 다른 기능도 제공하는 핵산 서열도 포함될 수 있다.
본 명세서에서 용어 “숙주세포”는 진핵생물 및 원핵생물을 포함하며, 상기 벡터를 복제할 수 있거나 벡터에 의해 코딩되는 유전자를 발현할 수 있는 임의의 형질 전환 가능한 생물을 의미한다. 숙주세포는 상기 벡터에 의해 형질감염(transfected) 또는 형질전환(transformed) 될 수 있으며, 이는 외생의 핵산분자가 숙주세포 내에 전달되거나 도입되는 과정을 의미한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 하기의 단계를 포함하는 시료에 포함된 IgG 항체 또는 IgG 항체의 Fc 부위의 존재를 확인하는 방법을 제공한다:
a) IgG 항체 또는 IgG 항체의 Fc 부위의 존재 여부를 판단하고자 하는 시료를 준비하는 단계;
b) 상기 시료에 상기 폴리펩타이드를 혼합하여 서로 결합시키는 단계; 및
c) 상기 폴리펩타이드가 결합된 IgG 항체 또는 IgG 항체의 Fc 부위의 존재를 확인하는 단계.
본 발명의 또 다른 양태에 따르면, 본 발명은 하기의 단계를 포함하는 시료에 포함된 IgG 항체 또는 IgG 항체의 Fc 부위를 정제하는 방법을 제공한다 :
a) IgG 항체 또는 IgG 항체의 Fc 부위를 포함하는 시료에 상기 폴리펩타이드를 혼합하여 서로 결합시키는 단계; 및
b) 상기 폴리펩타이드가 결합된 IgG 항체 또는 IgG 항체의 Fc 부위를 정제하는 단계.
상술한 바와 같이, 본 발명의 Fc 감마 수용체 변이체는 야생형 Fc 감마 수용체와 비교하여 IgG 항체 또는 IgG 항체의 Fc 부위에 대한 향상된 결합력을 갖기 때문에, 상기 특성을 활용하여 IgG 항체 또는 IgG 항체의 Fc 부위의 존재를 확인하거나, 이를 검출하거나, 이를 정제하는 용도로 유용하게 활용할 수 있다.
폴리펩타이드의 분리 및 정제는 몇 가지 공지된 기술 중 어느 하나에 의해 수행될 수 있다. 예를 들어, 이온교환 크로마토그래피, 겔 여과 크로마로그래피 및 친화성 크로마토그래피, 고속액체크로마토그래피(HPLC), 역상고속액체크로마토그래피, 제조용 디스크겔전기영동법을 들 수 있으나 이에 한정되지는 않는다. 상기 폴리펩타이드의 분리 및 정제 기술은 통상적인 방법에 의한 폴리펩타이드의 변형을 요구할 수 있다. 예를 들어, 니켈 컬럼 정제 시 단백질에 히스티딘 태그를 부가할 수 있다. 다른 변형으로는 더 높거나 더 낮은 활성을 유발하고, 더 높은 단백질 생산을 허용하거나, 단백질의 정제를 단순화할 수 있다. 다른 태그로는 플래그 태그(flag-tag) 또한 포함할 수 있다. 이러한 태그는 바람직하게는 진핵생물 숙주에 사용된다.
폴리펩타이드를 정제하기 위한 방법으로는, 용해도의 변화를 통한 단백질 정제 방법으로 황산암모늄 침전법을 포함한다. 이러한 방법은 염석법(salting out)과 같은 일반적인 기술보다 특정한 것이다. 황산암모늄은 그 용해도가 높으므로, 높은 이온강도의 염 용액을 허용할 수 있어 일반적으로 사용된다. 폴리펩타이드의 용해도는 상기 용액의 이온강도에 따라 달라지므로, 염 농도에 따라 변화한다.
폴리펩타이드의 용해도는 높은 이온강도에서 뚜렷하게 다르기 때문에, 염석법은 특정한 폴리펩타이드의 정제에 도움이 되는 매우 유용한 방법이다. 코스모트로픽 황산암모늄(kosmotropic ammonium sulfate) 첨가에 의해, 풀림 및 이상접힘 종류 같은 폴딩 부산물뿐 아니라, 숙주세포 유래의 세포벽 성분과 같은 불순물 및 폴리펩타이드가 침전된다. 침전 농도의 증가에 따라 침전 효과는 증가하므로, Fc 수용체 변이체가 고농도의 황산암모늄에서와 같은 침전에 대해 저항하는 동안은 고순도 Fc 수용체 변이체 제조물질을 획득할 수 있다.
상기 침전된 폴리펩타이드는 원심분리에 의해 제거되고, 용액 안에 여전히 폴리펩타이드 오염물의 최대량이 남아있는 동안, 황산암모늄 농도는 대부분의 관심 폴리펩타이드가 침전하는 값으로 증가한다. 다음 정제 단계를 위해 상기 침전된 관심 폴리펩타이드는 원심분리하여 회수되고, 새로운 버퍼에 용해된다.
본 발명의 또 다른 양태에 따르면, 본 발명은 하기의 단계를 포함하는 IgG 항체 또는 IgG 항체의 Fc 부위에 대한 결합력이 향상된 Fc 감마 수용체 변이체를 스크리닝하는 방법을 제공한다 :
a) 서열목록 제43서열 또는 서열목록 제49서열에서 117번째 아미노산이 아스파라긴(N)으로 치환되고 159번째 아미노산이 글루타민(Q)으로 치환된 서열을 포함하는 Fc 감마 수용체 변이체 라이브러리를 구축하는 단계; 및
b) 상기 라이브러리에서 상기 두 가지의 아미노산 서열의 치환만을 포함하는 Fc 감마 수용체 변이체와 비교하여 IgG 항체 또는 IgG 항체의 Fc 부위에 대한 결합력이 보다 향상된 Fc 감마 수용체 변이체를 선별하는 단계.
본 발명의 또 다른 양태에 따르면, 본 발명은 하기의 단계를 포함하는 IgG 항체 또는 IgG 항체의 Fc 부위에 대한 결합력이 향상된 Fc 감마 수용체 변이체를 스크리닝하는 방법을 제공한다 :
a) 서열목록 제43서열 또는 서열목록 제49서열에서 117번째 아미노산이 아스파라긴(N)으로 치환되고 159번째 아미노산이 글루타민(Q)으로 치환된 서열을 포함하고, 추가적으로 86번째 아미노산, 127번째 아미노산 및 171번째 아미노산으로 구성된 군으로부터 선택되는 1 또는 그 이상의 아미노산의 치환을 포함하는 Fc 감마 수용체 변이체 라이브러리를 구축하는 단계; 및
b) 상기 라이브러리에서 상기 117번째 및 159번째의 두 가지의 아미노산 서열의 치환만을 포함하는 Fc 감마 수용체 변이체와 비교하여 IgG 항체 또는 IgG 항체의 Fc 부위에 대한 결합력이 보다 향상된 Fc 감마 수용체 변이체를 선별하는 단계.
본 발명의 또 다른 양태에 다르면, 본 발명은 하기의 단계를 포함하는 IgG 항체 또는 IgG 항체의 Fc 부위에 대한 결합력이 향상된 Fc 감마 수용체 변이체를 스크리닝하는 방법을 제공한다 :
a) 서열목록 제43서열 또는 서열목록 제49서열에서 55번째 아미노산이 히스티딘(H)으로, 117번째 아미노산이 아스파라긴(N)으로, 119번째 아미노산이 발린(V)으로, 159번째 아미노산이 글루타민(Q)으로, 171번째 아미노산이 글루탐산(E)으로 치환된 서열을 포함하는 Fc 감마 수용체 변이체 라이브러리를 구축하는 단계; 및
b) 상기 라이브러리에서 상기 55번째, 117번째, 119번째, 159번째 및 171번째의 다섯 가지의 아미노산 서열의 치환만을 포함하는 Fc 감마 수용체 변이체와 비교하여 IgG 항체 또는 IgG 항체의 Fc 부위에 대한 결합력이 보다 향상된 Fc 감마 수용체 변이체를 선별하는 단계.
본 발명의 스크리닝 방법을 이용하면, Fc 감마 수용체 변이체와 비교하여 IgG 항체 또는 IgG 항체의 Fc 부위에 대한 결합력이 보다 향상된 Fc 감마 수용체 변이체를 유용하게 선별할 수 있다.
본 발명의 스크리닝 방법에 의해 선별된 변이체는 하기의 아미노산 변형을 추가적으로 포함할 수 있다: 서열목록 제43서열 또는 서열목록 제49서열에서 55번째 아미노산, 86번째 아미노산, 119번째 아미노산, 127번째 아미노산 및 171번째 아미노산으로 구성된 군으로부터 선택되는 1 또는 그 이상의 아미노산이 치환.
본 발명의 바람직한 구현예에 따르면, 추가적으로 55번째 아미노산이 히스티딘(H)으로, 86번째 아미노산이 아스파르트산(D)으로, 119번째 아미노산이 메티오닌(M) 또는 발린(V)으로, 127번째 아미노산이 류신(L)으로, 그리고 171번째 아미노산이 글루탐산(E)으로 치환된 군으로부터 선택되는 1 또는 그 이상의 아미노산이 치환된 것이다.
본 발명의 일 실시예에 따르면, 상기 스크리닝 방법을 통하여, IgG 항체 또는 IgG 항체의 Fc 부위에 대한 결합력이 보다 향상된 Fc 감마 수용체 변이체를 선별하였다(실시예 7 및 8).
본 발명의 스크리닝 방법은 형광표지세포분리(FACS) 스크리닝, 또는 다른 자동화된 유세포 분석 기술을 사용할 수 있다. 유세포 분석기를 실시하기 위한 기기는 당업자에게 공지이다. 그러한 기기의 예로는 FACSAria, FACS Star Plus, FACScan 및 FACSort 기기(Becton Dickinson, Foster City, CA), Epics C(Coulter Epics Division, Hialeah, FL), MOFLO(Cytomation, Colorado Springs, Colo.), MOFLO-XDP (Beckman Coulter, Indianapolis, IN)를 들 수 있다. 일반적으로 유세포 분석기 기술에는 액체 시료 중의 세포 또는 다른 입자의 분리가 포함된다. 전형적으로는 유세포 분석기의 목적은 분리된 입자를 이들의 하나 이상의 특성(예를 들면 표지된 리간드 또는 다른 분자의 존재)에 대해서 분석하는 것이다. 입자는 센서에 의해 하나씩 통과되며, 크기, 굴절, 광산란, 불투명도, 조도, 형상, 형광 등에 기초하여 분류된다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 폴리펩타이드, 핵산분자 또는 벡터를 포함하는 조성물을 제공한다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 조성물은 시료에 포함된 IgG 항체 또는 IgG 항체의 Fc 부위를 검출하기 위한 것이다.
본 명세서에서 용어, “시료”는 IgG 항체 또는 IgG 항체의 Fc 부위를 포함할 가능성이 있는 물질을 의미한다. 또한, 피검자로부터 자연적 또는 인위적으로 분리된 것으로 체외로 분리된 분변, 세포, 혈액, 혈장, 혈청, 모발 또는 뇨 등을 이용할 수 있다.
본 명세서에서 사용되는 “피검자”는 인간, 침팬지를 포함한 영장류, 개, 고양이 등의 애완동물, 소, 말, 양, 염소 등의 가축동물, 마우스, 래트 등의 설치 류 등의 포유동물을 포함하는 의미로 해석된다.
상기 조성물은 또한 키트에 포함될 수 있으며, 시료에 포함된 IgG 항체 또는 IgG 항체의 Fc 부위를 검출하거나, 피검자의 IgG 항체의 양을 정량하거나, 환자(예를 들어, 면역과민 반응, 자가면역 질환, 장기이식에 의한 면역의 변화)의 면역 능력 관련 상태를 측정하거나 진단하는 용도로 유용하게 활용될 수 있다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 폴리펩타이드와 생리활성 단백질 또는 생리활성 펩타이드가 결합된 단백질 또는 펩타이드 융합체를 제공한다.
본 발명에 따른 단백질 또는 펩타이드 융합체는, 생리활성 단백질 또는 생리활성 펩타이드를 상기 Fc 감마 수용체 변이체와 결합시켜, 체내 지속성을 유지함으로 체내 반감기를 증가시킨 것을 특징으로 한다.
본 명세서에서 용어, “단백질 융합체(fusion protein/fusion polypeptide)”는 하나 이상의 생리활성을 가진 단백질을 Fc 감마 수용체 변이체의 N-말단 또는 C-말단에 결합시킨 새로운 분자 구성을 가진 단백질 융합체를 의미할 수 있다. 또한 “펩타이드 융합체(fusion peptide)”는 하나 이상의 생리활성을 가진 저분자량의 펩타이드를 Fc 감마 수용체 변이체의 N-말단 또는 C-말단에 결합시킨 새로운 분자 구성을 가진 펩타이드 융합체를 의미한다.
상기 생리활성 단백질 또는 생리활성 펩타이드는 직접 또는 아미노산으로 구성된 링커를 이용하여 Fc 감마 수용체 변이체에 결합될 수 있다.
상기 생리활성 단백질 또는 생리활성 펩티드와 Fc 감마 수용체 변이체는 유전자 재조합 기술을 이용하여 결합시키는 것이 바람직하나, 당 업계에 알려져 있는 가교제를 사용하여 Fc 감마 수용체 변이체의 N-말단, C-말단 또는 유리기에 결합시킬 수 있다.
상기 생리활성 단백질은 호르몬류 및 이의 수용체, 생물학적반응 조절물질 (biological response modifier) 및 이의 수용체, 사이토카인류 및 이의 수용체, 효소류, 항체류, 항체 단편류 등을 포함할 수 있다. 구체적으로는, 상기 생리활성 단백질은 인간성장호르몬(hGH), 인슐린, 난포자극호르몬(follicle-stimulating hormone, FSH), 인간 융모성 성선자극호르몬(human chorionic gonadotropin), 부갑상선호르몬(parathyroid hormone, PTH), 적혈구 촉진인자(EPO), 혈소판생성 촉진인자(TPO), 과립구 콜로니 자극인자(G-CSF), 과립구 대식세포 콜로니 자극인자(GM-CSF), 인터페론 알파, 인터페론 베타, 인터페론 감마, 인터루킨, 대식세포 (marophage) 활성화 인자, 종양괴사인자(tumor necrosis factor), 조직플라스미노겐 활성체(tissue plasminogen activator), 혈액응고인자 Ⅶ, Ⅶa, VⅢ, Ⅸ, hBMP2 (human bone morphogenic protein 2), KGF(keratinocyte growth factor), PDGF (platelet-derived growth factor), 글루코세레브로시다제(glucocerebrosidase), 알파-갈락토시다제 A(α-galactosidase A), 알파 이두로니다제(α-L-iduronidase), 이두로네이트-2-설파타제(iduronate-2-sulfatase), 락타제(lactase), 아데노신 데아미나제(adenosine deaminase), 부티릴콜린에스터라제(butyrylcholinesterase), 키티나제(chitinase), 글루타메이트 디카복실라제(glutamate decarboxylase), 이미글루세라제(imiglucerase), 리파제(lipase), 유리카제(uricase), 혈소판-활성인자 아세틸하이드롤라제(platelet-activating factor acetylhydrolase), 중성 엔도펩티다제(neutral endopeptidase), 유로키나제, 스트렙토키나제, 마이엘로퍼옥시다제 (myeloperoxidase), 수퍼옥사이드디스뮤타제(superoxide dismutase), 보톨리늄 독소, 콜라게나제, 히알루로니다제(hyaluronidase), L-아스파라기나제(L-asparaginase), 단일클론항체, 다클론항체, scFv, Fab, Fab', F(ab')2 및 Fd 등을 포함하나, 이에 한정되지 않는다.
상기 생리활성 펩타이드는 글루카곤-유사 펩티드-1(glucagon-like peptide-1, GLP-1) 및 이의 유사체, 엑센딘 및 이의 유사체, 소마토스타틴(somatostatin) 및 이의 유사체, LHRH(luteinizing hormone-releasing hormone) 작용제 및 길항제, 아드레노코티코트로픽 호르몬(adrenocorticotropic hormone), 성장호르몬-방출 호르몬(growth hormone-releasing hormone), 옥시토신(oxytocin), 티모신 알파-1(thymosin alpha-1), 코티코트로핀-방출인자(corticotropin-releasing factor), 칼시토닌(calcitonin), 비발리루딘(bivalirudin), 바소프레신 유사체(vasopressin analogues), 및 생리활성 단백질의 단편 등을 포함하나, 이에 한정되지 않는다.
본 발명의 펩타이드는 다른 생리활성 단백질 또는 펩타이드의 체내 반감기를 증가시킬 목적으로 유용하게 활용될 수 있으며, 상기 단백질 또는 펩타이드 융합체는 체내 지속성을 유지함으로 체내 반감기가 증가될 수 있다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 조성물은 면역 억제용 약제학적 조성물인 것이다.
본 발명의 약제학적 조성물은 (a) 상기 폴리펩타이드, 이를 코딩하는 핵산분자 또는 상기 핵산분자를 포함하는 벡터; 및 (b) 약제학적으로 허용되는 담체를 포함할 수 있다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 조성물은 장기이식반응 억제용 또는 자가면역질환의 예방 또는 치료용 약제학적 조성물인 것이다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 약제학적 조성물을 투여하는 단계를 포함하는 면역 또는 장기이식반응 억제방법을 제공한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 약제학적 조성물을 투여하는 단계를 포함하는 자가면역질환의 예방 또는 치료방법을 제공한다.
본 명세서에 용어, "자가면역질환"은 용어 "자가면역장애"와 혼용되며, 그 자신의 세포, 조직, 장기 또는 이들 대상의 면역학적 반응에 의해 유발되는 세포, 조직, 장기 또는 이들의 손상에 의해 특정화된 대상의 상태를 의미한다. 용어, "염증성 질환"은 용어 "염증성 장애"와 혼용되며, 염증, 바람직하게는 만성적 염증에 의해 특정화된 상태를 의미한다. 자가면역질환은 염증과 관련될 수도 있고, 그렇지 않을 수도 있다. 또한, 염증은 자가면역질환을 유발할 수도, 그렇지 않을 수도 있다.
본 발명의 약제학적 조성물에 의해 예방 또는 치료될 수 있는 자가면역질환의 예는 알로페시아 그레아타(alopecia greata), 강직성 척추염, 항인지질 증후군, 자가면역 아디슨 질환, 부신의 자가면역 질환, 자가면역 용혈성 빈혈, 자가면역 간염, 자가면역 난소염 및 고환염, 자가면역 혈소판감소증, 베체트병, 수포성 유천포창, 심근병증, 복강 스프루우-피부염(celiac sprue-dermatitis), 아토피성 피부염, 천식, 비염, 만성 피로 면역이상 증후군, 만성염증성 탈수초 다발성 신경병증, Churg-Strauss 증후군, 반흔성유천포창, CREST 증후군, 한냉 응집소 질환, 크론씨병, 원판성 낭창, 복태성복합한냉글로불린혈증, 섬유근통-섬유근염, 사구체신염, 그레이브스 질환, 귈레인 바레 증후군, 하시모토 갑상선염, 특발성 폐섬유화증, 특발성 혈소판 감소성 자반증, IgA 신경염, 연소자성 관절염, 편평태선, 홍반성 루푸스, 메니에르병, 혼합성 연결 조직 질환, 다발성 경화증, 타입 I 또는 면역-매개 당뇨병, 중증근무력증, 심상성 천포창, 악성 빈혈, 결정성 다발동맥염, 다발연골염, 자가면역성 다선 증후군, 류마티스 다발성근통, 다발성 근염과 피부근염, 일차성 무감마글로불린혈증, 일차성 담증성 간경변, 건선, 건선성 관절염, 레이노 현상, 라이터 증후군, 류마티스 관절염, 사르코이드증, 공피증, 강직인간 증후군, 전신성 홍반성 루푸스, 홍반성 루푸스, 다가야스 동맥염, 일시적 동맥염, 거대세포 동맥염, 궤양성 대장염, 포도막염, 백반증 및 베게너 육아종증을 포함하나, 이에 한정되는 것은 아니다.
본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.
본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고, 바람직하게는 비경구 투여이며, 예컨대, 정맥 내 주입, 국소 주입 및 복강 주입 등으로 투여할 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 바람직한 구현예에 따르면, 본 발명의 약제학적 조성물의 1일 투여량은 0.0001-100 ㎎/㎏이다.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 약제학적 조성물은 단독의 요법으로 이용될 수 있으나, 다른 통상적인 화학 요법 또는 생물학적 요법과 함께 이용될 수도 있으며, 이러한 병행 요법을 실시하는 경우에는 보다 효과적으로 상기 면역관련 질환을 치료 할 수 있다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(i) 본 발명은 Fc 감마 수용체 변이체를 포함하는 폴리펩타이드를 제공한다.
(ii) 또한, 본 발명은 상기 폴리펩타이드의 제조방법을 제공한다.
(iii) 본 발명의 Fc 감마 수용체 변이체는 Fc 감마 수용체의 일부 아미노산 서열을 다른 아미노산 서열로 치환하여 최적화함으로써 면역글로불린에 대한 선택적 결합력이 우수하여 체내 반감기 증가, 면역글로블린의 검출 및 정제, 장기이식반응 억제용도 또는 자가면역질환의 예방 또는 치료용도로 유용하게 활용될 수 있다.
도 1은 본 발명의 FcγRIIa 변이체 라이브러리 구축에 대한 모식도를 나타낸다.
도 2는 human serum IgG에 대해 높은 친화도를 보이는 SH2A40 변이체의 선별 과정을 나타낸다.
도 3은 SDS-PAGE 상에서 FcγRIIa 단백질(32 kDa)이 고순도로 정제되었음을 확인한 결과를 나타낸다.
도 4는 N-linked canonical glycosylation motif이 추가된 SH2A40의 Fc에 대한 결합력을 야생형과 비교한 그래프이다.
도 5는 정제된 SH2A40를 수득과정을 나타낸 모식도이다.
도 6은 발현 정제 후 발굴한 SH2A40의 활성을 보기 위하여 ELISA를 진행한 결과를 나타낸다.
도 7은 N-linked canonical glycosylation motif가 형성되지 않도록 FcγRIIa 변이체 라이브러리를 제작하는 과정에 대한 모식도이다.
도 8은 구축된 라이브러리와 유세포 분석기를 이용하여 선별된 변이체들(MG2A28 및 MG2A45)의 Fc에 대한 결합력을 비교한 그래프이다.
도 9는 발굴한 변이체들을 정제한 결과를 나타낸다.
도 10은 발굴한 변이체들의 Fc에 대한 결합력을 분석하기 위한 ELISA 결과를 나타낸다.
도 11은 Biolayer interferometry를 통한 Fc 감마 수용체 변이체들과 rituximab의 KD value를 측정한 결과를 나타낸다.
도 12는 구축된 라이브러리와 유세포 분석기를 이용하여 선별된 변이체들(MG2A28.1 및 MG2A45.1)의 Fc에 대한 친화도를 비교한 그래프이다.
도 13은 발굴한 변이체들을 정제한 결과를 나타낸다.
도 14는 발굴한 변이체들의 Fc에 대한 결합력을 분석하기 위한 ELISA 결과를 나타낸다.
도 15는 Biolayer interferometry를 통한 Fc 감마 수용체 변이체들과 rituximab의 KD value를 측정한 결과를 나타낸다.
도 16은 Fc 감마 수용체 변이체들의 mouse serum IgG와의 결합력을 ELISA로 분석한 결과를 나타낸다.
도 17은 야생형 FcγRIIb와 MG2A45.1 돌연변이가 도입된 FcγRIIb(MG2B45.1)의 human serum IgG-FITC에 대한 친화도 비교결과를 나타낸다.
도 18은 동물세포에서 발현한 Bevacizumab scFv, Bevacizumab scFv-FcγRIIa wild type, Bevacizumab scFv-MG2A45.1를 나타낸다.
도 19는 ELISA assay-Bevacizumab scFv, Bevacizumab scFv-FcγRIIa wild type, Bevacizumab scFv-MG2A45.1의 bevacizumab scFv에 대한 VEGF 결합 활성 분석 결과를 나타낸다.
도 20은 ELISA assay-Bevacizumab scFv, Bevacizumab scFv-FcγRIIa wild type, Bevacizumab scFv-MG2A45.1의 FcγRIIa에 대한 IgG1 Fc (Rituximab) 결합 활성 분석 결과를 나타낸다.
이하, 실시 예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시 예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시 예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
실시예 1. FcγRIIa 변이체 라이브러리 제작
pMopac12-NlpA-FcγRIIa-FLAG vector를 기반으로 FcγRIIa 내에 0.2% 정도의 무작위 돌연변이가 일어나도록 프라이머 MJ#160, MJ#161을 이용하여 무작위로 돌연변이가 도입된 FcγRIIa 유전자를 제작하였다. 또, FcγRIIa의 IgG Fc와의 결합 위치에 degenerate codon인 NNK를 도입하여 다양한 아미노산이 도입 되도록 focused insert를 프라이머 MJ#160, MJ#161, p788, p789, p790, p791, p792, p793을 이용하여 제작하였다(표 1). 제작된 두 가지 insert를 SfiI(New England Biolab)으로 제한효소 처리하여 vector와 ligation하였다. 그 후 대장균 Jude1((F' [Tn10(Tetr )proAB+ lacI qΔ(lacZ)M15] mcrAΔ(mrr-hsdRMS-mcrBC)Φ80dlacZΔM15 ΔlacX74 deoR recA1 araD139Δ(ara leu)7697 galU galKrpsLendA1nupG)에transformation하여 거대 FcγRIIa 변이체 라이브러리(라이브러리 크기: 2.2x109)를 구축하였다(도 1).
primer# sequence(5’> 3’)
P788(서열목록 제1서열) GCGGGGTTTGCAGCACCAGMNNMNNMNNAAGCACGGTCAGATGCACCG
P789(서열목록 제2서열) CGGTGCATCTGACCGTGCTTNNKNNKNNKCTGGTGCTGCAAACCCCGC
P790(서열목록 제3서열) GCTTTTGCCATTCTGAAAAAAGGTCACTTTMNNCAGMNNMNNATCTTTCCAGCTATGGCAACGCAG
P791(서열목록 제4서열) CTGCGTTGCCATAGCTGGAAAGATNNKNNKCTGNNKAAAGTGACCTTTTTTCAGAATGGCAAAAGC
P792(서열목록 제5서열) GCGGAATGCTAAAGGTCGGATCCAGMNNAGAMNNTTTCTGMNNTTTGCCATTCTGAAAAAAGGTCACTTTCACC
P793(서열목록 제6서열) GGTGAAAGTGACCTTTTTTCAGAATGGCAAANNKCAGAAANNKTCTNNKCTGGATCCGACCTTTAGCATTCCGC
IIa Fw NdeI(서열목록 제7서열) GCGGAATTCCATATGCAGGCTGCCCCACCGAAAG
IIa Rv HindIII(서열목록 제8서열) TAAGGGAAGCTTAATCACGCCCATCGGTGAGC
MJ#1(서열목록 제9서열) CCA GGC TTT ACA CTT TAT GC
MJ#2(서열목록 제10서열) CTG CCC ATG TTG ACG ATT G
MJ#112(서열목록 제11서열) CAGCGGTTTATCTTTCCAGCTATGGC
MJ#113(서열목록 제12서열) GCCATAGCTGGAAAGATAAACCGCTGNNKNNGGTGNNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC
MJ#114(서열목록 제13서열) GCCATAGCTGGAAAGATAAACCGCTGNNKGATGTGNNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC
MJ#115(서열목록 제14서열) GCCATAGCTGGAAAGATAAACCGCTGNNKTTTGTGNNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC
MJ#116(서열목록 제15서열) GCCATAGCTGGAAAGATAAACCGCTGNNKCATGTGNNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC
MJ#117(서열목록 제16서열) GCCATAGCTGGAAAGATAAACCGCTGNNKATTGTGNNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC
MJ#118(서열목록 제17서열) GCCATAGCTGGAAAGATAAACCGCTGNNKTATGTGNNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC
MJ#119(서열목록 제18서열) GCCATAGCTGGAAAGATAAACCGCTGNNKNNGGTGNWKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC
MJ#120(서열목록 제19서열) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTGGCGTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC
MJ#121(서열목록 제20서열) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTGGGCTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC
MJ#122(서열목록 제21서열) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTGCCGTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC
MJ#123(서열목록 제22서열) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTGCGTTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC
MJ#124(서열목록 제23서열) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTGTGGTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC
MJ#160(서열목록 제24서열) CGCAGCGAGAGGCCCAGCCGGCCATG
MJ#161(서열목록 제25서열) CGCAATTCGGCCCCCGAGGCCCC
MJ#162(서열목록 제26서열) CGCAGCGAGCGCGCACTCCATGCAGGCTGCCCCACC
MJ#163(서열목록 제27서열) CCCTAAAATCTAGAAATCACGCCCATCGGTGAGC
MJ#197(서열목록 제28서열) CGGGAAAATTTCTTGGATTTTCCATTCTGGAAGAA
MJ#198(서열목록 제29서열) GCTGGAAGGACAAGCCTCTGGTCAATGTCGTGTTCTTCCAGAATGGAAAATCCAAGAAATTTTCCCG
MJ#199(서열목록 제30서열) CGCAATTCGGCCCCCGAGGCCCCGGGCTCTTGGACAGTGATGGTCACAGGCTTG
MJ#200(서열목록 제31서열) CAGCCCAGCTACCATTTCAAGGCCAAC
MJ#201(서열목록 제32서열) GTTGGCCTTGAAATGGTAGCTGGGCTG
MJ#202(서열목록 제33서열) CATAGGCTACACGCAGTACTCATCCAAGC
MJ#203(서열목록 제34서열) GCTTGGATGAGTACTGCGTGTAGCCTATG
실시예 2. 박테리아 배양 및 유세포 분리기(flow cytometry)를 이용한 FcγRIIa 변이체 라이브러리 탐색
구축된 FcγRIIa 변이체 라이브러리 세포 1 ml을 37℃, 250 rpm shaking 조건으로 2%(w/v) glucose에 chloramphenicol(40 μg/ml)이 포함된 Terrific Broth(TB) 배지에 넣어 주고 4시간 배양을 하였다. 배양된 라이브러리 세포를 TB 배지에 1:100으로 접종한 후 37℃, 250 rpm shaking으로 OD600가 0.6에 도달할 때까지 배양하였다. 그 후 cooling을 위해 20분 동안 25℃에서 배양한 후 1 mM isopropyl-1-thio-β-D-galactopyranoside(IPTG)를 넣어 발현을 유도 하였다. 배양이 끝난 후 세포를 회수하여 OD600 normalize를 통해 균일한 양 만큼씩 14,000 rpm, 1분간 원심분리를 통해 세포를 harvest하였다. 1 ml의 10 mM Tris-HCl(pH 8.0)을 첨가해 세포를 resuspension하고 1 분간 원심분리하는 wash 과정을 2회 반복하였다. 1 ml의 STE[0.5 M sucrose, 10 mM Tris-HCl, 10mM EDTA(pH 8.0)]로 resuspension하여 37℃, 30분간 rotation을 통해 세포 외막을 제거하였다. 원심분리하여 상등액을 버린 후 1 ml의 Solution A[0.5 M sucrose, 20 mM MgCl2, 10 mM MOPS pH 6.8]을 첨가해 resuspension과 원심분리를 하였다. 1 ml의 Solution A와 50 mg/ml lysozyme solution 20 μl를 혼합한 용액을 1 ml 첨가해 resuspension한 뒤 37℃, 15분간 rotation하여 peptidoglycan layer를 제거하였다. 원심분리 후 상등액을 제거하고 1 ml의 PBS로 resuspension한 뒤 300 μl를 취해 700 μl의 PBS와 human serum IgG-FITC probe(sigma aldrich)를 함께 넣고 상온에서 rotation하여 spheroplast에 형광 probe를 labeling하였다. Labeling후 1 ml의 PBS로 1회 wash한 후 유세포 분리기(Flow cytometry: S3 cell sorter(Bio-rad))를 이용하여 높은 형광을 보이는 상위 3% 세포들을 회수 하였고 형광이 높은 세포들의 순도를 높이기 위해서 sorting 받은 세포들을 다시 resorting 하였다. resorting 받은 sample을 프라이머 MJ#160, MJ#161과 Taq polymerase(Biosesang)을 이용해 PCR로 유전자를 증폭하고 SfiI 제한효소 처리 ligation, transformation 과정을 거쳐 sorting된 세포의 유전자들이 amplify된 서브라이브러리를 제작하였다. 이 과정을 총 4라운드에 걸쳐 반복한 후, 40개의 individual 클론들을 각각 분석하여 야생형 FcγRIIa(서열목록 제35서열 및 제43서열) 보다 human serum IgG에 대해 높은 친화도를 보이는 SH2A40 변이체(서열목록 제36서열 및 제44서열)를 선별하였다(도 2).
실시예 3: 발굴한 SH2A40 변이체를 동물세포에서 발현하기 위한 클로닝 및 발현, 정제
발굴한 변이체들 중 SH2A40을 HEK293F 세포에서 발현하기 위하여 유전자를Vent polymerase와 primer MJ#162, MJ#163을 사용해 PCR로 증폭한 뒤 BssHII, XbaI(New England Biolab)으로 제한효소 처리, ligation하여 pMAZ-FcγRIIa(wild type), pMAZ-FcγRIIa variant(SH2A40)를 제작하였다. 동물세포용 발현벡터인 pMAZ에 클로닝 한 유전자들은 HEK293F 세포에 transfection하고 300 ml 규모로 임시발현하였다. 배양이 끝난 배양액은 2,000 rpm, 10분간 원심분리를 통해 세포를 제거하고 상등액을 취해 25x PBS를 이용해 equilibrium을 맞추었다. bottle top filter를 이용해 0.2 μm filter(Merck Millipore)로 여과하였다. PBS로 평형을 맞춘 Ni-NTA agarose(Qiagen) 1 ml slurry를 첨가해 4℃, 16시간 교반한 다음polypropylene column(Thermo Fisher Scientific)에 흘려주었다. pass-through solution을 취해 한 번 더 resin에 흘려서 binding 시킨 뒤, 50 ml의 1x PBS, 25 ml의 10 mM imidazole buffer, 25 ml의 20 mM imidazole buffer, 200 ul의 250 mM imidazole buffer 순으로 wash를 해주었다. Elution은 250 mM imidazole buffer 2.5 ml로 수행하였다. 받아진 단백질은 Amicon Ultra-4(Merck Millipore)를 통해PBS로 buffer를 교체한 후 농축 과정을 거쳐 SDS-PAGE(BioRad)를 통해 정제된 단백질을 확인하였다(도 3). SDS-PAGE 상에서 FcγRIIa 단백질(32 kDa)이 고순도로 정제되었음이 확인되었다.
실시예 4: 동물세포 배양을 통해 생산한 FcγRIIa 단백질의 활성 및 결합력 분석을 위해 IgG1 subclass로 이루어져 있는 rituximab을 이용해 수행한 ELISA
0.05 M Na2CO3 pH 9.6에 4 μg/ml로 희석한 rituximab를 각각 50 μl씩 Flat Bottom Polystyrene High Bind 96 well microplate(costar)에 4℃, 16 시간 동안 고정화 한 후 100 μl의 5% BSA(in 0.05% PBST)로 상온에서 2 시간 동안 blocking 하였다. 0.05% PBST 180 μl로 4 회씩 wash를 진행한 뒤 blocking solution으로serially dilution된 FcγRIIa 단백질들을 50 μl 각 well에 분주하여 상온에서 1시간 동안 반응시켰다. Wash 과정 후 anti-His-HRP conjugate(Sigma-Aldrich) 50 μl씩을 이용해 상온에서 1시간 동안 항체 반응을 진행하고 wash 과정을 수행하였다. 1-Step Ultra TMB-ELISA Substrate Solution(Thermo Fisher Scientific) 50 μl씩 첨가해 발색 한 뒤 2 M H2SO4 50 μl씩 넣어주어 반응을 종료 시킨 다음 Epoch Microplate Spectrophotometer(BioTek)을 이용해 분석하였다. 각 실험은 모두 duplicate으로 진행하였으며 ELISA 결과 rituximab의 Fc부분과 야생형 FcγRIIa, SH2A40에 대한 결합력을 비교, 분석할 수 있었다. 그 결과 SH2A40이 새로운 N-linked canonical glycosylation motif이 추가가 되었기 때문에 WT FcγRIIa와 비슷한 결합력을 보였다(도 4).
실시예 5. MBP-FcγRIIa 단백질 발현을 위한 클로닝 및 E.coli 에서의 발현, 정제
선별된 SH2A40를 soluble한 단백질 형태로 생산하기 위하여 해당 gene을 IIa_Fw_NdeI, IIa_Rv_HindIII 프라이머를 이용하여 PCR을 한 후 NdeI, HindIII(New England Biolab)처리를 하였다. 그 후 NdeI, HindIII한 pET22b-MBP-TEV site-His vector와 ligation을 한 후 BL21(DE3) cell에 transformation 하였다. 해당 cell을 37℃ 250 rpm shaking 조건으로 2%(w/v) glucose에 ampicillin(100 μg/ml)이 포함된 TB 배지에 넣어 주고 전배양을 하였다. 배양된 세포를 TB 배지에 1:100으로 접종한 후 37℃ 250 rpm shaking 으로 OD600가 0.6에 도달할 때까지 배양 하였다. 그 후 cooling을 위해 20분 동안 18℃에서 배양한 후 1 mM IPTG를 넣고 14시간 동안 발현을 유도 하였다. 배양이 끝난 후 7,000 rpm, 10분간 원심분리를 통해 세포를 harvest하였다. 세포 파쇄를 위하여 sonication(5초on/10초off, 100 반복)하였고 15,000 rpm으로 30분간 원심분리하여 상등액을 0.45 μm syringe filter로 여과하였다. 여과된 상등액을 Ni-NTA resin에 binding시키고 100 ml의 10 mM imidazole buffer, 100 ml의 20 mM imidazole buffer로 wash를 한 뒤, 50 mM imidazole buffer 4 ml로 elution하였다. Elution한 sample을 50 mM Tris-HCl로 buffer exchange 한 후 TEV-GST를 이용하여 MBP-SH2A40을 MBP와 SH2A40로 cleavage 한 후 GST resin과 amylose resin으로 TEV-GST와 MBP 단백질을 제거하고 순수한 SH2A40만 얻었다(도 5).
실시예 6. 대장균에서 발현한 FcγRIIa변이체의 IgG1과의 결합력을 ELISA로 분석
발현 정제 후 발굴한 SH2A40의 활성을 보기 위하여 ELISA를 진행하였다. 0.05 M Na2CO3 pH 9.6에 4 μg/ml로 희석한 Rituximab을 50 μl씩 Flat Bottom Polystyrene High Bind 96 well microplate(costar)에 4℃, 16시간 동안 고정화 한 후 100 μl의 4% skim milk(GenomicBase)(in 0.05% PBST)로 상온에서 2시간 동안blocking 하였다. 0.05% PBST 180 μl로 4회씩 wash를 진행한 뒤 1% skim milk(in 0.05% PBST)으로 serially dilution 된 WT FcγRIIa와 SH2A40을 50 μl 각 well에 분주하여 상온에서 1시간 동안 반응시켰다. Wash 과정 후anti-His-HRP conjugate(sigma) 50 μl씩을 이용해 상온에서 1시간 동안 항체 반응을 진행하고 wash 과정을 수행하였다. 1-Step Ultra TMB-ELISA Substrate Solution(Thermo Fisher Scientific) 50 μl씩 첨가해 발색 한 뒤 2 M H2SO4 50 μl씩 넣어주어 반응을 종료 시킨 다음 Epoch Microplate Spectrophotometer(BioTek)를 이용해 분석하였다(도 6).
실시예 7: N-linked canonical glycosylation motif가 형성되지 않도록 FcγRIIa 변이체 라이브러리 제작
FcγRIIa 변이체(SH2A40: K117N, L159Q)에 형성된 N-linked canonical glycosylation motif(N-X-S/T)를 제거하면서 IgG Fc와의 친화도가 높은 FcγRIIa 변이체를 탐색하기 위하여 라이브러리를 제작하였다. 이 라이브러리는 SH2A40에서 N-linked canonical glycosylation motif가 형성된 V116, K117, T119 위치에 집중하여 제작하였다. 라이브러리의 template로는 SH2A40를 template로 하여 제작하였으며, unpaired Cyc를 예방하기 위해 Cys이 생기지 않도록 reduced codon을 이용하였다(도 7).
1. Sub-library-1: 117번 위치에 Asn, Cys가 생기지 않도록 제작
pMopac12-NlpA-FcγRIIa(SH2A40)-FLAG을 template로 하고 116번, 119번 위치는 20개 아미노산이 코딩 되도록 NNK degenerate codon을 사용하고, 117번 위치는 NNG reduced codon을 이용해 13개 아미노산을 코딩하고 5개의 나머지 아미노산(Gln, Phe, His, Ile, Tyr)은 각각 코딩하는 프라이머를 제작하여 동일한 양으로 혼합 후 사용하였다. 프라이머 MJ#160, MJ#112와 Vent polymerase(New England Biolab)를 사용해 FcγRIIa 유전자의 116번 앞쪽 부분인 fragment-1을 증폭하고, 뒤쪽인 fragment-2를 증폭할 때는 MJ#113-MJ#118을 동일한 아미노산 비율로 섞은mixture와 MJ#161를 사용하였다. 준비된 2개의 fragment는 Vent polymerase로 assemble하였으며, SfiI(New England Biolab) 제한효소 처리하였다.
2. Sub-library-2: 119번 위치에 Ser, Thr, Cys가 생기지 않도록 제작
pMopac12-NlpA-FcγRIIa(SH2A40)-FLAG을 template로 하고 116번, 117번 위치는 20개 아미노산이 코딩 되도록 NNK degenerate codon을 사용하고, 119번 위치는 NWK reduced codon을 이용해 12개 아미노산을 코딩하고 5개의 나머지 아미노산(Ala, Gly, Pro, Arg, Trp)은 각각 코딩하는 프라이머를 제작하여 동일한 양으로 혼합 후 사용하였다. 프라이머 MJ#160, MJ#112와 Vent polymerase(New England Biolab)를 사용해 FcγRIIa 유전자의 116번 앞쪽 부분인 fragment-1을 증폭하고, 뒤쪽인 fragment-2를 증폭할 때는 MJ#119-MJ#124을 동일한 아미노산 비율로 섞은mixture와 MJ#161를 사용하였다. 준비된 2개의 fragment는 Vent polymerase로 assemble하였으며, SfiI(New England Biolab) 제한효소 처리하였다.
제한효소 처리된 2개의 sub-library 유전자들은 동량으로 ligation 과정을 거쳐 Jude1에 transformation하여 FcγRIIa 라이브러리를 제작하였다(이론적 라이브러리 크기: 4.3 x 104, 실험적 라이브러리 크기: 6.3 x 108).
실시예 8: 구축된 라이브러리와 유세포 분석기를 스크리닝 및 MG2A28, MG2A45 등의 변이체 선별(human serum IgG에 대한 친화도 분석)
구축된 라이브러리는 250 ml 플라스크에서 TB+2% glucose 배지 25 ml에 1 vial(1 ml)을 풀어 37℃, 4시간 배양한 후 100 ml의 TB 배지가 담긴 500 ml 플라스크에서 1:100 접종하여 OD600=0.6까지 배양하였다. 곧바로 25℃, 250 rpm에서 20분간 cooling 과정을 거친 후 1 mM IPTG를 첨가하여 25℃, 250 rpm, 5시간 동안 과발현 하였다. 과발현 후 OD600값을 측정하여 normalize된 양 만큼씩 14,000 rpm, 1분간 원심분리를 통해 세포를 회수하였다. 1 ml의 10 mM Tris-HCl(pH 8.0)을 첨가해 세포를 resuspension하고 1분간 원심분리하는 wash 과정을 2회 반복하였다. 1 ml의 STE[0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)]로 resuspension하여 37℃, 30분간 rotation을 통해 세포 외막을 제거하였다. 원심분리하여 상등액을 제거한 후 1 ml의 Solution A[0.5 M sucrose, 20 mM MgCl2,10mM MOPS pH6.8]을 첨가해 resuspension과 원심분리를 하였다. 1 ml의 Solution A와 50 mg/ml lysozyme solution 20 μl를 혼합한 용액을 1 ml 첨가해 resuspension한 뒤 37℃, 15분간 rotation하여 peptidoglycan layer를 제거하였다. 원심분리 후 상등액을 제거하고 1 ml의 PBS로 resuspension한 뒤 300 μl를 취해 700 μl의 PBS와 human serum IgG-FITC(Sigma aldrich) probe를 함께 넣고 상온에서 rotation하여 spheroplast에 형광 probe를 labeling하였다. Labeling후 1 ml의 PBS로 1회 wash한 후 PBS에 20배 희석하여 S3 cell sorter(Bio-rad) 장비를 이용해 상위 3%의 형광 신호를 내는 세포들만 분리하여 취하였다. 보다 효율적인 스크리닝을 위해 분리한 세포들은 한 번 더 sorting 하여 resorting 작업을 수행하였다. 걸러낸 세포들은 MJ#1, MJ#2 primer와 Taq polymerase(Biosesang)을 이용해 PCR로 유전자를 증폭하고 SfiI 제한효소 처리 ligation, transformation 과정을 거쳐 sorting된 세포의 유전자들이 amplify된 서브라이브러리를 제작하였다. 이 과정을 총 3라운드에 걸쳐 반복한 후, 50여개의 individual 클론들의 염기서열 분석을 통해 human serum IgG의 Fc부분과 높은 친화도를 보이는 변이체들을 선별하였다(도 8).
실시예 9: 발굴한 변이체를 동물세포에서 발현하기 위한 클로닝 및 발현 정제
발굴한 변이체들 중 MG2A28(서열목록 제37서열 및 제45서열), MG2A45(서열목록 제38서열 및 제46서열)를 HEK293F 세포에서 발현하기 위하여 유전자를 Vent polymerase와 primer MJ#162, MJ#163을 사용해 PCR로 증폭한 뒤 BssHII, XbaI(New England Biolab)으로 제한효소 처리, ligation하여 pMAZ-FcγRIIa variant(MG2A28), pMAZ-FcγRIIa variant(MG2A45)를 제작하였다. 동물세포용 발현벡터인 pMAZ에 클로닝 한 유전자들은 HEK293F 세포에 transfection하고 300 ml 규모로 임시발현 하였다. 배양이 끝난 배양액은 2000 rpm, 10분간 원심분리를 통해 세포를 제거하고 상등액을 취해 25x PBS를 이용해 equilibrium을 맞추었다. bottle top filter를 이용해 0.2 μm filter(Merck Millipore)로 여과하였다. PBS로 평형을 맞춘 Ni-NTA agarose(Qiagen) 1 ml slurry를 첨가해 4℃, 16시간 교반한 다음 polypropylene column(Thermo Fisher Scientific)에 흘려주었다. pass-through solution을 취해 한 번 더 resin에 흘려서 binding 시킨 뒤, 50 ml의 1x PBS, 25 ml의 10 mM imidazole buffer, 25 ml의 20 mM imidazole buffer, 200 ul의 250 mM imidazole buffer 순으로 wash를 해주었다. Elution은 250 mM imidazole buffer 2.5 ml로 수행하였다. 받아진 단백질은 Amicon Ultra-4(Merck Millipore)를 통해 PBS로 buffer를 교체한 후 농축 과정을 거쳐 SDS-PAGE(BioRad)를 통해 정제된 단백질을 확인하였다(도 9). SDS-PAGE 상에서 FcγRIIa 단백질(32 kDa)이 고순도로 정제되었음이 확인되었다.
실시예 10: IgG1 subclass로 이루어져 있는 rituximab을 이용한 변이체들의 Fc에 대한 결합력을 분석하기 위한 ELISA
0.05 M Na2CO3 pH 9.6에 4 μg/ml로 희석한 rituximab를 각각 50 μl씩 Flat Bottom Polystyrene High Bind 96 well microplate(costar)에 4℃, 16시간 동안 고정화 한 후 100 μl의 5% BSA(in 0.05% PBST)로 상온에서 2시간 동안 blocking 하였다. 0.05% PBST 180 μl로 4회씩 wash를 진행한 뒤 blocking solution으로 serially dilution된 FcγRIIa 변이체들을 50 μl 각 well에 분주하여 상온에서 1시간동안 반응시켰다. Wash 과정 후 anti-His-HRP conjugate(Sigma-Aldrich) 50 μl씩을 이용해 상온에서 1시간 동안 항체 반응을 진행하고 wash 과정을 수행하였다. 1-Step Ultra TMB-ELISA Substrate Solution(Thermo Fisher Scientific) 50 μl씩 첨가해 발색 한 뒤 2 M H2SO4 50μl씩 넣어주어 반응을 종료 시킨 다음 Epoch Microplate Spectrophotometer(BioTek)을 이용해 분석하였다(도 10). 각 실험은 모두 duplicate으로 진행하였으며 ELISA 결과 rituximab의 Fc부분과 FcγRIIa 변이체들(야생형, SH2A40, MG2A28, MG2A45)에 대한 결합력을 비교, 분석할 수 있었다.
실시예 11: Biolayer interferometry를 통한 FcγRIIa 변이체들과 rituximab의 KD value측정
Human serum에서 약 70% 이상을 차지하고 있으며, 각종 항체 의약품에서 주로 사용되는 IgG subclass인 IgG1의 Fc와의 결합력을 측정하기 위해 rituximab을 이용하여 FcγRIIa 변이체들의 친화도 측정을 수행하였다. Blitz(Fortebio)를 사용하여 FcγRIIa 변이체들의 결합력을 측정하였다. 안정적인 분석을 위해 Amine reactive 2nd generation(AR2G) biosensor(Fortebio)에 sodium acetate pH 5.0 용액에 40 ug/ml로 희석한 rituximab 항체를 고정화하고, 1x kinetics buffer(fortebio)로 serially dilution한 FcγRIIa variants(야생형 SH2A40, MG2A28, MG2A45)를 각각 반응시켜 결합력을 분석하였다(도 11). Equilibrium binding constant(KD)를 계산하기 위하여 Blitz Pro 1.2 software(Fortebio)를 활용하였다(표 3). 그 결과 본 연구를 통해 발굴한 SH2A40과 MG2A28, MG2A45가 야생형과 비교하여 Fc에 대한 결합력이 각각 3.57배, 6.16배, 8.26배 증가된 것을 확인할 수 있었다.
실시예 12: Affinity maturation을 위한 MG2A28, MG2A45 기반의 FcγRIIa error-prone PCR 라이브러리 구축
MG2A28과 MG2A45를 기반으로 한 FcγRIIa 변이체 라이브러리를 제작하기 위하여 pMopac12-NlpA-FcγRIIa(MG2A28, MG2A45)-FLAG을 template로 하여 error prone PCR을 진행하였다. FcγRIIa 부분에 무작위적인 점 돌연변이를 가하기 위한 방법으로 Taq polymerase(Takara)을 이용한 error prone PCR 기법을 사용하였다. 라이브러리에 MG2A28과 MG2A45 두 가지의 변이체가 50%씩 동등한 비율로 존재하게 하기 위하여 각각 PCR을 진행하였으며, primer MJ#160, MJ#161을 사용하여 전체 FcγRIIa 유전자에서 0.3%의 nucleotide에 점 돌연변이가 도입되도록 하였다. 그런 다음 SfiI 제한효소 처리 및 ligation 과정을 거쳐 Jude1에 transformation하여 FcγRIIa 라이브러리를 제작하였다(라이브러리 크기: 2.6 x 109, experimental error rate: 0.32%). 대장균의 내막에 FcγRIIa 변이체들이 디스플레이 되는 라이브러리를 구축하였다.
실시예 13: 구축된 라이브러리와 유세포 분석기를 스크리닝 및 MG2A28.1, MG2A45.1 등의 변이체 선별(human serum IgG에 대한 친화도 분석)
구축된 라이브러리는 250 ml 플라스크에서 TB+2% glucose 배지 25 ml에 1 vial(1 ml)을 풀어 37℃, 4시간 배양한 후 100 ml의 TB 배지가 담긴 500 ml 플라스크에서 1:100 접종하여 OD600=0.6까지 배양하였다. 곧바로 25℃, 250 rpm에서 20분간 cooling 과정을 거친 후 1 mM IPTG를 첨가하여 25℃, 250 rpm, 5시간 동안 과발현 하였다. 과발현 후 OD600값을 측정하여 normalize된 양 만큼씩 14,000 rpm, 1분간 원심분리를 통해 세포를 회수하였다. 1 ml의 10 mM Tris-HCl(pH 8.0)을 첨가해 세포를 resuspension하고 1분간 원심분리하는 wash과정을 2회 반복하였다. 1 ml의 STE[0.5 M sucrose, 10 mM Tris-HCl, 10mM EDTA (pH 8.0)]로 resuspension하여 37℃, 30분간 rotation을 통해 세포 외막을 제거하였다. 원심분리하여 상등액을 제거한 후 1 ml의 Solution A[0.5 M sucrose, 20 mM MgCl2,10 mM MOPS pH 6.8]을 첨가해 resuspension과 원심분리를 하였다. 1 ml의 Solution A와 50 mg/ml lysozyme solution 20 μl를 혼합한 용액을 1 ml 첨가해 resuspension한 뒤 37℃, 15분 간 rotation하여 peptidoglycan layer를 제거하였다. 원심분리 후 상등액을 제거하고 1 ml의 PBS로 resuspension한 뒤 300 μl를 취해 700 μl의 PBS와 human serum IgG-FITC(Sigma aldrich) probe를 함께 넣고 상온에서 rotation하여 spheroplast에 형광 probe를 labeling하였다(1-2라운드: 20 nM, 3라운드: 5 nM). Labeling 후 1 ml의 PBS로 1회 wash한 후 PBS에 20배 희석하여 S3 cell sorter (Bio-rad) 장비를 이용해 상위 3%의 형광 신호를 내는 세포들만 분리하여 취하였다. 보다 효율적인 스크리닝을 위해 분리한 세포들은 한 번 더 sorting 하여 resorting 작업을 수행하였다. 걸러낸 세포들은 MJ#1, MJ#2 primer와 Taq polymerase(Biosesang)을 이용해 PCR로 유전자를 증폭하고 SfiI 제한효소 처리 ligation, transformation 과정을 거쳐 sorting된 세포의 유전자들이 amplify된 서브라이브러리를 제작하였다. 이 과정을 총 5라운드에 걸쳐 반복한 후, 70여개의 individual 클론들의 IgG-FITC와의 결합에 의한 형광 신호 세기를 분석하였다. 이를 통해 human serum IgG의 Fc부분과 높은 친화도를 보이는 변이체들을 선별하였으며, 염기서열 분석을 통해 MG2A28 기반의 변이체와 MG2A45 기반의 변이체가 각각 1종류씩 isolation되었음이 확인되었다(도 12).
실시예 14: 발굴한 변이체를 동물세포에서 발현하기 위한 클로닝 및 발현 정제
발굴한 변이체들 중 MG2A28.1(서열목록 제39서열 및 제47서열), MG2A45.1(서열목록 제40서열 및 제48서열)를 HEK293F 세포에서 발현하기 위하여 유전자를 Vent polymerase와 primer MJ#162, MJ#163을 사용해 PCR로 증폭한 뒤 BssHII, XbaI(New England Biolab)으로 제한효소 처리, ligation하여 pMAZ-FcγRIIa variant(MG2A28.1), pMAZ-FcγRIIa variant(MG2A45.1)를 제작하였다. 동물세포용 발현벡터인 pMAZ에 클로닝 한 유전자들은 HEK293F 세포에 transfection하고 300 ml 규모로 임시발현 하였다. 배양이 끝난 배양액은 2000 rpm, 10분간 원심분리를 통해 세포를 제거하고 상등액을 취해 25x PBS를 이용해 equilibrium을 맞추었다. bottle top filter를 이용해 0.2 μm filter(Merck Millipore)로 여과하였다. PBS로 평형을 맞춘 Ni-NTA agarose(Qiagen) 1 ml slurry를 첨가해 4℃, 16시간 교반한 다음 polypropylene column(Thermo Fisher Scientific)에 흘려주었다. pass-through solution을 취해 한 번 더 resin에 흘려서 binding 시킨 뒤, 50 ml의1x PBS, 25 ml의 10 mM imidazole buffer, 25 ml의 20 mM imidazole buffer, 200 ul의 250 mM imidazole buffer 순으로 wash를 해주었다. Elution은 250 mM imidazole buffer 2.5 ml로 수행하였다. 받아진 단백질은 Amicon Ultra-4(Merck Millipore)을 통해 PBS로 buffer를 교체한 후 농축 과정을 거쳐 SDS-PAGE(BioRad)를 통해 정제된 단백질을 확인하였다(도 13). SDS-PAGE 상에서 FcγRIIa 단백질(32 kDa)이 고순도로 정제되었음이 확인되었다.
실시예 15: IgG1 subclass로 이루어져 있는 rituximab을 이용한 변이체들의 Fc에 대한 결합력을 분석하기 위한 ELISA
0.05 M Na2CO3 pH 9.6에 4 μg/ml로 희석한 rituximab를 각각 50 μl씩 Flat Bottom Polystyrene High Bind 96 well microplate(costar)에 4℃, 16시간 동안 고정화 한 후 100 μl의 5% BSA(in 0.05% PBST)로 상온에서 2 시간 동안 blocking 하였다. 0.05% PBST 180 μl로 4회씩 wash를 진행한 뒤 blocking solution으로serially dilution 된 FcγRIIa 변이체들을 50 μl 각 well에 분주하여 상온에서 1시간 동안 반응시켰다. Wash 과정 후 anti-His-HRP conjugate(Sigma-Aldrich) 50 μl씩을 이용해 상온에서 1 시간 동안 항체 반응을 진행하고 wash 과정을 수행하였다. 1-Step Ultra TMB-ELISA Substrate Solution(Thermo Fisher Scientific) 50 μl씩 첨가해 발색 한 뒤 2 M H2SO4 50 μl씩 넣어주어 반응을 종료 시킨 다음 Epoch Microplate Spectrophotometer(BioTek)을 이용해 분석하였다(도 14). 각 실험은 모두 duplicate으로 진행하였으며 ELISA 결과 rituximab의 Fc부분과 FcγRIIa 변이체들(야생형, MG2A28, MG2A45, MG2A28.1, MG2A45.1)에 대한 결합력을 비교, 분석할 수 있었다.
실시예 16: Biolayer interferometry를 통한 FcγRIIa 변이체들과 rituximab의 KD value측정
Human serum에서 약 70% 이상을 차지하고 있으며, 각종 항체 의약품에서 주로 사용되는 IgG subclass인 IgG1의 Fc와의 결합력을 측정하기 위해 rituximab을 이용하여 FcγRIIa 변이체들의 친화도 측정을 수행하였다. Blitz(Fortebio)를 사용하여 FcγRIIa 변이체들의 결합력을 측정하였다. 안정적인 분석을 위해 Amine reactive 2nd generation(AR2G) biosensor(Fortebio)에 sodium acetate pH 5.0 용액에 40 ug/ml로 희석한 rituximab 항체를 고정화하고, 1x kinetics buffer(fortebio)로 serially dilution한 FcγRIIa variants(MG2A28.1, MG2A45.1)를 각각 반응시켜 결합력을 분석하였다(도 15). Equilibrium binding constant(KD)를 계산하기 위하여 Blitz Pro 1.2 software(Fortebio)를 활용하였다(표 4). 그 결과 본 연구를 통해 발굴한 MG2A28.1과 MG2A45.1이 야생형과 비교하여 Fc에 대한 결합력이 각각 5.39배, 32.09배 증가된 것을 확인할 수 있었다.
실시예 17: 쥐 모델을 이용한 동물실험을 위하여 mouse serum IgG와의 결합력을 ELISA로 분석
0.05 M Na2CO3 pH 9.6에 4 μg/ml로 희석한 mouse serum IgG를 각각 50 μl씩Flat Bottom Polystyrene High Bind 96 well microplate(costar)에 4℃, 16시간 동안 고정화 한 후 100 μl의 5% BSA(in 0.05% PBST)로 상온에서 2시간 동안 blocking하였다. 0.05% PBST 180 μl로 4회씩 wash를 진행한 뒤 blocking solution으로 serially dilution 된 FcγRIIa 변이체들(야생형, MG2A28, MG2A45, MG2A28.1, MG2A45.1)을 50 μl 각 well에 분주하여 상온에서 1시간 동안 반응시켰다. Wash 과정 후 anti-His-HRP conjugate(Sigma-Aldrich) 50 μl씩을 이용해 상온에서 1시간 동안 항체 반응을 진행하고 wash 과정을 수행하였다. 1-Step Ultra TMB-ELISA Substrate Solution(Thermo Fisher Scientific) 50 μl씩 첨가해 발색 한 뒤 2 M H2SO4 50μl씩 넣어주어 반응을 종료 시킨 다음 Epoch Microplate Spectrophotometer(BioTek)을 이용해 분석하였다(도 16). 각 실험은 모두duplicate으로 진행하였으며 ELISA 결과 mouse serum IgG와 FcγRIIa 변이체들(야생형, MG2A28, MG2A45, MG2A28.1, MG2A45.1)에 대한 결합력을 비교, 분석할 수 있었으며, MG2A28을 제외한 모든 변이체가 야생형과 비교해 유사하거나 높은 친화도로 mouse serum IgG와 결합한다는 것을 알 수 있었으며, 그 중 MG2A45와 MG2A45.1 변이체가 mouse serum IgG와 가장 높은 친화도로 결합하는 것을 확인하였다.
실시예 18: FcγRIIa와 약 96%의 homology를 가지고 있는 FcγRIIb의 Fc에 대한 친화도에 미치는 영향을 확인하기 위한 점 돌연변이 도입
발굴한 점 돌연변이들의 FcγRIIb(서열목록 제41서열 및 제49서열)에 대한 영향을 분석하기 위한 실험을 수행하였다. 이를 위해 pMopac12-NlpA-FcγRIIb-FLAG 플라스미드를 template로 사용하였으며, FcγRIIb 유전자 부분에 MG2A45.1 점 돌연변이(R55H, K117N, T119V, L159Q, V171E) 중 R55H와 L159Q를 도입하기 위하여 Quikchange site directed mutagenesis(Agilent) 기법을 이용하였다. 각 점 돌연변이 도입을 위해 MJ#200과 MJ#201, MJ#202와 MJ#203 프라이머를 사용하였으며, Pfu turbo polymerase(Agilent)를 이용하여 PCR을 한 뒤, DpnI(New England Biolab) 제한효소 처리를 위해 37℃에서 3시간 incubation하였다. 준비된 유전자는 transformation한 뒤 염기서열 분석을 통해 점 돌연변이가 성공적으로 삽입되었음을 확인하였다. 또 K117N과 T119V, V171E 세 가지의 점 돌연변이를 도입하기 위해 assembly PCR 기법을 활용하였다. Quikchange site directed mutagenesis로 R55H와 L159Q가 도입되어 있는 플라스미드를 template로 하고, MJ#160과 MJ#197, MJ#198과 MJ#199 프라이머와 vent polymerase(New England Biolab)를 이용해 2개의 fragment를 증폭하고 MJ#160과 MJ#199로 assemble하였다. 그 후 SfiI 제한효소 처리 및 ligation, transformation 과정을 거쳐 염기서열을 분석하여 MG2A45.1의 5개 점 돌연변이가 모두 삽입된 pMopac12-NlpA-FcγRIIb(MG2B45.1)-FLAG 유전자 제작을 완료하였다.
실시예 19: 야생형 FcγRIIb와 MG2A45.1 돌연변이가 도입된 FcγRIIb(MG2B45.1)의 human serum IgG-FITC에 대한 친화도 비교
FcγRIIb 변이체(MG2B45.1)(서열목록 제42서열 및 제50서열)는 human serum IgG-FITC에 대한 친화도를 야생형 FcγRIIb와 비교 분석하였다. 5 ml의 TB+2% glucose 배지에서 전배양한 inoculum을 5 ml의 TB 배지에 1:100 접종하여 OD600=0.6까지 배양하였다. 곧바로 25℃, 250 rpm에서 20분간 cooling 과정을 거친 후 1 mM IPTG를 첨가하여 25℃, 250 rpm, 5시간 동안 과발현 하였다. 과발현 후 OD600값을 측정하여 normalize된 양 만큼씩 14000 rpm, 1분간 원심분리를 통해 세포를 회수하였다. 1 ml의 10 mM Tris-HCl(pH 8.0)을 첨가해 세포를 resuspension하고 1분간 원심분리하는 wash과정을 2회 반복하였다. 1 ml의 STE[0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA(pH 8.0)]로 resuspension하여 37℃, 30분간 rotation을 통해 세포 외막을 제거하였다. 원심분리하여 상등액을 제거한 후 1 ml의 Solution A[0.5 M sucrose, 20 mM MgCl2,10 mM MOPS pH 6.8]을 첨가해 resuspension과 원심분리를 하였다. 1 ml의 Solution A와 50 mg/ml lysozyme solution 20 μl를 혼합한 용액을 1 ml 첨가해resuspension한 뒤 37℃, 15분 간 rotation하여 peptidoglycan layer를 제거하였다. 원심분리 후 상등액을 제거하고 1 ml의 PBS로 resuspension한 뒤 300 μl를 취해 700 μl의 PBS와 human serum IgG-FITC(Sigma aldrich) probe를 함께 넣고 상온에서 1시간 동안 rotation하여 spheroplast에 형광 probe를 labeling하였다. Labeling 후 1 ml의 PBS로 1회 wash한 후 Guava(Merck Millipore) 장비를 이용해 FcγRIIb에 결합된 human IgG-FITC에 의한 형광 신호를 분석하였다(도 17).
실시예 20: 혈중 반감기 증가 검증을 위한 Bevacizumab scFv와 Bevacizumab scFv-FcγRIIa 변이체 클로닝
Bevacizumab의 Heavy chain을 template으로 Vent polymerase와 primer BR#1, BR#2를 이용하여 VH 유전자를 증폭하고 Light chain을 template로 primer BR#4, BR#5를 이용하여 VL 유전자를 증폭하였다. 각각 증폭된 유전자는 primer BR#3에 도입된 GS linker를 이용하여 assembly 하였고 BssHII, XbaI(New England Biolab)으로 제한효소 처리, ligation 과정을 거쳐 동물세포 발현용 벡터인 pMAZ vector에 클로닝하여 bevacizumab scFv를 제작하였다. FcγRIIa wild type과 FcγRIIa variant는 primer BR#6, BR#7을 이용하여 각각 증폭하였다. 증폭된 FcγRIIa 유전자는 BR#6에 도입된 GS linker를 이용하여 assembly하여 bevacizumab scFv-FcγRIIa wild type, bevacizumab scFv-MG2A45.1 유전자를 각각 증폭하였다. 증폭된 유전자는 BssHII, XbaI(New England Biolab)으로 제한효소 처리, ligation하여 동물세포 발현용 벡터인 pMAZ vector에 클로닝하여 pMAZ-bevacizumab scFv, pMAZ-bevacizumab scFv-FcγRIIa wild type, pMAZ-bevacizumab scFv-MG2A45.1을 각각 제작하였다. 본 실시예에서 이용된 프라이머들에 대한 정보는 표 2와 같다.
primer# sequence(5’→3’)
BR#1 (서열목록 제51서열) CGCAGCGAGCGCGCACTCCGAGGTGCAGCTGGTGGAGAGC
BR#2 (서열목록 제52서열) ACTAGAGACAGTCACCAGTGTACCCT
BR#3 (서열목록 제53서열) AGGGTACACTGGTGACTGTCTCTAGTGGTGGAGGCGGATCAGGCGGTGGCGGCAGTGGAGGGGGTGGTAGCGGCGGAGGAGGTTCCGACATCCAGATGACTCAATCACCCAGT
BR#4 (서열목록 제54서열) CCCTAAAATCTAGATCACTAGTGATGGTGATGATGATGTGATCCGCCGGTCCGCTTAATCTCCACTTTGGTTC
BR#5 (서열목록 제55서열) GGTCCGCTTAATCTCCACTTTGGTTC
BR#6 (서열목록 제56서열) GAACCAAAGTGGAGATTAAGCGGACCGGCGGAGGCGGGAGTCAGGCTGCCCCACCGAAAG
BR#7 (서열목록 제57서열) TTTTAGGGTCTAGATCACTAGTGATGGTGATGATGATGTGATCCGCCAATCACGCCCATCGGTGAGCTG
실시예 21: Bevacizumab scFv와 Bevacizumab scFv-FcγRIIa 변이체의 발현 및 정제
제작된 유전자들은 Expi 293F 세포에 300 ml 규모로 임시발현 하였다. 배양이 끝난 후 7500 rpm, 15분간 원심분리를 통해 세포를 제거하고 상등액을 취해 25x PBS를 이용해 equilibrium을 맞춘 후 bottle top filter를 이용해 0.2 μm filter(Merck Millipore)로 여과하였다. PBS로 평형을 맞춘 Ni-NTA agarose(Qiagen) 1 ml slurry를 첨가해 4℃, 16시간 교반 한 다음 polypropylene column(Thermo Fisher Scientific)에 흘려주었다. 그 후 25 ml의 10 mM imidazole buffer, 25 ml의 20 mM imidazole buffer, 250 ul의 250 mM imidazole buffer 순으로 wash를 해주었다. Elution은 250 mM imidazole buffer 4 ml로 수행하였다. 받아진 단백질은 Amicon Ultra-4(Merck Millipore)을 통해 PBS로 buffer를 교체한 후 농축 과정을 거쳐 SDS-PAGE(BioRad)를 통해 정제된 단백질을 확인하였다(도 18).
실시예 22: 동물세포 배양을 통해 생산한 Bevacizumab scFv, Bevacizumab scFv-FcγRIIa 변이체의 Bevacizumab scFv의 활성 및 결합력 분석을 위해 VEGF를 이용하여 수행한 ELISA
0.05 M Na2CO3 pH9.6에 500 ng/ml로 희석한 VEGF(Genscript)를 각각 50 μl씩Flat Bottom Polystyrene High Bind 96 well microplate(costar)에 4℃, 16시간 동안 고정화 한 후 100 μl의 5% BSA(in 0.05% PBST)로 상온에서 1시간 동안 blocking 하였다. 0.05% PBST 180 μl로 4회씩 wash를 진행한 뒤 blocking solution으로 serially dilution된 bevacizumab scFv, bevacizumab scFv-FcγRIIa-wild type, bevacizumab scFv-MG2A45.1 단백질들을 50 μl씩 각 well에 분주하여 상온에서 1시간 동안 반응시켰다. Wash 과정 후 secondary antibody인 anti-His antibody-HRP conjugate(Sigma-Aldrich)의 Fc domain과 FcγRIIa와의 cross linking을 방지하지 위해 20 μg/ml의 Human serum IgG를 50 μl씩 각 well에 분주하여 상온에서 1시간 반응시켰다. Wash 과정을 거친 후 anti-His-HRP conjugate 50 μl씩을 이용해 상온에서 1시간 동안 항체 반응을 진행하고 wash 과정을 수행하였다. 1-Step Ultra TMB-ELISA Substrate Solution(Thermo Fisher Scientific) 50 μl씩 첨가해 발색 한 뒤 2 M H2SO4 50μl씩 넣어주어 반응을 종료 시킨 다음 Epoch Microplate Spectrophotometer(BioTek)를 이용해 450 nm에서의 흡광도을 분석하였다. 각 실험은 모두 duplicate로 진행하였으며 ELISA 결과 FcγRIIa 변이체들이 융합된 bevacizumab scFv의 VEGF에 대한 결합 활성을 분석할 수 있었다. 그 결과 FcγRIIa wild type과 FcγRIIa 변이체인 MG2A45.1이 bevacizumab scFv에 융합 되어도 bevacizumab scFv 고유의 특성인 VEGF 결합이 정상적으로 나타나는 것을 확인하였다(도 19). 또한, FcγRIIa가 비공유 결합으로 인해 dimer를 이루는 성질이 있어(Maxwell, K. F., M. S. Powell, M. D. Hulett, P. A. Barton, I. F. McKenzie, T. P. Garrett, and P. M. Hogarth. 1999. Crystal structure of the human leukocyte Fc receptor, FcγRIIa. Nat. Struct. Biol.6: 437-442) FcγRIIa가 융합된 단백질이 ELISA 상에서 avidity에 의해 결합력이 더 높게 나타난 것을 확인할 수 있었다.
실시예 23: 동물세포 배양을 통해 생산한 bevacizumab scFv, bevacizumab scFv-FcγRIIa 변이체의 FcγRIIa 활성 및 결합력 분석을 위해 rituximab을 이용하여 수행한 ELISA
0.05 M Na2CO3 pH9.6에 4 μg/ml로 희석한 rituximab를 각각 50 μl씩 Flat Bottom Polystyrene High Bind 96 well microplate(costar)에 4℃, 16시간 동안 고정화 한 후 100 μl의 5% BSA(in 0.05% PBST)로 상온에서 1 시간 동안 blocking하였다. 0.05% PBST 180 μl로 4회씩 wash를 진행한 뒤 blocking solution으로serially dilution된 bevacizumab scFv, bevacizumab scFv-FcγRIIa wild type, bevacizumab scFv-MG2A45.1 단백질들을 50 μl씩 각 well에 분주하여 상온에서 1시간 동안 반응시켰다. Wash 과정 후 anti-His-HRP conjugate(Sigma-Aldrich) 50 μl씩을 이용해 상온에서 1시간 동안 항체 반응을 진행하고 wash 과정을 수행하였다. 1-Step Ultra TMB-ELISA Substrate Solution(Thermo Fisher Scientific) 50 μl씩 첨가해 발색 한 뒤 2 M H2SO4 50μl씩 넣어주어 반응을 종료 시킨 다음 Epoch Microplate Spectrophotometer(BioTek)를 이용해 흡광도를 분석하였다. 각 실험은 모두 duplicate로 진행하였으며 ELISA 결과 FcγRIIa가 없는 bevacizumab scFv를 제외한 bevacizumab scFv-FcγRIIa wild type과 bevacizumab scFv-FcγRIIa-MG2A45.1의 IgG1 Fc로 구성된 rituximab에 대한 결합력이 모두 정상적으로 유지되는 것을 확인하였다. 또한 Fc와의 결합력이 향상된 MG2A45.1을 융합한 단백질의 rituximab에 대한 결합력이 더 증가된 것으로 나타나 bevacizumab scFv를 융합해도 wild type FcγRIIa와 그 변이체인 MG2A45.1이 그 특성을 유지하고 있음을 확인하였다(도 20).
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (20)

  1. Fc 감마 수용체 변이체를 포함하는 폴리펩타이드로서,
    상기 변이체는 서열목록 제43서열 또는 서열목록 제49서열의 야생형(wild type) Fc 감마 수용체의 서열에서 117번째 아미노산 및 159번째 아미노산이 변형된 것을 특징으로 하는 폴리펩타이드.
  2. 제 1 항에 있어서, 상기 변이체는 서열목록 제43서열 또는 서열목록 제49서열에서 117번째 아미노산이 아스파라긴(N)으로 치환되고 159번째 아미노산이 글루타민(Q)으로 치환된 서열을 포함하는 Fc 감마 수용체 변이체인 것을 특징으로 하는 폴리펩타이드.
  3. 제 2 항에 있어서, 상기 변이체는 추가적으로 55번째 아미노산, 86번째 아미노산, 119번째 아미노산, 127번째 아미노산 및 171번째 아미노산으로 구성된 군으로부터 선택되는 1 또는 그 이상의 아미노산 치환을 포함하는 Fc 감마 수용체 변이체인 것을 특징으로 하는 폴리펩타이드.
  4. 제 3 항에 있어서, 상기 변이체는 55번째 아미노산이 히스티딘(H)으로, 86번째 아미노산이 아스파르트산(D)으로, 119번째 아미노산이 메티오닌(M) 또는 발린(V)으로, 127번째 아미노산이 류신(L)으로, 그리고 171번째 아미노산이 글루탐산(E)으로 치환된 군으로부터 선택되는 1 또는 그 이상의 아미노산 치환을 포함하는 Fc 감마 수용체 변이체인 것을 특징으로 하는 폴리펩타이드.
  5. 제 1 항에 있어서, 상기 아미노산 치환을 포함하는 변이체는 야생형 Fc 감마 수용체와 비교하여 IgG 항체의 Fc 부위에 대한 결합력이 향상된 것을 특징으로 하는 폴리펩타이드.
  6. 제 1 항의 폴리펩타이드를 코딩하는 핵산분자.
  7. 제 6 항의 핵산분자를 포함하는 벡터.
  8. 제 7 항의 벡터를 포함하는 숙주세포.
  9. 제 1 항의 폴리펩타이드, 제 6 항의 핵산분자 또는 제 7 항의 벡터를 포함하는 조성물.
  10. 제 9 항에 있어서, 상기 조성물은 시료에 포함된 IgG 항체 또는 IgG 항체의 Fc 부위를 검출하기 위한 것을 특징으로 하는 조성물.
  11. 제 10 항의 조성물을 포함하는 IgG 항체 또는 IgG 항체의 Fc 부위를 검출하기 위한 키트.
  12. 제 9 항에 있어서, 상기 조성물은 면역 억제용 약제학적 조성물인 것을 특징으로 하는 조성물.
  13. 제 9 항에 있어서, 상기 조성물은 장기이식반응 억제용 약제학적 조성물인 것을 특징으로 하는 조성물.
  14. 제 9 항에 있어서, 상기 조성물은 자가면역질환의 예방 또는 치료용 약제학적 조성물인 것을 특징으로 하는 조성물.
  15. 제 9 항의 조성물을 투여하는 단계를 포함하는 면역 억제 또는 장기이식반응 억제 방법.
  16. 제 9 항의 조성물을 투여하는 단계를 포함하는 자가면역질환의 예방 또는 치료방법.
  17. 제 1 항의 폴리펩타이드와 생리활성 단백질 또는 생리활성 펩타이드가 결합된 단백질 또는 펩타이드 융합체로서, 상기 단백질 또는 펩타이드 융합체는 체내 지속성을 유지함으로 체내 반감기가 증가된 것을 특징으로 하는 단백질 또는 펩타이드 융합체.
  18. 하기의 단계를 포함하는 Fc 감마 수용체 변이체를 포함하는 폴리펩타이드의 제조방법:
    a) 제 1 항의 폴리펩타이드를 코딩하는 핵산분자를 포함하는 벡터를 포함하는 숙주세포를 배양하는 단계; 및
    b) 상기 숙주세포에 의해 발현된 폴리펩타이드를 회수하는 단계.
  19. 하기의 단계를 포함하는 시료에 포함된 IgG 항체 또는 IgG 항체의 Fc 부위를 정제하는 방법:
    a) IgG 항체 또는 IgG 항체의 Fc 부위를 포함하는 시료에 제 1 항의 폴리펩타이드를 혼합하여 서로 결합시키는 단계; 및
    b) 상기 폴리펩타이드가 결합된 IgG 항체 또는 IgG 항체의 Fc 부위를 정제하는 단계.
  20. 하기의 단계를 포함하는 IgG 항체 또는 IgG 항체의 Fc 부위에 대한 결합력이 향상된 Fc 감마 수용체 변이체를 스크리닝하는 방법:
    a) 서열목록 제43서열 또는 서열목록 제49서열에서 117번째 아미노산이 아스파라긴(N)으로 치환되고 159번째 아미노산이 글루타민(Q)으로 치환된 서열을 포함하는 인간 Fc 감마 수용체 변이체 라이브러리를 구축하는 단계; 및
    b) 상기 라이브러리에서 상기 두 가지의 아미노산 서열의 치환만을 포함하는 Fc 감마 수용체 변이체와 비교하여 IgG 항체 또는 IgG 항체의 Fc 부위에 대한 결합력이 보다 향상된 Fc 감마 수용체 변이체를 선별하는 단계.
PCT/KR2018/010783 2017-09-15 2018-09-13 Fc 감마 수용체 변이체들 WO2019054782A1 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU2018332475A AU2018332475B2 (en) 2017-09-15 2018-09-13 Fc-gamma receptor mutants
US16/628,427 US11650209B2 (en) 2017-09-15 2018-09-13 Fc-gamma receptor mutants
JP2019571392A JP7055434B2 (ja) 2017-09-15 2018-09-13 Ｆｃガンマ受容体変異体
CN201880045076.2A CN111183150B (zh) 2017-09-15 2018-09-13 Fcγ受体突变体
BR112020000098-1A BR112020000098A2 (pt) 2017-09-15 2018-09-13 mutantes de receptor fc-gama
EP18856285.4A EP3632928B1 (en) 2017-09-15 2018-09-13 Fc-gamma receptor mutants

Applications Claiming Priority (12)

Application Number Priority Date Filing Date Title
KR10-2017-0118769 2017-09-15
KR10-2017-0118770 2017-09-15
KR1020170118769A KR101986250B1 (ko) 2017-09-15 2017-09-15 Fc 감마 수용체 변이체 SH2A40
KR10-2017-0118771 2017-09-15
KR1020170118771A KR101987272B1 (ko) 2017-09-15 2017-09-15 Fc 감마 수용체 변이체 MG2A28.1
KR1020170118770A KR101986252B1 (ko) 2017-09-15 2017-09-15 Fc 감마 수용체 변이체 MG2A28
KR10-2017-0132864 2017-10-12
KR1020170132863A KR101987279B1 (ko) 2017-10-12 2017-10-12 Fc 감마 수용체 변이체 MG2A45.1
KR10-2017-0132862 2017-10-12
KR10-2017-0132863 2017-10-12
KR1020170132862A KR101987268B1 (ko) 2017-10-12 2017-10-12 Fc 감마 수용체 변이체 MG2A45
KR1020170132864A KR101987292B1 (ko) 2017-10-12 2017-10-12 Fc 감마 수용체 변이체 MG2B45.1

Publications (1)

Publication Number Publication Date
WO2019054782A1 true WO2019054782A1 (ko) 2019-03-21

Family

ID=65722844

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/010783 WO2019054782A1 (ko) 2017-09-15 2018-09-13 Fc 감마 수용체 변이체들

Country Status (7)

Country Link
US (1) US11650209B2 (ko)
EP (1) EP3632928B1 (ko)
JP (1) JP7055434B2 (ko)
CN (1) CN111183150B (ko)
AU (1) AU2018332475B2 (ko)
BR (1) BR112020000098A2 (ko)
WO (1) WO2019054782A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5985599A (en) * 1986-05-29 1999-11-16 The Austin Research Institute FC receptor for immunoglobulin
US20020107359A1 (en) * 1998-02-06 2002-08-08 P. Mark Hogarth Three dimensional structures and models of fc receptors and uses thereof
US20070207163A1 (en) * 1998-12-03 2007-09-06 Peter Sondermann Recombinant soluble Fc receptors
US20100196372A1 (en) * 2003-01-13 2010-08-05 Macrogenics, Inc. FcgammaRIIB Fusion Proteins and Compositions Thereof
US20120021484A1 (en) * 2008-10-22 2012-01-26 Biogen Idec Ma Inc. Recombinant FcRn and Variants Thereof for Purification of Fc-Containing Fusion Proteins

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2313105B1 (en) * 2008-06-27 2013-07-24 ZymoGenetics, Inc. SOLUBLE HYBRID Fc gamma RECEPTORS AND RELATED METHODS
SG11201700841QA (en) * 2014-12-19 2017-03-30 Chugai Pharmaceutical Co Ltd Anti-myostatin antibodies, polypeptides containing variant fc regions, and methods of use
US20180284130A1 (en) * 2015-10-02 2018-10-04 The Macfarlane Burnet Institute For Medical Research And Publichealth Ltd Binding assays and method for probing antibody function with fc binding multimers

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5985599A (en) * 1986-05-29 1999-11-16 The Austin Research Institute FC receptor for immunoglobulin
US20020107359A1 (en) * 1998-02-06 2002-08-08 P. Mark Hogarth Three dimensional structures and models of fc receptors and uses thereof
US20070207163A1 (en) * 1998-12-03 2007-09-06 Peter Sondermann Recombinant soluble Fc receptors
US20100196372A1 (en) * 2003-01-13 2010-08-05 Macrogenics, Inc. FcgammaRIIB Fusion Proteins and Compositions Thereof
US20120021484A1 (en) * 2008-10-22 2012-01-26 Biogen Idec Ma Inc. Recombinant FcRn and Variants Thereof for Purification of Fc-Containing Fusion Proteins

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 1995
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1994, JOHN, WILEY & SONS, INC
IERINO, F. L.: "Recombinant soluble human FcyRII: production, characterization, and inhibition of the Arthus reaction", JOURNAL OF EXPERIMENTAL MEDICINE, 1993, pages 1617 - 1628, XP009015491, DOI: doi:10.1084/jem.178.5.1617 *
MANIATIS ET AL.: "Molecular Cloning, A Laboratory Manual", 1988, COLD SPRING HARBOR PRESS
MAXWELL, K. F.M. S. POWELLM. D. HULETTP. A. BARTONI. F. MCKENZIET. P. GARRETTP. M. HOGARTH: "Crystal structure of the human leukocyte Fc receptor, FcyRIIa", NAT. STRUCT. BIOL., vol. 6, 1999, pages 437 - 442, XP003005007, DOI: 10.1038/8241
See also references of EP3632928A4
SONDERMANN, CURR OPIN IMMUNOL, 2016

Also Published As

Publication number Publication date
JP2020528269A (ja) 2020-09-24
EP3632928A4 (en) 2021-02-24
EP3632928A1 (en) 2020-04-08
US11650209B2 (en) 2023-05-16
EP3632928B1 (en) 2022-06-22
JP7055434B2 (ja) 2022-04-18
BR112020000098A2 (pt) 2020-07-14
CN111183150A (zh) 2020-05-19
AU2018332475B2 (en) 2020-12-17
CN111183150B (zh) 2024-04-02
AU2018332475A1 (en) 2020-01-16
US20200408778A1 (en) 2020-12-31

Similar Documents

Publication Publication Date Title
WO2014084607A1 (ko) 항체 중쇄불변부위의 이종이중체 고효율 형성을 유도하는 ch3 도메인 변이체 쌍, 이의 제조방법, 및 용도
WO2020231199A1 (ko) 신규 변형 면역글로불린 fc 융합단백질 및 그의 용도
WO2013051900A2 (en) Blood coagulation factor ⅶ and ⅶa derivatives, conjugates and complexes comprising the same, and use thereof
WO2014025198A2 (ko) Lfa3 변이체 및 상기 변이체 또는 lfa3 cd2 결합영역과 이에 표적 특이적 폴리펩타이드가 연결된 융합단백질 및 그 용도
WO2017222337A1 (ko) Fviii 및 vwf 인자를 포함하는 키메라 단백질 및 그 용도
WO2016056812A1 (en) Human igg4 fc polypeptide variant
WO2020050626A1 (ko) O-글리코실화 가능한 폴리펩타이드 영역을 포함하는 융합 폴리펩타이드
WO2021154046A1 (ko) pH-감응성 FC 변이체
WO2023214833A1 (ko) Glp-1, 면역글로불린 fc, 및 igf-1을 포함하는 융합단백질 및 이의 용도
WO2019054782A1 (ko) Fc 감마 수용체 변이체들
WO2013129852A1 (ko) 신규한 인터루킨-6에 대한 리피바디 및 그 용도
WO2012087017A2 (ko) 변형된 인간 종양 괴사 인자 수용체-1 폴리펩티드 또는 그의 절편 및 그의 제조방법
WO2018004294A9 (ko) 인간 성장호르몬 변이 단백질 또는 이의 트랜스페린 융합 단백질을 유효성분으로 포함하는 약학적 조성물
WO2011049350A2 (ko) 변형된 인간 종양 괴사 인자 수용체-1 폴리펩티드 또는 그의 절편 및 그의 제조방법
KR101987268B1 (ko) Fc 감마 수용체 변이체 MG2A45
KR101986252B1 (ko) Fc 감마 수용체 변이체 MG2A28
KR101987272B1 (ko) Fc 감마 수용체 변이체 MG2A28.1
KR101986250B1 (ko) Fc 감마 수용체 변이체 SH2A40
KR101987292B1 (ko) Fc 감마 수용체 변이체 MG2B45.1
KR101987279B1 (ko) Fc 감마 수용체 변이체 MG2A45.1
WO2024029876A1 (ko) 변형된 융합 단백질 및 이의 용도
WO2018105988A1 (ko) 면역반응이 약화된 결합체
WO2019093807A2 (ko) Il-17a 에 특이적으로 결합하는 항체 및 이의 용도
AU2022316521B2 (en) A fusion protein comprising an antigen binding domain and a cytokine trimer domain
WO2023158027A1 (en) A fusion protein comprising an antigen binding domain and a cytokine trimer domain

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18856285

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2019571392

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020000098

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2018332475

Country of ref document: AU

Date of ref document: 20180913

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018856285

Country of ref document: EP

Effective date: 20200103

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 112020000098

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200103