WO2018232359A1 - Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells - Google Patents
Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells Download PDFInfo
- Publication number
- WO2018232359A1 WO2018232359A1 PCT/US2018/037924 US2018037924W WO2018232359A1 WO 2018232359 A1 WO2018232359 A1 WO 2018232359A1 US 2018037924 W US2018037924 W US 2018037924W WO 2018232359 A1 WO2018232359 A1 WO 2018232359A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- cells
- cell
- sequence
- fdps
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/01001—Dimethylallyltranstransferase (2.5.1.1)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/12—Animals modified by administration of exogenous cells
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0331—Animal model for proliferative diseases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/31—Combination therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/50—Biochemical production, i.e. in a transformed host cell
- C12N2330/51—Specially adapted vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15023—Virus like particles [VLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16041—Use of virus, viral particle or viral elements as a vector
- C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/0101—(2E,6E)-Farnesyl diphosphate synthase (2.5.1.10), i.e. geranyltranstransferase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/01029—Geranylgeranyl diphosphate synthase (2.5.1.29)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/01058—Protein farnesyltransferase (2.5.1.58)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y503/00—Intramolecular oxidoreductases (5.3)
- C12Y503/03—Intramolecular oxidoreductases (5.3) transposing C=C bonds (5.3.3)
- C12Y503/03002—Isopentenyl-diphosphate DELTA-isomerase (5.3.3.2)
Definitions
- the present disclosure relates generally to the fields of gene therapy and immunotherapy, specifically in relation to increased activation and effector cell function of gamma delta ("GD") T cells.
- GD gamma delta
- Human T cells are distinguished on the basis of T cell receptor structure.
- Gamma delta (“GD") T cells make up 3-10% of circulating lymphocytes, and a V52+ subset makes up 75% of GD T cells in blood.
- V52+ cells recognize non-peptide epitopes and do not require antigen presentation by a major histocompatibility complex (“MHC”) or human leukocyte antigen (“HLA").
- MHC major histocompatibility complex
- HLA human leukocyte antigen
- V52+ T cells express a Vy9 chain and are stimulated by exposure to 5 -carbon pyrophosphate compounds that are intermediates in mevalonate and non-mevalonate sterol/isoprenoid synthesis pathways.
- the response to isopentenyl pyrophosphate (5-carbon) is nearly universal among healthy human beings.
- V5+1 cells are most commonly found in the epithelial mucosa and the skin. Minor cell populations express other V5 chains and may be associated with specific responses during allergy, transplantation or viral and bacterial diseases.
- GD T cells have several functions, including killing tumor cells and pathogen-infected cells. Stimulation through their unique T cell receptor ("TCR") composed of two glycoprotein chains, ⁇ and ⁇ that interact with CD3 complex proteins to create a functional TCR, improves the capacity for cellular cytotoxicity, cytokine secretion and other effector functions.
- TCR T cell receptor
- the TCRs of GD T cells have unique specificities and the cells themselves occur in high clonal frequencies, thus allowing rapid innate-like responses to tumors and pathogens.
- Bisphosphonate drugs and other inhibitors of farnesyl diphosphate synthase (“FDPS”), which are downstream from isopentenyl pyrophosphate (“IPP”) in the mevalonate pathway have been used to treat various diseases, including cancers, specifically those involving bone metastasis.
- Bisphosphonate drugs include, for example, trade names such as Zometa ® (Novartis), Actonel ® (Procter & Gamble), Aredia ® (Novartis) and Fosamax ® (Merck).
- Certain bisphosphonates have also been investigated for stimulation of GD T cells. This may be because inhibition of FDPS in myeloid or tumor cells, blocks the conversion of IPP to farnesyl diphosphate causing IPP to accumulate while simultaneously reducing levels of geranylgeranyl pyrophosphate ("GGPP"), a downstream product of FDPS that normally suppresses activation of the NLRP3 inflammasome pathway.
- GGPP geranylgeranyl pyrophosphate
- the reduction in GGPP removes an inhibitor of the caspase-dependent inflammasome pathway and allows secretion of cytokines including interleukin-1 beta and interleukin-18, the latter being especially important for gamma delta T cell activation.
- the increased IPP and decreased GGPP modify the myeloid or tumor cells and the modified cells gain an increased capacity for activating GD T cells and specifically the V52+ subset.
- Activated V52+ cells proliferate rapidly, express multiple cytokines and chemokines, and can function to cytotoxically destroy tumor cells or pathogen-infected cells.
- GD T cell effector activities include secretion of IFN-gamma, which activates macrophages and antigen-presenting cells, secretion of TNF-alpha among other cytokines and chemokines that activate other innate and acquired immune mechanisms, activation of granzyme B that attacks and destroys target cells and cell surface expression of FasL that triggers cellular apoptosis in Fas+ target cells.
- a significant problem with traditional cancer treatment is that patients become insensitive to chemotherapy treatments. Chemo-resistant tumor cells in particular become very difficult to treat. As an alternative therapy to treat chemo-resistant patients, or as a primary therapy in place of chemotherapy and/or radiation therapy the present application proposes the use of a recombinant lentivirus to express genes at the tumor site, where manipulation of proteins that impact GD T cell activity may slow down tumor growth and activate the patient's own innate immune response to recognize and kill cancers.
- a viral vector comprising first and second encoded genetic elements.
- the first encoded genetic element comprises at least one small RNA capable of inhibiting production of at least one enzyme involved in the mevalonate pathway
- the second encoded genetic element comprises one of a butyrophilin family member, a cytokine, or a chemokine.
- the viral vector also includes a third encoded genetic element, wherein the third encoded genetic element comprises one of a butyrophilin family member, a cytokine, or a chemokine.
- the viral vector also includes a fourth encoded genetic element, wherein the fourth encoded genetic element comprises one of a butyrophilin family member, a cytokine, or a chemokine.
- the at least one enzyme is famesyl diphosphate synthase (FDPS), geranylgeranyl-diphosphate synthase 1 (GGPS1), isopentyl-disphosphate delta isomerase 1 (IDI1), or famesyl transferase (F-Tase).
- the first encoded genetic element comprises a microRNA or a shRNA.
- the microRNA comprises a sequence having at least 80%, or at least
- the microRNA comprises
- the shRNA comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95% or more than 95% percent identity with
- the shRNA comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95% or more than 95% percent identity with SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, or SEQ ID NO: 76.
- the shRNA comprises:
- the shRNA comprises SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, or SEQ ID NO: 76.
- the butyrophilin family member comprises BTN3A3, BTN3A2, or BTN3A1 or variants thereof. In embodiments, the butyrophilin family member comprises BTN3A3 (R381H).
- the cytokine comprises IL-1, IL- ⁇ , IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, TNF-a, or interferon- ⁇ .
- the chemokine comprises a CC chemokine, a CXC chemokine, a CX3C chemokine, a C chemokine, or a XC chemokine.
- the CC chemokine comprises RANTES.
- the viral vector is a lentiviral vector.
- a lentiviral vector system for expressing a lentiviral particle includes a lentiviral vector as detailed herein; at least one envelope plasmid for expressing an envelope protein optimized for infecting a target cell; and at least one helper plasmid for expressing gag, pol, and rev genes, wherein when the lentiviral vector, the at least one envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell, the lentiviral particle is produced by the packaging cell, wherein the lentiviral particle is capable of infecting the target cell and inhibiting the at least one enzyme involved in the mevalonate pathway within the target cell.
- a lentiviral particle capable of infecting a target cell comprises an envelope protein optimized for infecting the target cell, and a lentiviral vector as detailed herein.
- the target cell is a cancer cell.
- a method of activating a gamma delta (GD) T cell includes infecting, or having infected, in the presence of the GD T cell, a target cell with a lentiviral particle, wherein the lentiviral particle comprises a viral vector comprising first and second encoded genetic elements wherein the first encoded genetic element comprises at least one small RNA capable of inhibiting production of at least one enzyme involved in the mevalonate pathway, and the second encoded genetic element comprises one of a butyrophilin family member, a cytokine, or a chemokine, wherein when the at least one enzyme is inhibited in the target cell, the target cell activates the GD T cell.
- the lentiviral particle comprises a viral vector comprising first and second encoded genetic elements wherein the first encoded genetic element comprises at least one small RNA capable of inhibiting production of at least one enzyme involved in the mevalonate pathway, and the second encoded genetic element comprises one of a butyrophilin family member, a cytokine,
- the target cell is a cancer cell.
- the method further comprises contacting, or having contacted, the target cell and the GD T cell with an amount of an aminobisphosphonate drug.
- the aminobisphosphonate drug is zoledronic acid.
- the at least one enzyme is farnesyl diphosphate synthase (FDPS), geranylgeranyl-diphosphate synthase 1 (GGPS 1), isopentenyl-diphosphate delta isomerase 1 (IDI1), or farnesyl transferase (F-Tase).
- a method of treating cancer in a subject includes administering, or having administered, to the subject a therapeutically effective amount of a lentiviral particle wherein the lentiviral particle comprises a viral vector comprising first and second encoded genetic elements wherein the first encoded genetic element comprises at least one small RNA capable of inhibiting production of at least one enzyme involved in the mevalonate pathway, and the second encoded genetic element comprises one of a butyrophilin family member, a cytokine, or a chemokine, wherein when the at least one enzyme is inhibited in a cancer cell in the presence of a GD T cell, the target cell activates the GD T cell, to thereby treat the cancer.
- the method further comprises contacting, or having contacted, the target cell and the GD T cell with an amount of an aminobisphosphonate drug.
- the aminobisphosphonate drug is zoledronic acid.
- the butyrophilin family member includes BTN3A3 (SEQ ID NO: 17) or BTN3A3 (R381H) (SEQ ID NO: 54).
- the cytokine includes IL-1 , IL-2, IL-12, IL-15, IL-17, IL-18, IL-23, or IL-36.
- a viral vector in another aspect, comprises a first small RNA that targets a first target of the mevalonate pathway and is capable of increasing a first product of the mevalonate pathway, and a second small RNA that targets a second target of the mevalonate pathway and is capable of decreasing a second product of the mevalonate pathway.
- the first target is a first enzyme of the mevalonate pathway and the second target is a second enzyme of the mevalonate pathway.
- At least one of the first enzyme and the second enzyme comprises farnesyl diphosphate synthase (FDPS), geranylgeranyl-diphosphate synthase 1 (GGPS1), isopentenyl-diphosphate delta isomerase 1 (IDI1), or farnesyl transferase (F-Tase).
- FDPS farnesyl diphosphate synthase
- GGPS1 geranylgeranyl-diphosphate synthase 1
- IDI1 isopentenyl-diphosphate delta isomerase 1
- F-Tase farnesyl transferase
- the first product of the mevalonate pathway comprises isopentenyl pyrophosphate (IPP).
- the second product of the mevalonate pathway comprises geranylgeranyl pyrophosphate (GGPP).
- a method of treating cancer in a subject comprises administering, or having administered, to the subject a therapeutically effective amount of a lentiviral particle wherein the lentiviral particle comprises a viral vector as described herein.
- the method further comprises administering, or having administered, to the subject a therapeutically effective amount of an aminobisphosphonate drug.
- Figure 1 depicts an overview of the major steps in the mevalonate pathway for biosynthesis of steroids and isoprenoids.
- Figure 2 depicts an exemplary 3-vector lentiviral vector system in a circularized form.
- Figure 3 depicts an exemplary 4-vector lentiviral vector system in a circularized form.
- Figure 4 depicts various linear maps of lentiviral vectors expressing a FDPS shRNA targeting sequence in combination with BTN3A3 and/or IL-2, IL-15, and IL-18.
- Figure 5 depicts FACS data demonstrating activation of V52+ T cells by PC3 prostate carcinoma cells with a lentivirus expressing BTN3A3 (R381H) or BTN3A3 (WT), as described herein.
- Figure 6 depicts FACS data demonstrating activation of V52+ T cells HepG2 cells with a lentivirus expressing BTN3A3 (R381H) or both BTN3A3 (R381H) and shRNA #4, as described herein.
- Figure 7 depicts FACS data demonstrating activation of V52+ T cells by PC3 prostate carcinoma cells with a lentivirus expressing BTN3A3 (R381H) or both BTN3A3 (R381H) and shRNA #4, as described herein.
- Figure 8 depicts FACS data demonstrating activation of V52+ T cells by HepG2 cells with a lentivirus expressing shFDPS-IL-2, as described herein.
- Figure 9 depicts FACS data demonstrating activation of V52+ T cells by PC3 cells with a lentivirus expressing shFDPS-IL-2, as described herein.
- Figure 10 depicts FACS data demonstrating activation of V52+ T cells by PC3 cells with a lentivirus expressing shFDPS-IL-15, as described herein.
- Figure 11 depicts data demonstrating the extracellular expression of BTN3A3 in PC3 and HepG2 cells with a lentivirus expressing BTN3A3 (R381H) or BTN3A3 (R381H) and shFDPS.
- Figure 12 depicts FACS data demonstrating activation of V52+ T cells by HepG2 cells transduced with a lentivirus expressing Lv-shFDPS, as described herein.
- Figure 13 depicts data demonstrating delayed growth of tumors in mice injected with
- PC3 cells transduced with a lentivirus expressing Lv-shFDPS, as described herein.
- Figure 14 depicts data demonstrating survival of mice injected with a lentivirus expressing Lv-shFDPS and subsequently treated with PBMC and/or zoledronic acid.
- Figure 15 depicts data demonstrating tumor volume of mice injected with a lentivirus expressing Lv-shFDPS and subsequently treated with PBMC and/or zoledronic acid.
- Figure 16 depicts the gross appearance of Lv-shFDPS PC3 xenografted tumors treated and untreated with PBMC.
- Figure 17 depicts a lentiviral vector containing a HI promoter with a synthetic shRNA sequence targeting FDPS, GGPSl, or IDIl, and a lentiviral vector containing an elongation factor 1 alpha promoter with a synthetic microRNA having a FDPS targeting sequence.
- Figure 18 depicts data demonstrating reduction of FDPS protein expression in HepG2 cells transduced with lentivirus expressing shFDPS #1 (SEQ ID NO: 1) or shFDPS #4 (SEQ ID NO: 4) and treated with or without zoledronic acid, as described herein.
- Figures 19A and 19B depict data demonstrating reduction of FDPS RNA ( Figures 19A and 19B depict data demonstrating reduction of FDPS RNA ( Figures 19A and 19B depict data demonstrating reduction of FDPS RNA ( Figures 19A and 19B depict data demonstrating reduction of FDPS RNA ( Figures 19A and 19B depict data demonstrating reduction of FDPS RNA ( Figures 19A and 19B depict data demonstrating reduction of FDPS RNA ( Figures 19A and 19B depict data demonstrating reduction of FDPS RNA ( Figures 19A and 19B depict data demonstrating reduction of FDPS RNA ( Figures 19A and 19B depict data demonstrating reduction of FDPS RNA ( Figures 19A and 19B depict data demonstrating reduction of FDPS RNA ( Figures 19A and 19B depict data demonstrating reduction of FDPS RNA ( Figures 19A and 19B depict data demonstrating reduction of FDPS RNA ( Figures 19A and 19B depict data demonstrating reduction of FDPS RNA ( Figures 19A and 19B
- Figure 20 depicts reduction of FDPS protein expression in HepG2 cells transduced with lentivirus expressing shFDPS-4 (SEQ ID NO: 4), miR30-FDPS-l (SEQ ID NO: 68) and miR30-FDPS-3 (SEQ ID NO: 69), as described herein.
- Figure 21 depicts FACS data demonstrating activation of V52+ T cells by THP-1 cells transduced with a lentivirus expressing miR30-FDPS #1 (SEQ ID NO: 68) and treated with or without zoledronic acid, as described herein.
- Figure 22 depicts reduction of GGPS1 protein expression in HeLa cells transduced with lentivirus expressing shGGPSl #1 (SEQ ID NO: 70), shGGPSl #2 (SEQ ID NO: 71), and shGGPSl #3 (SEQ ID NO: 73), as described herein.
- Figure 23 depicts FACS data demonstrating activation of V52+ T cells by PC3 cells transduced with a lentivirus expressing shFDPS sequence #4 (SEQ ID NO: 4) or shGGPSl sequence #1 (SEQ ID NO: 70) and treated with or without zoledronic acid, as described herein.
- Figure 24 depicts FACS data demonstrating activation of V52+ T cells by HepG2 cells transduced with a lentivirus expressing shFDPS sequence #4 (SEQ ID NO: 4) or shGGPSl sequence #1 (SEQ ID NO: 70) and treated with or without zoledronic acid, as described herein.
- Figure 25 depicts FACS data demonstrating activation of V52+ T cells by THP-1 cells transduced with a lentivirus expressing shFDPS sequence #4 (SEQ ID NO: 4) and/or shGGPSl sequence #1 (SEQ ID NO: 70) and treated with or without zoledronic acid, as described herein.
- Figure 26 depicts reduction of IDI1 protein expression in PC3 cells transduced with lentivirus expressing shIDIl (SEQ ID NO: 76), as described herein.
- Figure 27 depicts FACS data demonstrating activation of V52+ T cells by PC3 cells transduced with a lentivirus expressing shFDPS sequence #4 (SEQ ID NO: 1) or shIDIl sequence #1 (SEQ ID NO: 76), as described herein.
- Figure 28 depicts data demonstrating activation of V52+ T cells by THP-1 cells treated with zoledronic acid, FTI277, or zaragozic acid, as described herein.
- Figure 29 depicts FACS data demonstrating activation of V52+ T cells by PC3 cells transduced with a lentivirus expressing shFDPS sequence #4 (SEQ ID NO: 4) and treated with zoledronic acid, FTI277, or zaragozic acid, as described herein.
- Figure 30 depicts FACS data demonstrating activation of V52+ T cells by HepG2 cells transduced with a lentivirus expressing shFDPS sequence #4 (SEQ ID NO: 4) and treated with zoledronic acid, FTI277, or zaragozic acid, as described herein.
- the present disclosure relates to gene therapy constructs and delivery of the same to cells, resulting in suppression of Farnesyl diphosphate synthase ("FDPS") or other enzymes of the mevalonate pathway, which are necessary to convert isopentenyl phosphate (IPP) to farnesyl diphosphate (FDP) and other downstream products of the mevalonate pathway, as shown, for example, in Figure 1.
- FDPS Farnesyl diphosphate synthase
- IPP isopentenyl phosphate
- FDP farnesyl diphosphate
- one or more viral vectors are provided with microRNAs or short hairpin RNAs (shRNA) that target one or more of FDPS, GGPS1, IDI1, F-Tase, or squalene synthase, thereby reducing expression levels of these enzymes.
- the viral vectors include lentiviral vectors and AAV vectors.
- a consequence of modulating expression of FDPS and other enzymes of the mevalonate pathway is to increase the accumulation of IPP, which is a stimulator of GD T cell proliferation and differentiation.
- a consequence of modulating expression of GGPS1 and other enzymes of the mevalonate pathway is to decrease GGPP levels, which allows secretion of cytokines including interleukin-1 beta and interleukin-18. Accordingly, the constructs provided herein are used to activate GD T cells, and are used to treat cancers and infectious diseases.
- administering refers to providing an active agent to a subject in need of treatment in a form that can be introduced into that individual's body in a therapeutically useful form and therapeutically effective amount.
- butyrophilin 3A may be referred to herein as "BTN3A”.
- BTN3A1 may be referred to herein as “BTN3A1”
- BTN3A3 may include the BTN3A1 portion of SEQ ID NO: 53.
- BTN3A3 may be referred to herein as "BTN3A3” (SEQ ID NO: 17).
- Variants of BTN3A3 include, but are not limited to, BTN3A3 (R381H), and may include the BTN3A3 portion of SEQ ID NO: 54 or SEQ ID NO: 55 or SEQ ID NO: 59.
- R381H is reference to an arginine (R) amino acid being substituted by a histidine (H) amino acid at amino acid position 381. This convention for defining amino acid substitutions may be used for other positions and other amino acids herein.
- CA19-9 refers to carbohydrate antigen 19-9.
- CC chemokine refers to a class of chemokine proteins characterized by having two adjacent cysteines near their amino terminus.
- CXC chemokine refers to a class of chemokine proteins characterized by having two cysteines separated by one amino acid near their amino terminus.
- CX3C chemokine refers to a class of chemokine proteins characterized by having two cysteines separated by three amino acids near their amino terminus.
- XC chemokine refers to a class of chemokine proteins characterized by having one cysteine adjacent an amino acid near their amino terminus.
- CD refers to a cluster of differentiation protein.
- examples of such proteins include, but are not limited to CD4 and CD 8.
- Reference, for example, to CD4+ indicates that the CD4 protein is positively expressed.
- CEA carcinoembryonic antigen
- bisphosphonates and “bisphosphonate drugs” refer to therapeutic agents of various embodiments, and encompass any of aminobisphosphonates, diphosphonates, biphosphonic acids, and diphosphonic acids, as well as pharmaceutically acceptable salts and derivatives thereof.
- the use of a specific nomenclature in referring to bisphosphonates is not meant to limit the scope of the present invention, unless specifically indicated.
- the terms “co-administration” or “combined administration” or “combined use” or “combination therapy” or the like as utilized herein refer to administration of a therapeutic vector or a lentiviral particle and a bisphosphonate drug or any combination of these to a single subject in need thereof (e.g., a patient), and are intended to include treatment regimens in which the agents are not necessarily administered by the same route of administration and/or at the same time.
- fixed combination refers to two or more active ingredients or components, including any of their respective compositions, formulations or drug forms, e.g., a therapeutic vector or a lentiviral particle and a bisphosphonate drug or any combination of these, that are administered essentially in combination to a patient, for example essentially simultaneously, in the form of a single entity or dosage or combined entities or dosages, e.g., in one tablet or in one capsule or in combined tablets or capsules or combined liquid forms.
- non-fixed combination refers to two or more active ingredients or components, including any of their respective compositions, formulations or drug forms, e.g., a therapeutic vector or a lentiviral particle and a bisphosphonate drug or any combination of these, that are administered in combination to a patient as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the active components in the patient.
- the non-fixed combination can be dosed independently of each other or by use of different fixed combinations e.g., simultaneously or at different time points.
- the active components may be administered as separate pharmaceutical dosage forms or pharmaceutical formulations that may be, for example, sold independently of each other, with or without label instructions concerning the possibility of a combined use.
- Such instructions may be provided in the package equipment, e.g., leaflet or the like, or in other information, e.g., provided to physicians and medical staff.
- a non-fixed combination, its respective active ingredients or components, including any of their respective compositions, formulations or drug forms, or the parts thereof, can be administered simultaneously or chronologically staggered, e.g., at different time points and with equal or different time intervals for any part of the administration.
- Such time intervals may be chosen such that the effect on the treated disease, when treated in combination, is more effective than would be obtained by use of only any one of the active components.
- the terms “combination,” “in combination” and “combination therapies,” may refer generally to any or both of the “fixed combination” and “non-fixed combination” definitions and embodiments described above.
- the transitional term "comprising,” when used to define compositions and methods, means that the compositions and methods include the recited elements, but does not exclude others.
- “consisting essentially of,” when used to define compositions and methods, means that the composition and methods include additional elements, but only if those additional elements do not materially affect the basic and novel characteristics of the composition or methods.
- “consisting of,” when used to define compositions and methods, means that the compositions and methods exclude more than trace elements of other ingredients for compositions and substantial method steps. Embodiments defined by each of these transitional terms are within the scope of this disclosure. For example, it is intended that the methods and compositions can include additional steps and components (comprising) or alternatively including steps and compositions of no significance (consisting essentially of) or alternatively, intending only the stated method steps or compositions (consisting of).
- expression refers to a process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins.
- Expression may include splicing of the mRNA in a eukaryotic cell or other forms of post- transcriptional modification or post-translational modification.
- FDPS FDPS
- famesyl pyrophosphate synthase FPPS
- gamma delta T cell may also be referred to herein as a ⁇ T cell, a Vy9V52 T cell, a Vgamma9Vdelta2 T cell, a Vy2V52 T cell, a Vgamma2Vdelta2 T cell or further as a GD T cell.
- gamma delta T cell activation refers to any measurable biological phenomenon associated with a gamma delta T cell that is representative of such T cell being activated.
- Non-limiting examples of such a biological phenomenon include an increase of cytokine production, changes in the qualitative or quantitative composition of cell surface proteins, an increase in T cell proliferation, and/or an increase in T cell effector function, such as killing a target cell or assisting another effector cell to kill a target cell.
- F-Tase refers to famesyl transferase
- GGPP refers to geranylgeranyl pyrophosphate, and may also be referred to herein as geranylgeranyl diphosphate.
- GGDPS geranylgeranyl diphosphate synthase 1, and may also be referred to herein as geranylgeranyl pyrophosphate synthase or geranylgeranyl-diphosphate synthase.
- HER-2 refers to human epidermal growth factor receptor
- cytokines such as “interleukin 2” may also be referred to as “IL-2,” “IL2” and the like.
- IL-2 can also include reference to SEQ ID NO: 56.
- interleukin 15 can also include reference to SEQ ID NO: 57.
- interleukin 18 can also include reference to SEQ ID NO: 58.
- interleukin 23 can also include reference to SEQ ID NO: 60.
- interleukin 36 can also include reference to any of SEQ ID NOs: 61-63.
- the prefix "IL” refers to an interleukin.
- IDIl refers to isopentenyl-diphosphate delta isomerase 1.
- IFN interferon
- IFN-gamma and IFN- ⁇ refer to interferon-gamma
- the terms "individual,” “subject,” and “patient” are used interchangeably herein, and refer to any individual mammal subject, e.g., bovine, canine, feline, equine, and/or human.
- IPP isopentenyl pyrophosphate
- M2-PK refers to pyruvate kinase isoenzyme type M2.
- MHC refers to a major histocompatibility complex.
- miRNA refers to a microRNA, and also may be referred to herein as "miR”.
- NK cell or "NK receptor family” refers to a “natural killer cell” or “natural killer cell receptor family”, respectively.
- packing cell line refers to any cell line that can be used to express a lentiviral particle.
- PBMC peripheral blood mononuclear cells
- homology refers to the percentage number of amino acids, nucleic acids, or analogs thereof, that are identical or constitute conservative substitutions. Homology may be determined using sequence comparison programs such as GAP (Deveraux et al, 1984, Nucleic Acids Research 12, 387-395). In this way sequences of a similar or substantially different length to those cited herein could be compared by insertion of gaps into the alignment, such gaps being determined, for example, by the comparison algorithm used by GAP.
- sequence identity refers to the extent that sequences are identical on a nucleotide-by -nucleotide basis or an amino acid-by-amino acid basis over a window of comparison.
- a "percentage of sequence identity” may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
- the identical nucleic acid base e.g., A, T, C, G, I
- the identical amino acid residue e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe, Tyr, Trp, Lys, Arg,
- Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, Wis., USA) or by inspection and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected.
- GAP Garnier et al, Nucl. Acids Res. 25:3389, 1997.
- percent identity in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection.
- sequence comparison algorithms e.g., BLASTP and BLASTN or other algorithms available to persons of skill
- the "percent identity” can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.
- sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
- test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
- sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
- Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., infra).
- Suitable algorithms for determining percent sequence identity include the BLAST algorithm, which is described in Altschul et al, J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website.
- the percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6.
- the percent identity between two nucleotide or amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4: 11 -17 (1989)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
- the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch, (J. Mol. Biol. (48):444-453 (1970)) algorithm which has been incorporated into the GAP program in the GCG software package (available at http://www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4, 5, or 6.
- the nucleic acid and protein sequences of the present disclosure can further be used as a "query sequence" to perform a search against public databases to, for example, identify related sequences.
- Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215 :403-10.
- Gapped BLAST can be utilized as described in Altschul et al. Nucleic Acids Res. 25(17):3389-3402 (1997).
- the default parameters of the respective programs e.g., XBLAST and NBLAST
- XBLAST and NBLAST See http://www.ncbi.nlm.nih.gov.
- the term "pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and/or bodily fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit/risk ratio.
- a "pharmaceutically acceptable carrier” refers to, and includes, any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
- the compositions can include a pharmaceutically acceptable salt, e.g., an acid addition salt or a base addition salt (see, e.g., Berge et al. J Pharm Sci 66: 1 -19) (1977).
- pharmaceutically acceptable salt refers to derivatives of compounds or other active ingredients, wherein the parent compound or active ingredient is modified by converting an existing acid or base moiety to its salt form.
- pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; alkali metal, alkaline metal, ammonium, and mono-, di, tri-, or tetra- Cl-C30-alkyl-substituted ammonium; and the like.
- the pharmaceutically acceptable salts of various embodiments include the conventional non-toxic salts of the compound or active ingredient formed, for example, from nontoxic inorganic or organic acids.
- Suitable organic acids are, e.g., carboxylic acids or sulfonic acids, such as acetic acid, succinic acid, fumaric acid or methansulfonic acid.
- the pharmaceutically acceptable salts herein can be synthesized from the parent compound or active ingredient which contains a basic or acidic moiety by conventional chemical methods.
- such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418 and Journal of Pharmaceutical Science, 66, 2 (1977), each of which is incorporated herein by reference in its entirety.
- PSA prostate-specific antigen
- RANTES is synonymous with chemokine (C-C motif) ligand 5, which is also synonymous with CCL5.
- sequence ID NO is synonymous with the term “Sequence ID NO”.
- small RNA refers to non-coding RNA that are generally about 200 nucleotides or less in length and possess a silencing or interference function. In embodiments, the small RNA is about 175 nucleotides or less, about 150 nucleotides or less, about 125 nucleotides or less, about 100 nucleotides or less, or about 75 nucleotides or less in length.
- RNAs include microRNA (miRNA), small interfering RNA (siRNA), double stranded RNA (dsRNA), and short hairpin RNA (shRNA).
- miRNA microRNA
- siRNA small interfering RNA
- dsRNA double stranded RNA
- shRNA short hairpin RNA
- small RNA are capable of inhibiting or knocking-down gene expression of a target gene, generally through pathways that result in the inhibition or destruction of the target gene mRNA.
- TCR refers to a T cell receptor
- TCRs refers to the plural form thereof.
- the term "therapeutically effective amount” refers to a sufficient quantity of the active agents of the present disclosure, in a suitable composition, and in a suitable dosage form to treat or prevent the symptoms, progression, or onset of the complications seen in patients suffering from a given ailment, injury, disease, or condition.
- the therapeutically effective amount will vary depending on the state of the patient's condition or its severity, and the age, weight, etc., of the subject to be treated.
- a therapeutically effective amount can vary, depending on any of a number of factors, including, e.g., the route of administration, the condition of the subject, as well as other factors understood by those in the art.
- therapeutic vector includes, without limitation, reference to a lentiviral vector, and a lentivirus plasmid as mentioned, for example in Figures 2 and 3 herein.
- TNF tumor necrosis factor
- TNF- alpha or TNF-a tumor necrosis factor-alpha
- treatment refers to the intended targeting of a disease state and combatting of it, i.e., ameliorating or preventing the disease state.
- a particular treatment thus will depend on the disease state to be targeted and the current or future state of medicinal therapies and therapeutic approaches.
- a treatment may have associated toxicities.
- treatment generally refer to an intervention in an attempt to alter the natural course of the subject being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects include, but are not limited to, preventing occurrence or recurrence of disease, alleviating symptoms, suppressing, diminishing or inhibiting any direct or indirect pathological consequences of the disease, ameliorating or palliating the disease state, and causing remission or improved prognosis.
- VSVG vesicular stomatitis virus G envelope glycoprotein
- a viral vector comprising first and second encoded genetic elements.
- the first encoded genetic element comprises a small RNA capable of inhibiting production of an enzyme involved in the mevalonate pathway
- the second encoded genetic element comprises one of a butyrophilin family member, a cytokine, or a chemokine.
- the viral vector includes a third encoded genetic element, wherein the third encoded genetic element comprises one of a butyrophilin family member, a cytokine, or a chemokine.
- the viral vector includes a fourth encoded genetic element, wherein the fourth encoded genetic element comprises one of a butyrophilin family member, a cytokine, or a chemokine.
- the enzyme is farnesyl diphosphate synthase (FDPS) or a functional variant thereof.
- the first encoded genetic element comprises a microRNA or a shRNA.
- the shRNA comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95% percent identity or more with
- the shRNA comprises:
- the shRNA comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97% , at least 98% , at least 99%, or 100% identity with SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67.
- the miRNA comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97% , at least 98% , at least 99%, or 100% identity with SEQ ID NO: 68 or SEQ ID NO: 69.
- the enzyme is GGPS 1 or a functional variant thereof.
- the shRNA comprises a sequence having at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97% , at least 98% , at least 99%, or 100% identity with SEQ ID NO: 70, SEQ ID NO: 71 , or SEQ ID NO: 72.
- the enzyme is IDI1 or a functional variant thereof.
- the shRNA comprises a sequence having at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97% , at least 98% , at least 99%, or 100% identity with SEQ ID NO: 76.
- the enzyme is F-Tase, or squalene synthase, or functional variants thereof.
- the butyrophilin family member comprises BTN3A3, BTN3A3, or BTN3A1. In embodiments, the butyrophilin family member comprises BTN3A3 (R381H). In embodiments, the butyrophilin family member comprises a butyrophilin-like molecule. In embodiments, the butyrophilin-like molecule comprises BTNL3 or BTNL8. In embodiments, the cytokine comprises IL-1 , IL- ⁇ ⁇ , IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL- 33, IL-36, TNF-a, or interferon- ⁇ .
- the chemokine comprises a CC chemokine, a CXC chemokine, a
- the CC chemokine comprises RANTES.
- the viral vector is a lentiviral vector.
- the C chemokine comprises XCL1 (Lymphotactin).
- a lentiviral vector system for expressing a lentiviral particle includes a lentiviral vector as detailed herein; at least one envelope plasmid for expressing an envelope protein optimized for infecting a target cell; and at least one helper plasmid for expressing gag, pol, and rev genes, or functional variants thereof, wherein when the lentiviral vector, the at least one envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell, a lentiviral particle is produced by the packaging cell, wherein the lentiviral particle is capable of infecting the target cell and inhibiting an enzyme involved in the mevalonate pathway within the target cell.
- the lentiviral particle is capable of causing increased levels of a first product of the mevalonate pathway.
- the first product comprises IPP.
- the lentiviral particle is capable of causing decreased levels of a second product of the mevalonate pathway.
- the second product comprises GGPP.
- the lentiviral product increases the first product and decreases the second product.
- the lentiviral particle encodes a small RNA capable of targeting a first target of the mevalonate pathway. In embodiments, the lentiviral particle further encodes a small RNA capable of targeting a second target of the mevalonate pathway. In embodiments, at least one of the first target and the second target is an enzyme. In embodiments, at least one of the first target and the second target is FDPS, GGPS 1, IDI1, F- Tase, or squalene synthase.
- targeting of the first target by the small RNA causes an increase in the presence, level, or concentration of a first product of the mevalonate pathway.
- the presence, level, or concentration of the first product of the mevalonate pathway is increased by up to 10% over a first product control, wherein the first product control can mean the presence, level, or concentration of the first product when the first target is not targeted by the small RNA.
- the presence, level, or concentration of the first product of the mevalonate pathway is increased by up to 10% to up to 20% over the first product control, as described herein.
- the presence, level, or concentration of the first product of the mevalonate pathway is increased by up to 20% to up to 30% over the first product control, as described herein.
- the presence, level, or concentration of the first product of the mevalonate pathway is increased by up to 30% to up to 40% over the first product control, as described herein. In embodiments, the presence, level, or concentration of the first product of the mevalonate pathway is increased by up to 40% to up to 50% over the first product control, as described herein. In embodiments, the presence, level, or concentration of the first product of the mevalonate pathway is increased by more than 50% over the first product control, as described herein. In embodiments, the first product of the mevalonate pathway comprises IPP.
- targeting of the second target by the small RNA causes a decrease in the presence, level, or concentration of a second product of the mevalonate pathway.
- the presence, level, or concentration of the second product of the mevalonate pathway is decreased by up to 10% of a second product control, wherein the second product control can mean the presence, level, or concentration of the second product when the second target is not targeted by the small RNA.
- the presence, level, or concentration of the second product of the mevalonate pathway is decreased by up to 10% to up to 20% of the second product control, as described herein.
- the presence, level, or concentration of the second product of the mevalonate pathway is decreased by up to 20% to up to 30% of the second product control, as described herein.
- the presence, level, or concentration of the second product of the mevalonate pathway is decreased by up to 30% to up to 40% of the second product control, as described herein. In embodiments, the presence, level, or concentration of the second product of the mevalonate pathway is decreased by up to 40% to up to 50% of the second product control, as described herein. In embodiments, the presence, level, or concentration of the second product of the mevalonate pathway is decreased by more than 50% of the second product control, as described herein. In embodiments, the second product of the mevalonate pathway comprises GGPP.
- the increase in the presence, level, or concentration of the first product of the mevalonate pathway causes an increase in gamma delta (GD) T cell activation.
- GD T cell activation is increased by up to 10% over a first activation control, wherein the first activation control can mean the level of GD T cell activation when the first target is not targeted by the small RNA.
- GD T cell activation caused by modulation of the first product is increased by up to 10% to up to 20% over the first activation control, as described herein.
- GD T cell activation caused by modulation of the first product is inceased by up to 20% to up to 30% over the first activation control, as described herein.
- GD T cell activation caused by modulation of the first product is increased by up to 30% to up to 40% over the first activation control, as described herein. In embodiments, GD T cell activation caused by modulation of the first product is increased by up to 40% to up to 50% over the first activation control, as described herein. In embodiments, GD T cell activation caused by modulation of the first product is increased by 50% or more over first activation control, as described herein.
- the decrease in the presence, level, or concentration of the second product of the mevalonate pathway causes an increase in gamma delta (GD) T cell activation.
- GD T cell activation caused by modulation of the second product is increased by up to 10% over a second activation control, wherein the second activation control can mean the level of GD T cell activation when the second target is not targeted by the small RNA.
- GD T cell activation caused by modulation of the second product is increased by up to 10% to up to 20% over the second activation control, as described herein.
- GD T cell activation caused by modulation of the second product is increased by up to 20% to up to 30% over the second activation control, as described herein.
- GD T cell activation caused by modulation of the second product is increased by up to 30% to up to 40% over the second activation control, as described herein. In embodiments, GD T cell activation caused by modulation of the second product is increased by up to 40% to up to 50% over the second activation control, as described herein. In embodiments, GD T cell activation caused by modulation of the second product is increased by 50% or more over the second activation control, as described herein.
- a lentiviral particle capable of infecting a target cell comprises an envelope protein optimized for infecting the target cell, and a lentiviral vector as detailed herein.
- the target cell is a cancer cell.
- a method of activating a gamma delta (GD) T cell includes infecting, in the presence of the GD T cell, a target cell with a lentiviral particle, wherein the lentiviral particle comprises a viral vector comprising first and second encoded genetic elements wherein the first encoded genetic element comprises a small RNA capable of inhibiting production of an enzyme involved in the mevalonate pathway, and the second encoded genetic element comprises one of a butyrophilin family member, a cytokine, or a chemokine, wherein when the enzyme is inhibited in the target cell, the target cell activates the GD T cell.
- the enzyme comprises at least one of FDPS, GGPSl, IDI1, F-Tase, and/or squalene synthase, or functional variants thereof.
- the target cell is a cancer cell.
- the method further comprises contacting the target cell and the GD T cell with an amount of an aminobisphosphonate drug.
- the aminobisphosphonate drug is zoledronic acid.
- a method of treating cancer in a subject includes administering to the subject a therapeutically effective amount of a lentiviral particle wherein the lentiviral particle comprises a viral vector comprising first and second encoded genetic elements, wherein the first encoded genetic element comprises a small RNA capable of inhibiting production of an enzyme involved in the mevalonate pathway, and the second encoded genetic element comprises one of a butyrophilin family member, a cytokine, or a chemokine, wherein when the enzyme is inhibited in a cancer cell in the presence of a GD T cell, the target cell activates the GD T cell, to thereby treat the cancer.
- the enzyme comprises at least one of FDPS, GGPSl, IDI1, F-Tase, squalene synthase, and/or functional variants thereof.
- the method further comprises contacting the target cell and the GD T cell with an amount of an aminobisphosphonate drug.
- the method includes administering to the subject a therapeutically effective amount of a lentiviral particle wherein the lentiviral particle comprises a viral vector comprising first, second and third encoded genetic elements wherein the first encoded genetic element comprises a small RNA or RNAs capable of inhibiting production of an enzyme or enzymes involved in the mevalonate pathway, the second encoded genetic element comprises a butyrophilin family member, and the third genetic element encodes a cytokine or a chemokine, wherein when the enzyme is inhibited in a cancer cell in the presence of a GD T cell, the target cell activates the GD T cell, the butyrophilin increases efficiency of activating GD T cells, the cytokine increases GD T cell activation and proliferation, and the chemokine increases the presence of the GD T cells at a tumor site to thereby treat the cancer.
- the lentiviral particle comprises
- the butyrophilin family member includes BTN3A3 (SEQ ID NO: 17) or BTN3A3 (R381H) (SEQ ID NO: 54).
- the cytokine includes IL-2, IL- 12, IL-15, IL-18, IL-23, or IL-36 but can also include other cytokines which are known to activate immune cells, such as T cells.
- the chemokine may include chemokine (C-C motif) ligand 5 encoded by the CCL5 gene, or other chemokines known to be recognized by GD T cell receptors and known to be capable of attracting GD T cells to sites of tumor growth.
- a cell, tissue, or target may be a cancer cell, a cancerous tissue, harbor cancerous tissue, or be a subject or patient diagnosed or at risk of developing a disease or condition.
- a cell may be an epithelial, an endothelial, a mesothelial, a glial, a stromal, or a mucosal cell.
- the cancer cell population can include, but is not limited to a brain, a neuronal, a blood, an endometrial, a meninges, an esophageal, a lung, a cardiovascular, a liver, a lymphoid, a breast, a bone, a connective tissue, a fat, a retinal, a thyroid, a glandular, an adrenal, a pancreatic, a stomach, an intestinal, a kidney, a bladder, a colon, a prostate, a uterine, an ovarian, a cervical, a testicular, a splenic, a skin, a smooth muscle, a cardiac muscle, or a striated muscle cell, and can also include a cancer cell population from any of the foregoing, and can be associated with one or more of carcinomas, sarcomas, myelomas, leukemias, lymphomas, mixed types or mixtures of the foregoing.
- cancer includes, but is not limited to astrocytoma, acute myeloid leukemia, anaplastic large cell lymphoma, acute lymphoblastic leukemia, angiosarcoma, B-cell lymphoma, Burkitt's lymphoma, breast carcinoma, bladder carcinoma, carcinoma of the head and neck, cervical carcinoma, chronic lymphoblastic leukemia, chronic myeloid leukemia, colorectal carcinoma, endometrial carcinoma, esophageal squamous cell carcinoma, Ewing's sarcoma, fibrosarcoma, glioma, glioblastoma, gastrinoma, gastric carcinoma, hepatoblastoma, hepatocellular carcinoma, Kaposi's sarcoma, Hodgkin lymphoma, laryngeal squamous cell carcinoma, larynx carcinoma, leukemia, leiomyosarcoma, lipoma, liposarcoma, melanom
- compositions and methods provided herein are also used to treat NSCLC (non- small cell lung cancer), pediatric malignancies, cervical and other tumors caused or promoted by human papilloma virus (HPV), melanoma, Barrett's esophagus (pre-malignant syndrome), adrenal and skin cancers and auto immune, neoplastic cutaneous diseases.
- NSCLC non- small cell lung cancer
- HPV human papilloma virus
- melanoma melanoma
- Barrett's esophagus pre-malignant syndrome
- adrenal and skin cancers and auto immune, neoplastic cutaneous diseases.
- compositions and methods disclosed herein can be used to treat infectious diseases.
- infectious disease includes any disease that is caused by an infectious agent.
- infectious agent includes any exogenous pathogen including, without limitation, bacteria, fungi, viruses, mycoplasma, and parasites.
- Infectious agents that may be treated with compositions provided for in this disclosure include any art-recognized infectious organisms that cause pathogenesis in an animal, including such organisms as bacteria that are gram- negative or gram-positive cocci or bacilli, DNA and RNA viruses, including, but not limited to, DNA viruses such as papilloma viruses, parvoviruses, adenoviruses, herpesviruses and vaccinia viruses, and RNA viruses, such as arenaviruses, coronaviruses, rhinoviruses, respiratory syncytial viruses, influenza viruses, picomaviruses, paramyxoviruses, reoviruses, retroviruses, and rhabdoviruses.
- DNA viruses such as papilloma viruses, parvoviruses, adenoviruses, herpesviruses and vaccinia viruses
- RNA viruses such as arenaviruses, coronaviruses, rhinoviruses, respiratory sy
- Compositions and methods provided for herein may be utilized to treat parasitic infections including, but not limited to, infections caused by somatic tapeworms, blood flukes, tissue roundworms, ameba, and Plasmodium, Trypanosoma, Leishmania, and Toxoplasma species.
- compositions and methods for activating GD T cells in an individual as well as methods for treating tumors and infectious diseases.
- the compositions and methods provided herein can be used in methods to treat all known cancers because activated GD T cells comprise a natural mechanism for immune surveillance of tumors (See for e.g. : Pauza et al. Frontiers in Immunol. 5:687 (2014).
- the compositions and methods provided herein can be used to treat infectious diseases, including but not limited to flavivirus, influenza virus, human retrovirus, mycobacteria, plasmodia and a variety of other viral, fungal and bacterial infections. (See for e.g. : Pauza and Cairo, 2015 Cell Immunol. 296(1).
- a vector system is administered to an individual to transfect or transduce a target cell population with the disclosed constructs for decreasing expression of FDPS and, in other embodiments, increasing expression of chemokines or cytokines.
- Administration and transfection/transduction can occur in vivo or ex vivo, with the transfected cells later administered back into the subject in the latter scenario.
- the disclosed methods can also increase the capacity of NK cells to recognize and destroy tumor cells and/or infected cells.
- Crosstalk between GD T cells and NK cells is an important aspect of regulating the immune and inflammatory responses.
- GD T cells can trigger dendritic cell maturation, recruit B cells and macrophages, and participate in a variety of cytolytic activities, such as secretion of interferon- ⁇ and TNF-a.
- compositions and methods provided herein comprise a form of gene therapy for activating GD T cells at the site of tumor.
- the compositions and methods provided herein activate GD T cells and support their proliferation, differentiation, and functional capacities by promoting the production of specific cytokines needed for cytolytic activity capable of killing cancer cells or treating infectious diseases.
- the gene therapy sequences are carried by therapeutic vectors, including but not limited to viral vectors such as lentiviruses or adeno-associated viruses, although other viral vectors can also be suitable.
- therapeutic vectors including but not limited to viral vectors such as lentiviruses or adeno-associated viruses, although other viral vectors can also be suitable.
- Gene therapy constructs may also be delivered in the form of DNA or RNA, including but not limited to plasmid forms.
- the disclosed gene therapy constructs may also be delivered in the form of protein-nucleic acid complexes or lipid nucleic acid complexes and mixtures of these formulations.
- a protein-nucleic acid complex can comprise nucleic acids of interest in a complex with cationic peptides such as lysine and arginine.
- Lipid-nucleic acids complexes can comprise lipid emulsions, micelles, liposomes, and/or mixtures of neutral and cationic lipids such as DOTMA, DOSPA, DOTAP, and DMRIE.
- therapeutic vectors may comprise a single construct or at least two, at least three, at least four, or at least five different constructs.
- constructs may be identical, or they may be different.
- the constructs may vary in terms of their promoters, the presence or absence of integrating elements, and/or their sequences.
- a therapeutic vector will comprise at least one construct that encodes a small RNA capable of knocking down the expression of at least one of FDPS, GGPS1, IDI1, F-Tase, squalene synthase, and/or functional variants thereof.
- the therapeutic vector will also encode a specific cytokine(s) and/or chemokine(s), including but not limited to TNF-a, interferon- ⁇ , IL-1, IL- ⁇ , IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, or RANTES.
- a single construct may encode both small RNAs capable of knocking down the expression of FDPS and specific cytokines or chemokines, including but not limited to TNF-a, interferon- ⁇ , IL-1, IL- ⁇ , IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, or RANTES.
- cytokines or chemokines including but not limited to TNF-a, interferon- ⁇ , IL-1, IL- ⁇ , IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, or RANTES.
- viral vectors may introduce nucleic acid constructs that become integrated into the host chromosome.
- transient delivery vectors may be used to prevent chromosomal integration and limit the lifespan of gene therapy constructs.
- the disclosed constructs and vectors comprise short hairpin RNA (“shRNA”), micro RNA (“miRNA”), or siRNA capable of reducing or knocking down expression of FDPS, geranyl pyrophosphate synthase (“GPPS”), farnesyl transferase (“F- Tase”), IDI1, and/or squalene synthase genes.
- shRNA short hairpin RNA
- miRNA micro RNA
- siRNA capable of reducing or knocking down expression of FDPS
- GPPS geranyl pyrophosphate synthase
- F- Tase farnesyl transferase
- IDI1 farnesyl transferase
- IDI1 farnesyl transferase
- squalene synthase genes By down regulating these genes, which control steroid and isoprenoid synthesis, isopentenyl pyrophosphate (“IPP”) levels are elevated and/or GGPP levels are decreased. Elevation and accumulation of
- Vy9V52 T cells Vgamma9Vdelta2 T cells
- the disclosed constructs are regulated by specific promoters that are capable of producing interleukin-2 and/or interleukin-15 to sustain GD T cell proliferation.
- specific promoters capable of producing interleukin-2 and/or interleukin-15 to sustain GD T cell proliferation.
- other cytokines including IL-18, IL-23, and IL-36 can also be selected and used.
- the disclosed constructs may be regulated by specific promoters that are capable of producing interleukin-1 beta and/or interleukin-18 and/or interferon-gamma required for GD T cell differentiation and acquisition of all effector cell function.
- Desirable effector cell functions include the capacity for direct cytotoxic cell killing of tumors and/or infected cells, secretion of beneficial cytokines and/or chemokines, increased expression of NK receptors required to recognize cancerous or cells, and increased expression of Fc receptors needed to bind targeting antibodies in order to co-localize GD T cells with cancerous or infected cell targets.
- the disclosed methods activate GD T cells, resulting in the indirect effect of increasing the capacity for NK cells to attack and destroy cancerous cells, tumors, or infected cells.
- the activation of NK cells requires GD T cells that are stimulated to proliferate and differentiate, and to express 4-1BBL costimulatory ligand needed to engage the 4-lBB costimulatory receptor on NK cells.
- This form of crosstalk is known as an important mechanism for activating NK cells and is achieved here through the action of the disclosed methods and compositions.
- crosstalk between GD T cells and NK cells is an important mechanism for eliminating inflammatory dendritic cells that accumulate in diseased tissues.
- GD T cells nor NK cells are capable of destroying dendritic cells, but once the aforementioned crosstalk interactions have occurred, NK cells are altered to become cytotoxic against inflammatory dendritic cells. This immuno-regulatory mechanism depends on strong activation and proliferation of GD T cells.
- the disclosed methods for activation of GD T cells further comprise a step of suppressing pathologic inflammatory responses that may include cellular proliferation leading to atherosclerosis, chronic immune activation that stimulates tumor growth, autoimmune diseases including psoriasis and other presentations in the epidermis, inflammatory diseases of the central nervous system, and arthritis and other diseases of unregulated immune responses.
- pathologic inflammatory responses may include cellular proliferation leading to atherosclerosis, chronic immune activation that stimulates tumor growth, autoimmune diseases including psoriasis and other presentations in the epidermis, inflammatory diseases of the central nervous system, and arthritis and other diseases of unregulated immune responses.
- therapeutic vectors are administered concurrently with bisphosphonate drugs to achieve synergistic activation of gamma delta T cells.
- the synergism can allow alternate, modified or reduced doses of bisphosphonate drugs and may decrease adverse reactions to bisphosphonates including acute inflammatory responses and chronic diseases.
- therapeutic vectors are administered in combination with bisphosphonate drugs.
- such combinations achieve synergistic, positive or heightened activation of gamma delta T cells.
- Such positive activation may allow alternate, modified or reduced doses of bisphosphonates and may decrease adverse reactions to bisphosphonates including acute inflammatory responses and chronic diseases.
- Combinations of therapeutic vectors with bisphosphonates may be together or separate, with or without instructions for combined use or to combination products.
- the therapeutic vectors and/or bisphosphonates may be administered entirely separately and may be formulated in entirely distinct pharmaceutical dosage forms.
- the therapeutic vectors and/or bisphosphonates may be sold independently of each other, with or without label instructions concerning the possibility of a combined use.
- Such instructions also may be provided in the package equipment, e.g., leaflet or the like, or in other information e.g., provided to physicians and medical staff (e.g., oral communications, communications in writing or the like).
- Such labels or other instructions can refer to either a fixed combination in one dosage unit form, or a non-fixed combination as a kit of parts for the combined administration where the therapeutic vector may be administered independently of the bisphosphonate drug, at the same time, or separately within time intervals.
- the combination exhibits a cooperative or joint effect, or a decrease in toxicity or complications of treatment.
- the effect of the combination is synergistic. A synergistic effect is achieved when the active ingredients used together is greater than the sum of the effects that results from using the compounds separately.
- a synergistic effect may be attained when the active ingredients are: (1) co-formulated and administered or delivered simultaneously in a combined, unit dosage formulation; (2) delivered by alternation or in parallel as separate formulations; or (3) by some other regimen.
- a synergistic effect may be attained when the compounds are administered or delivered sequentially, e.g., by different injections in separate syringes.
- an effective dosage of each active ingredient is administered sequentially, i.e., serially
- effective dosages of two or more active ingredients are administered together, albeit subject to potential variances in timing as detailed herein.
- the combinations herein may be manufactured and/or formulated by the same or different manufacturers.
- the active ingredients may be brought together into a combination therapy: (i) prior to release of the combination product to physicians (e.g., in the case of a kit comprising the compound of the disclosure and the other therapeutic agent); (ii) by the treating physician (or under the guidance of a physician) shortly before administration; (iii) in the actual patient, e.g., during sequential administration of the active ingredients disclosed herein.
- a therapeutically effective amount of each of the combinations may be administered simultaneously or sequentially and in any order, and the components may be administered together or separate.
- the method of treating a proliferative disease according to the disclosure may comprise (i) administration of a first agent such as a therapeutic vector that forms part of a lentiviral particle and/or (ii) administration of a second agent such as a bisphosphonate drug in free or pharmaceutically acceptable salt form.
- the administration of agents (i), and/or (ii) may be simultaneous or sequential in any order, in therapeutically effective amounts, preferably in cooperative, jointly effective, and/or synergistically effective, amounts, e.g., in daily or intermittent dosages corresponding to the amounts described herein.
- administering also encompasses the use of a pro-drug of a combination partner that converts in vivo to the combination partner as such.
- the instant disclosure is therefore to be understood as embracing all such regimens of simultaneous or alternating treatment and the term “administering" is to be interpreted accordingly.
- agents (i) and (ii) can be administered using any pharmaceutically acceptable method, such as intranasal, buccal, sublingual, oral, rectal, ocular, parenteral (intravenously, intradermally, intramuscularly, subcutaneously, intraperitoneally), pulmonary, intravaginal, locally administered, topically administered, topically administered after scarification, mucosally administered, via an aerosol, in semi-solid media such as agarose or gelatin, or via a buccal or nasal spray formulation
- a therapeutic vector and/or bisphosphonate drug may be administered intravenously.
- agents (i) and (ii) can be formulated into any pharmaceutically acceptable dosage form, such as a solid dosage form, tablet, pill, lozenge, capsule, liquid dispersion, gel, aerosol, pulmonary aerosol, nasal aerosol, ointment, cream, semi-solid dosage form, a solution, an emulsion, and a suspension.
- a bisphosphonate drug may be formulated into a tablet and administered orally.
- a combination therapy according to the disclosure can besides or in addition be administered especially for cancer therapy in combination with chemotherapy, radiotherapy, immunotherapy, surgical intervention, or a combination of these.
- Long-term therapy is equally possible as is adjuvant therapy in the context of other treatment strategies, as described above.
- Other possible treatments are therapy to maintain the patient's status after tumor regression, or even chemo-preventive therapy, for example in patients at risk.
- Inhibition of FDPS, GGPS1, IDI1, and/or functional variants thereof may result in IPP accumulation and/or diminished GGPP levels, resulting in activation of Vdelta2+ GD T cells and expression of interferon-gamma, TNF-alpha, and IL-18, which are also important in activating GD T cells.
- Inhibition of farnesyl transferase and/or squalene synthase results in decreased prenylation of proteins.
- the disclosed constructs can be transfected or transduced into specific target cells, like tumor cells or infected cells, where they can express RNA sequences (i.e., siRNA, shRNA or microRNA) that will inhibit translation of FDPS, GGPS1, IDI1, F-Tase, squalene synthase, and/or functional variants thereof, as well as encode and express cytotoxic cytokines or chemokines.
- RNA sequences i.e., siRNA, shRNA or microRNA
- the constructs may encode for interferon-gamma, IL-1, IL- ⁇ , IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, or TNF-a.
- cytokines and chemokines will result in localized cytotoxic destruction of tumor cells or cells infected with pathogenic organisms. Accordingly, expression of such constructs by a tumor cell can result in the tumor cells assisting in their own destruction and activating an immune mechanism capable of destroying other tumor cells not genetically modified by the lenti virus vector.
- the capacity for genetically modified cells to activate GD T cells involves the GD T cell receptor, butyrophilin recognition, and the activation of GD T cell receptors for common gamma chain cytokines. Killing of tumor cells relies on a family of GD T cell surface receptors generally described as members of the NK receptor family that distinguish tumor cells from normal cells and provide for selectivity in the cell killing process.
- a small number of genetically modified tumor cells can activate a sufficient number of GD T cells to achieve broad destruction of tumors including killing of both genetically-modified and non-modified cells in the same or distant tumors. Accordingly, expression of such constructs by a tumor cell or an infected cell will result in the unwanted cells assisting in its own destruction.
- the disclosed constructs are expressed in a tumor cell or infected cell, decreasing the expression of FDPS, GGPS 1 , IDI1 , F-Tase, squalene synthase, and/or functional variants thereof may result in activation and recruitment of GD T cells to the tumor site of site of cell infection. Increasing expression of RANTES will further attract GD T cells to intended tissue location.
- GD T cells can kill a broad range of tumors of epithelial origin as well as many leukemias and lymphomas, and are further able to produce high levels of the anti-tumor cytokine, IFNy, recruitment of GD T cells to the site of a tumor can be a particularly effective means of inducing anti -tumor immunity.
- FDPS, GGPS 1, IDI1, F-Tase, squalene synthase, and/or functional variants thereof can be achieved via shRNA, microRNA, siRNA, or other means known in the art.
- shRNAs according to SEQ ID NOs: 1, 2, 3, or 4, or variants thereof can be used in the disclosed constructs and methods, although this example is not limiting.
- shRNAs according to SEQ ID NOs: 64-67, 70-72, 76, or variants thereof can be used in the disclosed constructs and methods, although this example is not limiting.
- miRNAs according to SEQ ID NOs: 68 or 69, or variants thereof can be used in the disclosed constructs and methods, although this example is not limiting.
- RNAs to decrease expression of FDPS, GGPS 1 , IDI1, F-Tase, squalene synthase, and/or functional variants thereof, and the coding regions of cytokine and chemokines may be in the same construct or on different constructs.
- constructs are based upon chromosomal integration of a transduced expression plasmid (or at least a portion thereof) into the genome of the host cell, short-duration plasmid transfection, or non-integrating viral vectors also with limited half-life.
- the sites of gene integration are generally random, and the number and ratio of genes integrating at any particular site are often unpredictable; likewise, non-integrating plasmids or viral vectors also generate nuclear DNA but these species usually lack sequences required for DNA replication and continuous maintenance.
- constructs that rely on chromosomal integration result in permanent maintenance of the recombinant gene that may exceed the therapeutic interval.
- transient expression constructs An alternative to stable expression constructs for gene expression are transient expression constructs.
- the expression of the latter gene expression construct is based on non- integrated plasmids, and hence the expression is typically lost as the cell undergoes division or the plasmid vectors are destroyed by endogenous nucleases.
- the disclosed constructs are preferably episomal constructs that are transiently expressed.
- Episomal constructs are degraded or diluted over time such that they do not make permanent changes to a subject's genome, nor are they incorporated into the chromosome of a target cell.
- the process of episomal replication typically incorporates both host cell replication machinery and viral trans-acting factors.
- the disclosed vectors support active gene and/or small RNA delivery over a period of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, or about 12 weeks. In embodiments, the disclosed vectors support active gene and/or small RNA delivery over a period of about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or longer. Any combination of these time periods can also be used in the methods of the invention, e.g., 1 month and 1 week, or 3 months and 2 weeks.
- the constructs comprise integrating elements that depend on a retroviral integrase gene, such that the construct becomes integrated into the subject's chromosome.
- Retrotransposition and transposition are additional examples of mechanisms whereby mobile genetic elements become integrated or inserted into the chromosome. Plasmids may become integrated into the chromosome by recombination, and gene editing technologies including CRISPR and TALEN utilize guide RNA sequences and alter chromosomal loci by gene deletion or gene conversion mechanisms.
- Constructs may comprise specific promoters for expressing cytokines involved in the maintenance of GD T cells (i.e., IL-2, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, or IL-36).
- cytokines involved in the maintenance of GD T cells i.e., IL-2, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, or IL-36.
- promoters that may be incorporated into the disclosed constructs include but are not limited to TATA-box promoters, CpG-box promoters, CCAAT-box promoters, TTGACA- box promoters, BRE-box promoters, INR-box promoters, AT-based promoters, CG-based promoters, ATCG-compact promoters, ATCG-balanced promoters, ATCG-middle promoters, ATCG-less promoters, AT-less promoters, CG-less promoters, AT-spike promoters, and CG- spike promoters.
- TATA-box promoters include but are not limited to TATA-box promoters, CpG-box promoters, CCAAT-box promoters, TTGACA- box promoters, BRE-box promoters, INR-box promoters, AT-based promoters, CG-based promoters, ATCG-compact promoters, ATCG-balanced promoters,
- the construct can be delivered via known transfection and/or transduction vectors, including but not limited to lentiviral vectors, adeno-associated virus, poxvirus, herpesvirus vectors, protein and/or lipid complexes, liposomes, micelles, bacterially-produced vesicles, eukaryotic cell-produced vesicles, exosomes and the like.
- transfection and/or transduction vectors including but not limited to lentiviral vectors, adeno-associated virus, poxvirus, herpesvirus vectors, protein and/or lipid complexes, liposomes, micelles, bacterially-produced vesicles, eukaryotic cell-produced vesicles, exosomes and the like.
- Viral vectors can be preferentially targeted to cell types that are useful for the disclosed methods (i.e., tumor cells or myeloid cells, or lymphocytes). Viral vectors can be used to transduce genes into target cells owing to specific virus envelope-host cell receptor interactions and viral mechanisms for gene expression. As a result, viral vectors have been used as vehicles for the transfer of genes into many different cell types including whole embryos, fertilized eggs, isolated tissue samples, tissue targets in situ, and cultured cell lines. The ability to introduce and express foreign genes in a cell is useful for the study of gene expression, and the elucidation of cell lineages as well as providing the potential for therapeutic interventions such as gene therapy, somatic cell reprogramming of induced pluripotent stem cells, and various types of immunotherapy.
- Viral components from viruses like Papovaviridae e.g., bovine papillomavirus or BPV
- Herpesviridae e.g. Epstein Ban- Virus or EBV
- Hepadnaviridae e.g., Hepatitis B Virus or HBV
- pox vectors including vaccinia may be used in the disclosed vectors.
- Lentiviral vectors are a preferred type of vector for the disclosed compositions and methods, although the disclosure is not specifically limited to lentiviral vectors.
- Lentivirus is a genus of viruses that can deliver a significant amount of viral nucleic acid into a host cell. Lentiviruses are characterized as having a unique ability to infect/transduce non-dividing cells, and following transduction, lentiviruses integrate their nucleic acid into the host cell's chromosomes.
- Infectious lentiviruses have three main genes coding for the virulence proteins gag, pol, and env, and two regulatory genes including tat and rev. Depending on the specific serotype and virus, there may be additional accessory genes that code for proteins involved in regulation, synthesis, and/or processing viral nucleic acids and other replicative functions.
- LTR long terminal repeat
- lentiviruses contain long terminal repeat (LTR) regions, which may be approximately 600 nt long. LTRs may be segmented into U3, R, and U5 regions. LTRs can mediate integration of retroviral DNA into the host chromosome via the action of integrase. Alternatively, without functioning integrase, the LTRs may be used to circularize the viral nucleic acid.
- LTR long terminal repeat
- Reverse transcriptase is the virally encoded, RNA-dependent DNA polymerase.
- the enzyme uses a viral RNA genome as a template for the synthesis of a complementary DNA copy.
- Reverse transcriptase also has RNaseH activity for destruction of the RNA-template.
- Integrase binds both the viral cDNA generated by reverse transcriptase and the host DNA. Integrase processes the LTR before inserting the viral genome into the host DNA.
- Tat acts as a trans-activator during transcription to enhance initiation and elongation.
- the rev responsive element acts post-transcriptionally, regulating mRNA splicing and transport to the cytoplasm.
- Viral vectors in general, comprise glycoproteins and the various glycoproteins may provide specific affinities.
- VSVG Vesicular Stomatitis Virus G
- viral vectors can also have targeting moieties, such as antibodies, attached to their shell peptides. Targeting antibodies can be specific for antigens that are overexpressed on a tumor, for instance, like HER-2, PSA, CEA, M2-PK, and CA19-9.
- viral vector specificities are also known in the art and can be used to target particular populations of cells.
- poxvirus and herpesvirus vectors target to macrophages, dendritic cells and epithelial cells, measles virus vectors may target to B cells, rabies viral vectors may target to neural cells.
- a lentiviral virion is expressed by a vector system encoding the necessary viral proteins to produce a virion (viral particle).
- a vector system encoding the necessary viral proteins to produce a virion (viral particle).
- the pol proteins are expressed by multiple vectors.
- the gag nucleic acid is on a separate vector from all the pol nucleic acid sequences that encode pol proteins. Numerous modifications can be made to the vectors, which are used to create the particles to further minimize the chance of obtaining wild type revertants. These include, but are not limited to deletions of the U3 region of the LTR, tat deletions and matrix (MA) deletions.
- gag, pol and env vector(s) do not contain nucleotides from the lentiviral genome that package lentiviral RNA, referred to as the lentiviral packaging sequence.
- the vector(s) forming the particle preferably do not contain a nucleic acid sequence from the lentiviral genome that expresses an envelope protein.
- a separate vector that contains a nucleic acid sequence encoding an envelope protein operably linked to a promoter is used.
- This env vector also does not contain a lentiviral packaging sequence.
- the env nucleic acid sequence encodes a lentiviral envelope protein.
- the envelope protein is not from the lentivirus, but from a different virus.
- the resultant particle is referred to as a pseudotyped particle.
- an env gene that encodes an envelope protein that targets an endocytic compartment such as that of the influenza virus, VSV-G, alpha viruses (Semliki forest virus, Sindbis virus), arenaviruses (lymphocytic choriomeningitis virus), flaviviruses (tick-bome encephalitis virus, Dengue virus, hepatitis C virus, GB virus), rhabdoviruses (vesicular stomatitis virus, rabies virus), paramyxoviruses (mumps or measles) and orthomyxoviruses (influenza virus).
- envelopes that can preferably be used include those from Moloney Leukemia Virus such as MLV-E, MLV- A and GALV. These latter envelopes are particularly preferred where the host ceil is a primary ceil.
- Other envelope proteins can be selected depending upon the desired host cell. For example, targeting specific receptors such as a dopamine receptor can be used for brain delivery. Another target can be vascular endothelium. These cells can be targeted using a filovirus envelope. For example, the GP of Ebola, which by post- transcriptional modification become the GP, and GP 2 glycoproteins.
- a pseudotyped envelope for example, FIV or SH1V [U.S. Patent No. 5,654,195]).
- a SHIV pseudotyped vector can readily be used in animal models such as monkeys.
- a lentiviral vector system typically includes at least one helper plasmid comprising at least one of a gag, pol, or rev gene, or functional variants thereof.
- Each of the gag, pol and rev genes, or functional variants thereof may be provided on individual plasmids, or one or more genes may be provided together on the same plasmid.
- the gag, pol, and rev genes are provided on the same plasmid (e.g., Figure 2).
- the gag and pol genes are provided on a first plasmid and the rev gene is provided on a second plasmid (e.g., Figure 3).
- both 3-vector and 4- vector systems can be used to produce a lentivirus as described in the Examples section and elsewhere herein.
- the therapeutic vector, the envelope plasmid and at least one helper plasmid are transfected into a packaging cell line.
- a non-limiting example of a packaging cell line is the 293T/17 HEK cell line.
- a lentiviral vector system for expressing a lentiviral particle includes a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infecting a cell; and at least one helper plasmid for expressing gag, pol, and rev genes, or functional variants thereof, wherein when the lentiviral vector, the envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell line, a lentiviral particle is produced by the packaging cell line, wherein the lentiviral particle is capable of inhibiting production of chemokine receptor CCR5 or targeting an HIV RNA sequence.
- the lentiviral vector which is also referred to herein as a therapeutic vector, can include the following elements: hybrid 5' long terminal repeat (RSV/5' LTR) (SEQ ID NOs: 5-6), Psi sequence (RNA packaging site) (SEQ ID NO: 7), RRE (Rev-response element) (SEQ ID NO: 8), cPPT (polypurine tract) (SEQ ID NO: 9), HI promoter (SEQ ID NO: 10), shFDPS (SEQ ID NOs: 1, 2, 3, 4), CMV (SEQ ID NO: 19), BTN3A3 (R381H) - T2A - IL-2 (collectively, SEQ ID NO: 55), Woodchuck Post- Transcriptional Regulatory Element (WPRE) (SEQ ID NO: 11), and 3' Delta LTR (SEQ ID NO: 12).
- sequence variation by way of substitution, deletion, addition, or mutation can be used to modify the sequences references herein.
- a helper plasmid has been designed to include the following elements: a CMV (CAG) enhancer (SEQ ID NO: 21); a Chicken beta actin (CAG) promoter (SEQ ID NO: 13); a chicken beta actin intron (SEQ ID NO: 22); a HIV gag (SEQ ID NO: 14); a HIV Pol (SEQ ID NO: 15); a HIV Int (SEQ ID NO: 16); a HIV RRE (SEQ ID NO: 8); a HIV Rev (SEQ ID NO: 18); and a rabbit beta globin poly A (SEQ ID NO: 23).
- CMV CMV
- CAG Chicken beta actin promoter
- SEQ ID NO: 22 chicken beta actin intron
- HIV gag SEQ ID NO: 14
- HIV Pol SEQ ID NO: 15
- a HIV Int SEQ ID NO: 16
- a HIV RRE SEQ ID NO: 8
- a HIV Rev SEQ ID NO: 18
- a rabbit beta globin poly A SEQ
- helper plasmid may be modified to include a first helper plasmid for expressing the gag and pol genes, and a second and separate plasmid for expressing the rev gene.
- sequence variation, by way of substitution, deletion, addition, or mutation can be used to modify the sequences references herein.
- an envelope plasmid has been designed to include the following elements being from left to right: RNA polymerase II promoter (CMV) (SEQ ID NO: 19) and vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 20).
- CMV RNA polymerase II promoter
- VSV-G vesicular stomatitis virus G glycoprotein
- sequence variation, by way of substitution, deletion, addition, or mutation can be used to modify the sequences references herein.
- the plasmids used for lentiviral packaging can be modified with similar elements and the intron sequences could potentially be removed without loss of vector function.
- the following elements can replace similar elements in the plasmids that comprise the packaging system: Elongation Factor-1 (EF-1), phosphoglycerate kinase (PGK), and ubiquitin C (UbC) promoters can replace the CMV or CAG promoter.
- EF-1 Elongation Factor-1
- PGK phosphoglycerate kinase
- UbC ubiquitin C
- SV40 poly A and bGH poly A can replace the rabbit beta globin poly A.
- the HIV sequences in the helper plasmid can be constructed from different HIV strains or clades.
- the VSV-G glycoprotein can be substituted with membrane glycoproteins from feline endogenous virus (RD114), gibbon ape leukemia virus (GALV), Rabies (FUG), lymphocytic choriomeningitis virus (LCMV), influenza A fowl plague virus (FPV), Ross River alphavirus (RRV), murine leukemia virus 10A1 (MLV), or Ebola virus (EboV).
- RD114 feline endogenous virus
- GALV gibbon ape leukemia virus
- FUG Rabies
- LCMV lymphocytic choriomeningitis virus
- influenza A fowl plague virus FV
- RRV Ross River alphavirus
- MMV murine leukemia virus 10A1
- Ebola virus Ebola virus
- lentiviral packaging systems can be acquired commercially (e.g., Lenti-vpak packaging kit from OriGene Technologies, Inc., Rockville, MD), and can also be designed as described herein. Moreover, it is within the skill of a person skilled in the art to substitute or modify aspects of a lentiviral packaging system to improve any number of relevant factors, including the production efficiency of a lentiviral particle.
- the disclosed vectors allow for short, medium, or long-term expression of genes or sequences of interest and episomal maintenance of the disclosed vectors. Accordingly, dosing regimens may vary based upon the condition being treated and the method of administration.
- transduction vectors may be administered to a subject in need in varying doses. Specifically, a subject may be administered about > 10 6 infectious doses (where 1 dose is needed on average to transduce 1 target cell). More specifically, a subject may be administered about > 10 7 , about > 10 8 , about > 10 9 , or about > 10 10 infectious doses, or any number of doses in-between these values. Upper limits of transduction vector dosing will be determined for each disease indication and will depend on toxi city/safety profiles for each individual product or product lot. Additionally, a vector of the present disclosure may be administered periodically, such as once or twice a day, or any other suitable time period.
- vectors may be administered to a subj ect in need once a week, once every other week, once every three weeks, once a month, every other month, every three months, every six months, every nine months, once a year, every eighteen months, every two years, every thirty months, or every three years.
- the disclosed vectors are administered as a pharmaceutical composition.
- the pharmaceutical composition comprising the disclosed vectors can be formulated in a wide variety of dosage forms, including but not limited to nasal, pulmonary, oral, topical, or parenteral dosage forms for clinical application.
- Each of the dosage forms can comprise various solubilizing agents, disintegrating agents, surfactants, fillers, thickeners, binders, diluents such as wetting agents or other pharmaceutically acceptable excipients.
- the pharmaceutical composition comprising a vector can also be formulated for injection, insufflation, infusion, or intradermal exposure.
- an injectable formulation may comprise the disclosed vectors in an aqueous or non-aqueous solution at a suitable pH and tonicity.
- the disclosed vectors may be administered to a subject via direct injection into a tumor site or at a site of infection.
- the vectors can be administered systemically.
- the vectors can be administered via guided cannulation to tissues immediately surrounding the sites of tumor or infection.
- the disclosed vector compositions can be administered using any pharmaceutically acceptable method, such as intranasal, buccal, sublingual, oral, rectal, ocular, parenteral (intravenously, intradermally, intramuscularly, subcutaneously, intraperitoneally), pulmonary, intravaginal, locally administered, topically administered, topically administered after scarification, mucosally administered, via an aerosol, in semi-solid media such as agarose or gelatin, or via a buccal or nasal spray formulation.
- any pharmaceutically acceptable method such as intranasal, buccal, sublingual, oral, rectal, ocular, parenteral (intravenously, intradermally, intramuscularly, subcutaneously, intraperitoneally), pulmonary, intravaginal, locally administered, topically administered, topically administered after scarification, mucosally administered, via an aerosol, in semi-solid media such as agarose or gelatin, or via a buccal or nasal spray formulation.
- compositions can be formulated into any pharmaceutically acceptable dosage form, such as a solid dosage form, tablet, pill, lozenge, capsule, liquid dispersion, gel, aerosol, pulmonary aerosol, nasal aerosol, ointment, cream, semi-solid dosage form, a solution, an emulsion, and a suspension.
- the composition may be a controlled release formulation, sustained release formulation, immediate release formulation, or any combination thereof.
- the composition may be a transdermal delivery system.
- the pharmaceutical composition comprising a vector can be formulated in a solid dosage form for oral administration, and the solid dosage form can be powders, granules, capsules, tablets or pills.
- the solid dosage form can include one or more excipients such as calcium carbonate, starch, sucrose, lactose, microcrystalline cellulose or gelatin.
- the solid dosage form can include, in addition to the excipients, a lubricant such as talc or magnesium stearate.
- the oral dosage form can be immediate release, or a modified release form. Modified release dosage forms include controlled or extended release, enteric release, and the like. The excipients used in the modified release dosage forms are commonly known to a person of ordinary skill in the art.
- the pharmaceutical composition comprising a vector can be formulated as a sublingual or buccal dosage form.
- dosage forms comprise sublingual tablets or solution compositions that are administered under the tongue and buccal tablets that are placed between the cheek and gum.
- the pharmaceutical composition comprising a vector can be formulated as a nasal dosage form.
- Such dosage forms of the present invention comprise solution, suspension, and gel compositions for nasal delivery.
- the pharmaceutical composition comprising a vector can be formulated in a liquid dosage form for oral administration, such as suspensions, emulsions or syrups.
- the liquid dosage form can include, in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as humectants, sweeteners, aromatics or preservatives.
- the composition comprising vectors can be formulated to be suitable for administration to a pediatric patient.
- the pharmaceutical composition can be formulated in a dosage form for parenteral administration, such as sterile aqueous solutions, suspensions, emulsions, non- aqueous solutions or suppositories.
- the solutions or suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil or injectable esters such as ethyl oleate.
- the dosage of the pharmaceutical composition can vary depending on the patient's weight, age, gender, administration time and mode, excretion rate, and the severity of disease.
- the treatment of cancer is accomplished by guided direct injection of the disclosed vector constructs into tumors, using needle, or intravascular cannulation.
- the disclosed vectors are administered into the cerebrospinal fluid, blood or lymphatic circulation by venous or arterial cannulation or injection, intradermal delivery, intramuscular delivery or injection into a draining organ near the site of disease.
- Lentiviral particles were produced in 293T/17 HEK cells (purchased from American Type Culture Collection, Manassas, VA) following transfection with the therapeutic vector, the envelope plasmid, and the helper plasmid.
- PEI Poly(ethylenimine)
- the plasmids and DNA were initially added separately in culture medium without serum in a ratio of 3: 1 (mass ratio of PEI to DNA).
- lentiviral particles were purified by high-speed centrifugation and/or filtration followed by anion- exchange chromatography.
- concentration of lentiviral particles can be expressed in terms of transducing units/ml (TU/ml).
- the determination of TU was accomplished by measuring HIV p24 levels in culture fluids (p24 protein is incorporated into lentiviral particles), measuring the number of viral DNA copies per cell by quantitative PCR, or by infecting cells and using light (if the vectors encode luciferase or fluorescent protein markers).
- a 3-vector system i.e., a 2-vector lentiviral packaging system
- a 3-vector system was designed for the production of lentiviral particles.
- a schematic of the 3-vector system is shown in Figure 2.
- the top-most vector is a helper plasmid, which, in this case, includes Rev.
- the vector appearing in the middle of Figure 2 is the envelope plasmid.
- the bottom-most vector is the therapeutic vector, as described herein.
- the Helper plus Rev plasmid includes a CMV (CAG) enhancer (SEQ ID NO: 21); a Chicken beta actin (CAG) promoter (SEQ ID NO: 13); a chicken beta actin intron (SEQ ID NO: 22); a HIV gag (SEQ ID NO: 14); a HIV Pol (SEQ ID NO: 15); a HIV Int (SEQ ID NO: 16); a HIV RRE (SEQ ID NO: 8); a HIV Rev (SEQ ID NO: 18); and a rabbit beta globin poly A (SEQ ID NO: 23).
- the Envelope plasmid includes a CMV promoter (SEQ ID NO: 19); a beta globin intron (SEQ ID NO: 24); a VSV-G (SEQ ID NO: 20); and a rabbit beta globin poly A (SEQ ID NO: 25).
- helper plasmid was constructed by initial PCR amplification of a DNA fragment from the pNL4-3 HIV plasmid (NIH Aids Reagent Program) containing Gag, Pol, and Integrase genes. Primers were designed to amplify the fragment with EcoRI and NotI restriction sites which could be used to insert at the same sites in the pCDNA3.1 plasmid (Invitrogen).
- the forward primer was (5 ' -TAAGC AGAATTC ATGAATTTGCC AGGAAGAT-3 ') (SEQ ID NO: 26) and reverse primer was (5'- CCATACAATGAATGGACACTAGGCGGCCGCACGAAT-3') (SEQ ID NO: 27).
- the CMV promoter of pCDNA3.1 was replaced with the CAG enhancer/promoter plus a chicken beta actin intron sequence.
- a DNA fragment containing the CAG enhancer/promoter/intron sequence with Mlul and EcoRI flanking restriction sites was synthesized by Eurofins Genomics. The DNA fragment was then inserted into the plasmid at the Mlul and EcoRI restriction sites.
- the DNA sequence was as follows:
- VSV-G vesicular stomatitis Indiana virus glycoprotein
- a 4-vector system (i.e., a 3-vector lentiviral packaging system) has also been designed and produced using the methods and materials described herein.
- a schematic of the 4-vector system is shown in Figure 3. Briefly, and with reference to Figure 3, the top-most vector is a helper plasmid, which, in this case, does not include Rev.
- the vector second from the top is a separate Rev plasmid.
- the vector second from the bottom is the envelope plasmid.
- the bottom-most vector is the previously described therapeutic vector.
- the Helper plasmid includes a CMV (CAG) enhancer (SEQ ID NO: 21); a Chicken beta actin (CAG) promoter (SEQ ID NO: 13); a chicken beta actin intron (SEQ ID NO: 22); a HIV gag (SEQ ID NO: 14); a HIV Pol (SEQ ID NO: 15); a HIV Int (SEQ ID NO: 16); a HIV RRE (SEQ ID NO: 8); and a rabbit beta globin poly A (SEQ ID NO: 23).
- the Rev plasmid includes a RSV promoter and a HIV Rev (SEQ ID NO: 33); and a rabbit beta globin poly A (SEQ ID NO: 23).
- the Envelope plasmid includes a CMV promoter (SEQ ID NO: 19); a beta globin intron (SEQ ID NO: 24); a VSV-G (SEQ ID NO: 20); and a rabbit beta globin poly A (SEQ ID NO: 23).
- the Helper plasmid without Rev was constructed by inserting a DNA fragment containing the RRE and rabbit beta globin poly A sequence. This sequence was synthesized by Eurofins Genomics with flanking Xbal and Xmal restriction sites. The RRE/rabbit poly A beta globin sequence was then inserted into the Helper plasmid at the Xbal and Xmal restriction sites.
- the DNA sequence is as follows:
- the RSV promoter and HIV Rev sequence was synthesized as a single DNA fragment by Eurofins Genomics with flanking Mfel and Xbal restriction sites. The DNA fragment was then inserted into the pCDNA3.1 plasmid (Invitrogen) at the Mfel and Xbal restriction sites in which the CMV promoter is replaced with the RSV promoter.
- the DNA sequence was as follows:
- the plasmids for the 2-vector and 3-vector packaging systems could be modified with similar elements and the intron sequences could potentially be removed without loss of vector function.
- the following elements could replace similar elements in the 2-vector and 3-vector packaging system:
- Elongation Factor-1 (EF-1) (SEQ ID NO: 34), phosphoglycerate kinase
- PGK SEQ ID NO: 35
- UbC ubiquitin C
- UbC ubiquitin C
- CMV Chicken beta actin
- CAG Chicken beta actin
- HIV Gag, Pol, and Integrase sequences The HIV sequences in the Helper plasmid can be constructed from different HIV strains or clades. For example, HIV Gag (SEQ ID NO: 14); HIV Pol (SEQ ID NO: 15); and HIV Int (SEQ ID NO: 16) from the Bal strain can be interchanged with the gag, pol, and int sequences contained in the helper/helper plus Rev plasmids as outlined herein. These sequences can also be further varied by addition, substitution, deletion or mutation.
- VSV-G glycoprotein can be substituted with membrane glycoproteins from feline endogenous virus (RD114) (SEQ ID NO: 39), gibbon ape leukemia virus (GALV) (SEQ ID NO: 40), Rabies (FUG) (SEQ ID NO: 41), lymphocytic choriomeningitis virus (LCMV) (SEQ ID NO: 42), influenza A fowl plague virus (FPV) (SEQ ID NO: 43), Ross River alphavirus (RRV) (SEQ ID NO: 44), murine leukemia virus 10A1 (MLV) (SEQ ID NO: 45), or Ebola virus (EboV) (SEQ ID NO: 46). Sequences for these envelopes are identified in the sequence portion herein. Further, these sequences can also be further varied by addition, substitution, deletion or mutation.
- the 3-vector versus 4-vector systems can be compared and contrasted, in part, as follows.
- the 3-vector lentiviral vector system contains: 1. Helper plasmid: HIV Gag, Pol, Integrase, and Rev/Tat; 2. Envelope plasmid: VSV-G/FUG envelope; and 3. Therapeutic vector: RSV, 5'LTR, Psi Packaging Signal, RRE, cPPT, HI, shFDPS, CMV, BTN3A3 (R381H) T2A IL-2, WPRE, and 3' ⁇ LTR.
- the 4-vector lentiviral vector system contains: 1. Helper plasmid: HIV Gag, Pol, and Integrase; 2.
- Rev plasmid Rev; 3. Envelope plasmid: VSV-G/FUG envelope; and 4. Therapeutic vector: RSV, 5'LTR, Psi Packaging Signal, RRE, cPPT, HI, shFDPS, CMV, BTN3A3 (R381H) T2A IL-2, WPRE, and 3' ⁇ LTR. Sequences corresponding with the above elements are identified in the sequence listings portion herein.
- the purpose of this Example was to develop an FDPS -inhibiting lentivirus vector, which is also referred to herein as LV-shFDPS.
- RNA interference sequences were identified by siRNA or shRNA design programs such as from GPP Web Portal hosted by the Broad Institute (http://portals.broadinstitute.org/gpp/public/) or the BLOCK-iT RNAi Designer from Thermo Scientific (https://rnaidesigner.thermofisher.com/rnaiexpress/).
- RNA polymerase III promoter such as HI (SEQ ID NO: 10), U6 (SEQ ID NO: 47), or 7SK (SEQ ID NO: 48) to regulate shRNA expression.
- HI SEQ ID NO: 10
- U6 SEQ ID NO: 47
- 7SK SEQ ID NO: 48
- shRNA constructs were used to transduce cells and measure the change in specific mRNA levels.
- the shRNA most potent for reducing mRNA levels were embedded individually within a microRNA backbone to allow for expression by either the EF-1 alpha or CMV RNA polymerase II promoters.
- the microRNA backbone was selected from mirbase.org.
- RNA sequences were also synthesized as synthetic siRNA oligonucleotides and introduced directly into cells without using a lentiviral vector.
- Lentiviral Vector Construction For FDPS shRNA, oligonucleotide sequences containing BamHI and EcoRI restriction sites were synthesized by Eurofins Genomics. Overlapping sense and antisense oligonucleotide sequences were mixed and annealed during cooling from 70 degrees Celsius to room temperature. The lentiviral vector was digested with the restriction enzymes BamHI and EcoRI for one hour at 37 degrees Celsius. The digested lentiviral vector was purified by agarose gel electrophoresis and extracted from the gel using a DNA gel extraction kit from Thermo Scientific. The DNA concentrations were determined and vector to oligo (3: 1 ratio) were mixed, allowed to anneal, and ligated.
- the ligation reaction was performed with T4 DNA ligase for 30 minutes at room temperature. 2.5 microliters of the ligation mix were added to 25 microliters of STBL3 competent bacterial cells. Transformation was achieved after heat-shock at 42 degrees Celsius. Bacterial cells were spread on agar plates containing ampicillin and drug-resistant colonies (indicating the presence of ampicillin-resistance plasmids) were recovered and expanded in LB broth. To check for insertion of the oligo sequences, plasmid DNA was extracted from harvested bacteria cultures with the Thermo Scientific DNA mini prep kit. Insertion of shRNA sequences in the lentiviral vector was verified by DNA sequencing using a specific primer for the promoter used to regulate shRNA expression. Using the following target sequences, exemplary shRNA sequences were determined to knock-down FDPS:
- therapeutic vectors (which are also referred to herein as lentiviral plasmids) can be constructed as detailed in Figures 2-4. With continued reference to Figure 4:
- Vector 1 includes from left to right, a 5' LTR sequence; a Psi sequence; a RRE sequence; a CMV sequence; a BTN3A1 sequence; a WPRE sequence; and a 3' LTR sequence.
- Vector 2 includes from left to right, a 5' LTR sequence; a Psi sequence; a RRE sequence; a CMV sequence; a BTN3A3 sequence; a WPRE sequence; and a 3' LTR sequence.
- Vector 3 includes from left to right, a 5' LTR sequence; a Psi sequence; a RRE sequence; a CMV sequence; a BTN3A3 (R381H) sequence; a WPRE sequence; and a 3' LTR sequence.
- Vector 4 includes from left to right, a 5' LTR sequence; a Psi sequence; a RRE sequence; a HI sequence; a shFDPS sequence; a CMV sequence; a BTN3A1 sequence; a WPRE sequence; and a 3' LTR sequence.
- Vector 5 includes from left to right, a 5' LTR sequence; a Psi sequence; a RRE sequence; a HI sequence; a shFDPS sequence; a CMV sequence; a BTN3A3 sequence; a WPRE sequence; and a 3' LTR sequence.
- Vector 6 includes from left to right, a 5' LTR sequence; a Psi sequence; a RRE sequence; a HI sequence; a shFDPS sequence; a CMV sequence; a BTN3A3 (R381H) sequence; a WPRE sequence; and a 3' LTR sequence.
- Vector 7 includes from left to right, a 5' LTR sequence; a Psi sequence; a RRE sequence; a HI sequence; a shFDPS sequence; an AFP sequence; a BTN3A3 (R381H) sequence, a WPRE sequence; and a 3' LTR sequence.
- Vector 8 includes from left to right, a 5' LTR sequence; a Psi sequence; a RRE sequence; a HI sequence; a shFDPS sequence; a CMV sequence; an IL-2 sequence; a WPRE sequence; and a 3' LTR sequence.
- Vector 9 includes from left to right, a 5' LTR sequence; a Psi sequence; a RRE sequence; a HI sequence; a shFDPS sequence; a CMV sequence; an IL-15 sequence; a WPRE sequence; and a 3' LTR sequence.
- Vector 10 includes from left to right, a 5' LTR sequence; a Psi sequence; a RRE sequence; a HI sequence; a shFDPS sequence; a CMV sequence; an IL-18 sequence; a WPRE sequence; and a 3' LTR sequence.
- Vector 11 includes from left to right, a 5' LTR sequence; a Psi sequence; a RRE sequence; a HI sequence; a shFDPS sequence; a CMV sequence; a BTN3A3 (R381H) sequence; a T2A sequence; an IL-2 sequence; a WPRE sequence; and a 3' LTR sequence.
- Example 3 Expression of BTN3A3 (R381H) or BTN3A3 (WT) in PC3 prostate carcinoma cells.
- This Example illustrates that expression of BTN3A3 (R381H) or BTN3A3 (WT) in PC3 cells by lentiviral (LV)-expressing BTN3A3 (R381H) or BTN3A3 (WT) stimulates TNF-a expression in GD T cells, as shown in Figure 5.
- PC3 cells were transduced with either LV-vector, LV-BTN3A3 (R381H), or LV- BTN3A3 (WT). Three days after transduction, cells were treated with or without ⁇ zoledronic acid. After 24 hours, the transduced PC3 cells were co-cultured with 5x10 5 PBMC cells and IL-2 in a round bottom 96 well plate for 4 hours. The PBMC cells were pre- stimulated with zoledronic acid and IL-2 for 11 days to expand Vy9V52 T cells. After staining for Vy9V52 and TNF-a using fluorophore-conjugated anti TCR-V52 and anti-TNF-a antibody, cells were analyzed via flow cytometry.
- V52+ and TNF- a+ cells were selected on a dot blot.
- the activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of flow cytograms.
- the percent of TNF-a expressing Vy9V52 T cells was 0.37% with LV-vector, 26.7% with BTN3A3 (R381H), and 0.44% with LV-BTN3A3 (WT).
- the percent of TNF-a expressing Vy9V52 T cells was 8.91% with LV-vector, 35.2% with BTN3A3 (R381H), and 8.76% with LV-BTN3A3 (WT).
- Example 4 Expression of BTN3A3 (R381H) and knock-down of FDPS in HepG2 liver carcinoma cells by shRNA #4.
- FDPS cells by lentiviral (LV)-expressing BTN3A3 (R381H) and FDPS shRNA #4 stimulates TNF-a expression in GD T cells, as shown in Figure 6.
- HepG2 cells were transduced with LV-vector, LV-BTN3A3 (R381H), or LV- shFDPS-BTN3A3 (R381H). Three days after transduction, cells were treated with or without ⁇ zoledronic acid. After 24 hours, the transduced HepG2 cells were co-cultured with 5xl0 5 PBMC cells and IL-2 in a round bottom 96 well plate for 4 hours. The PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vy9V52 T cells.
- Vy9V52 and TNF-a were analyzed via flow cytometry. Live cells were gated, and V52+ and TNF-a+ cells were selected on a dot blot. The activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of flow cytograms. Without zoledronic acid, the percent of TNF-a expressing Vy9V52 T cells was 0.6% with LV-vector, 9.5% with BTN3A3 (R381H), and 13.2% with the combination of LV-shFDPS-BTN3A3 (R381H).
- the percent of TNF-a expressing Vy9V52 T cells was 7.2% with LV-vector, 17.8% with BTN3A3 (R381H), and 30.1% with the combination of LV-shFDPS-BTN3A3 (R381H).
- Example 5 Expression of BTN3A3 (R381H) and knock-down of FDPS in PC3 prostate carcinoma cells by shRNA #4.
- PC3 cells were transduced with LV-vector, LV-BTN3A3 (R381H), or LV-shFDPS- BTN3A3 (R381H). Three days after transduction, cells were treated with or without ⁇ ⁇ zoledronic acid. After 24 hours, the transduced PC3 cells were co-cultured with 5x10 5 PBMC cells and IL-2 in a round bottom 96 well plate for 4 hours. The PBMC cells were pre- stimulated with zoledronic acid and IL-2 for 11 days to expand Vy9V52 T cells.
- Vy9V52 and TNF-a were analyzed via flow cytometry. Live cells were gated, and V52+ and TNF- a+ cells were selected on a dot blot. The activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of flow cytograms. Without zoledronic acid, the percent of TNF-a expressing Vy9V52 T cells was 0.1% with LV-vector, 21.1% with BTN3A3 (R381H), and 18.2% with the combination of LV-shFDPS-BTN3A3 (R381H).
- the percent of TNF-a expressing Vy9V52 T cells was 13.6% with LV-vector, 25.5% with BTN3A3 (R381H), and 39.6% with the combination of LV-shFDPS-BTN3A3 (R381H).
- Example 6 Expression of IL-2 and knock-down of FDPS in HepG2 liver carcinoma cells by shRNA #4.
- This Example illustrates that expression of IL-2 and knock-down of FDPS cells by lentiviral (LV)-expressing IL-2 and FDPS shRNA #4 stimulates TNF-a expression in GD T cells, as shown in Figure 8.
- lentiviral (LV)-expressing IL-2 and FDPS shRNA #4 stimulates TNF-a expression in GD T cells, as shown in Figure 8.
- HepG2 cells were transduced with LV-shFDPS or LV-shFDPS-IL-2. Three days after transduction, cells were treated with or without ⁇ ⁇ zoledronic acid. After 24 hours, the transduced HepG2 cells were co-cultured with 5x10 5 PBMC cells and with or without IL-2 in a round bottom 96 well plate for 4 hours. The PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vy9V52 T cells. After staining for Vy9V52 and TNF-a using fluorophore-conjugated anti TCR-V52 and anti-TNF-a antibody, cells were analyzed via flow cytometry.
- Vy9V52 T cells Live cells were gated, and V52+ and TNF-a+ cells were selected on a dot blot.
- the activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of flow cytograms.
- the percent of TNF-a expressing Vy9V52 T cells was 7.5% with LV-shFDPS and 20.1% with LV-shFDPS-IL-2.
- the percent of TNF-a expressing Vy9V52 T cells was 27.8% with LV-shFDPS and 24.7% with LV-shFDPS-IL-2.
- Example 7 Expression of IL-2 and knock-down of FDPS in PC3 carcinoma cells by shRNA #4.
- This Example illustrates that expression of IL-2 and knock-down of FDPS cells by lentiviral (LV)-expressing IL-2 and FDPS shRNA #4 stimulates TNF-a expression in GD T cells, as shown in Figure 9.
- lentiviral (LV)-expressing IL-2 and FDPS shRNA #4 stimulates TNF-a expression in GD T cells, as shown in Figure 9.
- PC3 cells were transduced with LV-shFDPS or LV-shFDPS-IL-2. Three days after transduction, cells were treated with or without ⁇ zoledronic acid. After 24 hours, the transduced PC3 cells were co-cultured with 5xl0 5 PBMC cells and with or without IL-2 in a round bottom 96 well plate for 4 hours. The PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vy9V52 T cells. After staining for Vy9V52 and TNF-a using fluorophore-conjugated anti TCR-V52 and anti-TNF-a antibody, cells were analyzed via flow cytometry.
- This Example illustrates that expression of IL-15 and knock-down of FDPS cells by lentiviral (LV)-expressing IL-15 and FDPS shRNA #4 stimulates TNF-a expression in GD T cells, as shown in Figure 10.
- PC3 cells were transduced with LV-vector, LV-shFDPS, or LV-shFDPS-IL-15. Three days after transduction, cells were treated with or without ⁇ zoledronic acid. After 24 hours, the transduced PC3 cells were co-cultured with 5x10 5 PBMC cells and with or without IL-2 in a round bottom 96 well plate for 4 hours. The PBMC cells were pre-stimulated with zoledronic acid and IL-2 for 11 days to expand Vy9V52 T cells. After staining for Vy9V52 and TNF- ⁇ using fluorophore-conjugated anti TCR-V52 and anti-TNF-a antibody, cells were analyzed via flow cytometry.
- V52+ and TNF-a+ cells were selected on a dot blot.
- the activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of flow cytograms.
- the percent of TNF-a expressing Vy9V52 T cells was 10% with LV-vector, 13% with LV-shFDPS, and 14.6% with LV- shFDPS-IL-15.
- the percent of TNF-a expressing Vy9V52 T cells was 14.5% with LV-vector, 21.7% with LV-shFDPS, and 21% with LV-shFDPS-IL-15.
- Example 9 Expression of BTN3A3 in PC3 and HepG2 carcinoma cells by LV-BTN3A3 (R381H) and LV-shFDPS-BTN3A3 (R381H).
- PC3 prostate or HepG2 liver carcinoma cells were transduced with LV-vector or LV- BTN3A3 (R381H) for 3 days, as shown in Figures 11 A and 1 IB.
- LV-vector or LV- BTN3A3 R381H
- FIG. 11 A and 1 IB After staining for BTN3A3 using a fluorophore-conjugated anti BTN3A3 (CD277) antibody, cells were analyzed via flow cytometry. There was an increase in the mean fluorescence intensity (MFI) from 6 to 21 and from 3 to 10 in PC3 and HepG2 cells, respectively.
- HepG2 liver carcinoma cells were transduced with LV-vector or LV-shFDPS-BTN3A3 (R381H) for 3 days, as shown in Figure l lC. There was an increase in the mean fluorescence intensity (MFI) from 4 to 18.
- Example 10 Stimulation of Cytotoxic Vy2V62 Cells by Lv-shFDPS Transduced Cells and Zoledronic Acid.
- HepG2 liver carcinoma cells were transduced with Lv-shFDPS, Lv-FDPS-IL-15 (expressing both shRNAFDPS and the human cytokine interleukin 15) or Lv-control and cultured for 72 hours.
- Zoledronic acid (1 ⁇ ) was added to (1) cells transduced with Lv- shFDPS, (2) cells transduced with Lv-FDPS-IL-15, and (3) HepG2 cells transduced with Lv- control. Treated cells were cultured for 24 hours.
- Lv-shFDPS transduced cells, Lv-FDPS-IL- 15 transduced cells, and Lv-control transduced cells were co-cultured with PBMC enriched for Vy9V52 cells plus a protein transport inhibitor (BD GolgiStop) for 4 hours. After 4 hours of stimulation, cells were collected and labeled with V52 phycoerythrin (PE) and TNFaallophycocyanin (APC), and the labeled cells were analyzed by flow cytometry.
- PE phycoerythrin
- API TNFaallophycocyanin
- results showed that the frequency of responding Vy9V52 T cells (expressing TNF-a measured by intracellular cytokine staining) in the presence of 1 ⁇ zoledronic acid, was higher in Lv-FDPS than in Lv-control and was increased further by Lv-FDPS-IL-15.
- IL-2 interleukin-2
- IL-2 substitute for IL-15 and reduced the differences between Lv-FDPS and Lv-FDPS-IL-15 treated HepG2 for activating Vy9V52 T cells.
- Xenografted PC3 tumors treated and/or transduced with Lv-shFDPS showed slower growth compared to the growth of xenografted PC3 tumors treated and/or transduced with Lv-control. For example, it took 21 days for Lv-control xenografted PC3 tumors to grow to 300 mm 3 , but it took 30 day for Lv-shFDPS xenografted PC3 tumors to grow to 300 mm 3 .
- This Example illustrates that treatment of xenografted PC3 tumors transduced with Lv-shFDPS and subsequently treated with Vy9V52 T cells, slows tumor growth and increases survival, with or without zoledronic acid treatment.
- mice were randomized and grouped into eight groups: four groups of Lv-shFDPS-transduced mice and four groups of Lv-control-transduced mice.
- One group from each of the Lv-shFDPS-transduced mice and the Lv-control-transduced mice were treated with intraperitoneal injections of PBMCs once per week for 4 weeks.
- One group from each of the Lv-shFDPS-transduced mice and the Lv- control-transduced mice were treated with 100 ⁇ g/kg of zoledronic acid.
- a Kaplan Meier survival curve showed a significant survival advantage achieved by Lv-shFDPS PC3 xenografted mice compared to Lv-control PC3 xenografted (scramble) mice.
- the survival rate of Lv-shFDPS xenografted mice treated with PBMCs was greater than the survival rate of Lv-shFDPS xenografted mice not treated with PBMCs.
- Treatment of Lv-control PC3 xenografted mice with PBMCs did not substantially affect survival.
- Example 13 Development of Lentiviral Vectors that Inhibit FDPS, GGPS1, and IDI1 This Example illustrates development of lentiviral vectors that inhibit FDPS, GGPS 1, and IDI1, as shown in Figure 17.
- RNA interference sequences were identified with the shRNA design program from the Broad institute (http://portals.broadinstitute.org/gpp/public/seq/search) of the BLOCK-iT RNAi Designer (https://rnaidesigner.thermofisher.com/rnaiexpress/) from Thermo Scientific. Short-hairpin oligonucleotide sequences containing BamHI and EcoRI restriction sites or microRNA sequences containing BsrGI and EcoRI restriction sites were synthesized by Eurofins Genomics. Oligonucleotide sequences were annealed by incubating at 70 degrees Celsius then cooling to room temperature for 1 hour.
- the lentiviral vectors were digested with the restriction enzymes BamHI and EcoRI or BsrGI and EcoRI for one hour at 37 degrees Celsius.
- the digested lentiviral vectors were purified by agarose gel electrophoresis and extracted from the gel using a DNA gel extraction kit (Thermo Scientific). The DNA concentration was determined for each and 50 ng of vector were added to 2 microliters of annealed oligo.
- the ligation reactions were done with T4 DNA ligase for 30 minutes at room temperature. 2.5 microliters of the ligation mix were added to 25 microliters of StbI3 competent bacterial cells. Transformations were done with a heat-shock step at 42 degrees Celsius.
- Bacterial cells were streaked onto agar plates containing ampicillin and selected colonies were expanded in LB broth. To check for insertion of the oligo sequences, plasmid DNA were extracted from harvested bacterial cultures with a DNA mini prep kit (Thermo Scientific). Insertions of the shRNA sequence in the lentiviral vector were verified by DNA sequencing using HI or EF-1 primers. Lentiviral vectors containing correct shRNA sequences were used to package lentiviral particles for testing their ability to knock-down mRNA. Cells were transduced with lentiviral particles and collected after 3 days; both protein and mRNA were analyzed.
- FDPS shRNA sequences The sequence of Homo sapiens farnesyl diphosphate synthase (FDPS) (NM_002004.3) mRNA were used to search for potential shRNA candidates to reduce FDPS levels in human cells.
- FDPS shRNA sequences #1-4 As discussed above, the following exemplary shRNA and microRNA sequences were determined to knock down FDPS:
- GGPSl Homo sapiens geranylgeranyl pyrophosphate synthase (NM_001037277.1) mRNA were used to search for potential shRNA candidates to reduce GGPSl in human cells. Using the following target sequences, exemplary shRNA sequences were determined to knock-down GGPSl :
- GGPS l shRNA sequence #1 SEQ ID NO: 70
- GGPS1 shRNA sequence #3 SEQ ID NO: 72.
- IDIl shRNA sequences The sequence of Homo sapiens isopentenyl-diphosphate delta-isomerase 1 (IDIl) (NM_004508.3) mRNA was used to search for potential shRNA candidates to reduce IDIl levels in human cells. Using the following target sequence, an exemplary shRNA sequence was determined to knock-down IDIl :
- Example 14 - FDPS RNA and protein expression in HepG2 hepatocellular carcinoma cells transduced with lentiviruses expressing shFDPS.
- This Example illustrates reduction of FDPS RNA and protein expression by shFDPS in HepG2 cells.
- FIG 18 shows that FDPS protein expression is reduced by shFDPS.
- HepG2 cells were infected at 5 MOI with lentiviral vectors containing either shCon or two different FDPS shRNA sequences, LV-shFDPS #1 (SEQ ID NO: 1) or LV-shFDPS #4 (SEQ ID NO: 4). After 48 hours, the cells were treated with or without 1 ⁇ zoledronic acid (Zol). After 72 hours, the cells were lysed and an immunoblot was performed using an anti-FDPS and an anti-actin antibody as a protein loading control. The densitometry of the immunoblot bands were quantified and LV-shControl was set as 1 (100%).
- Example 15 - FDPS protein expression in PC3 prostate carcinoma cells transduced with lentiviruses expressing shFDPS hairpin-loop variations.
- PC3 cells were infected, at 5 MOI, with lentiviral vectors containing a non-targeting sequence (shCon) or different variations of shFDPS, namely, shFDPS #4 (SEQ ID NO: 4), shFDPS-A (SEQ ID NO: 64), shFDPS-R (SEQ ID NO: 65), shFDPS-TT (SEQ ID NO: 66), or shFDPS-L (SEQ ID NO: 67).
- shFDPS #4 SEQ ID NO: 4
- shFDPS-A SEQ ID NO: 64
- shFDPS-R SEQ ID NO: 65
- shFDPS-TT SEQ ID NO: 66
- shFDPS-L SEQ ID NO: 67
- FDPS expression was detected with Fam- labeled TaqMan probe (5 ' -TAGC ATCTCCTATCTCTGGGTGCCC-3 ' ) (SEQ ID NO: 78), using the FDPS forward primer (5 ' -GTGCTGACTGAGGATGAGATG-3 ' ) (SEQ IF NO: 79) and reverse primer (5 '-CCGGTTATACTTGCCTCCAAT-3 ') (SEQ ID NO: 80). The samples were normalized to actin expression.
- Actin was detected with a Fam-labeled TaqMan probe (5 ' -AGCGGGAAATCGTGCGTGAC-3 ') (SEQ ID NO: 81) using the Actin forward primer (5 '-GGACCTGACTGACTACCTCAT-3 ') (SEQ ID NO: 82) and reverse primer (5'-CGTAGCACAGCTTCTCCTTAAT-3') (SEQ ID NO: 83).
- the relative FDPS RNA expression of the shCon sample is set at 100%.
- PC3 cells were infected at 5 MOI with lentiviral vectors containing either shControl or variations of shFDPS #4. After 72 hours, cells were lysed and an immunoblot was performed using an anti-FDPS and an anti-actin antibody as a protein loading control. The densitometry of the immunoblot bands were quantified and LV-shControl was set as 1 (100%).
- This Example illustrates decrease in FDPS protein expression in cells transduced with lentiviruses expressing miR30-FDPS.
- HepG2 human hepatocellular carcinoma cells were infected, at 5 MOI, with lentiviral vectors containing either a shControl, shFDPS #3 (SEQ ID NO: 3), miR30-FDPS #1 (SEQ ID NO: 68), or miR30-FDPS #3 (SEQ ID NO: 69). After 72 hours, cells were lysed with NP-40 lysis buffer and proteins were measured with the Bio-Rad protein assay reagent. Protein samples at 50 micrograms were electrophoresed on 4- 12% Bis-Tris gels (Thermo Scientific) and transferred to PVDF membranes. The blots were blocked in 5% blotting grade blocker.
- An immunoblot was performed using an anti-FDPS antibody (Bethyl Laboratories) and an anti-actin antibody (Millipore Sigma) as a protein loading control. Antibodies were bound with HRP-conjugated secondary antibodies (Thermo Scientific) and detected with a Licor c-DiGit Blot scanner using the Immobilon Western ECL reagent (Millipore Sigma). The densitometry of the immunoblot bands were quantified with the NIH image software, and LV-Control was set as 1 (100%).
- Example 17 Activation of Vy9V82 T cells by THP-1 monocytic leukemia carcinoma cells transduced with a lentivirus expressing miR30-FDPS #1.
- This Example illustrates that knock-down of FDPS for 7 days in THP-1 monocytic leukemia carcinoma cells by LV-expressing miR30-FDPS miRNA #1 (SEQ ID NO: 68) and treatment with or without zoledronic acid stimulates TNF-a expression in Vy9V52 T cells, as shown in Figure 21.
- THP-1 cells (2xl 0 5 cells) were transduced with LV-control or LV-miR30 FDPS #1
- the activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of the flow cytograms.
- LV-control stimulated 2.44% of TNF-a expressing Vy9V52 T cells and LV-miR30 FDPS #1 (SEQ ID NO: 68) stimulated 28.4%.
- LV-control stimulated 23.8% of TNF-a expressing Vy9V52 T cells and LV-miR30 FDPS # 1 (SEQ ID NO: 68) stimulated 61.4%.
- Example 18 - GGPS1 protein expression in HeLa cervical carcinoma cells transduced with lentiviruses expressing shGGPSl HeLa cells were infected at 5 MOI with lentiviral vectors containing either a shControl or three different GGPS1 shRNA sequences, namely LV-shGGPSl #1 (SEQ ID NO: 70), LV-shGGPSl #2 (SEQ ID NO: 71), or LV-shGGPSl #3 (SEQ ID NO: 73). After 72 hours, cells were lysed and an immunoblot was performed using an anti-GGPSl antibody from Santa Cruz Biotechnology (Cat. No. sc-271680) and an anti-actin antibody as a protein loading control.
- LV-shGGPSl #1 SEQ ID NO: 70
- LV-shGGPSl #2 SEQ ID NO: 71
- LV-shGGPSl #3 SEQ ID NO: 73
- LV- shControl was set as 1 (100%). As shown in Figure 22, there was a 54% (LV-shGGPSl #1(SEQ ID NO: 70)), 69% (LV- shGGPSl #2 (SEQ ID NO: 71)), and 51% (LV- shGGPS l #3(SEQ ID NO: 72)) reduction of FDPS protein expression, respectively.
- Example 19 Activation of Vy9V82 T cells by PC3 prostate carcinoma cells transduced with a lentivirus expressing shFDPS or shGGPSl and treated with zoledronic acid.
- This Example illustrates that knock-down of FDPS or GGPS1 for 3 days in PC3 cells transduced with LV-expressing FDPS shRNA #4 (SEQ ID NO: 4) or GGPS1 shRNA #1 (SEQ ID NO: 1) and treatment with zoledronic acid stimulates TNF-a expression in Vy9V52 T cells, as shown in Figure 23.
- PC3 cells were transduced with LV-control or LV-FDPS shRNA #4 (SEQ ID NO: 4) or LV-GGPS l shRNA #1 (SEQ ID NO: 70) for 3 days. Two days after transduction, cells were treated with or without 1 ⁇ zoledronic acid. After 24 hours, the transduced PC3 cells were co-cultured for 4 hours with 5x10 5 PBMC cells in a round bottom 96 well plate. The PBMC cells had been pre-stimulated with zoledronic acid plus IL-2 for at least 11 days to expand Vy9V52 T cells.
- Vy9V52 and TNF-a After staining for Vy9V52 and TNF-a using fluorophore-conjugated anti TCR-V52 and anti-TNF-a antibody, cells were analyzed via flow cytometry. Live cells were gated; V52+ and TNF-a+ cells were identified on a dot blot. The activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of the flow cytograms. Without zoledronic acid, LV-control stimulated 2.78% of TNF-a expressing Vy9V52 T cells whereas LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 0.77% and LV-GGPSl #1 shRNA (SEQ ID NO: 70) stimulated 1.23%.
- LV-control stimulated 5.71% of TNF-a expressing Vy9V52 T cells, whereas LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 11.4% and LV-GGPSl #1 shRNA (SEQ ID NO: 70) stimulated 10%.
- Example 20 - Activation of V82+ T cells by HepG2 hepatocellular carcinoma cells transduced with a lentivirus expressing shFDPS or shGGPSl and treated with zoledronic acid.
- This Example illustrates that knock-down of FDPS or GGPS1 for 3 days in HepG2 cells transduced with LV-expressing FDPS shRNA #4 (SEQ ID NO: 4) or GGPS1 shRNA #1 (SEQ ID NO: 70) and treatment with zoledronic acid stimulates TNF-a expression in Vy9V52 T cells, as shown in Figure 24.
- HepG2 cells were transduced with LV-control or LV-FDPS shRNA #4 (SEQ ID NO:
- LV-GGPS1 shRNA #1 (SEQ ID NO: 70) for 3 days.
- Vy9V52 T cells Live cells were gated; V52+ and TNF-a+ cells were identified on a dot blot. The activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of the flow cytograms. Without zoledronic acid, LV-control stimulated 0.36% of TNF-a expressing Vy9V52 T cells whereas LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 0.9% and LV-GGPS1 #1 (SEQ ID NO: 70) shRNA stimulated 0.58%.
- LV-control stimulated 6.88% of TNF-a expressing Vy9V52 T cells
- LV-FDPS shRNA #4 SEQ ID NO: 4
- LV-GGPS1 #1 shRNA SEQ ID NO: 70
- This Example illustrates that knock-down of FDPS or GGPS 1 for 3 days in THP-1 cells transduced with Lv-expressing FDPS shRNA #4 (SEQ ID NO: 4) and/or GGPS 1 shRNA #1 (SEQ ID NO: 70) and treatment with zoledronic acid stimulates TNF-a expression in Vy9V52 T cells, as shown in Figure 25.
- THP-1 cells were transduced with LV-control or LV-FDPS shRNA #4 (SEQ ID NO: 4) or Lv-GGPS l shRNA #1 (SEQ ID NO: 70) for 3 days. Two days after transduction, cells were treated with or without 1 ⁇ zoledronic acid. After 24 hours, the transduced THP-1 cells were co-cultured for 4 hours with 5x10 5 PBMC cells in a round bottom 96 well plate. The PBMC cells had been pre-stimulated with zoledronic acid plus IL-2 for at least 11 days to expand Vy9V52 T cells.
- Vy9V52 and TNF-a were analyzed via flow cytometry. Live cells were gated; V52+ and TNF-a+ cells were identified on a dot blot. The activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of the flow cytograms. Without zoledronic acid, LV-control stimulated 1.33% of TNF-a expressing Vy9V52 T cells whereas Lv-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 2.49%, Lv-GGPSl #1 shRNA (SEQ ID NO: 70) stimulated 1.22%, and both combined stimulated 1.91%.
- Lv-FDPS shRNA #4 SEQ ID NO: 4
- Lv-GGPSl #1 shRNA SEQ ID NO: 70
- Lv-control stimulated 5.74% of TNF-a expressing Vy9V52 T cells
- Lv-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 10.8%
- Lv-GGPSl shRNA #1 (SEQ ID NO: 70) stimulated 4.5%
- Example 22 IDI1 protein expression in PC3 prostate carcinoma cells transduced with lentiviruses expressing shIDIl.
- This Example illustrates the effects of transduction with a lentiviral vector encoding the IDI1 shRNA sequence on IDI1 expression, as determined by immunoblot analyses.
- PC3 cells were infected, at 5 MOI, with lentiviral vectors containing either a shControl or an IDI1 shRNA sequence (SEQ ID NO: 76). After 72 hours, cells were lysed and an immunoblot was performed using an anti-IDIl antibody from Thermo Fisher (Cat. No. PA5-44207) and an anti-actin antibody as a protein loading control. The densitometry of the immunoblot bands were quantified, and Lv-shControl was set as 1 (100%). As shown in Figure 26, there was an 88% reduction of IDI1 protein expression.
- Example 23 Activation of Vy9V82 T cells by PC3 prostate carcinoma cells transduced with a lentivirus expressing shFDPS or shIDIl and treated with zoledronic acid.
- This Example illustrates that knock-down of FDPS or IDI1 for 3 days in PC3 cells transduced with Lv-expressing FDPS shRNA #4 (SEQ ID NO: 4) or IDI1 shRNA #1 (SEQ ID NO: 76) and treatment with zoledronic acid stimulates TNF-a expression in Vy9V52 T cells, as shown in Figure 27.
- PC3 cells were transduced with Lv-control or Lv-FDPS shRNA #4 (SEQ ID NO: 4) or LV-IDI1 shRNA #1 (SEQ ID NO: 76) for 3 days. Two days after transduction, cells were treated with or without 1 ⁇ zoledronic acid. After 24 hours, the transduced PC3 cells were co-cultured for 4 hours with 5xl0 5 PBMC cells in a round bottom 96 well plate. The PBMC cells had been pre-stimulated with zoledronic acid plus IL-2 for at least 11 days to expand Vy9V52 T cells.
- Vy9V52 and TNF-a After staining for Vy9V52 and TNF-a using fluorophore-conjugated anti TCR-V52 and anti-TNF-a antibody, cells were analyzed via flow cytometry. Live cells were gated; V52+ and TNF-a+ cells were identified on a dot blot. The activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of the flow cytograms. Without zoledronic acid, LV-control stimulated 3.82% of TNF-a expressing Vy9V52 T cells whereas LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 2.28% and LV-IDI1 shRNA #1 (SEQ ID NO: 76) stimulated 1.92%.
- LV-control stimulated 8.66% of TNF-a expressing Vy9V52 T cells, whereas LV-FDPS shRNA #4 (SEQ ID NO: 4) stimulated 36.9% and LV-IDI1 shRNA #1 (SEQ ID NO: 76) stimulated 12.9%.
- Example 24 Activation of Vy9V82 T cells by THP-1 acute monocytic leukemia cells treated with zoledronic acid (Zol), FTI277 (FTI), or zaragozic acid (ZA).
- Zol zoledronic acid
- FTI277 FTI277
- ZA zaragozic acid
- ZA is a small molecule inhibitor of squalene synthase in the pathway committed to sterol synthesis.
- THP-1 cells were treated with either the FDPS inhibitor Zol (10 ⁇ ), the farnesyl transferase inhibitor FTI (10 ⁇ ), or ZA (50 ⁇ ) for 24 hours.
- THP-1 cells (2.5xl0 5 ) were co-cultured with 2.5xl0 5 PBMC cells in a round bottom 96 well plate for 5 hours.
- the PBMC cells had been pre-stimulated with zoledronic acid plus IL-2 for at least 11 days to expand Vy9V52 T cells.
- Vy9V52 and TNF-a were analyzed via flow cytometry. Live cells were gated; V52+ and TNF-a+ cells were identified on a dot blot. The activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of the flow cytograms. Untreated cells stimulated 3.08% of TNF-a expressing Vy9V52 T cells, whereas zoledronic acid treatment stimulated 40.1%, FTI277 treatment stimulated 11.7%, and zaragozic acid stimulated 2.13%.
- Example 25 Activation of Vy9V82 T cells by PC3 prostate carcinoma cells transduced with a lentivirus expressing shFDPS and treated with zoledronic acid (Zol), FTI277 (FTI), or zaragozic acid (ZA).
- Zol zoledronic acid
- FTI277 FTI277
- ZA zaragozic acid
- PC3 cells were transduced with LV-control or LV-FDPS shRNA #4 (SEQ ID NO: 4) for 3 days. Two days after transduction, cells were treated with or without 1 ⁇ zoledronic acid, 1 ⁇ FTI277, or 5 ⁇ zaragozic acid. After 24 hours, the transduced PC3 cells were co-cultured for 4 hours with 5xl0 5 PBMC cells in a round bottom 96 well plate. The PBMC cells had been pre-stimulated with zoledronic acid plus IL-2 for at least 11 days to expand Vy9V52 T cells.
- Vy9V52 and TNF-a were analyzed via flow cytometry. Live cells were gated; V52+ and TNF-a+ cells were identified on a dot blot. The activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of the flow cytograms.
- untreated cells stimulated 1.73% of TNF-a expressing Vy9V52 T cells, whereas zoledronic acid treatment stimulated 2.87%, FTI277 stimulated 1.64%, and zaragozic acid stimulated 1.57%.
- LV-FDPS shRNA #4 SEQ ID NO: 4
- untreated cells stimulated 1.77% of TNF-a expressing Vy9V52 T cells
- zoledronic acid stimulated 50.3%
- FTI277 stimulated 2.44%
- zaragozic acid stimulated 2.66%.
- Example 26 - Activation of Vy9V82 T cells by HepG2 hepatocellular carcinoma cells transduced with a lentivirus expressing shFDPS and treated with zoledronic acid (Zol), FTI277 (FTI), or zaragozic acid (ZA).
- HepG2 cells were transduced with LV-control or LV-FDPS shRNA #4 (SEQ ID NO: 4) for 3 days. Two days after transduction, cells were treated with or without 1 ⁇ zoledronic acid, 1 ⁇ FTI277, or 5 ⁇ zaragozic acid. After 24 hours, the transduced HepG2 cells were co-cultured for 4 hours with 5xl0 5 PBMC cells in a round bottom 96 well plate. The PBMC cells had been pre-stimulated with zoledronic acid plus IL-2 for at least 11 days to expand Vy9V52 T cells.
- Vy9V52 and TNF-a were analyzed via flow cytometry. Live cells were gated; V52+ and TNF-a+ cells were identified on a dot blot. The activated cytotoxic Vy9V52 T cells appeared in the upper right quadrant of the flow cytograms.
- untreated cells stimulated 1.82% of TNF-a expressing Vy9V52 T cells, whereas zoledronic acid treatment stimulated 3.02%, FTI277 stimulated 1.72%, and zaragozic acid stimulated 1.63%.
- LV-FDPS shRNA #4 SEQ ID NO: 4
- untreated cells stimulated 1.86% of TNF-a expressing Vy9V52 T cells
- zoledronic acid stimulated 50.8%
- FTI277 stimulated 2.69%
- zaragozic acid stimulated 2.82%.
- GCTATTACCATGGGTCGAGGTGAGCCCCACGTTCTGCTTC Chicken beta actin ACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTA (CAG) promoter; TTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCG Transcription GGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGG
- BTN3A3 Lenti-BTN3A3 ATGAAAATGGCAAGTTCCCTGGCTTTCCTTCTGCTCAACT
- BTN3A3 TTCATGTCTCCCTCTTCTTGGTCCAGCTGCTCACTCCTTGC
- VSV-G ATGAAGTGCCTTTTGTACTTAGCCTTTTTATTCATTGGGGT Glycoprotein GAATTGCAAGTTCACCATAGTTTTTCCACACAACCAAAA envelope-cell entry AGGAAACTGGAAAAATGTTCCTTCTAATTACCATTATTGC
- Elongation Factor- CCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAA 1 alpha EF1- AGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTG alpha promoter GGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACG
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Mycology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/614,682 US12559769B2 (en) | 2017-06-16 | 2018-06-15 | Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells |
| CA3064442A CA3064442A1 (en) | 2017-06-16 | 2018-06-15 | Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells |
| CN201880039828.4A CN110770338A (zh) | 2017-06-16 | 2018-06-15 | 由人γ-δ T细胞激活肿瘤细胞毒性的方法和组合物 |
| EP18817253.0A EP3638779A4 (en) | 2017-06-16 | 2018-06-15 | METHODS AND COMPOSITIONS FOR ACTIVATING TUMOR CYTOXICITY VIA HUMAN GAMMA DELTA T CELLS |
| JP2019569226A JP2020524996A (ja) | 2017-06-16 | 2018-06-15 | ヒトガンマデルタt細胞を介する腫瘍細胞傷害性の活性化のための方法および組成物 |
| KR1020207000631A KR20200018586A (ko) | 2017-06-16 | 2018-06-15 | 인간 감마-델타 t-세포를 통한 종양 세포독성의 활성화를 위한 방법 및 조성물 |
| IL271274A IL271274A (en) | 2017-06-16 | 2019-12-09 | Methods and compositions for inducing mast cell toxicity using human gamma-delta t-cells |
| JP2023118187A JP2023133396A (ja) | 2017-06-16 | 2023-07-20 | ヒトガンマデルタt細胞を介する腫瘍細胞傷害性の活性化のための方法および組成物 |
| JP2025048283A JP2025089431A (ja) | 2017-06-16 | 2025-03-24 | ヒトガンマデルタt細胞を介する腫瘍細胞傷害性の活性化のための方法および組成物 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762521274P | 2017-06-16 | 2017-06-16 | |
| US62/521,274 | 2017-06-16 | ||
| US201862633461P | 2018-02-21 | 2018-02-21 | |
| US62/633,461 | 2018-02-21 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018232359A1 true WO2018232359A1 (en) | 2018-12-20 |
Family
ID=64660752
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/037924 Ceased WO2018232359A1 (en) | 2017-06-16 | 2018-06-15 | Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US12559769B2 (https=) |
| EP (1) | EP3638779A4 (https=) |
| JP (3) | JP2020524996A (https=) |
| KR (1) | KR20200018586A (https=) |
| CN (1) | CN110770338A (https=) |
| CA (1) | CA3064442A1 (https=) |
| IL (1) | IL271274A (https=) |
| WO (1) | WO2018232359A1 (https=) |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10420789B2 (en) | 2016-01-15 | 2019-09-24 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
| US10428350B2 (en) | 2016-01-15 | 2019-10-01 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
| US10494647B2 (en) | 2016-07-08 | 2019-12-03 | American Gene Technologies International Inc. | HIV pre-immunization and immunotherapy |
| US10548914B2 (en) | 2008-10-17 | 2020-02-04 | American Gene Technologies International Inc. | Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules |
| US10767183B2 (en) | 2016-03-09 | 2020-09-08 | American Gene Technologies International Inc. | Combination vectors and methods for treating cancer |
| US10888613B2 (en) | 2016-02-08 | 2021-01-12 | American Gene Technologies International Inc. | Method of producing cells resistant to HIV infection |
| WO2021146628A1 (en) * | 2020-01-15 | 2021-07-22 | The Regents Of The University Of California | Compositions and methods for altering gamma delta t cell activity |
| CN114555785A (zh) * | 2019-10-17 | 2022-05-27 | 香港大学 | 制备v-t细胞衍生的外泌体以治疗epstein-barr病毒相关癌症的方法 |
| US11352646B2 (en) | 2018-11-05 | 2022-06-07 | American Gene Technologies International Inc. | Vector system for expressing regulatory RNA |
| US11583562B2 (en) | 2016-07-21 | 2023-02-21 | American Gene Technologies International Inc. | Viral vectors for treating Parkinson's disease |
| US11820999B2 (en) | 2017-04-03 | 2023-11-21 | American Gene Technologies International Inc. | Compositions and methods for treating phenylketonuria |
| EP4114439A4 (en) * | 2020-03-03 | 2024-04-17 | American Gene Technologies International Inc. | ON-DEMAND EXPRESSION OF EXOGENOUS FACTORS IN LYMPHOCYTES FOR THE TREATMENT OF HIV |
| US11976292B2 (en) | 2016-06-08 | 2024-05-07 | American Gene Technologies International Inc. | Non-integrating viral delivery system and methods related thereto |
| US11980663B2 (en) | 2015-07-08 | 2024-05-14 | American Gene Technologies International Inc. | HIV pre-immunization and immunotherapy |
| US12559769B2 (en) | 2017-06-16 | 2026-02-24 | American Gene Technologies International Inc. | Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113842459B (zh) * | 2021-01-18 | 2023-01-06 | 陈晓文 | 一种病理性血管生成抑制剂及其用途 |
| CN117460819A (zh) * | 2021-01-21 | 2024-01-26 | 美国基因技术国际有限公司 | 工程化的nk细胞和治疗癌症的方法 |
| US20240115705A1 (en) * | 2021-02-08 | 2024-04-11 | The J. Gladstone Institutes, a testamentary trust established under the will of J. David Gladstone | Regulation of Butyrophilin subfamily 3 member A1 (BTN3A1, CD277) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013096455A1 (en) * | 2011-12-20 | 2013-06-27 | Dana-Farber Cancer Institute, Inc. | Methods for diagnosing and treating oncogenic kras-associated cancer |
| US20150018539A1 (en) * | 2013-01-26 | 2015-01-15 | Mirimus, Inc. | Modified mirna as a scaffold for shrna |
| US20180142257A1 (en) * | 2016-01-15 | 2018-05-24 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta t-cells |
Family Cites Families (148)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5668255A (en) | 1984-06-07 | 1997-09-16 | Seragen, Inc. | Hybrid molecules having translocation region and cell-binding region |
| WO1994012629A1 (en) | 1992-12-02 | 1994-06-09 | Baylor College Of Medicine | Episomal vectors for gene therapy |
| BR9405507A (pt) | 1993-07-13 | 1999-05-25 | Rhone Poulenc Rorer Sa | Adenovirus recombinante defeituoso linhagem celular e composição farmaceutica |
| CA2265460A1 (en) | 1996-09-11 | 1998-03-19 | The Government Of The United States Of America, Represented By The Secre Tary, Department Of Health And Human Services | Aav4 vector and uses thereof |
| US6635472B1 (en) | 1997-08-15 | 2003-10-21 | Rubicon Laboratory, Inc. | Retrovirus and viral vectors |
| AU1124499A (en) | 1997-10-28 | 1999-05-17 | Maxygen, Inc. | Human papillomavirus vectors |
| AU3097399A (en) | 1998-03-20 | 1999-10-11 | Trustees Of The University Of Pennsylvania, The | Compositions and methods for helper-free production of recombinant adeno-associated viruses |
| ES2323744T3 (es) | 1998-10-01 | 2009-07-23 | University Of Southern California | Sistema retroviral de suministro de genes y metodos de uso. |
| US6156514A (en) | 1998-12-03 | 2000-12-05 | Sunol Molecular Corporation | Methods for making recombinant cells |
| US6410013B1 (en) | 1999-01-25 | 2002-06-25 | Musc Foundation For Research Development | Viral vectors for use in monitoring HIV drug resistance |
| WO2000072886A1 (en) | 1999-05-26 | 2000-12-07 | Dana-Farber Cancer Institute, Inc. | Episomally replicating lentiviral vectors |
| AU2001257611A1 (en) | 2000-04-28 | 2001-11-12 | Avigen, Inc. | Polynucleotides for use in recombinant adeno-associated virus virion production |
| CA2408830A1 (en) | 2000-05-12 | 2001-11-22 | The Regents Of The University Of California | Treatment of human papillomavirus (hpv)-infected cells |
| AU2001265187A1 (en) | 2000-05-30 | 2001-12-11 | Baylor College Of Medicine | Chimeric viral vectors for gene therapy |
| NO314588B1 (no) | 2000-09-04 | 2003-04-14 | Bionor Immuno As | HIV-peptider, antigener, vaksinesammensetning, immunoassay- testsett og en fremgangsmåte for å påvise antistoffer indusert av HIV |
| US7122181B2 (en) | 2000-12-19 | 2006-10-17 | Research Development Foundation | Lentiviral vector-mediated gene transfer and uses thereof |
| US20030119770A1 (en) | 2001-08-02 | 2003-06-26 | Zhennan Lai | Intercellular delivery of a herpes simplex virus VP22 fusion protein from cells infected with lentiviral vectors |
| WO2003015708A2 (en) | 2001-08-18 | 2003-02-27 | Myriad Genetics, Inc | Composition and method for treating hiv infection |
| US7737124B2 (en) | 2001-09-13 | 2010-06-15 | California Institute Of Technology | Method for expression of small antiviral RNA molecules with reduced cytotoxicity within a cell |
| US7368114B2 (en) | 2001-10-25 | 2008-05-06 | The United States Of America As Represented By The Department Of Health And Human Services | Fusion protein including of CD4 |
| US20070203333A1 (en) | 2001-11-30 | 2007-08-30 | Mcswiggen James | RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA) |
| JP2005521393A (ja) | 2002-03-20 | 2005-07-21 | マサチューセッツ インスティテュート オブ テクノロジー | Hiv治療 |
| AU2003237159A1 (en) | 2002-04-30 | 2003-11-17 | University Of Florida | Treatment for phenylketonuria |
| AU2003301556A1 (en) | 2002-05-07 | 2004-05-13 | Chiron Corporation | Hiv envelope-cd4 complexes and hybrids |
| US7199107B2 (en) | 2002-05-23 | 2007-04-03 | Isis Pharmaceuticals, Inc. | Antisense modulation of kinesin-like 1 expression |
| US20040161412A1 (en) | 2002-08-22 | 2004-08-19 | The Cleveland Clinic Foundation | Cell-based VEGF delivery |
| AU2003265948B8 (en) | 2002-09-06 | 2009-09-03 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Immunotherapy with in vitro-selected antigen-specific lymphocytes after nonmyeloablative lymphodepleting chemotherapy |
| ES2334125T3 (es) | 2002-11-04 | 2010-03-05 | University Of Massachusetts | Interferencia de arn especifico de alelos. |
| AU2003283174A1 (en) | 2002-12-11 | 2004-06-30 | Cytos Biotechnology Ag | Method for protein production |
| US20060246520A1 (en) | 2003-05-23 | 2006-11-02 | Institut National De La Sante Et De La Recherche Medicale | Gamma delta t cell-mediated therapy |
| WO2005005644A1 (en) | 2003-07-11 | 2005-01-20 | Cytos Biotechnology Ag | Gene expression system |
| US20050019927A1 (en) | 2003-07-13 | 2005-01-27 | Markus Hildinger | DECREASING GENE EXPRESSION IN A MAMMALIAN SUBJECT IN VIVO VIA AAV-MEDIATED RNAi EXPRESSION CASSETTE TRANSFER |
| US20050138677A1 (en) | 2003-09-16 | 2005-06-23 | Pfister Herbert J. | Transgenic animal model for the treatment of skin tumors |
| WO2005028634A2 (en) | 2003-09-18 | 2005-03-31 | Emory University | Improved mva vaccines |
| WO2005033282A2 (en) | 2003-10-01 | 2005-04-14 | Pharmacia & Upjohn Company Llc | Polyamide compositions and therapeutic methods for treatment of human papilloma virus |
| US20080039413A1 (en) | 2003-10-21 | 2008-02-14 | Morris David W | Novel compositions and methods in cancer |
| WO2005081911A2 (en) | 2004-02-25 | 2005-09-09 | Dana-Farber Cancer Institute, Inc. | METHODS AND COMPOSITIONS FOR THE TREATMENT AND PREVENTION OF HIV INFECTION USING TRIM5α |
| US20060058255A1 (en) | 2004-03-01 | 2006-03-16 | Jianzhu Chen | RNAi-based therapeutics for allergic rhinitis and asthma |
| TWI439284B (zh) | 2004-04-09 | 2014-06-01 | 艾伯維生物技術有限責任公司 | 用於治療TNFα相關失調症之多重可變劑量療法 |
| WO2005118802A2 (en) | 2004-06-03 | 2005-12-15 | The Regents Of The University Of California | Targeting pseudotyped retroviral vectors |
| WO2006012221A2 (en) | 2004-06-25 | 2006-02-02 | The Regents Of The University Of California | Target cell-specific short interfering rna and methods of use thereof |
| WO2006023491A2 (en) | 2004-08-16 | 2006-03-02 | The Cbr Institute For Biomedical Research, Inc. | Method of delivering rna interference and uses thereof |
| EP1802641B8 (en) | 2004-10-08 | 2012-03-07 | The Board Of Trustees Of The University Of Illinois | Bisphosphonate compounds and methods for bone resorption diseases, cancer, bone pain, immune disorders, and infectious diseases |
| EP1647595A1 (en) | 2004-10-15 | 2006-04-19 | Academisch Medisch Centrum bij de Universiteit van Amsterdam | Nucleic acids against viruses, in particular HIV |
| US20070298498A1 (en) | 2004-11-02 | 2007-12-27 | Stefano Colloca | Adenoviral Amplicon and Producer Cells for the Production of Replication-Defective Adenoviral Vectors, Methods of Preparation and Use Thereof |
| US7790446B2 (en) | 2005-02-11 | 2010-09-07 | Kosagen Cell Factory Oü | Vectors, cell lines and their use in obtaining extended episomal maintenance replication of hybrid plasmids and expression of gene products |
| AU2006214278C1 (en) | 2005-02-16 | 2012-07-19 | Miltenyi Biotec Technology, Inc. | Lentiviral vectors and their use |
| PL2002003T3 (pl) | 2005-05-27 | 2016-06-30 | Ospedale San Raffaele Srl | Wektor genetyczny zawierający mi-RNA |
| WO2007015122A1 (en) | 2005-08-02 | 2007-02-08 | Genexel, Inc. | Therapy for alzheimer’s disease |
| US20070032443A1 (en) | 2005-08-02 | 2007-02-08 | Jaeseob Kim | Therapy for Alzheimer's disease |
| US20070105835A1 (en) | 2005-11-07 | 2007-05-10 | Kazantsev Aleksey G | Compositions and methods for modulating poly(ADP-ribose) polymerase activity |
| WO2007133674A2 (en) | 2006-05-12 | 2007-11-22 | Lentigen Corporation | Lentiviral vector compositions, methods and applications |
| WO2007149476A2 (en) | 2006-06-19 | 2007-12-27 | Trustees Of Columbia University In The City Of New York | Assays for non-apoptotic cell death and uses thereof |
| US20080003225A1 (en) | 2006-06-29 | 2008-01-03 | Henri Vie | Method for enhancing the antibody-dependent cellular cytotoxicity (ADCC) and uses of T cells expressing CD16 receptors |
| US8124752B2 (en) | 2006-07-10 | 2012-02-28 | Alnylam Pharmaceuticals, Inc. | Compositions and methods for inhibiting expression of the MYC gene |
| EP1878440A1 (en) | 2006-07-13 | 2008-01-16 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and compositions for increasing the efficiency of therapeutic antibodies using gamma delta cell activator compounds |
| KR20090034395A (ko) | 2006-07-26 | 2009-04-07 | 노파르티스 아게 | 운데카프레닐 피로포스페이트 합성효소의 억제제 |
| US20080199961A1 (en) | 2006-08-25 | 2008-08-21 | Avi Biopharma, Inc. | ANTISENSE COMPOSITION AND METHOD FOR INHIBITION OF miRNA BIOGENESIS |
| EP2426142A3 (en) | 2006-10-16 | 2012-06-13 | Genelux Corporation | Modified vaccinia virus strains for use in a diagnostic and therapeutic method |
| US8338101B2 (en) | 2007-01-23 | 2012-12-25 | Virco Bvba | Method for designing a drug regime for HIV-infected patients |
| CN101679466A (zh) | 2007-04-12 | 2010-03-24 | 伊利诺伊大学评议会 | 对包括fpps、ggpps和dpps在内的多靶点效力提高的二膦酸盐化合物及方法 |
| US20080293142A1 (en) | 2007-04-19 | 2008-11-27 | The Board Of Regents For Oklahoma State University | Multiple shRNA Expression Vectors and Methods of Construction |
| WO2009001224A2 (en) | 2007-06-22 | 2008-12-31 | Eth Zurich | Antivirals |
| EP2008656A1 (en) | 2007-06-28 | 2008-12-31 | Bergen Teknologioverforing AS | Compositions for the treatment of hyperphenylalaninemia |
| WO2009026328A2 (en) | 2007-08-21 | 2009-02-26 | Immune Disease Institute, Inc. | Methods of delivery of agents to leukocytes and endothelial cells |
| RU2536242C2 (ru) | 2007-09-28 | 2014-12-20 | Антродженезис Корпорейшн | Угнетение опухолей с помощью плацентарного перфузата человека и выделенных из плаценты человека вспомогательных натуральных клеток-киллеров |
| EP2090659A1 (en) | 2008-02-14 | 2009-08-19 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Infectious particle, process for its preparation and use thereof |
| GB0810209D0 (en) | 2008-06-04 | 2008-07-09 | Cambridge Entpr Ltd | Pluripotency associated epigenetic factor |
| MX2010013888A (es) | 2008-06-16 | 2011-05-03 | Polyplus Battery Co Inc | Celdas para baterias del litio/aire acuosas. |
| US8629334B2 (en) | 2008-07-16 | 2014-01-14 | University Of Florida Research Foundation, Inc. | Viral-based transient-expression vector system for trees |
| WO2010022195A2 (en) | 2008-08-20 | 2010-02-25 | Virxsys Corporation | Non-integrating lenti/adeno-associated virus hybrid vector system |
| EP2342321B1 (en) | 2008-09-17 | 2018-04-11 | Isogenis, Inc. | Construction of fully-deleted adenovirus-based gene delivery vectors and uses thereof |
| WO2010045659A1 (en) | 2008-10-17 | 2010-04-22 | American Gene Technologies International Inc. | Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules |
| AU2009308707A1 (en) | 2008-10-31 | 2010-05-06 | Biogen Idec Ma Inc. | LIGHT targeting molecules and uses thereof |
| WO2010051521A1 (en) | 2008-10-31 | 2010-05-06 | Lentigen Corporation | Cell therapy product for the treatment of hiv infection |
| CN102369288A (zh) | 2008-11-14 | 2012-03-07 | 生命技术公司 | 用于工程化细胞的组合物和方法 |
| EP2191834A1 (en) | 2008-11-26 | 2010-06-02 | Centre National De La Recherche Scientifique (Cnrs) | Compositions and methods for treating retrovirus infections |
| CN102439136A (zh) | 2009-03-26 | 2012-05-02 | 加州大学校董 | 产生用于疾病修饰的抑制性rna的间充质干细胞 |
| US20120034197A1 (en) | 2009-04-09 | 2012-02-09 | Stemcyte Inc. | Hiv-resistant stem cells and uses thereof |
| JP5727458B2 (ja) | 2009-04-13 | 2015-06-03 | アプセト ゲゼルシャフト ミット ベシュレンクテル ハフツング ウント コンパニー コマンディトゲゼルシャフトApceth Gmbh & Co. Kg | 改変間葉系幹細胞及びそれを使用した腫瘍の治療方法 |
| US8728458B2 (en) | 2009-04-30 | 2014-05-20 | The Regents Of The University Of California | Combination anti-HIV vectors, targeting vectors, and methods of use |
| EP3659435A1 (en) | 2009-07-15 | 2020-06-03 | Calimmune, Inc. | Dual vector for inhibition of human immunodeficiency virus |
| US20120027725A1 (en) | 2009-11-30 | 2012-02-02 | Galvin Jeffrey A | Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules to treat liver cancer |
| CN101805750B (zh) | 2009-12-29 | 2011-11-30 | 浙江大学 | 法呢基焦磷酸合成酶rna干扰重组慢病毒载体构建及用途 |
| CA2790426A1 (en) | 2010-02-18 | 2011-08-25 | Emory University | Vectors expressing hiv antigens and gm-csf and related methods for generating an immune response |
| WO2011119942A1 (en) | 2010-03-25 | 2011-09-29 | Vistagen Therapeutics, Inc. | Induction of ips cells using transient episomal vectors |
| WO2011133687A2 (en) * | 2010-04-20 | 2011-10-27 | President And Fellows Of Harvard College | Methods and compositions for inhibition of beta2-adrenergic receptor degradation |
| HRP20182039T1 (hr) | 2010-04-23 | 2019-02-08 | Cold Spring Harbor Laboratory | NOVE STRUKTURNO DIZAJNIRANE MOLEKULE shRNA |
| CN102946907A (zh) | 2010-05-28 | 2013-02-27 | 牛津生物医学(英国)有限公司 | 慢病毒载体向脑的递送 |
| JP5805089B2 (ja) | 2010-08-10 | 2015-11-04 | タカラバイオ株式会社 | 細胞集団の製造方法 |
| WO2012048303A2 (en) | 2010-10-07 | 2012-04-12 | Columbia University | METHOD FOR TREATING CANCER HARBORING A p53 MUTATION |
| WO2012061075A2 (en) | 2010-10-25 | 2012-05-10 | The Regents Of The University Of California | Hiv resistant and functional hematopoietic stem/progenitor cells and macrophages from induced pluripotent stem cells |
| CN103492016A (zh) | 2010-11-23 | 2014-01-01 | 普莱萨格生命科学公司 | 用于实体递送的治疗方法和组合物 |
| US8865881B2 (en) | 2011-02-22 | 2014-10-21 | California Institute Of Technology | Delivery of proteins using adeno-associated virus (AAV) vectors |
| EP3318635A1 (en) | 2011-04-21 | 2018-05-09 | University of Massachusetts | Raav-based compositions and methods for treating alpha-1 anti-trypsin deficiencies |
| WO2013056148A2 (en) | 2011-10-15 | 2013-04-18 | Genentech, Inc. | Methods of using scd1 antagonists |
| JP6348064B2 (ja) | 2011-11-22 | 2018-06-27 | ザ チルドレンズ ホスピタル オブ フィラデルフィア | 効率の高いトランスジーン送達のためのウイルスベクター |
| CA2863964C (en) | 2012-02-07 | 2021-10-26 | Global Bio Therapeutics Usa, Inc. | Compartmentalized method of nucleic acid delivery and compositions and uses thereof |
| WO2013174404A1 (en) | 2012-05-23 | 2013-11-28 | Ganymed Pharmaceuticals Ag | Combination therapy involving antibodies against claudin 18.2 for treatment of cancer |
| IN2014KN02774A (https=) | 2012-06-06 | 2015-05-08 | Bionor Immuno As | |
| CA2879514C (en) | 2012-07-17 | 2020-04-14 | Universite De Geneve | Nucleic acids for down-regulation of gene expression |
| US10233495B2 (en) | 2012-09-27 | 2019-03-19 | The Hospital For Sick Children | Methods and compositions for screening and treating developmental disorders |
| ES2686129T3 (es) | 2012-11-13 | 2018-10-16 | Codiak Biosciences, Inc. | Administración de agentes terapéuticos |
| WO2014089212A1 (en) | 2012-12-05 | 2014-06-12 | Sangamo Biosciences, Inc. | Methods and compositions for regulation of metabolic disorders |
| US9642921B2 (en) | 2012-12-20 | 2017-05-09 | Tocagen Inc. | Cancer combination therapy and recombinant vectors |
| CN103184224A (zh) | 2013-04-03 | 2013-07-03 | 衡阳师范学院 | 一种抗艾滋病病毒感染的三联miRNA及构建方法 |
| WO2014187881A1 (en) | 2013-05-21 | 2014-11-27 | Max-Planck Gesellschaft zur Förderung der Wissenschaften e.V. | Isoforms of gata6 and nkx2-1 as markers for diagnosis and therapy of cancer and as targets for anti-cancer therapy |
| BR112015030211A2 (pt) | 2013-06-03 | 2017-08-22 | Theravectys | Vetores lentivirais contendo uma sequência promotora a montante da mhc de classe i, mhc de classe ii ou microglobulina beta-2 |
| CA2954168C (en) | 2013-08-02 | 2023-09-19 | The Regents Of The University Of California | Engineering antiviral t cell immunity through stem cells and chimeric antigen receptors |
| WO2015042308A2 (en) | 2013-09-18 | 2015-03-26 | City Of Hope | Rna-based hiv inhibitors |
| EA034103B1 (ru) | 2013-10-22 | 2019-12-27 | Транслейт Био, Инк. | СПОСОБ ЛЕЧЕНИЯ ФЕНИЛКЕТОНУРИИ С ПРИМЕНЕНИЕМ мРНК |
| AU2014346559B2 (en) | 2013-11-07 | 2020-07-09 | Editas Medicine,Inc. | CRISPR-related methods and compositions with governing gRNAs |
| EP2878674A1 (en) | 2013-11-28 | 2015-06-03 | Fundación Centro Nacional de Investigaciones Cardiovasculares Carlos III (CNIC) | Stable episomes based on non-integrative lentiviral vectors |
| CN113699159A (zh) | 2014-03-28 | 2021-11-26 | 明尼苏达大学评议会 | 涉及经工程改造的cd16的多肽、细胞和方法 |
| RU2763795C2 (ru) | 2014-04-23 | 2022-01-11 | Джуно Терапьютикс, Инк. | Способы выделения, культивирования и генетической инженерии популяций клеток иммунной системы для адоптивной терапии |
| ES2744565T3 (es) | 2014-04-25 | 2020-02-25 | Genethon | Tratamiento de la hiperbilirrubinemia |
| LT3134432T (lt) | 2014-04-25 | 2020-04-10 | Bluebird Bio, Inc. | Mnd promotorius chimerinių antigenų receptoriams |
| WO2016033163A1 (en) | 2014-08-29 | 2016-03-03 | Immunomedics, Inc. | Identification of cancer genes by in-vivo fusion of human cancer cells and animal cells |
| SI3197472T1 (sl) | 2014-09-22 | 2022-01-31 | Tanea Medical Ab | Rekombinantni proteini brez PHE za uporabo pri zdravljenju fenilketonurije |
| WO2016057980A1 (en) | 2014-10-10 | 2016-04-14 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Methods to eliminate cancer stem cells by targeting cd47 |
| EP3206696A4 (en) | 2014-10-14 | 2018-08-08 | Texas Tech University System | Multiplexed shrnas and uses thereof |
| WO2016069716A1 (en) | 2014-10-30 | 2016-05-06 | The Scripps Research Institute | Compositions and methods comprising tyrosyl-trna synthetases and resveratrol compounds |
| GB201509202D0 (en) | 2015-05-28 | 2015-07-15 | Ge Healthcare Bio Sciences Ab | Semi-static cell culture |
| EP3307894B1 (en) | 2015-06-10 | 2026-01-28 | American Gene Technologies International Inc. | Non-integrating viral delivery system and methods of use thereof |
| JP6890831B2 (ja) | 2015-07-08 | 2021-06-18 | アメリカン ジーン テクノロジーズ インターナショナル インコーポレイテッド | Hiv予備免疫化および免疫療法 |
| CA2994192C (en) | 2015-08-13 | 2020-06-16 | Peking University | Induced extended pluripotent stem cells, methods of making and using |
| CN105112370B (zh) | 2015-08-25 | 2019-02-05 | 杭州优善生物科技有限公司 | 一种体外刺激外周血γδT细胞高效增殖的方法及其应用 |
| WO2017068077A1 (en) | 2015-10-20 | 2017-04-27 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Methods and products for genetic engineering |
| US11389546B2 (en) | 2015-12-09 | 2022-07-19 | Modernatx, Inc. | Heterologous UTR sequences for enhanced mRNA expression |
| US10137144B2 (en) | 2016-01-15 | 2018-11-27 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
| US10888613B2 (en) | 2016-02-08 | 2021-01-12 | American Gene Technologies International Inc. | Method of producing cells resistant to HIV infection |
| DK3426777T3 (da) | 2016-03-09 | 2022-04-25 | American Gene Tech Int Inc | Kombinationsvektorer og fremgangsmåder til behandling af cancer |
| SG11201807223UA (en) | 2016-03-23 | 2018-09-27 | Univ Columbia | CANCER TREATMENT BASED ON DELIVERY OF OLIGOES VIA GAP JUNCTIONS FROM HUMAN MESENCHYMAL STEM CELLS (hMSC) |
| WO2017173453A1 (en) | 2016-04-01 | 2017-10-05 | The Brigham And Women's Hospital, Inc. | Stimuli-responsive nanoparticles for biomedical applications |
| US11976292B2 (en) | 2016-06-08 | 2024-05-07 | American Gene Technologies International Inc. | Non-integrating viral delivery system and methods related thereto |
| IL284348B2 (en) | 2016-07-08 | 2025-06-01 | American Gene Tech Int Inc | Hiv pre-immunization and immunotherapy |
| JP7176756B2 (ja) | 2016-07-21 | 2022-11-22 | アメリカン ジーン テクノロジーズ インターナショナル インコーポレイテッド | パーキンソン病を処置するためのウイルスベクター |
| KR102738752B1 (ko) | 2016-12-30 | 2024-12-06 | 더 트러스티스 오브 더 유니버시티 오브 펜실베니아 | 페닐케톤뇨증을 치료하기 위한 유전자 치료 |
| WO2018129540A1 (en) | 2017-01-09 | 2018-07-12 | American Gene Technologies International Inc. | Hiv immunotherapy with no pre-immunization step |
| AU2018219292B2 (en) | 2017-02-08 | 2024-09-26 | Dana-Farber Cancer Institute, Inc. | Tunable endogenous protein degradation with heterobifunctional compounds |
| CA3057142A1 (en) | 2017-04-03 | 2018-10-11 | American Gene Technologies International Inc. | Compositions and methods for treating phenylketonuria |
| CA3064442A1 (en) | 2017-06-16 | 2018-12-20 | American Gene Technologies International Inc. | Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells |
| WO2019070674A2 (en) | 2017-10-02 | 2019-04-11 | American Gene Technologies International Inc. | VECTORS COMPRISING PROMOTER AND ACTIVATOR COMBINATIONS FOR THE TREATMENT OF PHENYLCETONURIA |
| WO2019136273A1 (en) | 2018-01-05 | 2019-07-11 | NantBio Inc. | Reprogrammed t cell-like nk cells |
| US20210275589A1 (en) | 2018-07-13 | 2021-09-09 | Nanjing Legend Biotech Co. Ltd. | Co-receptor systems for treating infectious diseases |
| US11352646B2 (en) | 2018-11-05 | 2022-06-07 | American Gene Technologies International Inc. | Vector system for expressing regulatory RNA |
| BR112021024124A2 (pt) | 2019-05-31 | 2022-01-11 | American Gene Tech Int Inc | Expressão otimizada de fenilalanina hidroxilase |
| JP2023516685A (ja) | 2020-03-03 | 2023-04-20 | アメリカン ジーン テクノロジーズ インターナショナル インコーポレイテッド | Hivを処置するためのリンパ球における外因性因子のオンデマンド発現 |
-
2018
- 2018-06-15 CA CA3064442A patent/CA3064442A1/en active Pending
- 2018-06-15 CN CN201880039828.4A patent/CN110770338A/zh active Pending
- 2018-06-15 WO PCT/US2018/037924 patent/WO2018232359A1/en not_active Ceased
- 2018-06-15 EP EP18817253.0A patent/EP3638779A4/en active Pending
- 2018-06-15 JP JP2019569226A patent/JP2020524996A/ja active Pending
- 2018-06-15 US US16/614,682 patent/US12559769B2/en active Active
- 2018-06-15 KR KR1020207000631A patent/KR20200018586A/ko not_active Ceased
-
2019
- 2019-12-09 IL IL271274A patent/IL271274A/en unknown
-
2023
- 2023-07-20 JP JP2023118187A patent/JP2023133396A/ja not_active Withdrawn
-
2025
- 2025-03-24 JP JP2025048283A patent/JP2025089431A/ja active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013096455A1 (en) * | 2011-12-20 | 2013-06-27 | Dana-Farber Cancer Institute, Inc. | Methods for diagnosing and treating oncogenic kras-associated cancer |
| US20150018539A1 (en) * | 2013-01-26 | 2015-01-15 | Mirimus, Inc. | Modified mirna as a scaffold for shrna |
| US20180142257A1 (en) * | 2016-01-15 | 2018-05-24 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta t-cells |
Non-Patent Citations (5)
| Title |
|---|
| DATABASE Nucleotide [O] 24 January 2013 (2013-01-24), "Human DNA Sequence from Clone RP1-288M22 on Chromosome 6q12-13, Complete Sequence", XP055557668, retrieved from ncbi Database accession no. AL035467.23 * |
| JIANG, X ET AL.: "A Novel EST-derived RNAi Screen Reveals a Critical Role for Famesyl Diphosphate Synthase in Beta2-adrenergic Receptor Internalization and Down-Regulation", FASEB JOURNAL, vol. 26, no. 5, 25 January 2012 (2012-01-25), pages 1 - 13, XP055557661 * |
| MIETTINEN, TP ET AL.: "Mevalonate Pathway Regulates Cell Size Homeostasis and Proteostasis through Autophagy", CELL REPORTS, vol. 13, no. 11, December 2015 (2015-12-01), pages 2610 - 2620, XP055557663 * |
| TOLMACHOV: "Designing Lentiviral Gene Vectors", VIRAL GENE THERAPY, 2011, pages 263 - 284, XP055557665 * |
| WANG, H ET AL.: "Butyrophilin 3A1 Plays an Essential Role in Prenyl Pyrophosphate Stimulation of Human Vg2Vd2 T Cells", JOURNAL OF IMMUNOLOGY, vol. 191, no. 3, 5 July 2013 (2013-07-05), pages 1029 - 1042, XP055557660 * |
Cited By (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10548914B2 (en) | 2008-10-17 | 2020-02-04 | American Gene Technologies International Inc. | Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules |
| US11007209B2 (en) | 2008-10-17 | 2021-05-18 | American Gene Technologies International Inc. | Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules |
| US11980663B2 (en) | 2015-07-08 | 2024-05-14 | American Gene Technologies International Inc. | HIV pre-immunization and immunotherapy |
| US10428350B2 (en) | 2016-01-15 | 2019-10-01 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
| US10472649B2 (en) | 2016-01-15 | 2019-11-12 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
| US12403155B2 (en) | 2016-01-15 | 2025-09-02 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
| US10772905B2 (en) | 2016-01-15 | 2020-09-15 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
| US11519006B2 (en) | 2016-01-15 | 2022-12-06 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
| US10420789B2 (en) | 2016-01-15 | 2019-09-24 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
| US12410446B2 (en) | 2016-01-15 | 2025-09-09 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
| US12090200B2 (en) | 2016-02-08 | 2024-09-17 | American Gene Technologies International Inc. | Methods of producing cells resistant to HIV infection |
| US10888613B2 (en) | 2016-02-08 | 2021-01-12 | American Gene Technologies International Inc. | Method of producing cells resistant to HIV infection |
| US11242527B1 (en) | 2016-03-09 | 2022-02-08 | American Gene Technologies International Inc. | Combination vectors and methods for treating cancer |
| US10975374B2 (en) | 2016-03-09 | 2021-04-13 | American Gene Technologies International Inc. | Combination vectors and methods for treating cancer |
| US10767183B2 (en) | 2016-03-09 | 2020-09-08 | American Gene Technologies International Inc. | Combination vectors and methods for treating cancer |
| US12359203B2 (en) | 2016-03-09 | 2025-07-15 | American Gene Technologies International Inc. | Combination vectors and methods for treating cancer |
| US11976292B2 (en) | 2016-06-08 | 2024-05-07 | American Gene Technologies International Inc. | Non-integrating viral delivery system and methods related thereto |
| US11090379B2 (en) | 2016-07-08 | 2021-08-17 | American Gene Technologies International Inc. | HIV pre-immunization and immunotherapy |
| US12370253B2 (en) | 2016-07-08 | 2025-07-29 | American Gene Technologies International Inc. | Pre-immunization and immunotherapy |
| US11911458B2 (en) | 2016-07-08 | 2024-02-27 | American Gene Technologies International Inc. | HIV pre-immunization and immunotherapy |
| US10494647B2 (en) | 2016-07-08 | 2019-12-03 | American Gene Technologies International Inc. | HIV pre-immunization and immunotherapy |
| US11583562B2 (en) | 2016-07-21 | 2023-02-21 | American Gene Technologies International Inc. | Viral vectors for treating Parkinson's disease |
| US11820999B2 (en) | 2017-04-03 | 2023-11-21 | American Gene Technologies International Inc. | Compositions and methods for treating phenylketonuria |
| US12559769B2 (en) | 2017-06-16 | 2026-02-24 | American Gene Technologies International Inc. | Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells |
| US11352646B2 (en) | 2018-11-05 | 2022-06-07 | American Gene Technologies International Inc. | Vector system for expressing regulatory RNA |
| US12410445B2 (en) | 2018-11-05 | 2025-09-09 | American Gene Technologies International Inc. | Vector system for expressing regulatory RNA |
| CN114555785A (zh) * | 2019-10-17 | 2022-05-27 | 香港大学 | 制备v-t细胞衍生的外泌体以治疗epstein-barr病毒相关癌症的方法 |
| US20230226183A1 (en) * | 2020-01-15 | 2023-07-20 | The Regents Of The University Of California | Compositions and methods for altering gamma delta t cell activity |
| JP2023510565A (ja) * | 2020-01-15 | 2023-03-14 | ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア | ガンマ・デルタt細胞の活性を変化させるための組成物および方法 |
| WO2021146628A1 (en) * | 2020-01-15 | 2021-07-22 | The Regents Of The University Of California | Compositions and methods for altering gamma delta t cell activity |
| EP4114439A4 (en) * | 2020-03-03 | 2024-04-17 | American Gene Technologies International Inc. | ON-DEMAND EXPRESSION OF EXOGENOUS FACTORS IN LYMPHOCYTES FOR THE TREATMENT OF HIV |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2023133396A (ja) | 2023-09-22 |
| JP2020524996A (ja) | 2020-08-27 |
| US20200181645A1 (en) | 2020-06-11 |
| CN110770338A (zh) | 2020-02-07 |
| KR20200018586A (ko) | 2020-02-19 |
| IL271274A (en) | 2020-01-30 |
| CA3064442A1 (en) | 2018-12-20 |
| EP3638779A4 (en) | 2021-03-10 |
| US12559769B2 (en) | 2026-02-24 |
| EP3638779A1 (en) | 2020-04-22 |
| JP2025089431A (ja) | 2025-06-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12559769B2 (en) | Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells | |
| US12410446B2 (en) | Methods and compositions for the activation of gamma-delta T-cells | |
| US12403155B2 (en) | Methods and compositions for the activation of gamma-delta T-cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18817253 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3064442 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2019569226 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20207000631 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018817253 Country of ref document: EP Effective date: 20200116 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 271274 Country of ref document: IL |
|
| WWG | Wipo information: grant in national office |
Ref document number: 16614682 Country of ref document: US |