WO2018211453A1 - Compositions comprising naphthyridine derivatives and aluminium adjuvant for use in treating solid tumors - Google Patents

Compositions comprising naphthyridine derivatives and aluminium adjuvant for use in treating solid tumors Download PDF

Info

Publication number
WO2018211453A1
WO2018211453A1 PCT/IB2018/053481 IB2018053481W WO2018211453A1 WO 2018211453 A1 WO2018211453 A1 WO 2018211453A1 IB 2018053481 W IB2018053481 W IB 2018053481W WO 2018211453 A1 WO2018211453 A1 WO 2018211453A1
Authority
WO
WIPO (PCT)
Prior art keywords
pharmaceutical composition
amino
aluminum
pharmaceutically acceptable
naphthyridin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2018/053481
Other languages
English (en)
French (fr)
Inventor
Michael Cooke
Shailaja Kasibhatla
Andrew T. Miller
Tom Yao-Hsiang Wu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis AG
Original Assignee
Novartis AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to BR112019024260A priority Critical patent/BR112019024260A2/pt
Priority to AU2018268420A priority patent/AU2018268420B2/en
Priority to CA3062609A priority patent/CA3062609A1/en
Priority to CN201880032524.5A priority patent/CN110636848A/zh
Priority to RU2019141837A priority patent/RU2787157C2/ru
Priority to EP18730857.2A priority patent/EP3624806A1/en
Priority to CN202310419489.5A priority patent/CN116473981A/zh
Priority to JP2019563379A priority patent/JP2020520910A/ja
Priority to MX2019013720A priority patent/MX2019013720A/es
Priority to US16/614,280 priority patent/US11752162B2/en
Application filed by Novartis AG filed Critical Novartis AG
Priority to KR1020197037113A priority patent/KR20200007040A/ko
Publication of WO2018211453A1 publication Critical patent/WO2018211453A1/en
Anticipated expiration legal-status Critical
Priority to AU2021203564A priority patent/AU2021203564B2/en
Priority to US18/360,909 priority patent/US20240009215A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/66Phosphorus compounds
    • A61K31/675Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/02Inorganic compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/16Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
    • A61K47/18Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/26Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/14Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/19Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles lyophilised, i.e. freeze-dried, solutions or dispersions
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2818Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55505Inorganic adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • the invention provides methods of treating tumors by intratumoral administration of TLR7 agonistst and the use of such agonists for the treatment of tumors.
  • TLRs Toll-like receptors
  • TLRs are pattern recognition receptors which play an essential role in the innate immunity, by recognizing invasion of microbial pathogens and initiating intracellular signal transduction pathways to trigger expression of genes, the products of which can control innate immune responses.
  • TLR Toll like receptor
  • TLR7, TLR8, and TLR9 belong to a subfamily of TLRs based on their genomic structure, sequence similarities, and homology.
  • TLR7, TLR8, and TLR9 are located in intracellular endolysosomal compartments and show a unique pattern of cell type-specific expression that is thought to be responsible for different pathogen response profiles.
  • TLR7 and/or TLR8 Small molecule agonists of TLR7 and/or TLR8 have been reported and shown to activate innate immune responses by inducing selected cytokine biosynthesis, the induction of co- stimulatory molecules, and by increased antigen-presenting capacity.
  • Such compounds include imidazoquinoline amine derivatives (U.S. Patent No. 4689338), imidazopyridine amine derivative (U.S. Patent No. 5446153), imidazonaphthyridine derivative (U.S. Patent No.
  • the synthetic TLR7 agonist, Imiquimod (1 -(2-methylpropyl)-1 H-imidazo[ 4,5-c]quinolin-4- amine) is FDA-approved in a cream formulation for the topical treatment of cutaneous basal cell carcinoma, actinic keratosis and genital warts, and has limited activity against cutaneous melanoma and breast tumors (J. Immunol. 2014, 193(9) : 4722 ⁇ 1-731 ).
  • Systemic administration of Imiquimod, and structurally similar Resiquimod is limited by cytokine- mediated adverse effects including severe flu-like symptoms (Expert Opin. Emerging Drugs (2010), 15:544-555).
  • Imiquimod is used exclusively in topical applications and is not used to treat deep, non-cutaneous tumors such as melanoma or solid tumors.
  • An injectable lipid modified imidazoquinoline (TLR7/8 dual agonist) that forms a tissue depot with gradual, sustained release which allows for local TLR triggering activity without systemic cytokine release has been reported (J. Immunol. 2014, 193(9): 4722 ⁇ 731 ).
  • this compound was shown to be ineffective for large tumors and in addition the serum concentration of this compound 24 hours post subcutaneous administration decreased by approximately 50% (Journal for ImmunoTherapy of Cancer, 2014, 2:12). Therefore, there remains a need for intratumor administration of a TLR7 agonist with prolonged sustained release, which may benefit the treatment of large tumors.
  • the invention provides pharmaceutical compositions and pharmaceutical combinations comprising a TLR7 agonist and a suspension of particles comprising aluminum .
  • the invention also provides pharmaceutical compositions and pharmaceutical combinations comprising a TLR7 agonist and a suspension of particles comprising aluminum for the use in treating solid tumors or liquid tumors.
  • the invention further provides methods for treating a solid tumor or liquid tumor by administrating to a subject in need thereof such pharmaceutical compositions or pharmaceutical combinations, and the use such pharmaceutical compositions or
  • a pharmaceutical composition comprising a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, aluminum-containing particles, a buffering agent, and one or more pharmaceutically acceptable excipients:
  • R 2 is -L 2 R 4 , -L 2 R 6 , -L 2 L 3 L 2 R 6 , -L 2 L 3 R 4 , -L 2 L 3 L 2 R 4 , -OUR 4 , -OR 4 , -OUR 6 , -OUUR 6 , -
  • each R 3 is independently selected from H and fluoro;
  • R 4 is -P(0)(OH) 2 ,
  • R 5 is -CF 2 P(0)(OH) 2 or -C(0)OH ;
  • R 6 is -CF 2 P(0)(OH) 2 or -C(0)OH ;
  • Li is Ci-C 6 alkylene, C 2 -C 6 alkenylene or -((CR 4 R 4 ) p O) q (CH 2 ) p -, wherein the Ci-C 6 alkylene and C 2 -C6alkenylene of Li are substituted with 0 to 4 fluoro groups;
  • each L 2 is independently selected from Ci-C 6 alkylene and -((CR 3 R 3 ) p O) q (CH 2 ) p -,
  • Ci-C 6 alkylene of L 2 is substituted with 0 to 4 fluoro groups;
  • L 3 is arylene or a 5-6 membered heteroarylene;
  • each p is independently selected from 1 , 2, 3, 4, 5 and 6, and
  • q is 1 , 2, 3 or 4.
  • Item 2 The pharmaceutical composition of item 1 , wherein the composition comprises a
  • Item 3 The pharmaceutical composition of item 1 or item 2, wherein the composition
  • composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, a buffering agent, mannitol, wherein the composition has a pH in the range of 6.5 to 9.0, and the aluminum-containing particles are a suspension of aluminum-containing particles.
  • Item 4 The pharmaceutical composition of any one of items 1 to 3, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Item 5 The pharmaceutical composition of any one of items 1 to 4, wherein the composition has a pH in the range of 7.2 to 7.8.
  • Item 6 The pharmaceutical composition of any one of items 1 to 5, wherein the aluminum- containing particles are aluminum hydroxide particles, aluminum oxyhydroxide particles or aluminum hydroxyphosphate particles and the suspension of aluminum-containing particles is a suspension of aluminum hydroxide particles, aluminum oxyhydroxide particles or aluminum hydroxyphosphate particles.
  • Item 7 The pharmaceutical composition of any one of items 1 to 6, wherein the aluminum- containing particles are aluminum hydroxide particles, and the suspension of aluminum-containing particles is a suspension of aluminum hydroxide particles.
  • Item 8 The pharmaceutical composition of any one of items 1 to 7, wherein the composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles, Tris buffer and mannitol.
  • Item 9 The pharmaceutical composition of any one of items 1 to 8, wherein the composition comprises 0.5 to 2 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • Item 10 The pharmaceutical composition of any one of items 1 to 9, wherein the composition comprises 0.5 to 2 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-50 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • Item 1 1 The pharmaceutical composition of any one of items 1 to 10, wherein the composition comprises 0.5 to 2 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • a compound having the structure of Formula (A) or a pharmaceutically acceptable salt thereof
  • 5-20 mM Tris buffer 5-10% (w/v) mannitol
  • a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • Item 12 The pharmaceutical composition of any one of items 1 to 1 1 , wherein the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • Item 13 The pharmaceutical composition of any one of items 1 to 12, wherein the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • Item 14 The pharmaceutical composition of any one of items 1 to 12, wherein the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH of in the range of 7.0 to 8.0.
  • the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH of in the range of 7.0 to 8.0.
  • Item 15 The pharmaceutical composition of any one of items 1 to 12, wherein the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 5.5% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH of in the range of 7.0 to 8.0.
  • the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 5.5% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH of in the range of 7.0 to 8.0.
  • Item 16 The pharmaceutical composition of any one of items 1 to 7, wherein the composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof , a suspension of aluminum hydroxide particles, Tris buffer and sucrose.
  • Item 17 The pharmaceutical composition of any one of items 1 to 7 or 16, wherein the
  • composition comprises 0.5 to 2 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • Item 18 The pharmaceutical composition of any one of items 1 to 7 or 16 to 17, wherein the composition comprises 0.5 to 2 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-50 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • Item 19 The pharmaceutical composition of any one of items 1 to 7 or 15 to 17, wherein the composition comprises 0.5 to 2 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • Item 20 The pharmaceutical composition of any one of items 1 to 7 or 16 to 20, wherein the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • Item 21 The pharmaceutical composition of any one of items 1 to 7 or 16 to 20, wherein the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • Item 22 The pharmaceutical composition of any one of items 1 to 7 or 16 to 21 , wherein the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises 1 mg/mL of a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • Item 23 The pharmaceutical composition of any one of items 1 to 22, wherein the (w/w) ratio of the weight of compound of Formula A to the weight of aluminum in the suspension of aluminum-containing particles is in the range from 1 :1 to 1 :20.
  • Item 24 The pharmaceutical composition of any one of items 1 to 23, wherein the (w/w) ratio of the weight of compound of Formula A to the weight of aluminum in the suspension of aluminum-containing particles is in the range from 1 :1 .5 to 1 :2.5.
  • Item 25 The pharmaceutical composition of any one of items 1 to 22, wherein the (w/w) ratio of the weight of compound of Formula A to the weight of aluminum in the suspension of aluminum-containing particles is 1 :1 .5.
  • Item 26 The pharmaceutical composition of any one of items 1 to 22, wherein the (w/w) ratio of the weight of compound of Formula A to the weight of aluminum in the suspension of aluminum-containing particles is 1 :2.
  • Item 27 The pharmaceutical composition of any one of items 1 to 15 or 23, wherein the
  • composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of compound of Formula A to the weight of aluminum in the suspension of particles is 1 :20.
  • Item 28 The pharmaceutical composition of any one of items 1 to 15 or 23, wherein the
  • composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of compound of Formula A to the weight of aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range of 7.0 to 8.0.
  • Item 29 The pharmaceutical composition of any one of items 1 to 15 or 23, wherein the
  • composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5 (w/v) mannitol, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of compound of Formula A to the weight of aluminum in the suspension of particles is 1 :2 and the composition has a pH of in the range of 7.0 to 8.0.
  • Item 30 The pharmaceutical composition of any one of items 1 to 15 or 23, wherein the
  • composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25 (w/v) mannitol, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of compound of Formula A to the weight of aluminum in the suspension of particles is 1 :2 and the composition has a pH of in the range of 7.0 to 8.0.
  • Item 31 The pharmaceutical composition of any one of items 1 to 15 or 23, wherein the
  • composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 5.5 (w/v) mannitol, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of compound of Formula A to the weight of aluminum in the suspension of particles is 1 :2 and the composition has a pH of in the range of 7.0 to 8.0.
  • Item 32 The pharmaceutical composition of any one of items 16 to 23, wherein the composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the compound of Formula A to the aluminum in the suspension of particles is 1 :20.
  • the composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the compound of Formula A to the aluminum in the suspension of particles is 1 :20.
  • Item 33 The pharmaceutical composition of any one of items 16 to 23, wherein the composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the compound of Formula A to the aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the compound of Formula A to the aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range of 7.0 to 8.0.
  • Item 34 The pharmaceutical composition of any one of items 16 to 23, wherein the composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5 (w/v) sucrose, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the compound of Formula A to the aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5 (w/v) sucrose, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the compound of Formula A to the aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range of 7.0 to 8.0.
  • Item 35 The pharmaceutical composition of any one of items 16 to 23, wherein the composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25 (w/v) sucrose, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the compound of Formula A to the aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25 (w/v) sucrose, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the compound of Formula A to the aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range of 7.0 to 8.0.
  • Item 36 The pharmaceutical composition of any one of items 1 to 34, wherein the compound having the structure of Formula (A) is:
  • Item 37 The pharmaceutical composition of any one of items 1 to 36, wherein the compound is 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid.
  • Item 38 The pharmaceutical composition of any one of items 1 to 36, wherein the compound is 3-(5-amino-2-(2-methyl-4-(2-(2-(2-(2-(2- phosphonoethoxy)ethoxy)ethoxy)phenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid.
  • Item 39 The pharmaceutical composition of any one of items 1 to 8, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles, Tris buffer and mannitol.
  • Item 40 The pharmaceutical composition of any one of items 1 to 8 or 39, wherein the
  • composition comprises 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • Item 41 The pharmaceutical composition of any one of items 1 to 8 or 39 to 40, wherein the composition comprises 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-50 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • Item 42 The pharmaceutical composition of any one of items 1 to 8 or 39 to 41 , wherein the composition comprises 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • Item 43 The pharmaceutical composition of any one of items 1 to 8 or 39 to 42, wherein the composition comprises 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridm ⁇
  • composition has a pH in the range of 7.0 to 8.0.
  • Item 44 The pharmaceutical composition of any one of items 1 to 8 or 39 to 43, wherein the composition comprises 1 mg/ml_ of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/ml_, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises 1 mg/ml_ of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8
  • Item 45 The pharmaceutical composition of any one of items 1 to 8 or 39 to 43, wherein the composition comprises 1 mg/ml_ of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/ml_, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises 1 mg/ml_ of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin
  • Item 46 The pharmaceutical composition of any one of items 1 to 8 or 39 to 43, wherein the composition comprises 1 mg/ml_ of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 5.5% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/ml_, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises 1 mg/ml_ of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8
  • Item 47 The pharmaceutical composition of any one of items 1 to 7, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles, Tris buffer and sucrose.
  • Item 48 The pharmaceutical composition of any one of items 1 to 7 or 47, wherein the
  • composition comprises 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • Item 49 The pharmaceutical composition of any one of items 1 to 7 or 47 to 48, wherein the composition comprises 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-50 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • Item 50 The pharmaceutical composition of any one of items 1 to 7 or 47 to 49, wherein the composition comprises 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • the composition comprises 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically
  • Item 51 The pharmaceutical composition of any one of items 1 to 7 or 47 to 50, wherein the composition comprises 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)
  • Item 52 The pharmaceutical composition of any one of items 1 to 7 or 47 to 51 , wherein the composition comprises 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)prop
  • Item 53 The pharmaceutical composition of any one of items 1 to 7 or 47 to 52, wherein the composition comprises 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, and wherein the composition has a pH in the range of 7.0 to 8.0.
  • the composition comprises 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)prop
  • Item 54 The pharmaceutical composition of any one of claims 1 to 8 or 39 to 53, wherein the (w/w) ratio of the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, to the weight of aluminum in the suspension of aluminum-containing particles is in the range from 1 :1 to :20.
  • Item 55 The pharmaceutical composition of any one of claims 1 to 8 or 39 to 53, wherein the (w/w) ratio of the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, to the weight of aluminum in the suspension of aluminum-containing particles is in the range from 1 :1 .5 to 1 :2.5.
  • Item 56 The pharmaceutical composition of any one of claims 1 to 8 or 39 to 53, wherein the (w/w) ratio of the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridm ⁇
  • Item 57 The pharmaceutical composition of any one of claims 1 to 8 or 39 to 53, wherein the (w/w) ratio of the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, to the weight of aluminum in the suspension of aluminum-containing particles is 1 :2.
  • Item 58 The pharmaceutical composition of any one of items 1 to 8 or 39 to 45, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)- 2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of 3-(5- amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to the weight of aluminum in the suspension of particles is 1 :20.
  • Item 59 The pharmaceutical composition of any one of items 1 to 8 or 39 to 45, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)- 2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of 3-(5- amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to the weight of aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range of
  • Item 60 The pharmaceutical composition of any one of items 1 to 8 or 39 to 45, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)- 2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5 (w/v) mannitol, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to the weight of aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range of
  • Item 61 The pharmaceutical composition of any one of items 1 to 8 or 39 to 45, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)- 2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25 (w/v) mannitol, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to the weight of aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range
  • Item 62 The pharmaceutical composition of any one of items 1 to 8 or 39 to 45, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)- 2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 5.5 (w/v) mannitol, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to the weight of aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range of
  • Item 63 The pharmaceutical composition of any one of items 1 to 7 or 47 to 53, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)- 2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of 3-(5- amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to the weight of aluminum in the suspension of particles is 1 :20.
  • Item 64 The pharmaceutical composition of any one of items 1 to 7 or 47 to 53, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)- 2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to the weight of aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range of 7.0
  • Item 65 The pharmaceutical composition of any one of items 1 to 7 or 47 to 53, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)- 2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5 (w/v) sucrose, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to the weight of aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range of 7.0 to
  • Item 66 The pharmaceutical composition of any one of items 1 to 7 or 47 to 53, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)- 2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25 (w/v) sucrose, and a suspension of aluminum hydroxide particles, and wherein the (w/w) ratio of the weight of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to the weight of aluminum in the suspension of particles is 1 :2 and the composition has a pH in the range of 7.0 to
  • Item 67 The pharmaceutical composition of any one of items 1 to 66 further comprising an additional therapeutic agent.
  • Item 68 The pharmaceutical composition of item 67, wherein the additional therapeutic agents is a checkpoint inhibitor, a TLR9 agonist, a TLR8 agonist, a TLR7 agonist, a STING agonist or a chemotherapeutic agent.
  • the additional therapeutic agents is a checkpoint inhibitor, a TLR9 agonist, a TLR8 agonist, a TLR7 agonist, a STING agonist or a chemotherapeutic agent.
  • Item 69 A pharmaceutical combination comprising a first pharmaceutical composition of any one of items 1 to 66, and a second pharmaceutical composition comprising a checkpoint inhibitor, a TLR9 agonist, a TLR8 agonist, a TLR7 agonist, a STING agonist or a chemotherapeutic agent.
  • Item 70 A pharmaceutical combination comprising a first pharmaceutical composition of any one of items 1 to 66, a second pharmaceutical composition comprising a checkpoint inhibitor, a TLR9 agonist, a TLR8 agonist, a TLR7 agonist, a STING agonist or a chemotherapeutic agent and a third pharmaceutical composition comprising a checkpoint inhibitor, a TLR9 agonist, a TLR8 agonist, a TLR7 agonist, a STING agonist or a chemotherapeutic agent
  • Item 71 A pharmaceutical combination comprising:
  • a second pharmaceutical composition comprising a checkpoint inhibitor selected from a CTLA-4 receptor inhibitor, a PD-1 receptor inhibitor, a LAG-3 receptor inhibitor, TIM- 3 receptor inhibitor, a BTLA receptor inhibitor, a KIR receptor inhibitor, a PD-L1 inhibitor or a PD-L2 inhibitor.
  • a checkpoint inhibitor selected from a CTLA-4 receptor inhibitor, a PD-1 receptor inhibitor, a LAG-3 receptor inhibitor, TIM- 3 receptor inhibitor, a BTLA receptor inhibitor, a KIR receptor inhibitor, a PD-L1 inhibitor or a PD-L2 inhibitor.
  • a pharmaceutical combination comprising:
  • a second pharmaceutical composition comprising a PD-1 receptor inhibitor.
  • a pharmaceutical combination comprising:
  • a pharmaceutical combination comprising:
  • a pharmaceutical combination comprising:
  • Item 76 A pharmaceutical combination comprising:
  • a second pharmaceutical composition comprising a checkpoint inhibitor selected from a CTLA-4 receptor inhibitor, a PD-1 receptor inhibitor, a LAG-3 receptor inhibitor, TIM- 3 receptor inhibitor, a BTLA receptor inhibitor, a KIR receptor inhibitor, a PD-L1 inhibitor or a PD-L2 inhibitor, and
  • a third pharmaceutical composition comprising a checkpoint inhibitor selected from a CTLA-4 receptor inhibitor, a PD-1 receptor inhibitor, a LAG-3 receptor inhibitor, TIM-3 receptor inhibitor, a BTLA receptor inhibitor, a KIR receptor inhibitor, a PD-L1 inhibitor or a PD-L2 inhibitor,
  • checkpoint of the third composition is different than the checkpoint inhibitor in the second composition.
  • a pharmaceutical combination comprising:
  • a third pharmaceutical composition comprising a CTLA-4 receptor inhibitor.
  • Item 78 A pharmaceutical combination comprising:
  • a third pharmaceutical composition comprising a CTLA-4 receptor inhibitor.
  • a pharmaceutical combination comprising:
  • a pharmaceutical combination comprising:
  • Item 81 A method for treating a solid tumor by administering to a subject in need thereof a pharmaceutical composition of any one of items 1 to 68, or a pharmaceutical combination of any one of items 69 to 80.
  • Item 82 A method for treating a solid tumor by administering to a subject in need thereof a pharmaceutical combination comprising:
  • a second pharmaceutical composition comprising a checkpoint inhibitor selected from a CTLA-4 receptor inhibitor, a PD-1 receptor inhibitor, a LAG-3 receptor inhibitor, TIM- 3 receptor inhibitor, a BTLA receptor inhibitor, a KIR receptor inhibitor, a PD-L1 inhibitor or a PD-L2 inhibitor, and
  • a third pharmaceutical composition comprising a checkpoint inhibitor selected from a CTLA-4 receptor inhibitor, a PD-1 receptor inhibitor, a LAG-3 receptor inhibitor, TIM-3 receptor inhibitor, a BTLA receptor inhibitor, a KIR receptor inhibitor, a PD-L1 inhibitor or a PD-L2 inhibitor,
  • checkpoint of the third composition is different than the checkpoint inhibitor in the second composition
  • first pharmaceutical composition is administered intratumorally
  • second pharmaceutical composition and the third pharmaceutical composition are administered intratumorally, intramuscularly, intradermal ⁇ , subcutaneously, intravenously, by intraperitoneal injection, by lavage or by infusion.
  • Item 83 A method for treating a solid tumor by administering to a subject in need thereof a pharmaceutical combination comprising:
  • a second pharmaceutical composition comprising a checkpoint inhibitor selected from a CTLA-4 receptor inhibitor, a PD-1 receptor inhibitor, a LAG-3 receptor inhibitor, TIM- 3 receptor inhibitor, a BTLA receptor inhibitor, a KIR receptor inhibitor, a PD-L1 inhibitor or a PD-L2 inhibitor,
  • first pharmaceutical composition is administered intratumorally
  • second pharmaceutical composition is administered intratumorally, intramuscularly, intradermal ⁇ , subcutaneously, intravenously, by intraperitoneal injection, by lavage or by infusion.
  • Item 84 The method of any one of items 81 to 33, wherein the solid tumor is head and neck squamous cell carcinoma (HNSCC), melanoma or a visceral tumor.
  • HNSCC head and neck squamous cell carcinoma
  • melanoma a visceral tumor.
  • Item 85 Use of a pharmaceutical composition of any one of items 1 to 68, or use a
  • HNSCC human carcinoma
  • melanoma a visceral tumor
  • Item 87 A pharmaceutical composition of any one of items 1 to 68, or a pharmaceutical
  • Item 88 The pharmaceutical composition of item 87, wherein the solid tumor is head and neck squamous cell carcinoma (HNSCC), melanoma or a visceral tumor.
  • HNSCC head and neck squamous cell carcinoma
  • Item 89 A lyophilisate comprising a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients:
  • R 2 is -L2R 4 , -L2R 6 , -L2L3L2R 6 , -L2L3R 4 , -L2L3L2R 4 , -OL2R 4 , -OR 4 , -OL2R 6 , -OL2L3R 6 , -
  • each R 3 is independently selected from H and fluoro
  • R 4 is -P(0)(OH) 2 .
  • R 5 is -CF 2 P(0)(OH) 2 or -C(0)OH ;
  • R 6 is -CF 2 P(0)(OH) 2 or -C(0)OH ;
  • Li is Ci-C 6 alkylene, C 2 -C 6 alkenylene or -((CR 4 R 4 )pO)q(CH 2 ) P -, wherein the Ci-C 6 alkylene and C 2 -C 6 alkenylene of Li are substituted with 0 to 4 fluoro groups;
  • each l_2 is independently selected from Ci-C 6 alkylene and -((CR 3 R 3 )pO)q(CH 2 ) P -,
  • Ci-C6alkylene of L 2 is substituted with 0 to 4 fluoro groups
  • L 3 is arylene or a 5-6 membered heteroarylene
  • each p is independently selected from 1 , 2, 3, 4, 5 and 6, and
  • q is 1 , 2, 3 or 4.
  • Item 90 The lyophilisate of item 89, wherein the compound is 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid.
  • Item 91 A lyophilisate prepared from a solution having a pH between 6.5 and 9.0 and
  • R 2 is -L2R 4 , -L2R 6 , -L2L3L2R 6 , -L2L3R 4 , -L2L3L2R 4 , -OL2R 4 , -OR 4 , -OL2R 6 , -OL2L3R 6 , - OL2L3L2R 6 , -OL2L3R 4 -OL2L3L2R 4 or -OCH3; each R 3 is independently selected from H and fluoro;
  • R 4 is -P(0)(OH) 2 .
  • R 5 is -CF 2 P(0)(OH) 2 or -C(0)OH ;
  • R 6 is -CF 2 P(0)(OH) 2 or -C(0)OH ;
  • Li is Ci-C 6 alkylene, C 2 -C 6 alkenylene or -((CR 4 R 4 ) p O) q (CH 2 ) p -, wherein the Ci-C 6 alkylene and C 2 -C 6 alkenylene of Li are substituted with 0 to 4 fluoro groups;
  • each L 2 is independently selected from Ci-C 6 alkylene and -((CR 3 R 3 ) p O) q (CH 2 ) p -,
  • Ci-C6alkylene of L 2 is substituted with 0 to 4 fluoro groups;
  • L 3 is arylene or a 5-6 membered heteroarylene;
  • each p is independently selected from 1 , 2, 3, 4, 5 and 6, and
  • q is 1 , 2, 3 or 4.
  • Item 92 The lyophilisate of Item 91 , wherein the compound is 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid.
  • Item 93 A pharmaceutical composition prepared by reconstituting a lyophilisate of any one of items 89 to 92 with water and admixing with a suspension of aluminum-containing particles.
  • Item 94 The pharmaceutical composition of item 93 prepared by reconstituting a lyophilisate of any one of items 89 to 92 with water and admixing with a suspension of aluminum- containing particles having an aluminum content of 1 to 4 mg/ml_.
  • Item 95 The pharmaceutical composition of items 93 to 94, wherein the aluminum-containing particles are aluminum hydroxide particles.
  • FIG. 1 Plasma concentration-time profiles of Compound 15 in a MC38 tumor bearing
  • Figure 2 A) Plasma TNFa levels in a MC38 tumor bearing C57/BL6 mice following a single intratumoral (i.t.) or subcutaneous (sc) injection of Compound 15 adsorbed to aluminum hydroxide at 1 :1 .5, w/w ratio.
  • Figure 3 A) Plasma TNFa levels in a MC38 tumor bearing C57/BL6 mice following a single intratumoral (i.t.) or subcutaneous (sc) injection of Compound 15 adsorbed to aluminum hydroxide at 1 :2, w/w ratio.
  • FIG. 4 Plasma concentration-time profiles of Compound 15 in male Wistar rats following a single subcutaneous (sc) injection of 600 ⁇ g free Compound 15 in 100 mM Tris buffer (pH 7.4), a single subcutaneous (sc) injection of 600 ⁇ g free Compound 15 adsorbed to aluminum hydroxide in 100 mM Tris buffer (pH 7.4) at 1 :2.5, w/w ratio, (97% bound), a single subcutaneous (sc) injection of 200 ⁇ g free Compound 15 adsorbed to aluminum hydroxide in 100 mM Tris buffer (pH 7.4) at 1 :2.5, w/w ratio, (94% bound) and a single subcutaneous (sc) injection of 50 ⁇ g free Compound 15 in 100 mM Tris buffer (pH 7.4) adsorbed to aluminum hydroxide at 1 :2.5, w/w ratio, (91 % bound).
  • Figure 5 A) Plasma concentration-time profiles of Compound 15 in male Wistar rats following a single subcutaneous injection for 600 ⁇ g of Compound 15 in 100 mM Tris buffer (pH 7.4), a single subcutaneous injection of 600 ⁇ g of Compound 15 adsorbed to aluminum hydroxide in 100 mM Tris buffer buffer (pH 7.4) at 1 :1 .7, w/w ratio, (98% bound) and a single subcutaneous injection of 50 ⁇ g of Compound 15 adsorbed to aluminum hydroxide in 100 mM Tris buffer buffer (pH 7.4) at 1 :20, w/w ratio, (98% bound)
  • Figure 7 Aluminum serum concentration vs. time profile after subcutaneous administration of
  • Figure 8 Efficacy and dose response in A20 mouse lymphoma model following 2 weekly intra tumoral (i.t.) injections of different doses of Compound 15/aluminum hydroxide (at fixed ratio of 1 :1 .5, w/w, and 97% bound).
  • Compound 15/aluminum hydroxide at Compound 15 to aluminum hydroxide w/w ratios of 1 :1 .5, 1 :1 and 1 :0.5.
  • Figurel 0 A) Efficacy at the intratumor injection site following adminstration of Compound
  • Compound 15/aluminum hydroxide with anti PD-L1 was significantly different, ( **** p ⁇ 0.0001 ) .
  • Compound 15/aluminum hydroxide with anti CTLA4 was significantly different, ( * p ⁇ 0.05).
  • Compound 15/aluminum hydroxide with anti PD-L1 and antiCTLA4 was significantly different, ( **** p ⁇ 0.0001 ).
  • Compound 15 or Compound 15/aluminum hydroxide as single agents or after the administration of the combination of an anti-PDL1 antibody and an anti-CTLA4 antibody or after the administration of the triple combinations of Compound 15 and an anti-PDL1 antibody and an anti-CTLA4 antibody or after administration of the triple combinations of Compound 15/aluminum hydroxide and an anti-PDL1 antibody and an anti-CTLA4 antibody.
  • alkenyl or “alkene,” as used herein, refers to a partially unsaturated branched or straight chain hydrocarbon having at least one carbon-carbon double bond. Atoms oriented about the double bond are in either the cis (Z) or trans (E) conformation.
  • alkenyl or alkene group are optionally substituted.
  • the terms "C 2 - C 3 alkenyl”, “C 2 -C 4 alkenyl”, “C 2 -C 5 alkenyl”, “C 2 -C 6 alkenyl”, “C 2 -C 7 alkenyl”, and “C 2 -C 8 alkenyl” refer to an alkenyl group containing at least 2, and at most 3, 4, 5, 6, 7 or 8 carbon atoms, respectively.
  • an alkenyl group generally is a C 2 -C6 alkenyl.
  • Non- limiting examples of alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl and the like.
  • alkenylene refers to a partially unsaturated branched or straight chain divalent hydrocarbon radical derived from an alkenyl group. In certain embodiments, such alkenylene group are optionally substituted.
  • C 2 -C 3 alkenylene, “C 2 - C 4 alkenylene”, “C 2 -C 5 alkenylene”, “C 2 -C 6 alkenylene”, “C 2 -C 7 alkenylene”, and "C 2 -C 8 alkenylene” refer to an alkenylene group containing at least 2, and at most 3, 4, 5, 6, 7 or 8 carbon atoms respectively.
  • an alkenylene group generally is a C 2 -C6 alkenylene.
  • alkenylene groups as used herein include, ethenylene, propenylene, butenylene, pentenylene, hexenylene, heptenylene, octenylene, nonenylene, decenylene and the like.
  • alkyl refers to a saturated branched or straight chain hydrocarbon.
  • the terms "Ci-C 3 alkyl”, “Ci-C 4 alkyl”, “Ci-C 5 alkyl”, “Ci-C 6 alkyl”, “Ci-C 7 alkyl” and “Ci-Csalkyl” refer to an alkyl group containing at least 1 , and at most 3, 4, 5, 6, 7 or 8 carbon atoms, respectively.
  • an alkyl group generally is a Ci -C 6 alkyl.
  • Non- limiting examples of alkyl groups as used herein include methyl, ethyl, n-propyl, isopropyl, n- butyl, isobutyl, sec-butyl, t-butyl, n-pentyl, isopentyl, hexyl, heptyl, octyl, nonyl, decyl and the like.
  • alkylene refers to a saturated branched or straight chain divalent hydrocarbon radical derived from an alkyl group. In certain embodiments such alkylene groups are optionally substituted.
  • the terms "Ci-C3alkylene”, “Ci-C4alkylene”, “Ci-C 5 alkylene”, “Ci-C 6 alkylene”, “Ci-C 7 alkylene” and “Ci-C 8 alkylene” refer to an alkylene group containing at least 1 , and at most 3, 4, 5, 6, 7 or 8 carbon atoms respectively.
  • an alkylene group generally is a Ci-C 6 alkylene.
  • Non-limiting examples of alkylene groups as used herein include, methylene, ethylene, n-propylene, isopropylene, n- butylene, isobutylene, sec-butylene, t-butylene, n-pentylene, isopentylene, hexylene and the like.
  • aryl refers to phenyl or naphthalene.
  • arylene as used herein means a divalent radical derived from an aryl group.
  • an arylene group is a phenylene.
  • 5-6 membered heteroaryl refers to a monocyclic aromatic ring structure having 5 or 6 ring members, wherein 1 to 3 ring members are independently selected from the heteroatoms N, O and S.
  • Non-limiting examples of 5-6 membered heteroaryls include 2- or 3-furyl ; 2- or 3-thienyl; 1 -, 2- or 3-pyrrolyl; 2-, 4-, or 5-oxazolyl ; 2-, 4-, or 5-thiazolyl; 1 -, 2-,
  • heteroatoms refers to nitrogen (N), oxygen (O) or sulfur (S) atoms.
  • 5-6 membered heteroarylene means a divalent radical derived from a 5-6 membered heteroaryl group.
  • liquid tumor refers to cancers which affect bone marrow, blood cells and the lymphatic system.
  • An example of a liquid tumor is leukemia.
  • solid tumor refers to an abnormal mass of tissue that usually does not contain cysts or liquid areas.
  • the term refers to cancerous (malignant) tumors, although a solid tumor may be a non-cancerous (benign) tumor.
  • solid tumors are sarcomas, carcinomas, and lymphomas, which include, but are not limited to, a breast cancer tumor, a bladder cancer tumor, a head and neck cancer tumor (e.g. head and neck squamous cell carcinoma (HNSCC)), a non-small cell lung cancer tumor, a small cell lung cancer tumor, a colorectal cancer tumor, a gastrointestinal stromal tumor, a
  • HNSCC head and neck squamous cell carcinoma
  • gastroesophageal carcinoma a renal cell cancer tumor, a prostate cancer tumor, a liver cancer tumor, a colon cancer tumor, a pancreatic cancer tumor, an ovarian cancer tumor, a lymphoma, a cutaneous T -cell lymphoma, visceral tumors or a melanoma.
  • ком ⁇ онент or “pharmaceutical combination,” as used herein mean a product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients.
  • fixed combination means that the active ingredients, by way of example, a compound disclosed herein and one or more additional therapeutic agent are administered to a subject simultaneously in the form of a single entity or dosage.
  • non-fixed combination means that the active ingredients, by way of example, a compound disclosed herein and one or more additional therapeutic agent, are administered to a subject as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the active ingredients in the body of the subject.
  • cocktail therapy e.g. the administration of 3 or more active ingredients.
  • composition refers to a mixture of a compound disclosed herein with at least one and optionally more than one other pharmaceutically acceptable chemical components, such as carriers, stabilizers, diluents, dispersing agents, suspending agents, thickening agents, and/or excipients.
  • pharmaceutically acceptable chemical components such as carriers, stabilizers, diluents, dispersing agents, suspending agents, thickening agents, and/or excipients.
  • an optical isomer or "a stereoisomer”, as used herein, refers to any of the various stereo isomeric configurations which may exist for a given compound of the present invention and includes geometric isomers. It is understood that a substituent may be attached at a chiral center of a carbon atom.
  • the term “chiral” refers to molecules which have the property of non- superimposability on their mirror image partner, while the term “achiral” refers to molecules which are superimposable on their mirror image partner. Therefore, the invention includes enantiomers, diastereomers or racemates of the compound. "Enantiomers” are a pair of stereoisomers that are non- superimposable mirror images of each other.
  • a 1 :1 mixture of a pair of enantiomers is a "racemic" mixture.
  • the term is used to designate a racemic mixture where appropriate.
  • "Diastereoisomers” are stereoisomers that have at least two asymmetric atoms, but which are not mirror-images of each other. The absolute stereochemistry is specified according to the Cahn- Ingold- Prelog R-S system. When a compound is a pure enantiomer the stereochemistry at each chiral carbon may be specified by either R or S.
  • Resolved compounds whose absolute configuration is unknown can be designated (+) or (-) depending on the direction (dextro- or levorotatory) which they rotate plane polarized light at the wavelength of the sodium D line.
  • Certain compounds described herein contain one or more asymmetric centers or axes and may thus give rise to enantiomers, diastereomers, and other stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)-.
  • pharmaceutically acceptable salt refers to a salt which does not abrogate the biological activity and properties of the compounds disclosed herein, and does not cause significant irritation to a subject to which it is administered.
  • subject encompasses mammals and non-mammals.
  • mammals include, but are not limited to, humans, chimpanzees, apes, monkeys, cattle, horses, sheep, goats, swine; rabbits, dogs, cats, rats, mice, guinea pigs, and the like.
  • non-mammals include, but are not limited to, birds, fish and the like. Frequently the subject is a human.
  • a subject in need of such treatment refers to a subject which would benefit biologically, medically or in quality of life from such treatment.
  • terapéuticaally effective amount refers to an amount which may increase the immune response, ameliorate at least one symptom or clinical sign of a tumor and/or decrease the number and/or size of metastases.
  • Ameliorating at least one symptom or clinical sign of a tumor can include a decrease in the size of a tumor, stabilization in the size or growth of a tumor, a reduction in the rate of growth of a tumor, an increase in tumor necrosis, a change in the tumor structure such as disintegration, a change in a biochemical marker associated with decrease in tumor establishment, a decrease in tumor progression or a decrease in tumor survival.
  • An increase in immune response refers to an increase in at least one cell-mediated immune response of a cell population that includes cells of a tumor refers to an increase in at least one biochemical, histological, or immunological marker associated with improvement of the immunological profile of the tumor microenvironment.
  • Markers in which an increase in the amount of the marker is associated with an improvement of the immunological profile of the tumor microenvironment include, but are not limited to, interferon-alpha; interferon- gamma; interferon inducible proteins; Interferon gamma-induced protein 10 (IP-10) ; TNF-alpha; chemokines such as CCL2, CCL3, CCL4, CXCL2; activated T-cells; activated B-cells; activated NK-cells; tumor specific T-cells, activated tumor associated macrophages; chemokine receptors such as CCR6; or tumor associated lymphoid aggregates.
  • interferon-alpha interferon-gamma
  • interferon inducible proteins Interferon gamma-induced protein 10 (IP-10)
  • IP-10 Interferon gamma-induced protein 10
  • TNF-alpha Interferon gamma-induced protein 10
  • chemokines such as CCL2, CCL3, CCL4, CX
  • Markers associated with a tumor microenvironment can be determined, for example, by analysis of a biopsy (for example needle biopsy) from the tumor, the localized tumor region, or a tumor draining lymph node. Analysis for the markers can be done using standard techniques such as by histology (HNE stain), flow cytometry, gene expression assays (quantitative PCR), immunochemistry techniques, as well as other techniques commonly known to those of ordinary skill in the art.
  • a biopsy for example needle biopsy
  • Analysis for the markers can be done using standard techniques such as by histology (HNE stain), flow cytometry, gene expression assays (quantitative PCR), immunochemistry techniques, as well as other techniques commonly known to those of ordinary skill in the art.
  • TLR7 agonist refers to a compound which targets or activates the biological activity of Toll-like Receptor 7 (TLR7).
  • TLR7 agonist can be a compound that activates TLR7 with an EC 5 o of less than 5 ⁇ , measured by the reporter gene assay described herein, wherein Human embryonic kidney 293 (HEK 293) cells were stably transfected with human TLR7.
  • the "TLR7 agonist” is a compound that activates TLR7 with an EC 5 o of less than 1 ⁇ , measured by the reporter gene assay described herein, wherein Human embryonic kidney 293 (HEK 293) cells were stably transfected with human TLR7.
  • the TLR7 agonists can be for example any compound described in WO201 1/049677 and the exemplary compounds described herein.
  • treat comprises a treatment relieving, reducing or alleviating at least one symptom in a subject or effecting a delay of progression of a disease.
  • treatment can be the diminishment of one or several symptoms of a disorder or complete eradication of a disorder, such as cancer.
  • the term “treat” also denotes to arrest, delay the onset (i.e., the period prior to clinical manifestation of a disease) and/or reduce the risk of developing or worsening a disease.
  • protect is used herein to mean prevent delay or treat, or all, as appropriate, development or continuance or aggravation of a disease in a subject, e.g., a mammal or human.
  • prevent comprises the prevention of at least one symptom associated with or caused by the state, disease or disorder being prevented.
  • compositions comprising a TLR7 agonist, or a pharmaceutically acceptable salt thereof, one or more pharmaceutically acceptable excipients and aluminum-containing particles.
  • the pharmaceutical compositions are liquid compositions.
  • such liquid compositions are suspensions, while in other embodiments such liquid compositions are solutions.
  • these pharmaceutical compositions are solid compositions.
  • such solid compositions are lyophilisates, while in other embodiments such solid compositions are spray dried powders.
  • compositions comprising a TLR7 agonist, or a pharmaceutically acceptable salt thereof, one or more pharmaceutically acceptable excipients and a suspension of aluminum-containing particles.
  • compositions comprising a TLR7 agonist and one or more pharmaceutically acceptable excipients.
  • these pharmaceutical compositions are solid compositions.
  • such solid compositions are lyophilisates, while in other embodiments such solid compositions are spray dried powders.
  • compositions of the invention comprise a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof:
  • R 2 is -L 2 R 4 , -L 2 R 6 , -L 2 L 3 L 2 R 6 , -L 2 L 3 R 4 , -L 2 L 3 L 2 R 4 , -OUR 4 , -OR 4 , -OUR 6 , -OUUR 6 , -
  • each R 3 is independently selected from H and fluoro
  • R 4 is -P(0)(OH) 2 .
  • R 5 is -CF 2 P(0)(OH) 2 or -C(0)OH ;
  • R 6 is -CF 2 P(0)(OH) 2 or -C(0)OH ;
  • Li is Ci-C 6 alkylene, C 2 -C 6 alkenylene or -((CR 4 R 4 ) p O) q (CH 2 ) p -, wherein the Ci-C 6 alkylene and C 2 -C6alkenylene of U are substituted with 0 to 4 fluoro groups;
  • each U is independently selected from Ci-C 6 alkylene and -((CR 3 R 3 ) p O) q (CH 2 ) p -,
  • Ci-C 6 alkylene of U is substituted with 0 to 4 fluoro groups;
  • L 3 is arylene or a 5-6 membered heteroarylene;
  • each p is independently selected from 1 , 2, 3, 4, 5 and 6, and
  • q is 1 , 2, 3 or 4.
  • compounds of Formula (A) are prepared as a pharmaceutically acceptable base addition salt.
  • Pharmaceutically acceptable base addition salts of compounds of Formula (A) include, but are not limited to, sodium, potassium, ammonium, calcium, magnesium, iron, silver, zinc, copper, isopropylamine, benzathine, cholinate, diethanolamine, diethylamine, lysine, arginine, meglumine, piperazine or tromethamine salt forms.
  • compositions of the invention are injectable compositions which comprise a compound of Formula (A), or a pharmaceutically acceptable salt thereof, aluminum- containing particles and one or more pharmaceutically acceptable excipients.
  • the compound of Formula (A), or a pharmaceutically acceptable salt thereof, included in the pharmaceutical compositions of the invention are present in a therapeutically effective amount.
  • the pharmaceutically acceptable excipients included in the pharmaceutical compositions of the invention include, but are not limited to, bulking agents, lyoprotectants, buffering agent, tonicity modifier, isotonic agents, antioxidants, antimicrobial agents, antibacterial agents, antifungal agents, solubilizing agents, surfactants and wetting agents.
  • compositions of the invention also comprise water as the pharmaceutically and physiologically acceptable injectable fluid vehicle.
  • bulking agents are included in a lyophilized product to provide bulk and structure to the lyophilzed powder, which aids in dissolution of the active agent.
  • Lyoprotectants help to stabilize and prevent the degradation of the active agent during freeze-drying and storage.
  • the bulking agents and lyoprotectants which may be included in the pharmaceutical compositions of the invention incude, but are no limited to, sucrose, lactose, trehalose, mannitol, sorbitol, raffinose, glycine, histidine, polyethylene glycol and low molecular weight polyvinyl
  • pyrrrollidones i.e. Povidone K12 and Povidone K17.
  • Buffering agents are included into pharmaceutical compositions to adjust and stabilize pH and optimize active agent solubility and stability. Buffering agents are also used in the pharmaceutical compositions of the invention to ensure that the phosponic acid groups of the compounds of Formula (A) are ionized (e.g. in the pH range of 7-9).
  • the buffering agents which may be included in the pharmaceutical compositions of the invention incude, but are no limited to, Tris, glycine, meglumine, histidine and citrate/citric acid.
  • Tonicity modifiers and isotonic agents are included into pharmaceutical compositions to maintain ensure the formulation is isotonic with human plasma.
  • the tonicity modifiers and isotonic agents which may be included in the pharmaceutical compositions of the invention incude, but are no limited to, dextrose, glycerol, sodium chloride, glycerin and mannitol.
  • Antioxidants are used to prevent/minimize the any oxidation of active agent or excipeints during storage, whereas antimicrobial agents are used to prevent the growth of microorganisms.
  • the antioxidants which may be included in the pharmaceutical compositions of the invention incude, but are no limited to, ascorbic acid, acetylcysteine, sulfurous acid salts (bisulfite, metabisulfite), monothioglyercol, butylated hydroxy toluene (BHT), butylated hydroxyanisole (BHA) and thiourea.
  • antimicrobial agents which may be included in the pharmaceutical compositions of the invention incude, but are no limited to, phenol, meta-cresol, benzyl alcohol, parabens methyl, propyl, butyl), benzalkonium chloride, chlorobutanol, thimerosal, and phenylmercuric salts (acetate, borate, nitrate).
  • Solubilizing agents which can be broadly classified into surfactants and co-solvents, help in dissolving or increasing the active agent solubility into the formulation.
  • the surfactants which may be included in the pharmaceutical compositions of the invention incude, but are no limited to, polyoxyethylene sorbitan monooleate (Tween 80), sorbitan monooleate polyoxyethylene sorbitan monolaurate (Tween 20), lecithin, polyoxyethylene-polyoxypropylene copolymers
  • Surfactants may also act as wetting agents and the surfactant/wetting agents which may be included in the pharmaceutical compositions of the invention incude, but are no limited to, lecithin, Polysorbate 20, Polysorbate 80, Pluronic F-68 and Sorbitan trioleate (span 85).
  • compositions of the invention can be prepared using processes which include admixing a compound of Formula (A), or a pharmaceutically acceptable salts thereof, with one or more pharmaceutically acceptable excipients and water.
  • the pharmaceutical compositions of the invention can be prepared by admixing a reconstituted lyophilisate (reconstituted with water) with a solution comprising an aluminum-containing particles, wherein the lyophilisate comprises a compound of Formula (A), or a pharmaceutically acceptable salts thereof, a buffering agent (pH 7.0 to 8.0), a bulking agent and a lyoprotectant.
  • compositions of the invention can be prepared by admixing a reconstituted lyophilisate (reconstituted with water) with a solution comprising an aluminum-containing particles, wherein the lyophilisate comprises a compound of Formula (A), or a pharmaceutically acceptable salts thereof, a buffering agent (pH 7.0 to 8.0), a bulking agent, a lyoprotectant, a surfactant and a wetting agent.
  • a buffering agent pH 7.0 to 8.0
  • the particles that comprise aluminum included in the pharmaceutical composition or lyophilisate of the invention include, but are not limited to, aluminum hydroxide, aluminum oxyhydroxide and aluminum hydroxyphosphate.
  • Compounds of Formula (A) can bind to such particles, such as, by way of example only, aluminum hydroxide, aluminum oxyhydroxide and aluminum hydroxyphosphate.
  • Aluminum-containing particles have been used in vaccines to bind an antigen. A discussion of aluminum-containing particles and their uses in vaccines is given in Expert Rev. Vaccines, 46(5), 2007, 685-698 and Vaccines, 25, 2007, 6618-6624.
  • compositions of the invention are provided in the following listing of enumerated embodiments. It will be recognized that features specified in each embodiment may be combined with other specified features to provide further embodiments of the present invention.
  • Embodiment 1 A pharmaceutical composition comprising a TLR7 agonist having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients, wherein the compound of Formula (A) is selected from any one of the compounds of Table 1 :
  • Embodiment 2 A pharmaceutical composition comprising a TLR7 agonist having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, aluminum-containing particles, and one or more pharmaceutically acceptable excipients, wherein the TLR7 agonist a compound selected from any one of the compounds of Table 1 .
  • Embodiment 3 A pharmaceutical composition comprising a TLR7 agonist having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, aluminum-containing particles, and one or more pharmaceutically acceptable excipients, wherein the TLR7 agonist is
  • Embodiment 4 A pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles and one or more pharmaceutically acceptable excipients.
  • Embodiment 5 A lyophilisate comprising a TLR7 agonist having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, aluminum-containing particles, and one or more pharmaceutically acceptable excipients, wherein the TLR7 agonist is a compound selected from any one of the compounds of Table 1 .
  • Embodiment 6 A lyophilisate comprising a TLR7 agonist having the structure of Formula
  • Embodiment 7 A lyophilisate comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles, and one or more pharmaceutically acceptable excipients.
  • Embodiment 8 A lyophilisate comprising a TLR7 agonist having the structure of Formula (A), or a pharmaceutically acceptable salt thereof and one or more pharmaceutically acceptable excipients, wherein the TLR7 agonist is 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid.
  • Embodiment 9 A lyophilisate comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof and one or more pharmaceutically acceptable excipients.
  • Embodiment 10 A pharmaceutical composition comprising a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, a suspension of aluminum-containing particles, and one or more pharmaceutically acceptable excipients.
  • Embodiment 1 1 A pharmaceutical composition comprising a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, a suspension of aluminum-containing particles, and a buffering agent.
  • Embodiment 12 A pharmaceutical composition comprising a compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, a suspension of aluminum-containing particles, a buffering agent, and one or more pharmaceutically acceptable excipients.
  • Embodiment 13 A pharmaceutical composition comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, a suspension of aluminum-containing particles, and a buffering agent, wherein the composition has a pH in the range of 6.5 to 9.0.
  • Embodiment 14 A pharmaceutical composition comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, a suspension of aluminum-containing particles, a buffering agent, and one or more pharmaceutically acceptable excipients, wherein the composition has a pH in the range of 6.5 to 9.0.
  • Embodiment 15 A pharmaceutical composition comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, a suspension of aluminum-containing particles, and a buffering agent, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 16 A pharmaceutical composition comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, a suspension of aluminum-containing particles, a buffering agent, and one or more pharmaceutically acceptable excipients, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 17 A pharmaceutical composition comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, a suspension of aluminum-containing particles, a buffering agent, and sucrose, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 18 A pharmaceutical composition comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, a suspension of aluminum-containing particles, a buffering agent, and mannitol, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 19 A pharmaceutical composition comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles, and Tris buffer, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 20 A pharmaceutical composition comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles, Tris buffer, and sucrose, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 21 A pharmaceutical composition comprising 0.5 to 2 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0
  • Embodiment 22 A pharmaceutical composition comprising 0.5 to 2 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-50 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 23 A pharmaceutical composition comprising 0.5 to 2 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 24 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 25 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 26 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 27 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH of 7.5 +/- 0.5.
  • Embodiment 28 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH of 7.5 +/- 0.5.
  • Embodiment 29 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH of 7.5 +/- 0.3.
  • Embodiment 30 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH of 7.5 +/- 0.3.
  • Embodiment 31 A pharmaceutical composition comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles, Tris buffer, and mannitol, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 32 A pharmaceutical composition comprising 0.5 to 2 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0
  • Embodiment 33 A pharmaceutical composition comprising 0.5 to 2 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-50 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/ml_, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 34 A pharmaceutical composition comprising 0.5 to 2 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 35 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 36 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 37 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 38 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH of 7.5 +/- 0.5.
  • Embodiment 39 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH of 7.5 +/- 0.5.
  • Embodiment 40 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH of 7.5 +/- 0.3.
  • Embodiment 41 A pharmaceutical composition comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH of 7.5 +/- 0.3.
  • Embodiment 42 The pharmaceutical composition of any one of Embodiments 10 to 41 , wherein the compound of Formula (A) is a compound selected from any one of the compounds of Table 1 , or a pharmaceutically acceptable salt thereof.
  • Embodiment 43 The pharmaceutical composition of any one of Embodiments 10 to 42, wherein the compound of Formula (A) is 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid or 3-(5-amino-2-(2-methyl-4-(2-(2-(2-(2- phosphonoethoxy)ethoxy)ethoxy)phenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof.
  • the compound of Formula (A) is 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]
  • Embodiment 44 The pharmaceutical composition of any one of Embodiments 10 to 42, wherein the compound of Formula (A) is 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof.
  • Embodiment 45 The pharmaceutical composition of any one of Embodiments 10 to 42, wherein the compound of Formula (A) is 3-(5-amino-2-(2-methyl-4-(2-(2-(2-(2- phosphonoethoxy)ethoxy)ethoxy)phenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof.
  • Embodiment 46 The pharmaceutical composition of any one of Embodiments 10 to 45, wherein the compound of Formula (A) is present in a therapeutically effective amount.
  • Embodiment 47 The pharmaceutical composition of any one of Embodiments 10 to 46, wherein the composition further compises polyethylene glycol, polyoxyethylene sorbitan monooleate (Tween 80) or Pluronic F-68.
  • Embodiment 48 The pharmaceutical composition of any one of Embodiments 10 to 46, wherein the composition further compises 1 -2% of polyethylene glycol, polyoxyethylene sorbitan monooleate (Tween 80) or Pluronic F-68.
  • Embodiment 49 A pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, one or more pharmaceutically acceptable excipients and a suspension of aluminum-containing particles.
  • Embodiment 50 A pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent and a suspension of aluminum-containing particles.
  • Embodiment 51 A pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent, one or more pharmaceutically acceptable excipients and a suspension of aluminum-containing particles.
  • Embodiment 52 A pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent and a suspension of aluminum-containing particles, wherein the composition has a pH in the range of 6.5 to 9.0.
  • Embodiment 53 Embodiment 53.
  • a pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent, one or more pharmaceutically acceptable excipients and a suspension of aluminum-containing particles, wherein the composition has a pH in the range of 6.5 to 9.0.
  • Embodiment 54 A pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent and a suspension of aluminum-containing particles, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 55 A pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent, one or more pharmaceutically acceptable excipients and a suspension of aluminum-containing particles, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 56 A pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent, sucrose and a suspension of aluminum-containing particles, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 57 A pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent, mannitol and a suspension of aluminum-containing particles, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 58 A pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, Tris buffer, and a suspension of aluminum hydroxide particles.
  • Embodiment 59 A pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, Tris buffer, sucrose and a suspension of aluminum hydroxide particles, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 60 A pharmaceutical composition comprising 0.5 to 2 mg/mL of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin- 8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0
  • Embodiment 61 A pharmaceutical composition comprising 0.5 to 2 mg/mL of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin- 8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-50 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 62 A pharmaceutical composition comprising 0.5 to 2 mg/mL of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin- 8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 63 A pharmaceutical composition comprising 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 64 A pharmaceutical composition comprising 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 65 A pharmaceutical composition comprising 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 66 A pharmaceutical composition comprising 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH of 7.5 +/- 0.5.
  • Embodiment 67 A pharmaceutical composition comprising 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, wherein the composition has a pH of 7.5 +/- 0.5.
  • Embodiment 68 A pharmaceutical composition comprising 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/ml_, wherein the composition has a pH of 7.5 +/- 0.3.
  • Embodiment 69 A pharmaceutical composition comprising 1 mg/ml_ of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) sucrose, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/ml_, wherein the composition has a pH of 7.5 +/- 0.3.
  • Embodiment 70 A pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, Tris buffer, mannitol and a suspension of aluminum hydroxide particles, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 71 A pharmaceutical composition comprising 0.5 to 2 mg/ml_ of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin- 8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/ml_, wherein the composition has a pH in the range of 7.0 to 8.0
  • Embodiment 72 A pharmaceutical composition comprising 0.5 to 2 mg/ml_ of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin- 8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-50 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/ml_, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 73 A pharmaceutical composition comprising 0.5 to 2 mg/ml_ of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin- 8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/ml_, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 74 A pharmaceutical composition comprising 1 mg/ml_ of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer, 5-10% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/ml_, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 75 A pharmaceutical composition comprising 1 mg/ml_ of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/ml_, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 76 Embodiment 76.
  • a pharmaceutical composition comprising 1 mg/ml_ of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/ml_, wherein the composition has a pH in the range of 7.0 to 8.0.
  • Embodiment 77 A pharmaceutical composition comprising 1 mg/ml_ of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/ml_, wherein the composition has a pH of 7.5 +/- 0.5.
  • Embodiment 78 A pharmaceutical composition comprising 1 mg/ml_ of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/ml_, wherein the composition has a pH of 7.5 +/- 0.5.
  • Embodiment 79 A pharmaceutical composition comprising 1 mg/ml_ of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer, 7.5% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/ml_, wherein the composition has a pH of 7.5 +/- 0.3.
  • Embodiment 80 A pharmaceutical composition comprising 1 mg/ml_ of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer, 8.25% (w/v) mannitol, and a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/ml_, wherein the composition has a pH of 7.5 +/- 0.3.
  • Embodiment 81 The pharmaceutical composition of any one of Embodiments 49 to 80, wherein the 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid is present in a therapeutically effective amount.
  • Embodiment 82 The pharmaceutical composition of any one of Embodiments 49 to 81 , wherein the composition further compises polyethylene glycol, polyoxyethylene sorbitan monooleate (Tween 80) or Pluronic F-68.
  • Embodiment 83 The pharmaceutical composition of any one of Embodiments 49 to 81 , wherein the composition further compises 1 -2% of polyethylene glycol, polyoxyethylene sorbitan monooleate (Tween 80) or Pluronic F-68.
  • Embodiment 84 A lyophilisate comprising a compound of Formula (A), or a
  • Embodiment 85 A lyophilisate comprising a compound of Formula (A), or a
  • Embodiment 86 A lyophilisate comprising a compound of Formula (A), or a
  • Embodiment 87 A lyophilisate comprising a compound of Formula (A), or a
  • Embodiment 88 A lyophilisate comprising a compound of Formula (A), or a
  • Embodiment 89 A lyophilisate comprising a compound of Formula (A), or a
  • Embodiment 90 A lyophilisate prepared from a solution having a pH between 6.5 and 9.0 and comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, and a buffering agent.
  • Embodiment 91 A lyophilisate prepared from a solution having a pH between 6.5 and 9.0 and comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, a buffering agent and one or more pharmaceutically acceptable excipients.
  • Embodiment 92 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, and a buffering agent.
  • Embodiment 93 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, a buffering agent and one or more pharmaceutically acceptable excipients.
  • Embodiment 94 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, a buffering agent and sucrose.
  • Embodiment 95 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, a buffering agent and mannitol.
  • Embodiment 96 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, and Tris buffer.
  • Embodiment 97 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, Tris buffer and sucrose.
  • Embodiment 98 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer and 5-10% (w/v) sucrose.
  • Embodiment 99 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-50 mM Tris buffer and 5-10% (w/v) sucrose.
  • Embodiment 100 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer and 5-10% (w/v) sucrose.
  • Embodiment 101 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer and 5-10% (w/v) sucrose.
  • Embodiment 102 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer and 7.5% (w/v) sucrose.
  • Embodiment 103 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer and 8.25% (w/v) sucrose.
  • Embodiment 104 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.5 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer and 7.5% (w/v) sucrose.
  • Embodiment 105 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.5 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer and 8.25% (w/v) sucrose.
  • Embodiment 106 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.3 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer and 7.5% (w/v) sucrose.
  • Embodiment 107 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.3 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer and 8.25% (w/v) sucrose.
  • Embodiment 108 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, Tris buffer and mannitol.
  • Embodiment 109 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer and 5-10% (w/v) mannitol.
  • Embodiment 1 10. A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-50 mM Tris buffer and 5-10% (w/v) mannitol.
  • Embodiment 1 1 1 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer and 5-10% (w/v) mannitol.
  • Embodiment 1 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer and 5-10% (w/v) mannitol.
  • Embodiment 1 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer and 7.5% (w/v) mannitol.
  • Embodiment 1 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer and 8.25% (w/v) mannitol.
  • Embodiment 1 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.5 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer and 7.5% (w/v) mannitol.
  • Embodiment 1 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.5 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer and 8.25% (w/v) mannitol.
  • Embodiment 1 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.3 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer and 7.5% (w/v) mannitol.
  • Embodiment 1 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.3 and comprising 1 mg/mL of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer and 8.25% (w/v) mannitol.
  • Embodiment 1 19. The lyophilisate of any one of Embodiments 84 to 1 18, wherein the compound of Formula (A) is a compound selected from any one of the compounds of Table 1 , or a pharmaceutically acceptable salt thereof.
  • Embodiment 120 The lyophilisate of any one of Embodiments 84 to 1 18, wherein the compound of Formula (A) is 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid or 3-(5-amino-2-(2-methyl-4-(2- (2-(2-phosphonoethoxy)ethoxy)ethoxy)phenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof.
  • the compound of Formula (A) is 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7
  • Embodiment 121 The lyophilisate of any one of Embodiments 84 to 1 18, wherein the compound of Formula (A) is 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof.
  • Embodiment 122 The lyophilisate of any one of Embodiments 84 to 1 18, wherein the compound of Formula (A) is 3-(5-amino-2-(2-methyl-4-(2-(2-(2-(2- phosphonoethoxy)ethoxy)ethoxy)phenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof.
  • Embodiment 123 Embodiment 123.
  • a lyophilisate comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients.
  • Embodiment 124 A lyophilisate comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, and a buffering agent.
  • Embodiment 125 A lyophilisate comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent and one or more pharmaceutically acceptable excipients.
  • Embodiment 126 A lyophilisate comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, and Tris buffer.
  • Embodiment 127 A lyophilisate comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, Tris buffer and sucrose.
  • Embodiment 128 A lyophilisate comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, Tris buffer and mannitol.
  • Embodiment 129 A lyophilisate prepared from a solution having a pH between 6.5 and 9.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, and a buffering agent.
  • Embodiment 130 A lyophilisate prepared from a solution having a pH between 6.5 and 9.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent and one or more pharmaceutically acceptable excipients.
  • Embodiment 131 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, and a buffering agent.
  • Embodiment 132 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent and one or more pharmaceutically acceptable excipients.
  • Embodiment 133 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent and one
  • a lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent and sucrose.
  • Embodiment 134 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a buffering agent and mannitol.
  • Embodiment 135. A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, and Tris buffer.
  • Embodiment 136 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, Tris buffer and sucrose.
  • Embodiment 137 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer and 5-10% (w/v) sucrose.
  • Embodiment 138 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-50 mM Tris buffer and 5-10% (w/v) sucrose.
  • Embodiment 139 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer and 5-10% (w/v) sucrose.
  • Embodiment 140 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer and 5-10% (w/v) sucrose.
  • Embodiment 141 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer and 7.5% (w/v) sucrose.
  • Embodiment 142 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer and 8.25% (w/v) sucrose.
  • Embodiment 143 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.5 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer and 7.5% (w/v) sucrose.
  • Embodiment 144 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.5 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer and 8.25% (w/v) sucrose.
  • Embodiment 145 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.3 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer and 7.5% (w/v) sucrose.
  • Embodiment 146 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.3 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer and 8.25% (w/v) sucrose.
  • Embodiment 147 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, Tris buffer and mannitol.
  • Embodiment 148 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-100 mM Tris buffer and 5-10% (w/v) mannitol.
  • Embodiment 149 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-50 mM Tris buffer and 5-10% (w/v) mannitol.
  • Embodiment 150 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer and 5-10% (w/v) mannitol.
  • Embodiment 151 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5-20 mM Tris buffer and 5-10% (w/v) mannitol.
  • Embodiment 152 Embodiment 152.
  • a lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer and 7.5% (w/v) mannitol.
  • Embodiment 153 A lyophilisate prepared from a solution having a pH between 7.0 and 8.0 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer and 8.25% (w/v) mannitol.
  • Embodiment 154 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.5 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer and 7.5% (w/v) mannitol.
  • Embodiment 155 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.5 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer and 8.25% (w/v) mannitol.
  • Embodiment 156 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.3 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 16 mM Tris buffer and 7.5% (w/v) mannitol.
  • Embodiment 157 A lyophilisate prepared from a solution having a pH of 7.5 +/- 0.3 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, 5 mM Tris buffer and 8.25% (w/v) mannitol.
  • Embodiment 158 The lyophilisate of any one of Embodiments 84 to 157, further comprising aluminum-containing particles.
  • Embodiment 159 The lyophilisate of any one of Embodiments 84 to 157, further comprising aluminum hydroxide particles.
  • Embodiment 160 The lyophilisate of any one of Embodiments 84 to 159, further compising polyethylene glycol, polyoxyethylene sorbitan monooleate (Tween 80) or Pluronic F-68.
  • Embodiment 161 A pharmaceutical composition prepared by reconstituting a lyophilisate of any one of Embodiments 84 to 157, with water and admixing with a suspension of aluminum- containing particles having an aluminum content of 1 to 4 mg/mL.
  • Embodiment 162 A pharmaceutical composition prepared by reconstituting a lyophilisate of any one of Embodiments 84 to 157, with water and admixing with a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL.
  • Embodiment 163 A pharmaceutical composition prepared by reconstituting a lyophilisate of any one of Embodiments 84 to 157, with water and admixing with a suspension of aluminum- containing particles having an aluminum content of 2 mg/ml_.
  • Embodiment 164 A pharmaceutical composition prepared by reconstituting a lyophilisate of any one of Embodiments 84 to 157, with water and admixing with a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/ml_.
  • the aluminum-containing particles in the pharmaceutical compositions and certain lyophilisates of the invention may be present as a suspension.
  • the aluminum- containing particles are present as a 0.1 -5% suspension.
  • the aluminum-containing particles may be present as a 0.1 -2% suspension.
  • the size distribution of the aluminum-containing particles may be 0.1 -20 micrometers.
  • the size distribution of the aluminum-containing particles may be 1 -20 micrometers.
  • the size distribution of the aluminum-containing particles may be 2-10 micrometers.
  • the aluminum-containing particles are a 0.3-0.4% suspension with a size distribution of 2-10 micrometers.
  • Another embodiment is a 0.4% suspension of aluminum-containing particles with a size distribution of 2-10 micrometers.
  • the aluminum-containing particles in the pharmaceutical compositions and certain lyophilisates of the invention are aluminum hydroxide particles.
  • the aluminum hydroxide particles are present as a 0.1 -5% suspension, but preferably as a 0.1 -2% suspension.
  • the size distribution of the aluminum hydroxide articles is generally 1 -20 micrometers, but preferably, the size distribution of the aluminum hydroxide particles is 2-10 micrometers.
  • the aluminum hydroxide particles are present as a 0.3- 0.4% suspension with a size distribution of 2-10 micrometers.
  • Another embodiment is a 0.4% suspension of aluminum hydroxide particles with a size distribution of 2-10 micrometers.
  • the aluminum-containing particleas are aluminum hydroxide particleas and compounds of Formula (A) are bound/adsorbed to aluminum hydroxide particles.
  • the aluminum-containing particles are aluminum hydroxide particles and the compound is 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, wherein 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid is bound/adsorbed to the aluminum hydroxide particles.
  • the compounds of Formula (A) in the pharmaceutical compositions and lyophilisates of the invention can bind to aluminum-containing particles, such as, by way of example only, aluminum hydroxide particles, aluminum oxyhydroxide particles and aluminum
  • Compounds of Formula (A) have either a phosphate or a phosphonate (ionized phosphonic acid), with certain compounds of Formula (A) having an additional ionizable groups, such as a carboxylic acid.
  • the compounds of Formula (A) may bind/adsorb to aluminum-containing particles via ionic interactions between the aluminium ions of the aluminum-containing particle and the phosphate or phosphonate group of the compound of Formula (A).
  • the efficiency of binding of compounds of Formula (A) to an aluminum-containing particle is a function of the (weight/weight) ratio of weight of compound to weight of aluminum of the aluminum-containing particles. In addition, depending on the (w/w) ratio, the binding efficiency has an apparent pH dependence. Binding/ Adsorption of compounds of Formula (A) to aluminum-containing particles is mediated via ionic charge interactions between aluminium ions and the phosphate or phosphonate group of the compound of Formula (A). Binding/Adsorption is best accomplished in the pH interval between the point of zero charge (PZC) of the compound of Formula (A) and the PZC of the aluminum-containing particle.
  • PZC point of zero charge
  • Example 4 illustrates the dependence of binding efficiency on the (w/w) ratio of the weight of aluminum of the aluminum-containing particles to the weight of compound, and the pH dependence. Furthermore, at a fixed aluminum to compound ratio, the binding efficiency may depend on the final concentration of the compound of Formula (A) at values below 0.5 mg/mL.
  • the efficiency of binding of a compound of Formula (A) to aluminum- containing particles is 75-100%. In other embodiments the efficiency of binding of a compound of Formula (A) to aluminum-containing particles is 80-100%. In further embodiments the efficiency of binding of a compound of Formula (A) to aluminum-containing particles is 95- 100%. In further embodiments the efficiency of binding of a compound of Formula (A) to aluminum-containing particles is 97-100%. In further embodiments the efficiency of binding of a compound of Formula (A) to aluminum-containing particles is 98-100%.
  • the aluminum-containing particles are aluminum hydroxide particles and the efficiency of binding of a compound of Formula (A) to aluminum hydroxide particles is 75-100%. In other embodiments the aluminum-containing particles are aluminum hydroxide particles and the efficiency of binding of the compound of Formula (A) to aluminum hydroxide particles is 80-100%. In further embodiments the aluminum-containing particles are aluminum hydroxide particles and the efficiency of binding of the compound of Formula (A) to aluminum hydroxide particles is 95-100%. In further embodiments the aluminum-containing particles are aluminum hydroxide particles and the efficiency of binding of the compound of Formula (A) to aluminum hydroxide particles is 97-100%. In further embodiments the aluminum-containing particles are aluminum hydroxide particles and the efficiency of binding of the compound of Formula (A) to aluminum hydroxide particles is 98-100%.
  • the aluminum-containing particles are aluminum hydroxide particles and the compound is 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, wherein the efficiency of binding of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to aluminum hydroxide particles is 95-100%.
  • the aluminum-containing particles are aluminum hydroxide particles and the compound is 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, wherein the efficiency of binding of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to aluminum hydroxide particles is 97-100%.
  • the aluminum-containing particles are aluminum hydroxide and the compound is 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, wherein the efficiency of binding of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to aluminum hydroxide particles is 98-100%.
  • a binding efficiency of about 75%-100% for binding of a compound of Formula (A) to an aluminum-containing particles may be obtained with a (w/w) ratio of the weight of aluminum in the aluminum-containing particles to the weight of compound of Formula (A) in the range from about 0.8:1 to about 2.5:1 .
  • binding efficiencies in the range of 80%-100% may be obtained with a (w/w) ratio of aluminum in the aluminum-containing particles to a compound of Formula (A) in the range from 1 :1 to 2.5:1 .
  • binding efficiencies in the range of 90%-100% may be obtained with a (w/w) ratio of aluminum in the aluminum-containing particles to a compound of Formula (A) in the range from 1 .25:1 to 2.5:1 .
  • binding efficiencies in the range of 97%-100% may be obtained with a (w/w) ratio of aluminum in the aluminum-containing particles to a compound of Formula (A) in the range from 1 .5:1 to 2.5:1 .
  • binding efficiencies in the range of 97%-100% may be obtained with a (w/w) ratio of aluminum in the aluminum-containing particles to a compound of Formula (A) in the range from 1 .5:1 to 2:1 .
  • binding efficiencies in the range of 98%-100% may be obtained with a (w/w) ratio of aluminum in the aluminum-containing particles to a compound of Formula (A) in the range from 1 .5:1 to 2:1 .
  • a binding efficiency of about 75%-100% for binding of 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic to aluminum-containing particles may be obtained with a (w/w) ratio of the weight of aluminum in the aluminum-containing particles to the weight of 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic in the range from about 0.8:1 to about 2.5:1 .
  • binding efficiencies in the range of 80%-100% may be obtained with a (w/w) ratio of the weight of aluminum in the aluminum-containing particles to the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic in the range from 1 :1 to 2.5:1 .
  • binding efficiencies in the range of 90%-100% may be obtained with a (w/w) ratio of the weight of aluminum in the aluminum-containing particles to the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic in the range from 1 .25:1 to 2.5:1 .
  • binding efficiencies in the range of 97%-100% may be obtained with a (w/w) ratio of the weight of aluminum in the aluminum-containing particles to the weight of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin- 8-yl)propanoic in the range from 1 .5:1 to 2.5:1 .
  • binding efficiencies in the range of 97%-100% may be obtained with a (w/w) ratio of the weight of aluminum in the aluminum-containing particles to the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic in the range from 1 .5:1 to 2:1 .
  • binding efficiencies in the range of 98%-100% may be obtained with a (w/w) ratio of the weight of aluminum in the aluminum-containing particles to the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic in the range from 1 .5:1 to 2:1 .
  • a binding efficiency of about 75%-100% for binding of 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic to aluminum hydroxide particles may be obtained with a (w/w) ratio of the weight of aluminum in the aluminum hydroxide particles to the weight of 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic in the range from about 0.8:1 to about 2.5:1 .
  • binding efficiencies in the range of 80%-100% may be obtained with a (w/w) ratio of the weight of aluminum in the aluminum hydroxide particles to the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic in the range from 1 :1 to 2.5:1 .
  • binding efficiencies in the range of 90%-100% may be obtained with a (w/w) ratio of the weight of aluminum in the aluminum hydroxide particles to the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic in the range from 1 .25:1 to 2.5:1 .
  • binding efficiencies in the range of 97%-100% may be obtained with a (w/w) ratio of the weight of aluminum in the aluminum hydroxide particles to the weight of 3-(5-amino- 2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin- 8-yl)propanoic in the range from 1 .5:1 to 2.5:1 .
  • binding efficiencies in the range of 97%-100% may be obtained with a (w/w) ratio of the weight of aluminum in the aluminum hydroxide particles to the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic in the range from 1 .5:1 to 2:1 .
  • binding efficiencies in the range of 98%-100% may be obtained with a (w/w) ratio of the weight of aluminum in the aluminum hydroxide particles to the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic in the range from 1 .5:1 to 2:1 .
  • a preferred (w/w) ratio of the weight of aluminum in the aluminum-containing particles to the weight of a compound of Formula (A) is 1 .5:1
  • the most preferred (w/w) ratio of the weight of aluminum in the aluminum-containing particles to the weight of a compound of Formula (A) is 2:1 .
  • a preferred (w/w) ratio of the weight of aluminum in the aluminum-containing particles to the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid is 1 .5:1
  • the most preferred (w/w) ratio of the weight of aluminum in the aluminum-containing particles to the weight of 3-(5- amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid is 2:1 .
  • a preferred (w/w) ratio of the weight of aluminum in the aluminum hydroxide particles to the weight of a compound of Formula (A) is 1 .5:1
  • the most preferred (w/w) ratio of the weight of aluminum in the aluminum hydroxide particles to the weight of a compound of Formula (A) is 2:1 .
  • a preferred (w/w) ratio of the weight of aluminum in the aluminum hydroxide particles to the weight of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid is 1 .5:1
  • the most preferred (w/w) ratio of the weight of aluminum in the aluminum hydroxide particles to the weight of 3-(5- amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid is 2:1 .
  • the pH used for binding/adsorbing compounds of Formula (A) to aluminum-containing particles is in the range of pH 6.5 to pH 9.0. In certain embodiments the pH used for binding/adsorbing compounds of Formula (A) to aluminum-containing particles is in the range of pH 7 to pH 8. In preferred embodiments the pH used for binding/adsorbing compounds of Formula (A) to aluminum-containing particles is in the range of pH 7.2 to pH 7.8. In preferred embodiments the pH used for binding/adsorbing compounds of Formula (A) to aluminum-containing particles is pH 7.5 +/- 0.5. In the most preferred embodiment the pH used for binding/adsorbing compounds of Formula (A) to aluminum-containing particles is pH 7.5 +/- 0.3.
  • the binding/adsorption of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to aluminum-containing particles is mediated via ionic charge interactions between aluminium ions and the phosphonate group (ionized phosphonic acid) of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid.
  • the pH used for the binding/adsorbtion of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to an aluminum-containing particles is in the range of pH 6.5 to pH 9.
  • the pH used for the binding/adsorbtion of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to an aluminum-containing particles is in the range of pH 7 to pH 8.
  • the pH used for the binding/adsorbtion of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to an aluminum-containing particles is in the range of pH 7.2 to pH 7.8.
  • the pH used for the binding/adsorbtion of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to an aluminum-containing particles is pH 7.5 +/- 0.5.
  • the pH used for the binding/adsorbtion of 3- (5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to an aluminum-containing particles is pH 7.5 +/- 0.3.
  • the aluminum-containing particles are aluminum hydroxide particles and accordingly the binding/adsorption of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to aluminum hydroxide particles is mediated via ionic charge interactions between aluminium ions and the phosphonate group (ionized phosphonic acid) of 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid.
  • the binding/adsorption is more efficient in the pH interval between the point of zero charge (PZC) of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid and the PZC of the aluminum hydroxide particles.
  • PZC point of zero charge
  • the pH used for the binding/adsorbtion of 3-(5- amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to aluminum hydroxide particles is in the range of pH 6.5 to pH 9.
  • the pH used for the binding/adsorbtion of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to aluminum hydroxide particles is in the range of pH 7 to pH 8.
  • the pH used for the binding/adsorbtion of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to aluminum hydroxide particles is in the range of pH 7.2 to pH 7.8.
  • the pH used for the binding/adsorbtion of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid to aluminum hydroxide particles is in the range of pH 7.2 to pH 7.8.
  • the pH used for the binding/adsorbtion of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid to aluminum hydroxide is pH 7.5 +/- 0.3.
  • compositions of the invention comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, may be administered by injection, specifically intratumorally (intratumoral injection), intramuscularly (intramuscular injection), intradermal ⁇ (intradermal injection) or subcutaneously (subcutaneous injection).
  • pharmaceutical compositions of the invention comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, is administered intratumorally, while in other embodiments, pharmaceutical compositions of the invention comprising a compound of
  • Formula (A), or a pharmaceutically acceptable salt thereof is administered subcutaneously.
  • the pharmaceutical compositions of the invention comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, may be administered/ injected into the peritumoral region surrounding a tumor.
  • the peritumoral region may contain antitumor immune cells.
  • the binding of compounds of Formula (A) to aluminum-containing particles increases the retention of the compound of Formula (A) at the site of injection site, which decreases clearance of the compound and increases the half-life of the compound and thereby decreasing systemic exposure.
  • retention at the tumor site may lead to improved immune priming and reduced systemic inflammation when compared to the systemic administration of unbound
  • compositions of the invention may produce an immune response to a tumor in a subject. Accordingly, the invention provides methods for treating a solid tumor by producing an immune response to the solid tumor in a subject. Additionaly, the invention provides methods for treating a liquid tumor by producing an immune response to the tumor in a subject.
  • One aspect of the invention is a method for treating a solid tumor by administering to a subject in need thereof a pharmaceutical composition of any one of Embodiments 1 to 83 or 161 to 164.
  • One aspect of the invention is a method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition of any one of
  • One aspect of the invention is a method for treating a solid tumor by administering to a subject in need thereof a pharmaceutical composition comprising a TLR7 agonist compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, aluminum- containing particles and one or more pharmaceutically acceptable excipients.
  • One aspect of the invention is a method for treating a solid tumor by administering to a subject in need thereof a pharmaceutical composition comprising a TLR7 agonist compound of Table 1 , or a pharmaceutically acceptable salt thereof, aluminum-containing particles and one or more pharmaceutically acceptable excipients.
  • Another aspect of the invention is the use of a pharmaceutical composition of any one of Embodiments 1 to 83 or 161 to 164 for treating a solid tumor.
  • Another aspect of the invention is the use of a pharmaceutical composition
  • a pharmaceutical composition comprising a TLR7 agonist compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, aluminum-containing particles and one or more pharmaceutically acceptable excipients for treating a solid tumor.
  • Another aspect of the invention is the use of a pharmaceutical composition
  • a pharmaceutical composition comprising a TLR7 agonist compound of Table 1 , or a pharmaceutically acceptable salt thereof, aluminum- containing particles and one or more pharmaceutically acceptable excipients for treating a solid tumor.
  • Another aspect of the invention is a pharmaceutical composition of any one of Embodiments 1 to 83 or 161 to 164 for use in the treatment of a solid tumor.
  • Another aspect of the invention is a pharmaceutical composition
  • a pharmaceutical composition comprising a TLR7 agonist compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, aluminum-containing particles and one or more pharmaceutically acceptable excipients for use in treating a solid tumor.
  • Another aspect of the invention is a pharmaceutical composition
  • a pharmaceutical composition comprising a TLR7 agonist compound of Table 1 , or a pharmaceutically acceptable salt thereof, aluminum-containing particles and one or more pharmaceutically acceptable excipients for use in treating a solid tumor.
  • the invention provides methods for treating a solid tumor by administering, either intratumorally, intramuscularly, intradermal ⁇ or subcutaneously, a pharmaceutical composition of any one of Embodiments 1 to 83 or 161 to 164.
  • the invention further provides methods for treating a solid tumor by administering, either intratumorally, intramuscularly, intradermal ⁇ or subcutaneously, a pharmaceutical composition disclosed herein comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, aluminum-containing particles and one or more pharmaceutically acceptable excipients.
  • a pharmaceutical composition disclosed herein comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, aluminum-containing particles and one or more pharmaceutically acceptable excipients.
  • Another aspect of the invention is a method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition comprising a TLR7 agonist compound having the structure of Formula (A), or a pharmaceutically acceptable salt thereof, aluminum-containing particles and one or more pharmaceutically acceptable excipients.
  • Another aspect of the invention is a method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition comprising a TLR7 agonist compound of Table 1 , or a pharmaceutically acceptable salt thereof, aluminum- containing particles and one or more pharmaceutically acceptable excipients.
  • the solid tumors which may be treatable by such methods and uses include, but are not limited to, a breast cancer tumor, a bladder cancer tumor, a head and neck cancer tumor, a non-small cell lung cancer tumor, a small cell lung cancer tumor, a colorectal cancer tumor, a gastrointestinal stromal tumor, a gastroesophageal carcinoma, a renal cell cancer tumor, a prostate cancer tumor, a liver cancer tumor, a colon cancer tumor, a pancreatic cancer tumor, an ovarian cancer tumor, a lymphoma, a cutaneous T -cell lymphoma, or a melanoma.
  • an immune suppressed tumor is a tumor that contains immune suppressive associated cells such as for example T Reg cells, myeloid derived suppressor cells (MDSC), M2 macrophages, and the like or immune suppressive factors such as inducible nitric oxide synthase (iNOS), PD-L1 , and the like.
  • immune suppressive associated cells such as for example T Reg cells, myeloid derived suppressor cells (MDSC), M2 macrophages, and the like or immune suppressive factors such as inducible nitric oxide synthase (iNOS), PD-L1 , and the like.
  • the amount of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, incorporated in a pharmaceutical composition of the invention, which is the used in a method or use of the invention, may vary according to factors known in art such as for example, the physical and clinical status of the subject, the method of administration, the content of the formulation, the intended dosing regimen or sequence. In consideration of such factors the appropriate amount incorporated can be readily determined by one of ordinary skill in the art.
  • the pharmaceutical composition of the invention may include an amount of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, to provide a dose of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, to a subject from about 0.05 mg to about 5 mg.
  • the pharmaceutical composition of the invention includes an amount of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, which provides a dose of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, to a subject from about 0.1 mg to about 1 mg.
  • duration and frequency of treatment it is typical for skilled clinicians to monitor subjects in order to determine when the treatment is providing therapeutic benefit, and to determine whether to increase or decrease dosage, increase or decrease administration frequency, discontinue treatment, resume treatment or make other alteration to treatment regimen.
  • dosing schedules for the administration of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, adsorbed to aluminum hydroxide, either alone as a single agent or in combination with one or more additional therapeutic agents are
  • a cycle period is the number and timing or recommended repetitions of therapy and are usually expressed as number of days. Examples of a cycle period include every 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days or 31 days.
  • a dosing schedule can include a dose delay (pause), wherein a compound of Formula (A), or a pharmaceutically acceptable salt thereof, adsorbed to aluminum hydroxide is administered during cycle 1 and wherein a compound of Formula (A), or a pharmaceutically acceptable salt thereof, adsorbed to aluminum hydroxide is not administered during one or more subsequent cycle periods.
  • a compound of Formula (A), or a pharmaceutically acceptable salt thereof, adsorbed to aluminum hydroxide is administered during cycles 1 , 3, 5, 7 and 9, with a dose delay (pause) during cycles 2, 4, 6, and 8 wherein a compound of Formula (A), or a pharmaceutically acceptable salt thereof, adsorbed to aluminum hydroxide is not administered.
  • a compound of Formula (A), or a pharmaceutically acceptable salt thereof, adsorbed to aluminum hydroxide is administered during cycles 1 , 2, 4, 5, 7 and 8, with a dose delay (pause) during cycles 3 and 6 wherein a compound of Formula (A), or a pharmaceutically acceptable salt thereof, adsorbed to aluminum hydroxide is not administered.
  • a compound of Formula (A), or a pharmaceutically acceptable salt thereof, adsorbed to aluminum hydroxide is administered during cycles 1 , 2, 5 and 6, with a dose delay (pause) during cycles 3 and 4 wherein a compound of Formula (A), or a pharmaceutically acceptable salt thereof, adsorbed to aluminum hydroxide is not administered.
  • a six cycle dosing schedule for the administration of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, adsorbed to aluminum hydroxide, either alone as a single agent or in combination with one or more additional therapeutic agents, a compound of Formula (A), or a pharmaceutically acceptable salt thereof, adsorbed to aluminum hydroxide can be administered by intratumoral injection on Days 1 and 15 (biweekly schedule) or Day 1 only (monthly schedule) during a 28- day cycle. Intratumoral administration occurs in Cycles 1 and 2, followed by a two cycle dosing delay (Cycles 3 and 4), and then repeat injections on Days 1 and 15 (biweekly schedule) or Day 1 only (monthly schedule) for Cycles 5 and 6.
  • the dose of a compound of Formula (A), or a pharmaceutically acceptable salt thereof, administered during the six cycle schedule can be from about 0.1 mg to about 1 mg, or from about 0.1 mg to about 0.6 mg.
  • compositions will typically be used to treat human subjects they may also be used to treat similar or identical diseases in other vertebrates, such as other primates, dogs, cats, horses, and cows.
  • Embodiment 165 A method for treating a solid tumor by administering to a subject in need thereof a pharmaceutical composition of any one of Embodiments 1 to 83 or 161 to 164.
  • Embodiment 166 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition of any one of Embodiments 1 to 83 or 161 to 164.
  • Embodiment 167 A method for treating a solid tumor by administering to a subject in need thereof a pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles and one or more pharmaceutically acceptable excipients.
  • Embodiment 168 A method for treating a solid tumor by administering to a subject in need thereof a pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum hydroxide particles and one or more pharmaceutically acceptable excipients.
  • Embodiment 169 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum hydroxide particles and one or more pharmaceutically acceptable excipients.
  • Embodiment 170 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles and a buffering agent.
  • Embodiment 171 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles a buffering agent and one or more pharmaceutically acceptable excipients.
  • Embodiment 172 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles and a buffering agent.
  • Embodiment 173 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic, or a pharmaceutically acceptable salt thereof, aluminum-containing particles, a buffering agent and sucrose.
  • Embodiment 174 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic, or a pharmaceutically acceptable salt thereof, aluminum-containing particles, a buffering agent and mannitol.
  • Embodiment 175. A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum hydroxide particles and Tris buffer.
  • Embodiment 176 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum hydroxide particles, Tris buffer and sucrose.
  • Embodiment 177 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-100 mM Tris buffer and 5-10% (w/v) sucrose.
  • Embodiment 178 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-50 mM Tris buffer and 5-10% (w/v) sucrose.
  • Embodiment 179 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-
  • Embodiment 180 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 5-20 mM Tris buffer and 5-10% (w/v) sucrose.
  • Embodiment 181 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL of aluminum hydroxide, 16 mM Tris buffer and 7.5% (w/v) sucrose.
  • Embodiment 182 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL of aluminum hydroxide, 5 mM Tris buffer and 8.25% (w/v) sucrose.
  • Embodiment 183 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum hydroxide particles, Tris buffer and mannitol.
  • Embodiment 184 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-100 mM Tris buffer and 5-10% (w/v) mannitol.
  • Embodiment 185 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-50 mM Tris buffer and 5-10% (w/v) mannitol.
  • Embodiment 186 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 0.5 to 2 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-20 mM Tris buffer and 5-10% (w/v) mannitol.
  • Embodiment 187 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 5-20 mM Tris buffer and 5-10% (w/v) mannitol.
  • Embodiment 188 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL of aluminum hydroxide, 16 mM Tris buffer and 7.5% (w/v) mannitol.
  • Embodiment 189 A method for treating a solid tumor by intratumorally administering to a subject in need thereof a pharmaceutical composition having a pH between 7.0 and 8.0 and comprising 1 mg/mL of 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL of aluminum hydroxide, 5 mM Tris buffer and 8.25% (w/v) mannitol.
  • Embodiment 190 Use of a pharmaceutical composition for treating a solid tumor wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles and one or more pharmaceutically acceptable excipients.
  • Embodiment 191 Use of a pharmaceutical composition for treating a solid tumor wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum hydroxide particles and one or more pharmaceutically acceptable excipients.
  • Embodiment 192 Use of a pharmaceutical composition for treating a solid tumor wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles and a buffering agent.
  • Embodiment 193 Use of a pharmaceutical composition for treating a solid tumor wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles a buffering agent and one or more pharmaceutically acceptable excipients.
  • Embodiment 194 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises a 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles and a buffering agent.
  • the composition has a pH between 7.0 and 8.0 and comprises a 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles and a buffering agent.
  • Embodiment 195 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic, or a pharmaceutically acceptable salt thereof, aluminum-containing particles, a buffering agent and sucrose.
  • Embodiment 196 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid , or a pharmaceutically acceptable salt thereof, aluminum-containing particles, a buffering agent and mannitol.
  • the composition has a pH between 7.0 and 8.0 and comprises 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid , or a pharmaceutically acceptable salt thereof, aluminum-containing particles, a buffering agent and mannitol.
  • Embodiment 197 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum hydroxide particles and Tris buffer.
  • Embodiment 198 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum hydroxide particles, Tris buffer and sucrose.
  • Embodiment 199 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-100 mM Tris buffer and 5- 10% (w/v) sucrose.
  • Embodiment 200 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)
  • compositions for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-50 mM Tris buffer and 5- 10% (w/v) sucrose.
  • Embodiment 201 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-20 mM Tris buffer and 5- 10% (w/v) sucrose.
  • the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin
  • Embodiment 202 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 5-20 mM Tris buffer and 5-10% (w/v) sucrose.
  • Embodiment 203 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 16 mM Tris buffer and 7.5% (w/v) sucrose.
  • Embodiment 204 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 5 mM Tris buffer and 8.25% (w/v) sucrose.
  • Embodiment 205 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum hydroxide particles, Tris buffer and mannitol.
  • Embodiment 206 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-100 mM Tris buffer and 5- 10% (w/v) mannitol.
  • the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphth
  • Embodiment 207 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-50 mM Tris buffer and 5- 10% (w/v) mannitol.
  • the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphth
  • Embodiment 208 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-20 mM Tris buffer and 5- 10% (w/v) mannitol.
  • Embodiment 2 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 5-20 mM Tris buffer and 5-10% (w/v) mannitol.
  • the composition has a pH between 7.0 and 8.0 and comprises 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-
  • Embodiment 210 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 16 mM Tris buffer and 7.5% (w/v) mannitol.
  • the composition has a pH between 7.0 and 8.0 and comprises 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- y
  • Embodiment 21 1 Use of a pharmaceutical composition for treating a solid tumor wherein the composition has a pH between 7.0 and 8.0 and comprises 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 5 mM Tris buffer and 8.25% (w/v) mannitol.
  • the composition has a pH between 7.0 and 8.0 and comprises 1 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-
  • Embodiment 212 A pharmaceutical composition for use in treating a solid tumor, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles and one or more pharmaceutically acceptable excipients.
  • a pharmaceutical composition for use in treating a solid tumor wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum hydroxide particles and one or more pharmaceutically acceptable excipients.
  • Embodiment 214 A pharmaceutical composition for use in treating a solid tumor, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles and a buffering agent.
  • Embodiment 215. A pharmaceutical composition for use in treating a solid tumor, wherein the composition comprises 3-(5-amino-2-(4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2- methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles, a buffering agent, and one or more pharmaceutically acceptable excipients.
  • Embodiment 216 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles and a buffering agent.
  • Embodiment 217 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles, a buffering agent and one or more pharmaceutically acceptable excipients.
  • Embodiment 218 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum-containing particles and a buffering agent.
  • Embodiment 21 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic, or a pharmaceutically acceptable salt thereof, aluminum-containing particles, a buffering agent and sucrose.
  • Embodiment 220 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid , or a pharmaceutically acceptable salt thereof, aluminum-containing particles, a buffering agent and mannitol.
  • the composition has a pH between 7.0 and 8.0 and comprises 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid , or a pharmaceutically acceptable salt thereof, aluminum-containing particles, a buffering agent and mannitol.
  • Embodiment 221 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises of 3-(5-amino-2-(4-(2-(3,3- difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum hydroxide particles and Tris buffer.
  • Embodiment 222 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 3-(5-amino-2-(4-(2-(3,3-difluoro- 3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid, or a pharmaceutically acceptable salt thereof, aluminum hydroxide particles, Tris buffer and sucrose.
  • Embodiment 223. A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-100 mM Tris buffer and 5- 10% (w/v) sucrose.
  • Embodiment 224 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-50 mM Tris buffer and 5- 10% (w/v) sucrose.
  • Embodiment 225 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-20 mM Tris buffer and 5- 10% (w/v) sucrose.
  • Embodiment 226 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 1 .0 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 5-20 mM Tris buffer and 5-10% (w/v) sucrose.
  • Embodiment 227 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 1 .0 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 16 mM Tris buffer and 7.5% (w/v) sucrose.
  • Embodiment 228 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 1 .0 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 5 mM Tris buffer and 8.25% (w/v) sucrose.
  • Embodiment 229. A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-100 mM Tris buffer and 5- 10% (w/v) mannitol.
  • Embodiment 230 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-50 mM Tris buffer and 5- 10% (w/v) mannitol.
  • Embodiment 231 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 0.5 to 2 mg/mL of 3-(5-amino-2- (4-(2-(3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 1 to 4 mg/mL, 5-20 mM Tris buffer and 5- 10% (w/v) mannitol.
  • Embodiment 232 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 1 .0 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 5-20 mM Tris buffer and 5-10% (w/v) mannitol.
  • Embodiment 233 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 1 .0 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 16 mM Tris buffer and 7.5% (w/v) mannitol.
  • Embodiment 23 A pharmaceutical composition for use in treating a solid tumor, wherein the composition has a pH between 7.0 and 8.0 and comprises 1 .0 mg/mL of 3-(5-amino-2-(4-(2- (3,3-difluoro-3-phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8- yl)propanoic acid, or a pharmaceutically acceptable salt thereof, a suspension of aluminum hydroxide particles having an aluminum content of 2 mg/mL, 5 mM Tris buffer and 8.25% (w/v) mannitol.
  • Example 7 illustrates the effect on tumor volume by administration of a pharmaceutical composition comprising a compound of Formula (A) with or without aluminum-containing particles. Specifically, Example 7 illustrates the effect on tumor volume by administration of a pharmaceutical composition comprising 3-(5-amino-2-(4-(2-(3,3-difluoro-3- phosphonopropoxy)ethoxy)-2-methylphenethyl)benzo[f][1 ,7]naphthyridin-8-yl)propanoic acid with or without aluminum-containing particles.
  • the invention also provides methods for treating a solid tumor by administering, either intratumorally, intramuscularly, intradermal ⁇ or subcutaneously, a pharmaceutically composition of any one of Embodiments 1 to 83 or 161 to 164 in combination with one or more pharmaceutical compositions comprising another therapeutic agent.
  • additional therapeutic agents can be a checkpoint inhibitor, a TLR9 agonist, a TLR8 agonist, a TLR7 agonist, a STING agonist or a chemotherapeutic agent.
  • the invention further provides methods for treating a solid tumor by administering, either intratumorally, intramuscularly, intradermal ⁇ or subcutaneously, a pharmaceutically composition disclosed herein comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, aluminum-containing particles and one or more pharmaceutically acceptable excipients in combination with one or more pharmaceutical compositions comprising another therapeutic agent.
  • additional therapeutic agents can be a checkpoint inhibitor, a TLR9 agonist, a TLR8 agonist, a TLR7 agonist, a STING agonist or a chemotherapeutic agent.
  • General chemotherapeutic agents considered for use in combination therapies include anastrozole (Arimidex®), bicalutamide (Casodex®), bleomycin sulfate (Blenoxane®), busulfan (Myleran®), busulfan injection (Busulfex®), capecitabine (Xeloda®), N4-pentoxycarbonyl-5- deoxy-5-fluorocytidine, carboplatin (Paraplatin®), carmustine (BiCNU®), chlorambucil
  • TLRs Toll-like receptors
  • checkpoint receptors a family of receptors, known as checkpoint receptors, to downregulate activated immune cells, such as T-cells.
  • a number of tumors are able to expressing agonistic surface proteins to checkpoint receptors and thereby evade anti-tumor immune response in the tumor environment.
  • this cloaking behavior may be overcome by blocking the checkpoint pathway by the administration of checkpoint pathway inhibitors, and in conjunction activate the immune system with the administration of a Toll-like 7 receptor agonist.
  • Compounds of Formula (A), or a pharmaceutically acceptable salt thereof are TLR7 agonists and thereby activate multiple cell-mediated anti-tumor immune responses (such as for example T-cell activation). Therefore, a combination of immune activation with a compound of Formula (A), or a pharmaceutically acceptable salt thereof, and blockade of immune checkpoint pathways with immune one or more checkpoint inhibitor(s) may enhance and maintain an antitumor immune response initiated by the compound of Formula (A), or a pharmaceutically acceptable salt thereof.
  • the invention provides combinations of a pharmaceutical composition comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof in combination with one or more immune checkpoint inhibitors. Accordingly, the invention further provides methods and uses that may be useful for treating solid tumors by the administration of such combinations.
  • the invention provides combinations of a pharmaceutical composition of any one of Embodiments 1 to 83 or 161 to 164 in combination with one or more pharmaceutical compositions comprising one or more immune checkpoint inhibitors.
  • the invention provides a pharmaceutical composition of any one of Embodiments 1 to 83 or 161 to 164 further comprising one or more immune checkpoint inhibitors.
  • the invention provides combinations of a pharmaceutical composition comprising a compound of Formula (A), or a pharmaceutically acceptable salt thereof, aluminum-containing particles, one or more pharmaceutically acceptable excipients in combination with one or more pharmaceutical compositions comprising one or more immune checkpoint inhibitors.
  • the immune checkpoint inhibitor can be an inhibitor of the receptor or an inhibitor of the ligand.
  • Immune checkpoint receptor which may be targeted by inhibitors, include but are not limited to, Cytotoxic T-lymphocyte associated antigen 4 (CTLA-4), Programmed death 1 (PD-1 ), Lymphocyte activation gene 3 (LAG-3), T cell membrane protein 3 (TIM-3), B-and T-lymphocyte attenuator receptor (BTLA) and Killer cell immunoglobulin-like receptors (KIR), and immune checkpoint receptor ligands which may be tarrgetted by inhibitors, include but are not limited to, Programmed Death ligand 1 (PD-L1 ) and Programmed Death ligand 2 (PD-L2).
  • CTL-4 Cytotoxic T-lymphocyte associated antigen 4
  • PD-1 Programmed death 1
  • LAG-3 Lymphocyte activation gene 3
  • TIM-3 T cell membrane protein 3
  • B-and T-lymphocyte attenuator receptor BTLA
  • KIR Killer cell immunoglobul
  • the immune checkpoint inhibitor used in the combinations of the invention can be an inhibitor of the receptor or an inhibitor of the ligand.
  • the immune checkpoint inhibitor used in the combinations of the invention is a CTLA-4 receptor inhibitor, a PD-1 receptor inhibitor, a LAG-3 receptor inhibitor, a TIM-3 receptor inhibitor, a BTLA receptor inhibitor, or a KIR receptor inhibitor.
  • the immune checkpoint inhibitor used in the combinations of the invention is an inhibitor of Programmed death ligand 1 (PD-L1 ) and/or Programmed death ligand 2 (PD-L2).
  • the immune checkpoint inhibitors used in the combinations of the invention can be a low molecular weight organic molecule (molecular weight less than 1000 daltons), a peptide, a polypeptide, a protein, an antibody, an antibody fragment, or an antibody derivative.
  • the immune checkpoint inhibitor used in the combinations of the invention is an antibody.
  • the immune checkpoint inhibitor used in the combinations of the invention the antibody is a monoclonal antibody.
  • the immune checkpoint inhibitor used in the combinations of the invention the antibody is a human antibody or a humanized monoclonal antibody.
  • the immune checkpoint inhibitor used in the combinations of the invention is an anti-CTLA-4 receptor antibody, an anti-PD-1 receptor antibody, an antiLAG-3 receptor antibody, an anti-TIM-3 receptor antibody, an anti-BTLA receptor antibody, an anti-KIR receptor antibody, an anti-PD-L1 antibody, or an anti-PD-L2 antibody.
  • the immune checkpoint inhibitor used in the combinations of the invention is an inhibitor of the PD-L1 /PD-1 pathway or the PD-L2/PD-1 pathway.
  • the anti-PD-L1 antibody molecule for use in combinations of the invention is one of those disclosed in U.S. Patent Application No. 20160108123, filed October 13, 2015, entitled “Antibody Molecules to PD-L1 and Uses Thereof,” incorporated by reference in its entirety.
  • the anti-PD-L1 antibody includes at least one or two heavy chain variable domain (optionally including a constant region), at least one or two light chain variable domain (optionally including a constant region), or both, comprising the amino acid sequence of any of BAP058-hum01 , BAP058-hum02, BAP058-hum03, BAP058-hum04, BAP058-hum05, BAP058-hum06, BAP058-hum07, BAP058-hum08, BAP058-hum09, BAP058-hum10, BAP058- hum1 1 , BAP058-hum12, BAP058-hum13, BAP058-hum14, BAP058-hum15, BAP058-hum16, BAP058-hum17, BAP058-Clone-K, BAP058-Clone-L, BAP058-Clone-M, BAP058-Clone-N, or BAP058-Clone-
  • Patent Appliaction No. 20160108123 or encoded by the nucleotide sequence in Table 1 of U.S. Patent Appliaction No. 20160108123; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences.
  • the anti-PD-L1 antibody molecule includes at least one, two, or three complementarity determining regions (CDRs) from a heavy chain variable region and/or a light chain variable region of an antibody described herein, e.g., an antibody chosen from any of BAP058-hum01 , BAP058-hum02, BAP058-hum03, BAP058-hum04, BAP058-hum05, BAP058-hum06, BAP058-hum07, BAP058-hum08, BAP058-hum09, BAP058-hum10, BAP058- hum1 1 , BAP058-hum12, BAP058-hum13, BAP058-hum14, BAP058-hum15, BAP058-hum16, BAP058-hum17, BAP058-Clone-K, BAP058-Clone-L, BAP058-Clone-M, BAP058-Clone-N, or
  • Patent Appliaction No. 20160108123 or encoded by the nucleotide sequence in Table 1 of U.S. Patent Appliaction No. 20160108123; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences.
  • the anti-PD-L1 antibody molecule includes at least one, two, or three CDRs (or collectively all of the CDRs) from a heavy chain variable region comprising an amino acid sequence shown in Table 1 of U.S. Patent Appliaction No. 20160108123, or encoded by a nucleotide sequence shown in Table 1 of U.S. Patent Appliaction No.
  • one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions or deletions, relative to the amino acid sequence shown in Table 1 of U.S. Patent Appliaction No.
  • the anti-PD-L1 antibody molecule includes at least one, two, or three CDRs (or collectively all of the CDRs) from a light chain variable region comprising an amino acid sequence shown in Table 1 of U.S. Patent Appliaction No. 20160108123, or encoded by a nucleotide sequence shown in Table 1 of U.S. Patent Appliaction No.
  • one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions or deletions, relative to the amino acid sequence shown in Table 1 of U.S. Patent Appliaction No.
  • the anti-PD-L1 antibody molecule includes a substitution in a light chain CDR, e.g., one or more substitutions in a CDR1 , CDR2 and/or CDR3 of the light chain.
  • the anti-PD-L1 antibody molecule includes at least one, two, three, four, five or six CDRs (or collectively all of the CDRs) from a heavy and light chain variable region comprising an amino acid sequence shown in Table 1 of U.S. Patent Appliaction No. 20160108123, or encoded by a nucleotide sequence shown in Table 1 of U.S. Patent Appliaction No. 20160108123.
  • one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid
  • the anti-PD-L1 antibody molecule includes at least one, two or three CDRs or hypervariable loops from a heavy chain variable region of an antibody described herein, e.g., an antibody chosen from any of BAP058-hum01 , BAP058-hum02, BAP058-hum03, BAP058-hum04, BAP058-hum05, BAP058-hum06, BAP058-hum07, BAP058-hum08, BAP058- hum09, BAP058-hum10, BAP058-hum1 1 , BAP058-hum12, BAP058-hum13, BAP058-hum14, BAP058-hum15, BAP058-hum16, BAP058-hum17, BAP058-Clone-K, BAP058-Clone-L,
  • BAP058-Clone-M, BAP058-Clone-N, or BAP058-Clone-O according to the Kabat and Chothia definition (e.g., at least one, two, or three CDRs or hypervariable loops according to the Kabat and Chothia definition as set out in Table 1 of U.S. Patent Appliaction No. 20160108123); or encoded by the nucleotide sequence in Table 1 of U.S. Patent Appliaction No.
  • the anti-PD-L1 antibody molecule can include VH CDR1 according to Kabat et al. ((1991 ), "Sequences of Proteins of Immunological Interest," 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD) or VH hypervariable loop 1 according to Chothia et al. (1992) J. Mol. Biol. 227:799-817, or a combination thereof, e.g., as shown in Table 1 of U.S. Patent Appliaction No. 20160108123.
  • the combination of Kabat and Chothia CDR of VHCDR1 comprises the amino acid sequence GYTFTSYWMY (SEQ ID NO:1 , or an amino acid sequence substantially identical thereto (e.g., having at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions)).
  • the anti-PD-L1 antibody molecule can further include, e.g., VH CDRs 2-3 according to Kabat et al. and VL CDRs 1 -3 according to Kabat et al., e.g., as shown in Table 1 of U.S. Patent Appliaction No. 20160108123.
  • the anti PD-L1 antibody molecule for use in the combinations, methods and compositions of the invention comprises (see Table 2): (a) a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO:5, a VHCDR2 amino acid sequence of SEQ ID NO:6, and a VHCDR3 amino acid sequence of SEQ ID NO:4; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO:14, a VLCDR2 amino acid sequence of SEQ ID NO:15, and a VLCDR3 amino acid sequence of SEQ ID NO:16;
  • VH heavy chain variable region
  • VL light chain variable region
  • a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO:2; a VHCDR2 amino acid sequence of SEQ ID NO:3; and a VHCDR3 amino acid sequence of SEQ ID NO:4; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO:1 1 , a VLCDR2 amino acid sequence of SEQ ID NO:12, and a VLCDR3 amino acid sequence of SEQ ID NO:13;
  • a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO:1 , a VHCDR2 amino acid sequence of SEQ ID NO:6, and a VHCDR3 amino acid sequence of SEQ ID NO:4; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO:14, a VLCDR2 amino acid sequence of SEQ ID NO:15, and a VLCDR3 amino acid sequence of SEQ ID NO:16; or
  • a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO:1 ; a VHCDR2 amino acid sequence of SEQ ID NO:3; and a VHCDR3 amino acid sequence of SEQ ID NO:4; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO:1 1 , a VLCDR2 amino acid sequence of SEQ ID NO:12, and a VLCDR3 amino acid sequence of SEQ ID NO:13.
  • the anti-PD-L1 antibody molecule used in the combinations of the invention comprises:
  • the PD-1 inhibitor partner of a combination of the invention is an anti-PD-1 antibody molecule.
  • the PD-1 inhibitor is an anti-PD-1 antibody molecule as described in US 2015/021 0769, published on July 30, 201 5, entitled “Antibody Molecules to PD-1 and Uses Thereof,” incorporated by reference in its entirety.
  • the anti-PD-1 antibody molecule comprises at least one, two, three, four, five or six complementarity determining regions (CDRs) (or collectively all of the CDRs) from a heavy and light chain variable region comprising an am ino acid sequence shown in Table 3 (e.g., from the heavy and light chain variable region sequences of BAP049-Clone-E or BAP049-Clone-B disclosed in Table 3), or encoded by a nucleotide sequence shown in Table 3.
  • the CDRs are according to the Kabat definition (e.g., as set out in Table 3) .
  • the CDRs are according to the Chothia definition (e.g., as set out in Table 3).
  • the CDRs are according to the combined CDR definitions of both Kabat and Chothia (e.g., as set out in Table 3).
  • the combination of Kabat and Chothia CDR of VHCDR1 comprises the am ino acid sequence GYTFTTYWMH (SEQ I D NO : 21 ).
  • one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions (e.g., conservative amino acid substitutions) or deletions, relative to an amino acid sequence shown in Table 1 , or encoded by a nucleotide sequence shown in Table 3.
  • the anti-PD-1 antibody molecule comprises a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ I D NO: 22, a VHCDR2 amino acid sequence of SEQ I D NO: 23, and a VHCDR3 amino acid sequence of SEQ I D NO : 24; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 31 , a VLCDR2 amino acid sequence of SEQ ID NO: 32, and a VLCDR3 amino acid sequence of SEQ I D NO: 33, each disclosed in Table 3.
  • VH heavy chain variable region
  • VL light chain variable region
  • the antibody molecule comprises a VH comprising a VHCDR1 encoded by the nucleotide sequence of SEQ ID NO: 45, a VHCDR2 encoded by the nucleotide sequence of SEQ ID NO: 46, and a VHCDR3 encoded by the nucleotide sequence of SEQ ID NO: 47; and a VL comprising a VLCDR1 encoded by the nucleotide sequence of SEQ ID NO: 50, a VLCDR2 encoded by the nucleotide sequence of SEQ ID NO: 51 , and a VLCDR3 encoded by the nucleotide sequence of SEQ ID NO: 52, each disclosed in Table 3.
  • the anti-PD-1 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 27, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 27. In one embodiment, the anti-PD-1 antibody molecule comprises a VL comprising the amino acid sequence of SEQ ID NO: 41 , or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 41 . In one embodiment, the anti-PD-1 antibody molecule comprises a VL comprising the amino acid sequence of SEQ ID NO: 37, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 37.
  • the anti-PD-1 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 27 and a VL comprising the amino acid sequence of SEQ ID NO: 41 . In one embodiment, the anti-PD-1 antibody molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 27 and a VL comprising the amino acid sequence of SEQ ID NO: 37.
  • the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 28, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 28. In one embodiment, the antibody molecule comprises a VL encoded by the nucleotide sequence of SEQ ID NO: 42 or 38, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 42 or 38. In one embodiment, the antibody molecule comprises a VH encoded by the nucleotide sequence of SEQ ID NO: 28 and a VL encoded by the nucleotide sequence of SEQ ID NO: 42 or 38.
  • the anti-PD-1 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 29, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 29. In one embodiment, the anti- PD-1 antibody molecule comprises a light chain comprising the amino acid sequence of SEQ ID NO: 43, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 43. In one embodiment, the anti-PD-1 antibody molecule comprises a light chain comprising the amino acid sequence of SEQ ID NO: 39, or an amino acid sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 39.
  • the anti- PD-1 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 29 and a light chain comprising the amino acid sequence of SEQ ID NO: 43. In one embodiment, the anti-PD-1 antibody molecule comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 29 and a light chain comprising the amino acid sequence of SEQ ID NO: 39. In one embodiment, the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 30, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 30.
  • the antibody molecule comprises a light chain encoded by the nucleotide sequence of SEQ ID NO: 44 or 40, or a nucleotide sequence at least 85%, 90%, 95%, or 99% identical or higher to SEQ ID NO: 44 or 40.
  • the antibody molecule comprises a heavy chain encoded by the nucleotide sequence of SEQ ID NO: 30 and a light chain encoded by the nucleotide sequence of SEQ ID NO: 44 or 40.
  • the antibody molecules described herein can be made by vectors, host cells, and methods described in US 2015/0210769, incorporated by reference in its entirety.
  • VH and VL regions can be subdivided into regions of hypervariability, termed “complementarity determining regions” (CDR), interspersed with regions that are more conserved, termed “framework regions” (FR or FW).
  • CDR complementarity determining regions
  • FR framework regions
  • CDR complementarity determining region
  • the CDR amino acid residues in the heavy chain variable domain (VH) are numbered 31 -35 (HCDR1 ), 50-65 (HCDR2), and 95-102 (HCDR3); and the CDR amino acid residues in the light chain variable domain (VL) are numbered 24-34 (LCDR1 ), 50-56 (LCDR2), and 89-97 (LCDR3).
  • the CDR amino acids in the VH are numbered 26-32 (HCDR1 ), 52-56 (HCDR2), and 95-102 (HCDR3); and the amino acid residues in VL are numbered 26-32 (LCDR1 ), 50-52 (LCDR2), and 91 -96 (LCDR3).
  • the CDRs consist of amino acid residues 26-35 (HCDR1 ), 50-65 (HCDR2), and 95-102 (HCDR3) in human VH and amino acid residues 24-34 (LCDR1 ), 50-56 (LCDR2), and 89-97 (LCDR3) in human VL.
  • the anti-PD-1 antibody molecules can include any combination of one or more Kabat CDRs and/or Chothia CDRs, e.g., described in Table 3.
  • the following definitions are used for the anti-PD-1 antibody molecules described in Table 3: HCDR1 according to the combined CDR definitions of both Kabat and Chothia, and HCCDRs 2-3 and LCCDRs 1 -3 according the CDR definition of Kabat.
  • each VH and VL typically includes three CDRs and four FRs, arranged from amino- terminus to carboxy-terminus in the following order: FR1 , CDR1 , FR2, CDR2, FR3, CDR3, FR4.
  • the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes).
  • the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, 60%, and even more preferably at least 70%, 80%, 90%, 100% of the length of the reference sequence.
  • the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared.
  • amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid “homology”
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
  • the percent identity between two amino acid sequences is determined using the Needleman and Wunsch ((1970) J. Mol. Biol. 48:444-453 ) algorithm which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4, 5, or 6.
  • the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1 , 2, 3, 4, 5, or 6.
  • a particularly preferred set of parameters are a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
  • the percent identity between two amino acid or nucleotide sequences can be determined using the algorithm of E. Meyers and W. Miller ((1989) CABIOS, 4:1 1 -17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • nucleic acid and protein sequences described herein can be used as a "query sequence" to perform a search against public databases to, for example, identify other family members or related sequences.
  • Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.
  • Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402.
  • the default parameters of the respective programs e.g., XBLAST and NBLAST
  • XBLAST and NBLAST can be used. See www.ncbi.nlm.nih.gov.
  • a “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
  • Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • SEQ ID NO: 28 DNA VH CCGTGACCGTGTCTAGC
  • SEQ ID NO: 30 DNA HC CACCTTGTAGCCGGAGCACTAGCGAA
  • SEQ ID NO: 28 DNA VH CCGTGACCGTGTCTAGC
  • SEQ ID NO: 30 DNA HC TACCCCGGCACCGGCGGCTCTAACTT CGACGAGAAGTTTAAGAATAGAGTGA
  • the anti PD-1 antibody for use in the combinations, methods and compositions of the invention comprises: (a) a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 25, a VHCDR2 amino acid sequence of SEQ ID NO: 26, and a VHCDR3 amino acid sequence of SEQ ID NO: 24; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 34, a VLCDR2 amino acid sequence of SEQ ID NO: 35, and a VLCDR3 amino acid sequence of SEQ ID NO: 36;
  • VH heavy chain variable region
  • VL light chain variable region
  • VH heavy chain variable region
  • VL light chain variable region
  • a heavy chain variable region comprising a VHCDR1 amino acid sequence of SEQ ID NO: 21 , a VHCDR2 amino acid sequence of SEQ ID NO: 26, and a VHCDR3 amino acid sequence of SEQ ID NO: 24; and a a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 34, a VLCDR2 amino acid sequence of SEQ ID NO: 35, and a VLCDR3 amino acid sequence of SEQ ID NO: 36; or
  • VH heavy chain variable region
  • VL light chain variable region
  • the anti PD-1 antibody for use in the combinations, methods and compositions of the invention comprises a VH comprising the amino acid sequence of SEQ ID NO: 27 and a VL comprising the amino acid sequence of SEQ ID NO: 41 .
  • the anti PD-1 antibody for use in the combinations, methods and compositions of the invention comprises a VH comprising the amino acid sequence of SEQ ID NO: 27 and a VL comprising the amino acid sequence of SEQ ID NO: 37.
  • the anti PD-1 antibody for use in the combinations, methods and compositions of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 29 and a light chain comprising the amino acid sequence of SEQ ID NO: 43.
  • the anti PD-1 antibody for use in the combinations, methods and compositions of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 29 and a light chain comprising the amino acid sequence of SEQ ID NO: 39.
  • Other Exemplary PD-1 Inhibitors for use in the combinations described herein comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 29 and a light chain comprising the amino acid sequence of SEQ ID NO: 39.
  • the anti-PD-1 antibody molecule is Nivolumab (Bristol-Myers Squibb), also known as MDX-1 106, MDX-1 106-04, ONO-4538, BMS-936558, or OPDIVO®.
  • Nivolumab clone 5C4
  • other anti-PD-1 antibodies are disclosed in US 8,008,449 and WO 2006/121 168, incorporated by reference in their entirety.
  • the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of Nivolumab, e.g., as disclosed in Table 4.
  • the anti-PD-1 antibody molecule is Pembrolizumab (Merck & Co), also known as Lambrolizumab, MK-3475, MK03475, SCH-900475, or KEYTRUDA®.
  • the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of Pembrolizumab, e.g., as disclosed in Table 4.
  • the anti-PD-1 antibody molecule is Pidilizumab (CureTech), also known as CT-01 1 .
  • Pidilizumab and other anti-PD-1 antibodies are disclosed in Rosenblatt, J. et al. (201 1 ) J Immunotherapy 34(5): 409-18, US 7,695,715, US 7,332,582, and US 8,686,1 19, incorporated by reference in their entirety.
  • the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of Pidilizumab, e.g., as disclosed in Table 4.
  • the anti-PD-1 antibody molecule is MEDI0680 (Medimmune), also known as AMP-514. MEDI0680 and other anti-PD-1 antibodies are disclosed in US 9,205,148 and WO 2012/145493, incorporated by reference in their entirety.
  • the anti- PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of MEDI0680.
  • the anti-PD-1 antibody molecule is REGN2810 (Regeneron). In one embodiment, the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of REGN2810.
  • the anti-PD-1 antibody molecule is PF-06801591 (Pfizer). In one embodiment, the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of PF-06801591 . In one embodiment, the anti-PD-1 antibody molecule is BGB-A317 or BGB-108 (Beigene). In one embodiment, the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of BGB-A317 or BGB- 108.
  • the anti-PD-1 antibody molecule is INCSHR1210 (Incyte), also known as INCSHR01210 or SHR-1210. In one embodiment, the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of INCSHR1210.
  • the anti-PD-1 antibody molecule is TSR-042 (Tesaro), also known as ANB01 1 .
  • the anti-PD-1 antibody molecule comprises one or more of the CDR sequences (or collectively all of the CDR sequences), the heavy chain or light chain variable region sequence, or the heavy chain or light chain sequence of TSR-042.
  • anti-PD-1 antibodies include those described, e.g., in WO 2015/1 12800,
  • the anti-PD-1 antibody is an antibody that competes for binding with, and/or binds to the same epitope on PD-1 as, one of the anti-PD-1 antibodies described herein.
  • the PD-1 inhibitor is a peptide that inhibits the PD-1 signaling pathway, e.g., as described in US 8,907,053, incorporated by reference in its entirety.
  • the PD-1 inhibitor is an immunoadhesin (e.g., an immunoadhesin comprising an extracellular or PD-1 binding portion of PD-L1 or PD-L2 fused to a constant region (e.g., an Fc region of an immunoglobulin sequence).
  • the PD-1 inhibitor is AMP-224 (B7-DCIg (Amplimmune), e.g., disclosed in WO 2010/027827 and WO 201 1/066342, incorporated by reference in their entirety). Table 4. Amino acid sequences of other exemplary anti-PD-1 antibody molecules

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Inorganic Chemistry (AREA)
  • Dispersion Chemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Dermatology (AREA)
  • Oncology (AREA)
  • Endocrinology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
PCT/IB2018/053481 2017-05-19 2018-05-17 Compositions comprising naphthyridine derivatives and aluminium adjuvant for use in treating solid tumors Ceased WO2018211453A1 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
MX2019013720A MX2019013720A (es) 2017-05-19 2018-05-17 Composiciones que comprenden derivados de naftiridina y adyuvante de aluminio para uso en el tratamiento de tumores solidos.
CA3062609A CA3062609A1 (en) 2017-05-19 2018-05-17 Compositions comprising naphthyridine derivatives and aluminium adjuvant for use in treating solid tumors
CN201880032524.5A CN110636848A (zh) 2017-05-19 2018-05-17 用于治疗实体肿瘤的包含萘啶衍生物和铝辅助剂的组合物
RU2019141837A RU2787157C2 (ru) 2017-05-19 2018-05-17 Композиции, содержащие производные нафтиридина и алюмосодержащее вспомогательное средство, предназначенные для применения в лечении солидных опухолей
EP18730857.2A EP3624806A1 (en) 2017-05-19 2018-05-17 Compositions comprising naphthyridine derivatives and aluminium adjuvant for use in treating solid tumors
CN202310419489.5A CN116473981A (zh) 2017-05-19 2018-05-17 用于治疗实体肿瘤的包含萘啶衍生物和铝辅助剂的组合物
JP2019563379A JP2020520910A (ja) 2017-05-19 2018-05-17 固形腫瘍の治療において使用するための、ナフチリジン誘導体及びアルミニウムアジュバントを含む組成物
BR112019024260A BR112019024260A2 (pt) 2017-05-19 2018-05-17 composições que compreende derivados de naftiridina e adjuvante de aluminio para uso no tratamento de tumores solidos
AU2018268420A AU2018268420B2 (en) 2017-05-19 2018-05-17 Compositions comprising naphthyridine derivatives and aluminium adjuvant for use in treating solid tumors
US16/614,280 US11752162B2 (en) 2017-05-19 2018-05-17 Compounds and compositions for treating solid tumors by intratumoral administration
KR1020197037113A KR20200007040A (ko) 2017-05-19 2018-05-17 고형 종양을 치료하는 데 사용하기 위한 나프티리딘 유도체 및 알루미늄 애쥬번트를 포함하는 조성물
AU2021203564A AU2021203564B2 (en) 2017-05-19 2021-06-01 Compositions comprising naphthyridine derivatives and aluminium adjuvant for use in treating solid tumors
US18/360,909 US20240009215A1 (en) 2017-05-19 2023-07-28 Compounds and compositions for treating solid tumors by intratumoral administration

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762508474P 2017-05-19 2017-05-19
US62/508,474 2017-05-19

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/614,280 A-371-Of-International US11752162B2 (en) 2017-05-19 2018-05-17 Compounds and compositions for treating solid tumors by intratumoral administration
US18/360,909 Continuation US20240009215A1 (en) 2017-05-19 2023-07-28 Compounds and compositions for treating solid tumors by intratumoral administration

Publications (1)

Publication Number Publication Date
WO2018211453A1 true WO2018211453A1 (en) 2018-11-22

Family

ID=62597814

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2018/053481 Ceased WO2018211453A1 (en) 2017-05-19 2018-05-17 Compositions comprising naphthyridine derivatives and aluminium adjuvant for use in treating solid tumors

Country Status (13)

Country Link
US (2) US11752162B2 (cg-RX-API-DMAC7.html)
EP (1) EP3624806A1 (cg-RX-API-DMAC7.html)
JP (2) JP2020520910A (cg-RX-API-DMAC7.html)
KR (1) KR20200007040A (cg-RX-API-DMAC7.html)
CN (2) CN110636848A (cg-RX-API-DMAC7.html)
AR (1) AR111760A1 (cg-RX-API-DMAC7.html)
AU (2) AU2018268420B2 (cg-RX-API-DMAC7.html)
BR (1) BR112019024260A2 (cg-RX-API-DMAC7.html)
CA (1) CA3062609A1 (cg-RX-API-DMAC7.html)
CL (1) CL2019003293A1 (cg-RX-API-DMAC7.html)
MX (2) MX2019013720A (cg-RX-API-DMAC7.html)
TW (1) TW201900166A (cg-RX-API-DMAC7.html)
WO (1) WO2018211453A1 (cg-RX-API-DMAC7.html)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022009157A1 (en) 2020-07-10 2022-01-13 Novartis Ag Lhc165 and spartalizumab combinations for treating solid tumors
US11364304B2 (en) 2016-08-25 2022-06-21 Northwestern University Crosslinked micellar spherical nucleic acids

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109843327B (zh) 2016-07-07 2022-05-13 小利兰·斯坦福大学托管委员会 抗体佐剂缀合物
AR111760A1 (es) * 2017-05-19 2019-08-14 Novartis Ag Compuestos y composiciones para el tratamiento de tumores sólidos mediante administración intratumoral
WO2020190725A1 (en) 2019-03-15 2020-09-24 Bolt Biotherapeutics, Inc. Immunoconjugates targeting her2

Citations (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4689338A (en) 1983-11-18 1987-08-25 Riker Laboratories, Inc. 1H-Imidazo[4,5-c]quinolin-4-amines and antiviral use
US5446153A (en) 1993-07-15 1995-08-29 Minnesota Mining And Manufacturing Company Intermediates for imidazo[4,5-c]pyridin-4-amines
US6110929A (en) 1998-07-28 2000-08-29 3M Innovative Properties Company Oxazolo, thiazolo and selenazolo [4,5-c]-quinolin-4-amines and analogs thereof
US6194425B1 (en) 1997-12-11 2001-02-27 3M Innovative Properties Company Imidazonaphthyridines
WO2006121168A1 (en) 2005-05-09 2006-11-16 Ono Pharmaceutical Co., Ltd. Human monoclonal antibodies to programmed death 1(pd-1) and methods for treating cancer using anti-pd-1 antibodies alone or in combination with other immunotherapeutics
US7332582B2 (en) 2002-05-23 2008-02-19 Curetech Ltd. Humanized immunomodulatory monoclonal antibodies for the treatment of neoplastic disease or immunodeficiency
US7488802B2 (en) 2002-12-23 2009-02-10 Wyeth Antibodies against PD-1
WO2009114335A2 (en) 2008-03-12 2009-09-17 Merck & Co., Inc. Pd-1 binding proteins
WO2010027827A2 (en) 2008-08-25 2010-03-11 Amplimmune, Inc. Targeted costimulatory polypeptides and methods of use to treat cancer
US7695715B2 (en) 1999-03-31 2010-04-13 Mor Research Applications Ltd. Monoclonal antibodies, antigens and diagnosis and therapy of malignant diseases
WO2011049677A1 (en) 2009-09-02 2011-04-28 Irm Llc Compounds and compositions as tlr activity modulators
WO2011066342A2 (en) 2009-11-24 2011-06-03 Amplimmune, Inc. Simultaneous inhibition of pd-l1/pd-l2
WO2012031140A1 (en) * 2010-09-01 2012-03-08 Novartis Ag Adsorption of immunopotentiators to insoluble metal salts
WO2012145493A1 (en) 2011-04-20 2012-10-26 Amplimmune, Inc. Antibodies and other molecules that bind b7-h1 and pd-1
US8354509B2 (en) 2007-06-18 2013-01-15 Msd Oss B.V. Antibodies to human programmed death receptor PD-1
WO2013030378A1 (en) * 2011-09-01 2013-03-07 Novartis Ag Adjuvanted formulations of staphylococcus aureus antigens
US8466167B2 (en) 2008-03-03 2013-06-18 Irm Llc Compounds and compositions as TLR activity modulators
US8686119B2 (en) 2011-07-24 2014-04-01 Curetech Ltd. Variants of humanized immunomodulatory monoclonal antibodies
US8735553B1 (en) 2013-09-13 2014-05-27 Beigene, Ltd. Anti-PD1 antibodies and their use as therapeutics and diagnostics
WO2014179664A2 (en) 2013-05-02 2014-11-06 Anaptysbio, Inc. Antibodies directed against programmed death-1 (pd-1)
WO2014194302A2 (en) 2013-05-31 2014-12-04 Sorrento Therapeutics, Inc. Antigen binding proteins that bind pd-1
US8907053B2 (en) 2010-06-25 2014-12-09 Aurigene Discovery Technologies Limited Immunosuppression modulating compounds
WO2014209804A1 (en) 2013-06-24 2014-12-31 Biomed Valley Discoveries, Inc. Bispecific antibodies
US8927697B2 (en) 2008-09-12 2015-01-06 Isis Innovation Limited PD-1 specific antibodies and uses thereof
US8993731B2 (en) 2010-03-11 2015-03-31 Ucb Biopharma Sprl PD-1 antibody
WO2015085847A1 (zh) 2013-12-12 2015-06-18 上海恒瑞医药有限公司 Pd-1抗体、其抗原结合片段及其医药用途
WO2015112800A1 (en) 2014-01-23 2015-07-30 Regeneron Pharmaceuticals, Inc. Human antibodies to pd-1
US20150210769A1 (en) 2014-01-24 2015-07-30 Novartis Ag Antibody molecules to pd-1 and uses thereof
US9102727B2 (en) 2008-09-26 2015-08-11 Emory University Human anti-PD-1 antibodies and uses therefor
US9145410B2 (en) 2003-10-03 2015-09-29 3M Innovative Properties Company Pyrazolopyridines and analogs thereof
WO2015200119A1 (en) 2014-06-26 2015-12-30 Macrogenics, Inc. Covalently bonded diabodies having immunoreactivity with pd-1 and lag-3, and methods of use thereof
US20160108123A1 (en) 2014-10-14 2016-04-21 Novartis Ag Antibody molecules to pd-l1 and uses thereof
WO2016092419A1 (en) 2014-12-09 2016-06-16 Rinat Neuroscience Corp. Anti-pd-1 antibodies and methods of use thereof

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040265351A1 (en) 2003-04-10 2004-12-30 Miller Richard L. Methods and compositions for enhancing immune response
GB0321710D0 (en) 2003-09-16 2003-10-15 Novartis Ag Organic compounds
JP5867952B2 (ja) * 2009-06-10 2016-02-24 ノバルティス アーゲー ベンゾナフチリジン含有ワクチン
WO2011027222A2 (en) 2009-09-02 2011-03-10 Novartis Ag Immunogenic compositions including tlr activity modulators
CA2795050C (en) * 2010-03-31 2018-05-22 Stabilitech Ltd. Method for preserving alum adjuvants and alum-adjuvanted vaccines
EP2558069A1 (en) 2010-04-13 2013-02-20 Novartis AG Benzonapthyridine compositions and uses thereof
EP2532359A1 (en) * 2011-06-10 2012-12-12 Affiris AG CETP fragments
BR112015018014A2 (pt) 2013-02-01 2017-07-11 Glaxosmithkline Biologicals Sa liberação intradérmica de composições imunológicas compreendendo agonistas do receptor do tipo toll
BE1022875B1 (fr) 2014-03-26 2016-09-30 Glaxosmithkline Biologicals S.A. Compositions pour une immunisation contre staphylococcus aureus
EA201790180A1 (ru) 2014-08-01 2017-07-31 3М Инновейтив Пропертиз Компани Способы и терапевтические комбинации для лечения опухолей
CN105296433B (zh) 2014-08-01 2018-02-09 中山康方生物医药有限公司 一种ctla4抗体、其药物组合物及其用途
RU2734924C2 (ru) * 2015-11-03 2020-10-26 Аффирис Аг Способ вакцинации против аутоантигена у пациента-человека
AR111760A1 (es) * 2017-05-19 2019-08-14 Novartis Ag Compuestos y composiciones para el tratamiento de tumores sólidos mediante administración intratumoral

Patent Citations (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4689338A (en) 1983-11-18 1987-08-25 Riker Laboratories, Inc. 1H-Imidazo[4,5-c]quinolin-4-amines and antiviral use
US5446153A (en) 1993-07-15 1995-08-29 Minnesota Mining And Manufacturing Company Intermediates for imidazo[4,5-c]pyridin-4-amines
US6194425B1 (en) 1997-12-11 2001-02-27 3M Innovative Properties Company Imidazonaphthyridines
US6110929A (en) 1998-07-28 2000-08-29 3M Innovative Properties Company Oxazolo, thiazolo and selenazolo [4,5-c]-quinolin-4-amines and analogs thereof
US7695715B2 (en) 1999-03-31 2010-04-13 Mor Research Applications Ltd. Monoclonal antibodies, antigens and diagnosis and therapy of malignant diseases
US7332582B2 (en) 2002-05-23 2008-02-19 Curetech Ltd. Humanized immunomodulatory monoclonal antibodies for the treatment of neoplastic disease or immunodeficiency
US7488802B2 (en) 2002-12-23 2009-02-10 Wyeth Antibodies against PD-1
US9145410B2 (en) 2003-10-03 2015-09-29 3M Innovative Properties Company Pyrazolopyridines and analogs thereof
US8008449B2 (en) 2005-05-09 2011-08-30 Medarex, Inc. Human monoclonal antibodies to programmed death 1 (PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics
WO2006121168A1 (en) 2005-05-09 2006-11-16 Ono Pharmaceutical Co., Ltd. Human monoclonal antibodies to programmed death 1(pd-1) and methods for treating cancer using anti-pd-1 antibodies alone or in combination with other immunotherapeutics
US8354509B2 (en) 2007-06-18 2013-01-15 Msd Oss B.V. Antibodies to human programmed death receptor PD-1
US8466167B2 (en) 2008-03-03 2013-06-18 Irm Llc Compounds and compositions as TLR activity modulators
WO2009114335A2 (en) 2008-03-12 2009-09-17 Merck & Co., Inc. Pd-1 binding proteins
WO2010027827A2 (en) 2008-08-25 2010-03-11 Amplimmune, Inc. Targeted costimulatory polypeptides and methods of use to treat cancer
US8927697B2 (en) 2008-09-12 2015-01-06 Isis Innovation Limited PD-1 specific antibodies and uses thereof
US9102727B2 (en) 2008-09-26 2015-08-11 Emory University Human anti-PD-1 antibodies and uses therefor
WO2011049677A1 (en) 2009-09-02 2011-04-28 Irm Llc Compounds and compositions as tlr activity modulators
US9045470B2 (en) 2009-09-02 2015-06-02 Irm Llc Compounds and compositions as TLR activity modulators
WO2011066342A2 (en) 2009-11-24 2011-06-03 Amplimmune, Inc. Simultaneous inhibition of pd-l1/pd-l2
US8993731B2 (en) 2010-03-11 2015-03-31 Ucb Biopharma Sprl PD-1 antibody
US8907053B2 (en) 2010-06-25 2014-12-09 Aurigene Discovery Technologies Limited Immunosuppression modulating compounds
WO2012031140A1 (en) * 2010-09-01 2012-03-08 Novartis Ag Adsorption of immunopotentiators to insoluble metal salts
US9205148B2 (en) 2011-04-20 2015-12-08 Medimmune, Llc Antibodies and other molecules that bind B7-H1 and PD-1
WO2012145493A1 (en) 2011-04-20 2012-10-26 Amplimmune, Inc. Antibodies and other molecules that bind b7-h1 and pd-1
US8686119B2 (en) 2011-07-24 2014-04-01 Curetech Ltd. Variants of humanized immunomodulatory monoclonal antibodies
WO2013030378A1 (en) * 2011-09-01 2013-03-07 Novartis Ag Adjuvanted formulations of staphylococcus aureus antigens
WO2014179664A2 (en) 2013-05-02 2014-11-06 Anaptysbio, Inc. Antibodies directed against programmed death-1 (pd-1)
WO2014194302A2 (en) 2013-05-31 2014-12-04 Sorrento Therapeutics, Inc. Antigen binding proteins that bind pd-1
WO2014209804A1 (en) 2013-06-24 2014-12-31 Biomed Valley Discoveries, Inc. Bispecific antibodies
US8735553B1 (en) 2013-09-13 2014-05-27 Beigene, Ltd. Anti-PD1 antibodies and their use as therapeutics and diagnostics
WO2015085847A1 (zh) 2013-12-12 2015-06-18 上海恒瑞医药有限公司 Pd-1抗体、其抗原结合片段及其医药用途
WO2015112800A1 (en) 2014-01-23 2015-07-30 Regeneron Pharmaceuticals, Inc. Human antibodies to pd-1
US20150210769A1 (en) 2014-01-24 2015-07-30 Novartis Ag Antibody molecules to pd-1 and uses thereof
WO2015200119A1 (en) 2014-06-26 2015-12-30 Macrogenics, Inc. Covalently bonded diabodies having immunoreactivity with pd-1 and lag-3, and methods of use thereof
US20160108123A1 (en) 2014-10-14 2016-04-21 Novartis Ag Antibody molecules to pd-l1 and uses thereof
WO2016092419A1 (en) 2014-12-09 2016-06-16 Rinat Neuroscience Corp. Anti-pd-1 antibodies and methods of use thereof

Non-Patent Citations (25)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences, 18th ed.", 1990, MACK PRINTING COMPANY
"Remington's Pharmaceutical Sciences, 20th ed.", 1985, MACK PUBLISHING COMPANY
ALEX CORTEZ ET AL: "Incorporation of Phosphonate into Benzonaphthyridine Toll-like Receptor 7 Agonists for Adsorption to Aluminum Hydroxide", JOURNAL OF MEDICINAL CHEMISTRY, vol. 59, no. 12, 13 June 2016 (2016-06-13), pages 5868 - 5878, XP055494774, ISSN: 0022-2623, DOI: 10.1021/acs.jmedchem.6b00489 *
AL-LAZIKANI ET AL., JMB, vol. 273, 1997, pages 927 - 948
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 10
ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402
CHOTHIA ET AL., J. MOL. BIOL., vol. 227, 1992, pages 799 - 817
CHOTHIA, C. ET AL., J. MOL. BIOL., vol. 196, 1987, pages 901 - 917
DAVIES B; MORRIS T: "Physiological parameters in laboratory animals and humans", PHARMACEUTICAL RESEARCH, vol. 10, 1993, pages 1093 - 95
DUEBEL, S. AND KONTERMANN, R.: "Antibody Engineering Lab Manual", SPRINGER-VERLAG, article "Protein Sequence and Structure Analysis of Antibody Variable Domains"
E. MEYERS; W. MILLER, CABIOS, vol. 4, 1989, pages 11 - 17
EXPERT OPIN. EMERGING DRUGS, vol. 15, 2010, pages 544 - 555
EXPERT REV. VACCINES, vol. 46, no. 5, 2007, pages 685 - 698
HAMID, O. ET AL., NEW ENGLAND JOURNAL OF MEDICINE, vol. 369, no. 2, 2013, pages 134 - 44
J. IMMUNOL., vol. 193, no. 9, 2014, pages 4722 - 4731
JENNIFER DINE ET AL: "Immune checkpoint inhibitors: An innovation in immunotherapy for the treatment and management of patients with cancer", ASIA-PACIFIC JOURNAL OF ONCOLOGY NURSING, vol. 4, no. 2, 1 January 2017 (2017-01-01), pages 127, XP055495196, ISSN: 2347-5625, DOI: 10.4103/apjon.apjon_4_17 *
JOURNAL FOR IMMUNOTHERAPY OF CANCER, vol. 2, 2014, pages 12
KABAT ET AL.: "Sequences of Proteins of Immunological Interest, 5th ed.", 1991, PUBLIC HEALTH SERVICE, NATIONAL INSTITUTES OF HEALTH
KABAT, E. A. ET AL.: "Sequences of Proteins of Immunological Interest, 5th ed", 1991, U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES, NIH
MATTHIEU COLLIN: "Immune checkpoint inhibitors: a patent review (2010-2015)", EXPERT OPINION ON THERAPEUTIC PATENTS, vol. 26, no. 5, 18 April 2016 (2016-04-18), pages 555 - 564, XP055294986, ISSN: 1354-3776, DOI: 10.1080/13543776.2016.1176150 *
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 444 - 453
PHARMA TIMES, vol. 45, no. 3, 2013, pages 65 - 77
ROSENBLATT, J. ET AL., J IMMUNOTHERAPY, vol. 34, no. 5, 2011, pages 409 - 18
STAHL; WERMUTH: "Handbook of Pharmaceutical Salts: Properties, Selection, and Use", 2002, WILEY-VCH
VACCINES, vol. 25, 2007, pages 6618 - 6624

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11364304B2 (en) 2016-08-25 2022-06-21 Northwestern University Crosslinked micellar spherical nucleic acids
WO2022009157A1 (en) 2020-07-10 2022-01-13 Novartis Ag Lhc165 and spartalizumab combinations for treating solid tumors

Also Published As

Publication number Publication date
CL2019003293A1 (es) 2020-03-13
US20210154214A1 (en) 2021-05-27
RU2019141837A (ru) 2021-06-21
AR111760A1 (es) 2019-08-14
US11752162B2 (en) 2023-09-12
BR112019024260A2 (pt) 2020-06-09
AU2018268420B2 (en) 2021-07-15
MX2023004381A (es) 2023-05-04
AU2018268420A1 (en) 2019-11-21
AU2021203564B2 (en) 2023-01-05
TW201900166A (zh) 2019-01-01
JP2023093524A (ja) 2023-07-04
JP2020520910A (ja) 2020-07-16
CN116473981A (zh) 2023-07-25
MX2019013720A (es) 2020-01-30
CA3062609A1 (en) 2018-11-22
AU2021203564A1 (en) 2021-07-01
US20240009215A1 (en) 2024-01-11
CN110636848A (zh) 2019-12-31
EP3624806A1 (en) 2020-03-25
RU2019141837A3 (cg-RX-API-DMAC7.html) 2021-09-10
KR20200007040A (ko) 2020-01-21

Similar Documents

Publication Publication Date Title
US20240009215A1 (en) Compounds and compositions for treating solid tumors by intratumoral administration
US12383572B2 (en) Administration of an anti-activin-a compound to a subject
EP3689370B1 (en) Anti-gdf15 antibodies
RU2743077C2 (ru) Конъюгат анти-trop2 антитело-лекарственное средство
KR20190140472A (ko) 톨-유사 수용체 작용제를 포함하는 항체 접합체 및 병용 요법
KR20180068989A (ko) 톨-유사 수용체 효능제를 포함하는 항체 접합체
JP2018523652A (ja) Pd−1アンタゴニストとegfr阻害剤の組み合わせ物
US20140220033A1 (en) Administration of an Anti-Activin-A Compound to a Subject
KR20140063825A (ko) 클로스트리듐 디피실의 주요 외독소 tcda 및 tcdb에 대한 중화 항체
JP6951441B2 (ja) Met抗体薬物複合体
EP3180356B1 (en) Human anti-fgfr4 antibody
CN114762678B (zh) 抗tigit抗体药物组合物及其用途
EP2593479A1 (en) Superior efficacy of cd37 antibodies in cll blood samples
JP6909220B2 (ja) ヒト抗fgfr4抗体およびソラフェニブの組み合わせ
RU2787157C2 (ru) Композиции, содержащие производные нафтиридина и алюмосодержащее вспомогательное средство, предназначенные для применения в лечении солидных опухолей
CN112236166A (zh) 用于治疗骨疾病的转铁蛋白受体-2的拮抗剂和激动剂
WO2022009157A1 (en) Lhc165 and spartalizumab combinations for treating solid tumors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18730857

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3062609

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2019563379

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018268420

Country of ref document: AU

Date of ref document: 20180517

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019024260

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 20197037113

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2018730857

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2018730857

Country of ref document: EP

Effective date: 20191219

ENP Entry into the national phase

Ref document number: 112019024260

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20191118

WWR Wipo information: refused in national office

Ref document number: 519410586

Country of ref document: SA

WWW Wipo information: withdrawn in national office

Ref document number: 2018730857

Country of ref document: EP