WO2018174544A2 - Muc1에 특이적으로 결합하는 항체 및 그의 용도 - Google Patents

Muc1에 특이적으로 결합하는 항체 및 그의 용도 Download PDF

Info

Publication number
WO2018174544A2
WO2018174544A2 PCT/KR2018/003267 KR2018003267W WO2018174544A2 WO 2018174544 A2 WO2018174544 A2 WO 2018174544A2 KR 2018003267 W KR2018003267 W KR 2018003267W WO 2018174544 A2 WO2018174544 A2 WO 2018174544A2
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
muc1
cancer
cells
antigen
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2018/003267
Other languages
English (en)
French (fr)
Other versions
WO2018174544A3 (ko
Inventor
문경덕
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Peptron Inc
Original Assignee
Peptron Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to MX2019011101A priority Critical patent/MX2019011101A/es
Priority to US16/495,373 priority patent/US11472887B2/en
Priority to BR112019019650-1A priority patent/BR112019019650A2/pt
Priority to IL269488A priority patent/IL269488B2/en
Priority to EP20212863.3A priority patent/EP3825328A1/en
Priority to CN201880026127.7A priority patent/CN111201240B/zh
Priority to AU2018238165A priority patent/AU2018238165C1/en
Priority to JP2019552556A priority patent/JP7032425B2/ja
Priority claimed from KR1020180032592A external-priority patent/KR102127421B1/ko
Priority to CA3056582A priority patent/CA3056582C/en
Priority to RU2019132900A priority patent/RU2746413C1/ru
Priority to EP18771928.1A priority patent/EP3604334A4/en
Application filed by Peptron Inc filed Critical Peptron Inc
Publication of WO2018174544A2 publication Critical patent/WO2018174544A2/ko
Publication of WO2018174544A3 publication Critical patent/WO2018174544A3/ko
Anticipated expiration legal-status Critical
Priority to ZA2019/06813A priority patent/ZA201906813B/en
Priority to AU2020281132A priority patent/AU2020281132B2/en
Priority to AU2020281130A priority patent/AU2020281130B2/en
Priority to US17/116,265 priority patent/US11718684B2/en
Priority to JP2021158852A priority patent/JP7158547B2/ja
Priority to JP2021158853A priority patent/JP7158548B2/ja
Priority to US17/811,845 priority patent/US11739158B2/en
Priority to US17/811,904 priority patent/US11739159B2/en
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10Cells modified by introduction of foreign genetic material
    • C12N5/12Fused cells, e.g. hybridomas
    • C12N5/16Animal cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer

Definitions

  • the present invention relates to an anti-MUC1 antibody that specifically binds to MUC1 (Mucin 1) and its use, and more particularly, to an anti-MUC1 antibody or antigen-binding fragment thereof, the antibody or antigen-binding fragment thereof -Drug conjugates or bispecific antibodies, pharmaceutical compositions for the prevention or treatment of cancer comprising the same, nucleic acids encoding the antibodies or antigen-binding fragments thereof, vectors and host cells comprising the nucleic acids, anti-MUC1 antibodies or the same It relates to a method for preparing an antigen binding fragment.
  • Mucin 1 (MUC1, Mucin 1) is a transmembrane glycoprotein comprising a number of glycated extracellular domains. MUC1 length is 200-500 nm at the cell surface and MUC1 is located in the apical membrane of normal epithelial cells. MUC1 is expressed in glandular or luminal epithelial cells of many organs such as the breast, stomach, esophagus, pancreas, urethra, lungs, kidneys and gallbladder. The negatively charged carbohydrates of MUC1 in normal tissues form physical barriers that protect the basal epithelium from dehydration, pH changes, pollen and microorganisms.
  • the MUC1 gene encodes a single transcript. After translation, MUC1 is autocleaved in the GSVVV motif located in the sea urchin sperm protein enterokinase and agrin (SEA) domains. These consist of two peptide fragments, the N-terminal subunit (MUC1-N) and the C-terminal subunit (MUC1-C).
  • GSVVV motif located in the sea urchin sperm protein enterokinase and agrin (SEA) domains.
  • SEA sea urchin sperm protein enterokinase and agrin
  • the MUC1-N terminal subunit has a variable number of Tandem Repeats and consists of a Proline / Threonine / Serine-rich (PTS) domain and a SEA domain.
  • the MUC1-C terminal subunit consists of 58 amino acid extracellular domains (ECDs), 28 transmembrane domains (TMDs) and 72 amino acid cytoplasmic domains (CDs).
  • ECDs extracellular domains
  • TMDs transmembrane domains
  • CDs 72 amino acid cytoplasmic domains
  • MUC1 extensively O-linked glycosylation in the extracellular domain. Depending on the extent of the N-glycosylation pattern, the MUC1-C size ranges from 23 to 25 kDa, or 17 kDa in the absence of N-glycosylation.
  • MUC1 is bound to a cell by a noncovalent interaction between a part that can be released from the cell and cleavage occurs by an enzyme called Sheddase.
  • MUC1 complexes are isolated by stimulation of cytokines such as IFN- ⁇ and TNF- ⁇ .
  • MUC1-N release is caused by enzymes including TNF- ⁇ Converting Enzyme (TACE) and Matrix Metallo-protease (MMP). These enzymes cleave the ECD of MUC1-C into two fragments, and as cancer progresses, these extracellular fragments leave the cancer cells and float in the body's blood, causing the fragments that are bound to the cells to continue with the cancer cells. Will remain in a combined state.
  • TACE TNF- ⁇ Converting Enzyme
  • MMP Matrix Metallo-protease
  • MUC1 is important for cancer cell growth because it binds to cell membrane proteins related to cancer cell proliferation present in other cancer cells, and thus plays a crucial role in cancer cell proliferation by sending continuous cell proliferation signals.
  • this part is always the same fate until cancer cell growth and extinction, which is a good target of cancer detection and also a definitive biomarker capable of removing cancer.
  • this part is known to be the only part that does not glycosylation, and was thought to show a distinct difference between MUC1 in cancer and normal cells. Therefore, the present inventors have developed the antibody of the present invention by binding to MUC1 cells and sharing the fate with cancer, and looking at this fragment which can distinguish between MUC1 of normal cells and MUC1 of cancer cells as the optimal antigen of the antibody.
  • the antibody-drug conjugate is a cytotoxic drug bound to the antibody through a linker. Since monoclonal antibodies exhibit target specific properties, drugs in antibody-drug conjugates can be delivered to tumors expressing antigens / targets recognized by monoclonal antibodies with selective target capacity. Ideally, the antibody-drug conjugate in the prodrug state in the blood after administration should be non-toxic, and when the antibody binds to the target tumor antigen and then internalizes into the cancer cell, the drug is released in active form to kill the tumor cell.
  • targets / antigens to which antibodies bind have been cell surface proteins that predominantly, and ideally, cancer cell specific expression (overexpression) in tumor cells.
  • the present inventors have developed an antibody that specifically binds to cancer cells-MUC1 that recognizes a part different from MUC1 expressed in normal cells, and maximizes ADC efficacy by binding to cancer cells due to ADC characteristics.
  • Anti-MUC1 antibodies and antibody-drug conjugates that bind to "parts that bind to cells" that share fate with cancer cells can specifically bind to MUC1 expressing cells to treat diseases caused by MUC1 expression It was confirmed that the present invention was completed.
  • An object of the present invention is an antibody or antigen-binding fragment thereof that specifically binds to a “part bound to a cell” of MUC1, an antibody-drug conjugate conjugated with a drug to the antibody or antigen-binding fragment thereof, and the antibody or antigen thereof It is to provide a bispecific antibody comprising a binding fragment.
  • Another object of the present invention to provide a hybridoma (KCLRFBP 00395) for the production of the anti-MUC1 antibody.
  • Still another object of the present invention is to provide a composition and a method for treating or preventing cancer comprising the anti-MUC1 antibody or antigen-binding fragment thereof, the antibody-drug conjugate or bispecific antibody.
  • Still another object of the present invention is to provide a composition for diagnosing and diagnosing cancer comprising the anti-MUC1 antibody or antigen-binding fragment thereof.
  • It is another object of the present invention to provide an immunogenic composition comprising a complex encapsulating a MUC1-C terminal region, a SEA domain of MUC1 or a C-terminal extracellular domain of MUC1 and CpG-DNA in liposomes.
  • Still another object of the present invention is to provide a method of preparing an anti-MUC1 monoclonal antibody comprising inoculating a mouse with the immunogenic composition.
  • Still another object of the present invention is to provide a nucleic acid encoding the anti-MUC1 antibody or antigen-binding fragment thereof, a vector and a host cell comprising the nucleic acid, a method for producing an anti-MUC1 antibody or antigen-binding fragment thereof using the same. There is.
  • the present invention provides an anti-MUC1 antibody or antigen-binding fragment thereof that recognizes a polypeptide comprising five or more contiguous amino acids in the C-terminal extracellular domain of MUC1.
  • the anti-MUC1 antibody or antigen binding fragment thereof comprises six complementarity determining regions (CDRs), wherein the antibody or antigen binding fragment thereof is a heavy chain CDR1 of SEQ ID NO: 1 (GYTFTSYWMH); A heavy chain CDR2 of SEQ ID NO: 2 (YINPGTGYIEYNQKFKD); A heavy chain CDR3 of SEQ ID NO: 3 (STAPFDY); Light chain CDR1 of SEQ ID NO: 4 (KASQDIKSYLS); Light chain CDR2 of SEQ ID NO: 5 (YATRLAD); And light chain CDR3 of SEQ ID NO: 6 (LQYDESPYT) may be characterized in that it comprises one or more sequences selected from the group consisting of.
  • CDRs complementarity determining regions
  • the present invention also provides hybridomas (KCLRFBP 00395) for the production of the anti-MUC1 antibody.
  • the invention also provides antibody-drug conjugates and bispecific antibodies comprising anti-MUC1 antibodies or antigen binding fragments thereof.
  • the present invention also provides a pharmaceutical composition and a method for treating or preventing cancer comprising the anti-MUC1 antibody or antigen-binding fragment thereof, antibody-drug conjugate or bispecific antibody.
  • the invention also provides the use of said anti-MUC1 antibody or antigen binding fragment thereof for the prevention or treatment of cancer.
  • the invention also provides the use of said anti-MUC1 antibody or antigen binding fragment thereof for the manufacture of a medicament for the prevention or treatment of cancer.
  • the present invention also provides a diagnostic composition and diagnostic method for cancer comprising the anti-MUC1 antibody or antigen-binding fragment thereof.
  • the present invention also relates to an immunogenic composition
  • an immunogenic composition comprising a complex encapsulating (1) the C-terminal region of MUC1, the SEA domain of MUC1 or the C-terminal extracellular domain of MUC1, and (2) CpG-DNA in a liposome and said immunity
  • an anti-MUC1 monoclonal antibody manufacturing method comprising the step of inoculating a mouse with the original composition.
  • the present invention also provides a nucleic acid encoding the anti-MUC1 antibody or antigen-binding fragment thereof, a vector and host cell comprising the nucleic acid, a method for producing an anti-MUC1 antibody or antigen-binding fragment thereof using the same.
  • 1A is a graph showing the total amount of IgG in mice immunized with rhMUC1-C protein.
  • 1b and 1c show the results of screening hybridoma cells isolated from immunized mice
  • 1b is a screening result using HAT medium
  • Figure 1c is a screening result using HT medium.
  • 2A is a graph showing the results of ELISA on ascites of mice immunized with hybridoma cells (hMUC1-1H7 clone), showing the presence of rhMUC1-C specific antibodies.
  • Figure 2b shows the results of analysis of the purified anti-hMUC1 monoclonal antibody by SDS-PAGE and Commassie staining.
  • Figure 2c is a graph showing the results of confirming the iso type of the anti-MUC1 antibody through ELISA.
  • Figure 3a shows the results of Western blotting using breast cancer cell lysate using anti-hMUC1 monoclonal antibody and anti-MUC1-CT antibody purified from hMUC1-1H7 clone.
  • FIG. 3B immunoprecipitates cell lysates of MCF-7, MDA-MB-231, T47D and ZR75-1 cells with anti-hMUC1 monoclonal antibody purified from mouse normal IgG or hMUC1-1H7 clone, and anti-MUC1- The results of immunoblotting using CT antibodies are shown.
  • Figure 3C shows the results of Western blotting using T47D cell lysate with PNGase F and anti-hMUC1 monoclonal antibody purified from hMUC1-1H7 clone compared to the case with other antibodies.
  • FIG. 3D shows immunoblot of T47D cell lysate treated with PNGase F with anti-hMUC1 monoclonal antibody purified from hMUC1-1H7 clone, followed by immunoblotting with anti-MUC1-CT or anti-MUC1-CT2 antibody. Shows.
  • Figure 4a shows the results of Western blotting on pancreatic cancer cell lysates using anti-MUC1-CT antibodies, anti-hMUC1 antibodies purified from hMUC1-1H7 clones, or anti-beta-actin antibodies.
  • FIG. 4B shows immunoprecipitated with anti-hMUC1 monoclonal antibody purified from mouse normal IgG or hMUC1-1H7 clone against pancreatic cancer cell lysate and immunoblocked using anti-MUC1-CT antibody and anti-hMUC1 monoclonal antibody Show results.
  • FIG. 5A shows fluorescence images obtained by treating anti-hMUC1 antibody purified from hMUC1-1H7 clone at 4 ° C. (Surface) or lysing cells with 0.1% Triton X-100 to intracellular breast cancer cells. Shows.
  • 5B shows fluorescence images obtained after treating anti-hMUC1 antibodies purified from fluorescently probed hMUC1-1H7 clones and incubating at 37 ° C. for 6 hours.
  • FIG. 6 shows fluorescence images obtained by treating anti-hMUC1 antibodies purified from hMUC1-1H7 clones at 4 ° C. (Surface) or lysing cells with 0.1% Triton X-100 on intracellular pancreatic cancer cells (intracellular). Shows.
  • FIG. 7 shows fluorescence images obtained after treatment of pan-cancer cancer cells with anti-hMUC1 antibodies purified from fluorescently probed hMUC1-1H7 clones and incubated at 37 ° C. for 24 hours.
  • 8A is a cleavage map schematically showing the recombinant expression plasmid pFabE-hMUC1-1H7.
  • 8B schematically shows the recombinant protein expressed by the recombinant expression plasmid pFabE-hMUC1-1H7.
  • 8C is a fluorescence image obtained by treating Fab fragments of anti hMUC1 antibodies derived from hMUC1-1H7 clones in MCF-7, MDA-MB-231, T47D and ZR75-1 cells.
  • FIG. 9 is a graph showing changes in cell proliferation when MDA-MB-231, T47D and ZR75-1 cells were treated with anti-hMUC1 antibody derived from hMUC1-1H7 clone.
  • 10A to 10H are fluorescence images obtained by intravenous administration of anti-hMUC1 monoclonal antibodies derived from fluorescently labeled hMUC1-1H7 clones to mice with breast cancer.
  • 11A to 11C are fluorescence images obtained by intravenous administration of anti-hMUC1 monoclonal antibodies derived from fluorescently labeled hMUC1-1H7 clones to mice with pancreatic cancer.
  • 12A shows tumor tissue extracted from xenograft mouse models.
  • 12B is a graph showing the size ((width 2 * length) / 2) of tumors extracted from xenograft mouse models administered with anti-hMUC1 monoclonal antibodies derived from hMUC1-1H7 clones.
  • 12C is a graph showing tumor weights extracted from xenograft mouse models administered with anti-hMUC1 monoclonal antibody.
  • 12D is a graph showing the body weight of a xenograft mouse model administered with anti-hMUC1 monoclonal antibody.
  • 16 is a result showing the cancer cell proliferation inhibitory effect of hMUC1-1H7 antibody-drug conjugate in breast cancer tissue.
  • 17 shows the results of confirming the binding affinity between the humanized antibody (hMUC1-G3) and hMUC1-C through ELISA.
  • FIG. 18 shows the results of ELISA confirming the epitope homogeneity of hMUC1-C recognized by hMUC1-G3 and hMUC1-1H7 antibodies.
  • hMUC1-G3 antibody-drug conjugate selectively expresses breast cancer cells in MUC1-expressing cell lines (ZR75-1, T47D) and MUC1-free cell lines (MDA-MB-231). The result shows killing.
  • Figure 23 is a result showing the effect of selectively inhibiting the cancer cells of the hMUC1-G3 antibody-drug conjugate in xenograft mouse model produced through TNBC tissue transplantation derived from breast cancer patients.
  • MUC1 Moc 1, Mucin 1
  • MUC1 is generally expressed on one side of normal epithelial cells (apical membrane) and protects the basal epithelium from drying, pH changes, contamination, and microorganisms.
  • MUC1 is abnormally expressed at high levels in various human carcinomas, has a reduced degree of glycation, is expressed evenly on the entire surface of the cell, and is involved in promoting cancer cell proliferation, invasion, metastasis and angiogenesis.
  • MUC1 is a target for treating cancer specificity.
  • MUC1 comprises an N-terminal subunit (MUC1-N) and a C-terminal subunit (MUC1-C), wherein MUC1-N and MUC1-C are cleavage sites in the sea urchin sperm protein enterokinase and agrin domain. It is formed by cutting itself from above.
  • SEA domains contribute to the formation of stable heterodimeric complexes.
  • extracellular MUC1-N (the N-terminal subunit of MUC1) can be released to isolate many anti-MUC1-SEA antibodies.
  • Most anti-MUC1-SEA antibodies known to date are known to target the MUC1-N repeat sequence domain (Prinssen et al. 1998; Gillespie et al. 2000).
  • MUC1-N is not found directly at the cell surface but is observed in the peripheral circulation, there is a limitation that only limited circulating anti-MUC1-N antibodies can be used in MUC1-positive tumor cells.
  • the present invention provides an antibody that specifically binds to the novel MUC1 targeting the MUC1-C terminal region (extracellular domain) remaining on the cell surface after MUC1 cleavage.
  • the present invention in one aspect, relates to an anti-MUC1 antibody or antigen binding fragment thereof that specifically binds to MUC1. More specifically, it relates to an anti-MUC1 antibody or antigen binding fragment thereof that recognizes a polypeptide comprising five or more contiguous amino acids in the C-terminal extracellular domain of MUC1.
  • MUC1 is heavily glycosylated, but this part occurs mainly in the cut-out part, and is relatively glycosylated in the part where the cell is bound. In the present invention, this fact was recognized and expressed in E. coli without glycosylation using 190 amino acids bound to cells after cleavage.
  • the antibody according to the present invention is made of an antigen expressed in Escherichia coli, it recognizes an antigen that is not glycosylated.
  • an antibody was developed using mouse hybridoma technology, and the developed antibody specifically recognized that the tertiary structure was recognized without recognizing the primary structure of the amino acid sequence.
  • the FACS using the breast cancer cell lines T47D and ZR75-1 was confirmed that the MUC-1 specific, but in the lysate obtained by crushing the cells recognized in the Western recognized primary structure It wasn't.
  • the antibody was detected in the antibody according to the present invention, since the antigen was detected when Western cells were washed by Immunoprecipition method using the cell lysate and the antibody according to the present invention. Proved to be an antibody.
  • the C-terminal extracellular domain of MUC1 may be characterized by consisting of the amino acid sequence of SEQ ID NO: 10 (SVV VQLTLAFREG TINVHDVETQ FNQYKTEAAS RYNLTISDVS VSDVPFPFSA QS).
  • the term "antibody” is a generic term for a substance produced by stimulation of an antigen in the immune system, and the kind thereof is not particularly limited.
  • the antibody is an immunoglobulin molecule that is immunologically reactive with a specific antigen, and refers to a protein molecule that serves as a receptor that specifically recognizes an antigen, and includes a polyclonal antibody and a monoclonal antibody (monoclonal antibody). ) And all antibodies and antibody fragments.
  • the antibody may be one produced unnaturally, such as one produced recombinantly or synthetically.
  • the antibody may be an animal antibody (eg, a mouse antibody, etc.), chimeric antibody, humanized antibody or human antibody.
  • the antibody may be a monoclonal antibody.
  • Antibodies can also be understood to include antigen binding fragments of antibodies that possess antigen binding capacity, unless otherwise noted.
  • CDRs complementarity-determining regions
  • the anti-MUC1 antibody may be produced from hybridoma hMUC1-1H7 (KCLRF-BP-00395).
  • the anti-MUC1 antibody or antigen-binding fragment thereof is complementary determining regions (CDR-H1, CDR-H2, CDR-H3, CDR-) of the antibody produced from the hybridoma hMUC1-1H7 (KCLRF-BP-00395) L1, CDR-L2 and CDR-L3) or heavy chain variable region and light chain variable region may be characterized.
  • the anti-MUC1 antibody or antigen-binding fragment thereof comprises six complementarity determining regions (CDRs).
  • the antibody or antigen-binding fragment thereof may comprise a heavy chain CDR1 of SEQ ID NO: 1 (GYTFTSYWMH); A heavy chain CDR2 of SEQ ID NO: 2 (YINPGTGYIEYNQKFKD); A heavy chain CDR3 of SEQ ID NO: 3 (STAPFDY); Light chain CDR1 of SEQ ID NO: 4 (KASQDIKSYLS); Light chain CDR2 of SEQ ID NO: 5 (YATRLAD); And light chain CDR3 of SEQ ID NO: 6 (LQYDESPYT) may be characterized in that it comprises one or more sequences selected from the group consisting of.
  • the antibody or antigen-binding fragment thereof is a heavy chain CDR1 of SEQ ID NO: 1; A heavy chain CDR2 of SEQ ID NO: 2; A heavy chain CDR3 of SEQ ID NO: 3; Light chain CDR1 of SEQ ID NO: 4; Light chain CDR2 of SEQ ID NO: 5; And light chain CDR3 of SEQ ID NO: 6.
  • the antibody or antigen-binding fragment thereof may be characterized by comprising a heavy chain variable region of SEQ ID NO: 22 or 24 and a light chain variable region of SEQ ID NO: 23 or 25. More specifically.
  • the antibody or antigen-binding fragment thereof may comprise a heavy chain variable region of SEQ ID NO: 22 and a light chain variable region of SEQ ID NO: 23; Or a heavy chain variable region of SEQ ID NO: 24 and a light chain variable region of SEQ ID NO: 25.
  • the anti-MUC1 antibody or antigen-binding fragment thereof has an inhibitory effect on MUC1.
  • the MUC1 gene encodes one transcript, and after translation the MUC1 protein is autocleaved at "G" in the GSVVV motif located in the SEA domain.
  • the MUC1 protein may be a human MUC1 protein, for example GenBank Accession No. Sequence identity with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the amino acid sequences of P15941 (SEQ ID NO: 7) It may be to have.
  • the extracellular domain of the MUC1 protein may be the extracellular domain of human MUC1 protein, for example GenBank Accession No.
  • the extracellular domain of the MUC1 protein comprises an SEA domain, and in one embodiment, the SEA domain is GenBank Accession No. It may be a protein fragment (SEQ ID NO: 9) comprising 119 amino acids from 1034 to 1152 of the amino acid sequence (SEQ ID NO: 7) of P15941.
  • G is a cleavage site, and when cleavage occurs, the site after "G” (in the C-terminal direction) is the C-term extracellular domain (or ' MUC1-C terminal (site) extracellular domain 'or' MUC1-C subunit '(SEQ ID NO: 10).
  • MUC1 protein site Explanation order Full amino acid sequence of the MUC1 protein Full amino acid sequence of P15941 MTPGTQSPFF LLLLLTVLTV VTG SGHASST PGGEKETSAT QRSSVPSSTE KNAVSMTSSV LSSHSPGSGS STTQGQDVTL APATEPASGS AATWGQDVTS VPVTRPALGS TTPPAHDVTS APDNKPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS AP
  • the anti-MUC1 antibody or antigen-binding fragment thereof is MUC1 protein (eg SEQ ID NO: 7), specifically 5, 7 in the C-terminal extracellular domain (eg SEQ ID NO: 10) of the MUC1 protein. It may be characterized in that it recognizes or specifically binds a polypeptide (epitope) comprising dog, 10, 12 or more or preferably 15 or more amino acids.
  • the antibody or antigen-binding fragment thereof may comprise an extracellular domain of MUC1 protein (eg SEQ ID NO: 8), an SEA domain of MUC1 protein (eg SEQ ID NO: 9) or a C-terminal extracellular domain of MUC1 protein (eg SEQ ID NO: 10). ), And / or specifically binds thereto.
  • MUC1 specific antibody or “an antibody that specifically binds to MUC1” refers to an antibody that binds to MUC1 and results in inhibition of the biological activity of MUC1, and is used interchangeably with “anti-MUC1 antibody”. Used.
  • Anti-MUC1 antibody in the present invention may be an animal antibody (eg a mouse antibody), a chimeric antibody (eg a mouse-human chimeric antibody) or a humanized antibody, may be a monoclonal antibody or a polyclonal antibody
  • monoclonal antibodies may be an animal antibody (eg a mouse antibody), a chimeric antibody (eg a mouse-human chimeric antibody) or a humanized antibody
  • monoclonal antibodies may be a monoclonal antibody or a polyclonal antibody
  • the concept includes both a polyclonal antibody and a monoclonal antibody (monoclonal antibody, monoclonal antibody), preferably a monoclonal antibody, it may have a whole antibody (whole antibody) form.
  • the whole antibody is a structure having two full-length light chains and two full-length heavy chains, and includes a constant region, and each light chain is connected by heavy and disulfide bonds.
  • the total antibody of the anti-MUC1 antibody according to the present invention includes the IgA, IgD, IgE, IgM and IgG forms, wherein IgG is a subtype and includes IgG1, IgG2, IgG3 and IgG4.
  • a full IgG antibody has two full length light chains and two full length heavy chains, each of which is linked by a heavy chain and disulfide bond.
  • the constant region of the antibody is divided into a heavy chain constant region and a light chain constant region, and the heavy chain constant region has a gamma ( ⁇ ), mu ( ⁇ ), alpha ( ⁇ ), delta ( ⁇ ) and epsilon ( ⁇ ) type, subclass Gamma 1 ( ⁇ 1), gamma 2 ( ⁇ 2), gamma 3 ( ⁇ 3), gamma 4 ( ⁇ 4), alpha 1 ( ⁇ 1) and alpha 2 ( ⁇ 2).
  • the constant regions of the light chains have kappa ( ⁇ ) and lambda ( ⁇ ) types.
  • the term “heavy chain” refers to the variable region domain VH and the three constant region domains C H1 , C H2 and C H3 comprising an amino acid sequence having a variable region sequence sufficient to confer specificity to the antigen. It is interpreted to include both full-length heavy chains and fragments thereof including and hinges.
  • the term “light chain” refers to both the full-length light chain and fragment thereof comprising the variable region domain V L and the constant region domain C L comprising an amino acid sequence having sufficient variable region sequence to confer specificity to the antigen. It is interpreted to include.
  • complementarity determining region refers to the amino acid sequence of the hypervariable region of the heavy and light chains of immunoglobulin.
  • the heavy and light chains may each comprise three CDRs (CDRH1, CDRH2, CDRH3 and CDRL1, CDRL2, CDRL3).
  • the CDRs can provide key contact residues for the antibody to bind antigen or epitope.
  • Antigen binding fragment of the anti-MUC1 antibody means a fragment having the function of binding to the antigen of the anti-MUC1 antibody, namely MUC1, Fab, Fab ', F (ab') 2 , scFv (scFv) 2 , scFv-Fc, Fv, and the like, and the like.
  • antibody fragment is used interchangeably.
  • the antigen binding fragment may be, for example, but not limited to scFv, (scFv) 2 , Fab, Fab 'or F (ab') 2 .
  • Fab of the antigen-binding fragment has one antigen binding site in a structure having a variable region of the light and heavy chains, a constant region of the light chain and a first constant region of the heavy chain (C H1 ).
  • F (ab ') 2 antibodies are produced when the cysteine residues of the hinge region of Fab' form disulfide bonds. Recombinant techniques for generating Fv fragments with minimal antibody fragments in which Fv has only heavy chain variable regions and light chain variable regions are well known in the art.
  • Double-chain Fv is a non-covalent bond in which the heavy chain variable region and the light chain variable region are linked, and the single-chain Fv is generally shared by the variable region of the heavy chain and the short chain variable region through a peptide linker. It may be linked by bond or directly at the C-terminus to form a dimer-like structure such as a double chain Fv.
  • the antigen binding fragments can be obtained using proteolytic enzymes (e.g., restriction digestion of the entire antibody with papain can yield Fab and cleavage with pepsin can yield F (ab ') 2 fragment). It can be produced through genetic recombination technology.
  • the term "hinge region” is a region included in the heavy chain of the antibody, and exists between the C H1 and C H2 regions, and provides a function of providing flexibility of the antigen binding site in the antibody. It means the area to do.
  • the anti-MUC1 antibody may be a monoclonal antibody.
  • Monoclonal antibodies can be prepared according to methods well known in the art. For example, it may be manufactured using a phage display technique. Alternatively, anti-MUC1 antibodies can be used to prepare monoclonal antibodies derived from mice by conventional methods.
  • individual monoclonal antibodies can be screened based on their ability to bind to MUC1 using a typical Enzyme-Linked ImmunoSorbent Assay (ELISA) format.
  • Assays can be assayed for inhibitory activity through functional assays such as competitive ELISA or cell-based assays to assay molecular interactions for the conjugates.
  • Each affinity (Kd values) for MUC1 is then assayed for selected monoclonal antibody members based on strong inhibitory activity.
  • anti-MUC1 antibody or antigen-binding fragment thereof while having any one or more of CDR1 to CDR3 of light and heavy chains contained in the anti-MUC1 antibody or antigen-binding fragment thereof, as such, peptides and aptamers having the binding capacity and specificity for the same MUC1 antigen are also included.
  • the present invention relates to a hybridoma that produces the anti-MUC1 antibody.
  • the hybridoma is Accession No. KCLRF-BP-00395.
  • the present invention provides an anti-MUC1 antibody or antigen-binding fragment thereof produced by the hybridoma.
  • Another example is the heavy chain complementarity determining region (CDR-H1, CDR-H2, CDR-H3, or a combination thereof) of the anti-MUC1 antibody produced by the hybridoma, light chain complementarity determining region (CDR-L1, CDR-L2) , CDR-L3, or a combination thereof, or a combination thereof;
  • an anti-MUC1 antibody or antigen-binding fragment thereof comprising a heavy chain variable region, a light chain variable region, or a combination thereof of the anti-MUC1 antibodies produced by the hybridoma.
  • the complementarity determining portion may be determined by any conventional method, for example, IMGT definition (http://www.imgt.org/IMGT_vquest/share/textes/) or Kabat definition (http: // www. bioinf.org.uk/abs/), but is not limited thereto.
  • IMGT definition http://www.imgt.org/IMGT_vquest/share/textes/
  • Kabat definition http: // www. bioinf.org.uk/abs/
  • the anti-MUC1 antibody or antigen-binding fragment thereof specifically recognizes the MUC1-C terminal extracellular domain, whereby the MUC1-C terminal extracellular domain is expressed at a higher level and less glycosylation than normal cells. It can act specifically in cancer or tumor cells and can also recognize / bind MUC1 protein expressed on one surface of the cell as well as on the entire surface.
  • the anti-MUC1 antibody or antigen-binding fragment thereof not only binds MUC1 protein, in particular the MUC1-C terminal extracellular domain, but also internalizes into cells (see Examples 9-8 and 18) to mediate MUC1-mediated pathways. It can be effectively inhibited to maximize the pharmacological effect.
  • the internalization properties of the anti-MUC1 antibody or antigen-binding fragment thereof have the advantage of effectively delivering the conjugated drug into the cell when applied as an antibody-drug conjugate (ADC).
  • the present invention provides a chimeric antigen receptor (CAR) -T cell therapeutic agent and / or chimeric antigen receptor (CAR) -NK (natural killer cell) comprising an anti-MUC1 antibody or an antigen-binding fragment thereof according to the present invention. It is about.
  • the form of the anti-MUC1 antibody or antigen-binding fragment thereof contained in the CAR-T or CAR-NK is preferably scFv, but is not limited thereto.
  • the present invention relates to an antibody-drug conjugate (ADC) in which a drug is conjugated to the anti-MUC1 antibody or antigen-binding fragment thereof.
  • ADC antibody-drug conjugate
  • the drug of the antibody-drug conjugate is monomethyl auristatin E (MMAE).
  • MMAE monomethyl auristatin E
  • the antibody-drug conjugate binds to MUC1 expressing cells, then internalizes to MUC1 expressing tumor cells and selectively releases MMAE into target MUC1 cells by proteolytic cleavage.
  • the released MMAE binds to tubulin, it disrupts the intracellular microtubule network, induces cell cycle arrest, and apoptosis progresses while microtubule division occurs.
  • ADCs Antibody-drug conjugates require the anticancer drug to be stably bound to the antibody until the anticancer drug is delivered to the target cancer cell. Drug delivered to the target must be released from the antibody to induce killing of the target cell. This requires that the drug binds to the antibody stably and at the same time has sufficient cytotoxicity to induce the death of the target cell when released from the target cell.
  • the cytotoxic substances including drugs such as the anti-MUC1 antibody or antigen-binding fragment thereof and an anticancer agent are bound to each other (eg, by covalent bonds, peptide bonds, etc.) to conjugate or fusion proteins (cytotoxicity).
  • cytotoxicity In the form of a substance and / or a label).
  • the cytotoxic substance may be any substance that is toxic to cancer cells, particularly solid cancer cells, and may be one or more selected from the group consisting of radioisotopes, cytotoxic compounds, cytotoxic proteins, anticancer agents, and the like. It is not limited to this.
  • the cytotoxin protein is selected from the group consisting of lysine (ricin), saporin (saporin), gelonin (gelonin), momordin (momordin), deboganin (debouganin), diphtheria toxin, pseudomonas toxin, etc. It may be one or more, but is not limited thereto.
  • the radioisotope may be at least one selected from the group consisting of 131I, 188Rh, 90Y, and the like, but is not limited thereto.
  • the cytotoxin compound is duocarmycin, monomethyl auristatin E (MMAE), monomethyl auristatin F (MMAF), N2'-diacetyl-N2 '-( 3-mercapto-1-oxopropyl) maytansine (N2'-deacetyl-N2 '-(3-mercapto-1-oxopropyl) maytansine; DM1), PBD (Pyrrolobenzodiazepine) dimer, etc.
  • MMAE monomethyl auristatin E
  • MMAF monomethyl auristatin F
  • N2'-diacetyl-N2 '-( 3-mercapto-1-oxopropyl) maytansine N2'-deacetyl-N2 '-(3-mercapto-1-oxopropyl) maytansine
  • DM1 PBD (Pyrrolobenzodiazepine) dimer, etc.
  • PBD
  • the antibody-drug conjugate may be according to techniques well known in the art.
  • the antibody-drug conjugate may be characterized in that the antibody or antigen-binding fragment thereof is bound to the drug through a linker.
  • the linker may be a cleavable linker or a non-cleavable linker.
  • the linker is the linking site between the anti-MUC1 antibody and the drug, for example the linker is in a form that is cleavable under intracellular conditions, i.e., the drug can be released from the antibody through cleavage of the linker in the intracellular environment.
  • the linker may be cleaved by a cleavage agent present in an intracellular environment such as a lysosomal or endosome, and may be a peptide linker that may be cleaved by an intracellular peptidase or protease enzyme such as a lysosomal or endosomal protease.
  • Peptide linkers generally have at least two amino acids in length.
  • the cleavage agent may include cathepsin B and cathepsin D, plasmin, and may hydrolyze the peptide to release the drug into target cells.
  • the peptide linker may be cleaved by thiol dependent protease cathepsin-B, which is highly expressed in cancer tissue, for example Phe-Leu or Gly-Phe-Leu-Gly linkers can be used.
  • the peptide linker may be cleaved by, for example, an intracellular protease, and may be a Val-Cit linker or a Phe-Lys linker.
  • the cleavable linker is pH sensitive, and may be sensitive to hydrolysis at a specific pH value.
  • pH sensitive linkers can be hydrolyzed under acidic conditions.
  • acid labile linkers that can be hydrolyzed in lysosomes such as hydrazones, semicarbazones, thiosemicarbazones, cis-aconitic amides, orthoesters, acetals, Ketal and the like.
  • the linker may be cleaved under reducing conditions, for example disulfide linkers.
  • SATA N-succinimidyl-S-acetylthioacetate
  • SPDP N-succinimidyl-3- (2-pyridyldithio) propionate
  • SPDB N-succinimidyl-3- (2-pyridyldithio) butyrate
  • N-succinimidyl-oxycarbonyl SMPT Various alpha disulfide bonds can be formed using -alpha-methyl-alpha- (2
  • the drug and / or drug-linker may be conjugated randomly through lysine of the antibody or through cysteine which is exposed when the disulfide bond chain is reduced.
  • the linker-drug may be bound via a genetically engineered tag, such as cysteine present in a peptide or protein.
  • the genetically engineered tag eg, peptide or protein, may comprise an amino acid motif that can be recognized by, for example, an isoprenoid transferase.
  • the peptide or protein has a deletion at the carboxy terminus of the peptide or protein, or has an addition via covalent attachment of a spacer unit to the carboxy (C) terminus of the peptide or protein.
  • the peptide or protein may be directly covalently linked to an amino acid motif or covalently linked to a spacer unit to be linked to an amino acid motif.
  • the amino acid spacer unit is composed of 1 to 20 amino acids, of which a glycine unit is preferable.
  • the linker may comprise a beta-glucuronide linker which is present in a large number in lysosomes or is hydrolyzed by beta-glucuronidase which is overexpressed in some tumor cells.
  • the hydrophilicity is high, and when combined with drugs having high hydrophobic properties, the solubility of the antibody-drug complex can be increased.
  • the present invention relates to a beta-glucuronide linker disclosed in Korean Patent Publication No. 2015-0137015, for example, a beta-glucuronide linker comprising a self-immolative group. Can be used.
  • linker may be, for example, a non-cleavable linker, and the drug is released through only one step of antibody hydrolysis to produce, for example, an amino acid-linker-drug complex.
  • This type of linker may be a thioether group or maleimidocaproyl, and may maintain stability in blood.
  • the drug may be characterized as a chemotherapeutic agent, toxin, micro RNA (miRNA), siRNA, shRNA or radioisotope.
  • the drug may be bound to the antibody with an agent that exhibits a pharmacological effect.
  • the chemotherapeutic agent may be a cytotoxic agent or an immunosuppressant. Specifically, it may include a microtubulin inhibitor, a mitosis inhibitor, a topoisomerase inhibitor, or a chemotherapeutic agent that can function as a DNA intercalator. It may also include immunomodulatory compounds, anticancer agents, antiviral agents, antibacterial agents, antifungal agents, antiparasitic agents or combinations thereof.
  • Such drugs include, for example, maytansinoids, orstatin, aminopterin, actinomycin, bleomycin, thalisomycin, camptothecin, N8-acetyl spermidine, 1- (2 chloroethyl) -1, 2-dimethyl sulfonyl hydrazide, esperamycin, etoposide, 6-mercaptopurine, dolastatin, tricortesene, calicheamicin, taxol, taxanes, paclitaxel, docetaxel, Methotrexate, vincristine, vinblastine, doxorubicin, melphalan, mitomycin A, mitomycin C, chlorambucil, duocarmycin, L-asparaginase, mercaptopurine, thioguanine (thioguanine), hydroxyurea, cytarabine, cyclophosphamide, ifosfamide, nitrosourea,
  • the drug is an amine, thiol, hydroxyl, hydrazide, oxime, hydrazine, thiosemicarbazone, hydrazine carboxylate which can react to form covalent bonds with electrophilic groups on linkers and linker reagents. And one or more nucleophilic groups selected from the group consisting of arylhydrazide groups.
  • the present invention relates to a bispecific antibody comprising the anti-MUC1 antibody or antigen-binding fragment thereof.
  • Said bispecific antibody comprises of two arms of the antibody, one arm comprises an anti-MUC1 antibody or antigen binding fragment thereof according to the invention, and the other arm is other than MUC1. It refers to a form comprising an antibody or an antigen-binding fragment thereof that specifically binds to an antigen, preferably an antibody related to a cancer-associated antigen or an immune gateway protein antigen, or an antigen-cell-associated antigen.
  • the antigen to which the antibody other than the anti-MUC1 antibody included in the double antibody according to the present invention binds is preferably a cancer-related antigen or an immune gateway protein antigen, such as Her2, EGFR, VEGF, VEGF-R, CD-20, MUC16, CD30. , CD33, CD52, PD-1, PD-L1, CTLA4, BTLA4, EphB2, E-selectin, EpCam, CEA, PSMA, PSA, ERB3, c-MET, etc.
  • TCR / CD3, CD16 (Fc ⁇ RIIIa) CD44, CD56, CD69, CD64 (Fc ⁇ RI), CD89, and CD11b / CD18 (CR3) may be selected, but are not limited thereto.
  • the present invention relates to a pharmaceutical composition for preventing and / or treating MUC1-related diseases comprising the anti-MUC1 antibody or antigen-binding fragment thereof, the antibody-drug conjugate or the bispecific antibody.
  • the MUC1-related disease may be a disease associated with expression or overexpression of MUC1, expression on all surfaces of cells of MUC1, and / or reduced glycation of MUC1 protein relative to normal cells, for example cancer.
  • the normal cell may be a non-tumor cell. Accordingly, the MUC1-related disease is preferably cancer or tumor, but is not limited thereto.
  • cancer refers to or means the physiological state of a mammal, which is typically characterized by unregulated cell growth / proliferation.
  • the cancer or carcinoma that can be treated with the composition of the present invention is not particularly limited and includes both solid and hematological cancers.
  • Examples of such cancers include skin cancers such as melanoma, liver cancer, hepatocellular carcinoma, hepatocellular cancer, gastric cancer, breast cancer, lung cancer, ovarian cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colon cancer, colon cancer, and Cancer, cervical cancer, brain cancer, prostate cancer, bone cancer, skin cancer, thyroid cancer, parathyroid cancer, kidney cancer, esophageal cancer, biliary tract cancer, testicular cancer, rectal cancer, head and neck cancer, cervical cancer, ureter cancer, osteosarcoma, neuroblastoma, fibrosarcoma, rhabdomyosarcoma , But may be selected from the group consisting of astrocytoma, neuroblastoma and glioma, but is not limited thereto.
  • the cancer is characterized by the expression of MUC1 protein, breast cancer, pancreatic cancer, prostate cancer, lung cancer, thyroid cancer, gastric cancer, ovarian cancer, colon cancer, liver cancer, gallbladder cancer, kidney cancer, cervical cancer, or bladder cancer
  • the cancer may be primary or metastatic cancer.
  • the MUC1-related disease may be, but is not limited to, Non-Alcoholic SteatoHepatitis (NASH) or TGF- ⁇ -mediated immune disease.
  • NASH Non-Alcoholic SteatoHepatitis
  • TGF- ⁇ -mediated immune disease TGF- ⁇ -mediated immune disease.
  • the anti-MUC1 antibody or antigen-binding fragment thereof in the pharmaceutical composition, method and use for preventing and / or treating the cancer, is provided as a single active ingredient, or a cytotoxic substance such as an anticancer agent. It may be administered in combination or in the form of an antibody-drug conjugate (ADC) conjugated with a cytotoxic substance such as an anticancer agent.
  • ADC antibody-drug conjugate
  • the anti-MUC1 antibody or antigen-binding fragment thereof, and a pharmaceutical composition comprising the same according to the present invention can be used for use in combination with a conventional therapeutic agent.
  • the anti-MUC1 antibody or antigen-binding fragment thereof according to the present invention, and a pharmaceutical composition comprising the same may be used in the same or administered sequentially with a conventional therapeutic agent such as an anticancer agent.
  • the present invention comprises administering a therapeutically effective amount of the anti-MUC1 antibody or antigen-binding fragment thereof or the antibody-drug conjugate to a patient in need of preventing and / or treating MUC1-associated diseases.
  • the prevention and / or treatment method may further comprise identifying a patient in need of prevention and / or treatment of the disease prior to the administering step.
  • antibody conjugates for topical delivery of the drug in the composition allows the drug to be delivered to cells exhibiting an antigen targeted with an anti-MUC1 antibody.
  • the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier is conventionally used in the formulation of drugs, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose , Polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, mineral oil, etc. may be one or more selected from the group, but is not limited thereto. It doesn't happen.
  • the pharmaceutical composition may also further include one or more selected from the group consisting of diluents, excipients, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like conventionally used in the manufacture of pharmaceutical compositions.
  • the pharmaceutical composition may be administered orally or parenterally.
  • parenteral administration it may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, endothelial administration, intranasal administration, pulmonary administration, rectal administration, or topical administration of lesion site.
  • the protein or peptide is digested so that the oral composition can be formulated to coat the active agent or protect it from degradation in the stomach.
  • the composition may be administered by any device in which the active substance may migrate to the target cell.
  • the content or dosage of the anti-MUC1 antibody or antigen-binding fragment thereof in the pharmaceutical composition may vary depending on the method of formulation, mode of administration, age, weight, sex, morbidity, food, time of administration, interval of administration, route of administration, rate of excretion Various prescriptions can be made by factors such as response sensitivity.
  • the daily dose of the anti-MUC1 antibody or antigen-binding fragment thereof is 0.001 to 1000 mg / kg, specifically 0.01 to 100 mg / kg, more specifically 0.1 to 50 mg / kg, more specifically 0.1 to 20 It may be in the mg / kg range, but is not limited thereto.
  • the daily dosage may be formulated into one formulation in unit dosage form, may be formulated in appropriate quantities or may be prepared within a multi-dose container.
  • compositions may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media or may be formulated in the form of extracts, powders, powders, granules, tablets or capsules, and for the purpose of formulation, dispersants or stabilizers It may further include.
  • the patient to be administered the pharmaceutical composition may be a mammal including a primate including a human, a monkey, and the like, a rodent including a mouse, a rat, and the like.
  • the treatment of cancer may mean any anti-cancer action that prevents, alleviates or improves the symptoms of cancer, such as inhibiting the proliferation of cancer cells, killing cancer cells, inhibiting metastasis, or partially or completely eradicate cancer.
  • the invention relates to the use of said anti-MUC1 antibody or antigen binding fragment thereof for the prevention or treatment of cancer.
  • the present invention relates to the use of said anti-MUC1 antibody or antigen-binding fragment thereof for the manufacture of a medicament for the prevention or treatment of cancer.
  • the present invention provides a composition for detecting a MUC1 protein, such as an MUC1-C-terminal extracellular domain, comprising the anti-MUC1 antibody or antigen-binding fragment thereof, and a biological sample, wherein the anti-MUC1 antibody or It relates to a method for detecting MUC1 comprising processing an antigen binding fragment.
  • the detection method may further comprise the step of determining whether the antigen-antibody reaction after the step of the treatment.
  • the detection method when an antigen-antibody reaction is detected, it may be determined (determined) that MUC1, such as MUC1-C-terminal extracellular domain, is present in the biological sample. Accordingly, the detection method may further include determining that MUC1 is present in the biological sample when the antigen-antibody reaction is detected after the identifying step.
  • the biological sample may be selected from the group consisting of (isolated) cells, tissues, body fluids, cultures thereof, etc. obtained from mammals such as humans (eg cancer patients).
  • the present invention is in another aspect Treating (administering) the anti-MUC1 antibody or antigen-binding fragment thereof, comprising a composition for detecting or diagnosing a disease, such as cancer, including an anti-MUC1 antibody or antigen-binding fragment thereof, and a biological sample isolated from the subject It relates to a method for detecting or diagnosing cancer or providing information for detecting or diagnosing a cancer.
  • the detecting or diagnosing method may further include determining whether an antigen-antibody reaction is performed after the treating.
  • an antigen-antibody response when an antigen-antibody response is detected, it may be determined (determined) that a MUC1-related disease, such as cancer, is present in the biological sample or in a patient from which the biological sample is derived.
  • the method may further comprise, after the identifying step, determining that the biological sample or the patient is a MUC1-related disease patient, such as a cancer patient, when an antigen-antibody response is detected.
  • the biological sample may be selected from the group consisting of (isolated) cells, tissues, body fluids, cultures thereof, etc. obtained from mammals such as humans (eg cancer patients).
  • Determining whether the antigen-antibody reaction can be carried out through various methods known in the art. For example, it can be measured through conventional enzymatic reaction, fluorescence, luminescence and / or radiation detection, and specifically, immunochromatography, immunohistochemistry, enzyme linked immunosorbent assay assay: ELISA, radioimmunoassay (RIA), enzyme immunoassay (EIA), fluorescence immunoassay (FIA), luminescence immunoassay (LIA), Western blotting ), Microarrays, immunoprecipitation assays, etc. may be measured by a method selected from the group consisting of, but is not limited thereto.
  • the anti-MUC1 antibody or antigen-binding fragment thereof may further include a label.
  • the labeling substance may be at least one selected from the group consisting of radioisotopes, fluorescent substances, chromogens, dyeing substances, and the like.
  • the labeling substance may be linked (linked) to the antibody or antigen-binding fragment by conventional methods (eg, chemical bonds such as covalent bonds, coordination bonds, and ionic bonds).
  • the binding of the antibody (or antigen-binding fragment) and the labeling material may be according to techniques well known in the art.
  • the C-terminus of MUC1 was cloned from breast cancer cell lines and expressed in Rosetta competent cells to prepare monoclonal antibodies against MUC1.
  • the C-terminal portion of MUC1 was formulated with CpG-DNA (eg MB-ODN 4531 (O)) and encapsulated in the DOPE: CHEMS complex and used for mouse immunization.
  • CpG-DNA eg MB-ODN 4531 (O)
  • DOPE CHEMS complex
  • anti-hMUC1-SEA monoclonal antibodies are obtained by fusing splenocytes obtained from mice immunized with [hMUC1-SEA]-[MB-ODN 4531 (O)]-[DOPE: CHEMS] complex with SP2 / 0 cells. Can be.
  • the present invention relates to an immunogenic composition
  • an immunogenic composition comprising the C-terminal region of MUC1, the SEA domain of MUC1, or the C-terminal extracellular domain of MUC1.
  • Another example provides an immunogenic composition comprising a complex encapsulating (1) the C-terminal region of MUC1, the SEA domain of MUC1, or the C-terminal extracellular domain of MUC1 and (2) CpG-DNA in liposomes.
  • the immunogenic composition refers to a composition having the ability to generate an antibody by inducing an immune response upon injection (inoculation) into a living organism in vivo.
  • the liposome is a cationic liposome, such as dioleoylphosphatidylethanolamine (DOPE) and cholesteryl hemisuccinate (CHEMS) is 1: 0.5 to 1: 2, more specifically 1: 0.67 to 1: 1.5 (DOPE: CHEMS) molar ratio
  • DOPE dioleoylphosphatidylethanolamine
  • CHEMS cholesteryl hemisuccinate
  • molar ratio such as, but not limited to, a mixture mixed at a molar ratio of about 1: 1, or one obtained therefrom (eg, a solvent-free lipid film, etc.).
  • the CpG-DNA means an oligodeoxynucleotide (ODN: Oligodeoxynucleotide) including a total of 10 to 20 nucleotides including one or more CpG motifs, for example, 1 to 3.
  • ODN Oligodeoxynucleotide
  • the CpG-DNA may include a nucleic acid sequence of 'AGCAG CG TT CG TGT CG GCCT' (SEQ ID NO: 11), but is not limited thereto.
  • the liposomes and oligodeoxynucleotides can function as an adjuvant.
  • Adjuvant along with the immune system, help to recognize antigens more easily and enhance the immune response.
  • Bacterial DNA containing synthetic oligodeoxynucleotides (ODNs) and unmethylated CpG dinucleotides flanked by specific nucleotide sequences have important immunomodulatory effects in B lymphocytes, natural killer cells, macrophages, and dendritic cells .
  • Cationic liposomes eg lipofectamine, phosphatidyl-beta-oleoyl-gamma-palmitoyl ethanolamine (DOPE): cholesterol hemisuccinate (CHEMS) increase antibody production, antibody transport and CTL reactions To increase. Therefore, CpG-DNA (Lipoplex (O)) encapsulated in the DOPE: CHEMS (1: 1 ratio) complex can promote an effective immune response in human and mouse cells.
  • DOPE phosphatidyl-beta-oleoyl-gamma-palmitoyl ethanolamine
  • CHEMS cholesterol hemisuccinate
  • the present invention provides a C-terminal region of MUC1, an SEA domain of MUC1, or a C-terminal extracellular domain or liposome of MUC1, including (1) a C-terminal region of MUC1, an SEA domain of MUC1, or a MUC1.
  • a method for producing an anti-MUC1-SEA monoclonal antibody comprising inoculating a C-terminal extracellular domain and (2) a complex encapsulating CpG-DNA into a mammal, such as a mouse.
  • the method for preparing the antibody may further include, after the inoculating step, separating and / or purifying the antibody from the serum of the mouse in a conventional manner.
  • nucleic acids may be present in cells, cell lysates, or in partially purified or substantially pure form. Nucleic acids are prepared by other cellular components or other contaminants, for example, by standard techniques, including alkali / SDS treatment, CsCl banding, column chromatography, agarose gel electrophoresis, and others well known in the art. When purified from nucleic acids or proteins of other cells, they are "isolated” or “substantially pure.” Nucleic acids of the invention may be, for example, DNA or RNA, and may or may not include intron sequences.
  • the nucleic acid encoding the anti-MUC1 antibody may be characterized in that it comprises any one or more sequences selected from the group consisting of SEQ ID NO: 34 to SEQ ID NO: 45.
  • the polynucleotide sequence encoding the heavy chain of the antibody according to the present invention is SEQ ID NO: 34 to 39 and / or the polynucleotide sequence encoding the light chain of the antibody according to the present invention is SEQ ID NO: 40 to 45.
  • the present invention relates to a recombinant expression vector comprising the nucleic acid.
  • DNA encoding partial or full-length light and heavy chains can be selected from standard molecular biology techniques (e.g., PCR amplification or hybridomas expressing the antibody of interest). CDNA cloning used), and the DNA can be "bind to work" to transcription and translation control sequences and inserted into the expression vector.
  • binding to work may mean that the gene encoding the antibody is ligated into the vector such that the transcriptional and translational control sequences in the vector serve the intended function of regulating the transcription and translation of the antibody gene.
  • the expression vector and expression control sequences are chosen to be compatible with the expression host cell used.
  • the light chain gene of the antibody and the heavy chain gene of the antibody are inserted into separate vectors, or both genes are inserted into the same expression vector.
  • Antibodies are inserted into expression vectors by standard methods (eg ligation of complementary restriction enzyme sites on antibody gene fragments and vectors, or blunt terminal ligation if no restriction enzyme sites are present).
  • the recombinant expression vector may encode a signal peptide that facilitates secretion of the antibody chain from the host cell.
  • the antibody chain gene can be cloned into the vector such that the signal peptide binds to the amino terminus of the antibody chain gene in frame.
  • the signal peptide may be an immunoglobulin signal peptide or a heterologous signal peptide (ie, a signal peptide derived from an immunoglobulin non-protein).
  • the recombinant expression vector has a regulatory sequence that controls the expression of the antibody chain gene in the host cell.
  • a “regulatory sequence” can include promoters, enhancers and other expression control elements (eg, polyadenylation signals) that control the transcription or translation of antibody chain genes.
  • promoters e.g., promoters, enhancers and other expression control elements (eg, polyadenylation signals) that control the transcription or translation of antibody chain genes.
  • expression control elements e.g, polyadenylation signals
  • the design of the expression vector can vary by differently selecting regulatory sequences depending on factors such as the selection of host cells to be transformed, the expression level of the protein, and the like.
  • the present invention relates to a host cell comprising the nucleic acid or the vector.
  • the host cell according to the present invention is preferably selected from the group consisting of animal cells, plant cells, yeast, E. coli and insect cells, but is not limited thereto.
  • the host cell according to the present invention is E. coli, Bacillus subtilis, Streptomyces sp., Pseudomonas sp., Proteus mirabilis or Staphyllo Prokaryotic cells, such as the Staphylococcus sp.
  • fungi such as Aspergillus sp., Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces sp.
  • Neuro Eukaryotic cells such as yeast, such as Neurospora crassa, other lower eukaryotic cells, and cells of higher eukaryotes such as cells from insects.
  • COS7 cells monkey kidney cells (COS7) cells, NSO cells, SP2 / 0, Chinese hamster ovary (CHO) cells, W138, baby hamster kidney (BHK) cells, MDCK, myeloma cell lines, HuT 78 cells and HEK293 cells and the like are available, but are not limited to these.
  • COS7 cells monkey kidney cells
  • NSO cells NSO cells
  • SP2 / 0 Chinese hamster ovary (CHO) cells W138
  • BHK baby hamster kidney
  • MDCK myeloma cell lines
  • HuT 78 cells and HEK293 cells and the like are available, but are not limited to these.
  • CHO cells can be used.
  • the nucleic acid or the vector is transfected or transfected into a host cell.
  • Various expression host / vector combinations can be used to express anti-glycancan 3 antibodies according to the invention
  • Expression vectors suitable for eukaryotic hosts include, but are not limited to, expression control sequences derived from SV40, bovine papillomavirus, anenovirus, adeno-associated virus, cytomegalovirus and retroviruses.
  • Expression vectors include Escherichia coli such as pET, pRSET, pBluescript, pGEX2T, pUC vector, col E1, pCR1, pBR322, pMB9 and derivatives thereof. Resulting bacterial plasmids, plasmids with a broader host range such as RP4, phage DNA exemplified by a wide variety of phage lambda derivatives such as ⁇ gt10 and ⁇ gt11, NM989, and DNA phages of M13 and filamentary single strands; Other DNA phages such as, etc. Expression vectors useful for yeast cells are 2 ° C. plasmids and derivatives thereof.
  • the present invention provides a method for producing an anti-MUC1 antibody or antigen-binding fragment thereof according to the present invention comprising culturing a host cell to express an anti-MUC1 antibody or antigen-binding fragment thereof according to the present invention. It is about.
  • the antibody When a recombinant expression vector capable of expressing the anti-MUC1 antibody or antigen-binding fragment thereof is introduced into a mammalian host cell, the antibody is cultivated for a period sufficient to allow the antibody to be expressed in the host cell, or more preferably the host cell is cultured. It can be prepared by culturing the host cell for a period sufficient to allow the antibody to be secreted into the culture medium.
  • the expressed antibody may be purified from the host cell to be homogeneous. Separation or purification of the antibody can be carried out by separation, purification methods, such as chromatography, which are used in conventional proteins.
  • the chromatography can include, for example, affinity chromatography comprising a Protein A column, Protein G column, ion exchange chromatography or hydrophobic chromatography.
  • the antibody can be separated and purified by further combining filtration, ultrafiltration, salting out, dialysis and the like.
  • the MUC1-C terminus (hereinafter referred to as the "hMUC1-C protein"; a protein comprising 192 amino acids from 961 to 1152 of P15941, wherein 1034-1152 aa is the MUC-SEA domain); Encoding human cDNA was obtained and amplified by RT-PCR using the following primer sets.
  • Sense primer hMUC1 C-Nco I-S3 5'-CC ATG GCC TCA GGC TCT GCA TC-3 '(SEQ ID NO: 12);
  • Antisense Primer hMUC1 C-Xho I-AS4 5'-CTC GAG AGA CTG GGC AGA GAA AGG AAA T-3 '(SEQ ID NO: 13).
  • the obtained hMUC1-C terminal protein coding sequence was confirmed by DNA sequencing, GenBank Accession No. It was confirmed that it had the same sequence as the nucleic acid sequence containing 576 nucleotides of 2954 th-3529 of J05582.1 (SEQ ID NO: 26).
  • the amplified cDNA fragment was cloned into expression vector pET-22b (Novagen, Darmstadt, Germany) containing C-terminal His-tag.
  • the obtained plasmids were transformed into Escherichia coli Rosetta TM (Invitrogen, Carlsbad, CA) receptor cells, and using 1 mM isopropyl-D-1-thioglactopyranoside (IPTG, Sigma-Aldrich, Saint Louis, MO). Induction at 37 ° C. for 8 hours.
  • the obtained cells were lysed in ice lysis buffer (50 mM Tris-HCl, 100 mM NaCl, 5 mM EDTA, 0.5% Triton X100, 1 g / ml lysozyme, proteinase inhibitor cocktail). After centrifugation, the inclusion body fraction was mixed with buffer B (100 mM NaH 2 PO 4 , 10 mM Tris-HCl, 8 M urea, pH 8.0), using a Ni-NTA agarose (Qiagen, Valencia, CA) system. Purified.
  • the resulting mixture was loaded onto a Ni-NTA column and washed with wash buffer C (100 mM NaH 2 PO 4 , 10 mM Tris-HCl, 8 M urea, pH 6.3). Bound proteins were eluted with elution buffer (100 mM NaH 2 PO 4 , 10 mM Tris-HCl, 8 M urea, pH 4.5) and analyzed by SDS-PAGE and Western blotting. Western blots were performed using anti-His-tag antibody (Santa Cruz).
  • MB-ODN 4531 consists of 20 bases containing three CpG motifs (underlined) (AGCAG CG TT CG TGT CG GCCT: SEQ ID NO: 11).
  • the CpG oligodeoxynucleotide (ODN) (hereinafter referred to as "CpG-DNA 4531 (O)") was purchased from Samchully Pharm (Seoul, Korea) and GenoTech (Daejeon, Korea).
  • DOPE Phosphatidyl-beta-oleoyl-gamma-palmitoylethanolamine
  • CHEMS cholesterol hemisuccinate
  • Solvent-free lipid film was resuspended in a mixture containing 50 ⁇ g of the same volume of water-soluble CpG-DNA 4531 (O) and 50 ⁇ g of rhMUC1-C protein (Example 2), and vigorously stirred at room temperature for 30 minutes to give DOPE and CHEMS CpG-DNA 4531 (O) and rhMUC1-C proteins coencapsulated within the complex were prepared.
  • “Lipoplex (O) Complex” refers to CpG-DNA 4531 (O) encapsulated in DOPE and CHEMS complexes.
  • the rhMUC1-C protein and Lipoplex (O) complexes were sonicated for 30 seconds by sonicator, the solution was filtered using a 0.22 ⁇ m filter and freeze-thawed three times with liquid nitrogen. Used for.
  • mice Four-week-old female BALB / c mice (OrientBio, Inc. (Seoul, Korea)) and BALB / cAnNCri-nu / nu mice (four-week-old) were purchased from Nara Biotech, Inc. (Seoul, Korea). The mice were maintained at 20-25 ° C. and 32-37% humidity in sterile conditions without specific pathogens. All animal testing procedures were conducted in accordance with the "Guide for the Care and Use of Laboratory Animals of the National Veterinary Research & Quarantine Service of Korea" with the approval of the Institutional Animal Care and Use Committee. Every effort was made to sacrifice the mice through isoflurane inhalation and to minimize pain.
  • 50 ⁇ g of rhMUC1-C protein and 50 ⁇ g of CpG-DNA 4531 comprise a complex co-encapsulated in phosphatidyl-beta-oleoyl-gamma-palmitoylethanolamine: cholesterol hemisuccinate (DOPE: CHEMS complex)
  • DOPE cholesterol hemisuccinate
  • rhMUC1-C specific IgG was measured by ELISA.
  • 96-well immunoplates were coated with 10 ⁇ g / ml rhMUC1-C protein (Example 2) and 1% (w / v) in PBS-T (PBS with 0.1% (v / v) Tween-20) Blocked with bovine serum albumin (BSA).
  • BSA bovine serum albumin
  • Immunized mouse serum, hybridoma cell culture supernatants, or purified antibodies in Example 5 were diluted with PBS-T and incubated at room temperature for 2 hours. Plates were washed three times with PBS-T and incubated with goat anti-mouse IgG HRP-conjugated secondary antibody for 1 hour.
  • TMB substrate solutions A and B (1: 1 ratio) (Kirkegaard and Perry Laboratories, Gaithersburg, MD) were developed and 450 nm using a Spectra Max 250 micro plate reader (Molecular Devices, Sunnyvale, USA) Absorbance at was measured and colorimetric assay was performed.
  • Splenocytes of mice immunized with rhMUC1-C protein in Example 5 were fused with SP2 / 0 myeloma cells (ATCC) using polyethylene glycol (PEG, Sigma-Aldrich).
  • the fused cells were cultured and selected as hypoxanthine-aminopterin-thymidine (HAT, Sigma-Aldrich) medium.
  • the culture supernatants of the selected hybridoma cells were tested for binding to rhMUC1-C protein via ELISA and screened for hybridoma cells showing binding positive, ie, producing rhMUC1-C protein specific antibodies.
  • Hybridoma clones were selected according to standard hybridoma technology (Yokoyama et al. 2006).
  • the obtained hybridoma clone (KCLRF-BP-00395; hereinafter referred to as “hMUC1-1H7” for hybridoma cells and antibodies produced therefrom) was cultured in hypoxanthine-thymidine (HT) medium.
  • HT hypoxanthine-thymidine
  • ELISA-positive hybridoma cell populations were subcloned.
  • mice were hybridized with i.p. hybridoma cells (hMUC1-1H7 clone). Inoculation. After 10 days, the peritoneal fluid was collected and centrifuged at 3,000 rpm for 30 minutes. The supernatant was purified using Protein-A chromatography (Repligen, Waltham, MA) to anti-hMUC1 monoclonal antibody that binds to rhMUC1-C protein.
  • 96-well immunoplate (Nalgen Nunc International, Penfield, USA) was coated with 1 ⁇ g / ml of hMUC1-C protein, 1 Blocking with 0.05% Tween-20 (PBST) in PBS containing% BSA.
  • PBST Tween-20
  • Anti-hMUC1-C monoclonal antibodies were added to the top row of each plate and a series of 1: 4 dilutions in PBST were placed in the next row. Plates were incubated for 2 hours at room temperature and washed with PBST.
  • Anti-mouse total IgG, IgG1, IgG2a, IgG3b, IgG3 antibodies combined with Horseradish Peroxidase (HRP) (BD Pharmingen) were then added to each well (1: 500 dilution) and 1 at room temperature. Incubated for hours.
  • Whole volume analysis using TMB substrate solutions A and B (1: 1 ratio) (Kirkegaard and Perry Laboratories, Gaithersburg, MD, USA), using a Spectra Max 250 microplate reader (Molecular Devices, Sunnydale, CA, USA) was measured at 450 nm absorbance.
  • MCF-7 Human breast cancer cell lines
  • Capan-2 pancreatic cancer cell lines
  • ATCC American Type Culture Collection
  • T47D human breast cancer cell lines
  • ZR75- 1 pancreatic cancer cell lines
  • PANC-1 Korean Cell Line Bank
  • MCF-7 cells were cultured in Eagle's Minimum Essential Medium supplemented with 0.01 mg / ml human recombinant insulin; MDA-MB-231 cells were cultured in Leibovitz's L-15 medium (Thermo Fisher Scientific); T47D, ZR75-1, and Capan-1 cells were cultured in RPMI-1640 medium (Thermo Fisher Scientific).
  • Capan-2 cells in McMcoy's 5A medium (Thermo Fisher Scientific), CFPAC-1 cells in Iscove's modified Dulbecco's medium (IMDM, Thermo Fisher Scientific), PANC-1 cells in Dulbecco's modified Eagle's medium (DMEM, Thermo Fisher Scientific) Each was incubated.
  • MCF-7, T47D, ZR75-1 Capan-1, Capan-2, CFPAC-1, and PANC-1 cells were cultured at 37 ° C. and 5% CO 2 conditions, and MDA-MB-231 cells were CO 2 at 37 ° C. Incubated in the absence of conditions.
  • anti-MUC1-CT antibodies and anti-MUC1-CT2 antibodies were obtained from Abcam (Cambridge, UK).
  • Anti-MUC1-CT antibodies and anti-MUC1-CT2 antibodies recognize the cytoplasmic tail region of MUC1.
  • Anti-beta-actin antibodies were purchased from Sigma-Aldrich.
  • the cells were lysed in lysis buffer (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5 mM EDTA, 100 mM NaF, 2 mM Na 3 Vo 4 , Protease Inhibitor Cocktail, 1% (w / v) NP-40 ) And centrifuged at 14,000 rpm for 20 minutes at 4 ° C. The same amount of protein was separated on a 4-12% Bis-Tris gradient gel (Thermo Fisher Scientific) and transferred to a nitrocellulose membrane blocked with 3% (w / v) BSA in PBS-T for 1 hour at room temperature. The nitrocellulose membrane was left overnight at 4 ° C.
  • anti-hMUC1 antibody hMUC1-1H7; Example 7
  • anti-MUC1-CT antibody Abacam, EPR1023
  • anti-MUC1-CT2 antibody Abcam, ab80952
  • anti Incubated with beta-actin antibody Sigma-Aldrich.
  • Immune reactive proteins were measured using horseradish peroxidase bound secondary antibodies and enhanced chemiluminescent reagents (Thermo Fisher Scientific).
  • Cell lysis buffer (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5 mM EDTA, 100 mM NaF, 2 mM Na 3 Vo 4 , Protease Inhibitor Cocktail, 1% (w / v) NP-40) Incubated overnight at 4 ° C. with anti-hMUC1 antibody. Protein A beads were added to the mixture and incubated at 4 ° C. for 1 hour. The immune complexes collected by centrifugation were washed and analyzed by western blotting.
  • Membranes are combined with anti-hMUC1 antibody (hMUC1-1H7), anti-MUC1-CT antibody (Abacam, EPR1023), anti-MUC1-CT2 antibody (Abcam, ab80952), or anti-beta-actin antibody (Sigma-Aldrich) antibody. Incubated.
  • Cell lysates of T47D cells were extracted with lysis buffer (0.5% (w / v) SDS, 1% (w / v) beta-mercapto ethanol) and boiled at 100 ° C. for 10 minutes. Thereafter, the sample was incubated with PNGase F (Elpis-Biotech, Daejeon, Korea) for 2 hours at 37 °C, boiled for 10 minutes at 100 °C. The resulting sample was diluted with lysis buffer and immunoprecipitated with anti-hMUC1 monoclonal antibody. The resulting immune complexes were analyzed by western blotting with anti-MUC-CT antibody or anti-MUC1-CT2 antibody.
  • Cells were cultured on glasscover slips coated with poly-L-lysine in 12-well culture plates.
  • For cell surface staining cells were fixed with 4% (w / v) paraformaldehyde, blocked with 3% (w / v) BSA and stained with anti-hMUC1 antibody for 2 hours on ice.
  • For intracellular staining cells were fixed with 4% (w / v) paraformaldehyde, permeabilized with 0.1% (w / v) Triton X-100, blocked with 3% (w / v) BSA, Stained with anti-hMUC1 antibody for 2 hours at room temperature.
  • Anti-hMUC1 monoclonal antibodies were labeled with DyLight 488 according to the manufacturer's instructions (Thermo Fisher Scientific). Breast cancer cells and pancreatic cancer cells were treated with DyLight 488 labeled anti-hMUC1 antibody and incubated at 37 ° C. for the indicated time. Fluorescent signals generated from cells in which the antibody was internalized were detected by CLSM (LSM 710, Carl Zeiss).
  • Anti-hMUC1 monoclonal antibody (hMUC1-1H7; Example 7) was incubated using a mouse monoclonal antibody isotype typing kit (Dipstick format, Bibco BRL or Roche, Mannheim, Germany). Total RNA was extracted from the hybridoma cells using RNeasy Mini Kit (Qiagen) to generate cDNA. To clone the heavy and light chain variable regions (VH and VL) of the anti-hMUC1 monoclonal antibody generated from hMUC1-1H7, the generated cDNA was subjected to Vent polymerase (NEB) having the following primer sets. Amplified using.
  • Heavy chain primers IGG1 (5'-GGA AGA TCT ATA GAC AGA TGG GGG TGT CGT TTT GGC-3 '; SEQ ID NO: 14) and 5'MH2 (5'-CTT CCG GAA TTC SAR GTN MAG CTG SAG SAG TCW GG- 3 '; SEQ ID NO: 15)
  • -hMUC1 monoclonal antibody (hMUC1-1H7; Example 7) of the light chain variable region and heavy chain variable regions (VH and VL) for amplifying the coding sequence, and each with a Sfi I and BstX I serves as a bacterial expression vector FabE Cloning (Jeon et al., Mol. Immunol. 44: 827-836 (2007), Kwon et al. Oncol. Rep. 18: 513-517 (2007)) and the resulting recombinant expression plasmid with pFabE-hMUC1-1H7 (FIG. 8A). Named it.
  • the primer used at this time is as follows.
  • Reverse primer 5'-GGC CGT GCT GGC CCC GAC AGA TGG GGG TGT CGT TTT GGC-3 '(SEQ ID NO: 19),
  • Reverse primer 5'-CCA CCG TAC TGG CGG ATA CAG TTG GTG CAG CAT C-3 '(SEQ ID NO: 21).
  • pFabE-hMUC1-1H7 Recombinant expression plasmid pFabE-hMUC1-1H7 was confirmed by restriction analysis and DNA sequencing. pFabE-hMUC1-1H7 was transformed into TG1 Escherichia coli cells, optimized for expression of recombinant protein, and confirmed by western blotting with anti-His antibody.
  • FabE-hMUC1-1H7 For large scale production and purification of recombinant Fab, 500 ml of hybridoma hMUC1-1H7 clone was treated with 0.5 mM IPTG and incubated at 18 ° C. for 16 hours. The culture was centrifuged to harvest the culture supernatant and placed in a Ni-NTA affinity column (Clontech) to separate Fab proteins that were properly folded and assembled using His tags in the VH-CH fusion protein.
  • Recombinant Fab bound to the column was eluted with 10 mM imidazole (pH 8.0), the protein solution was centrifuged (3,500 xg) at 4 ° C, dialyzed and concentrated using centricon.
  • Capan-2 cells in 50% (w / v) Matrigel were subcutaneously inoculated into the dorsal right flank of 4 week old male BALB / cAnCrj-nu / nu mice.
  • 17 beta-estradiol pellets US, FL, Sarasota, Innovative Research of America, pellets, 60 day release
  • 5 ⁇ 10 6 cells (T47D, ZR75-1) in 50% (w / v) Matrigel were subcutaneously inoculated into the dorsal right flank of the mouse.
  • mice When the tumor volume reached an average of about 100 mm 3 , the mice were injected intravenously with normal mouse IgG-DyLight 755 (5 mg / kg) or anti-hMUC1 antibody-DyLight 755 (5 mg / kg).
  • the antibody target images were then monitored using an in vivo imaging system (IVIS 200, Xenogen Corporation, Mass.) At 0, 24, 48 hours.
  • IVIS 200 In vivo imaging system
  • DyLight 488-labeled anti-hMUC1 antibody 5 mg / kg was injected intravenously. After 2 days, tumor tissue was harvested and frozen sections were performed. Internalization of the antibody was detected in tumor sections with CLSM (LSM 710, Carl Zeiss).
  • Paraffin-depressed human breast cancer tissue sections were purchased from ISU ABXIS (Seoul, Korea). The tissue sections were treated with xylene for 30 minutes to remove paraffin, rehydrated with ethanol, and incubated with 3% hydrogen peroxide solution for 10 minutes. Antigen retrieval was performed in citric acid solution (pH 6.0). The sections were blocked for 30 minutes using normal horse serum and incubated with anti-hMUC1 antibody (1 ⁇ g / slide) for 2 hours at room temperature. The sections were washed and incubated with biotinylated anti-mouse IgG antibody Vector Laboratories, Burlingame, CA for 1 hour. It was then washed and incubated with HRP-streptavidin for 30 minutes.
  • FIG. 1A the control is a PBS inoculation group, and rhMUC1-C-1, -2, -3, and -4 denote each mouse. As shown in Figure 1a, it can be seen that rhMUC1-C specific IgG induced significant.
  • FIGS. 1B and 1C hybridoma cells isolated from the immunized mice were screened according to Example 7 and shown in FIGS. 1B and 1C.
  • Figure 1b is a screening result using HAT medium
  • Figure 1c is a screening result using HT medium. 1B and 1C
  • # is the number of 96-well plates
  • a to H designate horizontal sections of the plate. From the results in FIGS. 1B and 1C, hMUC1-1H7 clones were selected as hybridomas producing rhMUC1-C specific monoclonal antibodies.
  • the selected hybridoma hMUC1-1H7 cells were deposited on March 8, 2017 with the Korea Cell Line Research Foundation (KCLRF) located in Yeongun-dong, Jongno-gu, Seoul, Korea, and received accession number KCLRF-BP-00395.
  • KCLRF Korea Cell Line Research Foundation
  • FIG. 2a is a result of injecting the hybridoma hMUC1-1H7 clone into the abdominal cavity of the mouse, ascites was recovered, the analysis of the presence of rhMUC1-C specific antibody by ELISA, control serum means the result of the PBS inoculation group do. As a result, it was confirmed that rhMUC1-C specific antibody was present in ascites of mice injected with hMUC1-1H7 clone, and isolated and purified.
  • HC represents a heavy chain
  • LC represents a light chain
  • MUC1 protein in breast cancer cells MUC1 protein in normal cells is composed of dimers of MUC1-N subunit domain and MUC1-C subunit domain and is hyperglycosylated in cancer cells
  • MCF-7, MDA-MB-231, T47D and ZR75-1 cell lysates of breast cancer cells
  • the anti-MUC1-CT antibody detected MUC1 protein in MCF-7, T47D and ZR75-1, but not MDA-MB-231.
  • anti-hMUC1 monoclonal antibodies did not recognize MUC1 protein in all cell samples. Since no MUC-1 protein was detected in MDA-MB-231 cells, this cell line was used as a negative control in all tests.
  • results of FIG. 3A show that the anti-hMUC1 monoclonal antibody does not recognize the denatured MUC1 protein used in Western blotting
  • results of FIG. 3B show that the anti-hMUC1 monoclonal antibody is unique in cancer through immunoprecipitation. It can be seen that the recognition of the MUC1 protein of the anti-hMUC1 monoclonal antibody recognizes the unique tertiary structure of the MUC1 protein.
  • the extracellular domain of MUC1 is densely glycated from 200 to 500 nm from the cell surface. Therefore, it was investigated whether the anti-hMUC1 monoclonal antibody could recognize the deglycosylated protein core (see Example 9.6).
  • T47D cell lysates were treated with PNGase F and Western blotting using anti-MUC1-CT antibody, anti-MUC1-CT2 antibody, anti-hMUC1 monoclonal antibody (Example 7), or anti-beta-actin antibody
  • FIG. 3C it can be seen that the anti-hMUC1 monoclonal antibody does not detect the MUC1 protein.
  • T47D cell lysates treated with PNGase F were immunoprecipitated with anti-hMUC1 monoclonal antibody, and then immunoblotted with anti-MUC1-CT or anti-MUC1-CT2 antibody.
  • anti-hMUC1 monoclonal antibody could immunoprecipitate deglycosylated MUC1 protein in T47D cells.
  • pancreatic cancer cells Capan-1, Capan-2, CFPAC-1, and PANC-1
  • pancreatic cancer cells Capan-1, Capan-2, CFPAC-1, and PANC-1
  • anti-hMUC1 monoclonal antibody recognizes an intact MUC1 protein in pancreatic cancer cells
  • the lysates were separated by SDS-PAGE and western blotting was performed using anti-MUC1-CT antibodies, anti-hMUC1 antibodies, or anti-beta-actin antibodies, and the results are shown in FIG. 4A.
  • the anti-hMUC1 monoclonal antibody was not able to recognize MUC1 protein in all cell samples tested.
  • MCF-7 breast cancer cells
  • MDA-MB-231 MDA-MB-231
  • T47D and ZR75-1 pancreatic cancer cells
  • Capan- 1, Capan-2, CFPAC-1, PANC-1 immunofluorescence staining and the results were analyzed by confocal microscopy (see Example 9-7).
  • MCF-7, MDA-MB-231, T47D and ZR75-1 cells were treated with anti-hMUC1 monoclonal antibody or mouse normal IgG at 4 ° C. (for cell surface MUC1 protein) or at room temperature (intracellular MUC1 protein). After incubation in), and incubated with Alexa 488 (green) -conjugated secondary antibody for 1 hour, the cell nuclei were stained with Hoechst 33258 (blue). The obtained fluorescence image was observed with a confocal microscope (CLSM, LSM 710, Carl Zeiss, Jena, Germany), which is shown in A of FIG. 5 (scale bar: 10 ⁇ m).
  • MCF-7, MDA-MB-231, T47D and ZR75-1 cells were treated with DyLight 488 (green) -labeled anti-hMUC1 monoclonal antibody. And incubated at 37 ° C. for 6 hours, the nuclei were stained with Hoechst 33258, and the resulting fluorescence images were observed by confocal microscopy (CLSM, LSM 710, Carl Zeiss, Jena, Germany). (Scale bar: 10 ⁇ m).
  • pancreatic cancer cell lines Capan-1, Capan-2, CFPAC-1 and PANC-1 cells were incubated with anti-hMUC1 monoclonal antibody or mouse normal IgG at 4 ° C. (surface) or at room temperature (in cells), then Alexa 488 Incubated with conjugated secondary antibody for 1 hour and nuclei stained with Hoechst 33258.
  • the obtained fluorescence image was observed with a confocal microscope (CLSM, LSM 710, Carl Zeiss, Jena, Germany) and shown in FIG. 6 (scale bar: 10 mu m).
  • the anti-hMUC1 antibody stains MUC1 distinctly in breast cancer cells (MCF-7, T47D and ZR75-1) and pancreatic cancer cells (Capan-2 and CFPAC-1). It can be seen that they are located in the cell surface and in the cell.
  • the antibody recognizes the extracellular region of the MUC1 C-terminal subunit.
  • the efficacy of the antibody as a therapeutic agent can be said to depend more on cell internalization. Therefore, the anti-hMUC1 antibody was combined with DyLight 488, and treated with breast cancer cells and pancreatic cancer cells for 6 hours, and then the cell internalization of the antibody was confirmed through fluorescence images.
  • Pancreatic cancer cells (Capan-1, Capan-2, CFPAC-1 and PANC-1) were treated with DyLight 488-labeled anti-hMUC1 monoclonal antibody, 0, 30 minutes, 1 hour, 3 hours, 6 hours, 12 Incubated at 37 ° C. for 24 h and 24 h. Nuclei were stained with Hoechst 33258.
  • the results confirm that anti-hMUC1 monoclonal antibodies can target and internalize MUC1 protein in living cells.
  • variable regions of the heavy and light chains of the anti-hMUC1 monoclonal antibody were cloned from the hybridoma cells producing the anti-hMUC1 monoclonal antibody (hMUC1-1H7) and DNA sequenced (Example 10).
  • the sequence identified by the DNA sequencing was analyzed by the BLAST program (http://www.ncbi.nlm.nih.gov) to analyze homology with known sequences.
  • the cDNA (heavy chain variable region coding cDNA: 393bp; light chain variable region coding cDNA: 396bp) encoding the variable regions of the heavy and light chains of the hMUC1-1H7 antibody was encoded by the heavy and light chain variable regions of the known mouse immunoglobulin (IgG1). Sequence homology of about 80-95% and 93-98% with the sequence, respectively.
  • CDRs of the heavy and light chains were identified by a known method (kabat CDR definition) (Table 2).
  • the variable region sequences of the heavy and light chains are shown in Table 3 below.
  • Recombinant Fab was expressed in E. coli using the expression vector pFabE (Example 11).
  • Vector pFabE is a light chain constant region (CL), of the heavy chain constant region (CH1), the light chain variable region (VL), and a heavy chain variable region including two cloning sites BstX I and Sfi I in (VH) may be inserted respectively, do.
  • Recombinant expression plasmid pFabE-hMUC1-1H7 was constructed by sequentially subcloning the VL and VH sequences of hMUC1-1H7 (FIG. 8A). The recombinant plasmid bi-cistronic expression of the VL-CL fusion protein and the VH-CH1 fusion protein under control of the LacZ promoter in E. coli.
  • VL-CL fusion proteins include N-terminal OmpA tags and C-terminal Pre-S1 tags, while VH-CH1 fusion proteins include N-terminal pelB tags and C-terminal His tags (FIG. 8B). Since the recombinant VH-CH1 fusion protein contained His tag, large scale culture of E. coli and recombinant Fab purification of hMUC1-1H7 were performed using Ni-NTA affinity column chromatography.
  • recombinant Fab-hMUC1-1H7 breast cancer cells
  • An immunofluorescence staining test was performed for 1).
  • Breast cancer cells MCF-7, MDA-MB-231, T47D and ZR75-1 cells were incubated with recombinant Fab-hMUC1-1H7, respectively, followed by incubation with Alexa 488-conjugated secondary antibody, and nuclei stained with Hoechst 33258. It was.
  • the obtained fluorescence image was observed with a confocal microscope (CLSM, LSM 710, Carl Zeiss, Jena, Germany), and is shown in FIG. 8C (scale bar: 10 mu m).
  • the confocal image clearly stained MUC1 in recombinant Fab-hMUC1-1H7 breast cancer cells (MCF-7, T47D and ZR75-1), indicating that the recombinant Fab-hMUC1-1H7 stained breast cancer cells. It means to recognize MUC1.
  • MUC1 is overexpressed in various types of cancerous tissues to promote cell proliferation.
  • anti-hMUC1 monoclonal antibodies As cancer therapeutics, the effects of anti-hMUC1 monoclonal antibodies on breast cancer cell proliferation were tested.
  • MDA-MB-231, T47D and ZR75-1 cells were treated with anti-hMUC1 antibody (10 ⁇ g / ml; Example 7) or normal mouse IgG1 (10 ⁇ g / ml) and MTT assay at the time intervals shown in FIG. 9. The effect on cell proliferation was tested by (Example 12).
  • control is a group not treated with the antibody.
  • FIG. 9 it was confirmed that the treatment of anti-hMUC1 antibody significantly delayed the proliferation of T47D and ZR75-1 cells compared to the control IgG treatment.
  • anti-hMUC1 antibodies did not alter proliferation of MDA-MB-231 cells.
  • FIGS. 10A to 10H breast cancer
  • 11A to 11C pancreatic cancer
  • 10A to 10D show the results of tumors induced by subcutaneous injection of T47D cells, which are breast cancer cells
  • FIGS. 10E to 10H show results of tumors induced by tumors induced by tumor injection of ZR75-1 cells, which are breast cancer cells.
  • 10B and 10F imaging of dissected mice was performed using a real time IVIS imaging system 200.
  • 10C and 10G show the results of antibody distribution by separating several organs and tumors.
  • 10D and 10H show tumor sections stained with DAPI for nuclei and evaluated by confocal microscopy (scale bar: 10 ⁇ m).
  • anti-hMUC1 monoclonal antibody labeled with DyLight shows a clear staining result in tumor sections, whereas normal IgG labeled with DyLight does not show this effect.
  • tumor-specific intracellular localization of anti-hMUC1 monoclonal antibodies was further confirmed by the confocal images of FIGS. 10D, 10H and 11C.
  • anti-hMUC1 monoclonal antibodies can be used to specifically target breast and pancreatic cancer in animal models.
  • a xenograft mouse model was used to test the effect of MUC1 targeted monoclonal antibodies on the growth of pancreatic cancer cells in vivo.
  • FIG. 12A The tumor tissue extracted from the xenograft mouse model is shown in FIG. 12A and the tumor size ((width 2 * length) / 2), weight, and mouse weight are shown in FIGS. 12B, 12C, and 12D, respectively. It was. As shown in Figure 12a to 12d, administration of anti-hMUC1 monoclonal antibody is attenuated the progression of pancreatic tumors, it can be seen that the antibody treatment does not adversely affect the body weight of the test body.
  • MUC1 protein in breast and pancreatic cancer tissues was examined by immunostaining. Breast cancer tissue and pancreatic cancer tissue were tested using normal tissue as a control. The results are shown in FIGS. 13 (breast cancer) and 14 (pancreatic cancer). 13 and 14, it was confirmed that MUC1 is expressed in most breast cancer tissues and pancreatic cancer tissues, whereas MUC1 is not expressed in normal breast tissues.
  • ADC was prepared by binding MMAE to 1H7 antibody in Levena Biopharma (USA). The ratio of MMAE (DAR) to antibody of the prepared ADC was 5.80.
  • DAR MMAE
  • three cell lines of MDA-MB-231, T47D, and ZR75-1 were used. Each cell line was cultured in a 96-well plate, and 24 hours after the start of the culture, 1H7-ADC at the concentration set as shown in FIG. 15 was treated. 72 hours after 1H7-ADC treatment, cell viability was compared using CCK-8 kit (Dojindo, USA).
  • the treatment method of CCK-8 was performed according to the manual provided, and the absorbance value was measured using an I3X microplate reader (Molecular Devices, USA). It was confirmed that the survival rate of T47D and ZR75-1 cells treated with 1H7-ADC was significantly lower than the control group not treated with 1H7-ADC. In contrast, survival of MDA-MB-231 cells treated with 1H7-ADC showed no significant difference from the control. These results indicate that 1H7-ADC selectively shows anticancer effects on cancer cells expressing MUC1.
  • Humanized antibodies were prepared based on the 1H7 antibody which confirmed the cytotoxicity and anticancer effects in animal models through ADC preparation. Humanized antibodies were produced by the New Drug Development Support Center of Osong Advanced Medical Industry Promotion Foundation (Osong, Korea) and Fusion Antibodies (UK). The antigen recognition sites of the 1H7 antibody were identified and the variable region sequences except for the antigen recognition sites were changed to prepare 6 heavy chain sequences and 6 light chain sequences. Each amino acid sequence is shown in Table 6.
  • the affinity measurement for binding of the anti-hMUC1-C humanized antibody and hMUC1-C protein prepared in Example 27 was measured by ELISA method. Affinity analysis via ELISA was performed to coat the prepared anti-hMUC1-C humanized antibody in 96-well immune plate at the same concentration and blocked with super block solution. Thereafter, the MBP-hMUC1-C protein was diluted and placed in an immune plate coated with an anti-hMUC1-C humanized antibody, and left standing in a 37 ° C. incubator to bind. Plates were washed three times with wash solution and reacted with anti-MBP antibody conjugated with HRP. The reaction was developed using TMB substrate solution and the reaction was terminated with 2N HCl.
  • MBP-hMUC1-C protein was diluted and coated on 96-well immune plates at various concentrations. Subsequently, the biotin-labeled 50 nM anti-hMUC1-C humanized antibody and anti-hMUC1-C mouse antibody were serially diluted from 5 uM and simultaneously placed in a plate coated with MBP-hMUC1-C protein and reacted in a stationary state.
  • HRP-labeled streptavidin was treated at a constant concentration to detect biotin labeled on anti-hMUC1-C humanized antibody.
  • TMB substrate solution used for the confirmation of affinity was used.
  • Absorption value by the reaction was analyzed by measuring through an I3X microplate reader (Molecular Devices, USA). The results are shown in Figure 18, the decrease in absorbance with increasing concentration of anti-hMUC1-C mouse antibody unlabeled biotin was the same epitope of the anti-hMUC1-C humanized antibody and anti-hMUC1-C mouse antibody Recognize.
  • FACS analysis was performed to analyze cell binding patterns of h-MUCI-humanized antibodies against hMUCI-C in cell lines where the expression of hMUCI was known.
  • Each cell line was prepared by dividing a predetermined number of cells into each tube after culturing in a culture medium. Then 4% paraformaldehyde was fixed and washed once with FACS assay solution after centrifugation.
  • the prepared cell line was treated with anti-hMUC1 humanized antibody and treated to bind the corresponding humanized antibody to the cells through culture at 4 ° C. Thereafter, FITC-labeled anti-human IgG antibodies were treated, and FACS analysis was performed using BD FACS Canto (BD, USA). The analysis results are shown in FIG.
  • Anti-hMUC1-C humanized antibody (G3) and anti-hMUC1-C mouse antibody (1H7) were treated at various concentrations in the ZR75-1 cell line where the expression of hMUC1 was confirmed. Confirmation through analysis. The analysis results are shown in FIG.
  • ADCs were prepared by binding MMAE to anti-hMUC1 humanized antibodies in Alteogen (Daejeon, Korea). The ratio of MMAE (DAR) to the antibody of the prepared ADC was 4.8.
  • DAR MMAE
  • three cell lines of MDA-MB-231 MUC1-, HER2-
  • T47D MUC1 +, HER2 +
  • ZR75-1 MUC1 +, HER2 +
  • Each cell line was incubated in a 96-well plate, 24 hours after the start of the culture, MUC1-ADC (G3-ADC) and Kadcyla (HER2-ADC) used as a control was treated at the corresponding concentration.
  • Cytotoxicity in myeloid leukemia cell lines was confirmed using the same anti-hMUC1 humanized antibody ADC used in Example 31-1.
  • the myeloid leukemia cell lines used were K562 (MUC1 +) and KG-1 (MUC1-). Each cell line was incubated in a 96-well plate, and 24 hours after the start of the culture, anti-hMUC1 humanized antibody ADCs were treated at the corresponding concentrations. 72 hours after anti-hMUC1 humanized antibody ADC treatment, cell viability was compared by MTT assay. It was confirmed that the survival rate of the cells treated with the anti-hMUC1 humanized antibody ADC was significantly lower than that of the untreated control. This is shown in Figure 22, the cytotoxicity was confirmed only in the K562 cell line confirmed MUC1 expression of the two cell lines.
  • the anti-hMUC1-C humanized antibody-drug conjugates mentioned in Example 31 above have been shown to inhibit cancer growth in animal models.
  • the size of the cancer tissues of the mice administered with the anti-hMUC1-C humanized antibody-drug conjugate was reduced, but the size of the cancer tissues of control mice not administered the anti-hMUC1-C humanized antibody-drug conjugate. Showed no statistically significant difference.
  • the results indicate that the anti-hMUC1-C humanized antibody-drug conjugate has an effect of inhibiting the growth of TNBC breast cancer tissues against cancer tissues expressing MUC1. No statistically significant weight change was observed in all tested animal subjects, and it was confirmed that it effectively inhibited cancer cell growth in a concentration-dependent manner. Statistical analysis was done with Two-way ANOVA.
  • an antibody or antigen-binding fragment thereof that specifically binds to MUC1 exhibits good affinity and avidity for MUC1
  • the antibody-drug conjugate to which the drug is conjugated to the antibody or antigen-binding fragment thereof is a MUC1 expressing cell.
  • the drug can be delivered efficiently, specificly or selectively.
  • the anti-MUC1 antibodies and antibody-drug conjugates according to the invention can be usefully applied in the treatment of MUC1-related diseases such as cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hematology (AREA)
  • Mycology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

본 발명은 MUC1(Mucin 1)에 특이적으로 결합하는 항-MUC1 항체 및 그 용도에 관한 것으로, 더욱 상세하게는 항-MUC1 항체 또는 이의 항원 결합 단편, 상기 항체 또는 이의 항원 결합 단편을 포함하는 항체-약물 접합체 또는 이중특이 항체, 이를 포함하는 암의 예방 또는 치료용 약학 조성물 및 상기 항체 또는 이의 항원 결합 단편을 코딩하는 핵산, 상기 핵산을 포함하는 벡터 및 숙주세포, 이를 이용한 항-MUC1 항체 또는 이의 항원 결합 단편의 제조 방법에 관한 것이다. 본 발명에 따르면, MUC1에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편은 MUC1에 대한 우수한 친화도 및 결합력을 나타내며, 상기 항체 또는 이의 항원 결합 단편에 약물이 접합된 항체-약물 접합체는 MUC1 발현 세포에 특이적으로 결합함으로써 약물을 효과적이면서도 특이적 또는 선택적으로 전달할 수 있다. 따라서, 본 발명에 따른 항-MUC1 항체 및 항체-약물 접합체는 MUC1 관련 질병, 예컨대, 암의 치료에 유용하게 적용될 수 있다.

Description

MUC1에 특이적으로 결합하는 항체 및 그의 용도
본 발명은 MUC1(Mucin 1)에 특이적으로 결합하는 항-MUC1 항체 및 그 용도에 관한 것으로, 더욱 상세하게는 항-MUC1 항체 또는 이의 항원 결합 단편, 상기 항체 또는 이의 항원 결합 단편을 포함하는 항체-약물 접합체 또는 이중특이 항체, 이를 포함하는 암의 예방 또는 치료용 약학 조성물 및 상기 항체 또는 이의 항원 결합 단편을 코딩하는 핵산, 상기 핵산을 포함하는 벡터 및 숙주세포, 이를 이용한 항-MUC1 항체 또는 이의 항원 결합 단편의 제조 방법에 관한 것이다.
뮤신 1(MUC1, Mucin 1)은 다수의 당화된 세포외 도메인을 포함하는 막관통 당단백질이다. MUC1 길이는 세포 표면에서 200 내지 500 nm이고 MUC1은 정상 상피 세포의 정단막에 위치한다. MUC1은 유방, 위, 식도, 췌장, 요도, 폐, 신장 및 담낭과 같은 많은 장기의 선상 또는 내강 상피 세포에서 발현된다. 정상 조직에서 MUC1의 음전하 탄수화물은 탈수, pH 변화, 화분 및 미생물로부터 기저 상피를 보호하는 물리적 장벽을 형성한다.
MUC1 유전자는 단일 전사물을 암호화한다. 번역 후, MUC1는 성게 정자 단백질 엔테로키나아제 및 아그린(SEA) 도메인 내에 위치하는 GSVVV 모티프에서 오토클리브(autocleaved)된다. 이들은 N-말단 서브유닛 (MUC1-N) 및 C-말단 서브유닛(MUC1-C)의 2개의 펩티드 단편으로 구성된다.
MUC1-N 말단 서브유닛은 다양한 수의 반복서열(Tandem Repeats)을 가지며, 프롤린/트레오닌/세린이 풍부한(PTS: Proline/Threonine/Serine-rich) 도메인 및 SEA 도메인으로 구성된다. MUC1-C 말단 서브유닛은 58개의 아미노산 세포외 도메인(ECD: Extracellular Domain), 28개의 막관통 도메인(TMD: Transmembrane Domain) 및 72개의 아미노산 세포질 도메인(CD: Cytoplasmic Domain)으로 구성된다. MUC1은 세포외 도메인에 Extensively O-linked glycosylation이 일어난다. N-당화 패턴의 정도에 따라, MUC1-C 크기는 23 내지 25 kDa이 되며, N-당화가 결핍되는 경우에는 17 kDa이 된다. 처음 MUC1이 생성된 후, MUC1는 세포에 결합 되어 있는 부분과 세포밖에 release될 수 있는 부분이 noncovalent interaction을 통해 결합되며, 이때 cleavage는 Sheddase라는 효소에 의해 일어난다. MUC1 복합체는 IFN-γ 및 TNF-α와 같은 사이토카인의 자극에 의해 분리된다. MUC1-N 방출은 TNF-알파 전환 효소(TACE: TNF-α Converting Enzyme) 및 매트릭스 기질금속단백질 분해효소(MMP: Matrix Metallo-protease)를 포함한 효소에 의해 일어난다. 이들 효소는 MUC1-C의 ECD를 절단하여 두 개의 절편으로 나누게 되며, 암이 진행됨에 따라, 이 세포외 절편은 암세포로부터 떠나 몸의 혈액내에 떠다니게 되면 세포와 결합되어져 있는 절편은 암세포와 함께 지속적으로 결합된 상태로 존재하게 된다. MUC1은 암세포의 성장에 중요한데, 그 이유는 다른 암세포에 존재하는 암세포 증식에 관련된 세포막 단백질과의 결합을 통해 지속적인 세포 증식 signal을 보내 암세포 증식에 결정적인 역할을 한다. 또한, 이 부분은 암세포 성장 및 소멸 때까지 항상 같이 그 운명을 같이 하여 암 검출의 좋은 타겟이 되며 또한 암을 제거할 수 있는 결정적인 Biomarker가 된다. 또한, MUC1의 다른 부분과는 다르게 이 부분은 유일하게 glycosylation이 되지 않는 부분으로 알려져 있으며 암과 정상적인 세포에서의 MUC1을 구별할 수 있는 뚜렷한 차이를 보이는 부분으로 생각되었다. 이에 본 발명자들은 MUC1의 세포에 결합하여 암과 운명을 같이 하며, 정상세포의 MUC1과 암세포의 MUC1을 구별할 수 있는 이 절편을 항체의 최적의 항원으로 보고 본 발명의 항체를 개발하였다.
한편, 항체-약물 접합체(Antibody-drug conjugate, ADC)는 링커를 통해 항체에 세포 독성 약물을 결합시킨 것이다. 단클론항체가 타겟 특이적 특성을 나타내므로, 항체-약물 접합체 중 약물은 선택적 표적능을 가지는 단클론항체에 의해 인지되는 항원/표적을 발현하는 종양에 전달될 수 있다. 이상적으로는 투여 후 혈액 중 프로드럭 상태의 항체-약물 접합체는 독성이 없어야 하고, 항체가 표적 종양 항원에 결합한 다음 암세포 내로 내재화되면, 약물이 활성 형태로 방출되어 종양 세포를 살해하게 된다.
이와 같이 항체가 결합하는 표적/항원을 결정하는 것이 항체-약물 접합체 제작에 가장 중요한 점이다. 특히, 항체가 결합하는 표적/항원은 종양 세포에서 우세하게, 이상적으로는 암세포 특이적 발현(과발현)하는 세포 표면 단백질이 되어 왔다.
이러한 기술적 배경하에서, 본 발명자들은 정상세포에서 발현되는 MUC1과는 차별이 되는 부분을 인식하는 암세포-MUC1에 특이적으로 결합하는 항체를 개발하고, ADC 특성상 암세포에 결합되어 ADC 효능을 극대화 할 수 있게 암세포와 운명을 같이 하는 “세포에 결합되어 있는 부분”과 결합하는 항-MUC1 항체 및 이를 포함하는 항체-약물 접합체가 MUC1 발현 세포에 특이적으로 결합하여 MUC1 발현에 의해 유발되는 질환을 치료할 수 있음을 확인하고, 본 발명을 완성하였다.
본 배경기술 부분에 기재된 상기 정보는 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것이며, 이에 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 있어 이미 알려진 선행기술을 형성하는 정보를 포함하지 않을 수 있다.
발명의 요약
본 발명의 목적은 MUC1의 “세포에 결합되어 있는 부분”에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편, 상기 항체 또는 이의 항원 결합 단편에 약물이 접합된 항체-약물 접합체 및 상기 항체 또는 이의 항원 결합 단편을 포함하는 이중특이 항체를 제공하는 데 있다.
본 발명의 다른 목적은 상기 항-MUC1 항체 생산을 위한 하이브리도마(KCLRFBP 00395)를 제공하는 데 있다.
본 발명의 또 다른 목적은 상기 항-MUC1 항체 또는 이의 항원 결합 단편, 상기 항체-약물 접합체 또는 이중특이 항체를 포함하는 암의 예방 또는 치료용 조성물 및 치료 방법을 제공하는 데 있다.
본 발명의 또 다른 목적은 상기 항-MUC1 항체 또는 이의 항원 결합 단편을 포함하는 암의 진단용 조성물 및 진단 방법을 제공하는 데 있다.
본 발명의 또 다른 목적은 리포좀 내에 MUC1-C 말단 부위, MUC1의 SEA 도메인 또는 MUC1의 C-말단 세포외 도메인 및 CpG-DNA를 캡슐화한 복합체를 포함하는 면역원성 조성물을 제공하는 데 있다.
본 발명의 또 다른 목적은 상기 면역원성 조성물을 마우스에 접종하는 단계를 포함하는 항-MUC1 단일클론 항체의 제조 방법을 제공하는 데 있다.
또한 본 발명의 또 다른 목적은 상기 항-MUC1 항체 또는 이의 항원 결합 단편을 코딩하는 핵산, 상기 핵산을 포함하는 벡터 및 숙주세포, 이를 이용한 항-MUC1 항체 또는 이의 항원 결합 단편의 제조 방법을 제공하는 데 있다.
상기 목적을 달성하기 위하여, 본 발명은 MUC1의 C-말단 세포외 도메인 내의 연속하는 5개 이상의 아미노산을 포함하는 폴리펩타이드를 인식하는 항-MUC1 항체 또는 이의 항원 결합 단편을 제공한다.
바람직하게는 항-MUC1 항체 또는 이의 항원 결합 단편은 6개의 상보성결정부위(CDR)를 포함하며, 상기 항체 또는 이의 항원 결합 단편은 서열번호 1(GYTFTSYWMH)의 중쇄 CDR1; 서열번호 2(YINPGTGYIEYNQKFKD)의 중쇄 CDR2; 서열번호 3(STAPFDY)의 중쇄 CDR3; 서열번호 4(KASQDIKSYLS)의 경쇄 CDR1; 서열번호 5(YATRLAD)의 경쇄 CDR2; 및 서열번호 6(LQYDESPYT)의 경쇄 CDR3로 구성된 군에서 선택되는 어느 하나 이상의 서열을 포함하는 것을 특징으로 할 수 있다.
본 발명은 또한, 상기 항-MUC1 항체 생산을 위한 하이브리도마(KCLRFBP 00395)를 제공한다.
본 발명은 또한, 항-MUC1 항체 또는 이의 항원 결합 단편을 포함하는 항체-약물 접합체 및 이중특이 항체를 제공한다.
본 발명은 또한, 상기 항-MUC1 항체 또는 이의 항원 결합 단편, 항체-약물 접합체 또는 이중특이 항체를 포함하는 암의 예방 또는 치료용 약학 조성물 및 치료 방법을 제공한다.
본 발명은 또한, 암의 예방 또는 치료를 위한 상기 항-MUC1 항체 또는 이의 항원 결합 단편의 용도를 제공한다.
본 발명은 또한, 암의 예방 또는 치료용 약제 제조를 위한 상기 항-MUC1 항체 또는 이의 항원 결합 단편의 사용을 제공한다.
본 발명은 또한, 상기 항-MUC1 항체 또는 이의 항원 결합 단편을 포함하는 암의 진단용 조성물 및 진단 방법을 제공한다.
본 발명은 또한, 리포좀 내에 (1) MUC1의 C-말단 부위, MUC1의 SEA 도메인 또는 MUC1의 C-말단 세포외 도메인 및 (2) CpG-DNA를 캡슐화한 복합체를 포함하는 면역원성 조성물 및 상기 면역원성 조성물을 마우스에 접종하는 단계를 포함하는 항-MUC1 단일클론 항체 제조 방법을 제공한다.
본 발명은 또한, 상기 항-MUC1 항체 또는 이의 항원 결합 단편을 코딩하는 핵산, 상기 핵산을 포함하는 벡터 및 숙주세포, 이를 이용한 항-MUC1 항체 또는 이의 항원 결합 단편의 제조 방법을 제공한다.
도 1a는 rhMUC1-C 단백질로 면역화된 마우스에서의 IgG 총량을 보여주는 그래프이다.
도 1b 및 1c는 면역화된 마우스로부터 분리된 하이브리도마 세포를 스크리닝한 결과를 보여주는 것으로, 1b는 HAT 배지를 이용한 스크리닝 결과이고, 도 1c는 HT 배지를 이용한 스크리닝 결과이다.
도 2a는 하이브리도마 세포로(hMUC1-1H7 클론) 면역화된 마우스의 복수에 대하여 ELISA를 수행한 결과를 보여주는 그래프로서, rhMUC1-C 특이적 항체의 존재를 보여준다.
도 2b는 정제한 항-hMUC1 단일클론 항체를 SDS-PAGE 및 Commassie 염색에 의하여 분석한 결과를 보여준다.
도 2c는 ELISA를 통하여 항-MUC1 항체의 이소 타입을 확인한 결과를 보여주는 그래프이다.
도 3a는 유방암 세포 용해물에 hMUC1-1H7클론에서 정제한 항-hMUC1 단일클론 항체 및 항-MUC1-CT 항체를 사용하여 웨스턴 블라팅을 수행한 결과를 보여준다.
도 3b는 MCF-7, MDA-MB-231, T47D 및 ZR75-1 세포의 세포 용해물을 마우스 정상 IgG 또는 hMUC1-1H7클론에서 정제한 항-hMUC1 단일클론 항체로 면역 침전시키고, 항-MUC1-CT 항체를 사용하여 면역 블로팅한 결과를 보여준다.
도 3c는 T47D 세포 용해물을 PNGase F로 처리하고, hMUC1-1H7클론에서 정제한 항-hMUC1 단일클론 항체를 사용하여 웨스턴 블라팅한 결과를 다른 항체를 사용한 경우와 비교하여 보여준다.
도 3d는 PNGase F로 처리 한 T47D 세포 용해물을 hMUC1-1H7클론에서 정제한 항-hMUC1 단일클론 항체로 면역 침전시킨 다음, 항-MUC1-CT 또는 항-MUC1-CT2 항체로 면역 블로팅한 결과를 보여준다.
도 4a는 췌장암 세포 용해물에 대하여 항-MUC1-CT 항체, hMUC1-1H7클론에서 정제한 항-hMUC1 항체, 또는 항-베타-액틴 항체를 이용하여 웨스턴 블라팅한 결과를 보여준다.
도 4b는 췌장암 세포 용해액에 대하여 마우스 정상 IgG 또는 hMUC1-1H7클론에서 정제한 항-hMUC1 단일클론 항체로 면역 침전시키고, 항-MUC1-CT 항체 및 항-hMUC1 단일클론 항체를 사용하여 면역 블로킹한 결과를 보여준다.
도 5A는 유방암 세포에 hMUC1-1H7클론에서 정제한 항-hMUC1 항체를 4℃에서 처리하고(Surface) 또는 0.1% Triton X-100으로 세포를 용해시킨 후 항체를 처리하여 (intracellular) 얻어진 형광이미지를 보여준다.
도 5B는 유방암 세포에 형광이 탐침된 hMUC1-1H7클론에서 정제한 항-hMUC1 항체를 처리하고 6시간 동안 37℃에서 배양한 후 얻어진 형광이미지를 보여준다.
도 6은 췌장암 세포에 hMUC1-1H7클론에서 정제한 항-hMUC1 항체를 4℃에서 처리하고(Surface) 또는 0.1% Triton X-100으로 세포를 용해시킨 후 항체를 처리하여 (intracellular) 얻어진 형광이미지를 보여준다.
도 7은 췌장암 세포에 형광이 탐침된 hMUC1-1H7클론에서 정제한 항-hMUC1 항체를 처리하고 24시간 동안 37℃에서 배양한 후 얻어진 형광이미지를 보여준다.
도 8a는 재조합 발현 플라스미드 pFabE-hMUC1-1H7를 모식적으로 보여주는 개열지도이다.
도 8b는 재조합 발현 플라스미드 pFabE-hMUC1-1H7에 의하여 발현되는 재조합 단백질을 모식적으로 보여준다.
도 8c는 MCF-7, MDA-MB-231, T47D 및 ZR75-1 세포에 hMUC1-1H7클론에서 유래된 항 hMUC1 항체의 Fab 단편을 처리하여 얻어진 형광이미지이다.
도 9는 MDA-MB-231, T47D 및 ZR75-1 세포를 hMUC1-1H7클론에서 유래된 항-hMUC1 항체를 처리한 경우의 세포 증식 변화를 보여주는 그래프이다.
도 10a 내지 10h는 유방암을 갖는 마우스에 형광이 표지된 hMUC1-1H7클론에서 유래된 항-hMUC1 단일클론 항체를 정맥투여하여 얻어진 형광 이미지이다.
도 11a 내지 11c는 췌장암을 갖는 마우스에 형광이 표지된 hMUC1-1H7클론에서 유래된 항-hMUC1 단일클론 항체를 정맥투여하여 얻어진 형광 이미지이다.
도 12a는 이종이식 마우스 모델로부터 적출된 종양 조직의 모습이다.
도 12b는 hMUC1-1H7클론에서 유래된 항-hMUC1 단일클론 항체가 투여된 이종이식 마우스 모델로부터 적출된 종양의 크기((넓이2*길이)/2)를 보여주는 그래프이다.
도 12c는 항-hMUC1 단일클론 항체가 투여된 이종이식 마우스 모델로부터 적출된 종양 무게를 보여주는 그래프이다.
도 12d는 항-hMUC1 단일클론 항체가 투여된 이종이식 마우스 모델의 체중을 나타낸 그래프이다.
도 13은 유방암 조직에서의 MUC1 단백질 발현 여부를 보여주는 결과이다.
도 14는 췌장암 조직에서의 MUC1 단백질 발현 여부를 보여주는 결과이다.
도 15는 유방암 세포주에서의 hMUC1-1H7 항체-약물 접합체의 세포 독성을 보여주는 결과이다.
도 16은 유방암 조직에서의 hMUC1-1H7 항체-약물 접합체의 암세포 증식억제 효과를 보여주는 결과이다.
도 17은 ELISA를 통해 인간화 항체(hMUC1-G3)와 hMUC1-C의 결합 친화도를 확인한 결과이다.
도 18은 hMUC1-G3 항체와 hMUC1-1H7 항체가 인식하는 hMUC1-C의 에피토프 동질성 여부를 ELISA로 확인한 결과이다.
도 19는 유세포분석기를 통해 hMUC1-G3 항체가 세포에서 발현된 hMUC1을 특이적으로 인지함을 나타내는 결과이다.
도 20은 유세포분석기를 통해 hMUC1-G3 항체와 hMUC1-1H7 항체가 ZR75-1 유방암 세포에서 발현된 hMUC1을 농도 의존적으로 인지함을 나타내는 결과이다.
도 21은 유방암 세포주 중에서 MUC1이 발현되는 세포주(ZR75-1, T47D)와 MUC1이 발현되지 않는 세포주(MDA-MB-231)에서 hMUC1-G3 항체-약물 접합체가 MUC1 발현에 따라 선택적으로 유방암 세포를 죽이는 것을 보여주는 결과이다.
도 22는 골수성 백혈병 세포주에서의 hMUC1-G3 항체-약물 접합체의 세포 독성을 보여주는 결과이다.
도 23은 유방암 환자 유래 TNBC 조직이식을 통해 제작된 이종이식 마우스 모델에서의 hMUC1-G3 항체-약물 접합체의 암세포를 선택적으로 억제하는 효과를 나타내는 결과이다.
발명의 상세한 설명 및 바람직한 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
MUC1(뮤신 1, Mucin 1)은 일반적으로 정상 상피 세포의 일면(정단막: apical membrane)에서 발현되며, 기저 상피를 건조, pH 변화, 오염, 및 미생물로부터 보호한다. 그러나, MUC1은 다양한 인간 암종에서 높은 레벨로 비정상적으로 발현되며, 당화 정도가 감소되고, 세포의 전체 표면에서 고르게 발현되며, 암세포의 증식, 침습, 전이 및 혈관형성을 촉진시키는데 관여한다. MUC1은 암 특이성 치료를 위한 타겟이 된다.
MUC1은 N-말단 서브유닛(MUC1-N) 및 C-말단 서브유닛(MUC1-C)을 포함하며, 상기 MUC1-N과 MUC1-C는 SEA 도메인(Sea urchin sperm protein enterokinase and agrin domain) 내의 절단부위에서 자가 절단되어 형성된다. SEA 도메인은 안정된 이형이량체 복합체를 형성하는데 기여한다. MUC1 절단이 일어나면 세포외 MUC1-N(MUC1의 N-말단 서브유닛)이 방출되어 많은 항-MUC1-SEA 항체들을 격리시킬 수 있다. 이제까지 알려진 대부분의 항-MUC1-SEA 항체들은 MUC1-N 반복서열 도메인을 타겟으로 하는 것으로 알려져 있다(Prinssen et al. 1998; Gillespie et al. 2000). MUC1-N은 세포 표면에서 직접적으로 발견되지 않고 말초 순환에서 관찰되므로, 제한된 순환 항-MUC1-N 항체만이 MUC1-양성 종양 세포에서 사용될 수 있다는 한계가 있다. 또한, MUC1-C(MUC1의 C-말단 서브유닛)의 에피토프를 선택하는 것 역시 어려운데, 대부분의 경우에서, MUC1-C 도메인이 막관통이거나 세포질에 위치하기 때문이다. 이와 같은 문제를 극복하기 위하여, 본 발명은 MUC1 절단 후 세포 표면에 남는 MUC1-C 말단 부위(세포외 도메인)을 타겟으로 하는 신규한 MUC1에 특이적으로 결합하는 항체를 제공한다.
본 발명은 일 관점에서, MUC1에 특이적으로 결합하는 항-MUC1 항체 또는 이의 항원 결합 단편에 관한 것이다. 더욱 상세하게는 MUC1의 C-말단 세포외 도메인 내의 연속하는 5개 이상의 아미노산을 포함하는 폴리펩타이드를 인식하는 항-MUC1 항체 또는 이의 항원 결합 단편에 관한 것이다.
특히, 본 발명에서는 PCT/KR2010/003879 특허 “리포좀에 포집된 올리고 뉴클레오타이드 및 에피토프를 포함하는 면역증강용 조성물”의 기술을 이용하여 인간 Mucin1(CD227) 전체 단백질 1134 아미노산 중 SEA 도메인을 포함하는 961 아미노산 에서부터 1152 아미노산까지 192개의 아미노산이 발현된 항원을 이용하였다. Mucin1은 다양한 인간 아데노칼스노마 여러 암 종에서 약 100배 정도 높은 발현(Immunology, 2018, 225-240)을 하고 있으며 특이하게도 세포에서 합성된 후 SEA domain내에서 절단이 일어나 SEA domain을 포함한 세포에 결합되어 있는 부분과 그 나머지 부분으로 나누어 지게 되며 두 subunit는 noncovalent하게 결합되어 있다. 정상세포의 경우에 MUC1은 heavily glycosylated 되어 있으나 이 부분은 잘려져 나간 부분에서 주로 일어나며 세포와 결합되어 있는 부분에서는 상대적으로 glycosylation이 되어 있지 않다. 본 발명에서는 이 사실을 인지하여 cleavage가 되고 나서 세포와 결합하고 있는 190 아미노산을 항원으로 사용하여 glycosylation이 일어나지 않은 대장균에서 발현을 하였다.
본 발명에 따른 항체는 대장균에서 발현된 항원으로 만들어졌으므로 glycosylation 되지 않는 항원을 인지한다. 본 발명에서는 마우스 하이브리도마 기술을 이용하여 항체를 개발하였으며, 개발된 항체는 특이하게도 아미노산 서열의 일차적 구조를 인식하지 않고 3차 구조를 인식하는 것을 확인하였다.
본 발명의 일 실시예에서, 유방암 세포주인 T47D와 ZR75-1을 이용하여 FACS를 하였을 때 MUC-1 specific하게 인지하는 것을 확인하였으나, 세포를 파쇄하여 얻은 파쇄액에서는 일차구조를 인식하는 Western에서는 인지되지 않았다. 3차 구조를 인식하는 것을 검증하기 위해 세포 파쇄액과 본 발명에 따른 항체를 이용하여 Immunoprecipition 방법으로 침천 후 Western을 하였을 경우 항원을 detection 하였으므로, 본 발명에 따른 항체는 특이적으로 3차 구조를 인식하는 항체임을 입증하였다.
본 발명에 있어서, 상기 MUC1의 C-말단 세포외 도메인은 서열번호 10(SVV VQLTLAFREG TINVHDVETQ FNQYKTEAAS RYNLTISDVS VSDVPFPFSA QS)의 아미노산 서열로 이루어진 것을 특징으로 할 수 있다.
본 명세서에서 "항체"라 함은, 면역계 내에서 항원의 자극에 의하여 만들어지는 물질을 총칭하는 것으로서 그 종류는 특별히 제한되지 않는다. 상기 항체는 특정 항원과 면역학적으로 반응성인 면역글로블린 분자로, 항원을 특이적으로 인식하는 수용체 역할을 하는 단백질 분자를 의미하며, 다클론 항체(polyclonal antibody) 및 단클론 항체(단일클론 항체, monoclonal antibody) 항체와 전체 항체 및 항체 단편을 모두 포함할 수 있다. 상기 항체는 비자연적으로 생성된 것, 예컨대, 재조합적 또는 합성적으로 생성된 것일 수 있다. 상기 항체는 동물 항체(예컨대, 마우스 항체 등), 키메릭 항체, 인간화 항체 또는 인간 항체일 수 있다. 상기 항체는 단일클론 항체일 수 있다. 또한 항체는 특별한 언급이 없는 한, 항원 결합능을 보유한 항체의 항원 결합 단편도 포함하는 것으로 이해될 수 있다.
본 명세서에서 "상보성결정부위(Complementarity-determining regions, CDR)"라 함은, 항체의 가변 부위 중에서 항원과의 결합 특이성을 부여하는 부위를 의미한다. 앞서 설명한 항체의 항원 결합 단편은 상기 상보성결정부위를 하나 이상 포함하는 항체 단편일 수 있다.
본 발명에 있어서, 상기 항-MUC1 항체는 하이브리도마 hMUC1-1H7(KCLRF-BP-00395)로부터 생산된 것일 수 있다. 또한, 상기 항-MUC1 항체 또는 이의 항원 결합 단편은 상기 하이브리도마 hMUC1-1H7(KCLRF-BP-00395)로부터 생산된 항체의 상보성결정부위(CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 및 CDR-L3) 또는 중쇄 가변영역 및 경쇄 가변영역을 포함하는 것을 특징으로 할 수 있다.
한 측면에서, 본 발명에 따른 항-MUC1 항체 또는 이의 항원 결합 단편은 6개의 상보성결정부위(CDR)를 포함한다. 상기 항체 또는 이의 항원 결합 단편은 서열번호 1(GYTFTSYWMH)의 중쇄 CDR1; 서열번호 2(YINPGTGYIEYNQKFKD)의 중쇄 CDR2; 서열번호 3(STAPFDY)의 중쇄 CDR3; 서열번호 4(KASQDIKSYLS)의 경쇄 CDR1; 서열번호 5(YATRLAD)의 경쇄 CDR2; 및 서열번호 6(LQYDESPYT)의 경쇄 CDR3로 구성된 군에서 선택되는 어느 하나 이상의 서열을 포함하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 항체 또는 이의 항원 결합 단편은 서열번호 1의 중쇄 CDR1; 서열번호 2의 중쇄 CDR2; 서열번호 3의 중쇄 CDR3; 서열번호 4의 경쇄 CDR1; 서열번호 5의 경쇄 CDR2; 및 서열번호 6의 경쇄 CDR3를 모두 포함하는 것일 수 있다.
본 발명에 있어서, 상기 항체 또는 이의 항원 결합 단편은 서열번호 22 또는 24의 중쇄 가변영역 및 서열번호 23 또는 25의 경쇄 가변영역을 포함하는 것을 특징으로 할 수 있다. 더욱 구체적으로. 상기 항체 또는 이의 항원 결합 단편은 서열번호 22의 중쇄 가변영역 및 서열번호 23의 경쇄 가변영역; 또는 서열번호 24의 중쇄 가변영역 및 서열번호 25의 경쇄 가변영역을 포함하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 항-MUC1 항체 또는 이의 항원 결합 단편은 MUC1에 대한 저해 효과를 갖는다.
MUC1 유전자는 하나의 전사체를 암호화하고, 번역 후에 MUC1 단백질은 SEA 도메인 내에 위치하는 GSVVV 모티프 중 "G"에서 자가절단(autocleaved)된다. 본 발명에 있어서, MUC1 단백질은 인간 MUC1 단백질일 수 있으며, 예컨대, GenBank Accession No. P15941의 아미노산 서열(서열번호 7)을 포함하거나, 또는 이와 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 서열 상동성을 갖는 것일 수 있다. 상기 MUC1 단백질의 세포외 도메인은 인간 MUC1 단백질의 세포외 도메인일 수 있으며, 예컨대, GenBank Accession No. P15941의 아미노산 서열(서열번호 7) 중 961번째부터 1152번째까지의 192개 아미노산을 포함하는 단백질 단편(서열번호 8)일 수 있다. 상기 MUC1 단백질의 세포외 도메인은 SEA 도메인을 포함하며, 일 예에서, 상기 SEA 도메인은 GenBank Accession No. P15941의 아미노산 서열(서열번호 7) 중 1034번째부터 1152번째까지의 119개 아미노산을 포함하는 단백질 단편 (서열번호 9)일 수 있다. 상기 SEA 도메인에 존재하는 GSVVV 모티프 중 "G"이 절단부위이며, 여기서 절단이 발생한 경우, 상기 "G" 이후(C-말단 방향으로)의 부위는 MUC1 단백질의 C-말단 세포외 도메인(또는 'MUC1-C 말단(부위) 세포외 도메인' 또는 'MUC1-C 서브유닛'이라고도 칭함)(서열번호 10)이 된다(표 1).
MUC1 단백질 부위 설명 서열
MUC1 단백질의 전체 아미노산 서열 P15941의 전체 아미노산 서열 MTPGTQSPFF LLLLLTVLTV VTGSGHASST PGGEKETSAT QRSSVPSSTE KNAVSMTSSV LSSHSPGSGS STTQGQDVTL APATEPASGS AATWGQDVTS VPVTRPALGS TTPPAHDVTS APDNKPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDTRPAPGS TAPPAHGVTS APDNRPALGS TAPPVHNVTS ASGSASGSAS TLVHNGTSAR ATTTPASKST PFSIPSHHSD TPTTLASHST KTDASSTHHS SVPPLTSSNH STSPQLSTGV SFFFLSFHIS NLQFNSSLED PSTDYYQELQ RDISEMFLQI YKQGGFLGLS NIKFRPGSVV VQLTLAFREG TINVHDVETQ FNQYKTEAAS RYNLTISDVS VSDVPFPFSA QSGAGVPGWG IALLVLVCVL VALAIVYLIA LAVCQCRRKN YGQLDIFPAR DTYHPMSEYP TYHTHGRYVP PSSTDRSPYE KVSAGNGGSS LSYTNPAVAA TSANL(서열번호 7)
MUC1 단백질의 세포외 도메인(C 말단 방향) P15941 중 961-1152의 192개 아미노산 포함 ASGSASGSAS TLVHNGTSAR ATTTPASKST PFSIPSHHSD TPTTLASHST KTDASSTHHS SVPPLTSSNH STSPQLSTGV SFFFLSFHIS NLQFNSSLED PSTDYYQELQ RDISEMFLQI YKQGGFLGLS NIKFRPGSVV VQLTLAFREG TINVHDVETQ FNQYKTEAAS RYNLTISDVS VSDVPFPFSA QS(서열번호 8; 밑줄: SEA 도메인; "G": 절단부위)
MUC1 단백질의 SEA 도메인 P15941 중 1034-1152의 119개 아미노산 포함 PQLSTGV SFFFLSFHIS NLQFNSSLED PSTDYYQELQ RDISEMFLQI YKQGGFLGLS NIKFRPG SVV VQLTLAFREG TINVHDVETQ FNQYKTEAAS RYNLTISDVS VSDVPFPFSA QS(서열번호 9; 밑줄: C-말단 세포외 도메인)
MUC1-C 말단부위 세포외 도메인 MUC1 단백질의 SEA 도메인에서 절단되어 생성된 C-말단 서브유닛 SVV VQLTLAFREG TINVHDVETQ FNQYKTEAAS RYNLTISDVS VSDVPFPFSA QS(서열번호 10)
본 발명에 있어서, 상기 항-MUC1 항체 또는 이의 항원 결합 단편은 MUC1 단백질(예컨대, 서열번호 7), 구체적으로, MUC1 단백질의 C-말단 세포외 도메인(예컨대, 서열번호 10) 내의 5개, 7개, 10개, 12개 이상 또는 바람직하게는 15개 이상의 아미노산을 포함하는 폴리펩타이드(에피토프)를 인식하거나 특이적으로 결합하는 것을 특징으로 할 수 있다. 상기 항체 또는 이의 항원 결합 단편은 MUC1 단백질의 세포외 도메인(예컨대, 서열번호 8), MUC1 단백질의 SEA 도메인(예컨대, 서열번호 9) 또는 MUC1 단백질의 C-말단 세포외 도메인(예컨대, 서열번호 10)을 인식하거나, 및/또는 여기에 특이적으로 결합하는 것을 특징으로 할 수 있다.
본 명세서에서의 용어 “MUC1 특이적 항체" 또는 “MUC1에 특이적으로 결합하는 항체"는 MUC1에 결합하여 MUC1의 생물학적 활성의 억제를 초래하는 항체를 의미하며, "항-MUC1 항체"와 혼용되어 사용된다.
본 발명에서의 "항-MUC1 항체"는 동물 항체(예컨대, 마우스 항체), 키메릭 항체(예컨대, 마우스-인간 키메릭 항체) 또는 인간화 항체일 수 있고, 단일클론 항체 또는 다클론 항체일 수 있으며, 예컨대, 단일클론 항체일 수 있다. 다클론 항체(polyclonal antibody) 및 단일클론 항체(단클론 항체, monoclonal antibody)를 모두 포함하는 개념으로, 바람직하게는 단일클론 항체이며, 온전한 전체 항체(whole antibody) 형태를 가질 수 있다. 전체 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 구조로서, 불변영역을 포함하는 구조이며, 각각의 경쇄는 중쇄와 다이설파이드 결합으로 연결되어 있다.
본 발명에 따른 항-MUC1 항체의 전체 항체는 IgA, IgD, IgE, IgM 및 IgG 형태를 포함하는 개념으로, IgG는 아형(subtype)으로, IgG1, IgG2, IgG3 및 IgG4를 포함한다.
완전한 IgG 형태의 항체는 2개의 전장(full length) 경쇄 및 2개의 전장 중쇄를 가지는 구조이며 각각의 경쇄는 중쇄와 이황화 결합으로 연결되어 있다. 항체의 불변 영역은 중쇄 불변 영역과 경쇄 불변 영역으로 나뉘어지며, 중쇄 불변 영역은 감마(γ), 뮤(μ), 알파(α), 델타(δ) 및 엡실론(ε) 타입을 가지고, 서브클래스로 감마1(γ1), 감마2(γ2), 감마3(γ3), 감마4(γ4), 알파1(α1) 및 알파2(α2)를 가진다. 경쇄의 불변 영역은 카파(κ) 및 람다(λ) 타입을 가진다.
본 발명에 있어서, 용어 "중쇄(heavy chain)"는 항원에 특이성을 부여하기 위해 충분한 가변 영역 서열을 갖는 아미노산 서열을 포함하는 가변 영역 도메인 VH 및 3개의 불변 영역 도메인 CH1, CH2 및 CH3과 힌지(hinge)를 포함하는 전장 중쇄 및 이의 단편을 모두 포함하는 의미로 해석된다. 또한, 용어 "경쇄(light chain)"는 항원에 특이성을 부여하기 위한 충분한 가변영역 서열을 갖는 아미노산 서열을 포함하는 가변 영역 도메인 VL 및 불변 영역 도메인 CL을 포함하는 전장 경쇄 및 이의 단편을 모두 포함하는 의미로 해석된다.
본 발명에 있어서, "CDR(complementarity determining region)"은 면역글로불린의 중쇄 및 경쇄의 고가변 영역(hypervariable region)의 아미노산 서열을 의미한다. 중쇄 및 경쇄는 각각 3개의 CDR을 포함할 수 있다(CDRH1, CDRH2, CDRH3 및 CDRL1, CDRL2, CDRL3). 상기 CDR은 항체가 항원 또는 에피토프에 결합하는 데 있어서 주요한 접촉 잔기를 제공할 수 있다.
한편, 용어 "특이적으로 결합" 또는 "특이적으로 인식"은 당업자에게 통상적으로 공지되어 있는 의미와 동일한 것으로서, 항원 및 항체가 특이적으로 상호작용하여 면역학적 반응을 하는 것을 의미한다.
본 발명에 따른 항-MUC1 항체의 “항원 결합 단편”은 항-MUC1 항체의 항원, 즉 MUC1와 결합할 수 있는 기능을 보유하고 있는 단편을 의미하며, Fab, Fab', F(ab')2, scFv (scFv)2, scFv-Fc, 및 Fv 등을 포함하는 개념으로, 본 명세서에서는“항체 단편”과 동일한 의미로 혼용되어 사용된다. 항원 결합 단편은 예를 들어, scFv, (scFv)2, Fab, Fab' 또는 F(ab')2일 수 있으나, 이에 한정되는 것은 아니다. 상기 항원 결합 단편 중 Fab는 경쇄 및 중쇄의 가변영역과 경쇄의 불변 영역 및 중쇄의 첫 번째 불변 영역(CH1)을 가지는 구조로 1개의 항원 결합 부위를 가진다. Fab'는 중쇄 CH1 도메인의 C-말단에 하나 이상의 시스테인 잔기를 포함하는 힌지 영역(hinge region)을 가진다는 점에서 Fab와 차이가 있다. F(ab')2 항체는 Fab'의 힌지 영역의 시스테인 잔기가 디설파이드 결합을 이루면서 생성된다. Fv는 중쇄 가변부위 및 경쇄 가변부위만을 가지고 있는 최소의 항체조각으로 Fv 단편을 생성하는 재조합 기술은 당업계에 널리 공지되어 있다. 이중쇄 Fv(two-chain Fv)는 비공유 결합으로 중쇄 가변부위와 경쇄 가변부위가 연결되어 있고 단쇄 Fv(single-chain Fv)는 일반적으로 펩타이드 링커를 통하여 중쇄의 가변 영역과 단쇄의 가변 영역이 공유 결합으로 연결되거나 또는 C-말단에서 바로 연결되어 있어서 이중쇄 Fv와 같이 다이머와 같은 구조를 이룰 수 있다. 상기 항원 결합 단편은 단백질 가수분해 효소를 이용해서 얻을 수 있고(예를 들어, 전체 항체를 파파인으로 제한 절단하면 Fab를 얻을 수 있고 펩신으로 절단하면 F(ab')2 단편을 얻을 수 있다), 유전자 재조합 기술을 통하여 제작할 수 있다.
본 발명에 있어서, 용어 "힌지 영역(hinge region)"은 항체의 중쇄에 포함되어 있는 영역으로서, CH1 및 CH2 영역 사이에 존재하며, 항체 내 항원 결합 부위의 유연성(flexibility)을 제공하는 기능을 하는 영역을 의미한다.
상기 항-MUC1 항체는 단일클론 항체일 수 있다. 단일클론 항체는 당업계에 널리 알려진 방법대로 제조될 수 있다. 예컨대, phage display 기법을 이용해서 제조될 수 있다. 또는 항-MUC1 항체를 이용해서 통상의 방법에 의하여 마우스 유래의 단일클론 항체로 제조될 수 있다.
한편, 전형적인 ELISA(Enzyme-Linked ImmunoSorbent Assay) 포맷을 이용하여 MUC1와의 결합능에 기초하여 개별 단클론 항체들을 스크리닝할 수 있다. 결합체들에 대해 분자적 상호작용을 검정하기 위한 경쟁적 ELISA(Competitive ELISA)와 같은 기능성 분석 또는 세포-기반 분석(cell-based assay)과 같은 기능성 분석을 통해 저해 활성에 대해 검정할 수 있다. 그런 다음 강한 저해 활성에 기초하여 선택된 단클론항체 멤버들에 대해 MUC1에 대한 각각의 친화도(Kd values)를 검정한다.
본 발명에 따른 항-MUC1 항체 또는 그의 항원 결합 단편의 권리범위에는, 본 발명에 따른 항-MUC1 항체 또는 그의 항원 결합 단편에 포함된 경쇄 및 중쇄의 CDR1 내지 CDR3 중 어느 하나 이상을 가지면서, 실질적으로 동일한 MUC1 항원에 대한 결합능 및 특이성을 가지는 펩타이드(peptide) 및 압타머(aptamer)도 포함된다.
본 발명은 다른 관점에서, 상기 항-MUC1 항체를 생산하는 하이브리도마에 관한 것이다. 본 발명에 있어서, 상기 하이브리도마는 기탁번호 KCLRF-BP-00395이다.
본 발명은, 상기 하이브리도마가 생산하는 항-MUC1 항체 또는 이의 항원 결합 단편을 제공한다. 다른 예는 상기 하이브리도마가 생산하는 항-MUC1 항체의 중쇄 상보성결정부위(CDR-H1, CDR-H2, CDR-H3, 또는 이들의 조합), 경쇄 상보성결정부위(CDR-L1, CDR-L2, CDR-L3, 또는 이들의 조합), 또는 이들의 조합; 또는 상기 하이브리도마가 생산하는 항-MUC1 항체의 중쇄 가변영역, 경쇄 가변영역, 또는 이들의 조합을 포함하는 항-MUC1 항체 또는 이의 항원 결합 단편을 제공한다. 이 때, 상기 상보성결정부위는 통상적인 모든 방법에 의하여 결정될 수 있으며, 예컨대, IMGT definition(http://www.imgt.org/IMGT_vquest/share/textes/) 또는 Kabat definition(http://www.bioinf.org.uk/abs/)에 의하여 결정될 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 항-MUC1 항체 또는 이의 항원 결합 단편은 MUC1-C 말단 세포외 도메인을 특이적으로 인식함으로써, MUC1-C 말단 세포외 도메인이 정상세포 대비 높은 수준으로 발현되고 당화가 적게 된 암 또는 종양 세포에서 특이적으로 작용할 수 있으며, 또한 세포의 일면뿐 아니라 전체 표면에 발현된 MUC1 단백질을 인식/결합할 수 있다. 또한, 상기 항-MUC1 항체 또는 이의 항원 결합 단편은 MUC1 단백질, 특히 MUC1-C 말단 세포외 도메인과 결합할 뿐 아니라, 세포 내로 internalization시킴으로써(실시예 9-8, 실시예 18 참조) MUC1 매개 pathway를 효과적으로 저해하여 약리적 효과를 극대화시킬 수 있다. 또한, 상기 항-MUC1 항체 또는 이의 항원 결합 단편의 internalization 특성은 항체-약물 접합체(ADC)로 적용되는 경우에 접합된 약물을 효과적으로 세포 내로 전달시킬 수 있는 이점을 갖게 된다.
본 발명은 또 다른 관점에서, 본 발명에 따른 항-MUC1 항체 또는 그의 항원 결합 단편을 포함하는 CAR(Chimeric antigen receptor)-T 세포 치료제 및/또는 CAR(Chimeric antigen receptor)-NK(natural killer cell)에 관한 것이다. 상기 CAR-T 또는 CAR-NK에 포함되는 항-MUC1 항체 또는 그의 항원 결합 단편의 형태는 scFv가 바람직하지만, 이에 한정되는 것은 아니다.
본 발명은 또 다른 관점에서, 상기 항-MUC1 항체 또는 이의 항원 결합 단편에 약물이 접합된 항체-약물 접합체(Antibody-drug conjugate, ADC)에 관한 것이다.
본 발명의 일 실시예에서, 상기 항체-약물 접합체의 약물은 모노메틸 아우리스타틴 E(monomethyl auristatin E; MMAE)이다. 상기 항체-약물 접합체는 MUC1 발현 세포에 결합된 후, MUC1 발현 종양 세포로 내제화되고, 단백질 분해성 절단(proteolytic cleavage)에 의해 MMAE가 표적 MUC1 세포로 선택적으로 방출된다. 방출된 MMAE가 튜불린(Tubulin)에 결합하게 되면, 세포내 미세관 망을 분열시키고 세포주기정지를 유도하며, 미세관 분열이 발생하면서 세포사멸이 진행된다.
항체-약물 접합체(Antibody-drug conjugate, ADC)는 타겟 암세포로 항암 약물을 전달하기 전까지 항암 약물이 항체에 안정적으로 결합되어 있어야 한다. 타겟으로 전달된 약물은 항체로부터 유리되어 타겟 세포의 사멸을 유도해야 한다. 이를 위해서는 약물이 항체에 안정적으로 결합함과 동시에 타겟 세포에서 유리될 때는 타겟 세포의 사멸을 유도할 충분한 세포독성을 가져야 한다.
본 발명에 있어서, 상기 항-MUC1 항체 또는 이의 항원 결합 단편과 항암제 등 약물을 포함하는 세포독성물질은 서로 결합(예컨대, 공유결합, 펩타이드 결합 등에 의함)되어 접합체(conjugate) 또는 융합 단백질(세포독성물질 및/또는 표지물질이 단백질인 경우)의 형태로 사용될 수 있다. 상기 세포독성물질은 암세포, 특히 고형암세포에 대하여 독성을 갖는 모든 물질일 수 있으며, 방사선동위원소, 세포 독소 화합물(small molecule), 세포 독성 단백질, 항암제 등으로 이루어진 군에서 선택된 1종 이상일 수 있으나, 이에 제한되는 것은 아니다. 상기 세포 독소 단백질은 리신(ricin), 사포린(saporin), 젤로닌(gelonin), 모로딘(momordin), 데보가닌 (debouganin), 디프테리아독소, 녹농균독소(pseudomonas toxin) 등으로 이루어진 군에서 선택된 1종 이상일 수 있으나, 이에 제한되는 것은 아니다. 상기 방사선동위원소로는 131I, 188Rh, 90Y 등으로 이루어진 군에서 선택된 1종 이상일 수 있으나, 이에 제한되는 것은 아니다. 상기 세포 독소 화합물은 듀오카마이신(duocarmycin), 모노메틸 아우리스타틴 E(monomethyl auristatin E; MMAE), 모노메틸 아우리스타틴 F(monomethyl auristatin F; MMAF), N2'-디아세틸-N2'-(3-머캅토-1-옥소프로필)메이탄신(N2'-deacetyl-N2'-(3-mercapto-1-oxopropyl)maytansine; DM1), PBD (Pyrrolobenzodiazepine) dimer 등으로 이루어진 군에서 선택된 1종 이상일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 항체-약물 접합체는 본 발명이 속하는 기술분야에 잘 알려진 기술에 따른 것일 수 있다.
본 발명에 있어서, 상기 항체-약물 접합체는 상기 항체 또는 이의 항원 결합 단편이 링커를 통하여 약물과 결합되는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 링커는 절단성 링커 또는 비절단성 링커인 것을 특징으로 할 수 있다.
상기 링커는 항-MUC1 항체와 약물 사이를 연결하는 부위로, 예를 들어 상기 링커는 세포내 조건에서 절단 가능한 형태 즉, 세포 내 환경에서 항체에서 약물이 링커의 절단을 통해 방출될 수 있도록 한다.
상기 링커는 세포 내 환경 예를 들어 리소좀 또는 엔도좀에 존재하는 절단제에 의해 절단될 수 있으며, 세포 내 펩티다아제 또는 프로테아제 효소 예를 들어 리소좀 또는 엔도좀 프로테아제에 의해 절단될 수 있는 펩타이드 링커일 수 있다. 일반적으로 펩타이드 링커는 적어도 2개 이상의 아미노산 길이를 가진다. 상기 절단제는 카텝신 B 및 카텝신 D, 플라스민을 포함할 수 있으며, 펩타이드를 가수분해 하여 약물을 표적 세포 내로 방출할 수 있도록 한다. 상기 펩타이드 링커는 티올 의존성 프로테아제 카텝신-B에 의해 절단될 수 있고, 이는 암 조직에서 고발현되며, 예를 들어 Phe-Leu 또는 Gly-Phe-Leu-Gly 링커가 사용될 수 있다. 또한, 상기 펩타이드 링커는 예를 들어 세포 내 프로테아제에 의해 절단될 수 있는 것으로, Val-Cit 링커이거나 Phe-Lys 링커일 수 있다.
본 발명에 있어서, 상기 절단성 링커는 pH 민감성으로, 특정 pH 값에서 가수분해에 민감할 수 있다. 일반적으로, pH 민감성 링커는 산성 조건에서 가수분해될 수 있음을 나타낸다. 예를 들어, 리소좀에서 가수분해될 수 있는 산성 불안정 링커 예를 들어, 하이드라존, 세미카바존, 티오세미카바존, 시스-아코니틱 아마이드 (cis-aconitic amide), 오르쏘에스테르, 아세탈, 케탈 등일 수 있다.
상기 링커는 환원 조건에서 절단될 수도 있으며, 예를 들어 이황화 링커가 이에 해당할 수 있다. SATA(N-succinimidyl-S-acetylthioacetate), SPDP(N-succinimidyl-3-(2-pyridyldithio)propionate), SPDB(N-succinimidyl-3-(2-pyridyldithio)butyrate) 및 SMPT(N-succinimidyl-oxycarbonyl-alpha-methyl-alpha-(2-pyridyl-dithio)toluene)를 사용하여 다양한 이황화 결합이 형성될 수 있다.
본 발명에 있어서, 상기 약물 및/또는 약물-링커는 항체의 라이신을 통해 무작위로 접합되거나, 이황화 결합 사슬을 환원하였을 때 노출되는 시스테인을 통해 접합될 수 있다. 경우에 따라서, 유전공학적으로 제작된 태그 예를 들어, 펩타이드 또는 단백질에 존재하는 시스테인을 통해 링커-약물이 결합될 수 있다. 상기 유전공학적으로 제작된 태그 예를 들어, 펩타이드 또는 단백질은 예를 들어, 이소프레노이드 트랜스퍼라제에 의하여 인식될 수 있는 아미노산 모티프를 포함할 수 있다. 상기 펩타이드 또는 단백질은 펩타이드 또는 단백질의 카복시 말단에서 결실(deletion)을 가지거나, 펩타이드 또는 단백질의 카복시(C) 말단에 스페이서 유닛의 공유결합을 통한 부가를 갖는다. 상기 펩타이드 또는 단백질은 아미노산 모티프와 바로 공유결합 되거나, 스페이서 유닛과 공유결합 되어 아미노산 모티프와 연결될 수 있다. 상기 아미노산 스페이서 유닛은 1 내지 20개의 아미노산으로 구성되며, 그 중에서 글리신(glycine) 유닛이 바람직하다.
상기 링커는 리소좀에서 다수 존재하거나, 또는 몇몇 종양세포에서 과발현되는 베타-글루쿠로니데이즈(β-glucuronidase)에 의해 인식되어 가수분해 되는 베타-글루쿠로나이드 링커를 포함할 수 있다. 펩타이드 링커와는 달리 친수성(hydrophilicity)이 커서 소수성의 성질이 높은 약물과 결합시 항체-약물 복합체의 용해도를 증가시킬 수 있는 장점을 지닌다.
이와 관련하여, 본 발명에서는 대한민국 특허공개공보 제2015-0137015호에 개시된 베타-글루쿠로나이드 링커, 예를 들어 자가-희생기(self-immolative group)를 포함하는 베타-글루쿠로나이드 링커를 사용할 수 있다.
또한, 상기 링커는 예를 들어 비절단성 링커일 수 있으며, 항체 가수분해 한 단계만을 통해 약물이 방출되어, 예를 들어 아미노산-링커-약물 복합체를 생산한다. 이러한 유형의 링커는 티오에테르기 또는 말레이미도카프로일기(maleimidocaproyl)일 수 있고, 혈액 내 안정성을 유지할 수 있다.
본 발명에 있어서, 상기 약물은 화학요법제, 독소, 마이크로 RNA(miRNA), siRNA, shRNA 또는 방사성 동위원소인 것을 특징으로 할 수 있다. 상기 약물은 약리학적 효과를 나타내는 제제로 항체에 결합될 수 있다.
상기 화학요법제는 세포독성 제제 또는 면역억제제일 수 있다. 구체적으로 마이크로투불린 억제제, 유사분열 억제제, 토포이소머라아제 억제제, 또는 DNA 인터컬레이터로서 기능할 수 있는 화학요법제를 포함할 수 있다. 또한, 면역조절 화합물, 항암제, 항바이러스제, 항박테리아제, 항진균제, 구충제 또는 이들의 조합을 포함할 수 있다.
상기 약물에는 예를 들어, 마이탄시노이드, 오리스타틴, 아미노프테린, 악티노마이신, 블레오마이신, 탈리소마이신, 캄프토쎄신, N8-아세틸 스퍼미딘, 1-(2 클로로에틸)-1,2-다이메틸 술포닐 하이드라자이드, 에스퍼라마이신, 에토포사이드, 6-머캅토퓨린, 돌라스타틴, 트리코테센, 칼리케아미신, 탁솔(taxol), 탁산, 파클리탁셀(paclitaxel), 도세탁셀(docetaxel), 메토트렉세이트, 빈크리스틴, 빈블라스틴, 독소루비신, 멜팔란, 미토마이신 A, 미토마이신 C, 클로람부실, 듀오카마이신, L-아스파라기나제(L-asparaginase), 머캡토퓨린(mercaptopurine), 티오구아닌(thioguanine), 하이드록시우레아(hydroxyurea), 시타라빈(cytarabine), 사이클로포스파미드(cyclophosphamide), 이포스파미드(ifosfamide), 니트로소우레아(nitrosourea), 시스플라틴(cisplatin), 카보플라틴(carboplatin), 미토마이신(mitomycin), 다카바진(dacarbazine), 프로카바진(procarbazine), 토포테칸(topotecan), 질소 머스터드(nitrogen mustard), 사이톡산(cytoxan), 에토포시드(etoposide), 5-플루오로우라실(5-fluorouracil), CNU(bischloroethylnitrosourea), 이리노테칸(irinotecan), 캄포토테신(camptothecin), 블레오마이신(bleomycin), 이다루비신(idarubicin), 다우노루비신(daunorubicin), 닥티노마이신(dactinomycin), 플리카마이신(plicamycin), 미톡산트론(mitoxantrone), 아스파라기나제(asparaginase), 비노렐빈(vinorelbine), 클로로람부실(chlorambucil), 멜파란(melphalan), 카르무스틴(carmustine), 로무스틴(lomustine), 부설판(busuLfan), 트레오설판(treosulfan), 데카바진(decarbazine), 에토포시드(etoposide), 테니포시드(teniposide), 토포테칸(topotecan), 9-아미노캠프토테신(9-aminocamptothecin), 크리스나톨(crisnatol), 미토마이신 C(mitomycin C), 트리메트렉세이트(trimetrexate), 마이코페놀산(mycophenolic acid), 티아조퓨린(tiazofurin), 리바비린(ribavirin), EICAR(5-ethynyl-1-beta-Dribofuranosylimidazole-4-carboxamide), 하이드록시우레아(hydroxyurea), 데프록사민(deferoxamine), 플룩수리딘(floxuridine), 독시플루리딘(doxifluridine), 랄티트렉세드(raltitrexed), 시타라빈(cytarabine(ara C)), 시토신 아라비노시드(cytosine arabinoside), 플루다라빈(fludarabine), 타목시펜(tamoxifen), 라록시펜(raloxifene), 메게스트롤(megestrol), 고세렐린(goserelin), 류프롤리드 아세 테이트(leuprolide acetate), 플루타미드(flutamide), 바이칼루타마이드(bicalutamide), EB1089, CB1093, KH1060, 베르테포르핀(verteporfin), 프탈로시아닌(phthalocyanine), 광감작제 Pe4(photosensitizer Pe4), 데메톡시-하이포크레린 A(demethoxy-hypocrellin A), 인터페론-α(Interferon-α), 인터페론-γ(Interferon-γ), 종양 괴사 인자(tumor necrosis factor), 겜사이타빈(Gemcitabine), 벨케이드(velcade), 레발미드(revamid), 탈라미드(thalamid), 로바스타틴(lovastatin), 1-메틸-4-페닐피리디늄 이온(1-methyl-4-phenylpyridiniumion), 스타우로스포린(staurosporine), 악티노마이신 D(actinomycin D), 닥티노마이신(dactinomycin), 블레오마이신 A2(bleomycin A2), 블레오마이신 B2(bleomycinB2), 페플로마이신(peplomycin), 에피루비신(epirubicin), 피라루비신(pirarubicin), 조루비신(zorubicin), 마이토산트론(mitoxantrone), 베라파밀(verapamil) 및 탑시가르긴(thapsigargin), 핵산 분해 효소 및 세균이나 동식물 유래의 독소로 구성된 군에서 선택된 하나 이상일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 약물은 링커 및 링커 시약 상의 친전자성 기와 공유결합을 형성하기 위해 반응할 수 있는 아민, 티올, 히드록실, 히드라지드, 옥심, 히드라진, 티오세미카바존, 히드라진 카르복실레이트, 및 아릴히드라지드기로 구성된 군에서 선택된 하나 이상의 친핵기를 포함할 수 있다.
본 발명은 또 다른 관점에서, 상기 항-MUC1 항체 또는 이의 항원 결합 단편을 포함하는 이중특이 항체(Bispecific antibody)에 관한 것이다.
상기 이중특이 항체는 항체의 2개의 암(arm) 중에서, 하나의 암(arm)은 본 발명에 따른 항-MUC1 항체 또는 이의 항원 결합 단편을 포함하고, 나머지 다른 암(arm)은 MUC1 이외의 다른 항원, 바람직하게는 암 관련 항원 또는 면역관문 단백질 항원에 특이적인 항체 또는 면역효능세포 관련 항원에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편을 포함하는 형태를 의미한다.
본 발명에 따른 이중 항체에 포함되는 항-MUC1 항체 이외의 항체가 결합하는 항원은 바람직하게는 암 관련 항원 또는 면역관문 단백질 항원으로 Her2, EGFR, VEGF, VEGF-R, CD-20, MUC16, CD30, CD33, CD52, PD-1, PD-L1, CTLA4, BTLA4, EphB2, E-셀렉틴(selectin), EpCam, CEA, PSMA, PSA, ERB3, c-MET 등에서 선택될 수 있고, 면역효능세포 관련 항원으로는 TCR/CD3, CD16(FcγRIIIa) CD44, CD56, CD69, CD64(FcγRI), CD89 및 CD11b/CD18(CR3) 등이 선택될 수 있지만, 이에 한정되는 것은 아니다.
본 발명은 또 다른 관점에서, 상기 항-MUC1 항체 또는 이의 항원 결합 단편, 상기 항체-약물 접합체 또는 상기 이중특이 항체를 포함하는 MUC1 관련 질병의 예방 및/또는 치료용 약학 조성물에 관한 것이다.
상기 MUC1 관련 질병은 MUC1의 발현 또는 과발현, MUC1의 세포의 모든 표면에서 발현, 및/또는 정상 세포 대비 MUC1 단백질의 당화 감소와 관련된 질병일 수 있으며, 예컨대, 암일 수 있다. 상기 정상세포는 비-종양 세포일 수 있다. 이에 따라 상기 MUC1 관련 질병은 바람직하게는 암 또는 종양이지만, 이에 한정되는 것은 아니다.
용어 "암" 또는 "종양"은 전형적으로 조절되지 않은 세포 성장/증식을 특징으로 하는 포유동물의 생리학적 상태를 지칭하거나 의미한다.
본 발명의 조성물로 치료할 수 있는 암 또는 암종은 특별히 제한되지 않으며, 고형암 및 혈액암을 모두 포함한다. 이러한 암의 예로는 흑색종 등의 피부암, 간암, 간세포암(hepatocellular carcinoma), 간세포성암, 위암, 유방암, 폐암, 난소암, 기관지암, 비인두암, 후두암, 췌장암, 방광암, 대장암, 결장암, 이자암, 자궁경부암, 뇌암, 전립선암, 골암, 피부암, 갑상선암, 부갑상선암, 신장암, 식도암, 담도암, 고환암, 직장암, 두경부암, 경추암, 요관암, 골육종, 신경아세포종, 섬유육종, 횡문근육종, 성상세포종, 신경모세포종 및 신경교종으로 이루어진 군에서 선택될 수 있지만, 이에 한정되는 것은 아니다.
보다 바람직하게, 상기 암은 MUC1 단백질이 발현된 것을 특징으로 하며, 유방암, 췌장암, 전립선암, 폐암, 갑상선암, 위암, 난소암, 대장암, 간암, 담낭암, 신장암, 자궁경부암, 또는 방광암일 수 있으나, 이에 제한되는 것은 아니다. 상기 암은 원발성 암 또는 전이성 암일 수 있다.
상기 MUC1 관련 질병은 NASH(Non-Alcoholic SteatoHepatitis) 또는 TGF-β-mediated immune disease일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 실시예에서, 상기 암의 예방 및/또는 치료용 약학 조성물, 방법 및 용도에 있어서, 상기 항-MUC1 항체 또는 이의 항원 결합 단편은 단독 유효성분으로 제공되거나, 항암제 등의 세포독성 물질과 병용 투여 되거나, 항암제 등의 세포독성물질과 접합된 접합체(antibody-drug conjugate; ADC) 형태로 제공될 수 있다.
또한 본 발명에 따른 항-MUC1 항체 또는 이의 항원 결합 단편, 및 이를 포함하는 약학적 조성물은 종래의 치료제와 병용하여 사용하는 용도로 사용될 수 있다. 즉, 본 발명에 따른 항-MUC1 항체 또는 이의 항원 결합 단편, 및 이를 포함하는 약학적 조성물은 기존의 항암제 등의 치료제와 동시에 투여되거나, 순차적으로 투여되는 용도로 사용될 수 있다.
본 발명은 또 다른 관점에서, 상기 항-MUC1 항체 또는 이의 항원 결합 단편 또는 상기 항체-약물 접합체의 치료적 유효량을 MUC1 관련 질병의 예방 및/또는 치료를 필요로 하는 환자에게 투여하는 단계를 포함하는, MUC1 관련 질병의 예방 및/또는 치료 방법에 관한 것이다. 상기 예방 및/또는 치료 방법은 상기 투여 단계 이전에 상기 질병의 예방 및/또는 치료를 필요로 하는 환자를 확인하는 단계를 추가로 포함할 수 있다.
상기 조성물에서 약물의 국소적 전달을 위한 항체 접합체의 사용으로 약물이 항-MUC1 항체로 표적화된 항원을 나타내는 세포로 전달할 수 있도록 한다.
상기 약학 조성물은 약학적으로 허용 가능한 담체를 추가로 포함할 수 있다. 상기 약학적으로 허용 가능한 담체는 약물의 제제화에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘, 미네랄 오일 등으로 이루어진 군에서 선택된 1종 이상일 수 있으나, 이에 한정되는 것은 아니다. 상기 약학 조성물은 또한 약학 조성물 제조에 통상적으로 사용되는 희석제, 부형제, 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등으로 이루어진 군에서 선택된 1종 이상을 추가로 포함할 수 있다.
상기 약학 조성물은 경구 또는 비경구로 투여할 수 있다. 비경구 투여인 경우에는 정맥내 주입, 피하 주입, 근육 주입, 복강 주입, 내피 투여, 비내 투여, 폐내 투여, 직장내 투여, 또는 병변부위 국소 투여 등으로 투여할 수 있다. 경구 투여시, 단백질 또는 펩타이드는 소화가 되기 때문에 경구용 조성물은 활성 약제를 코팅하거나 위에서의 분해로부터 보호되도록 제형화될 수 있다. 또한, 상기 조성물은 활성 물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.
상기 약학 조성물 내의 항-MUC1 항체 또는 이의 항원 결합 단편의 함유량 또는 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 간격, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 예컨대, 상기 항-MUC1 항체 또는 이의 항원 결합 단편의 1일 투여량은 0.001 내지 1000㎎/kg, 구체적으로 0.01 내지 100㎎/kg, 보다 구체적으로 0.1 내지 50 ㎎/kg, 더욱 구체적으로 0.1 내지 20 ㎎/kg 범위일 수 있으나 이에 제한되는 것은 아니다. 상기 1일 투여량은 단위 용량 형태로 하나의 제제로 제제화되거나, 적절하게 분량하여 제제화되거나, 다용량 용기 내에 내입시켜 제조될 수 있다.
상기 약학 조성물은 오일 또는 수성 매질중의 용액, 현탁액, 시럽제 또는 유화액 형태이거나 엑스제, 산제, 분말제, 과립제, 정제 또는 캅셀제 등의 형태로 제형화될 수 있으며, 제형화를 위하여 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
상기 약학 조성물의 투여 대상 환자는 인간, 원숭이 등을 포함하는 영장류, 마우스, 래트 등을 포함하는 설치류 등을 포함하는 포유류일 수 있다.
본 명세서에서 암의 치료는 암세포의 증식 저해, 암세포 사멸, 전이 억제 등과 같이 암의 증상의 악화를 방지하거나 완화 또는 호전시키거나, 암을 부분적 또는 전부 소멸시키는 모든 항암 작용을 의미하는 것일 수 있다.
본 발명은 또 다른 관점에서, 암의 예방 또는 치료를 위한 상기 항-MUC1 항체 또는 이의 항원 결합 단편의 용도에 관한 것이다.
본 발명은 또 다른 관점에서, 암의 예방 또는 치료용 약제 제조를 위한 상기 항-MUC1 항체 또는 이의 항원 결합 단편의 사용에 관한 것이다.
상기 항-MUC1 항체 또는 이의 항원 결합 단편은 MUC1 단백질, 특히, MUC1-C-말단 세포외 도메인에 특이적으로 결합하므로, 이를 이용하여 MUC1 단백질 또는 MUC1-C-말단 세포외 도메인을 검출 또는 확인할 수 있다. 따라서, 본 발명은 또 다른 관점에서, 상기 항-MUC1 항체 또는 이의 항원 결합 단편을 포함하는 MUC1 단백질, 예컨대 MUC1-C-말단 세포외 도메인의 검출용 조성물 및 생물 시료에 상기 항-MUC1 항체 또는 이의 항원 결합 단편을 처리하는 단계를 포함하는 MUC1의 검출 방법에 관한 것이다.
상기 검출 방법은 상기 처리하는 단계 이후에, 항원-항체 반응 여부를 확인하는 단계를 추가로 포함하는 것일 수 있다. 상기 검출 방법에서, 항원-항체 반응이 탐지되는 경우, 상기 생물 시료에 MUC1, 예컨대 MUC1-C-말단 세포외 도메인이 존재하는 것으로 결정(판단)할 수 있다. 따라서, 상기 검출 방법은 상기 확인하는 단계 이후에, 항원-항체 반응이 탐지되는 경우, 상기 생물 시료에 MUC1이 존재하는 것으로 결정하는 단계를 추가로 포함할 수 있다. 상기 생물 시료는 포유류, 예컨대 인간(예컨대 암환자)으로부터 얻은 (분리된) 세포, 조직, 체액, 이들의 배양물 등으로 이루어진 군에서 선택된 것일 수 있다.
MUC1 단백질, 예컨대 MUC1 단백질의 C-말단 부위(또는 MUC1 단백질의 SEA 도메인 또는 MUC1-C-말단 세포외 도메인)의 발현은 여러 질병, 예컨대 암과 관련이 있으므로, 본 발명은 또 다른 관점에서, 상기 항-MUC1 항체 또는 이의 항원 결합 단편을 포함하는 MUC1 단백질 관련 질병, 예컨대, 암의 검출 또는 진단용 조성물 및 대상로부터 분리된 생물 시료에 상기 항-MUC1 항체 또는 이의 항원 결합 단편을 처리(투여)하는 단계를 포함하는 암의 검출 또는 진단 방법 또는 검출 또는 진단에 정보를 제공하는 방법에 관한 것이다.
상기 검출 또는 진단 방법은, 상기 처리하는 단계 이후에, 항원-항체 반응 여부를 확인하는 단계를 추가로 포함하는 것일 수 있다. 상기 방법에서, 항원-항체 반응이 탐지되는 경우, 상기 생물 시료 또는 상기 생물 시료가 유래된 환자에 MUC1 관련 질병, 예컨대 암이 존재하는 것으로 결정(판단)할 수 있다. 따라서, 상기 방법은 상기 확인하는 단계 이후에, 항원-항체 반응이 탐지되는 경우, 상기 생물 시료 또는 상기 환자를 MUC1 관련 질병 환자, 예컨대 암 환자로 결정하는 단계를 추가로 포함할 수 있다. 상기 생물 시료는 포유류, 예컨대 인간(예컨대 암환자)으로부터 얻은 (분리된) 세포, 조직, 체액, 이들의 배양물 등으로 이루어진 군에서 선택된 것일 수 있다.
상기 항원-항체 반응 여부를 확인하는 단계는 당업계에 공지된 다양한 방법을 통하여 수행할 수 있다. 예컨대, 통상적인 효소 반응, 형광, 발광 및/또는 방사선 검출을 통하여 하여 측정될 수 있으며, 구체적으로, 면역크로마토그래피(Immunochromatography), 면역조직화학염색(Immunohistochemistry), 효소결합 면역흡착 분석(enzyme linked immunosorbent assay: ELISA), 방사선 면역측정법(radioimmunoassay: RIA), 효소 면역분석(enzyme immunoassay: EIA), 형광면역분석(Floresence immunoassay: FIA), 발광면역분석(luminescence immunoassay: LIA), 웨스턴블라팅(Western blotting), 마이크로어레이, 면역침강분석 등으로 이루어진 군으로부터 선택된 방법에 의하여 측정될 수 있으나, 이에 제한되는 것은 아니다.
이 때, 상기 항-MUC1 항체 또는 이의 항원 결합 단편은 표지물질을 추가로 포함하는 것일 수 있다. 상기 표지 물질은 방사선동위원소, 형광 물질, 크로모젠(chromogen), 염색 물질 등으로 이루어진 군에서 선택된 1종 이상일 수 있다. 상기 표지물질은 상기 항체 또는 항원 결합 단편에 통상적인 방법(예컨대, 공유결합, 배위결합, 이온결합 등의 화학결합)으로 결합(연결)된 것일 수 있다. 상기 항체 (또는 항원 결합 단편)과 표지물질의 결합은 본 발명이 속하는 기술분야에 잘 알려진 기술에 따른 것일 수 있다.
본 발명의 일 실시예에서, MUC1의 C-말단부위를 유방암 세포주로부터 클로닝하고, Rosetta 컴피턴트 세포에서 발현하여 MUC1에 대한 단일클론 항체를 제조하였다. MUC1의 C-말단부위를 CpG-DNA(예컨대, MB-ODN 4531(O))와 제형화하여 DOPE:CHEMS 복합체내에 캡슐화하여, 마우스 면역화에 사용하였다. 마우스를 [MUC1의 C-말단부위]-[MB-ODN 4531(O)]-[DOPE:CHEMS] 복합체로 면역하면, MUC1-특이적 단일클론 항체의 생성이 현저히 증가함을 확인하였다. 또한, 항-hMUC1-SEA 단일클론 항체는 [hMUC1-SEA]-[MB-ODN 4531(O)]-[DOPE:CHEMS] 복합체로 면역화된 마우스로부터 얻어진 비장세포를 SP2/0 세포와 융합하여 수득될 수 있다.
따라서, 본 발명은 또 다른 관점에서, MUC1의 C-말단 부위, MUC1의 SEA 도메인, 또는 MUC1의 C-말단 세포외 도메인을 포함하는 면역원성 조성물에 관한 것이다. 다른 예는 리포좀 내에 (1) MUC1의 C-말단 부위, MUC1의 SEA 도메인, 또는 MUC1의 C-말단 세포외 도메인 및 (2) CpG-DNA를 캡슐화한 복합체를 포함하는 면역원성 조성물을 제공한다. 상기 면역원성 조성물은 살아있는 유기체 생체내에 주입(접종)시에 면역반응을 유발하여 항체를 생성시키는 능력을 갖는 조성물을 의미한다.
본 발명에 있어서, 상기 리포좀은 양이온성 리포좀, 예컨대, dioleoylphosphatidylethanolamine(DOPE) 및 cholesteryl hemisuccinate(CHEMS)가 1:0.5 내지 1:2, 더욱 구체적으로 1:0.67 내지 1:1.5(DOPE: CHEMS)의 몰비, 예컨대 약 1:1의 몰비로 혼합된 혼합물 또는 이로부터 얻어진 것(예컨대 무용매 리피드 필름 등)일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 CpG-DNA는 CpG 모티프를 하나 이상, 예컨대 1 내지 3개 포함하는 총 10 내지 20개의 뉴클레오티드를 포함하는 올리고데옥시뉴클레오티드(ODN: Oligodeoxynucleotide)를 의미한다. 본 발명의 일 실시예에서, 상기 CpG-DNA는 'AGCAGCGTTCGTGTCGGCCT'(서열번호 11)의 핵산 서열을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 리포좀과 올리고데옥시뉴클레오티드는 아주번트로서 기능을 할 수 있다. 아주번트(Adjuvant)는 면역 시스템과 함께 항원을 보다 쉽게 인식하는 것을 도우며, 면역 반응을 향상시킨다. 합성 올리고데옥시뉴클레오티드(ODN: Oligodeoxynucleotide) 및 특정 염기 서열에 의해 플랭크된 비메틸화된 CpG 디뉴클레오티드를 함유하는 박테리아 DNA는 B 림프구, 자연살 세포, 대식 세포, 및 수지상 세포에서 중요한 면역조절 효과를 갖는다.
양이온성 리포좀(예를 들면, 리포펙타민, 포스파티딜-베타-올레오일-감마-팔미토일 에탄올아민(DOPE):콜레스테롤 헤미숙시네이트(CHEMS))이 항체 생성을 증가시키고, 항체 운반 및 CTL 반응을 증가시킨다. 그러므로, DOPE:CHEMS(1:1 비율) 복합체 내 캡슐화된 CpG-DNA (Lipoplex(O))는 인간 및 마우스 세포내에서 효과적인 면역 반응을 촉진시킬 수 있다.
본 발명은 또 다른 관점에서, MUC1의 C-말단 부위, MUC1의 SEA 도메인, 또는 MUC1의 C-말단 세포외 도메인 또는 리포좀 내에 (1) MUC1의 C-말단 부위, MUC1의 SEA 도메인, 또는 MUC1의 C-말단 세포외 도메인 및 (2) CpG-DNA를 캡슐화한 복합체를 포유류, 예컨대 마우스에 접종하는 단계를 포함하는 항 MUC1-SEA 단일클론 항체의 제조 방법에 관한 것이다. 상기 항체의 제조 방법은, 상기 접종하는 단계 이후에, 상기 마우스의 혈청으로부터 항체를 통상적인 방법으로 분리 및/또는 정제하는 단계를 추가로 포함할 수 있다.
본 발명은 또 다른 관점에서, 본 발명에 따른 항-MUC1 항체를 코딩하는 핵산에 관한 것이다. 본 명세서에서 사용되는 핵산은 세포, 세포 용해물(lysate) 중에 존재하거나, 또는 부분적으로 정제된 형태 또는 실질적으로 순수한 형태로 존재할 수도 있다. 핵산은 알칼리/SDS 처리, CsCl 밴드화(banding), 컬럼 크로마토그래피, 아가로스 겔 전기 영동 및 해당 기술분야에 잘 알려진 기타의 것을 포함하는 표준 기술에 의해 다른 세포 성분 또는 기타 오염 물질, 예를 들어 다른 세포의 핵산 또는 단백질로부터 정제되어 나올 경우 "단리"되거나 "실질적으로 순수하게 된" 것이다. 본 발명의 핵산은 예를 들어 DNA 또는 RNA일 수 있으며, 인트론 서열을 포함하거나 포함하지 않을 수 있다.
본 발명에 있어서, 상기 항-MUC1 항체를 코딩하는 핵산은 서열번호 34 내지 서열번호 45로 구성된 군에서 선택되는 어느 하나 이상의 서열을 포함하는 것을 특징으로 할 수 있다. 구체적으로, 본 발명에 따른 항체의 중쇄를 코딩하는 폴리뉴클레오티드 서열은 서열번호 34 내지 39 및/또는 본 발명에 따른 항체의 경쇄를 코딩하는 폴리뉴클레오티드 서열은 서열번호 40 내지 45이다.
본 발명은 또 다른 관점에서, 상기 핵산을 포함하는 재조합 발현 벡터에 관한 것이다. 본 발명에 따른 항-MUC1 항체 또는 이의 항원 결합 단편의 발현을 위하여, 부분적이거나 전장인 경쇄 및 중쇄를 코딩하는 DNA를 표준 분자 생물학 기술(예를 들어 PCR 증폭 또는 목적 항체를 발현하는 하이브리도마를 사용한 cDNA 클로닝)로 수득할 수 있으며, DNA가 전사 및 번역 제어 서열에 "작동되도록 결합"되어 발현 벡터 내로 삽입될 수 있다.
본 명세서에서 사용되는 용어 "작동되도록 결합"은 벡터 내의 전사 및 번역 제어 서열이 항체 유전자의 전사 및 번역을 조절하는 의도된 기능을 하도록 항체를 코딩하는 유전자가 벡터 내로 라이게이션된다는 것을 의미할 수 있다. 발현 벡터 및 발현 제어 서열은 사용되는 발현용 숙주세포와 상용성 있도록 선택된다. 항체의 경쇄 유전자 및 항체의 중쇄 유전자는 별개의 벡터 내로 삽입되거나, 두 유전자 모두 동일한 발현 벡터 내로 삽입된다. 항체는 표준 방법(예를 들어 항체 유전자 단편 및 벡터 상의 상보성 제한 효소 부위의 라이게이션, 또는 제한 효소 부위가 전혀 존재하지 않을 경우 블런트(blunt) 말단 라이게이션)으로 발현 벡터 내로 삽입된다. 경우에 따라서, 상기 재조합 발현 벡터는 숙주세포로부터의 항체 사슬의 분비를 용이하게 하는 신호 펩티드를 코딩할 수 있다. 항체 사슬 유전자는 신호 펩티드가 프레임에 맞게 항체 사슬 유전자의 아미노 말단에 결합되도록 벡터 내로 클로닝될 수 있다. 신호 펩티드는 면역글로불린 신호 펩티드 또는 이종성 신호 펩티드(즉, 면역글로불린 외 단백질 유래의 신호 펩티드)일 수 있다. 또한, 상기 재조합 발현 벡터는 숙주세포에서 항체 사슬 유전자의 발현을 제어하는 조절서열을 지닌다. "조절서열"은 항체 사슬 유전자의 전사 또는 번역을 제어하는 프로모터, 인핸서 및 기타 발현 제어 요소(예를 들어 폴리아데닐화 신호)를 포함할 수 있다. 통상의 기술자는 형질전환시킬 숙주세포의 선택, 단백질의 발현 수준 등과 같은 인자에 따라 조절 서열을 달리 선택하여, 발현 벡터의 디자인이 달라질 수 있음을 인식할 수 있다.
본 발명은 또 다른 관점에서, 상기 핵산 또는 상기 벡터를 포함하는 숙주세포에 관한 것이다. 본 발명에 따른 숙주 세포는 동물세포, 식물세포, 효모, 대장균 및 곤충세포로 구성된 군에서 선택되는 것이 바람직하지만, 이에 한정되는 것은 아니다.
구체적으로는 본 발명에 따른 숙주세포는 대장균, 바실러스 서브틸리스(Bacillus subtilis), 스트렙토마이세스 속 (Streptomyces sp.), 슈도모나스 속(Pseudomonas sp.), 프로테우스 미라빌리스(Proteus mirabilis) 또는 스타필로코쿠스 속(Staphylococcus sp.)과 같은 원핵 세포일 수 있다. 또한, 아스페르길러스 속(Aspergillus sp.)과 같은 진균, 피치아 파스토리스(Pichia pastoris), 사카로마이세스 세레비지애(Saccharomyces cerevisiae), 쉬조사카로마세스 속(Schizosaccharomyces sp.) 및 뉴로스포라 크라사(Neurospora crassa)와 같은 효모, 그 밖의 하등진핵 세포, 및 곤충으로부터의 세포와 같은 고등 진핵생물의 세포와 같은 진핵 세포일 수 있다.
또한 식물이나 포유동물로부터 유래할 수 있다. 바람직하게는, 원숭이 신장 세포7(COS7: monkey kidney cells)세포, NSO 세포, SP2/0, 차이니즈 햄스터 난소(CHO: Chinese hamster ovary) 세포, W138, 어린 햄스터 신장(BHK: baby hamster kidney)세포, MDCK, 골수종 세포주, HuT 78 세포 및 HEK293 세포 등이 이용 가능하지만 이에 한정되지 않는다. 특히 바람직하게는 CHO 세포가 사용될 수 있다.
상기 핵산 또는 상기 벡터는 숙주세포에 형질주입 또는 트랜스펙션(transfection)된다. "형질주입" 또는 "트랜스펙션시키기 위해 원핵 또는 진핵 숙주세포 내로 외인성 핵산(DNA 또는 RNA)을 도입하는 데에 통상 사용되는 여러 종류의 다양한 기술, 예를 들어 전기 영동법, 인산칼슘 침전법, DEAE-덱스트란 트랜스펙션 또는 리포펙션(lipofection) 등을 사용할 수 있다. 본 발명에 따른 항-글리피칸 3 항체를 발현시키기 위해 다양한 발현 숙주/벡터 조합이 이용될 수 있다. 진핵숙주에 적합한 발현 벡터로는 이들로 한정되는 것은 아니지만 SV40, 소 유두종바이러스, 아네노바이러스, 아데노-연관 바이러스(adeno-associated virus), 시토메갈로바이러스 및 레트로바이러스로부터 유래된 발현 조절 서열이 포함된다. 세균 숙주에 사용할 수 있는 발현 벡터에는 pET, pRSET, pBluescript, pGEX2T, pUC벡터, col E1, pCR1, pBR322, pMB9 및 이들의 유도체와 같이 대장균(Escherichia coli)에서 얻어지는 세균성 플라스미드, RP4와 같이 보다 넓은 숙주 범위를 갖는 플라스미드, λgt10과 λgt11, NM989와 같은 매우 다양한 파지 람다(phage lambda) 유도체로 예시될 수 있는 파지 DNA, 및 M13과 필라멘트성 단일가닥의 DNA 파지와 같은 기타 다른 DNA 파지가 포함된다. 효모 세포에 유용한 발현 벡터는 2℃ 플라스미드 및 그의 유도체이다. 곤충 세포에 유용한 벡터는 pVL941이다.
본 발명은 또 다른 관점에서, 숙주세포를 배양하여 본 발명에 따른 항-MUC1 항체 또는 이의 항원 결합 단편을 발현시키는 단계를 포함하는 본 발명에 따른 항-MUC1 항체 또는 이의 항원 결합 단편의 제조 방법에 관한 것이다.
상기 항-MUC1 항체 또는 이의 항원 결합 단편을 발현할 수 있는 재조합 발현 벡터가 포유류 숙주세포 내로 도입될 경우 항체는 숙주세포에서 항체가 발현되게 하기에 충분한 기간 동안, 또는 더 바람직하게는 숙주세포가 배양되는 배양 배지 내로 항체가 분비되게 하기에 충분한 기간 동안 숙주세포를 배양함으로써 제조될 수 있다.
경우에 따라서, 발현된 항체는 숙주세포로부터 분리하여 균일하도록 정제할 수 있다. 상기 항체의 분리 또는 정제는 통상의 단백질에서 사용되고 있는 분리, 정제 방법, 예를 들어 크로마토그래피에 의해 수행될 수 있다. 상기 크로마토그래피는 예를 들어, 프로틴 A 컬럼, 프로틴 G 컬럼을 포함하는 친화성 크로마토그래피, 이온 교환 크로마토그래피 또는 소수성 크로마토그래피를 포함할 수 있다. 상기 크로마토그래피 이외에, 추가로 여과, 초여과, 염석, 투석 등을 조합함으로써 항체를 분리, 정제할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1: 재조합 hMUC1-C 단백질의 제작
MCF7 세포로부터 MUC1-C 말단(이하, "hMUC1-C 단백질"로 칭함; P15941의 961번째부터 1152번째까지의 192개 아미노산을 포함하는 단백질, 이 중에서 1034-1152 aa는 MUC-SEA 도메인임)을 암호화하는 인간 cDNA를 얻고 다음의 프라이머 세트를 사용하여 RT-PCR하여 증폭시켰다.
센스 프라이머: hMUC1 C-Nco I-S3 5'-CC ATG GCC TCA GGC TCT GCA TC-3'(서열번호 12);
안티센스 프라이머: hMUC1 C-Xho I-AS4 5'-CTC GAG AGA CTG GGC AGA GAA AGG AAA T-3'(서열번호 13).
얻어진 hMUC1-C 말단 단백질 암호화 서열은 DNA 시퀀싱으로 확인하여, GenBank Accession No. J05582.1의 2954번째부터 3529까지의 576개의 뉴클레오티드를 포함하는 핵산 서열과 동일한 서열을 갖는 것을 확인하였다(서열번호 26).
실시예 2: 재조합 hMUC1-C(rhMUC1-C) 단백질의 발현 및 정제
상기 증폭된 cDNA 단편을 C-말단 His-tag을 포함하는 발현벡터 pET-22b(Novagen, Darmstadt, Germany)에 클로닝하였다. 상기 얻어진 플라스미드를 Escherichia coli RosettaTM(Invitrogen, Carlsbad, CA) 수용세포(competent cells)에 형질전환시키고, 1 mM isopropyl-D-1-thioglactopyranoside(IPTG, Sigma-Aldrich, Saint Louis, MO)를 사용하여 37℃에서 8시간동안 유도시켰다. 상기 얻어진 세포를 얼음상의 용해버퍼(50 mM Tris-HCl, 100 mM NaCl, 5 mM EDTA, 0.5% Triton X100, 1 g/ml lysozyme, proteinase inhibitor cocktail)에서 소니케이션에 의하여 용해시켰다. 원심분리 후, inclusion body 분획을 buffer B(100 mM NaH2PO4, 10 mM Tris-HCl, 8 M urea, pH 8.0)와 혼합하고, Ni-NTA agarose(Qiagen, Valencia, CA) system를 사용하여 정제하였다. 상기 얻어진 혼합물을 Ni-NTA 컬럼상으로 로딩시키고, wash buffer C(100 mM NaH2PO4, 10 mM Tris-HCl, 8 M urea, pH 6.3)로 세척하였다. 결합된 단백질을 elution buffer(100 mM NaH2PO4, 10 mM Tris-HCl, 8 M urea, pH 4.5)로 용출시키고, SDS-PAGE 및 웨스턴블라팅으로 분석하였다. 웨스턴 블랏은 항-His-tag 항체(Santa Cruz)를 사용하여 수행하였다.
실시예 3: Lipoplex(O) 복합체의 제조
MB-ODN 4531은 3개의 CpG 모티프(밑줄로 표시)를 포함하는 20개의 염기로 구성되어 있다(AGCAGCGTTCGTGTCGGCCT: 서열번호 11). 상기 CpG ODN(oligodeoxynucleotide)(이하, "CpG-DNA 4531(O)"로 칭함)은 Samchully Pharm(한국, 서울) 및 GenoTech(한국 대전)에서 구입하였다. 포스파티딜-베타-올레오일-감마-팔미토일에탄올아민(DOPE) 및 콜레스테롤헤미석시네이트(CHEMS)를 에탄올에서 1:1 몰비로 혼합한 후, 질소 가스로 증발시켜 무용매 리피드 필름(solvent-free lipid film)을 제조하였다. 무용매 리피드 필름을 같은 부피의 수용성 CpG-DNA 4531(O) 50㎍ 및 rhMUC1-C 단백질(실시예 2) 50㎍을 포함하는 혼합물에 재현탁하고, 실온에서 30분간 강렬하게 교반하여 DOPE 및 CHEMS 복합체 내에 공동캡슐화(coencapsulated)된 CpG-DNA 4531(O) 및 rhMUC1-C 단백질을 제조하였다. "Lipoplex(O) 복합체"는 CpG-DNA 4531(O)이 DOPE 및 CHEMS 복합체 내에 캡슐화된 것을 칭한다. pH를 7.0으로 맞춘 후, rhMUC1-C 단백질 및 Lipoplex(O) 복합체를 초음파발생장치로 30초간 초음파 처리하고, 용액을 0.22 ㎛ 필터를 사용하여 여과하고 액체 질소로 3번 동결-융해하여, 하기 시험에 사용하였다.
실시예 4: 동물의 준비
4주령 암컷 BALB/c 마우스(OrientBio, Inc. (한국 서울)) 및 BALB/cAnNCri-nu/nu 마우스(four-week-old)를 Nara Biotech, Inc(Seoul, Korea)로부터 구입하였다. 상기 마우스를 특정 병원체가 없는 조건에서 의 무균 조건에서 20-25℃ 및 32-37% 습도 하에 유지되었다. 모든 동물 시험 과정은 한림대학교 실험동물운영위원회(Institutional Animal Care and Use Committee)의 승인을 받아 "Guide for the Care and Use of Laboratory Animals of the National Veterinary Research & Quarantine Service of Korea"에 따라 수행하였다. 상기 마우스를 isoflurane 흡입을 통하여 희생시키고 고통을 최소화하기 위한 모든 노력을 기울였다.
실시예 5: 마우스의 면역화
50㎍의 rhMUC1-C 단백질 및 50㎍의 CpG-DNA 4531가 포스파티딜-베타-올레오일-감마-팔미토일에탄올아민:콜레스테롤헤미석시네이트(DOPE:CHEMS 복합체)에 공동캡슐화된 복합체를 포함하는 리포솜 복합체를 BALB/c 마우스에 10일 간격으로 4회 복강내 주입하여 면역화하였다.
실시예 6: 항원-특이적 Ig ELISA
rhMUC1-C 특이적 IgG 총량을 ELISA에 의해 측정하였다. 96-웰 면역플레이트를 10㎍/ml의 rhMUC1-C 단백질(실시예 2)로 코팅하고 PBS-T(0.1%(v/v) Tween-20를 포함하는 PBS) 내의 1%(w/v) 소 혈청 알부민(BSA)으로 차단시켰다. 상기 실시예 5에서 면역화된 마우스 혈청, 하이브리도마 세포 배양 상등액, 또는 정제된 항체를 PBS-T로 희석하고 실온에서 2 시간 동안 배양 하였다. 플레이트를 PBS-T로 3 회 세척하고 염소 항-마우스 IgG HRP-접합된 2 차 항체와 함께 1 시간 동안 배양 하였다. TMB 기질 용액 A 및 B(1:1 비율)(Kirkegaard and Perry Laboratories, 미국 메릴랜드주 게이더스버그)를 사용하여 전개시키고, Spectra Max 250 마이크로 플레이트 판독기 (Molecular Devices, Sunnyvale, USA)를 사용하여 450 nm에서의 흡광도를 측정하여, 비색분석(colorimetric assay)을 수행하였다.
실시예 7: 항-hMUC1 단일클론 항체의 제조 및 정제
상기 실시예 5에서 rhMUC1-C 단백질로 면역화된 마우스의 비장 세포를 폴리에틸렌 글리콜(PEG, Sigma-Aldrich)을 사용하여 SP2/0 골수종 세포(ATCC)와 융합시켰다. 융합된 세포를 배양하고, hypoxanthine-aminopterin-thymidine(HAT, Sigma-Aldrich) 배지로 선택하였다. 상기 선택된 하이브리도마 세포의 배양 상청액을 ELISA를 통하여 rhMUC1-C 단백질에 대한 결합을 시험하고, 결합 양성을 보이는, 즉 rhMUC1-C 단백질 특이적인 항체를 생성하는 하이브리도마 세포를 스크리닝하였다. 하이브리도마 클론은 표준 하이브리도마 기술에 따라 선별되었다(Yokoyama et al. 2006). 상기 얻어진 하이브리도마 클론(KCLRF-BP-00395; 이하 상기 하이브리도마 세포 및 이로부터 생산되는 항체를 "hMUC1-1H7"로 명명함)을 hypoxanthine-thymidine(HT) 배지에서 배양 하였다. ELISA-양성 하이브리도마 세포 집단을 서브클로닝하였다. 단일클론 항체 생산을 위하여, 초기 및 10 일 후, 마우스에 하이브리도마 세포(hMUC1-1H7 클론)를 i.p. 접종하였다. 10 일 후에 복강액을 채취하고, 3,000 rpm으로 30 분간 원심분리 하였다. 상등액을 Protein-A 크로마토 그래피(Repligen, Waltham, MA)를 사용하여 rhMUC1-C 단백질에 결합하는 항-hMUC1 단일클론 항체를 정제 하였다.
실시예 8: 항-hMUC1 단일클론 항체의 IgG 이소타입(Isotype) 확인
상기 실시예 7에서 얻어진 항-hMUC1 단일클론 항체의 IgG 이소타입을 측정하기 위해, 96-웰 면역플레이트(Nalgen Nunc International, 미국 펜필드)를 1 ㎍/㎖의 hMUC1-C 단백질로 코팅하고, 1% BSA를 함유하는 PBS 내 0.05% Tween-20(PBST)로 차단하였다. 항-hMUC1-C 단일클론 항체를 각 플레이트의 상부 열에 첨가하고, 일련의 PBST 내 1:4 희석은 다음 열에 위치시켰다. 플레이트를 실온에서 2시간 동안 배양시키고 PBST로 세척하였다. 이어서, 호스라디시 퍼옥사이드(HRP: Horseradish Peroxidase)(BD Pharmingen)와 결합된 항-마우스 총 IgG, IgG1, IgG2a, IgG3b, IgG3 항체를 각 웰에 첨가하고(1:500 dilution), 실온에서 1시간 동안 배양하였다. TMB 기질 용액 A 및 B(1:1 비율)(Kirkegaard and Perry Laboratories, 미국 메릴랜드주 게이더스버그)를 사용하여 전량 분석하였고, Spectra Max 250 마이크로플레이트 리더(Molecular Devices, 미국 캘리포니아주 써니데일)을 사용하여 450 nm 흡광도에서 측정하였다.
실시예 9: 항-hMUC1-SEA 단일클론 항체의 반응성 시험
실시예 9-1: 세포 배양
인간 유방암 세포주(MCF-7, MDA-MB-231) 및 췌장암 세포주(Capan-2, CFPAC-1)는 American Type Culture Collection(ATCC, Manassas, VA)으로부터 구입하고, 인간 유방암 세포주(T47D, ZR75-1) 및 췌장암 세포주 Capan-1, PANC-1)는 Korean Cell Line Bank(KCLB, Seoul, Korea)으로부터 구입하였다.
MCF-7 세포는 0.01 mg/ml의 인간 재조합 인슐린이 보충된 Eagle's Minimum Essential Medium에서 배양하고; MDA-MB-231 세포는 Leibovitz's L-15 medium(Thermo Fisher Scientific)에서 배양하고; T47D, ZR75-1, 및 Capan-1 세포는 RPMI-1640 medium(Thermo Fisher Scientific)에서 배양하였다. Capan-2 세포는 McMcoy's 5A medium(Thermo Fisher Scientific)에서, CFPAC-1 세포는 Iscove's modified Dulbecco's medium(IMDM, Thermo Fisher Scientific)에서, PANC-1 세포는 Dulbecco's modified Eagle's medium(DMEM, Thermo Fisher Scientific)에서 각각 배양하였다. 모든 배지는 10%(w/v) 우태아혈청(FBS, Thermo Fisher Scientific), 100 U/ml 페니실린, 및 100 mg/ml 스트렙토마이신을 보충하여 사용하였다. MCF-7, T47D, ZR75-1 Capan-1, Capan-2, CFPAC-1, 및 PANC-1 세포는 37℃ 및 5% CO2 조건에서 배양하고, MDA-MB-231 세포는 37℃의 CO2이 없는 조건에서 배양하였다.
실시예 9-2: 시험을 위한 항체의 준비
웨스턴 블라팅 및 면역 침전에 의해 세포에서 MUC1을 검출하기 위하여, 상업적으로 입수 가능한 항-MUC1-CT 항체 및 항-MUC1-CT2 항체를 Abcam(Cambridge, UK)으로부터 입수하였다. 항-MUC1-CT 항체 및 항 -MUC1-CT2 항체는 MUC1의 세포질 꼬리 영역을 인식한다. 항-베타-액틴 항체는 Sigma-Aldrich로부터 구입하였다.
실시예 9-3: 웨스턴 블라팅 분석
상기 세포를 용해 완충액(20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5 mM EDTA, 100 mM NaF, 2 mM Na3Vo4, 프로티아제 저해제 칵테일, 1%(w/v) NP-40)으로 용해시키고, 4 ℃에서 14,000 rpm으로 20 분간 원심 분리하였다. 4~12% Bis-Tris 구배 겔(Thermo Fisher Scientific)에서 같은 양의 단백질을 분리하고, 실온에서 1 시간 동안 PBS-T 중 3 %(w/v) BSA로 차단 된 니트로셀룰로오스 멤브레인으로 옮겼다. 상기 니트로셀룰로오스 멤브레인을 4 ℃에서 하룻밤 동안 항-hMUC1 항체(hMUC1-1H7; 실시예 7), 항-MUC1-CT 항체(Abacam, EPR1023), 항-MUC1-CT2 항체(Abcam, ab80952), 또는 항-베타-액틴 항체(Sigma-Aldrich)와 항온 배양 하였다. 면역 반응성 단백질은 horseradish peroxidase가 결합된 2차 항체와 향상된 화학 발광 시약(Thermo Fisher Scientific)을 사용하여 측정하였다.
실시예 9-4: 면역 침강 분석
세포 용해 완충액(20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5 mM EDTA, 100 mM NaF, 2 mM Na3Vo4, 프로티아제 저해제 칵테일, 1%(w/v) NP-40)을 항-hMUC1 항체와 4 ℃에서 밤새 항온 배양 하였다. 단백질 A 비드를 혼합물에 첨가하고 4 ℃에서 1 시간 동안 배양하였다. 원심 분리에 의해 수집된 면역 복합체를 세척하고 웨스턴 블라팅으로 분석하였다. 멤브레인을 항-hMUC1 항체 (hMUC1-1H7), 항-MUC1-CT 항체(Abacam, EPR1023), 항-MUC1-CT2 항체(Abcam, ab80952), 또는 항-베타-액틴 항체(Sigma-Aldrich) 항체와 배양 하였다.
실시예 9-5: 탈글리코실화 분석(Deglycosylation assay)
T47D 세포의 세포 용해물을 용해 완충액(0.5%(w/v) SDS, 1%(w/v) 베타-머 캅토 에탄올)으로 추출하고 100 ℃에서 10 분간 끓였다. 그 후 시료를 37 ℃에서 2 시간 동안 PNGase F(Elpis-Biotech, Daejeon, Korea)와 함께 배양하고, 100 ℃에서 10 분간 끓여 주었다. 얻어진 시료를 용해 완충액으로 희석하고 항-hMUC1 단일클론 항체로 면역 침전시켰다. 생성된 면역 복합체를 항 -MUC-CT 항체 또는 항 -MUC1-CT2 항체로 웨스턴 블라팅하여 분석하였다.
실시예 9-6: 공초점 현미경 분석(Confocal microscopy)
세포를 12-웰 배양판의 폴리-L-라이신으로 코팅된 유리커버 슬립 상에서 배양 하였다. 세포 표면 염색을 위해, 세포를 4%(w/v) 파라포름알데하이드로 고정시키고, 3%(w/v) BSA로 차단시키고, 얼음상에서 2 시간 동안 항-hMUC1 항체로 염색하였다. 세포 내부 염색을 위해, 세포를 4%(w/v) 파라포름알데하이드로 고정시키고, 0.1%(w/v) Triton X-100으로 투과성화시키고, 3%(w/v) BSA로 차단시키고, 실온에서 2 시간 동안 항-hMUC1 항체로 염색시켰다. PBS-T로 세척 한 후, 얻어진 세포 시료를 Alexa Flour 488 접합 2차 항체(Invitrogen, Eugene, OR)와 함께 1 시간 동안 배양하였다. 세포 핵은 Hoechst 33258로 염색하였다. 모든 세포 시료는 공촛점 레이저 스캐닝 현미경 시스템 CLSM, LSM 710, Carl Zeiss, Jena, Germany)에 장착하고 관찰하였다.
실시예 9-7: 세포 내재화 분석(Internalization assay)
항-hMUC1 단일클론 항체를 DyLight 488로 제조자의 지시(Thermo Fisher Scientific)에 따라 표지 하였다. 유방암 세포 및 췌장암 세포를 DyLight 488 표지 항-hMUC1 항체로 처리하고 37 ℃에서 지시된 시간 동안 배양하였다. 항체가 내재화된 세포로부터 발생하는 형광 신호는 CLSM(LSM 710, Carl Zeiss)으로 검출 하였다.
실시예 10: 항-hMUC1 단일클론 항체의 가변부위의 클로닝
항-hMUC1 단일클론 항체(hMUC1-1H7; 실시예 7)를 마우스 단일클론 항체 이소타입 타이핑 키트(Dipstick format, Bibco BRL 또는 Roche, Mannheim, Germany)를 사용하여 배양하였다. RNeasy Mini Kit(Qiagen)을 이용하여 상기 하이브리도마 세포에서 total RNA를 추출하여 cDNA를 생성하였다. hMUC1-1H7로부터 생성된 항-hMUC1 단일클론 항체의 중쇄 가변부위 및 경쇄 가변부위(VH 및 VL)를 클로닝하기 위해, 상기 생성된 cDNA를 하기 프라이머 세트를 갖는 벤트 폴리머라제(Vent polymerase, NEB)를 사용하여 증폭시켰다.
중쇄용 프라이머: IGG1(5'-GGA AGA TCT ATA GAC AGA TGG GGG TGT CGT TTT GGC-3'; 서열번호 14) 및 5'MH2(5'-CTT CCG GAA TTC SAR GTN MAG CTG SAG SAG TCW GG-3'; 서열번호 15)
경쇄(kappa chain)용 프라이머: 3'Kc(5'-GGT GCA TGC GGA TAC AGT TGG TGC AGC ATC-3'; 서열번호 16) 및 5'Mk(5'-GG GAG CTC GAY ATT GTG MTS ACM CAR WCT MCA-3'; 서열번호 17).
표준 PCR 반응을 25 사이클 동안 수행하였다. 얻어진 PCR 산물을 pGEM-T 이지 벡터(Promega)에 직접 라이게이션시켰다. 클로닝된 마우스 Ig 삽입물을 DNA 시퀀싱으로 분석 하였다.
실시예 11: 항-hMUC1 단일클론 항체의 항원 결합 단편(Fab)의 발현
항-hMUC1 단일클론 항체(hMUC1-1H7; 실시예 7)의 경쇄 가변부위 및 중쇄 가변부위(VH 및 VL)를 암호화하는 서열을 증폭하고 각각 Sfi I 및 BstX I을 사용하여 세균 발현 벡터 FabE로 서브 클로닝하고(Jeon 등, Mol.Immunol.44: 827-836 (2007), Kwon 등 Oncol. Rep. 18: 513-517 (2007)), 얻어진 재조합 발현 플라스미드를 pFabE-hMUC1-1H7(도 8a)로 명명하였다.
이때 사용된 프라이머는 다음과 같다.
중쇄가변부위 암호화 서열 (393 bp) 증폭용 프라이머
Forward primer: 5'-ggc cca gcc ggc cat ggc cSA RGT NMA GCT GSA GSA GTC WGG-3' (서열번호 18);
Reverse primer: 5' -GGC CGT GCT GGC CCC GAC AGA TGG GGG TGT CGT TTT GGC-3'(서열번호 19),
경쇄가변부위 암호화 서열 (396 bp) 증폭용 프라이머
Forward primer: 5'-CCA TTG CAG TGG CAC TGG CTG GTT TCG CTA CCG TAG CAC AGG CAG CCG AYA TTG TGM TSA CMC ARW CTM CA-3' (서열번호 20);
Reverse primer: 5'-CCA CCG TAC TGG CGG ATA CAG TTG GTG CAG CAT C-3' (서열번호 21).
재조합 발현 플라스미드pFabE-hMUC1-1H7을 제한 분석(restriction analysis) 및 DNA 시퀀싱으로 확인하였다. pFabE-hMUC1-1H7을 TG1 대장균 세포에 형질전환시키고, 재조합 단백질의 발현을 최적화하고, 항-His 항체를 사용하여 웨스턴 블라팅하여 확인 하였다.
재조합 Fab(pFabE-hMUC1-1H7)의 대규모 생산 및 정제를 위하여, 하이브리도마 hMUC1-1H7 클론의 배양액 500 ml를 0.5 mM IPTG로 처리하고 18℃에서 16 시간동안 배양하였다. 상기 배양물을 원심분리하여 배양 상등액을 수확하고, Ni-NTA 친 화성 칼럼(Clontech)에 넣어, VH-CH 융합 단백질에서의 His 태그를 사용하여 적절하게 접혀지고 조립된 Fab 단백질을 분리하였다.
칼럼에 결합된 재조합 Fab를 10 mM imidazole(pH 8.0)로 용출시키고, 단백질 용액을 4℃에서 원심분리(3,500 xg)하여 centricon을 사용하여 투석하고 농축시켰다.
실시예 12: MTT 분석
5일 동안 항-hMUC1 단일클론 항체(10 ㎍/ml)로 처리된 암세포의 성장은 3-(4,5-디메틸티아졸-2-일)-2,5-디페닐 테트라졸륨 브로마이드(MTT, Sigma-Aldrich) 용액을 사용하여 측정하였다. 지시된 시간에 MTT 용액을 각 웰에 첨가하고, 플레이트를 37 ℃에서 추가로 4 시간 동안 배양하였다. 배지를 제거한 후, 포르마잔 결정(formazan crystals)을 DMSO에 용해시켰다. 발색은 650 nm의 기준 파장을 갖는 595 nm의 분광 광도계를 사용하여 모니터링하였다.
실시예 13: 생체내 분포 이미징(Biodistribution imaging in vivo)
50%(w/v) Matrigel 중의 5×106 Capan-2 세포를 4 주령의 수컷 BALB/cAnCrj-nu/nu 마우스의 등쪽 우측 옆구리에 피하 접종 하였다. 유방암 세포주 주입을 위해, 17베타-에스트라디올 펠렛(미국, FL, Sarasota, Innovative Research of America, 펠렛, 60 일 방출)을 마우스에 피하 이식하였다. 다음날, 50%(w/v) Matrigel 중의 5×106 세포(T47D, ZR75-1)를 상기 마우스의 등쪽 우측 옆구리에 피하 접종하였다.
종양 체적이 평균 약 100mm3에 이르면, 상기 마우스에 정상 마우스 IgG-DyLight 755(5 mg/kg) 또는 항-hMUC1 항체-DyLight 755(5 mg/kg)를 정맥 주사 하였다. 이어서, 0, 24, 48 시간에서 생체 내 영상 시스템(IVIS 200, Xenogen Corporation, MA)을 사용하여 항체 표적 이미지를 모니터링하였다. 생체 내에서 항-hMUC1 단일클론 항체의 세포 내 국소 위치화를 검출하기 위해, DyLight 488- 표지된 항-hMUC1 항체(5 mg/kg)를 정맥 내에 주사하였다. 2 일 후, 종양 조직을 채취하고, 동결 절편을 수행하였다. 항체의 내재화는 CLSM(LSM 710, Carl Zeiss)으로 종양 절편에서 검출되었다.
실시예 14: 췌장암 마우스 모델의 제조
이종이식(xenograft) 분석을 위하여, 50% Matrigel 내의 5×106 Capan-2 세포를 16마리의 BALB/cAnCrj-nu/nu 마우스의 등쪽 우측 옆구리에 피하 접종하였다(n=8). 종양 부피가 75 mm3이 되었을 때, 상기 마우스를 무작위로 2개의 처리군으로 나누었다(eight mice/group): PBS 처리군 및 항-hMUC1 단일클론 항체 처리군. 상기 항체는 10 mg/kg의 양으로 1주일에 2번 정맥내 투여하였다. 캘리퍼스를 사용하여 7일 간격으로 종양 지름을 측정하고, 다음의 수식에 의하여 종양 부피를 계산하였다: (넓이2*길이)/2. 항-hMUC1 단일클론 항체 처리 후 11주일 후에 마우스들을 희생시키고 종양의 무게를 측정하였다.
실시예 15: 조직 어레이 및 면역조직화학(immunohistochemistry)
파라핀-함몰 인간 유방암 조직 절편을 ISU ABXIS(Seoul, Korea)로부터 구입하였다. 상기 조직 절편에 xylene을 30분동안 처리하여 파라핀을 제거하고, 에탄올로 다시 수화시킨 후, 3% 과산화수소 용액과 함께 10분동안 인큐베이팅하였다. 시트르산 용액(pH 6.0)에서 항원 회복(Antigen retrieval)을 수행하였다. 상기 절편을 정상 말혈청을 사용하여 30분간 블라킹하고, 실온에서 2시간동안 항-hMUC1 항체(1㎍/slide)와 함께 인큐베이팅하였다. 상기 절편을 세척하고 바이오틴화된 항-마우스 IgG 항체 Vector Laboratories, Burlingame, CA)와 함께 1시간동안 인큐베이팅하였다. 그 후, 세척하고, HRP-스트렙타비딘과 함께 30분간 인큐베이팅하였다. 3,3-diaminobenzidine(DAB, Thermo Fisher Scientific)을 사용하여 면역반응성을 검출하고, 헤마톡실린(Muto Pure Chemicals, Tokyo, Japan)으로 대조염색하였다. 현미경 (Eclipse E-200, Nikon, and Tokyo, Japan)을 사용하여 모든 이미지를 시험하였다.
실시예 16: 항-hMUC1 단일클론 항체의 특성 확인
PBS(control) 또는 rhMUC1-C와 Lipoplex (O) 복합체로 마우스(n=4)를 면역화시킨 후(실시예 5 참조), 3차 면역 접종 후, 마우스 혈청을 수집하고 ELISA를 이용하여 rhMUC1-C 특이적 IgG 총량을 측정하여(실시예 6 참조), rhMUC1-C에 대한 항체 형성을 확인하였다. 그 결과를 도 1a에 나타내었다. 도 1a에서 control은 PBS 접종군이고, rhMUC1-C-1, -2, -3, 및 -4는 마우스 각 개체를 의미한다. 도 1a에서 보여지는 바와 같이, rhMUC1-C 특이 적 IgG가 유의적을 유도된 것을 확인할 수 있다.
다음으로, 상기 면역화된 마우스로부터 분리된 하이브리도마 세포를 실시예 7에 따라서 스크리닝한 결과를 도 1b 및 1c에 나타내었다. 도 1b는 HAT 배지를 이용한 스크리닝 결과이고, 도 1c는 HT 배지를 이용한 스크리닝 결과이다. 도 1b 및 1c에서, #는 96-well plate의 개수이며, A~H는 plate의 가로 구획을 명명한 것이다. 도 1b 및 1c의 결과로부터, hMUC1-1H7 클론을rhMUC1-C 특이적 단일클론 항체를 생산하는 하이브리도마로 선정하였다.
상기 선정된 하이브리도마 hMUC1-1H7 세포를 2017년 3월 8일자로 대한민국 서울 종로구 연건동에 위치한 한국세포주연구제단(KCLRF)에 기탁하여, 수탁번호 KCLRF-BP-00395를 부여 받았다.
다음으로, 상기 분리된 하이브리도마 hMUC1-1H7 클론으로부터 항-hMUC1 단일클론 항체를 정제하고, SDS-PAGE 및 Commassie 염색을 사용하여 정제된 항체를 분석하였다. 도 2a는 하이브리도마 hMUC1-1H7 클론을 마우스의 복강에 주사한 후 복수를 회수하고, ELISA를 통하여 rhMUC1-C 특이적 항체의 존재를 분석한 결과이며, control serum은 PBS 접종군의 결과를 의미한다. 그 결과, hMUC1-1H7 클론이 주입된 마우스의 복수에 rhMUC1-C 특이적 항체가 존재함을 확인하여 이를 분리, 정제하였다. 상기 분리, 정제된 항-hMUC1 단일클론 항체를 SDS-PAGE 및 Commassie 염색에 의하여 분석하여, 그 결과를 도 2b에 나타내었다. 도 2b에서 HC는 중쇄, LC는 경쇄를 각각 나타낸다.
몇 가지 IgG 이소타입에 대한 ELISA를 수행하여, 상기 얻어진 항-MUC1 항체의 이소 타입을 확인하여(실시예 8 참조), 그 결과를 도 2c에 나타내었다. 도 2c에서 알 수 있는 바와 같이, 상기 정제된 항-MUC1 항체는 IgG1 타입임을 확인하였다.
실시예 17: 유방암 세포 및 췌장암 세포에서의 항-MUC1 항체 특이성 시험
상기 얻어진 항-hMUC1 단일클론 항체가 유방암 세포에서 MUC1 단백질(정상세포에서 MUC1 단백질이 MUC1-N 서브유닛 도메인과 MUC1-C 서브유닛 도메인의 dimer로 구성되어 있으며 hyperglycosylation 되어 있는 것과 달리, 암세포주에서는 주로 MUC1-C 서브유닛 도메인이 존재하며 hypoglycosylation 되어 있음)을 인식하는지를 평가하기 위해, 유방암 세포(MCF-7, MDA-MB-231, T47D 및 ZR75-1)의 세포 용해물을 SDS-PAGE에 의하여 분리하고, 항-hMUC1 단일클론 항체 및 항-MUC1-CT 항체를 사용하여 웨스턴 블라팅을 수행하였다(실시예 9.4 참조). 상기 얻어진 결과를 도 3a에 나타내었다. 그 결과, 항-MUC1-CT 항체는 MCF-7, T47D 및 ZR75-1에서 MUC1 단백질을 검출하였지만, MDA-MB-231에서는 검출하지 못하였다. 반면, 항-hMUC1 단일클론 항체는 모든 세포시료에서 MUC1 단백질을 인식하지 못하였다. MDA-MB-231 세포에서 MUC-1 단백질이 검출되지 않았기 때문에, 이 세포주를 모든 시험에서 음성 대조군으로 사용하였다.
항-hMUC1 단일클론 항체가 내재(endogenous) MUC1 단백질을 고유한 상태로 인지할 수 있는지를 알아보기 위해, MCF-7, MDA-MB-231, T47D 및 ZR75-1 세포의 세포 용해물을 마우스 정상 IgG 또는 항-hMUC1 단일클론 항체로 면역 침전시키고, 항-MUC1-CT 항체를 사용하여 면역 블로팅하여(실시예 9.5 참조), 그 결과를 도 3b에 나타내었다. 도 3b에 나타난 바와 같이, 항-hMUC1 단일클론 항체가 MCF-7, T47D 및 ZR75-1 세포에서 자연 상태의 MUC1 단백질을 효율적으로 면역 침전시킬 수 있음을 알 수 있다.
상기 도 3a의 결과는 항-hMUC1 단일클론 항체가 Western blotting에서 사용된 denature된 MUC1 단백질은 인식 못함을 보여주는 반면, 도 3b의 결과는 항-hMUC1 단일클론 항체가 면역침전을 통해 암에서 고유한 형태의 MUC1 단백질을 인식함을 보여주며, 이는 항-hMUC1 단일클론 항체가 MUC1 단백질의 고유한 3차 구조를 인식함을 입증한다고 할 수 있다.
MUC1의 세포외 도메인은 세포 표면으로부터 200-500nm까지 조밀하게 당화되어 있다. 따라서, 항-hMUC1 단일클론 항체가 탈글리코실화된 단백질 코어를 인식 할 수 있는지 여부를 조사하였다(실시예 9.6 참조). T47D 세포 용해물을 PNGase F로 처리하고, 항-MUC1-CT 항체, 항-MUC1-CT2 항체, 항-hMUC1 단일클론 항체(실시예 7), 또는 항-베타-액틴 항체를 사용하여 웨스턴 블라팅한 결과를 도 3c에 나타내었다. 도 3c에 나타낸 바와 같이, 항-hMUC1 단일클론 항체는 MUC1 단백질을 검출하지 않음을 알 수 있다. 한편, PNGase F로 처리 한 T47D 세포 용해물을 항-hMUC1 단일클론 항체로 면역 침전시킨 다음, 항-MUC1-CT 또는 항-MUC1-CT2 항체로 면역 블로팅한 결과를 도 3d에 나타내었다. 도 3d에 나타난 바와 같이, 항-hMUC1 단일클론 항체는 T47D 세포에서 탈글리코실화된 MUC1 단백질을 면역 침전시킬 수 있음을 확인하였다. 이러한 결과는 항-hMUC1 단일클론 항체가 글리코실화 상태와 무관하게 천연 상태의 MUC1 단백질을 성공적으로 인식 할 수 있음을 입증한다.
항-hMUC1 단일클론 항체가 췌장암 세포에서 손상되지 않은(intact) MUC1 단백질을 인식하는지 여부를 시험하기 위하여, 췌장암 세포(Capan-1, Capan-2, CFPAC-1, 및 PANC-1)의 세포 용해물을 SDS-PAGE에 의해 분리시키고, 항-MUC1-CT 항체, 항-hMUC1 항체, 또는 항-베타-액틴 항체를 이용하여 웨스턴 블라팅을 수행하여, 그 결과를 도 4a에 나타내었다. 도 4a에서 알 수 있는 바와 같이, 항-hMUC1 단일클론 항체는 시험된 모든 세포 시료에서 MUC1 단백질을 인식 할 수 없는 것으로 나타났다.
한편, 항-hMUC1 단일클론 항체가 내인성 MUC1 단백질을 고유한 상태로인지 할 수 있는지를 알아보기 위해, 다양한 췌장암 세포(Capan-1, Capan-2, CFPAC-1, 및 PANC-1)의 세포 용해액에 대하여 면역 침전을 수행하고, 항-MUC1-CT 항체 및 항-hMUC1 단일클론 항체를 사용하여 면역 블로킹하였다. 상기 얻어진 결과를 도 4b에 나타내었다. 도 4b에 나타난 바와 같이, 항-hMUC1 단일클론 항체는 췌장암 세포(Capan-2 및 CFPAC-1)에서 자연 상태의 MUC1 단백질을 효율적으로 면역 침전할 수 있음을 확인할 수 있다.
실시예 18: 항-hMUC1 단일클론 항체의 세포 표면 및 세포 내 MUC1 단백질의 인지 및 세포 내재화(internalization) 확인
항-hMUC1 단일클론 항체가 손상되지 않은 세포에서 MUC1 단백질을 인식하고 결합할 수 있는지 확인하기 위하여, 유방암 세포 (MCF-7, MDA-MB-231, T47D 및 ZR75-1) 및 췌장암 세포(Capan-1, Capan-2, CFPAC-1, PANC-1)에 대하여 면역 형광 염색하고 그 결과를 공초점 현미경으로 분석하였다(실시예 9-7 참조).
보다 구체적으로, MCF-7, MDA-MB-231, T47D 및 ZR75-1 세포를 항-hMUC1 단일클론 항체 또는 마우스 정상 IgG와 함께 4℃(세포 표면 MUC1 단백질의 경우) 또는 실온(세포내 MUC1 단백질의 경우)에서 항온 배양 한 후, Alexa 488(녹색)-접합된 2 차 항체와 함께 1시간 동안 배양하였으며, 세포 핵은 Hoechst 33258(청색)로 염색하였다. 얻어진 형광 이미지는 공초점 현미경(CLSM, LSM 710, Carl Zeiss, Jena, Germany)으로 관찰하였으며, 이를 도 5의 A 에 나타내었다(scale bar: 10㎛). 또한, 유방암 세포에서의 항-hMUC1 단일클론 항체의 내재화를 확인하기 위하여, MCF-7, MDA-MB-231, T47D 및 ZR75-1 세포를 DyLight 488(녹색)-표지된 항-hMUC1 단일클론 항체로 처리하고 37℃에서 6 시간 동안 배양하고, 핵은 Hoechst 33258로 염색한 후, 얻어진 형광 이미지를 공초점 현미경(CLSM, LSM 710, Carl Zeiss, Jena, Germany)으로 관찰하여, 도 5의 B에 나타내었다 (scale bar: 10㎛).
또한, 췌장암 세포에서의 세포 표면 및 세포내 영역에 위치한 MUC1 단백질에 대한 항-hMUC1 단일클론 항체의 결합을 시험하였다. 췌장암 세포주 Capan-1, Capan-2, CFPAC-1 및 PANC-1 세포를 항-hMUC1 단일클론 항체 또는 마우스 정상 IgG와 함께 4 ℃(표면) 또는 실내 온도(세포 내)에서 배양한 다음, Alexa 488 접합 2 차 항체와 함께 1시간 동안 배양하였으며, 핵은 Hoechst 33258로 염색하였다. 얻어진 형광 이미지는 공초점 현미경(CLSM, LSM 710, Carl Zeiss, Jena, Germany)으로 관찰하여, 도 6에 나타내었다(scale bar: 10㎛).
상기 도 5 및 도 6의 결과로부터, 항-hMUC1 항체가 유방암 세포(MCF-7, T47D 및 ZR75-1)와 췌장암 세포(Capan-2 및 CFPAC-1)에서 MUC1을 뚜렷하게 염색함을 알 수 있고, 이들은 세포 표면 및 세포 내에 위치함을 알 수 있다.
이러한 결과는 항체가 MUC1 C-말단의 서브유닛의 세포외 영역을 인식한다는 것을 시사한다. 항체의 치료제로서의 효능은 세포 내재화에 더욱 의존한다고 할 수 있다. 따라서, 항-hMUC1 항체를 DyLight 488과 결합시키고, 이를 유방암 세포와 췌장암 세포에 6 시간 동안 처리한 후, 항체의 세포 내재화 여부를 형광 이미지를 통하여 확인하였다. 췌장암 세포(Capan-1, Capan-2, CFPAC-1 및 PANC-1)를 DyLight 488-표지된 항-hMUC1 단일클론 항체로 처리하고, 0, 30분, 1시간, 3시간, 6시간, 12시간 및 24시간 동안 37 ℃에서 배양하였다. 핵은 Hoechst 33258로 염색하였다. 얻어진 형광 이미지는 공초점 현미경(CLSM, LSM 710, Carl Zeiss, Jena, Germany)으로 관찰하여, 도 7에 나타내었다(scale bar: 10㎛). 유방암에서의 세포 내재화는 도 5(b)에서 확인할 수 있다.
즉, 상기 결과들은 항-hMUC1 단일클론 항체가 살아있는 세포에서 MUC1 단백질을 표적하고 내재화할 수 있음을 확인시켜준다.
실시예 19: 항-hMUC1 단일클론 항체의 가변부위 클로닝 결과
항-hMUC1 단일클론 항체를 생산하는 하이브리도마 세포(hMUC1-1H7)로부터 항-hMUC1 단일클론 항체의 중쇄 및 경쇄의 가변부위를 클로닝하고, DNA 시퀀싱하였다(실시예 10). 상기 DNA 시퀀싱에 의해 확인된 서열을 BLAST 프로그램(http://www.ncbi.nlm.nih.gov)에 의해 분석하여 공지된 서열과의 상동성을 분석하였다. hMUC1-1H7 항체의 중쇄 및 경쇄의 가변부위를 코딩하는 cDNA(중쇄 가변부위 코딩 cDNA: 393bp; 경쇄 가변부위 코딩 cDNA: 396bp)는 공지된 마우스 면역글로불린(IgG1)의 중쇄 및 경쇄의 가변부위의 암호화 서열과 각각 약 80 내지 95 % 및 93 내지 98 %의 서열 상동성을 보였다.
상기 얻어진 DNA 서열을 기초로 중쇄 및 경쇄의 CDR을 공지된 방법(kabat CDR definition)으로 확인하였다(표 2). 중쇄 및 경쇄의 가변영역 서열은 하기 표 3에 나타내었다.
Figure PCTKR2018003267-appb-T000001
Figure PCTKR2018003267-appb-T000002
실시예 20: 항-hMUC1 단일클론 항체로부터 유도된 재조합 Fab 단편의 발현 확인 및 상기 재조합 Fab 단편의 암세포의 MUC1 단백질 인식 시험
발현 벡터 pFabE를 사용하여 대장균에서 재조합 Fab를 발현시켰다(실시예 11).
벡터 pFabE는 경쇄의 불변부위(CL), 중쇄의 불변부위(CH1), 경쇄 가변부위(VL), 및 중쇄 가변부위(VH)가 삽입될 수 있는 2 개의 클로닝 사이트 BstX I 및 Sfi I를 각각 포함한다. hMUC1-1H7의 VL 및 VH 서열을 순차적으로 서브 클로닝함으로써 재조합 발현 플라스미드 pFabE-hMUC1-1H7을 구축하였다(도 8a). 상기 재조합 플라스미드는 대장균에서 LacZ 프로모터의 제어하에서 VL-CL 융합 단백질 및 VH-CH1 융합 단백질을 이중-시스트론 발현(bi-cistronic expression)시킨다. VL-CL 융합 단백질은 N 말단 OmpA 태그 및 C 말단 Pre-S1 태그를 포함하지만, VH-CH1 융합 단백질은 N 말단 pelB 태그 및 C 말단 His 태그를 포함한다(도 8b). 재조합 VH-CH1 융합 단백질이 His tag를 포함하므로, Ni-NTA affinity column chromatography를 사용하여 대장균의 대규모 배양과 배양 상등액으로부터 hMUC1-1H7의 재조합 Fab 정제를 수행하였다.
상기 정제된 재조합 Fab(이하, "재조합 Fab-hMUC1-1H7")이 암세포의 MUC1을 인식(결합)할 수 있는지 시험하기 위하여, 유방암 세포(MCF-7, MDA-MB-231, T47D 및 ZR75-1)에 대하여 면역 형광 염색 시험을 수행하였다. 유방암 세포 MCF-7, MDA-MB-231, T47D 및 ZR75-1 세포를 각각 재조합 Fab-hMUC1-1H7과 함께 배양한 후, Alexa 488-접합 2 차 항체와 함께 배양하였으며, 핵은 Hoechst 33258로 염색하였다. 얻어진 형광 이미지는 공초점 현미경(CLSM, LSM 710, Carl Zeiss, Jena, Germany)으로 관찰하여, 도 8 c에 나타내었다(scale bar: 10㎛).
도 8c에 나타난 바와 같이, 공 초점 영상은 재조합 Fab-hMUC1-1H7가 유방암 세포(MCF-7, T47D 및 ZR75-1)에서 MUC1을 뚜렷하게 염색하였으며, 이는 상기 재조합 Fab-hMUC1-1H7가 유방암 세포의 MUC1을 인식함을 의미한다.
실시예 21: 항-hMUC1 단일클론 항체의 유방암 세포의 증식 억제 효과
MUC1은 다양한 유형의 암 조직에서 과발현되어 세포의 증식을 촉진한다. 항-hMUC1 단일클론 항체의 암치료제로서의 유효성을 확인하기 위하여, 항-hMUC1 단일클론 항체가 유방암 세포 증식에 미치는 영향을 시험하였다.
MDA-MB-231, T47D 및 ZR75-1 세포를 항-hMUC1 항체(10 ㎍/ml; 실시예 7) 또는 정상 마우스 IgG1(10 ㎍/ml)로 처리하고, 도 9에 표시된 시간 간격으로 MTT 분석(실시예 12)에 의해 세포 증식에 미치는 영향을 시험하였다.
상기 얻어진 결과를 도 9에 나타내었다. 도 9에서 control은 항체를 처리하지 않은 군이다. 도 9에 나타난 바와 같이, 항-hMUC1 항체의 처리에 의하여, 대조군 IgG 처리와 비교하여, T47D 및 ZR75-1 세포의 증식이 현저하게 지연됨이 확인되었다. 대조적으로, 항-hMUC1 항체는 MDA-MB-231 세포의 증식을 변화시키지 않았다. 이러한 결과는, 항-hMUC1 단일클론 항체는 MUC1을 발현하는 암세포에 선택적으로 항암효과를 나타냄을 의미한다.
실시예 22: 유방암 및 췌장암에 주입된 항-hMUC1 단일클론 항체의 생체 내 위치화 확인
생체 내 항-hMUC1 단일클론 항체의 효과를 입증하기 위해, T47D, ZR75-1, 또는 Capan-2 종양을 갖는 BALB/C nu/nu 마우스에 DyLight 755-표지된 정상 IgG(5 mg/kg) 또는 DyLight 755-표지 항-hMUC1 단일클론 항체(5 mg/kg)를 정맥투여하고 전신 형광 이미징을 수행하였다(실시예 13). 표지된 항체의 분포는 0, 24 및 48 시간에서 형광의 총 flux(photon/sec)를 측정함으로써 정량화하였다.
상기 얻어진 결과를 도 10a 내지 10h(유방암), 및 11a 내지 11c(췌장암)에 나타내었다.
도 10a 내지 10d는 유방암 세포인 T47D 세포가 피하주입되어 종양이 유도된 마우스에서의 결과이고, 도 10e 내지 10h는 유방암 세포인 ZR75-1 세포가 피하주입되어 종양이 유도된 마우스에서의 결과를 나타낸다. 도 10b 및 10f에서, 해부 마우스의 이미징은 실시간 IVIS 이미징 시스템 200을 사용하여 수행하였다. 도 10c 및 10g의 경우, 여러 기관과 종양을 분리하여 항체 분포한 결과를 보여준다. 도 10d 및 10h는 종양 절편을 핵에 대해 DAPI로 염색하고 공초점 현미경으로 평가한 결과를 보여준다(scale bar: 10㎛).
도 10a, 10b, 10e, 10f, 11a, 및 11b의 결과로부터, 상기 항-hMUC1 항체가 종양 영역에 특이적으로 국한되어 위치함을 알 수 있다. 또한, 도 10c 및 10g의 결과로부터, 종양 및 기타 장기가 분리되었을 때, 항-hMUC1 항체는 다른 중요한 기관에 영향을 미치지 않고 종양 조직에만 위치함이 확인되었다.
또한 상기 결과로부터 DyLight로 표지된 항-hMUC1 단클론 항체는 종양 절편에서 뚜렷한 염색 결과를 나타내는 반면, DyLight로 표지된 정상 IgG는 이러한 효과를 나타내지 않음을 확인할 수 있다. 또한, 도 10d, 10h 및 11c의 공초점 영상에 의하여, 항-hMUC1 단일클론 항체의 종양 특이적 세포 내 위치화가 추가로 확인되었다.
상기 결과는 항-hMUC1 단일클론 항체가 동물 모델에서 유방암과 췌장암을 특이 적으로 표적화하는데 사용될 수 있음을 시사한다.
실시예 23: 항-hMUC1 단일클론 항체의 이종이식 마우스 모델에서의 항암 효과 시험
이종이식 마우스 모델을 사용하여 in vivo에서 췌장암 세포의 성장에 대한 MUC1 표적 단일클론 항체의 효과를 시험하였다. 첫째로 우리는 Capan-2 세포를 이용하여 nors 마우스(n = 8)를 등쪽 오른쪽 옆구리에 피하 주사하여 종양 성장을 허용했다. 종양 크기가 75mm3에 도달하면, 항-hMUC1 단일클론 항체를 일주일에 두 번 정맥내 투여하고, 11주동안 종양 크기를 모니터링하였다. 상기 이종이식 마우스 모델의 준비 및 종양 크기 시험은 실시예 14에 따라 수행하였다.
이종 이식 마우스 모델 실험 동안, PBS 투여 그룹에서 8 마리의 마우스 중 2 마리가 죽었고, 8 마리의 마우스 중 하나가 항-hMUC1 단클론 항체 투여 그룹에서 사망하였다.
상기 이종이식 마우스 모델로부터 적출된 종양 조직의 모습을 도 12a에 나타내고, 종양의 크기((넓이2*길이)/2), 무게, 및 마우스의 체중을 각각 도 12b, 12c, 및 12d에 각각 나타내었다. 도 12a 내지 12d에 나타난 바와 같이, 항-hMUC1 단일클론 항체 투여에 의하여 췌장 종양의 진행이 약화됨과, 상기 항체 치료가 시험체의 체중에 불리한 영향을 미치지 않음을 확인할 수 있다.
실시예 24: 인간 유방암 및 췌장암 조직에서의 MUC1 단백질의 발현 시험
면역염색에 의하여 유방암 및 췌장암 조직에서의 MUC1 단백질의 발현 여부를 조사하였다. 정상 조직을 대조군으로 하여 유방암 조직 및 췌장암 조직을 시험하였다. 그 결과를 도 13(유방암) 및 도 14(췌장암)에 나타내었다. 도 13 및 도 14로부터, 대부분의 유방암 조직 및 췌장암 조직에서 MUC1이 발현하는 반면, 정상 유방 조직에서는 MUC1이 발현하지 않는 것을 확인하였다.
유방암 조직 및 췌장암조직에서의 MUC1 발현을 확인한 면역조직화학 분석 결과를 표 4(유방암 조직) 및 표 5(췌장암 조직)에 각각 나타내었다.
Figure PCTKR2018003267-appb-T000003
Figure PCTKR2018003267-appb-T000004
표 4에 나타난 바와 같이, 51개 유방암 시료를 분석한 결과, 전체 시료 중 18 %가 종양 세포의 75 % 이상에서 MUC1 양성 반응을 보였다. 암세포 시료의 14 %와 25 %는 종양 세포의 50-74 %와 11-49 %에서 MUC1 발현이 양성이었다. 그러나 유방암 표본의 12 %는 MUC1의 발현을 보이지 않았다.
또한, 표 5에 나타난 바와 같이, 33 개의 췌장암 표본의 경우, 3 %의 시료가 종양 세포의 75 % 이상에서 MUC1 양성 반응을 보였다. 암 시료의 9.1 %와 48.5 %는 종양 세포의 50-74 %와 11-49 %에서 MUC1 발현에 양성이었다.
이러한 결과는 MUC1의 발현이 유방암 진단 및 치료 표적에 유용하게 사용될 수 있음을 시사한다.
실시예 25: 항-hMUC1 마우스 항체(1H7) ADC의 세포독성(cytotoxicity) 확인
Levena Biopharma(USA)에서 MMAE를 1H7 항체에 결합시켜 ADC를 제작하였다. 제작된 ADC의 항체 대비 MMAE의 비율(DAR)은 5.80이었다. 1H7-ADC의 세포독성 확인을 위하여, MDA-MB-231, T47D, ZR75-1 3종의 세포주를 사용하였다. 각 세포주는 96-웰 플레이트에서 배양하였으며, 배양 시작 24시간 뒤, 도 15와 같이 설정된 농도의 1H7-ADC를 처리하였다. 1H7-ADC 처리 후, 72시간 뒤, CCK-8 kit(Dojindo, USA)를 이용하여 세포 생존율을 비교하였다. CCK-8의 처리 방법은 제공된 매뉴얼에 따라 수행하였으며, 흡광값은 I3X 마이크로플레이트 리더(Molecular Devices, USA)를 사용하여 측정하였다. 1H7-ADC를 처리한 T47D 및 ZR75-1 세포의 생존율은 1H7-ADC를 처리하지 않은 대조군 대비 현저히 낮아짐을 확인하였다. 대조적으로, 1H7-ADC를 처리한 MDA-MB-231 세포의 생존은 대조군과 유의적인 차이를 보이지 않았다. 이러한 결과는, 1H7-ADC는 MUC1이 발현되는 암세포에 선택적으로 항암효과를 나타냄을 의미한다.
실시예 26: 환자 유래 유방암 조직에서의 항-hMUC1 단일클론 항체(1H7)-ADC의 암 증식 억제 효과
상기 실시예 25에서 언급된 1H7-ADC의 암 증식 억제 효과를 동물모델에서 확인하고자 하였다. 중아바이오(서울, 한국)에서 구입한 MUC1이 과발현 되는 환자 유래 유방암 조직(TNBC)을 NRGA 마우스에 이식하였고, 마우스에 이식한 유방암 조직이 일정 크기 이상 자랐을 때(100-200mm3), 1H7-ADC를 혈관주사로 투여하였다. 도 16에서 나타난 바와 같이, 1H7-ADC를 투여하였던 마우스의 암 조직의 크기는 시간에 따라 감소하였으나, 1H7-ADC를 투여하지 않았던 대조군 마우스의 암 조직은 시간이 지남에 따라 비례적으로 사이즈가 커지는 것을 확인하였다. 상기 결과는 MUC1이 발현된 환자 유래의 암조직에서 1H7-ADC가 조직 수준에서 암세포의 성장을 억제하는 효과를 가짐을 의미한다.
실시예 27: 1H7을 바탕으로 한 인간화 항체의 제작
ADC 제조를 통해 세포 독성 및 동물 모델에서의 항암 효과를 확인한 1H7 항체를 바탕으로 인간화 항체를 제작하였다. 인간화 항체는 오송 첨단의료산업 진흥재단의 신약개발지원 센터(오송, 한국)와 퓨전 안티바디스(Fusion antibodies, 영국)에 의뢰하여 제작하였다. 1H7 항체의 항원 인식 부위를 동일시 하고, 항원 인식 부위를 제외한 가변 부위 서열에 변화를 주어 Heavy chain 서열 6종, light chain 서열 6종을 제작하였다. 각각의 아미노산 서열은 표 6에 나타내었다.
Figure PCTKR2018003267-appb-T000005
실시예 28: 인간화 항체와 hMUC1-C의 결합 친화도(Binding affinity) 측정
상기 실시예 27에서 제작된 항-hMUC1-C 인간화 항체와 hMUC1-C 단백질의 결합에 관한 친화도 측정은 ELISA 방법을 통해 측정하였다. ELISA를 통한 친화도 분석은 제작된 항-hMUC1-C 인간화 항체를 동일농도로 96-웰 면역 플레이트에 코팅하고, super block 용액으로 차단시켰다. 이 후, MBP-hMUC1-C 단백질을 희석하여 항-hMUC1-C 인간화 항체가 코팅된 면역 플레이트에 넣고, 37℃ incubator에서 정치하여 결합시켰다. 플레이트를 세척 용액으로 3회 세척하고, HRP가 접합된 항-MBP 항체와 함께 반응시켰다. TMB 기질 용액을 사용하여 반응을 전개시키고, 2N HCl을 사용하여 반응을 종료시켰다. 이후, 항원-항체 결합 반응에 의해 나타난 흡광값은 I3X 마이크로플레이트 리더(Molecular Devices, USA) 기를 통해 측정하여, 비색분석(colorimetric assay)을 수행하였다. 도 17은 코팅된 인간화 항체에 따른 MBP-hMUC1-C에 대한 결합 친화도 차이를 나타낸다.
실시예 29: 항-hMUC1-C 인간화 항체와 항-hMUC1-C 마우스 항체(1H7)의 에피토프 동질성 확인
제작된 항-hMUC1-C 인간화 항체와 항-hMUC1-C 마우스 항체의 에피토프 동질성 확인은 경쟁적 ELISA(Competitive ELISA)를 통해 확인하였다. MBP-hMUC1-C 단백질을 희석하여 다양한 농도로 96-웰 면역 플레이트에 코팅하였다. 이 후, 바이오틴이 표지 된 50nM 항-hMUC1-C 인간화 항체와 항-hMUC1-C 마우스 항체를 5uM부터 연속적 희석하여 동시에 MBP-hMUC1-C 단백질이 코팅된 플레이트에 넣고 정치 상태에서 반응시켰다. HRP가 표지 된 스트렙트애비딘을 일정농도로 처리하여 항-hMUC1-C 인간화 항체에 표지 된 바이오틴을 감지하였다. 비색분석을 위해서 친화성 확인을 위해 사용된 TMB 기질 용액을 사용하였다. 반응에 의한 흡광값은 I3X 마이크로플레이트 리더(Molecular Devices, USA) 기를 통해 측정하여 분석하였다. 도 18에 그 결과를 나타내었으며, 바이오틴이 표지 되지 않은 항-hMUC1-C 마우스 항체의 농도 증가에 따른 흡광값의 감소는 항-hMUC1-C 인간화 항체와 항-hMUC1-C 마우스 항체가 동일한 에피토프를 인지함을 나타낸다.
실시예 30: 항-hMUC1-C 인간화 항체의 hMUC1-C에 대한 세포 결합 양상 분석(FACS analysis)
hMUC1의 발현이 알려진 세포주에서의 항-hMUC1 인간화 항체의 hMUC1-C에 대한 세포 결합 양상을 분석하고자 FACS 분석을 수행하였다. 각 세포주들은 배양배지에서 배양 후, 일정 수의 세포를 각 튜브로 나누어 준비하였다. 이후, 4% 파라포름알데히드로 고정시키고, 원심분리 후 FACS 분석 용액으로 1회 세척하였다. 준비된 세포주에 항-hMUC1 인간화 항체를 처리하였고, 4℃에서 배양을 통해 세포에 해당 인간화 항체가 결합하도록 처치하였다. 이후, FITC가 표지된 항-인간 IgG 항체를 처리하였고, FACS 분석은 BD FACS Canto(BD, USA)를 이용하여 실시하였다. 분석 결과는 도 19에 나타내었으며, 대조물질로써, 인간 IgG를 사용하여 비교하였다. hMUC1의 발현이 알려진 3종의 세포주에서는 항-hMUC1 인간화 항체와 hMUC1-C의 결합에 의해 형광값이 증가하였으며, hMUC1을 발현하지 않는 MDA-MB-231 세포주 에서는 형광값의 변화가 없었다. 이는, 제작된 항-hMUC1 인간화 항체가 세포에서 발현된 hMUC1을 특이적으로 인지함을 나타낸다.
hMUC1의 발현이 확인된 ZR75-1 세포주에서 항-hMUC1-C 인간화 항체(G3)와 항-hMUC1-C 마우스 항체(1H7)를 다양한 농도로 처리하여 항체의 농도 의존적으로 형광값이 증가하는 것을 FACS분석을 통해 확인하였다. 분석 결과는 도20에 나타내었다.
실시예 31: 항-hMUC1 인간화 항체 ADC(G3-ADC)의 세포독성(cytotoxicity) 확인
실시예 31-1: 유방암 세포주에서의 세포독성 확인
알테오젠(대전, Korea)에서 MMAE를 항-hMUC1 인간화 항체에 결합시켜 ADC를 제작하였다. 제작된 ADC의 항체 대비 MMAE의 비율(DAR)은 4.8이었다. 제작된 ADC의 세포독성 확인을 위하여, MDA-MB-231(MUC1-, HER2-), T47D(MUC1+, HER2+), ZR75-1(MUC1+, HER2+) 3종의 세포주를 사용하였다. 각 세포주는 96-웰 플레이트에서 배양하였으며, 배양 시작 24시간 뒤, MUC1-ADC(G3-ADC) 와 대조군으로 이용된 Kadcyla(HER2-ADC)를 해당 농도로 처리하였다. ADC 처리 후, 72시간 뒤, CellTiterGlo kit(Promega, USA)를 이용하여 세포 생존율을 비교하였다. CellTiterGlo 처리 방법은 된 매뉴얼에 따라 수행하였으며, 발광값은 I3X 마이크로플레이트 리더(Molecular Devices, USA)를 사용하여 측정하였다. G3-ADC를 처리한 T47D 및 ZR75-1 세포의 성장율은 G3-ADC를 처리하지 않은 대조군 대비 현저히 낮아짐을 확인하였다(도 21). 대조적으로, ADC를 처리한 MDA-MB-231 세포의 생존은 대조군과 유의적인 차이를 보이지 않았다. 이러한 결과는, G3-ADC는 MUC1이 발현되는 암세포에 선택적으로 항암효과를 나타냄을 의미한다. 대조군으로 이용된 Kadcyla의 경우 G3-ADC 대비 낮은 세포 독성을 보였으나, 이는 Her2의 발현 수준이 실험된 세포에서 낮게 발현되기 때문이라고 보여진다.
실시예 31-2: 골수성 백혈병 세포주에서의 세포독성 확인
실시예 31-1에서 사용된 동일한 항-hMUC1 인간화 항체 ADC를 사용하여, 골수성 백혈병 세포주에서의 세포 독성을 확인하였다. 사용된 골수성 백혈병 세포주는, K562(MUC1+), KG-1(MUC1-) 2종을 사용하였다. 각 세포주는 96-웰 플레이트에서 배양하였으며, 배양 시작 24시간 뒤, 항-hMUC1 인간화 항체 ADC를 해당 농도로 처리하였다. 항-hMUC1 인간화 항체 ADC 처리 후, 72시간 뒤, MTT assay를 통해 세포 생존율을 비교하였다. 항-hMUC1 인간화 항체 ADC를 처리한 세포의 생존율은 처리하지 않은 대조군 대비 현저히 낮아짐을 확인하였다. 이는 도 22에 나타내었으며, 2종의 세포주 중 MUC1 발현이 확인된 K562 세포주에서만 세포 독성이 확인되었다.
실시예 32: 환자 유래 유방암 조직에서의 항-hMUC1-C 인간화 항체-ADC의 암 증식 억제 효과
상기 실시예 31에서 언급된 항-hMUC1-C 인간화 항체-약물 접합체의 암 증식 억제 효과를 동물모델에서 확인하였다. 중아바이오(서울, Korea)에서 구입한 MUC1이 과발현되어 있는 환자 유래 유방암 조직(TNBC)을 NRGA 마우스에 총 24마리에 이식하였고, 마우스에 이식한 유방암 조직이 일정 크기 이상 자랐을 때(100-200mm3), 무작위적으로 선택하여 4개 그룹(n=5)로 구분하였다. 각 그룹은 음성대조군, Kadcyla(5 mg/kg), 항-hMUC1-G3-ADC(5 mg/kg 및 10 mg/kg)로서, 1주일에 1회, 총 3회를 혈관주사로 투여하였다. 도 23에 나타난 바와 같이, 항-hMUC1-C 인간화 항체-약물접합체를 투여하였던 마우스의 암 조직의 크기는 감소하였으나, 항-hMUC1-C 인간화 항체-약물접합체를 투여하지 않았던 대조군 마우스의 암 조직 크기는 통계적으로 유의한 차이를 보이지 않았다. 상기 결과는 MUC1이 발현된 암 조직에 대하여 항-hMUC1-C 인간화 항체-약물접합체가 TNBC 유방암 조직의 생장을 저해하는 효과가 있음을 의미한다. 실험된 모든 동물 개체에서 통계적으로 유의한 몸무게 변화는 관찰되지 않았으며, 농도 의존적으로 암세포 성장을 효과적으로 억제함을 확인하였다. 통계적 분석은 Two-way ANOVA로 하였다.
수탁번호
기탁기관명: 한국세포주연구재단
수탁번호: KCLRFBP00395
수탁일자: 20170308
본 발명에 따르면, MUC1에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편은 MUC1에 대한 우수한 친화도 및 결합력을 나타내며, 상기 항체 또는 이의 항원 결합 단편에 약물이 접합된 항체-약물 접합체는 MUC1 발현 세포에 특이적으로 결합함으로써 약물을 효과적이면서도 특이적 또는 선택적으로 전달할 수 있다. 따라서, 본 발명에 따른 항-MUC1 항체 및 항체-약물 접합체는 MUC1 관련 질병, 예컨대, 암의 치료에 유용하게 적용될 수 있다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.
[규칙 제26조에 의한 보정 04.05.2018] 
Figure WO-DOC-TABLE-394

Claims (27)

  1. MUC1의 C-말단 세포외 도메인 내의 연속하는 5개 이상의 아미노산을 포함하는 폴리펩타이드를 인식하는 항-MUC1 항체 또는 이의 항원 결합 단편.
  2. 제1항에 있어서, 상기 MUC1의 C-말단 세포외 도메인은 서열번호 10의 아미노산 서열로 이루어진 것을 특징으로 하는 항-MUC1 항체 또는 이의 항원 결합 단편.
  3. 제1항에 있어서,
    서열번호 1의 중쇄 CDR1; 서열번호 2의 중쇄 CDR2; 서열번호 3의 중쇄 CDR3; 및
    서열번호 4의 경쇄 CDR1; 서열번호 5의 경쇄 CDR2; 서열번호 6의 경쇄 CDR3를 포함하는 것을 특징으로 하는 항-MUC1 항체 또는 이의 항원 결합 단편.
  4. 제3항에 있어서,
    서열번호 22 또는 24의 중쇄 가변영역 및 서열번호 23 또는 25의 경쇄 가변영역을 포함하는 항-MUC1 항체 또는 이의 항원 결합 단편.
  5. 제4항에 있어서,
    서열번호 22의 중쇄 가변영역 및 서열번호 23의 경쇄 가변영역; 또는
    서열번호 24의 중쇄 가변영역 및 서열번호 25의 경쇄 가변영역을 포함하는 항-MUC1 항체 또는 이의 항원 결합 단편.
  6. 기탁번호 KCLRF-BP-00395인 항-MUC1 항체 생산을 위한 하이브리도마.
  7. 제1항의 항-MUC1 항체 또는 이의 항원 결합 단편에 약물이 접합된 항체-약물 접합체.
  8. 제7항에 있어서, 상기 항체 또는 이의 항원 결합 단편은 링커를 통하여 약물과 결합되는 것을 특징으로 하는 항체-약물 접합체.
  9. 제8항에 있어서, 상기 링커는 절단성 링커 또는 비절단성 링커인 것을 특징으로 하는 항체-약물 접합체.
  10. 제7항에 있어서, 상기 약물은 화학요법제, 독소, 마이크로 RNA(miRNA), siRNA, shRNA 또는 방사성 동위원소인 것을 특징으로 하는 항체-약물 접합체.
  11. 제1항의 항-MUC1 항체 또는 이의 항원 결합 단편을 포함하는 이중특이 항체(bispecific antibody).
  12. 제11항에 있어서, 상기 이중특이 항체는 항-MUC1 항체 또는 이의 항원 결합 단편과, 암 관련 항원 또는 면역관문 단백질 항원 또는 면역효능세포 특이적 표적분자에 대한 결합능을 가지는 항체로 이루어진 것을 특징으로 하는 이중특이 항체.
  13. 제1항 내지 제5항 중 어느 한 항의 항-MUC1 항체 또는 이의 항원 결합 단편, 제7항 내지 제10항 중 어느 한 항의 항체-약물 접합체 또는 제11항 내지 제12항 중 어느 한 항의 이중특이 항체를 포함하는 암의 예방 또는 치료용 약학 조성물.
  14. 제13항에 있어서, 상기 암은 MUC1 단백질이 발현된 것을 특징으로 하는 암의 예방 또는 치료용 약학 조성물.
  15. 제14항에 있어서, 상기 암은 유방암, 췌장암, 전립선암, 폐암, 갑상선암, 위암, 난소암, 대장암, 간암, 담낭암, 신장암, 자궁경부암, 또는 방광암인 암의 예방 또는 치료용 약학 조성물.
  16. 제1항 내지 제5항 중 어느 한 항의 항-MUC1 항체 또는 이의 항원 결합 단편을 포함하는 암의 진단용 조성물.
  17. 제16항에 있어서, 상기 암은 MUC1 단백질이 발현된 것을 특징으로 하는 암의 진단용 조성물.
  18. 리포좀 내에 (1) MUC1의 C-말단 부위, MUC1의 SEA 도메인, 또는 MUC1의 C-말단 세포외 도메인 및 (2) CpG-DNA를 캡슐화한 복합체를 포함하는 면역원성 조성물.
  19. 제18항에 있어서, 상기 리포좀은 dioleoylphosphatidylethanolamine(DOPE) 및 cholesteryl hemisuccinate(CHEMS)가 1:0.5 내지 1:2의 몰비로 혼합된 혼합물인 것을 특징으로 하는 면역원성 조성물.
  20. 제18항에 있어서, 상기 CpG-DNA는 CpG 모티프를 1 내지 3개 포함하는 총 10 내지 20개의 뉴클레오티드를 포함하는 올리고데옥시뉴클레오티드인 것을 특징으로 하는 면역원성 조성물.
  21. 제18항 내지 제20항 중 어느 한 항의 면역원성 조성물을 마우스에 접종하는 단계를 포함하는 항 MUC1-SEA 단일클론 항체의 제조 방법.
  22. 제1항 내지 제5항 중 어느 한 항에 따른 항-MUC1 항체 또는 이의 항원 결합 단편을 코딩하는 핵산.
  23. 제22항에 따른 핵산을 포함하는 재조합 발현 벡터.
  24. 제23항에 따른 재조합 발현 벡터로 형질전환된 숙주세포.
  25. 제24항에 있어서, 동물세포, 식물세포, 효모, 대장균 및 곤충세포로 구성된 군에서 선택된 것을 특징으로 하는 숙주세포.
  26. 제25항에 있어서, 원숭이 신장 세포7(COS7: monkey kidney cells) 세포, NSO 세포, SP2/0 세포, 차이니즈 햄스터 난소(CHO: Chinese hamster ovary) 세포, W138, 어린 햄스터 신장(BHK: baby hamster kidney) 세포, MDCK, 골수종 세포주, HuT 78 세포 및 HEK293 세포, 대장균, 바실러스 서브틸리스(Bacillus subtilis), 스트렙토마이세스 속(Streptomyces sp.), 슈도모나스 속(Pseudomonas sp.), 프로테우스 미라빌리스(Proteus mirabilis)또는 스타필로코쿠스 속(Staphylococcus sp.), 아스페르길러스 속(Aspergillus sp.), 피치아 파스토리스(Pichiapastoris),사카로마이세스 세레비지애(Saccharomyces cerevisiae), 쉬조사카로마세스 속(Schizosaccharomyces sp.) 및 뉴로스포라 크라사(Neurosporacrassa)으로 구성된 군에서 선택된 것을 특징으로 하는 숙주세포.
  27. 제24항 내지 제26항 중 어느 한 항에 따른 숙주세포를 배양하는 단계를 포함하는 항-MUC1 항체 또는 이의 항원 결합 단편의 제조 방법.
PCT/KR2018/003267 2017-03-21 2018-03-21 Muc1에 특이적으로 결합하는 항체 및 그의 용도 Ceased WO2018174544A2 (ko)

Priority Applications (19)

Application Number Priority Date Filing Date Title
AU2018238165A AU2018238165C1 (en) 2017-03-21 2018-03-21 Antibody binding specifically to MUC1 and use thereof
BR112019019650-1A BR112019019650A2 (pt) 2017-03-21 2018-03-21 ligação de anticorpos especificamente à muc1 e utilização dos mesmos
IL269488A IL269488B2 (en) 2017-03-21 2018-03-21 Conjugation of an antibody specifically for muc1 and its use
EP20212863.3A EP3825328A1 (en) 2017-03-21 2018-03-21 Antibody binding specifically to muc1 and use thereof
CN201880026127.7A CN111201240B (zh) 2017-03-21 2018-03-21 特异性地结合muc1的抗体及其用途
JP2019552556A JP7032425B2 (ja) 2017-03-21 2018-03-21 Muc1に特異的に結合する抗体及びその用途
CA3056582A CA3056582C (en) 2017-03-21 2018-03-21 Antibody binding specifically to muc1 and use thereof
MX2019011101A MX2019011101A (es) 2017-03-21 2018-03-21 Anticuerpo que se une especificamente a muc1 y uso del mismo.
US16/495,373 US11472887B2 (en) 2017-03-21 2018-03-21 Antibody binding specifically to MUC1 and use thereof
RU2019132900A RU2746413C1 (ru) 2017-03-21 2018-03-21 Антитело, специфически связывающееся с muc1, и его применение
EP18771928.1A EP3604334A4 (en) 2017-03-21 2018-03-21 ANTIBODIES SPECIFICALLY BINDING TO MUC1 AND USES THEREOF
ZA2019/06813A ZA201906813B (en) 2017-03-21 2019-10-16 Antibody binding specifically to muc1 and use thereof
AU2020281130A AU2020281130B2 (en) 2017-03-21 2020-12-04 Antibody binding specifically to MUC1 and use thereof
AU2020281132A AU2020281132B2 (en) 2017-03-21 2020-12-04 Antibody binding specifically to MUC1 and use thereof
US17/116,265 US11718684B2 (en) 2017-03-21 2020-12-09 Antibody binding specifically to MUC1 and use thereof
JP2021158853A JP7158548B2 (ja) 2017-03-21 2021-09-29 Muc1に特異的に結合する抗体及びその用途
JP2021158852A JP7158547B2 (ja) 2017-03-21 2021-09-29 Muc1に特異的に結合する抗体及びその用途
US17/811,845 US11739158B2 (en) 2017-03-21 2022-07-11 Antibody binding specifically to MUC1 and use thereof
US17/811,904 US11739159B2 (en) 2017-03-21 2022-07-12 Antibody binding specifically to MUC1 and use thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20170035622 2017-03-21
KR10-2017-0035622 2017-03-21
KR10-2018-0032592 2018-03-21
KR1020180032592A KR102127421B1 (ko) 2017-03-21 2018-03-21 Muc1에 특이적으로 결합하는 항체 및 그의 용도

Related Child Applications (4)

Application Number Title Priority Date Filing Date
US16/495,373 A-371-Of-International US11472887B2 (en) 2017-03-21 2018-03-21 Antibody binding specifically to MUC1 and use thereof
US17/116,265 Division US11718684B2 (en) 2017-03-21 2020-12-09 Antibody binding specifically to MUC1 and use thereof
US17/811,845 Division US11739158B2 (en) 2017-03-21 2022-07-11 Antibody binding specifically to MUC1 and use thereof
US17/811,904 Division US11739159B2 (en) 2017-03-21 2022-07-12 Antibody binding specifically to MUC1 and use thereof

Publications (2)

Publication Number Publication Date
WO2018174544A2 true WO2018174544A2 (ko) 2018-09-27
WO2018174544A3 WO2018174544A3 (ko) 2018-11-08

Family

ID=63586355

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/003267 Ceased WO2018174544A2 (ko) 2017-03-21 2018-03-21 Muc1에 특이적으로 결합하는 항체 및 그의 용도

Country Status (1)

Country Link
WO (1) WO2018174544A2 (ko)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110174515A (zh) * 2019-05-09 2019-08-27 青岛海兰深生物科技有限公司 一种检测抗肺癌天然抗体的组合物、试剂盒和方法
WO2020252472A3 (en) * 2019-06-14 2021-01-21 Dana-Farber Cancer Institute, Inc. Antibodies against muc1 and methods of use thereof
CN113444181A (zh) * 2021-09-01 2021-09-28 北京华睿博生物科技有限公司 抗kl-6双特异性抗体及基因、重组载体、药物、试剂盒
WO2022139537A2 (ko) 2020-12-24 2022-06-30 주식회사 엘지화학 뮤신 1에 특이적인 폴리펩티드 및 이의 이용
WO2022148736A1 (en) * 2021-01-05 2022-07-14 Transgene Vectorization of muc1 t cell engager
JP2023517754A (ja) * 2020-03-18 2023-04-26 バイオモディファイング・エルエルシー 抗muc1-sea抗体
CN116194150A (zh) * 2020-06-03 2023-05-30 默克专利股份公司 靶向egfr和muc1的双特异性抗体-药物缀合物及其用途
CN117547600A (zh) * 2023-11-15 2024-02-13 华中科技大学同济医学院附属协和医院 一种靶向hdac的脂质体疫苗的制备及应用
CN119912575A (zh) * 2023-10-30 2025-05-02 深圳华大生命科学研究院 一种ca15-3抗原结合蛋白及其应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150137015A (ko) 2014-05-28 2015-12-08 주식회사 레고켐 바이오사이언스 자가-희생 기를 포함하는 화합물

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5165175B2 (ja) * 2000-09-11 2013-03-21 デイナ ファーバー キャンサー インスティチュート,インコーポレイテッド Muc1細胞外ドメインおよびそれから得られた癌治療組成物
JP2005508839A (ja) * 2001-03-29 2005-04-07 ラモット・アット・テル・アビブ・ユニバーシテイ・リミテッド ペプチドおよびmuc1タンパク質に対する抗体
WO2005042573A1 (en) * 2003-10-24 2005-05-12 Dana-Farber Cancer Institute, Inc. Modulation of the interaction of muc1 with muc1 ligands
CN103977394B (zh) * 2009-07-17 2016-03-09 翰林大学校产学协力团 包含脂质体包胶的寡核苷酸和表位的免疫刺激性组合物
WO2015116753A1 (en) * 2014-01-29 2015-08-06 Dana-Farber Cancer Institute, Inc. Antibodies against the muc1-c/extracellular domain (muc1-c/ecd)

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150137015A (ko) 2014-05-28 2015-12-08 주식회사 레고켐 바이오사이언스 자가-희생 기를 포함하는 화합물

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JEON ET AL., MOL. IMMUNOL., vol. 44, 2007, pages 827 - 836
KWON ET AL., ONCOL. REP., vol. 18, 2007, pages 513 - 517

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110174515A (zh) * 2019-05-09 2019-08-27 青岛海兰深生物科技有限公司 一种检测抗肺癌天然抗体的组合物、试剂盒和方法
CN110174515B (zh) * 2019-05-09 2022-07-01 青岛海兰深生物科技有限公司 一种检测抗肺癌天然抗体的组合物、试剂盒和方法
WO2020252472A3 (en) * 2019-06-14 2021-01-21 Dana-Farber Cancer Institute, Inc. Antibodies against muc1 and methods of use thereof
US12448462B2 (en) 2019-06-14 2025-10-21 Dana-Farber Cancer Institute, Inc. Antibodies against MUC1
JP2023517754A (ja) * 2020-03-18 2023-04-26 バイオモディファイング・エルエルシー 抗muc1-sea抗体
JP7828286B2 (ja) 2020-03-18 2026-03-11 バイオモディファイング・エルエルシー 抗muc1-sea抗体
CN116194150A (zh) * 2020-06-03 2023-05-30 默克专利股份公司 靶向egfr和muc1的双特异性抗体-药物缀合物及其用途
KR20220092432A (ko) * 2020-12-24 2022-07-01 주식회사 엘지화학 뮤신 1에 특이적인 폴리펩티드 및 이의 이용
EP4265640A4 (en) * 2020-12-24 2024-12-11 Lg Chem, Ltd. POLYPEPTIDE SPECIFIC FOR MUCIN 1 AND USE THEREOF
KR102811084B1 (ko) * 2020-12-24 2025-05-23 주식회사 엘지화학 뮤신 1에 특이적인 폴리펩티드 및 이의 이용
WO2022139537A2 (ko) 2020-12-24 2022-06-30 주식회사 엘지화학 뮤신 1에 특이적인 폴리펩티드 및 이의 이용
WO2022148736A1 (en) * 2021-01-05 2022-07-14 Transgene Vectorization of muc1 t cell engager
CN113444181A (zh) * 2021-09-01 2021-09-28 北京华睿博生物科技有限公司 抗kl-6双特异性抗体及基因、重组载体、药物、试剂盒
CN119912575A (zh) * 2023-10-30 2025-05-02 深圳华大生命科学研究院 一种ca15-3抗原结合蛋白及其应用
CN117547600A (zh) * 2023-11-15 2024-02-13 华中科技大学同济医学院附属协和医院 一种靶向hdac的脂质体疫苗的制备及应用
CN117547600B (zh) * 2023-11-15 2024-04-30 华中科技大学同济医学院附属协和医院 一种靶向hdac的脂质体疫苗的制备及应用

Also Published As

Publication number Publication date
WO2018174544A3 (ko) 2018-11-08

Similar Documents

Publication Publication Date Title
JP7158548B2 (ja) Muc1に特異的に結合する抗体及びその用途
WO2018174544A2 (ko) Muc1에 특이적으로 결합하는 항체 및 그의 용도
WO2024136594A1 (ko) 클라우딘-18.2에 특이적으로 결합하는 단클론항체 및 이의 용도
WO2018217058A1 (en) Anti-human interleukin-2 antibodies and uses thereof
WO2019050362A2 (ko) 인간 dlk1에 대한 항체 및 이의 용도
WO2019190206A1 (ko) 클라우딘 3의 ecl-2에 특이적으로 결합하는 항체, 이의 단편 및 이들의 용도
WO2024025343A1 (ko) 항-ror1 항체 및 이의 용도
WO2022124866A1 (ko) 항-pd-1 항체 및 이의 용도
WO2021101346A1 (en) Anti-ror1/anti-4-1bb bispecific antibodies and uses thereof
WO2022149837A1 (ko) 항-fgfr3 항체 및 이의 용도
WO2020004937A1 (ko) 항-bcma 항체-약물 접합체 및 그 용도
WO2021101349A1 (ko) Ror1 및 b7-h3에 결합하는 항체, 이를 포함하는 항체-약물 접합체 및 그 용도
WO2025264040A1 (ko) 항-클라우딘18.2 항체, 항-클라우딘18.2 항체-약물접합체 및 이의 용도
WO2020209645A1 (ko) 프로그램화된 세포 사멸 단백질 리간드-1 (pd-l1)에 대한 항체 및 이의 용도
WO2024225556A1 (ko) 인테그린 표적 항체 및 이의 용도
WO2022124864A1 (ko) 항-tigit 항체 및 이의 용도
WO2026024136A1 (ko) 항-베타2-마이크로글로불린 항체 및 이의 용도
WO2025230359A1 (ko) 항-메소텔린 항체 및 이의 용도
WO2025239669A1 (en) Anti-bcam antibody and conjugate thereof
WO2023080695A1 (ko) 리지스틴 특이적 항체 및 이의 용도
WO2025183244A1 (ko) Psma에 대한 항체 및 그의 용도
WO2025244462A1 (ko) Gfral을 표적으로 하는 단일클론 항체 및 이의 용도
WO2026095670A1 (ko) 메소텔린의 c-말단에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편 및 이의 용도
WO2024014930A1 (ko) 항-ror1 항체, 이를 포함하는 이중특이성 항체, 및 이들의 용도
WO2025063790A1 (ko) 항-메소텔린 항체 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18771928

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 3056582

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2019552556

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019019650

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2018238165

Country of ref document: AU

Date of ref document: 20180321

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018771928

Country of ref document: EP

Effective date: 20191021

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112019019650

Country of ref document: BR

Free format text: COMO FORAM SOLICITADOS 2 SERVICOS (PROCURACAO E TRADUCAO DOS DOCUMENTOS APRESENTADOS NO DEPOSITO) ATRAVES DA PETICAO 870190117781 E, DE ACORDO COM A RESOLUCAO NO189/2017 DEVEM SER PAGAS RETRIBUICOES ESPECIFICAS PARA CADA UM DOS SERVICOS SOLICITADOS, SE FAZ NECESSARIA A COMPLEMENTACAO DO PAGAMENTO.

ENP Entry into the national phase

Ref document number: 112019019650

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190920