WO2018152333A1 - Methods and compositions for gene transfer across the vasculature - Google Patents

Methods and compositions for gene transfer across the vasculature Download PDF

Info

Publication number
WO2018152333A1
WO2018152333A1 PCT/US2018/018381 US2018018381W WO2018152333A1 WO 2018152333 A1 WO2018152333 A1 WO 2018152333A1 US 2018018381 W US2018018381 W US 2018018381W WO 2018152333 A1 WO2018152333 A1 WO 2018152333A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
seq
capsid protein
aav
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/018381
Other languages
English (en)
French (fr)
Other versions
WO2018152333A9 (en
Inventor
Aravind Asokan
Giridhar MURLIDHARAN
Blake ALBRIGHT
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of North Carolina at Chapel Hill
Original Assignee
University of North Carolina at Chapel Hill
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020197025393A priority Critical patent/KR20190117571A/ko
Priority to EP18754551.2A priority patent/EP3583220A4/en
Priority to EA201991911A priority patent/EA038695B1/ru
Priority to IL312788A priority patent/IL312788A/en
Priority to AU2018221738A priority patent/AU2018221738B2/en
Priority to CN202410828011.2A priority patent/CN118978574A/zh
Priority to MX2019009720A priority patent/MX2019009720A/es
Priority to US16/485,094 priority patent/US11905312B2/en
Priority to CA3052829A priority patent/CA3052829A1/en
Priority to SG11201907298WA priority patent/SG11201907298WA/en
Priority to CN201880025093.XA priority patent/CN110520536B/zh
Priority to BR112019016769-2A priority patent/BR112019016769A2/pt
Application filed by University of North Carolina at Chapel Hill filed Critical University of North Carolina at Chapel Hill
Priority to IL268534A priority patent/IL268534B2/en
Priority to JP2019542561A priority patent/JP7291397B2/ja
Publication of WO2018152333A1 publication Critical patent/WO2018152333A1/en
Publication of WO2018152333A9 publication Critical patent/WO2018152333A9/en
Anticipated expiration legal-status Critical
Priority to JP2023007075A priority patent/JP7574508B2/ja
Priority to US18/409,304 priority patent/US20240209031A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14121Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14145Special targeting system for viral vectors

Definitions

  • STRD_004_01WO_SeqListSST25.txt The text file is 4 KB, and was created on February 14, 2018, and is being submitted electronically via EFS-Web.
  • the present invention relates to modified capsid proteins from adeno-associated virus (AAV) and virus capsids and virus vectors comprising the same.
  • AAV adeno-associated virus
  • the invention relates to modified AAV capsid proteins and capsids comprising the same that can be incorporated into virus vectors to confer a desirable transduction profile with respect to a target tissue(s) of interest.
  • AAV adeno-associated virus
  • the present disclosure provides an adeno-associated virus
  • AAV capsid protein wherein the AAV capsid protein comprises a modification at amino acid residues S262, A263, S264, T265, A267, S268 and H272, and a single amino acid residue insertion between residues G266 and A267, (VP1 numbering), wherein the numbering of each residue is based on the amino acid sequence of AAV1 (SEQ ID NO:l) or the equivalent amino acid residue in AAV2 (SEQ ID NO:2), AAV3 (SEQ ID NO:3), AAV6 (SEQ ID NO:4), AAV7 (SEQ ID NO:5), AAV8 (SEQ ID NO:6), AAV9 (SEQ ID NO:7) or AAVrhlO (SEQ ID NO:8).
  • the AAV capsid protein of this invention can further comprise a modification at amino acid residues Q148, E152, S157, T162, T326, D328, V330, T331, V341 and S345, and a single amino acid residue insertion between residues E152 and P153 (VP1 numbering) wherein the numbering of each residue is based on the amino acid sequence of SEQ ID NO:l or the equivalent amino acid residue in SEQ ID NOs:2, 3, 4, 5, 6, 7 or 8.
  • the AAV capsid protein of this invention can further comprise a modification of amino acid residues LI 88, S205, N223 and A224 (VP1 numbering), wherein the numbering of each residue is based on the amino acid sequence of SEQ ID NO: 1 or the equivalent amino acid residue in SEQ ID NOs:2, 3, 4, 5, 6, 7 or 8.
  • the present disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises a modification at amino acid residues S262, A263, S264, T265, and A267 (VPl numbering), and a single amino acid residue insertion between residues S268 and N269, wherein the amino acid residues are based on the amino acid sequence of AAV1 (SEQ ID NO: 1) or the equivalent amino acid residues in AAV2 (SEQ ID NO:2), AAV3 (SEQ ID NO:3), AAV6 (SEQ ID NO:4), AAV7 (SEQ ID NO:5), AAV8 (SEQ ID NO:6), AAV9 (SEQ ID NO:7) or AAVrhlO (SEQ ID NO:8).
  • AAV adeno-associated virus
  • the capsid protein further comprises a modification at amino acid residue H272.
  • the AAV capsid protein further comprises a modification at amino acid residues Q148, El 52, SI 57, T162, H272, T326, D328, V330, T331, V341 and S345, and a single amino acid residue insertion between residues E152 and P153.
  • the AAV capsid protein further comprises a modification at amino acid residues LI 88, S205, N223, A224, and H272.
  • the disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises a modification resulting in the amino acid sequence: X !
  • X 1 is any amino acid other than S
  • X 2 is any amino acid other than A
  • X 3 is any amino acid other than S
  • X 4 is any amino acid other than T.
  • the disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises a modification at amino acid residues S262, A263, S264, T265, A267, and H272, and a single amino acid residue insertion between residues S268 and N269, (VP1 numbering), wherein the numbering of each residue is based on the amino acid sequence of AAV1 (SEQ ID NO:2) or the equivalent amino acid residue in AAV1 (SEQ ID NO:l), AAV3 (SEQ ID NO:3), AAV6 (SEQ ID NO:4), AAV7 (SEQ ID NO:5), AAV8 (SEQ ID NO:6), AAV9 (SEQ ID NO:7) or AAVrhlO (SEQ ID NO:8).
  • AAV capsid protein comprises a modification at amino acid residues S262, A263, S264, T265, A267, and H272, and a single amino acid residue insertion between residues S268 and N269
  • the disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises a modification at amino acid residues S262, Q263, S264, A266, S267, and H271, and a insertion of at least one amino acid residue between residues S261 and S262, (VP1 numbering), wherein the numbering of each residue is based on the amino acid sequence of AAV2 (SEQ ID NO:2) or the equivalent amino acid residue in AAV1 (SEQ ID NO: l), AAV3 (SEQ ID NO:3), AAV6 (SEQ ID NO:4), AAV7 (SEQ ID NO:5), AAV8 (SEQ ID NO:6), AAV9 (SEQ ID NO:7) or AAVrhlO (SEQ ID NO:8).
  • AAV capsid protein comprises a modification at amino acid residues S262, Q263, S264, A266, S267, and H271, and a insertion of at least one amino acid residue between residues S
  • the disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises a modification at amino acid residues S262, Q263, S264, A266, A267, H271, and a single amino acid residue insertion between residues S261 and S262, wherein the numbering of each residue is based on the amino acid sequence of AAV3 (SEQ ID NO:3) or the equivalent amino acid residue in AAV1 (SEQ ID NO:l), AAV2 (SEQ ID NO:2), AAV6 (SEQ ID NO:4), AAV7 (SEQ ID NO:5), AAV8 (SEQ ID NO:6), AAV9 (SEQ ID NO:7) or AAVrhlO (SEQ ID NO:8).
  • AAV capsid protein comprises a modification at amino acid residues S262, Q263, S264, A266, A267, H271, and a single amino acid residue insertion between residues S261 and S262, wherein the numbering of each residue is
  • the disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises a modification at amino acid residues S263, S269, A237 (VP1 numbering), wherein the numbering of each residue is based on the amino acid sequence of AAV9 (SEQ ID NO:9) or the equivalent amino acid residue in AAVl (SEQ ID NO: 1), AAV2 (SEQ ID NO:2), AAV3 (SEQ ID NO:3), AAV6 (SEQ ID NO:4), AAV7 (SEQ ID NO:5), AAV8 (SEQ ID NO:6), or AAVrhlO (SEQ ID NO:8).
  • AAV capsid protein comprises a modification at amino acid residues S263, S269, A237 (VP1 numbering), wherein the numbering of each residue is based on the amino acid sequence of AAV9 (SEQ ID NO:9) or the equivalent amino acid residue in AAVl (SEQ ID NO: 1), AAV2 (SEQ ID
  • the disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises the sequence of any one of SEQ ID NO: 9 to SEQ ID NO: 34.
  • AAV adeno-associated virus
  • the present disclosure additionally provides an AAV capsid comprising a capsid protein of the disclosure, as well as a virus vector comprising an AAV capsid of the disclosure.
  • the virus vector comprises an AAV capsid of the disclosure and a nucleic acid comprising at least one terminal repeat sequence, wherein the nucleic acid is encapsidated by the AAV capsid.
  • the present disclosure additionally provides pharmaceutical compositions comprising the AAV capsids and/or the virus vectors disclosed herein.
  • Also provided herein is a method of introducing a nucleic acid molecule into a cell, comprising contacting the cell with a virus vector of the disclosure, as well as a method of delivering a nucleic acid molecule to a subject, comprising administering to the subject a virus vector of the disclosure.
  • the present disclosure provides a method of selectively delivering a nucleic acid molecule of interest to a neuronal cell, comprising contacting the neuronal cell with the virus vector of this invention, wherein the virus vector comprises the nucleic acid molecule of interest.
  • the present disclosure provides a method of treating a neurological disorder or defect in a subject, comprising administering to the subject a virus vector of the disclosure, wherein the virus vector comprises a nucleic acid molecule that encodes a therapeutic protein or therapeutic RNA effective in treating the neurological disorder or defect.
  • FIG. 2 Crossing the brain vasculature and neuronal expression.
  • AAV vectors packaging a Cbh-scGFP transgene were administered to C57/B16 mice via tail vein injection at a dose of 5 x 10 11 vg.
  • Mice were sacrificed at 21 days post injection, tissues were harvested, fixed, sectioned, DAB-stained to detect GFP, imaged via Aperio Scanner and image processing performed with ImageScope software.
  • CX Cortex
  • MCT motor cortex
  • STR striatum
  • HC hippocampus
  • DG dentate gyrus
  • FIG. 3 Liver detargeting.
  • FIGS. 4A-C Phylogenetic and structural analyses of the AAVl/rh.lO domain swap capsid library.
  • FIG. 4A Schematic of the panel of representative AAVl/rh.lO chimeric capsids isolated from the library demonstrating sequence diversity, at the amino acid level, of domain swaps obtained through shuffling. Individual parental or chimeric capsids are listed vertically, while the VP1 capsid sequence with different domain swaps is displayed horizontally, from the N-terminus on the left to the C-terminus on the right. AAVl- derived residues are shown in gray, AAVrh.10 residues in green-cyan and consensus residues between the two in black.
  • FIG. 4B .
  • FIG. 5 In vivo screen yields AAVl/rh.lO chimeras capable of crossing the blood-brain barrier following intravenous administration.
  • FIGS. 6A-G In vivo screen of AAVl/rh.lO chimeras for their ability to cross the blood-brain barrier and transduce various brain regions following intravascular
  • mice received a dose of 5 x 10 11 vg of either parental (AAV1 or AAVrh.10) or chimeric vector packaging a CBh-scGFP transgene via tail vein injection.
  • FIGS. 7A-H CNS transduction profile of AAV1R6 and AAV1R7 compared to parental AAV1 and AAVrh.10 in the brain.
  • Transduction profiles at three weeks post tail vein injection of AAV vectors packaging a CBh-scGFP transgene at a dose of 5 x 10 11 vg for parental serotypes, AAV1 and AAVrh.10 (left columns), and for AAV1R6 and AAV1 7 (right columns) across various brain regions are shown, including the motor cortex (FIG. 7A), cerebral (somatosensory) cortex (FIG. 7B), hippocampus (FIG. 7C), dentate gyrus (FIG. 7D), thalamus (FIG. 7E), hypothalamus (FIG. 7F), striatum (FIG. 7G), and amygdala (FIG. 7H).
  • Scale bar ⁇ .
  • FIGS. 8A-H Quantitative comparison of neuronal and glial transduction levels for parental and chimeric capsid variants. Relative neuronal transduction levels at 3 weeks post administration of vectors packaging a CBh-scGFP transgene via tail vein injection at a dose of 5x 10 11 vg were quantified by counting the number of transduced neurons and glia, identified based on morphology, for each brain region, per 50 ⁇ coronal section.
  • FIGS. 9A-F Structural analysis of the AAV1R6 chimeric capsid variant.
  • FIG. 9A The sequence alignment of AAV1R6 with AAVl & AAVrh.lO highlights the amino acid residues (AAV1R6 numbering) that are uniquely derived from AAVrh.lO (shown in black lettering and highlighted in blue). conserveed residues are lettered red and highlighted in yellow, while the non-conserved equivalent residues on AAVl are shown in black or green text and are highlighted in either green or white.
  • the three-dimensional structural model of the chimeric AAV1R6 VP3 subunit FIG. 9A
  • FIGS. 10A-B Relative cardiac and liver transduction by AAV1R6 and AAV1R7 compared to parental capsids. Either parental (AAVl or AAVrh.lO) or chimeric
  • AAV1R6 or AAV1R7 vectors packaging a CBh-scGFP transgene were administered at
  • FIGS. 11A-H Rational design and functional mapping of a minimal AAVrh.lO footprint for crossing the BBB.
  • FIG. 11 A The sequence alignment of AAVIRX with AAVl and AAVrh. lO shows the numbered amino acid residues within and adjacent to the neurotropic footprint. conserveed residues are highlighted in yellow, the residues composing the footprint are highlighted in cyan and non-conserved residues are highlighted in either green or white.
  • Structural models of the engineered AAVIRX chimeric capsid were generated using SWISS-MODEL software for homology-based modelling and VIPERdb was used to generate oligomers. PyMol was used to generate surface rendered models of the AAVIRX VP3 subunit monomer (FIG.
  • FIG. 11B trimer dimer /2-fold axis of symmetry (FIG. 11C), trimer / three-fold axis of symmetry (FIG. 11D), pentamer / 5-fold axis of symmetry (FIG. HE) and the full capsid (60-mer) (FIG. 11F).
  • AAVl -derived amino acids and those homologous between AAVl and AAVrh.10 are represented in gray while the residues comprising the neurotropic footprint from AAVrh.lO for crossing the BBB are depicted in green cyan.
  • FIG. 11G The stereographic roadmap projection shows the neurotropic footprint as viewed down the threefold symmetry axis on the AAVIRX capsid and was generated using RIVEM.
  • FIGS. 12A-H Peripheral tissue transduction and biodistribution of AAV1R6, AAV1R7 and AAVIRX following intravenous administration.
  • Mice were injected via the tail vein with PBS or with either AAVl, AAVrh.lO, AAV1R6, AAV1R7 or AAVIRX vectors packaging a CBA-Luc reporter transgene at a dose of 1 x 10 ⁇ vg.
  • luciferase reporter transgene expression levels FIGGS. 12A, 12C, 12E, 12G
  • biodistribution of viral genome copies across various tissues FIGG. 12B, 12D, 12F, 12H
  • Luciferase expression levels were normalized to grams of tissue lysate and are represented as relative light units.
  • One-way ANOVA and an unpaired two-tailed T-test with Welch's correction for each group were carried out and significance relative to AAVrh.lO is shown, ns, not significant. *, P ⁇ 0.05.
  • FIGS. 13A-H Quantification of neuronal and glial transduction levels mediated by AAVIRX compared to parental and other chimeric capsid variants. Mice received a dose
  • FIG. 14 Sequence alignment of lRX footprint, and Variable Region I (VR-I) across common AAV serotypes.
  • the sequence alignment of AAVIRX with common AAV serotypes highlights the amino acid residues (VP1 numbering) of the 1RX footprint, within the larger context of variable region I (VR-I), compared across common natural AAV serotypes. Black lines above and below demarcate the specific residues within the lRX footprint. Key: Residues that are identical across serotypes are represented by red letters on a yellow background; conservative residues, blue letters on a cyan background; similar residues, black letters on a green background; weakly similar residues, green letters on a white background; non-similar residues, black letters on a white background. This sequence alignment was generated using Vector NTI Advance 11.5.2 software.
  • FIG. 15 Sequence alignment of AAV1, AAV1R7, and AAVrh.lO VP1 capsid protein.
  • the term "about,” as used herein when referring to a measurable value such as an amount of the length of a polynucleotide or polypeptide sequence, dose, time, temperature, and the like, is meant to encompass variations of ⁇ 20%, ⁇ 10%, ⁇ 5%, ⁇ 1%,
  • amino acid can be selected from any subset of these amino acid(s) for example A, G, I or L; A, G, I or V; A or G; only L; etc. as if each such subcombination is expressly set forth herein.
  • amino acid can be disclaimed.
  • the amino acid is not A, G or I; is not A; is not G or V; etc. as if each such possible disclaimer is expressly set forth herein.
  • the terms “reduce,” “reduces,” “reduction” and similar terms mean a decrease of at least about 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97% or more, relative to a control or reference.
  • the terms “increase,” increases” “increasing,” “enhance,” “enhances,” “enhancement” and similar terms indicate an increase or enhancement of at least about 5%, 10%, 20%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, 500% or more, relative to a control or reference.
  • parvovirus encompasses the family Parvoviridae, including autonomously replicating parvoviruses and dependo viruses.
  • the autonomous parvoviruses include members of the genera Parvovirus, Erythrovirus, Densovirus, Iteravirus, and
  • Exemplary autonomous parvoviruses include, but are not limited to, minute virus of mouse, bovine parvovirus, canine parvovirus, chicken parvovirus, feline
  • panleukopenia virus feline parvovirus, goose parvovirus, HI parvovirus, muscovy duck parvovirus, B 19 virus, and any other autonomous parvovirus now known or later discovered.
  • Other autonomous parvoviruses are known to those skilled in the art. See, e.g., BERNARD N. FIELDS et al, VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
  • AAV adeno-associated virus
  • AAV includes but is not limited to, AAV type 1 , AAV type 2, AAV type 3 (including types 3 A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type rhlO, AAV type 11, AAV type 12, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, and any other AAV now known or later discovered. See, e.g., BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
  • a number of AAV serotypes and clades have been identified (see, e.g., Gao et al. (2004) J. Virology 78:6381-6388; Moris et al. (2004) Virology 33-:375-383; and Table 1).
  • parvoviruses as well as the sequences of the native terminal repeats (TRs), Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as the GenBank ® Database. See, e.g., GenBank Accession Numbers NC 044927, NC 002077, NC_001401, NC_001729, NC 001863, NC 001829, NC_001862, NC_000883, NC 001701, NC_001510, NC_006152, NC 006261, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061,
  • tropism refers to preferential entry of the virus into certain cells or tissues, optionally followed by expression (e.g., transcription and, optionally, translation) of a sequence(s) carried by the viral genome in the cell, e.g., for a recombinant virus, expression of a heterologous nucleic acid(s) of interest.
  • expression e.g., transcription and, optionally, translation
  • transcription of a heterologous nucleic acid sequence from a viral genome may not be initiated in the absence of trans-acting factors, e.g., for an inducible promoter or otherwise regulated nucleic acid sequence.
  • recombinant AAV (rAAV) genome gene expression from the viral genome may be from a stably integrated provirus and/or from a non-integrated episome, as well as any other form the virus may take within the cell.
  • systemic tropism and “systemic transduction” (and equivalent terms) indicate that the virus capsid or virus vector of the disclosure exhibits tropism for and/or transduces, respectively, tissues throughout the body (e.g. , brain, lung, skeletal muscle, heart, liver, kidney and/or pancreas).
  • systemic transduction of the central nervous system e.g., brain, neuronal cells, etc.
  • systemic transduction of cardiac muscle tissues is achieved.
  • control e.g., at least about 50%, 60%,
  • the virus vector efficiently transduces or has efficient tropism for neuronal cells and cardiomyocytes. Suitable controls will depend on a variety of factors including the desired tropism profile.
  • the virus vector does not efficiently transduce (i.e., does not have efficient tropism) for liver, kidney, gonads and/or germ cells.
  • undesirable transduction of tissue(s) e.g., liver
  • tissue(s) is 20% or less, 10% or less, 5% or less, 1% or less, 0.1 % or less as compared with the level of transduction of the desired target tissue(s)
  • polypeptide encompasses both peptides and proteins, unless indicated otherwise.
  • a "polynucleotide” is a sequence of nucleotide bases, and may be RNA, DNA or
  • DNA-R A hybrid sequences (including both naturally occurring and non-naturally occurring nucleotides), but in representative embodiments are either single or double stranded DNA sequences.
  • an "isolated" polynucleotide e.g., an "isolated DNA” or an “isolated RNA" means a polynucleotide that is at least partially separated from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polynucleotide.
  • an "isolated" nucleic acid molecule is enriched by at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more as compared with the starting material.
  • an "isolated" polypeptide means a polypeptide that is at least partially separated from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polypeptide.
  • an "isolated" polypeptide is enriched by at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more as compared with the starting material.
  • isolated or “purify” (or grammatical equivalents) a virus vector, it is meant that the virus vector is at least partially separated from at least some of the other components in the starting material.
  • isolated or “purify” (or grammatical equivalents) a virus vector
  • purified virus vector is enriched by at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more as compared with the starting material.
  • neuroneuronal cell includes sensory neurons, pseudo-unipolar neurons, motor neurons, multipolar neurons, intemeurons, and/or bipolar neurons located in brain substructures such as the cortex, motor cortex, hippocampus, hypothalamus, striatum, basal ganglia, amygdala, cerebellum, dorsal root ganglia and/or spinal cord.
  • a “therapeutic protein” is a protein that can alleviate, reduce, prevent, delay and/or stabilize symptoms that result from an absence of or defect in a protein in a cell or subject and/or is a protein that otherwise confers a benefit to a subject.
  • a "therapeutic RNA molecule” or “functional RNA molecule” as used herein can be an antisense nucleic acid, a ribozyme (e.g., as described in U.S. Patent No. 5,877,022), an RNA that effects spliceo some-mediated traas-splicing (see, Puttaraju et al. (1999) Nature Biotech. 17:246; U.S. Patent No. 6,013,487; U.S. Patent No.
  • RNAi interfering RNA
  • shRNA shRNA
  • miRNA miRNA
  • any other non-translated RNA such as a "guide" RNA
  • treat By the terms “treat,” “treating” or “treatment of (and grammatical variations thereof) it is meant that the severity of the subject's condition is reduced, at least partially improved or stabilized and/or that some alleviation, mitigation, decrease or stabilization in at least one clinical symptom is achieved and/or there is a delay in the progression of the disease or disorder.
  • prevent By the terms “prevent,” “preventing” and “prevention” (and grammatical variations thereof) refer to prevention and/or delay of the onset of a disease, disorder and/or a clinical symptom(s) in a subject and/or a reduction in the severity of the onset of the disease, disorder and/or clinical symptom(s) relative to what would occur in the absence of the methods of the disclosure.
  • the prevention can be complete, e.g., the total absence of the disease, disorder and/or clinical symptom (s).
  • the prevention can also be partial, such that the occurrence of the disease, disorder and/or clinical symptom(s) in the subject and/or the severity of onset is less than what would occur in the absence of the present disclosure.
  • a “treatment effective” amount as used herein is an amount that is sufficient to provide some improvement or benefit to the subject.
  • a “treatment effective” amount is an amount that will provide some alleviation, mitigation, decrease and/or stabilization in at least one clinical symptom in the subject.
  • prevention effective amount is an amount that is sufficient to prevent and/or delay the onset of a disease, disorder and/or clinical symptoms in a subject and/or to reduce and/or delay the severity of the onset of a disease, disorder and/or clinical symptoms in a subject relative to what would occur in the absence of the methods of the disclosure.
  • level of prevention need not be complete, as long as some benefit is provided to the subject.
  • heterologous nucleotide sequence and “heterologous nucleic acid molecule” are used interchangeably herein and refer to a nucleic acid molecule and/or nucleotide sequence that is not naturally occurring in the virus.
  • the heterologous nucleic acid molecule or nucleotide sequence comprises an open reading frame that encodes a protein or nontranslated RNA of interest (e.g., for delivery to a cell or subject).
  • virus vector refers to a virus (e.g., AAV) particle that functions as a nucleic acid delivery vehicle, and which comprises the vector genome (e.g., viral DNA [vDNA]) packaged within a virion.
  • AAV a virus
  • vDNA viral DNA
  • vector may be used to refer to the vector genome/vDNA alone.
  • rAAV vector genome or "rAAV genome” is a recombinant AAV genome (i.e., vDNA) that comprises one or more heterologous nucleic acid sequences.
  • rAAV vectors generally require only the terminal repeat(s) (TR(s)) in cis to generate virus. All other viral sequences are dispensable and may be supplied in trans (Muzyczka (1992) Curr. Topics Microbiol. Immunol. 158:97).
  • the rAAV vector genome will only retain the one or more TR sequence so as to maximize the size of the transgene that can be efficiently packaged by the vector.
  • the structural and non-structural protein coding sequences may be provided in trans ⁇ e.g., from a vector, such as a plasmid, and/or by stably integrating the sequences into a packaging cell).
  • the rAAV vector genome comprises at least one terminal repeat (TR) sequence (e.g., AAV TR sequence), optionally two TRs (e.g., two AAV TRs), which typically will be at the 5' and 3' ends of the vector genome and flank the heterologous nucleic acid sequence, but need not be contiguous thereto.
  • the TRs can be the same or different from each other.
  • terminal repeat includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat (i.e., mediates the desired functions such as replication, virus packaging, integration and/or pro virus rescue, and the like).
  • the TR can be an AAV TR or a non-AAV TR.
  • a non-AAV TR sequence such as those of other parvoviruses (e.g., canine parvovirus (CPV), mouse parvovirus (MVM), human parvovirus B-19) or any other suitable virus sequence (e.g., the SV40 hairpin that serves as the origin of SV40 replication) can be used as a TR, which can further be modified by truncation, substitution, deletion, insertion and/or addition.
  • the TR can be partially or completely synthetic, such as the "double-D sequence" as described in US Patent No. 5,478,745 to Samulski et al.
  • An "AAV terminal repeat” or “AAV TR” may be from any AAV, including but not limited to serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or any other AAV now known or later discovered (see, e.g., Table 1).
  • An AAV terminal repeat need not have the native terminal repeat sequence (e.g., a native AAV TR sequence may be altered by insertion, deletion, substitution, truncation and/or missense mutations), as long as the terminal repeat mediates the desired functions, e.g., replication, virus packaging, integration, and/or provirus rescue, and the like.
  • virus vectors of the disclosure can further be "targeted” virus vectors (e.g., having a directed tropism) and/or a “hybrid” parvovirus (i.e., in which the viral TRs and viral capsid are from different parvoviruses) as described in international patent publication WO
  • the virus vectors of the disclosure can further be duplexed parvovirus particles as described in international patent publication WO 01/92551 (the disclosure of which is incorporated herein by reference in its entirety).
  • double stranded (duplex) genomes can be packaged into the virus capsids of the disclosure.
  • the viral capsid or genomic elements can contain other modifications, including insertions, deletions and/or substitutions.
  • amino acid encompasses any naturally occurring amino acid, modified forms thereof, and synthetic amino acids.
  • non-naturally occurring amino acid can be an "unnatural" amino acid as described by Wang et al. Annu Rev Biophys Biomol Struct. 35:225-49 (2006)). These unnatural amino acids can advantageously be used to chemically link molecules of interest to the AAV capsid protein.
  • the present disclosure provides AAV capsid proteins comprising a mutation (i.e., a modification, which can be a substitution or an insertion or a deletion) in the amino acid sequence and virus capsids and virus vectors comprising the modified AAV capsid protein.
  • the mutated AAV capsid proteins, and the nucleic acids encoding them are not found in nature (i.e., are non-natural) and have neither the sequence of the wild-type sequences found in nature nor the function of those sequences.
  • modifications at the amino acid positions described herein can confer one or more desirable properties to virus vectors comprising the modified AAV capsid protein including without limitation: (i) selective transduction of neuronal cells after crossing the blood-brain barrier following systemic injection; (ii) simultaneous transduction of cardiac tissue and neuronal tissue following systemic injection; and (iii) detargeting from the liver, spleen, kidney and other peripheral organs.
  • the modified AAV capsid protein of the disclosure comprises one or more mutations (i.e., modifications) in the amino acid sequence of the native AAVl capsid protein or the corresponding amino acid residue(s) of a capsid protein from another AAV serotype, including but not limited to AAV2, AAV3, AAV6, AAV7, AAV8, AAV9 and AAVrh.10.
  • the amino acid positions in other AAV serotypes or modified AAV capsids that "correspond to" these positions in the native AAVl capsid protein will be apparent to those skilled in the art and can be readily determined using sequence alignment techniques (see, e.g., Figure 7 of WO 2006/066066) and/or crystal structure analysis (Padron et al.
  • the corresponding modification will be an insertion and/or a substitution, depending on whether the corresponding amino acid positions are partially or completely present in the virus or, alternatively, are completely absent.
  • the specific amino acid position(s) may be different than the position in AAVl (using VP1 numbering.
  • the corresponding amino acid position(s) will be readily apparent to those skilled in the art using well-known techniques.
  • a “mutation” or “modification” in an amino acid sequence includes substitutions, insertions and/or deletions, each of which can involve one, two, three, four, five, six, seven, eight, nine, ten or more amino acids.
  • the modification is a substitution.
  • the modification is an insertion (e.g., of a single amino acid residue between two amino acid residues in an amino acid sequence.)
  • the present disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists essentially of or consists of a modification at amino acid residues S262, A263, S264, T265, A267, and S268, and a single amino acid residue insertion between residues 266 and 267 (VP1 numbering), wherein the numbering of each residue is based on the amino acid sequence of AAVl (SEQ ID NO:l) or the equivalent amino acid residue in AAV2 (SEQ ID NO:2), AAV3 (SEQ ID NO:3), AAV6 (SEQ ID NO:4), AAV7 (SEQ ID NO:5), AAV8 (SEQ ID NO:6), AAV9 (SEQ ID NO:7) or AAVrhlO (SEQ ID NO:8).
  • AAV capsid protein comprises, consists essentially of or consists of a modification at amino acid residues S262, A263, S264, T265, A267, and S268,
  • the AAV capsid protein may comprise a modification at amino acid residue H272.
  • the modification is S262N, A263G, S264T, T265S, A267S, S268T , H272T, and combinations thereof.
  • the single amino acid residue insertion between residues 266 and 267 is G (designated -267G).
  • the AAV capsid protein described above can further comprise, consist essentially of or consist of a modification at amino acid residues Q148, El 52, SI 57, T162, H272, T326, D328, V330, T331, V341 and S345, and a single amino acid residue insertion between residues 152 and 153 (VP1 numbering), wherein the numbering of each residue is based on the amino acid sequence of SEQ ID NO:l or the equivalent amino acid residue in SEQ ID NOs:2, 3, 4, 5, 6, 7 or 8.
  • the modification is Q148P, E152R, S157T, T162K, H272T, T326Q, D328E, V330T, T331K, V341I and S345T.
  • the single amino acid residue insertion between residues 152 and 153 is S (designated -153S).
  • the AAV capsid protein described above can further comprise, consist essentially of or consist of a modification of amino acid residues LI 88, S205, N223 ,A224, and H272 (VPl numbering), wherein the numbering of each residue is based on the amino acid sequence of SEQ ID NO: 1 or the equivalent amino acid residue in SEQ ID NOs:2, 3, 4, 5, 6, 7 or 8.
  • the modification is LI 881, S205A, N223S, A224S, and H272T.
  • the disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists essentially of, or consists of a modification at amino acid residues S262, A263, S264, T265, and A267 (VPl numbering), and a single amino acid residue insertion between residues S268 and N269, wherein the numbering of each residue is based on the amino acid sequence of AAV1 (SEQ ID NO:l) or the equivalent amino acid residue in AAV2 (SEQ ID NO:2), AAV3 (SEQ ID NO:3), AAV6 (SEQ ID NO:4), AAV7 (SEQ ID NO:5), AAV8 (SEQ ID NO:6), AAV9 (SEQ ID NO:7) or AAVrhlO (SEQ ID NO:8).
  • AAV capsid protein comprises, consists essentially of, or consists of a modification at amino acid residues S262, A263, S264, T265, and A267 (VPl number
  • the modification is at least one of S262N, A263G, S264T, T265S, and A267S.
  • the AAV capsid can further comprise, consist essentially of, or consist of a modification at amino acid residue H272.
  • the AAV capsid protein can further comprise, consist essentially of, or consist of a modification at amino acid residues Q148, E152, S157, T162, H272, T326, D328, V330, T331, V341 and S345, and a single amino acid residue insertion between residues E152 and P153.
  • the AAV capsid protein further comprises a modification at amino acid residues LI 88, S205, N223, A224, and H272.
  • the modification is at least one of LI 881, S205A, N223S, A224S and H272T.
  • the amino acid residue insertion between residues S268 and N269 is an insertion of a single T residue.
  • the amino acid residue insertion between residues El 52 and P 153 is an insertion of a single S residue.
  • the disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists of, or consists essentially of a modification resulting in the amino acid sequence: X'-X 2 -X 3 -X 4 (SEQ ID NO:35) at the amino acids corresponding to amino acid positions 262 to 265 (VPl numbering) of the native AAV1 capsid protein (SEQ ID NO: 1), wherein X 1 is any amino acid other than S; wherein
  • AAV capsid protein comprises, consists of, or consists essentially of a modification resulting in the amino acid sequence: X'-X 2 -X 3 -X 4 (SEQ ID NO:35) at the amino acids corresponding to amino acid positions 262 to 265 (VPl numbering) of the native AAV1 capsid protein (SEQ ID NO: 1), wherein X 1 is any amino acid other than S;
  • X 2 is any amino acid other than A; wherein X 3 is any amino acid other than S; and wherein X 4 is any amino acid other than T. 45.
  • the AAV capsid protein further comprises a modification at amino acid residue H272. In some embodiments, the modification is H272T. In some
  • the AAV capsid protein further comprises an amino acid residue insertion between amino acid residues S268 and N269.
  • the amino acid residue insertion is an insertion of a single T residue.
  • the disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists essentially of, or consists of a modification at amino acid residues S262, A263, S264, T265, A267, and H272, and a single amino acid residue insertion between residues S268 and N269, (VP1 numbering), wherein the numbering of each residue is based on the amino acid sequence of AAV1 (SEQ ID NO:2) or the equivalent amino acid residue in AAV1 (SEQ ID NO:l), AAV3 (SEQ ID NO:3), AAV6 (SEQ ID NO:4), AAV7 (SEQ ID NO:5), AAV8 (SEQ ID NO:6), AAV9 (SEQ ID NO:7) or AAVrhlO (SEQ ID NO:8).
  • AAV capsid protein comprises, consists essentially of, or consists of a modification at amino acid residues S262, A263, S264, T265, A267, and
  • the modification comprises at least one of S262N, A263G, S264T, T265S, A267G, and H272T.
  • the natural single amino acid residue insertion between residues S268 and N269 is an insertion of a single T residue.
  • the disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists essentially of, or consists of a modification at amino acid residues S262, Q263, S264, A266, S267, and H271, and an insertion of at least one amino acid residue between residues S261 and S262, (VP1 numbering), wherein the numbering of each residue is based on the amino acid sequence of AAV2 (SEQ ID NO:2) or the equivalent amino acid residue in AAV1 (SEQ ID NO:l), AAV3 (SEQ ID NO:3), AAV6 (SEQ ID NO:4), AAV7 (SEQ ID NO:5), AAV8 (SEQ ID NO:6), AAV9 (SEQ ID NO:7) or AAVrhlO (SEQ ID NO:8).
  • AAV capsid protein comprises, consists essentially of, or consists of a modification at amino acid residues S262, Q263, S264, A266, S267,
  • the modification comprises at least one of S262T, Q263S, S264G, A266S, S267T, and H271T.
  • the insertion between residues SS61 and S262 is an insertion of a single amino acid residue.
  • the insertion between residues S251 and S252 is an insertion more than one amino acid residue.
  • the insertion between residues S251 and S252 is an insertion of an N and a G residue.
  • the disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists essentially of, or consists of a modification at amino acid residues S262, Q263, S264, A266, A267, H271, and a single amino acid residue insertion between residues S261 and S262, wherein the numbering of each residue is based on the amino acid sequence of AAV3 (SEQ ID NO:3) or the equivalent amino acid residue in AAV1 (SEQ ID NO:l), AAV2 (SEQ ID NO:2), AAV6 (SEQ ID NO:4), AAV7 (SEQ ID NO:5), AAV8 (SEQ ID NO:6), AAV9 (SEQ ID N0:7) or AAVrhlO (SEQ ID NO:8).
  • AAV capsid protein comprises, consists essentially of, or consists of a modification at amino acid residues S262, Q263, S264, A266, A267, H271, and a single amino
  • the modification comprises at least one of S262T, Q263S, S264G, A266S, A267T, H271T.
  • the insertion between residues SS61 and S262 is an insertion of a single amino acid residue, or more than one amino acid residue.
  • the insertion between residues S251 and S252 is an insertion of an N and a G residue.
  • the disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists essentially of, or consists of a modification at amino acid residues S263, S269, A237 (VP1 numbering), wherein the numbering of each residue is based on the amino acid sequence of AAV9 (SEQ ID NO: 9) or the equivalent amino acid residue in AAV1 (SEQ ID NO: 1), AAV2 (SEQ ID NO:2), AAV3 (SEQ ID NO:3), AAV6 (SEQ ID NO:4), AAV7 (SEQ ID NO:5), AAV8 (SEQ ID NO:6), or AAVrhlO (SEQ ID NO:8).
  • the modification comprises at least one of S263G, S269T, and A273T.
  • the disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists essentially of, or consists of the sequence of any one of SEQ ID NO: 9 to SEQ ID NO: 34.
  • AAV adeno-associated virus
  • Nonlimiting examples of modifications to produce the capsid proteins of this disclosure in AAV serotypes 1, 2, 3, 6, 7, 8, and 9, respectively, are shown in Table 2, wherein the equivalent amino acid residues in the respective AAV serotypes are identified.
  • the capsid proteins of this disclosure can comprise, consist essentially of or consist of: the amino acid sequence of SEQ ID NO:9 (AAVIRX); the amino acid sequence of SEQ ID NO: 10 (AAV2RX); the amino acid sequence of SEQ ID NO:l 1 (AAV3RX); the amino acid sequence of SEQ ID NO: 12 (AAV6RX); the amino acid sequence of SEQ ID NO:13 (AAV7RX); the amino acid sequence of SEQ ID NO:14
  • AAV8RX amino acid sequence of SEQ ID NO: 15 (AAV9RX); the amino acid sequence of SEQ ID NO:16 (AAV1R6); the amino acid sequence of SEQ ID NO:17
  • AAV2R6 amino acid sequence of SEQ ID NO: 18 (AAV3R6); amino acid sequence of SEQ ID NO: 19 (AAV6R6); amino acid sequence of SEQ ID NO:20 (AAV7R6); the amino acid sequence of SEQ ID NO:21 (AAV8R6); the amino acid sequence of SEQ ID NO:22 (AAV9R6); the amino acid sequence of SEQ ID NO:23 (AAV1R7); the amino acid sequence of SEQ ID NO:24 (AAV2R7); the amino acid sequence of SEQ ID NO:25
  • a capsid protein of this disclosure has the amino acid sequence of SEQ ID NO: 9 (AAV1RX).
  • a capsid protein of this disclosure has the amino acid sequence of SEQ ID NO: 16 (AAV1R6).
  • a capsid protein of this disclosure has the amino acid sequence of SEQ ID NO:23 (AAV1R7).
  • the present disclosure provides AAV capsid proteins having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, inclusive of all ranges and subranges therebetween, sequence identity to the amino acid sequence of SEQ ID NO:9 (AAV1 RX); the amino acid sequence of SEQ ID NO: 10 (AAV2RX); the amino acid sequence of SEQ ID NO:l 1 (AAV3RX); the amino acid sequence of SEQ ID NO: 12 (AAV6RX); the amino acid sequence of SEQ ID NO: 13 (AAV7RX); the amino acid sequence of SEQ ID NO:14 (AAV8RX); and the amino acid sequence of SEQ ID NO:15 (AAV9RX).
  • the present disclosure provides AAV capsid proteins having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, inclusive of all ranges and subranges therebetween, sequence identity to the amino acid sequence of SEQ ID NO: 16 (AAV1R6); the amino acid sequence of SEQ ID NO: 17 (AAV2R6); the amino acid sequence of SEQ ID NO: 18 (AAV3R6); the amino acid sequence of SEQ ID NO: 19 (AAV6R6); the amino acid sequence of SEQ ID NO:20 (AAV7R6); the amino acid sequence of SEQ ID NO:21 (AAV8R6); the amino acid sequence of SEQ ID NO:22 (AAV9R6).
  • the present disclosure provides AAV capsid protein having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, inclusive of all ranges and subranges therebetween, sequence identity to the amino acid sequence of the amino acid sequence of SEQ ID NO:23 (AAV1R7); the amino acid sequence of SEQ ID NO:24
  • AAV2R7 amino acid sequence of SEQ ID NO:25 (AAV3R7); the amino acid sequence of SEQ ID NO:26 (AAV6R7); the amino acid sequence of SEQ ID NO:27 (AAV7R7); the amino acid sequence of SEQ ID NO:28 (AAV8R7); and the amino acid sequence of SEQ ID NO:29 (AAV9R7).
  • the present disclosure also provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises one or more substitution at all positions or in any combination of fewer than all positions, resulting in the amino acid sequence: X*-X 2 -X 3 -X 4 (SEQ ID NO: 35).
  • AAV adeno-associated virus
  • X 2 -X 3 -X 4" is at the amino acids corresponding to amino acid positions 262 to 265 (VP1 numbering) of the native AAV1 capsid protein (SEQ ID NO: 1).
  • X 1 can be any amino acid other than S.
  • X 2 can be any amino acid other than A.
  • X can be any amino acid other than S.
  • X 4 can be any amino acid other than T.
  • the amino acid X 1 is N.
  • the amino acid X 2' is G.
  • the amino acid X 3 is T.
  • the amino acid X 4 is S.
  • X 1 is N, X 2 is G, X 3 - is T, and X 4 is S.
  • one of X 1 through X 4 is not substituted, and the amino acid residue at the unsubstituted position is the wild type amino acid residue.
  • amino acid residues that can be substituted for the native amino acid at the respective positions described herein are set forth in Table 3.
  • substitutions and insertions described in the AAV capsid proteins of this disclosure can include substitutions and/or insertions with conservative amino acid residues.
  • conservative substitutions are well known in the art and include, e.g., nonpolar amino acids Gly, Ala, Val, Leu, He, Met, Phe, Trp and Pro can be substituted for one another; polar amino acids Ser, Thr, Cys, Tyr, Asn and Gin can be substituted for one another; negatively charged amino acids Asp and Glu can be substituted for one another; and positively charged amino acids Lys, Arg and His can be substituted for one another, in any combination.
  • the present disclosure also provides an AAV capsid comprising a capsid protein of this disclosure as well as a virus vector comprising an AAV capsid of this disclosure.
  • the virus vector can comprise, consist essentially of or consist of a virus vector comprising: an AAV capsid of this disclosure; and a nucleic acid molecule comprising at least one terminal repeat sequence, wherein the nucleic acid is encapsidated by the AAV capsid.
  • the terminal repeat is an AAV terminal repeat. In some embodiments, the terminal repeat is a non-AAV terminal repeat.
  • composition comprising the capsid protein and/or virus vector of this disclosure in a pharmaceutically acceptable carrier.
  • a method of introducing a nucleic acid molecule into a cell comprising contacting the cell with the virus vector of and/or composition of this disclosure, e.g., under conditions whereby the virus vector is taken into or internalized by the cell and a nucleic acid molecule introduced via the virus vector is expressed in the cell.
  • the virus vector and/or composition are administered to the central nervous system of the subject.
  • the virus vector and/or composition is delivered across the blood brain barrier.
  • the virus vector of this disclosure can comprise a nucleic acid molecule of interest.
  • the nucleic acid molecule of interest can encode a therapeutic protein or therapeutic RNA molecule.
  • the present disclosure also provides a method of selectively delivering a nucleic acid molecule of interest to a neuronal cell, comprising contacting the neuronal cell with the virus vector of this disclosure, wherein the virus vector comprises the nucleic acid molecule of interest.
  • the method can additionally comprise selectively delivering a nucleic acid molecule of interest to a cardiomyocyte, e.g., when the method is carried out in a subject (e.g., a human subject).
  • the composition is selectively delivered to a neuronal cell.
  • the composition is selectively delivered to a cardiomyocyte.
  • the present disclosure provides a method of treating a neurological disorder or defect in a subject, comprising administering to the subject the virus vector of this disclosure, wherein the virus vector comprises a nucleic acid molecule that encodes a therapeutic protein or therapeutic RNA effective in treating the neurological disorder or defect.
  • virus vector of this disclosure comprises a nucleic acid molecule that encodes a therapeutic protein or therapeutic RNA effective in treating the neurological and
  • the virus vector and/or composition of this disclosure can be administered/delivered to a subject of this disclosure via a systemic route (e.g., intravenously, intraarterially, intraperitoneally, etc.).
  • a systemic route e.g., intravenously, intraarterially, intraperitoneally, etc.
  • the virus vector and/or composition can be administered to the subject via an intracerebroventrical, intracisternal, intraparenchymal, intracranial and/or intrathecal route.
  • the systemic administration of the virus vector and/or composition to the subject results in lower transduction in off-target tissues (e.g., other than the central nervous system).
  • the virus vector is detargeted from the spleen, the liver, and/or the kidney. In some embodiments, the virus vector is detargeted from splenocytes, hepatocytes and/or kidney cells.
  • the virus vector transduces the liver, spleen, and/or kidney at a level that is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to transduction by AAVrh.lO, wherein viral transduction is optionally determined by luciferase or GFP expression.
  • the virus vector transduces the liver, spleen, and/or kidney at a level that reduced by at least 50%- 100%, or 80-90%) compared to transduction by AAVrh.10, wherein viral transduction is optionally determined by luciferase or GFP expression.
  • the virus vector transduces the brain at a level that is increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to transduction by AAVl, wherein viral transduction is optionally determined by luciferase or GFP expression.
  • the virus vector transduces brain at a level that is increased by at least 2-fold, 2.5-fold, 3-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, or 10-fold compared to transduction by AAVl, wherein viral transduction is optionally determined by luciferase or GFP expression.
  • the virus vector selectively transduces neurons.
  • modified capsid proteins of the disclosure can be produced by modifying the capsid protein of any AAV now known or later discovered.
  • the AAV capsid protein that is to be modified can be a naturally occurring AAV capsid protein (e.g., an AAV2, AAV3a or 3b, AAV6, AAV7, AAV8, AAV9, AAVrh.lO or any of the AAV serotypes shown in Table 1), but is not so limited.
  • AAV2, AAV3a or 3b e.g., an AAV2, AAV3a or 3b, AAV6, AAV7, AAV8, AAV9, AAVrh.lO or any of the AAV serotypes shown in Table 1
  • the capsid protein to be modified may already have modifications as compared with naturally occurring AAV (e.g.
  • AAV capsid protein is derived from a naturally occurring AAV capsid protein, e.g., AAV2, AAV3a, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1 and/or AAV12 or any other AAV now known or later discovered).
  • AAV capsid proteins are also within the scope of the present disclosure.
  • the AAV capsid protein to be modified can be derived from a naturally occurring AAV but can further comprise one or more foreign sequences (e.g., that are exogenous to the native virus) that are inserted and/or substituted into the capsid protein and/or have been altered by deletion of one or more amino acids.
  • AAV capsid protein e.g., an AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1 or AAVl 2 capsid protein or a capsid protein from any of the AAV serotypes shown in Table 1, etc.
  • AAV capsid protein e.g., an AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1 or AAVl 2 capsid protein or a capsid protein from any of the AAV serotypes shown in Table 1, etc.
  • Such alterations include substitutions, insertions and/or deletions.
  • the capsid protein can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, less than 20, less than 30, less than 40 less than 50, less than 60, or less than 70 amino acids inserted therein (other than the insertions of the present disclosure) as compared with the native AAV capsid protein sequence.
  • the capsid protein can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, less than 20, less than 30, less than 40 less than 50, less than 60, or less than 70 amino acid substitutions (other than the amino acid substitutions according to the present invention) as compared with the native AAV capsid protein sequence.
  • the capsid protein can comprise a deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, less than 20, less than 30, less than 40 less than 50, less than 60, or less than 70 amino acids (other than the amino acid deletions of the disclosure) as compared with the native AAV capsid protein sequence.
  • the AAV capsid protein has the native AAV capsid protein sequence or has an amino acid sequence that is at least about 90%, 95%, 97%, 98% or 99% similar or identical to a native AAV capsid protein sequence.
  • capsid protein encompasses the native AAVl , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1, AAV12 capsid protein sequence as well as sequences that are at least about 80%, 85%, 90%, 95%, 97%, 98% or 99% similar or identical to the native AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1, AAVl 2 capsid protein sequence.
  • Sequence similarity or identity may be determined using standard techniques known in the art, including, but not limited to, the local sequence identity algorithm of Smith and Waterman, Adv. Appl. Math. 2, 482 (1981), by the sequence identity alignment algorithm of Needleman and Wunsch J. Mol. Biol. 48,443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci.
  • WU-BLAST-2 uses several search parameters, which are optionally set to the default values.
  • modified virus capsids can be used as "capsid vehicles," as have been described, for example, in US Patent No. 5,863,541.
  • Molecules that can be packaged by the modified virus capsid and transferred into a cell include heterologous DNA, RNA, polypeptides, small organic molecules, metals, or combinations of the same.
  • Heterologous molecules are defined as those that are not naturally found in an AAV infection, e.g., those not encoded by a wild-type AAV genome.
  • therapeutically useful molecules can be associated with the outside of the chimeric virus capsid for transfer of the molecules into host target cells.
  • Such associated molecules can include DNA, RNA, small organic molecules, metals, carbohydrates, lipids and/or polypeptides.
  • the therapeutically useful molecule is covalently linked (i.e., conjugated or chemically coupled) to the capsid proteins. Methods of covalently linking molecules are known by those skilled in the art.
  • modified virus capsids of the disclosure also find use as templates for further modification of antigenicity to evade neutralizing antibodies in any mammalian serum, as described, e.g., in PCT Application Serial No. PCT/2016/054143.
  • modified virus capsids of the disclosure also find use in raising antibodies against the novel capsid structures.
  • an exogenous amino acid sequence may be inserted into the modified virus capsid for antigen presentation to a cell, e.g., for administration to a subject to produce an immune response to the exogenous amino acid sequence.
  • the virus capsids can be administered to block certain cellular sites prior to and/or concurrently with (e.g., within minutes or hours of each other) administration of a virus vector delivering a nucleic acid molecule encoding a polypeptide, peptide and/or functional RNA of interest.
  • a virus vector delivering a nucleic acid molecule encoding a polypeptide, peptide and/or functional RNA of interest.
  • inventive capsids can be delivered to block cellular receptors on particular cells and a delivery vector can be administered subsequently or concurrently, which may reduce transduction of the blocked cells, and enhance transduction of other targets.
  • modified virus capsids can be administered to a subject prior to and/or concurrently with a modified virus vector according to the present disclosure.
  • the disclosure provides compositions and pharmaceutical formulations comprising the inventive modified virus capsids; optionally, the composition also comprises a modified virus vector of the disclosure.
  • the disclosure also provides nucleic acid molecules (optionally, isolated nucleic acid molecules) encoding the modified virus capsids and capsid proteins of the disclosure.
  • vectors comprising the nucleic acid molecules and cells (in vivo or in culture) comprising the nucleic acid molecules and/or vectors of the disclosure.
  • Suitable vectors include without limitation viral vectors (e.g., adenovirus, AAV, herpesvirus, alphavirus, vaccinia, poxviruses, baculoviruses, and the like), plasmids, phage, YACs, BACs, and the like.
  • Such nucleic acid molecules, vectors and cells can be used, for example, as reagents (e.g. , helper packaging constructs or packaging cells) for the production of modified virus capsids or virus vectors as described herein.
  • Virus capsids according to the disclosure can be produced using any method known in the art, e.g., by expression from a baculovirus (Brown et al. (1994) Virology 198:477-488).
  • the modifications to the AAV capsid protein according to the present disclosure are "selective" modifications. This approach is in contrast to previous work with whole subunit or large domain swaps between AAV serotypes (see, e.g., international patent publication WO 00/28004; Hauck et al. (2003) J. Virology 77:2768-2774; Shen et al. (2007) Mol Ther. 15(11): 1955-62; and Mays et al. (2013) J Virol. 87(17):9473-85).
  • the AAV capsid proteins of this disclosure are, to the inventors' knowledge, the first examples of specific amino acid changes to enable crossing the blood brain barrier.
  • an AAV capsid protein contains specific amino acid changes that enable crossing the blood brain barrier.
  • the AAV capsid protein comprises substitutions of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 amino acids, wherein the substituted amino acids are derived from AAVrh.lO, wherein the amino acid substitutions enable crossing the blood brain barrier.
  • the AAV capsid protein is derived from an AAV1 capsid protein, and comprises substitutions of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 amino acids, wherein the substituted amino acids are derived from AAVrh.10, wherein the amino acid substitutions enable crossing the blood brain barrier.
  • the specific amino acids that enable crossing the blood brain barrier are 262N, 263G, 264T, 265S, 267G, 268S, 269T and 273T (VP1 numbering), wherein the numbering of each residue is based on the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 30.
  • an AAV capsid protein contains specific amino acid changes that enable detargeting from the liver, kidney, and/or spleen. In some embodiments, the
  • AAV capsid protein comprises substitutions of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 amino acids, wherein the substituted amino acids are derived from AAVrh.lO, wherein the amino acid substitutions enable detargeting from the liver, kidney, and/or spleen.
  • the AAV capsid protein is derived from an AAVl capsid protein, and comprises 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 amino acids, wherein the substituted amino acids are derived from AAVrh.10, wherein the amino acid substitutions enable detargeting from the liver, kidney, and/or spleen.
  • the substituted amino acids are located in the VR-I region of the capsid. In some embodiments, the substituted amino acids are located on the surface of the capsid. In some embodiments, the substituted amino acids are located at the base of the protrusions at a 3 -fold axis of symmetry of the capsid. In some embodiments, the substituted amino acids are located in the depression at a 2-fold axis of symmetry of the capsid. In some embodiments, the substituted amino acids are located within the VR-II region of the capsid protein, within the DE-loop. In some embodiments, the substituted amino acids are located within beta-strand E of the capsid.
  • a "selective" modification results in the insertion and/or substitution and/or deletion of less than about 20, 18, 15, 12, 10, 9, 8, 7, 6, 5, 4, 3 or 2 contiguous amino acids.
  • modified capsid proteins and capsids of the disclosure can further comprise any other modification, now known or later identified.
  • the AAV capsid proteins and virus capsids of the disclosure can be chimeric in that they can comprise all or a portion of a capsid subunit from another virus, optionally another parvovirus or other AAV serotype, e.g. , as described in international patent publication WO 00/28004.
  • the virus capsid can comprise a targeting sequence (e.g., substituted and/or inserted in the viral capsid) that directs the virus capsid to interact with cell-surface molecules present on a desired target tissue(s) (see, e.g., International patent publication WO 00/28004 and Hauck et al. (2003) J. Virology 77:2768-2774); Shi et al. Human Gene Therapy 17:353-361 (2006) [describing insertion of the integrin receptor binding motif RGD at positions 520 and/or 584 of the AAV capsid subunit]; US Patent No. 7,314,912 [describing insertion of the PI peptide containing an RGD motif following amino acid positions 447, 534, 573 and 587 of the AAV2 capsid subunit] and International Patent Publication No. WO 2015038958
  • virus capsids of the disclosure have relatively inefficient tropism toward most target tissues of interest (e.g., liver, skeletal muscle, heart, diaphragm muscle, kidney, brain, stomach, intestines, skin, endothelial cells, and/or lungs).
  • a targeting sequence can advantageously be incorporated into these low-transduction vectors to thereby confer to the virus capsid a desired tropism and, optionally, selective tropism for particular tissue(s).
  • AAV capsid proteins, capsids and vectors comprising targeting sequences are described, for example in international patent publication WO 00/28004.
  • one or more non-naturally occurring amino acids as described by Wang et al.
  • AAV capsid subunit can be incorporated into the AAV capsid subunit at an orthogonal site as a means of redirecting a low-transduction vector to a desired target tissue(s).
  • These unnatural amino acids can advantageously be used to chemically link molecules of interest to the AAV capsid protein including without limitation: glycans (mannose - dendritic cell targeting); RGD, bombesin or a neuropeptide for targeted delivery to specific cancer cell types; RNA aptamers or peptides selected from phage display targeted to specific cell surface receptors such as growth factor receptors, integrins, and the like.
  • Methods of chemically modifying amino acids are known in the art ⁇ see, e.g., Greg T. Hermanson, Bioconjugate Techniques, 1 st edition, Academic Press, 1996).
  • the targeting sequence may be a virus capsid sequence
  • an autonomous parvovirus capsid sequence ⁇ e.g., an autonomous parvovirus capsid sequence, AAV capsid sequence, or any other viral capsid sequence
  • AAV capsid sequence ⁇ e.g., an autonomous parvovirus capsid sequence, AAV capsid sequence, or any other viral capsid sequence
  • a heparin binding domain (e.g., the respiratory syncytial virus heparin binding domain) may be inserted or substituted into a capsid subunit that does not typically bind heparan sulfate (HS) receptors (e.g., AAV 4, AAV5) to confer heparin binding to the resulting mutant.
  • HS heparan sulfate
  • amino acid footprints that can enable binding to glycans such as galactose, sialic acid, mannose, lactose, sulfo-N-lactosamine, galactosamine, glucose, glucosamine, fructose, fucose, gangliosides, chitotriose, chondroitin sulfate, keratin sulfate, dermatan sulfate may be grafted onto a capsid subunit that does not typically bind one or more of the sugars listed above [e.g., US Patent Publication No. US20160017005, entitled Methods and compositions for dual glycan binding AA V vectors].
  • B19 infects primary erythroid progenitor cells using globoside as its receptor (Brown et al. (1993) Science 262 : 114).
  • the structure of B 19 has been determined to 8 A resolution (Agbandje-McKenna et al. (1994) Virology 203:106).
  • the region of the B19 capsid that binds to globoside has been mapped between amino acids 399-406 (Chapman et al. (1993) Virology 194:419), a looped out region between ⁇ -barrel structures E and F (Chipman et al. (1996) Proc. Nat. Acad. Sci. USA 93:7502).
  • the globoside receptor binding domain of the B 19 capsid may be substituted into the AAV capsid protein to target a virus capsid or virus vector comprising the same to erythroid cells.
  • the exogenous targeting sequence may be any amino acid sequence encoding a peptide that alters the tropism of a virus capsid or virus vector comprising the modified AAV capsid protein.
  • the targeting peptide or protein may be naturally occurring or, alternately, completely or partially synthetic.
  • Exemplary targeting sequences include ligands and other peptides that bind to cell surface receptors and glycoproteins, such as RGD peptide sequences, bradykinin, hormones, peptide growth factors (e.g., epidermal growth factor, nerve growth factor, fibroblast growth factor, platelet-derived growth factor, insulin-like growth factors I and II, etc.), cytokines, melanocyte stimulating hormone (e.g., ⁇ , ⁇ or ⁇ ), neuropeptides and endorphins, and the like, and fragments thereof that retain the ability to target cells to their cognate receptors.
  • Other illustrative peptides and proteins include substance P, keratinocyte growth factor,
  • neuropeptide Y gastrin releasing peptide
  • interleukin 2 hen egg white lysozyme
  • the binding domain from a toxin can be substituted into the capsid protein as a targeting sequence.
  • the AAV capsid protein can be modified by substitution of a "nonclassical" import/export signal peptide (e.g., fibroblast growth factor-1 and -2, interleukin 1, HIV-1 Tat protein, herpes virus VP22 protein, and the like) as described by Cleves (Current Biology 7:R318 (1997)) into the AAV capsid protein.
  • a "nonclassical" import/export signal peptide e.g., fibroblast growth factor-1 and -2, interleukin 1, HIV-1 Tat protein, herpes virus VP22 protein, and the like
  • Cleves Current Biology 7:R318 (1997)
  • peptide motifs that direct uptake by specific cells, e.g., a FVFLP peptide motif triggers uptake by liver cells.
  • Phage display techniques as well as other techniques known in the art, may be used to identify peptides that recognize any cell type of interest.
  • the targeting sequence may encode any peptide that targets to a cell surface binding site, including receptors (e.g., protein, carbohydrate, glycoprotein or proteoglycan).
  • receptors e.g., protein, carbohydrate, glycoprotein or proteoglycan.
  • cell surface binding sites include, but are not limited to, heparan sulfate, chondroitin sulfate, and other glycosaminoglycans, sialic acid moieties, polysialic acid moieties, glycoproteins, and gangliosides, MHC I glycoproteins, carbohydrate components found on membrane glycoproteins, including, mannose, N-acetyl-galactosamine, N-acetyl- glucosamine, fucose, galactose, and the like.
  • the targeting sequence may be a peptide that can be used for chemical coupling (e.g., can comprise arginine and/or lysine residues that can be chemically coupled through their R groups) to another molecule that targets entry into a cell.
  • a peptide that can be used for chemical coupling e.g., can comprise arginine and/or lysine residues that can be chemically coupled through their R groups
  • the disclosure also encompasses virus vectors comprising the modified capsid proteins and capsids of the disclosure.
  • the virus vector is a parvovirus vector (e.g., comprising a parvovirus capsid and/or vector genome), for example, an AAV vector (e.g., comprising an AAV capsid and/or vector genome).
  • the virus vector comprises a modified AAV capsid comprising a modified capsid subunit of the disclosure and a vector genome.
  • the virus vector comprises: (a) a modified virus capsid (e.g., a modified AAV capsid) comprising a modified capsid protein of the disclosure; and (b) a nucleic acid comprising a terminal repeat sequence (e.g., an AAV TR), wherein the nucleic acid comprising the terminal repeat sequence is encapsidated by the modified virus capsid.
  • the nucleic acid can optionally comprise two terminal repeats (e.g., two AAV TRs).
  • the virus vector is a recombinant virus vector comprising a heterologous nucleic acid molecule encoding a protein or functional RNA of interest. Recombinant virus vectors are described in more detail below.
  • modified capsid proteins, virus capsids and virus vectors of the disclosure exclude those capsid proteins, capsids and virus vectors that have the indicated amino acids at the specified positions in their native state (i.e., are not mutants).
  • the present disclosure further provides methods of producing the inventive virus vectors.
  • the present disclosure provides a method of producing a virus vector, the method comprising providing to a cell: (a) a nucleic acid template comprising at least one TR sequence (e.g. , AAV TR sequence), and (b) AAV sequences sufficient for replication of the nucleic acid template and encapsidation into AAV capsids (e.g., AAV rep sequences and AAV cap sequences encoding the AAV capsids of the disclosure).
  • the nucleic acid template further comprises at least one heterologous nucleic acid sequence.
  • the nucleic acid template comprises two AAV ITR sequences, which are located 5' and 3' to the heterologous nucleic acid sequence (if present), although they need not be directly contiguous thereto.
  • the nucleic acid template and AAV rep and cap sequences are provided under conditions such that virus vector comprising the nucleic acid template packaged within the AAV capsid is produced in the cell.
  • the method can further comprise the step of collecting the virus vector from the cell.
  • the virus vector can be collected from the medium and/or by lysing the cells.
  • the cell can be a cell that is permissive for AAV viral replication. Any suitable cell known in the art may be employed. In particular embodiments, the cell is a mammalian cell. As another option, the cell can be a trans-complementing packaging cell line that provides functions deleted from a replication-defective helper virus, e.g., 293 cells or other El a trans- complementing cells.
  • a replication-defective helper virus e.g., 293 cells or other El a trans- complementing cells.
  • the AAV replication and capsid sequences may be provided by any method known in the art. Current protocols typically express the AAV rep/cap genes on a single plasmid. The AAV replication and packaging sequences need not be provided together, although it may be convenient to do so.
  • the AAV rep and/or cap sequences may be provided by any viral or non-viral vector.
  • the rep/cap sequences may be provided by a hybrid adenovirus or herpesvirus vector (e.g., inserted into the El a or E3 regions of a deleted adenovirus vector). EBV vectors may also be employed to express the AAV cap and rep genes.
  • EBV vectors are episomal, yet will maintain a high copy number throughout successive cell divisions (i.e., are stably integrated into the cell as extra-chromosomal elements, designated as an "EBV based nuclear episome," see Margolski (1992) Curr. Top. Microbiol. Immun. 158:67).
  • the rep leap sequences may be stably incorporated into a cell.
  • the AAV rep/cap sequences will not be flanked by the TRs, to prevent rescue and/or packaging of these sequences.
  • the nucleic acid template can be provided to the cell using any method known in the art.
  • the template can be supplied by a non- viral (e.g., plasmid) or viral vector.
  • the nucleic acid template is supplied by a herpesvirus or adenovirus vector (e.g., inserted into the El a or E3 regions of a deleted adenovirus).
  • a herpesvirus or adenovirus vector e.g., inserted into the El a or E3 regions of a deleted adenovirus.
  • Palombo et al. (1998) J. Virology 72:5025, describes a baculovirus vector carrying a reporter gene flanked by the AAV TRs.
  • EBV vectors may also be employed to deliver the template, as described above with respect to the rep/cap genes.
  • the nucleic acid template is provided by a replicating rAAV virus.
  • an AAV provirus comprising the nucleic acid template is stably integrated into the chromosome of the cell.
  • helper virus functions e.g., adenovirus or herpesvirus
  • helper virus sequences necessary for AAV replication are known in the art. Typically, these sequences will be provided by a helper adenovirus or herpesvirus vector.
  • the adenovirus or herpesvirus sequences can be provided by another non- viral or viral vector, e.g., as a noninfectious adenovirus miniplasmid that carries all of the helper genes that promote efficient AAV production as described by Ferrari et al., (1997) Nature Med. 3:1295, and U.S. Patent Nos. 6,040,183 and 6,093,570.
  • helper virus functions may be provided by a packaging cell with the helper sequences embedded in the chromosome or maintained as a stable extrachromosomal element.
  • the helper virus sequences cannot be packaged into AAV virions, e.g., are not flanked by TRs.
  • helper construct may be a non-viral or viral construct.
  • helper construct can be a hybrid adenovirus or hybrid herpesvirus comprising the AAV rep/cap genes.
  • the AAV rep/cap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector.
  • This vector further can further comprise the nucleic acid template.
  • the AAV rep/cap sequences and/or the rAAV template can be inserted into a deleted region (e.g., the Ela or E3 regions) of the adenovirus.
  • the AAV rep/cap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector.
  • the rAAV template can be provided as a plasmid template.
  • the AAV rep/cap sequences and adenovirus helper sequences are provided by a single adenovirus helper vector, and the rAAV template is integrated into the cell as a pro virus.
  • the rAAV template is provided by an EBV vector that is maintained within the cell as an extrachromosomal element (e.g., as an EBV based nuclear episome).
  • the AAV rep/cap sequences and adenovirus helper sequences are provided by a single adenovirus helper.
  • the rAAV template can be provided as a separate replicating viral vector.
  • the rAAV template can be provided by a rAAV particle or a second recombinant adenovirus particle.
  • the hybrid adenovirus vector typically comprises the adenovirus 5' and 3' cis sequences sufficient for adenovirus replication and packaging (i.e., the adenovirus terminal repeats and PAC sequence).
  • the AAV rep I cap sequences and, if present, the rAAV template are embedded in the adenovirus backbone and are flanked by the 5' and 3' cis sequences, so that these sequences may be packaged into adenovirus capsids.
  • the adenovirus helper sequences and the AAV rep/cap sequences are generally not flanked by TRs so that these sequences are not packaged into the AAV virions.
  • Zhang et al. ((2001) Gene Ther. 18:704-12) describes a chimeric helper comprising both adenovirus and the AAV rep and cap genes.
  • Herpesvirus may also be used as a helper virus in AAV packaging methods.
  • Hybrid herpesviruses encoding the AAV Rep protein(s) may advantageously facilitate scalable AAV vector production schemes.
  • a hybrid herpes simplex virus type I (HSV-1) vector expressing the AAV-2 rep and cap genes has been described (Conway et al. (1999) Gene Therapy 6:986 and WO 00/17377.
  • virus vectors of the disclosure can be produced in insect cells using baculovirus vectors to deliver the rep I cap genes and rAAV template as described, for example, by Urabe et al. (2002) Human Gene Therapy 13:1935-43.
  • AAV vector stocks free of contaminating helper virus may be obtained by any method known in the art.
  • AAV and helper virus may be readily differentiated based on size.
  • AAV may also be separated away from helper virus based on affinity chromatography [e.g., for a heparin substrate (Zolotukhin et al. (1999) Gene Therapy 6:973) or using affinity resin (Wang et al., (2015), Mol Ther Methods Clin Dev 2:15040) or for e.g., other methods (reviewed in Qu et al. (2015) Curr Pharm Biotechnol. 16(8):684-95)].
  • Deleted replication- defective helper viruses can be used so that any contaminating helper virus is not replication competent.
  • an adenovirus helper lacking late gene expression may be employed, as only adenovirus early gene expression is required to mediate packaging of AAV virus.
  • Adenovirus mutants defective for late gene expression are known in the art (e.g., tslOOK and tsl49 adenovirus mutants).
  • virus vectors of the present disclosure are useful for the delivery of nucleic acids to cells in vitro, ex vivo, and in vivo.
  • the virus vectors can be advantageously employed to deliver or transfer nucleic acids to animal, including mammalian, cells.
  • Nucleic acids of interest include nucleic acids encoding polypeptides, including therapeutic (e.g., for medical or veterinary uses) or immunogenic (e.g., for vaccines) proteins and/or functional or therapeutic RNA molecules.
  • Therapeutic polypeptides include, but are not limited to, cystic fibrosis
  • CTR transmembrane regulator protein
  • dystrophin including mini- and micro-dystrophins, see, e.g., Vincent et al. (1993) Nature Genetics 5:130; U.S. Patent Publication No.
  • mini-utrophin mini-utrophin
  • clotting factors e.g., Factor VIII, Factor IX, Factor X, etc.
  • erythropoietin angiostatin, endostatin, catalase, tyrosine hydroxylase, superoxide dismutase, leptin, the LDL receptor, lipoprotein lipase, ornithine transcarbamylase, ⁇ -globin, -globin, spectrin, ai-antitrypsin, adenosine deaminase, hypoxanthine guanine phosphoribosyl transferase, ⁇ -glucocerebrosidase, sphingomyelinase, lysosomal hexosaminidase A, branched-chain keto acid dehydrogenase, RP65 protein, cytokines (e.g., -interferon, ⁇ - interferon,
  • a molecule that effects G- protein coupled receptor kinase type 2 knockdown such as a truncated constitutively active bARJ ct, anti-inflammatory factors such as IRAP, anti-myostatin proteins, aspartoacylase, monoclonal antibodies (including single chain monoclonal antibodies; an exemplary Mab is the Herceptin ® Mab), neuropeptides and fragments thereof (e.g., galanin, Neuropeptide Y (see, U.S.
  • angio genesis inhibitors such as Vasohibins and other VEGF inhibitors (e.g., Vasohibin 2 [see, WO JP2006/073052]).
  • Other illustrative heterologous nucleic acid sequences encode suicide gene products (e.g., thymidine kinase, cytosine deaminase, diphtheria toxin, and tumor necrosis factor), proteins conferring resistance to a drug used in cancer therapy, tumor suppressor gene products (e.g., p53, Rb, Wt-1), TRAIL, FAS-ligand, and any other polypeptide that has a therapeutic effect in a subject in need thereof.
  • AAV vectors can also be used to deliver monoclonal antibodies and antibody fragments, for example, an antibody or antibody fragment directed against myostatin (see, e.g., Fang et al. Nature Biotechnology 23:584-590 (2005)).
  • Heterologous nucleic acid sequences encoding polypeptides include those encoding reporter polypeptides (e.g., an enzyme). Reporter polypeptides are known in the art and include, but are not limited to, green fluorescent protein (GFP), ⁇ -galactosidase, alkaline phosphatase, luciferase, and chloramphenicol acetyltransferase gene.
  • GFP green fluorescent protein
  • ⁇ -galactosidase alkaline phosphatase
  • luciferase luciferase
  • chloramphenicol acetyltransferase gene chloramphenicol acetyltransferase gene.
  • the heterologous nucleic acid molecule can encode a secreted polypeptide (e.g., a polypeptide that is a secreted polypeptide in its native state or that has been engineered to be secreted, for example, by operable association with a secretory signal sequence as is known in the art).
  • a secreted polypeptide e.g., a polypeptide that is a secreted polypeptide in its native state or that has been engineered to be secreted, for example, by operable association with a secretory signal sequence as is known in the art.
  • the heterologous nucleic acid may encode an antisense nucleic acid, a ribozyme (e.g., as described in U.S. Patent No. 5,877,022), RNAs that effect spliceosome-mediated trans-splicing (see, Puttaraju et al. (1999) Nature Biotech. 17:246; U.S. Patent No. 6,013,487; U.S. Patent No. 6,083,702), interfering RNAs (RNAi) including siRNA, shRNA or miRNA that mediate gene silencing (see, Sharp et al.
  • RNAi interfering RNAs
  • RNAs such as "guide" RNAs (Gorman et al. (1998) Proc. Nat. Acad. Sci. USA 95:4929; U.S. Patent No. 5,869,248 to Yuan et al), and the like.
  • RNAi against a multiple drug resistance (MDR) gene product e.g., to treat and/or prevent tumors and/or for administration to the heart to prevent damage by chemotherapy
  • MDR multiple drug resistance
  • myostatin e.g., for Duchenne muscular dystrophy
  • VEGF e.g., to treat and/or prevent tumors
  • RNAi against phospholamban e.g., to treat cardiovascular disease, see, e.g., Andino et al. J. Gene Med. 10:132-142 (2008) and Li et al. Acta Pharmacol Sin.
  • phospholamban inhibitory or dominant-negative molecules such as phospholamban S16E (e.g., to treat cardiovascular disease, see, e.g., Hoshijima et al. Nat. Med. 8:864-871 (2002)), RNAi to adenosine kinase (e.g., for epilepsy), and RNAi directed against pathogenic organisms and viruses (e.g., hepatitis B and/or C virus, human immunodeficiency virus, CMV, herpes simplex virus, human papilloma virus, etc.).
  • pathogenic organisms and viruses e.g., hepatitis B and/or C virus, human immunodeficiency virus, CMV, herpes simplex virus, human papilloma virus, etc.
  • a nucleic acid sequence that directs alternative splicing can be delivered.
  • an antisense sequence (or other inhibitory sequence) complementary to the 5' and/or 3' splice site of dystrophin exon 51 can be delivered in conjunction with a Ul or U7 small nuclear (sn) RNA promoter to induce skipping of this exon.
  • a DNA sequence comprising a Ul or U7 snRNA promoter located 5' to the antisense/inhibitory sequence(s) can be packaged and delivered in a modified capsid of the disclosure.
  • the virus vector may also comprise a heterologous nucleic acid molecule that shares homology with and recombines with a locus on a host chromosome. This approach can be utilized, for example, to correct a genetic defect in the host cell.
  • the present disclosure also provides virus vectors that express an immunogenic polypeptide, e.g., for vaccination.
  • the nucleic acid molecule may encode any immunogen of interest known in the art including, but not limited to, immunogens from human
  • HIV immunodeficiency virus
  • SIV simian immunodeficiency virus
  • influenza virus HIV or SIV gag proteins, tumor antigens, cancer antigens, bacterial antigens, viral antigens, and the like.
  • an immunogenic polypeptide can be any polypeptide suitable for eliciting an immune response and/or protecting the subject against an infection and/or disease, including, but not limited to, microbial, bacterial, protozoal, parasitic, fungal and/or viral infections and diseases.
  • the immunogenic polypeptide can be an orthomyxovirus immunogen (e.g., an influenza virus immunogen, such as the influenza virus hemagglutinin (HA) surface protein or the influenza virus nucleoprotein, or an equine influenza virus immunogen) or a lentivirus immunogen (e.g., an equine infectious anemia virus immunogen, a Simian
  • an influenza virus immunogen such as the influenza virus hemagglutinin (HA) surface protein or the influenza virus nucleoprotein, or an equine influenza virus immunogen
  • a lentivirus immunogen e.g., an equine infectious anemia virus immunogen, a Simian
  • Immunodeficiency Virus (SIV) immunogen, or a Human Immunodeficiency Virus (HIV) immunogen, such as the HIV or SIV envelope GP160 protein, the HIV or SIV matrix/capsid proteins, and the HIV or SIV gag,pol and env genes products).
  • SIV Immunodeficiency Virus
  • HAV Human Immunodeficiency Virus
  • the immunogenic polypeptide can also be an arenavirus immunogen (e.g., Lassa fever virus immunogen, such as the Lassa fever virus nucleocapsid protein and the Lassa fever envelope glycoprotein), a poxvirus immunogen (e.g., a vaccinia virus immunogen, such as the vaccinia LI or L8 gene products), a flavivirus immunogen (e.g., a yellow fever virus immunogen or a Japanese encephalitis virus immunogen), a filovirus immunogen (e.g., an Ebola virus immunogen, or a Marburg virus immunogen, such as NP and GP gene products), a bunyavirus immunogen (e.g., RVFV, CCHF, and/or SFS virus immunogens), or a coronavirus immunogen (e.g., an infectious human coronavirus immunogen, such as the human coronavirus envelope glycoprotein, or a porcine transmissible gastroenteritis virus immunogen, or an avian infectious
  • the immunogenic polypeptide can further be a polio immunogen, a herpes immunogen (e.g., CMV, EBV, HSV immunogens) a mumps immunogen, a measles immunogen, a rubella immunogen, a diphtheria toxin or other diphtheria immunogen, a pertussis antigen, a hepatitis (e.g., hepatitis A, hepatitis B, hepatitis C, etc.) immunogen, and/or any other vaccine immunogen now known in the art or later identified as an immunogen.
  • a herpes immunogen e.g., CMV, EBV, HSV immunogens
  • a mumps immunogen e.g., a mumps immunogen
  • measles immunogen e.g., a measles immunogen
  • a rubella immunogen e.g., a diphtheria toxin or other diphtheria immuno
  • the immunogenic polypeptide can be any tumor or cancer cell antigen.
  • the tumor or cancer antigen is expressed on the surface of the cancer cell.
  • cancer and tumor cell antigens are described in S.A. Rosenberg (Immunity 10:281 (1991)).
  • Other illustrative cancer and tumor antigens include, but are not limited to: BRCAl gene product, BRCA2 gene product, gplOO, tyrosinase, GAGE- 1/2, BAGE, RAGE, LAGE, NY-ESO-1, CDK-4, ⁇ -catenin, MUM-1, Caspase-8, KIAA0205, HPVE, SART-1, PRAME, pl5, melanoma tumor antigens (Kawakami et al. (1994) Proc. Natl. Acad. Sci. USA 91 :3515; Kawakami et al, (1994) J. Exp. Med., 180:347; Kawakami et al. (1994) Cancer Res.
  • telomerases telomerases
  • nuclear matrix proteins prostatic acid phosphatase
  • papilloma virus antigens and/or antigens now known or later discovered to be associated with the following cancers: melanoma, adenocarcinoma, thymoma, lymphoma (e.g., non-Hodgkin's lymphoma,
  • Hodgkin's lymphoma Hodgkin's lymphoma
  • sarcoma lung cancer, liver cancer, colon cancer, leukemia, uterine cancer, breast cancer, prostate cancer, ovarian cancer, cervical cancer, bladder cancer, kidney cancer, pancreatic cancer, brain cancer and any other cancer or malignant condition now known or later identified (see, e.g., Rosenberg (1996) Ann. Rev. Med. 47:481-91).
  • heterologous nucleic acid can encode any polypeptide that is desirably produced in a cell in vitro, ex vivo, or in vivo.
  • virus vectors may be introduced into cultured cells and the expressed gene product isolated therefrom.
  • the heterologous nucleic acid can encode (a) a site- directed modifying polypeptide based on zinc finger nucleases or meganucl eases or endonucleases or TALENs or CRISPR/Cas system based nucleases that contain an RNA- binding portion that interacts with a DNA-targeting RNA molecule (gRNA), or an mRNA encoding such polypeptide; (b) one or more guide RNA molecules (gRNAs) comprising a nucleotide sequence that is complementary to a sequence in a target DNA, and a second segment that interacts with a site-directed modifying polypeptide; and/or (c) one or more DNA donor template molecules comprising a single or double stranded DNA sequence designed for homologous recombination into the target site of a mammalian genome.
  • gRNA DNA-targeting RNA molecule
  • virus vectors may be introduced into stem cells and/or T lymphocytes ex vivo, cultured cells, tissues and/or whole organisms in vivo and the expressed gene product enables editing, disruption, transcriptional activation and/or repression of target genes in the host.
  • heterologous nucleic acid molecule(s) of interest can be operably associated with appropriate control sequences.
  • the heterologous nucleic acid molecule can be operably associated with expression control elements, such as transcription/translation control signals, origins of replication, polyadenylation signals, internal ribosome entry sites (IRES), promoters, and/or enhancers, and the like.
  • expression control elements such as transcription/translation control signals, origins of replication, polyadenylation signals, internal ribosome entry sites (IRES), promoters, and/or enhancers, and the like.
  • heterologous nucleic acid molecule(s) of interest can be achieved at the post-transcriptional level, e.g., by regulating selective splicing of different introns by the presence or absence of an oligonucleotide, small molecule and/or other compound that selectively blocks splicing activity at specific sites (e.g., as described in WO 2006/119137).
  • promoter/enhancer elements can be used depending on the level and tissue-specific expression desired.
  • promoter/enhancer can be constitutive or inducible, depending on the pattern of expression desired.
  • the promoter/enhancer can be native or foreign and can be a natural or a synthetic sequence. By foreign, it is intended that the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced.
  • the promoter/enhancer elements can be native to the target cell or subject to be treated.
  • the promo ters/enhancer element can be native to the heterologous nucleic acid sequence.
  • the promo ter/enhancer element is generally chosen so that it functions in the target cell(s) of interest.
  • the promoter/enhancer element can be a mammalian promoter/enhancer element.
  • the promoter/enhancer element can be constitutive or inducible.
  • Inducible expression control elements are typically advantageous in those applications in which it is desirable to provide regulation over expression of the heterologous nucleic acid sequence(s).
  • Inducible promoters/enhancer elements for gene delivery can be tissue-specific or -preferred promoter/enhancer elements, and include muscle specific or preferred
  • inducible promoter/enhancer elements include hormone-inducible and metal-inducible elements.
  • exemplary inducible promoters/enhancer elements include, but are not limited to, a Tet on/off element, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, and a metallothionein promoter.
  • heterologous nucleic acid sequence(s) is transcribed and then translated in the target cells
  • specific initiation signals are generally included for efficient translation of inserted protein coding sequences.
  • exogenous translational control sequences which may include the ATG initiation codon and adjacent sequences, can be of a variety of origins, both natural and synthetic.
  • the virus vectors according to the present disclosure provide a means for delivering heterologous nucleic acids into a broad range of cells, including dividing and non-dividing cells.
  • the virus vectors can be employed to deliver a nucleic acid of interest to a cell in vitro, e.g., to produce a polypeptide in vitro or for ex vivo gene therapy.
  • the virus vectors are additionally useful in a method of delivering a nucleic acid to a subject in need thereof, e.g., to express an immunogenic or therapeutic polypeptide or a functional RNA.
  • the polypeptide or functional RNA can be produced in vivo in the subject.
  • the subject can be in need of the polypeptide because the subject has a deficiency of the polypeptide.
  • the method can be practiced because the production of the polypeptide or functional RNA in the subject may impart some beneficial effect.
  • the virus vectors can also be used to produce a polypeptide of interest or functional RNA in cultured cells or in a subject (e.g., using the subject as a bioreactor to produce the polypeptide or to observe the effects of the functional RNA on the subject, for example, in connection with screening methods).
  • virus vectors of the present disclosure can be employed to deliver a heterologous nucleic acid encoding a polypeptide or functional RNA to treat and/or prevent any disease state for which it is beneficial to deliver a therapeutic polypeptide or functional RNA.
  • disease states include, but are not limited to: cystic fibrosis (cystic fibrosis transmembrane regulator protein) and other diseases of the lung, hemophilia A (Factor VIII), hemophilia B (Factor IX), thalassemia ( ⁇ -globin), anemia (erythropoietin) and other blood disorders, Alzheimer's disease (GDF; neprilysin), multiple sclerosis ( ⁇ -interferon),
  • Parkinson's disease glial-cell line derived neurotrophic factor [GDNF]
  • Huntington's disease RNAi to remove repeats
  • amyotrophic lateral sclerosis epilepsy
  • epilepsy galanin, neurotrophic factors
  • cancer endostatin, angiostatin, TRAIL, FAS-ligand, cytokines including interferons
  • RNAi including RNAi against VEGF or the multiple drug resistance gene product, mir-26a [e.g., for hepatocellular carcinoma]
  • diabetes mellitus insulin
  • muscular dystrophies including Duchenne (dystrophin, mini- dystrophin, insulin-like growth factor I, a sarcoglycan [e.g., ⁇ , ⁇ , ⁇ ], RNAi against myostatin, myostatin propeptide, follistatin, activin type II soluble receptor, anti-inflammatory polypeptides such as the Ikappa B dominant mutant, sarcospan, utroph
  • GDNF astrocytomas [endostatin, angiostatin and/or RNAi against VEGF], glioblastomas [endostatin, angiostatin and/or RNAi against VEGF]), liver, kidney, heart including congestive heart failure or peripheral artery disease (PAD) (e.g., by delivering protein phosphatase inhibitor I (1-1) and fragments thereof ⁇ e.g., I1C), serca2a, zinc finger proteins that regulate the phospholamban gene, Barkct, p2-adrenergic receptor, 2-adrenergic receptor kinase (BARK), phosphoinositide-3 kinase (PI3 kinase), S100A1, parvalbumin, adenylyl cyclase type 6, a molecule that effects G-protein coupled receptor kinase type 2 knockdown such as a truncated constitutively active bARKct; calsarcin, RNAi against phospho
  • the disclosure can further be used following organ transplantation to increase the success of the transplant and/or to reduce the negative side effects of organ transplantation or adjunct therapies ⁇ e.g., by administering immunosuppressant agents or inhibitory nucleic acids to block cytokine production).
  • organ transplantation or adjunct therapies ⁇ e.g., by administering immunosuppressant agents or inhibitory nucleic acids to block cytokine production.
  • bone morphogenic proteins including BMP 2, 7, etc., RANKL and/or VEGF
  • the disclosure can also be used to produce induced pluripotent stem cells (iPS).
  • a virus vector of the disclosure can be used to deliver stem cell associated nucleic acid(s) into a non-pluripotent cell, such as adult fibroblasts, skin cells, liver cells, renal cells, adipose cells, cardiac cells, neural cells, epithelial cells, endothelial cells, and the like.
  • Nucleic acids encoding factors associated with stem cells are known in the art.
  • Nonlimiting examples of such factors associated with stem cells and pluripotency include Oct-3/4, the SOX family (e.g., SOXl, SOX2, SOX3 and/or SOXl 5), the Klf family (e.g., Klfl, Klf2, Klf4 and/or Klf5), the Myc family (e.g., C-myc, L-myc and/or N-myc), NANOG and/or LIN28.
  • SOX family e.g., SOXl, SOX2, SOX3 and/or SOXl 5
  • the Klf family e.g., Klfl, Klf2, Klf4 and/or Klf5
  • the Myc family e.g., C-myc, L-myc and/or N-myc
  • NANOG e.g., NANOG and/or LIN28.
  • the disclosure can also be practiced to treat and/or prevent epilepsy, stroke, traumatic brain injury, cognitive disorders, behavioral disorders, psychiatric disorders, Huntington's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), as well as any other neurodegenerative condition that might benefit from or require axonal/neuronal regeneration or repair.
  • epilepsy stroke, traumatic brain injury, cognitive disorders, behavioral disorders, psychiatric disorders, Huntington's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), as well as any other neurodegenerative condition that might benefit from or require axonal/neuronal regeneration or repair.
  • the present disclosure can be practiced to promote axonal regeneration and neuronal repair, restore circuits and/or replenish lost neurons as a corrective therapy, e.g., by targeted regulation or overexpression of stem cell differentiation and reprogramming factors such as FoxJl, Fox2, NeuroD2, NG2 or 01ig2 and/or microRNAs such as miR-137, MiR124, as well as any other factors or miRNAs implicated in neuronal development and differentiation.
  • stem cell differentiation and reprogramming factors such as FoxJl, Fox2, NeuroD2, NG2 or 01ig2
  • microRNAs such as miR-137, MiR124, as well as any other factors or miRNAs implicated in neuronal development and differentiation.
  • deficiency states usually of enzymes, which are generally inherited in a recessive manner, and unbalanced states, which may involve regulatory or structural proteins, and which are typically inherited in a dominant manner.
  • gene transfer can be used to bring a normal gene into affected tissues for replacement therapy, as well as to create animal models for the disease using antisense mutations.
  • gene transfer can be used to create a disease state in a model system, which can then be used in efforts to counteract the disease state.
  • virus vectors according to the present disclosure permit the treatment and/or prevention of genetic diseases.
  • the virus vectors according to the present disclosure may also be employed to provide a functional RNA to a cell in vitro or in vivo.
  • Expression of the functional R A in the cell for example, can diminish expression of a particular target protein by the cell.
  • RNA can be administered to decrease expression of a particular protein in a subject in need thereof.
  • Functional RNA can also be administered to cells in vitro to regulate gene expression and/or cell physiology, e.g., to optimize cell or tissue culture systems or in screening methods.
  • virus vectors according to the instant disclosure find use in diagnostic and screening methods, whereby a nucleic acid of interest is transiently or stably expressed in a cell culture system, or alternatively, a transgenic animal model.
  • the virus vectors of the present disclosure can also be used for various non- therapeutic purposes, including but not limited to use in protocols to assess gene targeting, clearance, transcription, translation, etc., as would be apparent to one skilled in the art.
  • the virus vectors can also be used for the purpose of evaluating safety (spread, toxicity, immunogenicity, etc.). Such data, for example, are considered by the United States Food and Drug Administration as part of the regulatory approval process prior to evaluation of clinical efficacy.
  • virus vectors of the present disclosure may be used to produce an immune response in a subject.
  • a virus vector comprising a heterologous nucleic acid sequence encoding an immunogenic polypeptide can be
  • Immunogenic polypeptides are as described hereinabove. In some embodiments, a protective immune response is elicited.
  • the virus vector may be administered to a cell ex vivo and the altered cell is administered to the subject.
  • the virus vector comprising the heterologous nucleic acid is introduced into the cell, and the cell is administered to the subject, where the heterologous nucleic acid encoding the immunogen can be expressed and induce an immune response in the subject against the immunogen.
  • the cell is an antigen- presenting cell ⁇ e.g., a dendritic cell).
  • an “active immune response” or “active immunity” is characterized by “participation of host tissues and cells after an encounter with the immunogen. It involves differentiation and proliferation of immunocompetent cells in lymphoreticular tissues, which lead to synthesis of antibody or the development of cell-mediated reactivity, or both.” Herbert B. Herscowitz, Immunophysiology: Cell Function and Cellular Interactions in Antibody
  • an active immune response is mounted by the host after exposure to an immunogen by infection or by vaccination.
  • Active immunity can be contrasted with passive immunity, which is acquired through the "transfer of preformed substances (antibody, transfer factor, thymic graft, interleukin-2) from an actively immunized host to a non-immune host.” Id.
  • a "protective" immune response or “protective” immunity as used herein indicates that the immune response confers some benefit to the subject in that it prevents or reduces the incidence of disease.
  • a protective immune response or protective immunity may be useful in the treatment and/or prevention of disease, in particular cancer or tumors (e.g., by preventing cancer or tumor formation, by causing regression of a cancer or tumor and/or by preventing metastasis and/or by preventing growth of metastatic nodules).
  • the protective effects may be complete or partial, as long as the benefits of the treatment outweigh any disadvantages thereof.
  • virus vector or cell comprising the heterologous nucleic acid can be administered in an immunogenically effective amount, as described below.
  • the virus vectors of the present disclosure can also be administered for cancer immunotherapy by administration of a virus vector expressing one or more cancer cell antigens (or an immunologically similar molecule) or any other immunogen that produces an immune response against a cancer cell.
  • a virus vector expressing one or more cancer cell antigens (or an immunologically similar molecule) or any other immunogen that produces an immune response against a cancer cell.
  • an immune response can be produced against a cancer cell antigen in a subject by administering a virus vector comprising a heterologous nucleic acid encoding the cancer cell antigen, for example to treat a patient with cancer and/or to prevent cancer from developing in the subject.
  • the virus vector may be administered to a subject in vivo or by using ex vivo methods, as described herein.
  • cancer antigen can be expressed as part of the virus capsid or be otherwise associated with the virus capsid (e.g., as described above).
  • any other therapeutic nucleic acid e.g., RNAi
  • polypeptide e.g., cytokine
  • cancer encompasses tumor-forming cancers.
  • cancer tissue encompasses tumors.
  • cancer cell antigen encompasses tumor antigens.
  • cancer has its understood meaning in the art, for example, an uncontrolled growth of tissue that has the potential to spread to distant sites of the body (i.e., metastasize).
  • exemplary cancers include, but are not limited to melanoma, adenocarcinoma, thymoma, lymphoma (e.g., non-Hodgkin's lymphoma, Hodgkin's lymphoma), sarcoma, lung cancer, liver cancer, colon cancer, leukemia, uterine cancer, breast cancer, prostate cancer, ovarian cancer, cervical cancer, bladder cancer, kidney cancer, pancreatic cancer, brain cancer and any other cancer or malignant condition now known or later identified.
  • the disclosure provides a method of treating and/or preventing tumor-forming cancers.
  • Tumor is also understood in the art, for example, as an abnormal mass of undifferentiated cells within a multicellular organism. Tumors can be malignant or benign. In representative embodiments, the methods disclosed herein are used to prevent and treat malignant tumors.
  • treating cancer By the terms “treating cancer,” “treatment of cancer” and equivalent terms it is intended that the severity of the cancer is reduced or at least partially eliminated and/or the progression of the disease is slowed and/or controlled and/or the disease is stabilized. In particular embodiments, these terms indicate that metastasis of the cancer is prevented or reduced or at least partially eliminated and/or that growth of metastatic nodules is prevented or reduced or at least partially eliminated.
  • prevention of cancer or “preventing cancer” and equivalent terms it is intended that the methods at least partially eliminate or reduce and/or delay the incidence and/or severity of the onset of cancer.
  • the onset of cancer in the subject may be reduced in likelihood or probability and/or delayed.
  • cells may be removed from a subject with cancer and contacted with a virus vector expressing a cancer cell antigen according to the instant disclosure.
  • the modified cell is then administered to the subject, whereby an immune response against the cancer cell antigen is elicited.
  • This method can be advantageously employed with immunocompromised subjects that cannot mount a sufficient immune response in vivo (i.e., cannot produce enhancing antibodies in sufficient quantities).
  • immunomodulatory cytokines e.g., a-interferon, ⁇ -interferon, ⁇ -interferon, co-interferon, ⁇ -interferon, interleukin- la, interleukin- ⁇ , interleukin-2, interleukin-3, interleukin-4, interleukin 5, interleukin-6, interleukin-7, interleukin-8, interleukin-9, interleukin- 10, interleukin-11, interleukin 12, interleukin-13, interleukin- 14, interleukin- 18, B cell Growth factor, CD40 Ligand, tumor necrosis factor- , tumor necrosis factor- ⁇ , monocyte chemoattractant protein- 1, granulocyte- macrophage colony stimulating factor, and lymphotoxin).
  • immunomodulatory cytokines preferably, CTL inductive cytokines
  • Cytokines may be administered by any method known in the art. Exogenous cytokines may be administered to the subject, or alternatively, a nucleic acid encoding a cytokine may be delivered to the subject using a suitable vector, and the cytokine produced in vivo. Subjects, Pharmaceutical Formulations, and Modes of Administration
  • Virus vectors and capsids find use in both veterinary and medical applications. Suitable subjects include both avians and mammals.
  • avian as used herein includes, but is not limited to, chickens, ducks, geese, quail, turkeys, pheasant, parrots, parakeets, and the like.
  • mammal as used herein includes, but is not limited to, humans, non-human primates, bovines, ovines, caprines, equines, felines, canines, lagomorphs, etc. Human subjects include neonates, infants, juveniles, adults and geriatric subjects.
  • the subject is "in need of the methods of the disclosure.
  • the present disclosure provides a pharmaceutical composition
  • a pharmaceutical composition comprising a virus vector and/or capsid of the disclosure in a pharmaceutically acceptable carrier and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc.
  • the carrier will typically be a liquid.
  • the carrier may be either solid or liquid.
  • the carrier will be respirable, and optionally can be in solid or liquid particulate form.
  • pharmaceutically acceptable it is meant a material that is not toxic or otherwise undesirable, i.e., the material may be administered to a subject without causing any undesirable biological effects.
  • the virus vector may be introduced into the cells at the appropriate multiplicity of infection according to standard transduction methods suitable for the particular target cells.
  • Titers of virus vector to administer can vary, depending upon the target cell type and number, and the particular virus vector, and can be determined by those of skill in the art without undue experimentation.
  • at least about 10 infectious units, optionally at least about 10 5 infectious units are introduced to the cell.
  • the cell(s) into which the virus vector is introduced can be of any type, including but not limited to neural cells (including cells of the peripheral and central nervous systems, in particular, brain cells such as neurons and oligodendricytes), lung cells, cells of the eye
  • neural cells including cells of the peripheral and central nervous systems, in particular, brain cells such as neurons and oligodendricytes
  • lung cells cells of the eye
  • the cell can be any progenitor cell.
  • the cell can be a stem cell (e.g., neural stem cell, liver stem cell).
  • the cell can be a cancer or tumor cell.
  • the cell can be from any species of origin, as indicated above.
  • the virus vector can be introduced into cells in vitro for the purpose of administering the modified cell to a subject.
  • the cells have been removed from a subject, the virus vector is introduced therein, and the cells are then administered back into the subject.
  • Methods of removing cells from subject for manipulation ex vivo, followed by introduction back into the subject are known in the art (see, e.g., U.S. patent No. 5,399,346).
  • the recombinant virus vector can be introduced into cells from a donor subject, into cultured cells, or into cells from any other suitable source, and the cells are administered to a subject in need thereof (i.e., a "recipient" subject).
  • Suitable cells for ex vivo nucleic acid delivery are as described above. Dosages of the cells to administer to a subject will vary upon the age, condition and species of the subject, the type of cell, the nucleic acid being expressed by the cell, the mode of administration, and the like. Typically, at least about 10 2 to about 10 8 cells or at least about 10 3 to about 10 6 cells will be administered per dose in a pharmaceutically acceptable carrier. In particular embodiments, the cells transduced with the virus vector are administered to the subject in a treatment effective or prevention effective amount in combination with a pharmaceutical carrier.
  • the virus vector is introduced into a cell and the cell can be administered to a subject to elicit an immunogenic response against the delivered polypeptide (e.g., expressed as a transgene or in the capsid).
  • an immunogenic response against the delivered polypeptide e.g., expressed as a transgene or in the capsid.
  • an "immunogenically effective amount” is an amount of the expressed polypeptide that is sufficient to evoke an active immune response against the polypeptide in the subject to which the pharmaceutical formulation is administered.
  • the dosage is sufficient to produce a protective immune response (as defined above). The degree of protection conferred need not be complete or permanent, as long as the benefits of administering the immunogenic polypeptide outweigh any disadvantages thereof.
  • a further aspect of the disclosure is a method of administering the virus vector and/or virus capsid to subjects.
  • Administration of the virus vectors and/or capsids according to the present disclosure to a human subject or an animal in need thereof can be by any means known in the art.
  • the virus vector and/or capsid is delivered in a treatment effective or prevention effective dose in a pharmaceutically acceptable carrier.
  • the virus vectors and/or capsids of the disclosure can further be administered to elicit an immunogenic response (e.g., as a vaccine).
  • immunogenic compositions of the present disclosure comprise an immunogenically effective amount of virus vector and/or capsid in combination with a pharmaceutically acceptable carrier.
  • the dosage is sufficient to produce a protective immune response (as defined above).
  • the degree of protection conferred need not be complete or permanent, as long as the benefits of administering the immunogenic polypeptide outweigh any disadvantages thereof.
  • Subjects and immunogens are as described above.
  • Dosages of the virus vector and/or capsid to be administered to a subject depend upon the mode of administration, the disease or condition to be treated and/or prevented, the individual subject's condition, the particular virus vector or capsid, and the nucleic acid to be delivered, and the like, and can be determined in a routine manner.
  • Exemplary doses for achieving therapeutic effects are titers of at least about 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 n , 10 12 , 10 13 , 10 14 , 10 15 transducing units, optionally about 10 8 - 10 13 transducing units.
  • more than one administration may be employed to achieve the desired level of gene expression over a period of various intervals, e.g., daily, weekly, monthly, yearly, etc.
  • Exemplary modes of administration include oral, rectal, transmucosal, intranasal, inhalation (e.g., via an aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, in utero (or in ovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular, intradermal, intrapleural, intracerebral, and intraarticular), topical (e.g., to both skin and mucosal surfaces, including airway surfaces, and transdermal administration), intralymphatic, and the like, as well as direct tissue or organ injection (e.g., to liver, skeletal muscle, cardiac muscle, diaphragm muscle or brain).
  • buccal e.g., sublingual
  • vaginal intrathecal
  • intraocular, transdermal, in utero or in ovo
  • parenteral e.g., intravenous, subcutaneous, intradermal, intramuscular
  • intramuscular includes administration to skeletal, diaphragm and/or cardiac muscle. Administration can also be to a tumor (e.g., in or near a tumor or a lymph node).
  • a tumor e.g., in or near a tumor or a lymph node.
  • the most suitable route in any given case will depend on the nature and severity of the condition being treated and/or prevented and on the nature of the particular vector that is being used.
  • Delivery to a target tissue can also be achieved by delivering a depot comprising the virus vector and/or capsid.
  • a depot comprising the virus vector and/or capsid is implanted into skeletal, cardiac and/or diaphragm muscle tissue or the tissue can be contacted with a film or other matrix comprising the virus vector and/or capsid.
  • a virus vector and/or virus capsid according to the present disclosure is administered to skeletal muscle, diaphragm muscle and/or cardiac muscle (e.g., to treat and/or prevent muscular dystrophy, heart disease). In some embodiments, a virus vector and/or virus capsid according to the present disclosure is administered to treat PAD or congestive heart failure.
  • RNAi RNAi
  • ribozyme RNAi
  • RNAi RNAi
  • ribozyme RNAi or other functional RNA
  • Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions.
  • one may administer the virus vector and/or virus capsids of the disclosure in a local rather than systemic manner, for example, in a depot or sustained-release formulation.
  • the virus vector and/or virus capsid can be delivered adhered to a surgically implantable matrix (e.g. , as described in U.S. Patent Publication No. US-2004-
  • virus vectors and virus capsids can be administered to tissues of the CNS (e.g., brain, eye) and may advantageously result in broader distribution of the virus vector or capsid than would be observed in the absence of the present disclosure.
  • the delivery vectors of the disclosure may be administered to treat diseases of the CNS, including genetic disorders, neurodegenerative disorders, psychiatric disorders and tumors.
  • Illustrative diseases of the CNS include, but are not limited to Alzheimer's disease, Parkinson's disease, Huntington's disease, Canavan disease, Leigh's disease, Refsum disease, Tourette syndrome, primary lateral sclerosis, amyotrophic lateral sclerosis (ALS), progressive muscular atrophy, Pick's disease, muscular dystrophy, multiple sclerosis, myasthenia gravis, Binswanger's disease, trauma due to spinal cord and/or head injury (e.g., traumatic brain injury), Tay Sachs disease, Lesch-Nyan disease, epilepsy, stroke, cerebral infarcts, psychiatric disorders including mood disorders (e.g., depression, bipolar affective disorder, persistent affective disorder, secondary mood disorder), schizophrenia, drug dependency (e.g., alcoholism and other substance dependencies), neuroses (e.g., anxiety, obsessional disorder, somatoform disorder, dissociative disorder, grief, post-partum depression), psychosis (e.g., hallucinations and
  • disorders of the CNS include ophthalmic disorders involving the retina, posterior tract, and optic nerve (e.g., retinitis pigmentosa, diabetic retinopathy and other retinal degenerative diseases, uveitis, age-related macular degeneration, glaucoma).
  • optic nerve e.g., retinitis pigmentosa, diabetic retinopathy and other retinal degenerative diseases, uveitis, age-related macular degeneration, glaucoma.
  • ophthalmic diseases and disorders are associated with one or more of three types of indications: (1) angiogenesis, (2) inflammation, and (3) degeneration.
  • the delivery vectors of the present disclosure can be employed to deliver anti-angiogenic factors; anti-inflammatory factors; factors that retard cell degeneration, promote cell sparing, or promote cell growth and combinations of the foregoing.
  • Diabetic retinopathy for example, is characterized by angiogenesis. Diabetic retinopathy can be treated by delivering one or more anti-angiogenic factors either intraocularly (e.g., in the vitreous) or periocularly (e.g., in the sub-Tenon's region). One or more neurotrophic factors may also be co-delivered, either intraocularly (e.g., intravitreally) or periocularly.
  • Uveitis involves inflammation.
  • One or more anti-inflammatory factors can be administered by intraocular (e.g., vitreous or anterior chamber) administration of a delivery vector of the disclosure.
  • Retinitis pigmentosa by comparison, is characterized by retinal degeneration.
  • retinitis pigmentosa can be treated by intraocular (e.g., vitreal administration) of a delivery vector encoding one or more neurotrophic factors.
  • Age-related macular degeneration involves both angiogenesis and retinal
  • This disorder can be treated by administering the inventive deliver vectors encoding one or more neurotrophic factors intraocularly (e.g., vitreous) and/or one or more anti-angiogenic factors intraocularly or periocularly (e.g., in the sub-Tenon's region).
  • one or more neurotrophic factors intraocularly (e.g., vitreous) and/or one or more anti-angiogenic factors intraocularly or periocularly (e.g., in the sub-Tenon's region).
  • Glaucoma is characterized by increased ocular pressure and loss of retinal ganglion cells.
  • Treatments for glaucoma include administration of one or more neuroprotective agents that protect cells from excitotoxic damage using the inventive delivery vectors.
  • Such agents include N-methyl-D-aspartate (NMD A) antagonists, cytokines, and neurotrophic factors, delivered intraocularly, optionally intravitreally.
  • NMD A N-methyl-D-aspartate
  • cytokines cytokines
  • neurotrophic factors delivered intraocularly, optionally intravitreally.
  • the present disclosure may be used to treat seizures, e.g., to reduce the onset, incidence or severity of seizures.
  • the efficacy of a therapeutic treatment for seizures can be assessed by behavioral (e.g., shaking, ticks of the eye or mouth) and/or electrographic means (most seizures have signature electrographic abnormalities).
  • the disclosure can also be used to treat epilepsy, which is marked by multiple seizures over time.
  • somatostatin (or an active fragment thereof) is administered to the brain using a delivery vector of the disclosure to treat a pituitary tumor.
  • the delivery vector encoding somatostatin (or an active fragment thereof) is administered by microinfusion into the pituitary.
  • such treatment can be used to treat acromegaly (abnormal growth hormone secretion from the pituitary).
  • the nucleic acid e.g., GenBank Accession No. J00306) and amino acid (e.g., GenBank Accession No. P01166; contains processed active peptides somatostatin-28 and somatostatin- 14) sequences of somatostatins are known in the art.
  • the vector can comprise a secretory signal as described in U.S. Patent No. 7,071 ,172.
  • the virus vector and/or virus capsid is administered to the CNS (e.g., to the brain or to the eye).
  • the virus vector and/or capsid may be introduced into the spinal cord, brainstem (medulla oblongata, pons), midbrain (hypothalamus, thalamus, epithalamus, pituitary gland, substantia nigra, pineal gland), cerebellum, telencephalon (corpus striatum, cerebrum including the occipital, temporal, parietal and frontal lobes, cortex, basal ganglia, hippocampus and portaamygdala), limbic system, neocortex, corpus striatum, cerebrum, and inferior colliculus.
  • the virus vector and/or capsid may also be administered to different regions of the eye such as the retina, cornea and/or optic nerve.
  • the virus vector and/or capsid may be delivered into the cerebrospinal fluid (e.g., by lumbar puncture) for more disperse administration of the delivery vector.
  • the virus vector and/or capsid may further be administered intravascularly to the CNS in situations in which the blood-brain barrier has been perturbed (e.g. , brain tumor or cerebral infarct).
  • the virus vector and/or capsid can be administered to the desired region(s) of the CNS by any route known in the art, including but not limited to, intracerebroventricular, intracisternal, intraparenchymal, intracranial, intrathecal, intra-ocular, intracerebral, intraventricular, intravenous (e.g., in the presence of a sugar such as mannitol), intranasal, intra-aural, intra-ocular (e.g., intra- vitreous, sub-retinal, anterior chamber) and peri -ocular (e.g., sub-Tenon's region) delivery as well as intramuscular delivery with retrograde delivery to motor neurons.
  • intracerebroventricular intracisternal
  • intraparenchymal intracranial
  • intrathecal intrathecal
  • intra-ocular intracerebral
  • intraventricular intravenous (e.g., in the presence of a sugar such as mannitol)
  • intra-aural e.g
  • the virus vector and/or capsid is administered in a liquid formulation by direct injection (e.g., stereotactic injection) to the desired region or compartment in the CNS.
  • the virus vector and/or capsid may be provided by topical application to the desired region or by intra-nasal administration of an aerosol formulation. Administration to the eye, may be by topical application of liquid droplets.
  • the virus vector and/or capsid may be administered as a solid, slow-release formulation (see, e.g., U.S. Patent No. 7,201,898).
  • the virus vector can be used for retrograde transport to treat and/or prevent diseases and disorders involving motor neurons (e.g., amyotrophic lateral sclerosis (ALS); spinal muscular atrophy (SMA), etc.).
  • motor neurons e.g., amyotrophic lateral sclerosis (ALS); spinal muscular atrophy (SMA), etc.
  • the virus vector can be delivered to muscle tissue from which it can migrate into neurons.
  • Adeno-associated viruses are non-pathogenic parvoviruses composed of a small, 25 nm icosahedral capsid packaging an approximately 4.7 kb single-stranded DNA genome.
  • a wide array of AAV capsid sequences have been isolated from human and primate tissues, which have been categorized into several distinct clades based upon sequence and structural diversity. Across these clades, different serotypes display broad tropism at the species, tissue and cellular levels. These diverse phenotypes are determined by capsid structure.
  • the AAV capsid is assembled from 60 viral protein (VP) subunits.
  • the core VP monomer (VP3) has a jellyroll, beta barrel structure comprised of 7 anti-parallel beta strands connected by interdigitating loop regions. Portions of these highly variable loops are surface exposed and define the topology of the AAV capsid, which in turn determines tissue tropism, antigenicity and receptor usage across the various AAV serotypes.
  • the surface loop residues on the AAV capsid are highly plastic and amenable to modification, affording control over antigenicity, transduction profile and tissue tropism.
  • the first step in the AAV lifecycle is recognition of and attachment to cell surface glycan receptors.
  • cell surface glycan receptors include heparan sulfate (HS) for AAV2, AAV3 and AAV6, a2,3- and a2,6-N-linked Sialic acid (Sia) for AAVl, AAV5 and AAV6, O-linked sialic acid for AAV4, and galactose (Gal) for AAV9.
  • HS heparan sulfate
  • Sia Sialic acid
  • AAV5 and AAV6, O-linked sialic acid for AAV4 and galactose
  • Gal galactose
  • tissue tropisms of different AAV serotypes contribute to the varying tissue tropisms of different AAV serotypes.
  • different AAV serotypes display a spectrum of transduction profiles and cellular tropisms, depending on the route of administration.
  • CSF intra-cerebrospinal fluid
  • AAV capsids undergo axonal transport and transynaptic spread in the anterograde and/or retrograde directions, depending on the serotype.
  • glial-associated lymphatic (glymphatic) transport of CSF influences AAV spread within the mouse brain parenchyma and clearance from the CNS.
  • AAV vectors To achieve CNS gene transfer, intravenously administered AAV vectors must first cross the blood-brain barrier (BBB) in order to gain entry into the brain.
  • BBB blood-brain barrier
  • the BBB blocks the diffusion and paracellular flux of macromolecules/particles and regulates the transport of other molecules.
  • Most viruses which infect the brain do so through disrupting or weakening the BBB; however, some viruses have devised strategies to gain entry into the CNS by methods such as hitchhiking within host immune cells (e.g., HIV), by infecting brain endothelial cells or by infecting peripheral nerves and exploiting axonal transport (e.g., Rabies).
  • the BBB prevents entry of most serotypes into the brain with a few notable exceptions.
  • intravascular administration of AAV serotypes 1-6 and 8 results in poor CNS transduction, while isolates AAV9, AAVrh.8 and AAVrh.lO have been shown, amongst others, to efficiently traverse the BBB in different animal models.
  • AAVl/rh.lO domain swap capsid library was generated through DNA shuffling. Briefly, the Cap genes of AAV1 and AAVrh.10 were randomly fragmented by brief DNase digestion and reassembled using primerless PCR with Phusion High-Fidelity DNA polymerase (NEB Cat #M0530L) in which the partial homology of the short ( ⁇ 400 bp) fragments allows for self-priming of the fragments. A secondary PCR step using specific conserved primers flanking the Cap gene were then used to amplify the library of reassembled full-length Cap sequences and simultaneously insert flanking restriction sites to facilitate subsequent cloning into a pTR plasmid backbone used for virus production. Phylogenetic and sequence analyses
  • the amino acid sequences of different AAV capsid isolates were aligned using ClustalW and phylogenetic trees were generated using the MEGA v7.0.21 software package.
  • the phylogeny was produced using the neighbor-joining algorithm and amino acid distances were calculated using a Poisson correction.
  • Statistical testing was done by bootstrapping with 1 ,000 replicates to test the confidence of the phylogenetic analysis and to generate the bootstrap consensus tree. Branches corresponding to partitions reproduced in less than 50% of bootstrap replicates are collapsed. The percentage of replicate trees in which associated taxa clustered together in the bootstrap test is displayed next to the branches. All sequence alignments were performed using Invitrogen's Vector NTI Advance
  • the transfected plasmids include (i) a capsid-specific pXR helper plasmid (i.e. pXRl, pXRrh.10, or various plasmids encoding the various chimeric Cap genes used in this study), (ii) the adenoviral helper plasmid pXX680, and (iii) either pTR-CBh-scGFP or pTR-CBA-Luc plasmids (encoding either a self-complementary green fluorescent protein (GFP) reporter transgene driven by the chicken beta actin hybrid (CBh) promoter or a luciferase reporter transgene (Luc) driven by the chicken beta actin promoter (CBA), respectively, flanked by inverted terminal repeats (TRs) derived from the AAV2 genome.
  • a capsid-specific pXR helper plasmid i.e. pXRl, pXRrh
  • Vectors packaging a CBh-scGFP transgene were subsequently subjected to buffer exchange and concentration using Sartorius Vivaspin2 100 kDa molecular weight cut-off (MWCO) centrifugation columns (F-2731-100 Bioexpress, Kaysville, UT).
  • Vectors packaging a CBA-Luc transgene were subjected to buffer exchange and de-salting using Zeba Spin Desalting Columns, 40K MWCO (Thermo Scientific, Cat # 87770).
  • viral genome titers were determined via quantitative PCR using a Roche Lightcycler 480 (Roche Applied Sciences, Pleasanton, CA).
  • Quantitative PCR primers were designed to specifically recognize the AAV2 inverted terminal repeats (forward, 5'- AACATGCTACGCAGAGAGGGAGTGG -3'; (SEQ ID O: 36) reverse, 5'- CATGAGACAAGGAACCCCTAGTGATGGAG -3') (SEQ ID NO: 37) (IDT Technologies, Ames IA).
  • transgene at a dose of 1 x 10 vg. Mice were sacrificed, as described above, at 14 days post injection and various tissues were removed. For these experiments, no fixation with 4% paraformaldehyde in lx PBS was performed and instead tissues were dissected and frozen at -80°C prior to use.
  • mice injected with 1 x 10 ⁇ viral genomes packaging a CBA-Luc transgene were sacrificed at 14 days post injection and tissues were harvested and frozen at -80°C. Tissues were later thawed, weighed and lysed by adding 150 ⁇ of 2x passive lysis buffer (Promega, Madison WI) prior to mechanical lysis using a Tissue Lyser II 352 instrument (Qiagen, Valencia, CA) followed by centrifugation to remove any remaining tissue debris.
  • 50 ⁇ of supernatant from each lysate was then loaded onto an assay plate along with 50 ⁇ of luciferin and luminometric analysis was performed using a Victor2 luminometer
  • mice were sacrificed and tissues were frozen at -80°C. Tissues were later thawed and viral genomes were extracted from the tissue lysates using the DNeasy kit (Qiagen, Valencia, CA). Viral genome copy numbers were then determined for each tissue using quantitative PCR with primers specificto the luciferase transgene (forward, 5'- AAAAGCACTCTGATTGAC AAATAC-3 ' (SEQ ID NO: 38); and reverse, 5'- CCTTCGCTTCAAAAAATGGAAC-3 ' (SEQ ID NO: 39)).
  • Previously published coordinates (PDB ID, 3NG9) were used to generate three- dimensional structures of the AAVl VP3 trimer/three-fold axis of symmetry.
  • Homology models of AAVrh.lO and various AAVl/rh.lO chimeric capsid structures were obtained using the SWISS-Model server ( swissmodel . expasy. org), with the crystal structure of AAV8 VP3 (PDB ID, 2QA0) used as a template and a structure-based alignment was generated using the secondary structure matching (SSM) application in the WinCoot software, with the AAVl VP3 (PDB ID 3NG9) monomer being used as a template.
  • SWISS-Model server swissmodel . expasy. org
  • SSM secondary structure matching
  • the VP3 trimers/3-fold symmetry axes, VP3 trimer dimers/2-fold symmetry axes, VP3 pentamers/5- fold symmetry axes, and full capsids were generated using the VIPERd oligomer generator utility (viperdb . scripps.edu/ oligomer multi .php) . Surface rendered depictions of these models were visualized using PyMOL (the PyMOL Molecular Graphics System,
  • This panel of clones was further characterized phylogenetically by constructing a neighbor-joining tree, which broadly categorized these variants as either more AAVl -like (Clade A) or more AAVrh.10-like (Clade E) (FIG. 4B). Small-scale vector production was then used to establish relative titers to exclude capsids defective in assembly or packaging from the study. Homology-based structural models of the parental and representative chimeric capsid trimers highlighting key surface domains/residues at the three- fold axis of symmetry (FIG. 4C) were generated to further narrow the list of chimeric capsid variants for initial screening in vivo.
  • Ten chimeric capsid variants were selected based on structural analyses, out of which six yielded recombinant vectors (packaging scGFP or ssLuc transgene cassettes) at titers similar to parental AAVl and AAVrh.lO vectors. These variants were then screened further.
  • In vivo screening identifies two AAVl /rh.10 chimeric capsids capable of crossing the BBB after intravenous administration in adult mice
  • AAVl Rl 9.1 and AAVl R20 transduce predominantly microvascular endothelial cells in the cortex, while low to modest transduction of neuronal and glial cells is evident for AAV1R8 and AAVlR19d vectors (FIG. 5). In contrast, AAV1R6 and
  • AAV1R7 demonstrate robust transduction of cortical neurons with modest transduction of glia and scarce, if any, transduction of the vasculature within the cortex. Representative images of the somatosensory area of the cortex at high magnification are shown. A similar trend for these chimeras was observed consistently across other regions of the brain (FIG. 6). These observations indicate that the chimeric capsids AAV1R6 and AAV1R7 likely possess the ability to cross the BBB, similar to the parental AAVrh.lO vector, although the mechanism is unknown. However, unlike either parent, AAVl or AAVrh.lO, neither chimera efficiently transduces the vasculature.
  • Intravenously delivered AAV1R6 and AA V1R7 chimeric capsids cross the BBB and transduce neurons preferentially throughout the brain.
  • Cerebral Cortex. AAVrh.lO displays robust transduction of neuronal, glial and vascular endothelial cells throughout the cortex and, in the case of intravascularly delivered AAVl, vascular transduction accompanied by the absence of neuronal expression and low expression levels in glia was observed (FIG. 7 and FIG. 8).
  • AAV1R6 and AAV1R7 (AAV1R6/7) vectors mediate robust GFP expression in cortical neurons and reduced expression in glia throughout the amygdalar, piriform, entorhinal, temporal association, auditory, somatosensory, motor, posterior parietal and retrosplenial areas of the cortex yet varied at consistently trending levels across the sections analyzed. Representative images of cortical regions transduced are shown for the motor cortex (FIG. 7 A) and the somatosensory area of the cortex (FIG. 7B).
  • AAV1R6/7 seem to display a preferentially neuronal cellular tropism across the entire cortex, showing moderate glial transduction and remarkably reduced vascular transduction. This profile is in stark contrast to the vasculotropic AAVl as well as AAVrh.lO, which transduces neuronal, glial, and vascular endothelial cells with high efficiency (FIG. 7 A and 7B). While AAV1R6/7 mediate robust neuronal and moderate glial expression throughout the cortex, their expression levels are nonetheless lower than those achieved by AAVrh.lO. These trends are corroborated by quantitation of our morphological analysis of GFP+ cells (FIG.
  • AAVrh.lO transduction across the cortex has a tendency to be concentrated at the peripheries of the tissue, around cortical layers 1- 3, particularly within the retrosplenial, motor, somatosensory and visual cortical areas. While this can be attributed to differential immunostaining, we observed this phenomenon with high consistency across the stained AAVrh.lO sections in our analysis. This trend does not hold true for AAV 1R6/7, which appear to mediate more uniformly distributed expression across the cortical layers.
  • AAV1R6/7 Hippocampus. Following intravenous delivery, the chimeric AAV1R6/7 vectors appear to mediate robust GFP expression in neurons throughout the hippocampus, bilaterally across brain h emispheres. GFP+ hippocampal neurons are observed within the CA1, CA2 and CA3 pyramidal layers (FIG. 7C, CA2 and partial CA1 shown). AAV1R6/7 also appear to be effective at transducing neurons within the dentate gyrus, showing a large number of GFP+ neurons which appear to be granular cells based on morphology (FIG. 7D). The neuronal transduction profile displayed by AAV1R6/7 in the hippocampus is similar to that seen for AAVrh.lO.
  • AAV1R6/7 do not appear to transduce either glia or endothelial cells in either region at any appreciable level, with no significant difference in GFP+ glial cells observed between AAV1 and AAV1R6/7 (FIG. 8C and 8D).
  • AAV1 transduction observed in the hippocampus is again limited to the vasculature.
  • these qualitative trends are corroborated by quantitative data for neuronal and glial cell transduction in the hippocampus (FIG. 8C) and dentate gyrus (FIG. 8D).
  • AAV1R6/7 demonstrate minimal transduction of the endothelium and dramatically reduced levels of glial transduction in the thalamus compared to AAVrh.lO.
  • FIG. 8E quantitative data in which transduction of thalamic neurons was found to be significantly different for AAVrh.lO, AAV1R6 and AAV1R7, relative to AAV1. Contrarily, no significant difference was found for thalamic glial transduction for AAV1R6/7 relative to AAV1. Hypothalamus.
  • Striatum. AAV1R6/7 transduce neurons in the striatum (specifically, the caudate putamen) as efficiently as AAVrh.lO (FIG. 7G), as corroborated further by our quantitative data demonstrating a significant difference for each relative to AAV1 ; however, these vectors transduce ⁇ 2-fold fewer glial cells and lower numbers of endothelial cells in the striatum (FIG. 8G) despite some observed variation.
  • Amygdala The amygdalar transduction profiles for AAV1R6/7 show robust neuronal GFP expression, significantly different compared to A AVI . Few GFP+ glial cells were detected, which were not significantly different compared to AAV1 (FIG. 7H and FIG. 8H), and barely detectable GFP+ endothelial cells were observed, similarly to other brain regions such as the striatum and thalamus.
  • mice taken together, the morphological assessment of immunostained brain regions derived from mice following intravenous delivery of AAV1R6 and AAV1R7 demonstrates robust and selective neuronal transduction comparable to parental AAVrh.lO. Furthermore, these chimeras display reduced glial transduction and their ability to transduce endothelial cells of the brain microvasculature appears diminished. Furthermore, these results appear to be consistent across various brain regions, with the exception of the hypothalamus, where low transduction levels in general are observed.
  • AA V1R6 and AA VI R7 are de-targeted from the liver while retaining parental cardiac transduction profiles
  • both chimeric vectors demonstrate comparable levels of GFP expression in the heart relative to the parental serotypes, AAV1 and AAVrh.lO, with no significant difference found for AAVrh.lO, AAV1R6 or AAV1R7, relative to AAV1;
  • AAVrh.lO expression levels in cardiac tissue showed substantial variation across mice (FIG. 10A and 10B).
  • AAV1 demonstrated moderate transduction levels while AAVrh.10 performed exceptionally well, demonstrating a log- fold higher transduction.
  • AAV1R6 and AAV1R7 mediated negligible GFP expression in the liver at background levels comparable to mock-treated mice (FIG. 10B) that were significantly reduced relative to AAVrh.lO.
  • AAV1R6 and AAV1R7 are liver-de- targeted relative to their parental serotypes.
  • AAV vectors packaging a chicken beta actin (CBA) promoter linked to a luciferase coding sequence to produce a CBA-luciferase transgene were administered to C57/B16 mice via tail vein injection at a dose of 1 x 10 11 vg.
  • Mice were sacrificed at 14 days post injection, tissues were harvested, chopped up, lysed and luciferase assays were performed to detect relative transduction levels for brain, cardiac, liver, and spinal cord tissues. Data was normalized as relative light units per gram tissue.
  • AAV1RX display considerable transduction levels, albeit not as high as AAVrh.lO (FIG. 3).
  • the chimeric capsids additionally display transduction levels comparable to the parental AAVl and AAVrh.lO capsids in the heart.
  • AAV1R6 is 97-98% identical to AAVl with 18 unique amino acid residues derived from AAVrh.lO.
  • AAV1R7 is also largely identical to AAVl, but with a total of 22 AAVrh.10-derived residues, including the 18 present in AAV1R6.
  • 4 additional residues unique to AAV1R7 two are located within the VPl unique (VPlu) N-terminal region (1891, 206A) and the other two are located at the buried VP3 N-terminal region (224S and 225 S).
  • AAV1R6 possesses 3 stretches of non-consecutive residues derived from the
  • the first group of residues includes three amino acids (148P, 152R and 153S) within the VPlu region (FIG. 9A). Specifically, one residue is located adjacent to basic region 1 (BR1), which contains the first nuclear localization signal (NLS) of VP1. Additionally, group i contains two residues (158T and 163K) also near the NLS located within the VP2 N-terminal region (FIG. 9A) As mentioned earlier, these residues are not surface-exposed and instead remain internalized within the capsid until later in the intracellular trafficking pathway.
  • the second group of AAVrh.lO-derived residues on AAV1R6 (group ii) consists of 8 amino acids comprising the BC loop, located within variable region I (VR-I) (FIG. 9 A and 9B). These residues are exposed on the surface of the capsid at the base of the protrusions at the 3 -fold axis of symmetry (FIG. 9D and 9F) and are also localized to the depression at the 2-fold symmetry axis (FIG. 9C and 9F). It is also important to note that this group of amino acid residues on AAVrh.lO is substituted with AAV1 residues in the chimeric AAV 1R8/19/20 capsids that are unable to penetrate the CNS after systemic administration.
  • the third group of AAVrh.lO-derived residues present in AAV1R6 includes a total of 6 amino acids.
  • Four of these residues (328Q, 330E, 332T and 333K) are located at VR-II, within the DE loop, which contributes to formation of the pore at the 5- fold axis of symmetry (FIG. 9 A, 9B, 9E, 9F).
  • the last two remaining residues within this group (3431 and 347T) are located within ⁇ -strand E, positioned within the interior of the capsid (FIG. 9A and 9B).
  • AAVIRX transduces neurons within the motor cortex and cortical neurons across the entire cortex while demonstrating limited transduction of glia and reduced vascular transduction, as seen earlier with the chimeric capsids AAV1R6 and AAV1R7. Continuing this trend, numerous GFP+ pyramidal neurons are o b served in the hippocampus along with an abundance of GFP+ granular cells in the dentate gyrus. Notably, GFP+ glial and endothelial cells in these regions are largely absent. In the thalamus, AAVIRX
  • AAV1R6 and AAV1R7 demonstrate robust neuronal transduction at levels comparable to AAV1R6 and AAV1R7 with modest transduction of glial and endothelial cells, albeit at levels higher than for other brain regions.
  • GFP+ neurons are sparse and few GFP+ glia and vascular endothelial cells are observed.
  • the preferentially neuronal transduction profile displayed by AAVIRX is also seen within the striatum (specifically, the caudate putamen) and amygdala (FIG. 11H). Quantitative analyses of these brain regions and comparisons to those seen for AAVl, AAVrh.lO and the chimeric AAV1R6 and AAV1R7 vectors suggest that this minimal footprint of 8 amino acid residues from
  • AAVrh.10 is critical for crossing the BBB (FIG. 13).
  • AAV1R6, AAV1R7 and AA V IRX mediate low transduction levels and biodistribution in peripheral tissues.
  • mice 6-8 week old female C57/B16 mice were injected via tail vein with either AAV1, AAVrh.lO, AAV1R6, AAV1R7 or AAV1RX vectors packaging a single- stranded luciferase reporter transgene driven by a chicken beta actin promoter (ssCBA-Luc) at a dose of 1 x 10 11 vg per animal.
  • ssCBA-Luc chicken beta actin promoter
  • mice were sacrificed and tissues were harvested. Luciferase activity assays on tissue lysates as well as qPCR analyses to determine vector biodistribution were carried out (FIG. 12).
  • AAVrh.lO mediates ⁇ 2-4-fold higher cardiac luciferase expression and correspondingly ⁇ 2-fold higher viral genome copies in the heart compared to the other vectors (FIG. 12C and 12D).
  • AAVrh.lO displayed several fold higher luciferase transgene expression levels and consistently high viral genome copies in the liver.
  • low to background levels of luciferase expression and significantly reduced viral genome copies were detected in the liver for AAVl, 1R6, 1R7 and IRX (FIG. 12E and 12F). It is noteworthy to mention that luciferase expression and a corresponding trend in viral genome copy numbers were detected for AAVrh.lO in the kidney (FIG.
  • AAVl and AAVrh.10 the parental serotypes used to generate the chimeric capsid library in this study, are both non-human primate isolates that belong to two different clades - AAVl belongs to clade A while AAVrh.10 falls within Clade E. Despite the evolutionary distance between them, they share ⁇ 85% sequence homology between their Cap genes.
  • AAVl is known to recognize N-linked sialic acid (Sia) and the key residues composing the Sia recognition footprint on the AAVl capsid have been recently reported.
  • the current study identified 262N, 263G, 264T, 265S, 267G, 268S, 269T and 273T as key residues on the chimeric AAV1RX capsid, derived from AAVrh.10, that are essential for crossing the BBB. While none of the Sia contact residues for AAVl are located within the chimeric 1RX footprint, the backbone carbonyl oxygen atoms of residues S268, D271, and N272 have been implicated in possibly stabilizing capsid-glycan interactions and increasing Sia binding affinity. Furthermore, residues at this position (D271 and N272) are located within the galactose-binding footprint on AAV9. Thus, the current study supports the notion that residues within VR-I are critical.
  • AAVrh.43 also located within Clade E, demonstrate the ability to cross the BBB, albeit far less efficiently. Both possess 7 out of the 8 residues in this footprint; therefore, introducing the complete footprint onto these capsids will likely enhance their ability to cross the BBB.
  • AAVl and AAVrh.10 differ markedly in their ability to cross the BBB and transduce neurons and glia in the brain.
  • AAVl When delivered intravenously, AAVl demonstrates preferential uptake and transduction in vascular endothelial cells.
  • AAVrh.10 appears not only to be taken up by and transduce vascular endothelial cells, but also to traverse the vasculature and transduce underlying tissue such as the CNS or skeletal muscle.
  • the current study identifies a minimum set of residues on the AAVrh.lO capsid that partially confers these traits to AAV1 capsids.
  • capsids that can traverse the BBB, preferentially transduce neurons within the brain and that are simultaneously de-targeted from the liver may demonstrate an improved safety profile for CNS-targeted gene transfer applications from a systemic route of administration.
  • Decreased vector uptake in peripheral organs, particularly the liver, could reduce the potential threat of hepatotoxicity, as evidenced by the transient elevation in transaminases in patient serum following systemic injection of certain AAV serotypes.
  • the AAV1R6/7/X vectors may be broadly used for global CNS gene transfer and in particular, for developing gene therapy strategies to treat neurological disorders such as Friedreich's Ataxia or spinal muscular atrophy.
  • Hepatocyte Growth Factor Receptor Is a Coreceptor for Adeno- Associated Virus Type 2 Infection. J. Virol. 79: 609-614.
  • Epidermal growth factor receptor is a co-receptor for adeno- associated virus 26 serotype 6. Nat. Med. 16: 662-4.
  • Adeno-associated virus type 2 contains an integrin alpha5betal binding domain essential for viral cell entry. J. Virol. 80: 8961—9.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Epidemiology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Vascular Medicine (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2018/018381 2017-02-15 2018-02-15 Methods and compositions for gene transfer across the vasculature Ceased WO2018152333A1 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
CN201880025093.XA CN110520536B (zh) 2017-02-15 2018-02-15 用于穿过维管结构的基因转移的方法和组合物
EA201991911A EA038695B1 (ru) 2017-02-15 2018-02-15 Способы и композиции для переноса генов по сосудистой сети
IL312788A IL312788A (en) 2017-02-15 2018-02-15 Methods and compositions for gene transfer across the vasculature
AU2018221738A AU2018221738B2 (en) 2017-02-15 2018-02-15 Methods and compositions for gene transfer across the vasculature
CN202410828011.2A CN118978574A (zh) 2017-02-15 2018-02-15 用于穿过维管结构的基因转移的方法和组合物
MX2019009720A MX2019009720A (es) 2017-02-15 2018-02-15 Metodos y composiciones para la transferencia de genes a traves de la vasculatura.
US16/485,094 US11905312B2 (en) 2017-02-15 2018-02-15 Methods and compositions for gene transfer across the vasculature
CA3052829A CA3052829A1 (en) 2017-02-15 2018-02-15 Methods and compositions for gene transfer across the vasculature
SG11201907298WA SG11201907298WA (en) 2017-02-15 2018-02-15 Methods and compositions for gene transfer across the vasculature
KR1020197025393A KR20190117571A (ko) 2017-02-15 2018-02-15 혈관계를 통한 유전자 전달 방법 및 조성물
EP18754551.2A EP3583220A4 (en) 2017-02-15 2018-02-15 PROCEDURES AND COMPOSITIONS FOR GENERAL TRANSFER IN THE VASCULAR SYSTEM
BR112019016769-2A BR112019016769A2 (pt) 2017-02-15 2018-02-15 Métodos e composições para transferência genética através da vasculatura
IL268534A IL268534B2 (en) 2017-02-15 2018-02-15 Methods and compositions for gene transfer across the vasculature
JP2019542561A JP7291397B2 (ja) 2017-02-15 2018-02-15 血管系を通過する遺伝子移入の方法および組成物
JP2023007075A JP7574508B2 (ja) 2017-02-15 2023-01-20 血管系を通過する遺伝子移入の方法および組成物
US18/409,304 US20240209031A1 (en) 2017-02-15 2024-01-10 Methods and compositions for gene transfer across the vasculature

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762459286P 2017-02-15 2017-02-15
US62/459,286 2017-02-15

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/485,094 A-371-Of-International US11905312B2 (en) 2017-02-15 2018-02-15 Methods and compositions for gene transfer across the vasculature
US18/409,304 Continuation US20240209031A1 (en) 2017-02-15 2024-01-10 Methods and compositions for gene transfer across the vasculature

Publications (2)

Publication Number Publication Date
WO2018152333A1 true WO2018152333A1 (en) 2018-08-23
WO2018152333A9 WO2018152333A9 (en) 2019-01-24

Family

ID=63169716

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/018381 Ceased WO2018152333A1 (en) 2017-02-15 2018-02-15 Methods and compositions for gene transfer across the vasculature

Country Status (13)

Country Link
US (2) US11905312B2 (https=)
EP (1) EP3583220A4 (https=)
JP (2) JP7291397B2 (https=)
KR (1) KR20190117571A (https=)
CN (2) CN118978574A (https=)
AU (1) AU2018221738B2 (https=)
BR (1) BR112019016769A2 (https=)
CA (1) CA3052829A1 (https=)
EA (1) EA038695B1 (https=)
IL (2) IL268534B2 (https=)
MX (1) MX2019009720A (https=)
SG (1) SG11201907298WA (https=)
WO (1) WO2018152333A1 (https=)

Cited By (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10414803B2 (en) 2015-05-11 2019-09-17 Ucl Business Plc Capsid
US10745447B2 (en) 2015-09-28 2020-08-18 The University Of North Carolina At Chapel Hill Methods and compositions for antibody-evading virus vectors
WO2020206189A1 (en) * 2019-04-04 2020-10-08 Regenxbio Inc. Recombinant adeno-associated viruses and uses thereof
WO2021087007A1 (en) * 2019-10-28 2021-05-06 University Of Florida Research Foundation, Incorporated Gene therapy vectors
WO2021050614A3 (en) * 2019-09-09 2021-05-20 Massachusetts Eye And Ear Infirmary Methods and compositions for modulating the interaction between adeno-associated virus (aav) and the aav receptor (aavr) for altered bio-distribution of aav
WO2021102234A1 (en) * 2019-11-22 2021-05-27 The Children's Hospital Of Philadelphia Adeno-associated viral vector variants
WO2021163357A2 (en) 2020-02-13 2021-08-19 Tenaya Therapeutics, Inc. Gene therapy vectors for treating heart disease
WO2021168509A1 (en) * 2020-02-25 2021-09-02 Children's Medical Research Institute Adeno-associated virus capsid polypeptides and vectors
US11149256B2 (en) 2018-09-26 2021-10-19 California Institute Of Technology Adeno-associated virus compositions for targeted gene therapy
WO2022076750A3 (en) * 2020-10-07 2022-05-27 Regenxbio Inc. Recombinant adeno-associated viruses for cns or muscle delivery
WO2023283649A1 (en) 2021-07-08 2023-01-12 Tenaya Therapeutics, Inc. Optimized expression cassettes for gene therapy
WO2023023781A1 (en) * 2021-08-25 2023-03-02 Children's Medical Research Institute Modified aav capsid polypeptides and vectors
WO2023060272A3 (en) * 2021-10-07 2023-06-15 Regenxbio Inc. Recombinant adeno-associated viruses for cns tropic delivery
WO2023169115A1 (zh) * 2022-03-11 2023-09-14 上海勉亦生物科技有限公司 一种神经系统高亲和性的aav载体及其应用
US11759531B2 (en) 2020-02-13 2023-09-19 Tenaya Therapeutics, Inc. Gene therapy vectors for treating heart disease
WO2023201277A1 (en) * 2022-04-14 2023-10-19 Regenxbio Inc. Recombinant adeno-associated viruses for cns tropic delivery
US20230374541A1 (en) * 2020-10-07 2023-11-23 Regenxbio Inc. Recombinant adeno-associated viruses for cns or muscle delivery
US11905523B2 (en) 2019-10-17 2024-02-20 Ginkgo Bioworks, Inc. Adeno-associated viral vectors for treatment of Niemann-Pick Disease type-C
WO2024054864A1 (en) 2022-09-06 2024-03-14 Tenaya Therapeutics, Inc. Cardioprotective heart disease therapies
US11976096B2 (en) 2018-04-03 2024-05-07 Ginkgo Bioworks, Inc. Antibody-evading virus vectors
US11981914B2 (en) 2019-03-21 2024-05-14 Ginkgo Bioworks, Inc. Recombinant adeno-associated virus vectors
US11987801B2 (en) 2018-05-11 2024-05-21 Massachusetts Eye And Ear Infirmary Altering tissue tropism of adeno-associated viruses
US12060390B2 (en) 2018-04-03 2024-08-13 Ginkgo Bioworks, Inc. Antibody-evading virus vectors
US12104163B2 (en) 2020-08-19 2024-10-01 Sarepta Therapeutics, Inc. Adeno-associated virus vectors for treatment of Rett syndrome
US12116384B2 (en) 2018-04-03 2024-10-15 Ginkgo Bioworks, Inc. Virus vectors for targeting ophthalmic tissues
WO2024215655A1 (en) 2023-04-10 2024-10-17 Tenaya Therapeutics, Inc. Cardioprotective bag3 therapies
WO2024215653A1 (en) 2023-04-10 2024-10-17 Tenaya Therapeutics, Inc. Guide rnas, vectors, and virions for targeting mutations in the pln gene
JP2024161365A (ja) * 2019-01-31 2024-11-19 オレゴン・ヘルス・アンド・サイエンス・ユニバーシティ Aavキャプシドの転写依存性定方向進化を使用するための方法
US12146150B2 (en) 2017-09-29 2024-11-19 Voyager Therapeutics, Inc. Rescue of central and peripheral neurological phenotype of friedreich's ataxia by intravenous delivery
WO2025015388A1 (en) * 2023-07-20 2025-01-23 Children's Medical Research Institute Modified cardiotropic aav capsid polypeptides and vectors
US12281321B2 (en) 2018-09-28 2025-04-22 Voyager Therapeutics, Inc. Frataxin expression constructs having engineered promoters and methods of use thereof
MA64618B2 (fr) * 2021-08-20 2025-04-30 Joint Stock Company "Biocad" Protéine modifiée séparée vp1 de capside aav9
US12331331B2 (en) 2019-02-04 2025-06-17 Spur Therapeutics Limited Polynucleotides
EP4392436A4 (en) * 2021-08-25 2025-07-16 Childrens Medical Res Institute MODIFIED AAV VECTORS AND CAPSIDS
WO2025147741A1 (en) * 2024-01-11 2025-07-17 Children's Medical Research Institute Aav capsids and vectors for transduction of cells
RU2845941C1 (ru) * 2019-11-22 2025-08-28 Дзе Чилдрен'З Хоспитал Оф Филадельфия Варианты аденоассоциированного вирусного вектора
US12611436B2 (en) 2019-10-17 2026-04-28 Sarepta Therapeutics, Inc. AAV transfer cassette

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2018320849A1 (en) * 2017-08-25 2020-03-05 Ovid Therapeutics Inc. Recombinant adeno-associated vectors
WO2020014471A1 (en) 2018-07-11 2020-01-16 The Brigham And Women's Hospital, Inc. Methods and compositions for delivery of agents across the blood-brain barrier
WO2020219868A1 (en) * 2019-04-24 2020-10-29 Regenxbio Inc. Fully-human post-translationally modified antibody therapeutics
WO2021030764A1 (en) * 2019-08-14 2021-02-18 University Of Florida Research Foundation, Incorporated Aav capsid variants for gene therapy
CN115279400B (zh) 2020-01-10 2026-04-28 布里格姆妇女医院 用于跨血脑屏障递送免疫治疗剂以治疗脑癌的方法和组合物
CA3177869A1 (en) * 2020-05-05 2021-11-11 Duke University Cross-species compatible adeno-associated virus compositions and methods of use thereof
WO2022150634A2 (en) * 2021-01-08 2022-07-14 Massachusetts Eye And Ear Infirmary Methods and compositions for modulating the interaction between adeno-associated virus (aav) and the aav receptor (aavr) for altered bio-distribution of aav
EP4277524A4 (en) * 2021-01-13 2025-06-04 Duke University Compositions for and methods of improving fluid flux in the brain
WO2023288184A2 (en) * 2021-07-14 2023-01-19 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for treating chronic pain and for retrograde transduction of neurons
CN113563430B (zh) * 2021-07-30 2022-05-31 上海信致医药科技有限公司 用于治疗眼部疾病的基因递送系统及其应用
CN113480615B (zh) * 2021-07-30 2022-05-31 上海信致医药科技有限公司 高视网膜亲和性的新型腺相关病毒衣壳蛋白及其应用
CR20240137A (es) * 2021-08-20 2024-07-29 Biocad Joint Stock Co Método para obtener una cápside de virus adenoasociado modificada
KR102855674B1 (ko) * 2022-10-06 2025-09-08 주식회사 글루진테라퓨틱스 폐 기관지 특이적 유전자 전달이 가능한 아데노부속바이러스 벡터
KR102868933B1 (ko) * 2023-11-08 2025-10-14 주식회사 글루진테라퓨틱스 성상세포 특이적 유전자 전달이 가능한 아데노부속바이러스 벡터
WO2025121957A1 (ko) * 2023-12-06 2025-06-12 주식회사 글루진테라퓨틱스 뇌 성상교세포 특이적 유전자 전달이 가능한 아데노부속바이러스 변이체와 이의 응용
CN119405806A (zh) * 2024-10-25 2025-02-11 南通大学 小肌营养蛋白域含2抑制剂在制备促进神经生长药物中的应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030053990A1 (en) * 1998-11-10 2003-03-20 University Of North Carolina At Chapel Hill Virus vectors and methods of making and administering the same
WO2004027019A2 (en) * 2002-05-01 2004-04-01 University Of Florida Research Foundation, Inc. Improved raav expression systems for genetic modification of specific capsid proteins
US7252997B1 (en) * 1999-07-15 2007-08-07 Medigene Ag Structural protein of adeno-associated virus with modified antigenicity, its production and its use

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010093784A2 (en) * 2009-02-11 2010-08-19 The University Of North Carolina At Chapel Hill Modified virus vectors and methods of making and using the same
HK1202434A1 (en) * 2011-11-22 2015-10-02 The Children's Hospital Of Philadelphia Virus vectors for highly efficient transgene delivery
EP2900686B1 (en) * 2012-09-28 2020-06-10 The University of North Carolina At Chapel Hill Aav vectors targeted to oligodendrocytes
EP3151866B1 (en) * 2014-06-09 2023-03-08 Voyager Therapeutics, Inc. Chimeric capsids
WO2017015102A1 (en) * 2015-07-17 2017-01-26 The Trustees Of The University Of Pennsylvania Compositions and methods for achieving high levels of transduction in human liver cells

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030053990A1 (en) * 1998-11-10 2003-03-20 University Of North Carolina At Chapel Hill Virus vectors and methods of making and administering the same
US7252997B1 (en) * 1999-07-15 2007-08-07 Medigene Ag Structural protein of adeno-associated virus with modified antigenicity, its production and its use
WO2004027019A2 (en) * 2002-05-01 2004-04-01 University Of Florida Research Foundation, Inc. Improved raav expression systems for genetic modification of specific capsid proteins

Cited By (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10414803B2 (en) 2015-05-11 2019-09-17 Ucl Business Plc Capsid
US12138318B2 (en) 2015-05-11 2024-11-12 Ucl Business Ltd Capsid
US10745447B2 (en) 2015-09-28 2020-08-18 The University Of North Carolina At Chapel Hill Methods and compositions for antibody-evading virus vectors
US11840555B2 (en) 2015-09-28 2023-12-12 The University Of North Carolina At Chapel Hill Methods and compositions for antibody-evading virus vectors
US11208438B2 (en) 2015-09-28 2021-12-28 The University Of North Carolina At Chapel Hill Methods and compositions for antibody-evading virus vectors
US12146150B2 (en) 2017-09-29 2024-11-19 Voyager Therapeutics, Inc. Rescue of central and peripheral neurological phenotype of friedreich's ataxia by intravenous delivery
US11976096B2 (en) 2018-04-03 2024-05-07 Ginkgo Bioworks, Inc. Antibody-evading virus vectors
US12060390B2 (en) 2018-04-03 2024-08-13 Ginkgo Bioworks, Inc. Antibody-evading virus vectors
US12091435B2 (en) 2018-04-03 2024-09-17 Ginkgo Bioworks, Inc. Antibody-evading virus vectors
US12116384B2 (en) 2018-04-03 2024-10-15 Ginkgo Bioworks, Inc. Virus vectors for targeting ophthalmic tissues
US11987801B2 (en) 2018-05-11 2024-05-21 Massachusetts Eye And Ear Infirmary Altering tissue tropism of adeno-associated viruses
US11149256B2 (en) 2018-09-26 2021-10-19 California Institute Of Technology Adeno-associated virus compositions for targeted gene therapy
US12049648B2 (en) 2018-09-26 2024-07-30 California Institute Of Technology Adeno-associated virus compositions for targeted gene therapy
US12281321B2 (en) 2018-09-28 2025-04-22 Voyager Therapeutics, Inc. Frataxin expression constructs having engineered promoters and methods of use thereof
JP2024161365A (ja) * 2019-01-31 2024-11-19 オレゴン・ヘルス・アンド・サイエンス・ユニバーシティ Aavキャプシドの転写依存性定方向進化を使用するための方法
US12331331B2 (en) 2019-02-04 2025-06-17 Spur Therapeutics Limited Polynucleotides
US11981914B2 (en) 2019-03-21 2024-05-14 Ginkgo Bioworks, Inc. Recombinant adeno-associated virus vectors
WO2020206189A1 (en) * 2019-04-04 2020-10-08 Regenxbio Inc. Recombinant adeno-associated viruses and uses thereof
CN114667349A (zh) * 2019-09-09 2022-06-24 马萨诸塞眼科耳科诊所 用于调节腺相关病毒(aav)和aav受体(aavr)之间的相互作用以改变aav生物分布的方法和组合物
WO2021050614A3 (en) * 2019-09-09 2021-05-20 Massachusetts Eye And Ear Infirmary Methods and compositions for modulating the interaction between adeno-associated virus (aav) and the aav receptor (aavr) for altered bio-distribution of aav
US12570998B2 (en) 2019-09-09 2026-03-10 Massachusetts Eye & Ear Infirmary Methods and compositions for modulating the interaction between adeno-associated virus (AAV) and the AAV receptor (AAVR) for altered bio-distribution of AAV
US11905523B2 (en) 2019-10-17 2024-02-20 Ginkgo Bioworks, Inc. Adeno-associated viral vectors for treatment of Niemann-Pick Disease type-C
US12611436B2 (en) 2019-10-17 2026-04-28 Sarepta Therapeutics, Inc. AAV transfer cassette
WO2021087007A1 (en) * 2019-10-28 2021-05-06 University Of Florida Research Foundation, Incorporated Gene therapy vectors
CN115023242B (zh) * 2019-11-22 2025-03-14 费城儿童医院 腺相关病毒载体变体
CN115023242A (zh) * 2019-11-22 2022-09-06 费城儿童医院 腺相关病毒载体变体
EP4061427A4 (en) * 2019-11-22 2024-01-10 The Children's Hospital of Philadelphia Adeno-associated viral vector variants
RU2845941C1 (ru) * 2019-11-22 2025-08-28 Дзе Чилдрен'З Хоспитал Оф Филадельфия Варианты аденоассоциированного вирусного вектора
WO2021102234A1 (en) * 2019-11-22 2021-05-27 The Children's Hospital Of Philadelphia Adeno-associated viral vector variants
US12478691B2 (en) 2020-02-13 2025-11-25 Tenaya Therapeutics, Inc. Gene therapy vectors for treating heart disease
WO2021163357A2 (en) 2020-02-13 2021-08-19 Tenaya Therapeutics, Inc. Gene therapy vectors for treating heart disease
US11759531B2 (en) 2020-02-13 2023-09-19 Tenaya Therapeutics, Inc. Gene therapy vectors for treating heart disease
CN115836081A (zh) * 2020-02-25 2023-03-21 儿童医学研究院 腺相关病毒衣壳多肽及载体
WO2021168509A1 (en) * 2020-02-25 2021-09-02 Children's Medical Research Institute Adeno-associated virus capsid polypeptides and vectors
US12104163B2 (en) 2020-08-19 2024-10-01 Sarepta Therapeutics, Inc. Adeno-associated virus vectors for treatment of Rett syndrome
WO2022076750A3 (en) * 2020-10-07 2022-05-27 Regenxbio Inc. Recombinant adeno-associated viruses for cns or muscle delivery
US20230374541A1 (en) * 2020-10-07 2023-11-23 Regenxbio Inc. Recombinant adeno-associated viruses for cns or muscle delivery
WO2023283649A1 (en) 2021-07-08 2023-01-12 Tenaya Therapeutics, Inc. Optimized expression cassettes for gene therapy
MA64618B2 (fr) * 2021-08-20 2025-04-30 Joint Stock Company "Biocad" Protéine modifiée séparée vp1 de capside aav9
EP4392436A4 (en) * 2021-08-25 2025-07-16 Childrens Medical Res Institute MODIFIED AAV VECTORS AND CAPSIDS
EP4392435A4 (en) * 2021-08-25 2025-10-08 Childrens Medical Res Institute MODIFIED AAV CAPSID POLYPEPTIDES AND VECTORS
WO2023023781A1 (en) * 2021-08-25 2023-03-02 Children's Medical Research Institute Modified aav capsid polypeptides and vectors
WO2023060272A3 (en) * 2021-10-07 2023-06-15 Regenxbio Inc. Recombinant adeno-associated viruses for cns tropic delivery
WO2023169115A1 (zh) * 2022-03-11 2023-09-14 上海勉亦生物科技有限公司 一种神经系统高亲和性的aav载体及其应用
WO2023201277A1 (en) * 2022-04-14 2023-10-19 Regenxbio Inc. Recombinant adeno-associated viruses for cns tropic delivery
WO2024054864A1 (en) 2022-09-06 2024-03-14 Tenaya Therapeutics, Inc. Cardioprotective heart disease therapies
WO2024215653A1 (en) 2023-04-10 2024-10-17 Tenaya Therapeutics, Inc. Guide rnas, vectors, and virions for targeting mutations in the pln gene
WO2024215655A1 (en) 2023-04-10 2024-10-17 Tenaya Therapeutics, Inc. Cardioprotective bag3 therapies
WO2025015388A1 (en) * 2023-07-20 2025-01-23 Children's Medical Research Institute Modified cardiotropic aav capsid polypeptides and vectors
WO2025147741A1 (en) * 2024-01-11 2025-07-17 Children's Medical Research Institute Aav capsids and vectors for transduction of cells

Also Published As

Publication number Publication date
CA3052829A1 (en) 2018-08-23
IL268534B2 (en) 2024-10-01
EP3583220A1 (en) 2019-12-25
EA038695B1 (ru) 2021-10-06
AU2018221738B2 (en) 2024-06-27
US20240209031A1 (en) 2024-06-27
US11905312B2 (en) 2024-02-20
EA201991911A1 (ru) 2020-02-20
CN110520536B (zh) 2024-07-09
BR112019016769A2 (pt) 2020-05-26
KR20190117571A (ko) 2019-10-16
MX2019009720A (es) 2019-10-07
WO2018152333A9 (en) 2019-01-24
CN118978574A (zh) 2024-11-19
JP2023052541A (ja) 2023-04-11
IL268534A (en) 2019-09-26
EP3583220A4 (en) 2021-07-07
SG11201907298WA (en) 2019-09-27
JP7291397B2 (ja) 2023-06-15
IL268534B1 (en) 2024-06-01
JP2020505936A (ja) 2020-02-27
AU2018221738A1 (en) 2019-08-22
US20190367562A1 (en) 2019-12-05
IL312788A (en) 2024-07-01
JP7574508B2 (ja) 2024-10-29
CN110520536A (zh) 2019-11-29

Similar Documents

Publication Publication Date Title
US20240209031A1 (en) Methods and compositions for gene transfer across the vasculature
US12281335B2 (en) Methods and compositions for delivery of viral vectors across the blood-brain barrier
JP6042825B2 (ja) 改変された形質導入プロファイルを有するウイルスベクターならびにその製造および使用の方法
JP7406783B2 (ja) パルボウイルスベクターの高められた送達のための改変キャプシドタンパク質
EP3707257A1 (en) Methods and compositions for circular rna molecules
IL257628B2 (en) Methods and compositions for stealth virus antibody vectors
EP4277920A1 (en) Aav vectors targeting t-cells
HK40098902A (en) Viral vectors with modified transduction profiles and methods of making and using the same
HK1192565B (en) Viral vectors with modified transduction profiles and methods of making and using the same
HK1192565A (en) Viral vectors with modified transduction profiles and methods of making and using the same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18754551

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3052829

Country of ref document: CA

Ref document number: 2019542561

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019016769

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2018221738

Country of ref document: AU

Date of ref document: 20180215

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20197025393

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018754551

Country of ref document: EP

Effective date: 20190916

ENP Entry into the national phase

Ref document number: 112019016769

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190813

WWW Wipo information: withdrawn in national office

Ref document number: 312788

Country of ref document: IL

WWW Wipo information: withdrawn in national office

Ref document number: 755963

Country of ref document: NZ

WWW Wipo information: withdrawn in national office

Ref document number: 2018754551

Country of ref document: EP