WO2018105941A2 - 탈모방지 또는 발모촉진용 주사용 조성물 - Google Patents

탈모방지 또는 발모촉진용 주사용 조성물 Download PDF

Info

Publication number
WO2018105941A2
WO2018105941A2 PCT/KR2017/013758 KR2017013758W WO2018105941A2 WO 2018105941 A2 WO2018105941 A2 WO 2018105941A2 KR 2017013758 W KR2017013758 W KR 2017013758W WO 2018105941 A2 WO2018105941 A2 WO 2018105941A2
Authority
WO
WIPO (PCT)
Prior art keywords
keratin
pharmaceutical composition
hyaluronic acid
peroxide
hair
Prior art date
Application number
PCT/KR2017/013758
Other languages
English (en)
French (fr)
Other versions
WO2018105941A3 (ko
Inventor
황유식
김소연
반세영
Original Assignee
주식회사 케라메딕스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 케라메딕스 filed Critical 주식회사 케라메딕스
Publication of WO2018105941A2 publication Critical patent/WO2018105941A2/ko
Publication of WO2018105941A3 publication Critical patent/WO2018105941A3/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/715—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
    • A61K31/726—Glycosaminoglycans, i.e. mucopolysaccharides
    • A61K31/728—Hyaluronic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/40—Peroxides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A61K38/1748—Keratin; Cytokeratin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/06—Ointments; Bases therefor; Other semi-solid forms, e.g. creams, sticks, gels

Definitions

  • the present invention relates to an anti-hair loss or hair growth injectable composition
  • an anti-hair loss or hair growth injectable composition comprising pegylated keratin or keratin-hyaluronic acid complex hydrogel.
  • Hair loss refers to a condition in which hair is normally missing and genetic factors are known as the main causes. Recently, hair loss population is gradually increasing due to social stress, westernized eating habits such as environmental pollution and instant food, frequent perm and dyeing, and poor scalp management. However, no clear cause for hair loss has yet been identified, and in recent years, more and more people are suffering from alopecia, and their age is decreasing.
  • Conventional methods for treating alopecia include formulations based on female hormones related to hormonal theory, but there have been reports of skin inflammation, side effects caused by hormone administration, etc., and are currently discontinued.
  • Representative hair regrowth recently used, it was first developed and used to promote blood circulation, and it is known to have a hair growth effect as a side effect among patients using it, and then as a raw material for hair regrowth, the US Food and Drug Administration (FDA) Minoxidil (6-Amino-1,2-dihydro-1-hydroxy-2-imino-4-phenoxypyrimidine) of U.S. Patent No. 3,382,247 and U.S. Patent No. 5,215,894 approved by U.S. Pat. finasteride).
  • FDA Food and Drug Administration
  • the present inventors continue to study new therapeutic agents that can replace the existing hair regrowth, and confirm that pegylated keratin and keratin-hyaluronic acid complex hydrogels can promote hair growth and prevent hair loss.
  • the present invention has been completed.
  • Another object of the present invention is to provide an injectable pharmaceutical composition for preventing hair loss or promoting hair growth comprising a keratin-hyaluronic acid complex hydrogel.
  • the present invention provides an injectable pharmaceutical composition for preventing hair loss or promoting hair growth comprising a keratin-hyaluronic acid complex hydrogel.
  • the keratin may be any keratin commercially available, preferably keratin derived from human hair.
  • the keratin of the present invention is added to human hair in a mixture of chloroform and methanol in a ratio of 2: 1 to remove lipids, and stirred for 12 hours in a 2% peracetic acid peroxide solution, 5% 2-mercaptoethanol, 5 M urea, 2.6 M thiourea and 25 mM Tris-HCl, pH 8.5, can be obtained by reaction at 50 ° C. for 72 hours, but is not limited thereto, and a conventional method of obtaining keratin is provided. It can be obtained through.
  • the hyaluronic acid is a kind of polysaccharide composed of amino sugars and uronic acid present in tissues such as vitreous body, amniotic fluid, umbilical cord, joint fluid, pleural fluid or skin of an animal.
  • the hyaluronic acid may be any hyaluronic acid commercially available, preferably the sodium hyaluronate salt so that the keratin-hyaluronic acid complex can be formed well.
  • the molecular weight of the hyaluronic acid may be 1000 kDa to 4000 kDa, preferably 2000 kDa to 3000 kDa.
  • keratin-hyaluronic acid complex of the present invention
  • "-" may represent that the keratin and hyaluronic acid react to form a complex.
  • the keratin-hyaluronic acid complex may be formed through the amidation reaction of the carboxyl group of hyaluronic acid with an amine group of keratin, but is not limited thereto and may be formed through a conventional reaction used to form the complex.
  • the keratin-hyaluronic acid complex may promote hair regeneration.
  • the keratin-hyaluronic acid complex hydrogel was injected to analyze hair density and hair follicle formation. As a result, it was confirmed that the keratin-hyaluronic acid complex hydrogel promotes hair follicle formation and hair regeneration. Therefore, it can be seen that keratin-hyaluronic acid complex hydrogel can be used in the injectable pharmaceutical composition for preventing hair loss or promoting hair growth.
  • the pharmaceutical composition may further include a peroxide.
  • the peroxide is a compound in which an oxygen atom is added to an oxide, and in general, a compound including an anion or a peroxide ion having two oxygen atoms in a single bond.
  • the peroxide may be any one or more selected from the group consisting of carbamide peroxide, calcium peroxide and hydroperoxide, but is not limited thereto.
  • the hydroperoxide is a compound in which one hydrogen atom of hydrogen peroxide is substituted with an alkyl group or other organic atom group, and methyl hydroperoxide, ethyl hydroperoxide, propyl hydroperoxide, isopropyl hydroperoxide, etc. according to the type of the substituent. It may be, and more specifically may be hydrogen peroxide.
  • keratin-hyaluronic acid complex hydrogel containing peroxide after shaving the hair of the elderly rats with poor body function, the injection of keratin-hyaluronic acid complex hydrogel containing peroxide was analyzed to analyze hair density and hair follicle formation. As a result, it was confirmed that the keratin-hyaluronic acid complex hydrogel containing peroxide promotes hair follicle formation and hair regeneration. Therefore, it can be seen that keratin-hyaluronic acid complex hydrogel containing peroxide can be used in the injectable pharmaceutical composition for preventing hair loss or promoting hair growth.
  • the hydrogel of the present invention has the advantage that the peroxide is contained in the keratin-hyaluronic acid complex so that the peroxide and keratin, in particular the peroxide, can be continuously and stably administered, and can be easily applied to the skin.
  • the term "injection” refers to the use of a syringe to inject a drug solution into an intradermal, subcutaneous, intramuscular vein or artery.
  • the injection may be a subcutaneous injection, but the present invention is not limited thereto.
  • the syringe may be used as long as it is a syringe used for subcutaneously administering the pharmaceutical composition of the present invention as well as a general syringe capable of administering a drug solution through a needle.
  • the injectable pharmaceutical composition may be in the form of a liquid or dry powder.
  • the dry powder for injection may be administered to a subject by reconstitution with any one or more selected from water for injection, physiological saline, glucose solution, and amino acid solution when administered to a patient.
  • the amount of active ingredient included in the composition of the present invention depends on the condition of the subject to be administered, the desired degree of treatment, and the like.
  • the keratin-hyaluronic acid complex hydrogel of the present invention is 0.001 to 10 (w / v)%, specifically 0.01 (w / v)% to 5 (w / v)%, more specifically, compared to the injectable pharmaceutical composition. It may be included in a concentration of 0.05 to 2 (w / v)%.
  • the concentration of the keratin-hyaluronic acid complex hydrogel is less than 0.001 (w / v)%, hair loss prevention or hair growth promoting effect may be insufficient, and when the concentration of the keratin-hyaluronic acid complex hydrogel is more than 10 (w / v)%, the body may show side effects. there is a problem.
  • the hair growth of the elderly rats with impaired body function was sheared, and compared with the mice injected with keratin-hyaluronic acid complex hydrogel and the rats coated with keratin.
  • the keratin-coated mice showed no hair regeneration effect. Therefore, it can be seen that keratin-hyaluronic acid complex hydrogel can be used as an injectable preparation for anti-hair loss or hair growth promoting effect.
  • the composition may further comprise a percutaneous absorption enhancer (penetration enhancer).
  • penetration enhancer percutaneous absorption enhancer
  • the present invention is not limited thereto, and may be used in a pharmaceutical composition for injection, and may include a conventional promoter for promoting transdermal absorption of the active ingredient.
  • the sulfoxide is dimethyl sulfoxide (DMSO), dimethyl acetamide (dimethyl acetamide, DMAC), dimethyl formamide (dimethyl formamide, DMF), and decylmethyl sulfoxide (decylmethyl sulfoxide, DCMS) in the group containing Any one or more may be selected, but is not limited thereto.
  • DMSO dimethyl sulfoxide
  • DMAC dimethyl acetamide
  • DMF dimethyl formamide
  • DCMS decylmethyl sulfoxide
  • the pyrrolidione may be any one or more selected from the group consisting of N-methyl-2-pyrrolidone (NMP) and 2-pyrrolidone (2P), but is not limited thereto.
  • the azone may be 2-dodecylazacycloheptan-2-one or laurocapram.
  • the percutaneous absorption enhancer may be included in a conventionally acceptable amount in the composition for injection, depending on the type used.
  • composition of the present invention can be used alone or in combination with methods for using hormonal therapy, chemotherapy and biological response modifiers to prevent hair loss or promote hair growth.
  • the present invention provides an injectable pharmaceutical composition for preventing hair loss or promoting hair growth, comprising a PEGylated keratin composition.
  • pegylated can be used interchangeably with “PEGylated” or “pegylated”.
  • the pegylated keratin means a substance in which polyethylene glycol (PEG) is bonded to an amino acid residue of keratin.
  • PEG polyethylene glycol
  • the polyethylene glycol may be bound to any amino acid residue of keratin without limitation, and may specifically bind to an amine group.
  • the polyethylene glycol is, for example, O-methyl-O ⁇ -succinyl polyethylene glycol, dibasic polyethylene glycol, ⁇ , ⁇ -bis (2-carboxyethyl-polyethylene glycol, O, O ⁇ - Bis (2-bromoethyl) polyethyleneglycol, O, O ⁇ -bis (2-chloroethyl) polyethyleneglycol, polyethyleneglycol dimesyl acid, methoxypolyethyleneglycol acetic acid, O- [2- (3-succinylamino) Ethyl] -O ⁇ -methyl-polyethyleneglycol, O- (2-bromoethyl) -O ⁇ -methylpolyethyleneglycol, O- (2-chloroethyl) -O ⁇ -methylpolyethyleneglycol, polyethyleneglycol monomethyl ether mesyl Acid, aldehyde functionalized polyethylene glycol, glycidyl ether functionalized polyethylene glycol, alde
  • the pegylated keratin may promote hair regeneration.
  • pegylated keratin is treated to outer root sheath (ORS) cells and dermal papilla (DP) cells known to be responsible for hair growth.
  • ORS outer root sheath
  • DP dermal papilla
  • Cell proliferation was increased and expression of beta catenin, sox-2, cd133 and sox9 genes, which are involved in hair growth, was increased.
  • the hair of the back part of the elderly rats with poor body function was cut, and then the pegylated keratin was injected to analyze hair density and hair follicle formation.
  • pegylated keratin promotes hair follicle formation and hair regeneration. Accordingly, it has been found that pegylated keratin may be used in injectable pharmaceutical compositions for preventing hair loss or promoting hair growth.
  • the pharmaceutical composition may further include a peroxide.
  • the peroxide is the same as described above.
  • the pegylated keratin solution containing peroxide was injected to analyze the density of hair growth and the formation of hair follicles. As a result, it was confirmed that the pegylated keratin solution containing peroxide promoted the formation of hair follicles and hair regeneration. Accordingly, it has been found that pegylated keratin solutions containing peroxides can be used in injectable pharmaceutical compositions for preventing hair loss or promoting hair growth.
  • the injectable pharmaceutical composition may be in the form of a liquid or dry powder.
  • the dry powder for injection may be administered to a subject by reconstitution with any one or more selected from water for injection, physiological saline, glucose solution, and amino acid solution when administered to a patient.
  • the amount of active ingredient included in the composition of the present invention depends on the condition of the subject to be administered, the desired degree of treatment, and the like. Specifically, pegylated keratin of the present invention is 0.001 to 10 (w / v)%, specifically 0.01 (w / v)% to 5 (w / v)%, more specifically 0.05 compared to the pharmaceutical composition for injection To 2 (w / v)% concentration.
  • the composition may further comprise a percutaneous absorption enhancer (penetration enhancer).
  • penetration enhancer percutaneous absorption enhancer
  • the percutaneous absorption enhancer is the same as described above.
  • the present invention provides a method for reacting S1) hyaluronic acid salt with 4- (4,6-dimethoxy-1,3,5-triazin-2-yl) 4-methoxymorpholinium chloride (DMTMM). step; And S2) provides a method for producing a keratin-hyaluronic acid complex hydrogel comprising the step of reacting the material produced in step S1) with keratin.
  • DTMM 4- (4,6-dimethoxy-1,3,5-triazin-2-yl) 4-methoxymorpholinium chloride
  • S3) provides a method for producing a keratin-hyaluronic acid composite hydrogel comprising a peroxide further comprising the step of reacting the material produced in step S2) with a peroxide.
  • Step S1) is preparing a carboxyl group of the hyaluronic acid salt to react with the amine residue of the amino acid of keratin
  • step S2) amidating the carboxyl group of the hyaluronic acid salt with the amine residue of the amino acid of keratin keratin Generating a hyaluronic acid complex
  • step S3) is a step of preparing a hydrogel including peroxide in the keratin-hyaluronic acid complex.
  • the present invention provides S1) O-methyl-O ⁇ -succinyl polyethylene glycol 4- (4,6-dimethoxy-1,3,5-triazin-2-yl) 4-methoxymolpoly Reacting with nium chloride (DMTMM); S2) Provides a method for producing pegylated keratin, comprising the step of reacting the material produced in step S1) with keratin.
  • DTMM nium chloride
  • S3) provides a method for producing pegylated keratin containing peroxide, further comprising the step of reacting the material produced in step S2) with a peroxide.
  • the step S1) is a step of activating the succinic acid functional group of O-methyl-O ⁇ -succinyl polyethylene glycol
  • the step S2) is a amine residue of the amino acid of keratin reacts with the succinyl group to generate pegylated keratin
  • the step S3) is a step of including a peroxide in the pegylated keratin.
  • the present invention provides a method for preventing or promoting hair loss, comprising administering to a subject an injectable pharmaceutical composition comprising pegylated keratin or keratin-hyaluronic acid complex hydrogel.
  • pegylated keratin and “keratin-hyaluronic acid complex hydrogel” are the same as described above.
  • administration is meant the introduction of certain substances into the subject in a suitable manner.
  • the composition is injected into a subject to exhibit a hair loss prevention or hair growth effect, the administration may be subcutaneous administration.
  • the term "individual” means all animals, such as rats, mice, and livestock, including humans, in whom hair loss symptoms may occur or may occur. Specifically, it may be a mammal including a human.
  • Injectable pharmaceutical compositions comprising keratin-hyaluronic acid complex hydrogels or pegylated keratin of the present invention promote hair growth and hair follicle formation. Therefore, the pharmaceutical composition of the present invention can be used as a therapeutic agent for preventing hair loss or promoting hair growth.
  • 1 is a schematic of a process for preparing pegylated keratin.
  • Figure 3 is a schematic of the method for preparing the keratin-hyaluronic acid complex.
  • Figure 5a is a graph showing the survival rate of pegylated keratin-treated dermal fibroblasts.
  • Figure 5b is a graph showing the survival rate of dermal fibroblasts treated with keratin-hyaluronic acid complex.
  • Figure 6a is a graph showing the particle size of the nanoparticles formed by the self-aggregated pegylated keratin.
  • 6B is a diagram showing TEM particles of nanoparticles formed by self-aggregation of pegylated keratin.
  • Figure 7a is a diagram showing the clonal activity and cellular activity of pegylated keratin-treated hair follicle cells.
  • Figure 7b is a diagram showing the cell activity of PEGylated keratin-treated dermal papilla cells.
  • 8A is a graph showing cell proliferation of pegylated keratin-treated hair follicle cells.
  • 8B is a graph showing cell proliferation of PEGylated keratin-treated dermal papilla cells.
  • Figure 9a is a graph showing the expression level of beta-catenin and sox-9 molecules related to hair regeneration of hair follicle cells after treatment of pegylated keratin.
  • FIG. 9B is a graph showing the expression levels of beta-catenin, EGF-receptor and sox9 genes involved in stem cell traits of myopic cells after treatment with PEGylated keratin.
  • Figure 10a is a graph showing the expression level of beta-catenin, sox-2, ALPase and CD133 molecules, hair growth related factors of hair papilla cells after treatment with PEGylated keratin.
  • FIG. 10B is a graph showing the expression levels of beta-catenin, sox-2, BMP6, FGF7 and FGF10 genes involved in stem cell appearance of myopic cells after treatment with PEGylated keratin.
  • FIG. 10B is a graph showing the expression levels of beta-catenin, sox-2, BMP6, FGF7 and FGF10 genes involved in stem cell appearance of myopic cells after treatment with PEGylated keratin.
  • Figure 11a is a diagram showing the hair growth effect 2 weeks after injection of pegylated keratin or keratin-hyaluronic acid complex in the hair removed mice.
  • FIG. 11B is a diagram showing the degree of hair follicle formation by staining with hematoxylin-eosin 2 weeks after injection of pegylated keratin or keratin-hyaluronic acid complex in the hair-removed mice.
  • FIG. 11C is a graph showing the number of hair follicle formation at each stage of hair growth two weeks after injection of pegylated keratin or keratin-hyaluronic acid complex in dehaired mice.
  • FIG. 11D is a graph showing the number of newly formed hair follicles two weeks after injection of pegylated keratin or keratin-hyaluronic acid complexes in dehaired mice.
  • FIG. 11E is a graph showing the size of hair follicles formed two weeks after injection of pegylated keratin or keratin-hyaluronic acid complex in dehaired mice.
  • FIG. 11F is a graph showing the degree of uniformity of hair follicle size formed two weeks after injection of pegylated keratin or keratin-hyaluronic acid complex in dehaired mice.
  • 12a is a photograph showing a method of treating keratin-hyaluronic acid conjugate hydrogel containing H 2 O 2 at the hair-cut site.
  • Figure 12b is a diagram showing the degree of hair follicle formation after injection of keratin-hyaluronic acid complex hydrogel containing hydrogen peroxide or pegylated keratin containing hydrogen peroxide in the hair removed mice.
  • 12C is a graph showing the number of hair follicle formation at each stage of hair growth after injection of keratin-hyaluronic acid complex hydrogel with hydrogen peroxide and pegylated keratin with hydrogen peroxide.
  • Human hair was washed with a mild detergent and then washed several times with distilled water.
  • the hairs were placed in a beaker to remove lipids, and the mixture was added to a mixture of chloroform and methanol in a ratio of 2: 1 until the hairs were submerged. After 24 hours, the hair was air-dried after washing several times with distilled water until no solution used for removing lipids remained in the hair.
  • 20 g of dried hair was added to 800 mL of 2% acetic acid peroxide (Sigma aldrich) and stirred at 300 rpm for 12 hours at 37 ° C. After 12 hours, the hairs were sieved and washed with distilled water to remove the remaining oxides.
  • the hairs were placed in 400 mL Shindai solution (5% 2-mercaptoethanol, 5 M urea, 2.6 M thiourea (or above Sigma aldrich) and 25 mM Tris-HCl (pH 8.5)) at 50 ° C and 400 rpm. The reaction was carried out for 72 hours under the conditions. The hair solution was then placed in a 50 mL tube and centrifuged for 20 minutes at 3500 rpm. Supernatants were collected and dialyzed using a 12-14 kDa cutoff Spectra / Por®4 dialysis membrane (Spectrum). Keratin powder was prepared by freeze-drying the dialysis of the keratin liquid sample.
  • PEGylated keratin was synthesized by the reaction shown in FIG. 1.
  • keratin powder was weighed with an electronic scale (0.001 g to 620 g, AJ-620E) for measuring the microcomponent unit coefficient and placed in a 500 mL Pyrex beaker (ISOLAB, YLS, Germany). 100 mL of tertiary water was added to the beaker and stirred for 24 hours at a speed of 300 rpm using a 40 ⁇ 8 mm magnetic stir bar ([B00C3ME4ZA], 1572500 IKAFLON 40, IKA) and MS-H-S10 10-Channel magnetic stirrer. It was.
  • the keratin solution and the combined solution of mPEG and DMTMM were placed in a 500 mL beaker and at room temperature at 500 rpm using a 40 ⁇ 8 mm magnetic stirring rod (1572500 IKAFLON 40, IKA) and MS-H-S10 10-Channel magnetic stirrer. Stirred for 3 days to react the PEG and keratin.
  • Pegylated keratin obtained in Preparation Example 2-2 was analyzed by NMR. As a result, as shown in FIG. 2, it was confirmed that the peaks specifically expressed in keratin and PEG were present in the pegylated keratin, respectively.
  • pegylated keratin PEGylated Keratin
  • 20 mg of pegylated keratin was added to 1 mL of the prepared 500 uM H 2 O 2 solution and vortexed for 5 minutes to prepare a pegylated keratin solution containing 500 uM of H 2 O 2.
  • the vial containing the prepared solution was stored in a nylon vacuum packaging machine 150X200mm (NY / PEL-LDPE) (80um) using a pneumatic vacuum packaging machine.
  • the keratin-hyaluronic acid complex was synthesized by the reaction shown in FIG. 3.
  • HA hyaluronic acid sodium salt
  • a solution of sodium hyaluronate salt and DMTMM reacted was placed in a Spectra / Por permeable membrane tube (16 mm diameter, 25 mm width, MW10000, Spectrum) and immersed in 4 L distilled water to precipitate DMTMM after the reaction.
  • a 40 ⁇ 8 mm magnetic stir bar [B00C3ME4ZA], 1572500 IKAFLON 40, IKA) and MS-H-S10 10-Channel magnetic stirrer were removed using a stirrer at room temperature for 24 hours at 500 rpm.
  • Keratin Powder (Molecular Weight: 4 ⁇ 60000 Da) Measure 1200mg weight, dissolve in 300mL distilled water, and carboxyl group of the solution of sodium hyaluronate salt and DMTMM react with amine group of keratin to make final molar concentration of 8: 2 Synthesized as much as possible.
  • a 40 ⁇ 8 mm magnetic stir bar [B00C3ME4ZA], 1572500 IKAFLON 40, IKA) and MS-H-S10 10-Channel magnetic stirrer were synthesized using a stirrer at room temperature for 3 days at 500 rpm.
  • the reacted keratin and DMTMM were completely removed in the hyaluronic acid-keratin solution. At this time, every 3 hours was changed to fresh 4 L of distilled water, and dialyzed while changing the distilled water for 5 days at room temperature. Finally, the finished hyaluronic acid-keratin solution was divided into 50 mL centrifuge tubes (17 ⁇ 120 mm, BD Falcon) in 35 mL portions, and then -70 ° C. (Nihon freezer, Upright type, Single cooling type, 542l). And completely frozen for 24 hours.
  • the centrifuge tube was opened, placed in a lyophilizer (ALPHA 2-4 LSC PLUS, Laboratory freeze dryers, Christ) and dried for at least 3 days to form a complete powder in vacuo to obtain a final hyaluronic acid-keratin gel powder.
  • APHA 2-4 LSC PLUS Laboratory freeze dryers, Christ
  • the hyaluronic acid-keratin powder obtained in Preparation Example 3-2 was used to measure the weight of 25 mg using a micro-component unit coefficient measurement electronic scale ((0.001 g to 620 g) AJ-620E). Then, 102 ⁇ L of H 2 O 2 was added to 898 ⁇ L of tertiary distilled water to make 1 mL of 1 M of final concentration, and then 3 ⁇ L of 1 M H 2 O 2 solution was added to 1 mL of distilled water to make 3 mM H 2 O 2 solution.
  • hyaluronic acid-keratin powder in 3mM H2O2 solution, and vortex for 5 minutes, and put it in 50 mL centrifuge tube (17 ⁇ 120 mm, BD Falcon) to mix and dissolve the hyaluronic acid-keratin powder uniformly. Centrifugation for a minute to prepare a keratin-Hyaluronic acid Conjugate hydrogel containing H2O2.
  • the glass gel containing the prepared hydrogel was stored in a nylon vacuum packaging machine 150X200mm (NY / PEL-LDPE) (80um) using a pneumatic vacuum packaging machine.
  • keratin is a hydrophobic protein, which dissolves only in a strong alkaline solution of pH 10 or higher, so that the pegylated keratin solution prepared according to Preparation Examples 2-1 and 2-2 can be used as a biomaterial.
  • keratin is a hydrophobic protein, which dissolves only in a strong alkaline solution of pH 10 or higher, so that the pegylated keratin solution prepared according to Preparation Examples 2-1 and 2-2 can be used as a biomaterial.
  • the PEGylated keratin solution by concentration was dissolved in water of neutral pH, and then the degree of turbidity was visually evaluated.
  • pegylated keratin solution can be used as a preparation for injection because of high solubility in the body.
  • human fetal fibroblasts were inoculated in 5 x 103 pieces in a 24-well plate, and after 24 hours, the medium was concentrated in DMEM medium or 0.5%, 1% and 2% (w / v) PEGylated keratin. Or it was replaced with a high concentration of DMEM normal medium containing keratin-hyaluronic acid complex. After culturing for another 24 hours, Live & Dead assay and cell proliferation assay were performed.
  • Live / Dead viability / cytotoxicity kit (invitrogen) was used when performing the Live & Dead assay. After removing the medium, 0.5 ⁇ l of calcein (Calcein) and 2.0 ⁇ l of Ethidium Homodimer were added to each well washed with DPBS, and 200 ⁇ l of the mixed solution was added thereto. Light was blocked with aluminum foil, incubated at 37 ° C. for 10 minutes, washed with DPBS, and observed with a fluorescence microscope (Olympus BX51).
  • pegylated keratin and keratin-hyaluronic acid complex did not show cytotoxicity was found to be harmless to the human body.
  • pegylated keratin was added to phosphate buffered saline (PBS) at pH 7.4 at a concentration of 2 mg / ml, followed by stirring to form nanoparticles consisting of pegylated keratin.
  • PBS phosphate buffered saline
  • the average hydrodynamic diameter of the pegylated keratin nanoparticles then obtained was calculated via dynamic light scattering.
  • Pegylated keratin nanoparticles were also examined by transmission electron microscopy (TEM).
  • pegylated keratin forms nanoparticles by self-assembly, and it was confirmed that the size of the nanoparticles formed was 100 nm or less (FIGS. 6A and 6B).
  • pegylated keratin forms nanoparticles of appropriate size in the body, and thus is suitable for use as an injectable preparation.
  • Example 2 in laboratory Pegylated Confirmation of proliferation of keratin hair regeneration-related cells
  • ORS human outer root sheath
  • DP dermal papilla
  • Live / Dead viability / cytotoxicity kit (invitrogen) was used when performing the Live & Dead assay. After removing the medium, 0.5 ⁇ l of calcein (Calcein) and 2.0 ⁇ l of Ethidium Homodimer were added to each well washed with DPBS, and 200 ⁇ l of the mixed solution was added thereto. Light was blocked with aluminum foil, incubated at 37 ° C. for 10 minutes, washed with DPBS, and observed with a fluorescence microscope (Olympus BX51).
  • each well was placed in a Cell Counting Kit-8 solution (Dojindo laboratory) diluted 10-fold with ORS medium or DP medium, light was blocked with aluminum foil, and then incubated at 37 ° C. for 1 hour 30 minutes. After incubation, 100 ⁇ l of each well was transferred to a 96 well plate and absorbed at 450 nm wavelength (OD 450 nm) using a 96 well format plate reader (ELX 800 universal microplate reader, Bio Tek, Inc.) instrument. Measured.
  • ORS human root sheath cells were inoculated 5 ⁇ 10 4 in 6 well plates and replaced with ORS medium containing ORS medium or 2% (w / v) PEGylated keratin after 24 hours. . After incubation for 1, 3 and 5 days, the expression levels of beta catenin, sox-9, and EGF-receptor were measured by immunochemical staining and RT-PCR analysis.
  • RNA extraction was used for RNA extraction, and the extracted RNA was quantified using a nanodrop (MICROP UV-Vis Spectrophotometer M600). 1 ⁇ g of RNA was added to AccuPower Cycle Script RT Premix (Bioneer, Daejeon, Korea) and cDNA was made using a thermal cycler (T106, Bio-Rad). The primer sequences used are shown in Table 1 below.
  • DP cells human dermal papilla (DP) cells were inoculated in microwells with polyethyleneglycol to form cell spheroids for one day, and then the formed cell spheroids were inoculated in 20 6-well plates. After 24 hours it was replaced with DP medium or DP medium containing 2% (w / v) PEGylated keratin. After incubation for 1, 3 and 5 days, the expression levels of beta catenin, sox-2, CD133, and alkaline phosphatase were analyzed by immunochemical staining and RT-PCR analysis. Measured.
  • RNA extraction was used for RNA extraction, and the extracted RNA was quantified using a nanodrop (MICROP UV-Vis Spectrophotometer M600). 1 ⁇ g of RNA was added to AccuPower Cycle Script RT Premix (Bioneer, Daejeon, Korea) and cDNA was made using a thermal cycler (T106, Bio-Rad). The sequences of the used primers are shown in Table 2 below.
  • Examples 2-1 and 2-2 pegylated keratin was found to induce early proliferation of stem cells involved in hair regeneration and increase stem cellity to effectively induce hair regeneration. .
  • Keratin-Hyaluronic acid Conjugate hydrogel containing hydrogen peroxide (3 mM), PEGylated keratin solution containing hydrogen peroxide (500 uM), Hydrogen peroxide solution (500 uM) was injected subcutaneously using a needleless syringe for 200 ⁇ l each (FIG. 12A).
  • rats which had not been treated after shaving were used.
  • the cut hairs were observed with a stereomicroscope (SZX16, Olympus), and after sacrifice, tissue specimens were obtained and stained with hematoxylin and eosin (H & E).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Dermatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Inorganic Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)

Abstract

본 발명은 페길화된 케라틴 또는 케라틴-히알루론산 복합체를 포함하는 탈모 방지 또는 발모 촉진용 주사용 약학 조성물에 대한 것으로, 상기 조성물은 모낭 발생 및 발모 성장 촉진 효과가 우수하여, 탈모의 예방 및 치료제 또는 발모 촉진제로 유용하게 사용될 수 있다.

Description

탈모방지 또는 발모촉진용 주사용 조성물
본 출원은 2016년 12월 08일자 한국 특허 출원 제10-2016-0166851호에 기초한 우선권의 이익을 주장하며, 해당 한국 특허 출원의 문헌에 개시된 모든 내용은 본 명세서의 일부로서 포함한다.
본 발명은 페길화된 케라틴 또는 케라틴-히알루론산 복합체 하이드로젤을 포함하는 탈모방지 또는 발모촉진용 주사용 조성물에 대한 것이다.
탈모란 정상적으로 모발이 있어야 할 곳에 모발이 없는 상태를 말하며 유전적 요인이 가장 주요한 원인으로 알려져 있다. 최근 사회적 스트레스의 증가와 더불어 환경오염 및 인스턴트 식품 등 서구화된 식습관, 잦은 파마와 염색, 잘못된 두피관리들로 인하여 탈모 인구가 점차 증가하고 있는 추세이다. 그러나 아직까지 탈모에 대한 명확한 원인은 규명되고 있지 않았고, 최근 들어 오히려 탈모증으로 고민하는 사람이 점점 늘고 있으며 그 연령층도 낮아지고 있는 실정이다.
탈모증의 치료법에 관해서도 아직까지 뚜렷한 효과를 지닌 것은 없으며, 동의보감에서는 신응양진단 등 탈모에 관계되는 몇몇 복용하는 처방들이 있고, 호마유(참깨) 등을 탈모 부위에 마사지한다든지, 특정 한약처방을 주침해서 바르는 방법과 특정 혈위를 자극하는 방법 등이 있지만 효과에 있어서는 개인적 차이가 많다고 알려져 있다. 또한, 일반적으로 적용될 수 있는 신약 소재는 아직까지 보고되지 않고 있다.
종래의 탈모증 치료방법으로는, 호르몬설과 관련하여 여성 호르몬을 주재로 한 제제가 있으나 피부 염증 발생, 호르몬 투여에 의한 부작용 발생 등의 보고가 있어 현재는 사용이 중단되고 있다. 최근 사용되고 있는 대표적인 발모제로는, 처음에는 혈액 순환 촉진을 위한 용도로 개발되어 사용되다가 이를 사용하는 환자들 사이에서 부작용으로 발모 효과를 나타내는 것으로 알려져, 이후, 발모용 원료로 미국식품의약품안전청(FDA)에서 승인받아 발모 치료제로 사용되고 있는 미국특허 제3,382,247호의 미녹시딜(6-Amino-1,2-dihydro-1-hydroxy-2-imino-4-phenoxypyrimidine)및 미국특허 제 5,215,894 호에서 언급된 머크사의 피나스테라이드(finasteride)가 있다.
그러나, 미녹시딜의 경우 끈적이는 사용감과 피부에 자극을 유발하는 부작용이 보고된 바 있으며, 피나스테라이드의 경우 현재 경구투여용 제제로 사용되고 있으나, 이의 섭취에 따라 성기능 장애 등의 부작용이 보고된 일도있을 뿐 아니라, 탈모에 대해서도 꾸준한 복용이 이루어져야만 효과가 있다는 부작용이 있다.
이에, 본 발명자들은 기존의 발모제를 대체할 수 있는 새로운 치료제에 관하여 연구를 계속하던 중, 페길화된 케라틴 및 케라틴-히알루론산 복합체 하이드로젤이 발모를 촉진하고, 탈모를 방지할 수 있음을 확인하고 본 발명을 완성하였다.
본 발명의 목적은 페길화된 케라틴을 포함하는 탈모방지 또는 발모촉진용 주사용 약학 조성물을 제공하는 것이다.
본 발명의 다른 목적은 케라틴-히알루론산 복합체 하이드로젤을 포함하는 탈모방지 또는 발모촉진용 주사용 약학 조성물을 제공하는 것이다.
상기 목적을 수행하기 위한 하나의 양태로서, 본 발명은 케라틴-히알루론산 복합체 하이드로젤을 포함하는 탈모방지 또는 발모 촉진용 주사용 약학 조성물을 제공한다.
상기 케라틴은 상업적으로 이용가능한 임의의 케라틴일 수 있고, 바람직하게는 사람 머리카락 유래의 케라틴일수 있다.
구체적으로, 본 발명의 케라틴은 사람 머리카락을 클로로포름과 메탄올을 2:1의 비율로 섞은 혼합액에 넣어 지질을 제거하고, 2 % 과산화아세트산 용액에서 12시간 교반한 후, 5 % 2-머캅토에탄올, 5 M 우레아, 2.6 M 티오우레아 및 25 mM Tris-HCl(pH 8.5)에 넣고, 50 ℃에서 72시간동안 반응시켜 수득할 수 있으나, 이에 제한되는 것은 아니고, 케라틴을 수득할 수 있는 통상적인 방법을 통해 수득할 수 있다.
상기 히알루론산은 동물의 초자체, 양수, 탯줄, 관절액, 늑막액 또는 피부 등의 조직에 존재하는, 아미노당과 우론산으로 이루어진 다당류의 일종이다. 상기 히알루론산은 상업적으로 이용가능한 임의의 히알루론산일 수 있으며, 바람직하게는 케라틴-히알루론산 복합체가 잘 형성될 수 있도록 히알루론산 나트륨 염일 수 있다.
상기 히알루론산의 분자량은 1000 kDa 내지 4000 kDa일 수 있으며, 바람직하게는 2000 kDa 내지 3000 kDa 일 수 있다.
본 발명의 케라틴-히알루론산 복합체에 있어서, 상기 "-"는 케라틴과 히알루론산이 반응하여 복합체를 형성한 것을 나타낼 수 있다. 구체적으로 상기 케라틴-히알루론산 복합체는 히알루론산의 카르복실기가 케라틴의 아민기와 아미드화 반응을 통해 형성될 수 있으나, 이에 제한되는 것은 아니며 복합체를 형성하는데 사용되는 통상적인 반응을 통해 형성될 수 있다.
상기 케라틴-히알루론산 복합체는 모발재생을 촉진할 수 있다.
본 발명의 구체적인 일 실시예에서, 신체 기능이 떨어진 노령쥐의 등 부분의 털을 깎은 후, 케라틴-히알루론산 복합체 하이드로젤을 주사하여 털이 자란 밀도와 모낭의 형성을 분석하였다. 그 결과, 케라틴-히알루론산 복합체 하이드로젤이 모낭의 형성 및 모발의 재생을 촉진함을 확인하였다. 따라서, 케라틴-히알루론산 복합체 하이드로젤이 탈모방지 또는 발모촉진용 주사용 약학 조성물에 사용될 수 있음을 알 수 있었다.
본 발명에 있어서, 상기 약학 조성물은 과산화물을 추가적으로 포함할 수 있다.
상기 과산화물은 산화물에 산소 원자가 더해진 화합물로서, 일반적으로 산소 원자 2개가 단일 결합을 한 음이온이나 과산화 이온을 포함하는 화합물일 수 있다.
구체적으로, 상기 과산화물은 카바마이드 퍼옥사이드, 칼슘 퍼옥사이드 및 하이드로퍼옥사이드를 포함하는 군에서 선택된 어느 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
상기 하이드로퍼옥사이드는 과산화수소의 수소 1원자를 알킬기 또는 그 외의 유기 원자단으로 치환한 화합물로서, 치환기의 종류에 따라 메틸 하이드로퍼옥사이드, 에틸 하이드로퍼옥사이드, 프로필 하이드로퍼옥사이드, 및 이소프로필 하이드로퍼옥사이드 등 일 수 있고, 보다 구체적으로 과산화수소일 수 있다.
본 발명의 구체적인 일 실시예에서, 신체 기능이 떨어진 노령쥐의 등 부분의 털을 깎은 후, 과산화물을 포함하는 케라틴-히알루론산 복합체 하이드로젤을 주사하여 털이 자란 밀도와 모낭의 형성을 분석하였다. 그 결과, 과산화물을 포함하는 케라틴-히알루론산 복합체 하이드로젤이 모낭의 형성 및 모발의 재생을 촉진함을 확인하였다. 따라서, 과산화물을 포함하는 케라틴-히알루론산 복합체 하이드로젤이 탈모방지 또는 발모촉진용 주사용 약학 조성물에 사용될 수 있음을 알 수 있었다.
본 발명의 하이드로젤은 과산화물이 케라틴-히알루론산 복합체에 포함되어 있어 과산화물과 케라틴, 특히 과산화물이 지속적이고 안정적으로 투여될 수 있고, 피부에 용이하게 적용될 수 있는 이점이 있다.
본 발명에 있어서, 용어 "주사"는 주사기를 사용하여 약액을 피내, 피하, 근육 내 정맥 내 또는 동맥 내 등에 주입하는 것이다. 구체적으로 본 발명의 약학적 조성물이 탈모방지 또는 발모촉진 효능을 나타내는 특성상 상기 주사는 피하 주사일 수 있으나 이에 제한되는 것은 아니다. 상기 주사기는 바늘을 통해 약액의 투여가 가능한 일반적인 주사기 뿐만 아니라 본 발명의 약학적 조성물을 피하로 투여하기 위해 사용되는 주사기라면 제한없이 사용 가능하다.
본 발명에 있어서, 상기 주사용 약학 조성물은 액제 또는 건조분말의 형태일 수 있다. 상기 주사용 건조분말은 환자에게 투여시 주사용수, 생리식염수, 포도당액, 및 아미노산액에서 선택된 어느 하나 이상과 재구성하여 개체에 투여될 수 있다.
본 발명의 조성물에 포함된 활성성분의 양은 투여 대상 개체의 상태, 목적하는 치료 정도 등에 따라서 달라진다. 구체적으로, 본 발명의 케라틴-히알루론산 복합체 하이드로젤은 주사용 약학 조성물 대비 0.001 내지 10(w/v)%, 구체적으로는 0.01(w/v)% 내지 5(w/v)%, 더욱 구체적으로는 0.05 내지 2(w/v)% 농도로 포함될 수 있다.
상기 케라틴-히알루론산 복합체 하이드로젤의 농도가 0.001(w/v)% 미만인 경우, 탈모방지 또는 발모촉진 효과가 미비할 수 있고, 10(w/v)% 초과인 경우, 체내 부작용을 나타낼 수 있는 문제가 있다.
본 발명의 구체적인 일 실시예에서, 신체 기능이 떨어진 노령쥐의 등 부분의 털을 깎은 후, 케라틴-히알루론산 복합체 하이드로젤을 주사한 쥐과 케라틴을 도포한 쥐의 모발 성장 정도를 비교하였다. 그 결과, 케라틴-히알루론산 복합체 하이드로젤을 주사한 군과 달리, 케라틴을 도포한 쥐는 모발 재생 효과가 전혀 나타나지 않음을 확인하였다. 따라서, 케라틴-히알루론산 복합체 하이드로젤이 탈모방지 또는 발모촉진 효과를 위해 주사용 제제로 사용될 수 있음을 알 수 있었다.
본 발명에 있어서, 상기 조성물은 경피흡수 촉진제(penetration enhancer)를 추가로 포함할 수 있다.
상기 경피흡수 촉진제는 술폭시드(sulphoxide), 아존(azone), 피롤리돈(pyrrolidone), 지방산, 탄소수 1 내지 4의 저급 알코올, 탄소수 6 이상의 고급 지방 알코올(fatty alcohol), 글리콜(glycol), 요소(urea), 테르펜(terpene), 테르페노이드(terpenoid), 및 인지질(phospholipid)를 포함하는 군에서 선택된 어느 하나 이상일 수 있다. 다만, 이에 제한되는 것은 아니며, 주사용 약학 조성물에 사용되어 활성성분의 경피 흡수를 촉진시키는 통상적인 촉진제를 포함할 수 있다.
상기 술폭시드는 디메틸술폭시드(dimethyl sulfoxide, DMSO), 디메틸아세트아마이드(dimethyl acetamide, DMAC), 디메틸포름아마이드(dimethyl formamide, DMF), 및 데실메틸설폭시드(decylmethyl sulfoxide, DCMS)를 포함하는 군에서 선택되는 어느 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
상기 피롤리돈(pyrrolidione)은 N-메틸-2-피롤리돈 (NMP) 및 2-피롤리돈(2P)를 포함하는 군에서 선택되는 어느 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
상기 아존(azone)은 2-도데실아자사이클로헵탄-2-온(1-dodecylazacycloheptan-2-one) 또는 라우로카프람(laurocapram)일 수 있다.
상기 경피흡수 촉진제는 사용되는 종류에 따라 주사용 조성물에 통상적으로 허용되는 양으로 포함될 수 있다.
본 발명의 조성물은 탈모방지 또는 발모촉진을 위하여 단독으로, 또는 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
본 발명은 일 양태로서, 페길화된 케라틴 조성물을 포함하는 탈모방지 또는 발모촉진용 주사용 약학 조성물을 제공한다.
본 발명에 있어서, 용어 "페길화된"은 "PEG화된" 또는 "페길레이션된"과 혼용하여 사용될 수 있다.
본 발명에 있어서, 상기 페길화된 케라틴이란 케라틴의 아미노산 잔기에 폴리에틸렌글리콜(polyethylene glycol, PEG)이 결합되어 있는 물질을 의미한다. 상기 폴리에틸렌글리콜은 케라틴의 임의의 아미노산 잔기에 제한 없이 결합될 수 있고, 구체적으로 아민기에 결합할 수 있다.
본 발명에 있어서, 상기 폴리에틸렌글리콜은 예를 들어, O-메틸-O`-숙시닐 폴리에틸렌글리콜, 2염기산 폴리에틸렌글리콜, α,ω-비스(2-카르복시에틸-폴리에틸렌글리콜, O,O`-비스(2-브로모에틸)폴리에틸렌글리콜, O,O`-비스(2-클로로에틸)폴리에틸렌글리콜, 폴리에틸렌 글리콜 디메실산, 메톡시폴리에틸렌글리콜 아세트산, O-[2-(3-숙시닐아미노)에틸]-O`-메틸-폴리에틸렌글리콜, O-(2-브로모에틸)-O`-메틸폴리에틸렌글리콜, O-(2-클로로에틸)-O`-메틸폴리에틸렌글리콜, 폴리에틸렌글리콜 모노메틸 에테르 메실산(mesylate), 알데히드 기능화 폴리에틸렌글리콜, 글리시딜이써 기능화 폴리에틸렌글리콜, 나이트로페틸 카보네이트 기능화 폴리에틸렌글리콜, 메실(Mesyl) 기능화 폴리에틸렌글리콜 또는 토실(Tosyl) 기능화 폴리에틸렌글리콜일 수 있으며, 구체적으로는 O-메틸-O`-숙시닐 폴리에틸렌글리콜일 수 있다. 상기 PEG의 분자량은 1000 Da 내지 20000 Da일 수 있으며, 구체적으로는 2000 Da 내지 10000 Da 일 수 있다.
상기 페길화된 케라틴은 모발재생을 촉진할 수 있다.
본 발명의 구체적인 일 실시예에서, 모발의 성장을 담당하는 것으로 알려진 외모근소(outer root sheath, ORS) 세포와 모유두(dermal papilla, DP) 세포에 페길화된 케라틴을 처리한 결과, 세포의 활성 및 세포 증식이 증가하고, 모발성장에 관여하는 인자인 베타 카테닌(beta catenin), sox-2, cd133 및 sox9 유전자의 발현이 증가함을 확인하였다.
또한, 본 발명의 구체적인 일 실시예에서, 신체 기능이 떨어진 노령쥐의 등 부분의 털을 깎은 후, 페길화된 케라틴을 주사하여 털이 자란 밀도와 모낭의 형성을 분석하였다. 그 결과, 페길화된 케라틴이 모낭의 형성 및 모발의 재생을 촉진함을 확인하였다. 따라서, 페길화된 케라틴이 탈모방지 또는 발모촉진용 주사용 약학 조성물에 사용될 수 있음을 알 수 있었다.
본 발명에 있어서, 상기 약학 조성물은 과산화물을 추가적으로 포함할 수 있다.
상기 과산화물은 상기에서 설명한 바와 동일하다.
본 발명의 구체적인 일 실시예에서, 신체 기능이 떨어진 노령쥐의 등 부분의 털을 깎은 후, 과산화물을 포함하는 페길화된 케라틴 용액을 주사하여 털이 자란 밀도와 모낭의 형성을 분석하였다. 그 결과, 과산화물을 포함하는 페길화된 케라틴 용액이 모낭의 형성 및 모발의 재생을 촉진함을 확인하였다. 따라서, 과산화물을 포함하는 페길화된 케라틴 용액이 탈모방지 또는 발모촉진용 주사용 약학 조성물에 사용될 수 있음을 알 수 있었다.
본 발명에 있어서, 상기 주사용 약학 조성물은 액제 또는 건조분말의 형태일 수 있다. 상기 주사용 건조분말은 환자에게 투여시 주사용수, 생리식염수, 포도당액, 및 아미노산액에서 선택된 어느 하나 이상과 재구성하여 개체에 투여될 수 있다.
본 발명의 조성물에 포함된 활성성분의 양은 투여 대상 개체의 상태, 목적하는 치료 정도 등에 따라서 달라진다. 구체적으로, 본 발명의 페길화된 케라틴은 주사용 약학 조성물 대비 0.001 내지 10(w/v)%, 구체적으로는 0.01(w/v)% 내지 5(w/v)%, 더욱 구체적으로는 0.05 내지 2(w/v)% 농도로 포함될 수 있다.
상기 페길화된 케라틴의 농도가 0.001(w/v)% 미만인 경우, 탈모방지 또는 발모촉진 효과가 미비할 수 있고, 10(w/v)% 초과인 경우, 체내 부작용을 나타낼 수 있는 문제가 있다.
본 발명에 있어서, 상기 조성물은 경피흡수 촉진제(penetration enhancer)를 추가로 포함할 수 있다.
상기 경피흡수 촉진제는 상기에서 설명한 바와 동일하다.
본 발명은 일 양태로서, S1) 히알루론산 염을 4-(4,6-디메톡시-1,3,5-트리아진-2-일) 4-메톡시몰폴리늄 클로라이드(DMTMM)와 반응시키는 단계; 및 S2) 단계 S1) 에서 생성된 물질을 케라틴과 반응시키는 단계를 포함하는, 케라틴-히알루론산 복합체 하이드로젤의 제조 방법을 제공한다.
상기 제조 방법에 있어서, S3) 단계 S2)에서 생성된 물질을 과산화물과 반응시키는 단계를 추가적으로 포함하여 과산화물을 포함하는 케라틴-히알루론산 복합체 하이드로젤의 제조 방법을 제공한다.
상기 제 S1) 단계는 히알루론산 염의 카르복실기가 케라틴의 아미노산의 아민 잔기와 반응할 수 있도록 준비하는 단계이고, 상기 제 S2) 단계는 히알루론산 염의 카르복실기가 케라틴의 아미노산의 아민 잔기와 아미드화 반응하여 케라틴-히알루론산 복합체를 생성하는 단계이며, 제 S3) 단계는 케라틴-히알루론산 복합체에 과산화물이 포함된 하이드로젤을 제조하는 단계이다.
본 발명은 일 양태로서, S1) O-메틸-O`-숙시닐 폴리에틸렌글리콜을 4-(4,6-디메톡시-1,3,5-트리아진-2-일) 4-메톡시몰폴리늄 클로라이드(DMTMM)와 반응시키는 단계; S2) 단계 S1)에서 생성된 물질을 케라틴과 반응시키는 단계를 포함하는, 페길화된 케라틴의 제조 방법을 제공한다.
상기 제조 방법에 있어서, S3) 단계 S2)에서 생성된 물질을 과산화물과 반응시키는 단계를 추가적으로 포함하여 과산화물을 포함하는 페길화된 케라틴의 제조 방법을 제공한다.
상기 제 S1) 단계는 O-메틸-O`-숙시닐 폴리에틸렌글리콜의 숙신산 작용기를 활성화시키는 단계이고, 상기 제 S2) 단계는 케라틴의 아미노산의 아민 잔기가 숙시닐기와 반응하여 페길화된 케라틴을 생성하는 단계이며, 상기 제 S3) 단계는 페길화딘 케라틴에 과산화물을 포함시키는 단계이다.
본 발명은 페길화된 케라틴 또는 케라틴-히알루론산 복합체 하이드로젤을 포함하는 주사용 약학 조성물을 개체에 투여하는 단계를 포함하는, 탈모방지 또는 발모촉진 방법을 제공한다.
상기 "페길화된 케라틴" 및 "케라틴-히알루론산 복합체 하이드로젤"은 상기에서 설명한 바와 동일하다.
상기 "투여"란 적절한 방법으로 개체에 소정의 물질을 도입하는 것을 의미한다. 본 발명에 있어서, 상기 조성물은 개체에 주사하여 탈모방지 또는 발모촉진 효과를 나타내는 특성상, 상기 투여는 피하 투여일 수 있다.
상기 "개체"란 탈모 증상이 발생하였거나 발생할 수 있는 인간을 포함한 쥐, 생쥐, 가축 등의 모든 동물을 의미한다. 구체적으로는 인간을 포함한 포유동물일 수 있다.
본 발명의 케라틴-히알루론산 복합체 하이드로젤 또는 페길화된 케라틴을 포함하는 주사용 약학적 조성물은 모발의 성장과 모낭의 형성을 촉진한다. 따라서, 본 발명의 약학적 조성물은 탈모방지 또는 발모촉진용 치료제로 사용될 수 있다.
도 1은 페길화된 케라틴을 제조하는 방법을 도식화한 것이다.
도 2는 페길화된 케라틴을 NMR 분석한 데이터이다.
도 3은 케라틴-히알루론산 복합체를 제조하는 방법을 도식화한 것이다.
도 4는 페길화된 케라틴의 용해도를 나타낸 그래프이다.
도 5a는 페길화된 케라틴이 처리된 진피 섬유아세포의 생존율을 나타낸 그래프이다.
도 5b는 케라틴-히알루론산 복합체가 처리된 진피 섬유아세포의 생존율을 나타낸 그래프이다.
도 6a는 페길화된 케라틴이 자가 응집하여 형성된 나노파티클의 입자크기를 나타낸 그래프이다.
도 6b는 페길화된 케라틴이 자가 응집하여 형성된 나노파티클의 입자를 TEM으로 확인한 도이다.
도 7a는 페길화된 케라틴이 처리된 외모근소 세포의 클론 활성 및 세포활성을 나타낸 도이다.
도 7b는 페길화된 케라틴이 처리된 모유두 세포의 세포활성을 나타낸 도이다.
도 8a는 페길화된 케라틴이 처리된 외모근소 세포의 세포 증식을 나타낸 그래프이다.
도 8b는 페길화된 케라틴이 처리된 모유두 세포의 세포 증식을 나타낸 그래프이다.
도 9a는 페길화된 케라틴의 처리 후 외모근소 세포의 모발재생 관련 인자인 베타 카테닌 및 sox-9 분자의 발현 정도를 나타낸 그래프이다.
도 9b는 페길화된 케라틴의 처리 후 외모근소 세포의 줄기세포성(stemness)에 관여하는 베타 카테닌, EGF-리셉터 및 sox9 유전자의 발현 정도를 나타낸 그래프이다.
도 10a는 페길화된 케라틴의 처리 후 모유두 세포의 모발재생 관련 인자인 베타 카테닌, sox-2, ALPase 및 CD133 분자의 발현 정도를 나타낸 그래프이다.
도 10b는 페길화된 케라틴의 처리 후 외모근소 세포의 줄기세포성(stemness)에 관여하는 베타 카테닌, sox-2, BMP6, FGF7 및 FGF10 유전자의 발현 정도를 나타낸 그래프이다.
도 11a는 털을 제거한 쥐에 페길화된 케라틴 또는 케라틴-히알루론산 복합체의 주사 후 2주 후의 발모효과를 나타낸 도이다.
도 11b는 털을 제거한 쥐에 페길화된 케라틴 또는 케라틴-히알루론산 복합체의 주사 후 2주 후 헤마톡실린-에오신으로 염색하여 모낭 형성의 정도를 나타낸 도이다.
도 11c는 털을 제거한 쥐에 페길화된 케라틴 또는 케라틴-히알루론산 복합체의 주사 후 2주 후 모발 성장의 각 단계에서의 모낭 형성의 수를 나타낸 그래프이다.
도 11d는 털을 제거한 쥐에 페길화된 케라틴 또는 케라틴-히알루론산 복합체의 주사 후 2주 후 새로 형성된 모낭의 수를 나타낸 그래프이다.
도 11e는 털을 제거한 쥐에 페길화된 케라틴 또는 케라틴-히알루론산 복합체의 주사 후 2주 후 형성된 모낭의 크기를 나타낸 그래프이다.
도 11f는 털을 제거한 쥐에 페길화된 케라틴 또는 케라틴-히알루론산 복합체의 주사 후 2주 후 형성된 모낭 크기의 균일성의 정도를 나타낸 그래프이다.
도 12a는 털이 깎인 부위에 H2O2를 함유한 케라틴-히알루론산 복합체(keratin-Hyaluronic acid Conjugate) 하이드로젤를 처리하는 방법을 나타낸 사진이다.
도 12b는 털을 제거한 쥐에 과산화수소를 포함한 케라틴-히알루론산 복합체 하이드로젤 또는 과산화수소를 포함한 페길화된 케라틴의 주사 후 모낭 형성의 정도를 나타낸 도이다.
도 12c는 과산화수소를 포함한 케라틴-히알루론산 복합체 하이드로젤 및 과산화수소를 포함한 페길화된 케라틴의 주사 후 모발 성장의 각 단계에서의 모낭 형성의 수를 나타낸 그래프이다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 제조예 및 실시예를 제시한다. 그러나 하기의 제조예 및 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 이에 의해 본 발명의 내용이 한정되는 것은 아니다.
제조예 1: 케라틴의 수득
사람 머리카락을 약한 세제를 이용해서 깨끗하게 세척한 후 증류수로 여러 번 씻어주었다. 지질제거를 위해 머리카락을 비이커에 담고, 클로로포름과 메탄올을 2:1의 비율로 섞은 혼합액에 머리카락이 잠길 때까지 넣어주었다. 24시간 후 지질 제거에 사용한 용액이 머리카락에 남아있지 않을 때까지 증류수로 여러 번 세척한 후 머리카락을 기건(air-dry)시켰다. 2 % 과산화아세트산(Sigma aldrich) 800 mL에 기건시킨 머리카락 20 g을 넣고 37 ℃에서 12시간동안 300 rpm의 속도로 교반하였다. 12시간 후, 머리카락을 체에 거르고 증류수로 세척하여 남아있는 산화물을 제거하였다. 머리카락을 400 mL 신다이(Shindai) 용액(5 % 2-머캅토에탄올, 5 M 우레아, 2.6 M 티오우레아(이상 Sigma aldrich) 및 25mM Tris-HCl(pH 8.5))에 넣고, 50 ℃, 400 rpm의 조건에서 72시간동안 반응시켰다. 그 후, 머리카락 용액을 50 mL 튜브에 넣고 3500 rpm으로 20분 동안 원심분리하였다. 상등액을 모아 12-14 kDa 컷오프 Spectra/Por®4 투석막(Spectrum)을 이용해서 투석하였다. 투석이 끝난 케라틴 액체샘플을 동결 건조하여 케라틴 파우더를 제조하였다.
제조예 2: 페길화된 케라틴(PEGylated Keratin)의 제조
제조예 2-1: 페길화된 케라틴의 합성
도 1에 제시된 반응과정으로 페길화된 케라틴을 합성하였다.
먼저, 케라틴 파우더 0.5 g을 미세부품 단위계수 측정 전자저울(0.001 g ~ 620 g, AJ-620E)로 달아 500 mL 파이렉스 비이커(ISOLAB, YLS, 독일)에 넣었다. 비이커에 삼차수 100 mL를 넣고, 40×8 mm 마그네틱 교반봉([B00C3ME4ZA], 1572500 IKAFLON 40, IKA)과 MS-H-S10 10-Channel 마그네틱 교반기를 이용하여 300 rpm의 속도로 24시간 동안 교반하였다.
메톡시폴리에틸렌글리콜을 변형시킨 O-메틸-O`-숙시닐 폴리에틸렌글리콜 5000(mPEG, 17929-5G-F, Lot#R063737/2V Sigma aldrich) 300 mg을 삼차수 20 mL에 1시간 동안 녹였다. mPEG 용액에 4-(4,6-디메톡시-1,3,5-트리아진-2-일)-4-메톡시몰폴리늄 클로라이드(DMTMM) n-수화물(327-53752, wako chemical) 16 mg을 넣고 1시간동안 교반하였다. 케라틴 용액과 mPEG 및 DMTMM의 결합 용액을 500 mL 비커에 넣어, 40×8mm 마그네틱 교반봉(1572500 IKAFLON 40, IKA)과 MS-H-S10 10-Channel 마그네틱 교반기를 이용하여 500 rpm의 속도로 실온에서 3일 동안 교반하여 PEG와 케라틴을 반응시켰다.
제조예 2-2: 페길화된 케라틴의 정제
제조예 2-1의 반응이 끝난 후, Spectra/Por 투과막 튜브(직경 16 mm, 평폭 25 mm, MW10000, Spectrum)에 페길화된 케라틴 용액을 한 튜브당 100 mL씩 넣고, Spectra/Por RC 투석 튜빙 클로져(최대 폭 55 mm, Orange, Spectrum)를 양쪽 튜브에 패킹하였다. 5 L의 플라스틱 비이커(지름 197 mm, 높이 265 mm)에 삼차수 4 L를 채워 페길화된 케라틴 용액이 담긴 튜브를 넣고 마그네틱 바를 넣고 교반하면서 투석하였다. 이때, 12시간마다 새로운 삼차수로 갈아주었으며, 실온에서 3일동안 삼차수로 총 6번을 갈아주면서 투석하였다. 최종 페길화된 케라틴 용액을 50 mL 원심관(17×120 mm, BD Falcon)에 40 mL 씩 나눠 담은 후, 초저온냉장고(Nihon freezer, Upright type, Single cooling type, 542ℓ)에서 -70 ℃로 24시간 동안 완전히 동결시켰다. 원심관 뚜껑을 열고, 동결건조기(ALPHA 2-4 LSC PLUS, Laboratory freeze dryers, Christ)에 넣고 -85 ℃의 진공상태에서 완전히 파우더 형태가 되도록 3일동안 건조시켰다.
제조예 2-3: 페길화된 케라틴의 확인
제조예 2-2에서 얻은 페길화된 케라틴을 NMR을 통해 분석하였다. 그 결과, 도 2에 나타난 바와 같이 페길화된 케라틴에서 각각 케라틴 및 PEG에서 특이적으로 나타나는 피크가 동시에 존재하고 있음을 확인하였다.
제조예 2-4: 과산화수소를 함유한 페길화된 케라틴 용액의 제조
제조예 2-2에서 얻은 페길화된 케라틴 20mg을 미세부품 단위계수 측정 전자저울((0.001g ~ 620g) AJ-620E)을 이용하여 측정하였다. 그리고 H2O2 (과산화수소 30%, 분자량 34.01 , JUNSEI CHEMICAL, 7722-84-1) 102μL를 3차증류수 898μL에 넣어 농도 1M의 1mL를 만든 후, 증류수로 100배와 20배로 연속 희석(serial dilution)을 하여 최종 500uM의 H2O2 용액을 만들었다. 제조된 500uM의 H2O2 용액 1mL에 20mg의 페길화된 케라틴(PEGylated Keratin)을 넣고 5분간 볼텍싱하여 500uM의 H2O2이 함유된 페길화된 케라틴 용액을 제조하였다. 제조된 용액이 들어가 있는 유리병을 공압식 진공포장기를 사용하여 나일론 진공포장기150X200mm(NY/PEL-LDPE)(80um)로 밀봉하여 보관하였다.
제조예 3: 케라틴-히알루론산 복합체 (keratin- Hyaluronic acid Conjugate) 하이드로젤의 제조
제조예 3-1: 케라틴-히알루론산 복합체의 합성
도 3에 제시된 반응과정으로 케라틴-히알루론산 복합체를 합성하였다.
500ml 증류수에 히알루론산나트륨염(Hyaluronic acid sodium salt, HA)(분자량: 2500000 Da (LifeCore biomedical, chaska, MN, 미국)) 800mg을 녹였다. 40 X 8 mm 마그네틱 교반봉([B00C3ME4ZA], 1572500 IKAFLON 40, IKA)과 MS-H-S10 10-Channel 마그네틱 교반기를 이용하여 300rpm의 속도로 완전히 녹게 24시간 동안 교반하였다.
10mL 증류수에 4-(4,6-디메톡시-1,3,5-트리아진-2-일)-4-메톡시몰폴리늄 클로라이드(DMTMM) n-수화물(327-53752, wako chemical) 16mg을 넣고 실온에서 2시간 교반하여 녹인 후 상기 히알루론산나트륨염 용액에 넣고 히알루론산나트륨염의 카르복실기(Carboxyl group)와 케라틴의 아민기(amine group)가 아미드화 반응을 할 수 있게 반응시켰다. 히알루론산나트륨염과 DMTMM이 반응된 용액을 Spectra/Por 투과막 튜브(직경 16 mm, 평폭 25 mm, MW10000, Spectrum)에 넣고 반응 후 DMTMM을 석출하기 위해 4L 증류수에 담궜다. 40 X 8 mm 마그네틱 교반봉([B00C3ME4ZA], 1572500 IKAFLON 40, IKA)과 MS-H-S10 10-Channel 마그네틱 교반기를 이용하여 500rpm의 속도로 실온에서 24시간 동안 교반기를 이용해서 제거하였다. 케라틴 파우더 (분자량:4~60000 Da) 1200mg 무게를 측정하여 300mL 증류수에 녹인 후 히알루론산나트륨염과 DMTMM이 반응된 용액의 카르복실기와 케라틴의 아민기가 아미드화 반응을 하여 최종 몰농도가 8:2가 되도록 합성시켰다. 40 X 8 mm 마그네틱 교반봉([B00C3ME4ZA], 1572500 IKAFLON 40, IKA)과 MS-H-S10 10-Channel 마그네틱 교반기를 이용하여 500rpm의 속도로 실온에서 3일 동안 교반기를 이용해서 합성하였다.
제조예 3-2: 케라틴-히알루론산 복합체의 정제
제조예 3-1의 반응이 끝난 후, Spectra/Por 투과막 튜브(직경 16 mm, 평폭 25 mm, MW10000, Spectrum)에 합성된 히알루론산-케라틴 용액을 한 튜브 당 100 mL씩 넣고, Spectra/Por RC 투석 튜빙 클로져(최대 폭 55 mm, Orange, Spectrum)를 양쪽 튜브에 패킹하였다. 5 L의 플라스틱 비이커 (5000cc, 지름 197mm, 높이 265mm)에 4L 증류수를 채워 합성된 히알루론산-케라틴 용액이 담긴 튜브를 넣고 마그네틱바를 교반하면서 투석하였다. 히알루론산-케라틴 용액 중 반응이 된 케라틴과 DMTMM을 완전히 제거하였다. 이때, 3시간마다 새로운 4 L의 증류수로 갈아주었으며, 실온에서 5일간 증류수를 갈아주면서 투석하였다. 최종적으로 완성된 히알루론산-케라틴 용액을 50 mL 원심관(17×120 mm, BD Falcon)에 35mL씩 나눠 담은 후, -70 ℃이ㅡ 초저온냉장고 (Nihon freezer, Upright type, Single cooling type, 542ℓ)에 넣어 24시간 동안 완전히 동결시켰다. 원심관 뚜껑을 열고, 동결건조기(ALPHA 2-4 LSC PLUS, Laboratory freeze dryers, Christ)에 넣고 진공상태에서 완전히 파우더 형태가 되도록 3일 이상 동안 건조시켜, 최종 히알루론산-케라틴 젤 파우더를 얻었다.
제조예 3-3: 과산화수소를 함유한 케라틴-히알루론산 복합체 하이드로젤의 제조
제조예 3-2에서 얻은 히알루론산-케라틴 파우더를 미세부품 단위계수 측정 전자저울 ((0.001g ~ 620g) AJ-620E)을 이용하여 25mg 의 무게를 측정하였다. 그리고 102μL의 H2O2를 3차 증류수 898μL에 넣어 최종농도 1M의 1mL을 만든 후, 1M H2O2 용액 3μL를 3차 증류수 1mL에 넣어 3mM H2O2 용액을 만들었다. 3mM H2O2 용액에 히알루론산-케라틴 파우더 25mg을 넣고 5분간 볼텍싱을 한 후, 히알루론산-케라틴 파우더가 균일하게 섞이고 용해되도록 50 mL 원심관(17×120 mm, BD Falcon)에 넣고 35000rpm 속도에서 10분간 원심분리하여 H2O2를 함유한 케라틴-히알루론산 복합체 (keratin-Hyaluronic acid Conjugate) 하이드로젤을 제조하였다. 제조된 하이드로젤이 들어가 있는 유리병을 공압식 진공포장기를 사용하여 나일론 진공포장기150X200mm(NY/PEL-LDPE)(80um)로 밀봉하여 보관하였다.
실시예 1: 페길화된 케라틴 및 케라틴-히알루론산 복합체의 생체적합성
실시예 1-1: 페길화된 케라틴 용액의 용해도
일반적으로 케라틴은 소수성단백질로서 pH 10 이상의 강한 알칼리 용액에서만 용해되는 특성이 있는 바, 제조예 2-1 및 2-2에 따라 제조된 페길화된 케라틴 용액이 생체재료로 사용될 수 있는지 확인하기 위해 용해도를 측정하였다.
구체적으로 농도별 페길화된 케라틴 용액을 중성 pH의 물에 녹인 후, 육안으로 탁한 정도를 평가하였다.
그 결과, 페길화된 케라틴 용액이 중성 pH의 물에서 잘 용해됨을 확인하였으며, 20(w/v)%의 농도까지도 용해가 잘되는 것을 확인하였다(도 4).
이를 통해, 페길화된 케라틴 용액은 체내 용해도가 높아 주사용 제제로 사용될 수 있음을 알 수 있었다.
실시예 1-2: 페길화된 케라틴 용액 및 케라틴-히알루론산 복합체의 세포독성 확인
진피 섬유아세포(dermal fibroblast)를 사용하여 제조예 2-1 및 2-2에 따라 제조된 페길화된 케라틴 용액 및 제조예 3-1 및 3-2에 따라 제조된 의 케라틴-히알루론산 복합체가 세포독성을 나타내는지 여부를 확인하였다.
구체적으로, 사람섬유아세포 (Human Fetal Fibroblast)를 24 웰 플레이트에 5x103 개씩 접종하고, 24시간 후에 배지를 고농도의 DMEM 일반배지, 또는 0.5%, 1% 및 2%(w/v)의 페길화 케라틴 또는 케라틴-히알루론산 복합체가 포함된 고농도의 DMEM 일반 배지로 교체하였다. 다시 24시간동안 배양한 후 Live&Dead assay 및 세포 증식 분석을 수행하였다.
Live&Dead assay의 수행시 Live/Dead viability/cytotoxicity 키트(invitrogen)를 사용하였다. 상기 배지를 제거한 후 DPBS로 세척한 각각의 웰에 1ml의 DPBS에 0.5μl의 칼세인(Calcein)과 2.0μl의 에티듐 호모다이머(Ethidium Homodimer)를 넣고 혼합한 혼합액을 200μl씩 넣어주었다. 알루미늄 호일로 빛을 차단하고, 37 ℃에서 10분 동안 인큐베이션한 후, DPBS로 세척해주고, 형광현미경(Olympus BX51)으로 관찰하였다.
또한, DPBS로 웰을 세척한 후, 각각의 웰에 고농도의 DMEM 일반배지로 10배 희석된 Cell Counting Kit-8 용액(Dojindo laboratory)을 넣고, 알루미늄 호일로 빛을 차단한 후, 37 ℃에서 1시간 30분 동안 인큐베이션하였다. 인큐베이션 후, 각각의 웰에서 100μl씩을 96웰 플레이트에 옮기고, 96웰 포맷 플레이트 리더(format plate reader, ELX 800 universal microplate Reader, Bio Tek, Inc.) 기기를 이용하여 450nm 파장(O.D 450nm)에서 흡광도를 측정하였다.
그 결과, 페길화된 케라틴 용액 및 케라틴-히알루론산 복합체의 처리 유무와 관계없이 섬유아세포의 생존율에 변화가 없음을 확인하였다. 특히 2.0(w/v)% 농도 이상의 페길화된 케라틴 용액 및 케라틴-히알루론산 복합체를 처리한 경우에도 90% 이상의 높은 생존율을 나타냄을 확인하였다(도 5a 및 도 5b).
이를 통해, 페길화된 케라틴 및 케라틴-히알루론산 복합체는 세포독성을 나타내지 않아 인체에 무해함을 알 수 있었다.
실시예 1-3: 페길화된 케라틴의 나노파티클 형성
페길화된 케라틴이 중성 pH의 물에서 응집시 형성되는 나노파티클의 크기를 확인하였다.
구체적으로, 페길화된 케라틴을 2mg/ml의 농도로 pH 7.4의 인산완충식염수(PBS)에 첨가 후 교반하여 페길화된 케라틴으로 구성된 나노입자를 형성시켰다. 그 후 얻어진 페길화된 케라틴 나노입자의 평균 입자 크기(hydrodynamic diameter)를 동적 광산란을 통해 계산하였다. 또한, 페길화된 케라틴 나노입자를 투과 전자 현미경(TEM)으로 조사하였다.
그 결과, 페길화된 케라틴은 자가 응집(self-assembly)에 의해 나노파티클을 형성하며, 형성된 나노파티클의 크기는 100 nm 이하임을 확인하였다(도 6a 및 6b).
이를 통해, 페길화된 케라틴은 체내에서 적절한 크기의 나노파티클을 형성하므로, 주사용 제제로 사용하기에 적합함을 알 수 있었다.
실시예 2: 실험실 단계(in vitro)에서 페길화된 케라틴의 모발재생 관여 세포의 증식 확인
실시예 2-1: 세포활성 실험
페길화된 케라틴의 모발재생 효과를 확인하기 위해, 모발의 성장을 담당하는 것으로 알려진 인간 외모근소(outer root sheath, ORS) 세포와 인간 모유두(dermal papilla, DP) 세포의 세포활성 및 세포증식을 확인하였다.
구체적으로, 인간 외모근소(outer root sheath, ORS) 세포와 이간 모유두(dermal papilla, DP) 세포를 12 웰 플레이트에 2.5x104 개씩 접종하고, 24시간 후에 ORS 배지, DP 배지 또는 2%(w/v)의 페길화된 케라틴이 포함된, ORS 배지 및 DP medium 배지로 교체하였다. 24시간동안 배양한 후 Live&Dead assay를 수행하였고 및 1일, 3일 및 5일동안 배양한 후 세포 증식 분석을 수행하였다.
Live&Dead assay의 수행시 Live/Dead viability/cytotoxicity 키트(invitrogen)를 사용하였다. 상기 배지를 제거한 후 DPBS로 세척한 각각의 웰에 1ml의 DPBS에 0.5μl의 칼세인(Calcein)과 2.0μl의 에티듐 호모다이머(Ethidium Homodimer)를 넣고 혼합한 혼합액을 200μl씩 넣어주었다. 알루미늄 호일로 빛을 차단하고, 37 ℃에서 10분 동안 인큐베이션한 후, DPBS로 세척해주고, 형광현미경(Olympus BX51)으로 관찰하였다.
또한, 페길화된 케라틴 처리 후 1일, 3일 및 5일동안 배양한 후, DPBS로 웰을 세척하였다. 그 후, 각각의 웰에 ORS 배지 또는 DP 배지로 10배 희석된 Cell Counting Kit-8 용액(Dojindo laboratory)을 넣고, 알루미늄 호일로 빛을 차단한 후, 37 ℃에서 1시간 30분 동안 인큐베이션하였다. 인큐베이션 후, 각각의 웰에서 100μl씩을 96웰 플레이트에 옮기고, 96웰 포맷 플레이트 리더(format plate reader, ELX 800 universal microplate Reader, Bio Tek, Inc.) 기기를 이용하여 450nm 파장(O.D 450nm)에서 흡광도를 측정하였다.
그 결과, 외모근소 세포의 경우 페길화된 케라틴의 처리 후 1시간 후부터 클론의 활성이 나타나고 세포활성이 유지되었으며, 모유두 세포의 경우 클론의 활성이 유지됨을 확인하였다(도 7a 및 7b). 또한, 외모근소 세포와 모유두 세포 모두 페길화된 케라틴의 처리 후부터 초반 증식이 증가됨을 확인하였다(도 8a 및 8b).
실시예 2-2: 모발성장 관여 인자의 발현
페길화된 케라틴의 모발재생 효과를 확인하기 위해, 모발의 성장과 줄기세포성에 관련이 있는 인자들의 발현을 확인하였다.
구체적으로, 인간 외모근소(outer root sheath, ORS) 세포를 6 웰 플레이트에 5x104 개씩 접종하고, 24시간 후에 ORS 배지 또는 2%(w/v)의 페길화된 케라틴이 포함된 ORS 배지로 교체하였다. 1일, 3일 및 5일동안 배양한 후 면역화학적 염색과 RT-PCR 분석을 통해 베타 카테닌(beta catenin), sox-9, EGF-수용체의 발현 정도를 측정하였다.
상기와 같이 인간 외모근소(outer root sheath, ORS) 세포를 배양한 후, 배지를 제거하고 DPBS로 세척하였다. 4% 파라포름알데하이드를 10분간 처리하여 고정시킨 후 다시 DPBS로 세척해 주었다. 고정 후 0.1% triton X-100를 30분간 처리하여 투과성화(permeabilization) 시킨 후, 10% (w/v)의 정상염소혈청(normal goat serum, NGS)을 1시간 동안 처리하였다. 그 후, 1:200으로 희석된 토끼의 항-인간 베타-카테닌 항체(rabbit anti-human beta-catenin antibody), 토끼의 항-인간 sox9 항체(rabbit anti-human sox9 antibody) 및 쥐의 항-인간 인테그린 베타 항체(mouse anti-human integrin beta1 antibody)를 처리하여 24시간동안 4℃에서 반응시켰다. 24 시간 반응 후, DPBS로 세 번 세척하였으며, secondary Alexa Fluor 546 conjugated antibody 와 secondary Alexa Fluor 488-conjugated antibody를 상온에서 1시간동안 처리하였다. 그 후, DPBS로 세 번 세척하였고, 4',6-diamidino-2-phenylindole (DAPI)를 처리하였다. 그 후, 염색된 세포들을 형광현미경(Olympus IX71)으로 관찰하였다.
RT-PCR분석을 위해 6웰 플레이트에서 배양한 세포들의 배양배지를 제거하고 DPBS로 세척하였다. RNA의 추출시 Hybrid-R 키트(Gene All)를 사용하였고, 나노드롭(MICROP UV-Vis Spectrophotometer M600)을 사용하여 추출된 RNA를 정량하였다. 1μg의 RNA를 AccuPower Cycle Script RT Premix (Bioneer, 대전, 한국)에 첨가하고, 열 순환기(T106, Bio-Rad)를 이용해 cDNA를 만들었다. 사용한 프라이머의 서열은 하기 표 1과 같다.
Sense(5’-3’) Antisense(5’-3’)
beta-catenin TGCAGTTCGCCTTCACTATG(서열번호 1) CTGCACAAACAATGGAATGG(서열번호 2)
beta-actin GTCAGGCAGCTCGTAGCTCT(서열번호 3) TCGTGCGTGACATTAAGGAG(서열번호 4)
Sox-9 ACCAGTACCCGCATCTGCA(서열번호 5) TGTTCCGTGGCCTCTTCG(서열번호 6)
EGF-Receptor GCCTGATAACTGGACTGACCT(서열번호 7) ATTGGGTGTCCCGAAGAGT(서열번호 8)
각각의 반응에 SYBR Green PCR Mix 10μL, 0.5pm의 프라이머(sense와 antisense)와 50nm의 주형(template)을 넣어주었다. RT-PCR은 RG6000 5plex HRM (Corbett Research)기기를 사용하였으며, 95 에서 15초, 어닐링(annealing) 온도 57에서 45초로, 40 사이클을 설정하였다. 역치주기(Threshold cycle, Ct) 값을 측정하기 위해, 상대정량(comparative Ct (2-컴Ct))법을 사용하였다.
또한 인간 모유두(dermal papilla, DP) 세포를 폴리에틸렌글라이콜로 마이크로웰에 접종하여 하루동안 세포 타원체(cell spheroid)를 형성시킨 후, 형성된 세포 타원체를 6 웰 플레이트에 20개씩 접종하였다. 24시간 후에 DP 배지 또는 2%(w/v)의 페길화된 케라틴이 포함된 DP 배지로 교체하였다. 1일, 3일, 및 5일동안 배양한 후 면역화학적 염색과 RT-PCR 분석을 통해 베타 카테닌(beta catenin), sox-2, CD133, 및 알칼리성 인산가수분해효소(Alkaline Phosphatase)의 발현 정도를 측정하였다.
상기와 같이 인간 모유두(dermal papilla, DP) 세포의 배양 후, 배지를 제거하고 DPBS로 세척하였다. 4% 파라포름알데하이드를 10분간 처리하여 고정시킨 후 다시 DPBS로 세척하였다. 고정 후 0.1% triton X-100를 30분간 처리하여 투과성화(permeabilization) 시킨 후, 10% (w/v)의 정상염소혈청(normal goat serum)을 1시간 동안 처리하였다. 그 후, 1:200으로 희석된 토끼의 항-인간 베타-카테닌 항체(rabbit anti-human beta-catenin antibody), 쥐의 항-인간 sox2 항체(mouse anti-human sox2 antibody), 쥐의 항-인간 ALPase 항체(rabbit anti-human ALPase antibody) 및 쥐의 항-인간 CD133 항체(mouse anti-human CD133 antibody)를 처리하여 24시간동안 4에서 반응시켰다. 24 시간 반응 후, DPBS로 세 번 세척하였으며, secondary Alexa Fluor 546 conjugated antibody 와 secondary Alexa Fluor 488-conjugated antibody를 상온에서 1시간동안 처리하였다. 그 후 DPBS로 세 번 세척하였고, 4',6-diamidino-2-phenylindole (DAPI)를 처리하였다. 염색된 세포들을 형광현미경(Olympus IX71)으로 관찰하였다.
RT-PCR분석을 위해 6웰 플레이트에서 배양한 세포들의 배양배지를 제거하고 DPBS로 세척하였다. RNA의 추출시 Hybrid-R 키트(Gene All)를 사용하였고, 나노드롭(MICROP UV-Vis Spectrophotometer M600)을 사용하여 추출된 RNA를 정량 하였다. 1㎍의 RNA를 AccuPower Cycle Script RT Premix (Bioneer, 대전, 한국)에 첨가하고, 열 순환기(T106, Bio-Rad)를 이용해 cDNA를 만들었다. 사용한 프라이머의 서열은 하기 표 2와 같다.
Sense(5'-3') Antisense(5'-3')
beta-catenin TGCAGTTCGCCTTCACTATG(서열번호 1) CTGCACAAACAATGGAATGG(서열번호 2)
beta-actin GTCAGGCAGCTCGTAGCTCT(서열번호 3) TCGTGCGTGACATTAAGGAG(서열번호 4)
Sox-2 GCGGAGTGGAAACTTTTGTCC(서열번호 9) CGGGAAGCGTGTACTTATCCTT(서열번호 10)
BMP6 AACCAACCACGCGATTGTG(서열번호 11) AAGTCTCATCGTCCCACCTC(서열번호 12)
FGF7 CCTGAGCGACACACAAGAAG(서열번호 13) GCCACTGTCGCTTCCTTATT(서열번호 14)
FGF10 ATGTGCGGAGCTACAATCAC(서열번호 15) TACGGGCAGTTCTCCTTCT(서열번호 16)
각각의 반응에 SYBR Green PCR Mix 10μL, 0.5pm의 프라이머(sense와 antisense)와 50nm의 주형(template)을 넣어주었다. RT-PCR은 RG6000 5plex HRM (Corbett Research)기기를 사용하였으며, 95 에서 15초, 어닐링(annealing) 온도 57에서 45초로, 40 사이클을 설정하였다. 역치주기(Threshold cycle, Ct) 값을 측정하기 위해, 상대정량(comparative Ct (2-컴Ct))법을 사용하였다.
그 결과, 인간 외모근소(outer root sheath, ORS) 세포의 경우 케라틴 처리시 모발재생과 관련하여 외모근소 세포의 이동 및 클론의 활성과 관련된 인자인 베타 카테닌(beta catenin) 분자 및 줄기세포성(stemmess)에 관여하는 Sox-9분자의 발현이 증가됨을 확인하였다(도 9a). 또한, 줄기세포성(stemmess)에 관여하는 sox9 유전자, EGF-receptor 및 베타 카테닌(beta catenin) 유전자의 발현이 증가됨을 확인하였다(도 9b).
또한, 인간 모유두(dermal papilla, DP) 세포의 경우 케라틴 처리시 모유두 세포의 모발재생과 줄기세포성(stemmess)에 관여하는 인자인 베타 카테닌(beta catenin), sox-2, Alkalkine phosphatase 및 CD133 분자의 발현이 증가됨을 확인하였다(도 10a). 또한, 모발재생과 줄기세포성(stemmess)에 관여하는 인자인 sox2 유전자, 베타 카테닌(beta catenin) 유전자 및 BMP6, FGF7, FGF10 유전의 발현이 증가됨을 확인하였다(도 10b).
상기 실시예 2-1 및 2-2를 통해 페길화된 케라틴은 모발재생에 관여하는 줄기세포들의 초기증식을 유도하고, 줄기세포성을 증가시켜 모발의 재생을 효과적으로 유도할 수 있음을 알 수 있었다.
실시예 3: 동물실험에서 모발 성장 효과
실시예 3-1: 동물모델의 준비
제조예 2 및 3에 따라 제조된 페길화된 케라틴 및 케라틴-히알루론산 복합체의 모발 성장 효과를 검증하기 위한 동물실험 모델로 12주령된 20-25g 무게의 C57BL/6J 노령쥐(Charles River Corp. Inc., Barcelona, 스페인) 10마리를 사용하였다. 상기 쥐를 아이소플루레인(isoflurane)으로 마취시킨 후, 쥐의 등 부분을 클리퍼(cliper)로 찝고 휴지기(telogen stage)모근을 남겨두고, 머리카락 및 모근을 깎았다. 포비돈-요오드(povidone-iodine) 용액으로 피부를 소독한 후 60% 알코올로 닦았다.
실시예 3-2: 페길화된 케라틴과 케라틴-히알루론산 복합체의 모발 성장 효과
상기 실시예 3-1에 따라 준비된 쥐의 등 부분에 제조예 2-1 및 2-2에 따라 제조된 1w/v% 농도의 페길화된 케라틴과 제조예 3-1 및 3-2에 따라 제조된 케라틴-히알루론산 복합체를 300㎕씩 바늘없는 주사기를 이용하여 피하 주사하였다. 음성대조군으로는 털을 깍은 후 어떠한 처리도 하지 않은 쥐를 사용하였고, 양성대조준으로는 3%의 미녹시딜을 매일 300㎕씩 도포한 쥐를 사용하였다. 2주간 사육한 후, 2주째에 털을 깍은 부위를 실체 현미경 (SZX16, Olympus)으로 관찰하였으며, 희생 후 조직시편을 취득하고 헤마톡실린-에오신(hematoxylin and eosin, H&E)으로 염색하여 관찰하였다.
그 결과, 1w/v%의 페길화된 케라틴 용액 및 케라틴-히알루론산 복합체 하이드로젤을 주사한 쥐의 등 부위에서 미녹시딜을 도포한 쥐의 등 부위에 비해 발모효과가 뛰어남을 확인하였고, 2주 뒤에 균일하고 밀도가 촘촘한 발모 효과를 확인하였다. 다만, 페길화된 케라틴 용액을 도포한 쥐에서는 발모효과가 거의 나타나지 않음을 확인하였다.(도 11a). 또한, 염색 결과 모낭(hair follicle)의 형성이 음성대조군에 비해 매우 높은 빈도로 발생하였음을 확인하였다(도 11b). 구체적으로, 모발 성장의 초기 단계인 성장기(anagen stage)에서 모낭의 형성이 촉진된 현상이 나타나고, 이로부터 새로운 모낭의 형성이 유도되었음을 확인하였다(도 11c및 도 11d).
또한, 형성된 모낭의 크기를 측정한 결과 케라틴이 주사된 군에서 모낭의 크기가 증가된 것을 확인하였으며(도 11e), 미녹시딜을 바른 군의 경우 모낭 크기의 변형(variation)이 관찰되었으나, 케라틴이 주사된 군의 경우 모낭의 크기가 균일하고 사이즈가 큰 모낭발생 쪽으로 균일성이 관찰됨을 확인하였다(도 11f).
실시예 3-3: 과산화수소를 함유한 페길화된 케라틴과 과산화수소를 함유한 케라틴-히알루론산 복합체의 모발 성장 효과
상기 실시예 3-1에 따라 준비된 쥐의 등 부분에 과산화수소를 함유한 케라틴-히알루론산 복합체 (keratin-Hyaluronic acid Conjugate) 하이드로젤(3mM), 과산화수소를 함유한 페길화화된 케라틴 용액(500uM), 및 과산화수소 용액(500uM)을 각각 200㎕씩 바늘없는 주사기를 이용하여 피하 주사하였다(도 12a). 산소 투과성 투명 상처 드레싱(테가덤 필름, 3M)으로 드레싱하였으며 3일에 한번씩 드레싱을 교체하였다. 대조군으로서는 털을 깍은 후 어떠한 처리도 하지 않은 쥐를 사용하였다. 10일간 사육 후, 털을 깍은 부위를 실체 현미경 (SZX16, Olympus)으로 관찰하였으며, 희생 후 조직시편을 취득하고 헤마톡실린-에오신(hematoxylin and eosin, H&E)으로 염색하여 관찰하였다.
그 결과 과산화수소를 함유한 케라틴-히알루론산 복합체(keratin-Hyaluronic acid Conjugate) 하이드로젤 및 과산화수소를 함유한 페길화된 케라틴 용액을 주사한 쥐의 등 부위에서 훨씬 높은 밀도의 털이 자란 것을 확인하였다(도 12b). 또한 모낭(hair follicle)의 형성이 대조군에 비해 매우 높은 빈도로 발생하였음을 확인하였다(도 12c).

Claims (18)

  1. 케라틴-히알루론산 복합체 하이드로젤을 포함하는 탈모방지 또는 발모촉진용 주사용 약학 조성물.
  2. 제1항에 있어서, 상기 케라틴-히알루론산 복합체는 히알루론산의 카르복실기가 케라틴의 아민기와 아미드화 반응을 통해 형성된 것인, 약학 조성물.
  3. 제1항에 있어서, 상기 케라틴-히알루론산 복합체는 모발재생을 촉진하는 것인, 약학 조성물.
  4. 제1항에 있어서, 상기 약학 조성물은 과산화물을 추가적으로 포함하는 것인, 약학 조성물.
  5. 제4항에 있어서, 상기 과산화물은 카바마이드 퍼옥사이드, 칼슘 퍼옥사이드 및 하이드로퍼옥사이드를 포함하는 군에서 선택된 어느 하나 이상인 것인, 약학 조성물.
  6. 제4항에 있어서, 상기 과산화물은 과산화수소인 것인, 약학 조성물.
  7. 제1항에 있어서, 상기 약학 조성물은 경피흡수 촉진제(penetration enhancer)를 추가적으로 포함하는 것인, 약학 조성물.
  8. 제7항에 있어서, 상기 경피흡수 촉진제는 술폭시드(sulphoxide), 아존(azone), 피롤리돈(pyrrolidone), 지방산, 탄소수 1 내지 4의 저급 알코올, 탄소수 6 이상의 고급 지방 알코올(fatty alcohol), 글리콜(glycol), 요소(urea), 테르펜(terpene), 테르페노이드(terpenoid), 및 인지질(phospholipid)를 포함하는 군에서 선택된 어느 하나 이상인 것인, 약학 조성물.
  9. 페길화된 케라틴을 포함하는 탈모방지 또는 발모촉진용 주사용 약학 조성물.
  10. 제9항에 있어서, 상기 페길화된 케라틴은 케라틴의 아민기에 폴리에틸렌글리콜이 결합된 것인, 약학 조성물.
  11. 제9항에 있어서, 상기 페길화된 케라틴은 모발재생을 유도하는 것인, 약학 조성물.
  12. 제9항에 있어서, 상기 약학 조성물은 과산화물을 추가적으로 포함하는 것인, 약학 조성물.
  13. 제12항에 있어서, 상기 과산화물은 카바마이드 퍼옥사이드, 칼슘 퍼옥사이드 및 하이드로퍼옥사이드를 포함하는 군에서 선택된 어느 하나 이상인 것인, 약학 조성물.
  14. 제12항에 있어서, 상기 과산화물은 과산화수소인 것인, 약학 조성물.
  15. 제9항에 있어서, 상기 약학 조성물은 경피흡수 촉진제(penetration enhancer)를 추가적으로 포함하는 것인, 약학 조성물.
  16. 제15항에 있어서, 상기 경피흡수 촉진제는 술폭시드(sulphoxide), 아존(azone), 피롤리돈(pyrrolidone), 지방산, 탄소수 1 내지 4의 저급 알코올, 탄소수 6 이상의 고급 지방 알코올(fatty alcohol), 글리콜(glycol), 요소(urea), 테르펜(terpene), 테르페노이드(terpenoid), 및 인지질(phospholipid)를 포함하는 군에서 선택된 어느 하나 이상인 것인, 약학 조성물.
  17. S1) 히알루론산 염을 4-(4,6-디메톡시-1,3,5-트리아진-2-일)-4-메톡시몰폴리늄 클로라이드(DMTMM)와 반응시키는 단계; 및
    S2) 단계 S1)에서 생성된 물질을 케라틴과 반응시키는 단계를 포함하는 제1항 내지 제8항 중 어느 한 항의 케라틴-히알루론산 복합체의 제조 방법.
  18. S1) O-메틸-O`-숙시닐 폴리에틸렌글리콜을 4-(4,6-디메톡시-1,3,5-트리아진-2-일)-4-메톡시몰폴리늄 클로라이드(DMTMM)와 반응시키는 단계; 및
    S2) 단계 S1)에서 생성된 물질을 케라틴과 반응시키는 단계를 포함하는 제9항 내지 제14항 중 어느 한 항의 페길화된 케라틴의 제조 방법.
PCT/KR2017/013758 2016-12-08 2017-11-29 탈모방지 또는 발모촉진용 주사용 조성물 WO2018105941A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2016-0166851 2016-12-08
KR1020160166851A KR101706515B1 (ko) 2016-12-08 2016-12-08 탈모방지 또는 발모촉진용 주사용 조성물

Publications (2)

Publication Number Publication Date
WO2018105941A2 true WO2018105941A2 (ko) 2018-06-14
WO2018105941A3 WO2018105941A3 (ko) 2018-11-29

Family

ID=58156171

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/013758 WO2018105941A2 (ko) 2016-12-08 2017-11-29 탈모방지 또는 발모촉진용 주사용 조성물

Country Status (2)

Country Link
KR (1) KR101706515B1 (ko)
WO (1) WO2018105941A2 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2017397569B2 (en) * 2017-01-31 2021-03-04 Keramedix Inc. Injectable composition for preventing hair loss or stimulating hair growth

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101706515B1 (ko) * 2016-12-08 2017-02-13 경희대학교 산학협력단 탈모방지 또는 발모촉진용 주사용 조성물
KR20230120594A (ko) * 2022-02-08 2023-08-17 주식회사 케라메딕스 탈당화 재조합 케라틴을 포함하는 탈모 치료용 조성물

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3382248A (en) 1965-11-01 1968-05-07 Upjohn Co 6-amino-4, 5-di(substituted amino)-1, 2-dihydro-1-hydroxy-2-iminopyrimidines
US5215894A (en) 1992-02-25 1993-06-01 Merck & Co., Inc. Biological process for producing 17β-N-monosubstituted carbamoyl-11-oxo-4-aza-5-α-androst-3-one testosterone-5-α reductase inhibitors
JPH1143422A (ja) * 1997-07-28 1999-02-16 Nippon Bio Kk 毛髪化粧料
KR100966902B1 (ko) * 2009-08-25 2010-06-30 (주)엘큐어 모발 건강용 트리트먼트
KR101390408B1 (ko) * 2012-01-06 2014-05-27 최수영 헤어 트리트먼트용 조성물
KR101746219B1 (ko) * 2015-01-12 2017-06-13 경희대학교 산학협력단 케라틴과 egcg 복합체를 함유하는 조성물 및 그 제조방법
KR101706515B1 (ko) * 2016-12-08 2017-02-13 경희대학교 산학협력단 탈모방지 또는 발모촉진용 주사용 조성물

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2017397569B2 (en) * 2017-01-31 2021-03-04 Keramedix Inc. Injectable composition for preventing hair loss or stimulating hair growth

Also Published As

Publication number Publication date
KR101706515B1 (ko) 2017-02-13
WO2018105941A3 (ko) 2018-11-29

Similar Documents

Publication Publication Date Title
WO2018143552A2 (ko) 탈모방지 또는 발모촉진용 주사용 조성물
WO2017123022A1 (ko) 고함량의 성장인자를 함유한 줄기세포 유래 엑소좀
CN101589137B (zh) 羊膜来源的细胞组合物及其制备方法和用途
JP2019130384A (ja) ヒト胎盤コラーゲン組成物、並びにそれらの製造方法及び使用方法
WO2018143736A1 (ko) 갈롤기로 수식된 히알루론산 유도체를 기재로 하는 하이드로젤 및 이의 용도
WO2018105941A2 (ko) 탈모방지 또는 발모촉진용 주사용 조성물
WO2010062059A2 (ko) 상처 치유를 위한 하이드로 겔 형태의 세포전달용 비히클 및 그 제조방법
EP0462194B1 (fr) Compositions stabilisees a base de fgf
WO2013085303A1 (ko) 개과동물 양막-유래 다분화능 줄기세포
WO2014021683A1 (ko) 모발 생장 촉진용 조성물
KR101746219B1 (ko) 케라틴과 egcg 복합체를 함유하는 조성물 및 그 제조방법
KR20160109019A (ko) 지방-유래 줄기세포를 함유하는 정맥혈관 투여를 통한 아토피 피부염의 예방 또는 치료용 조성물
KR101320165B1 (ko) 간엽줄기세포의 무항생제 배양액 조성물
WO2022158816A1 (ko) 줄기세포 유래 엑소좀, 히알루론산, 및 bdde를 포함하는 피부 주름개선용 필러 조성물 및 이의 제조 방법
WO2022131820A1 (ko) 아토피 피부염 예방 또는 치료용 항염증 펩타이드
WO2010077093A9 (ko) 에리스로포이에틴을 함유하는 발모 촉진 또는 탈모 방지용 조성물
WO2022050695A1 (ko) 세포외기질이 담지된 생체모사 조직 접착성 하이드로젤 패치
WO2024043715A1 (ko) 유도만능줄기세포 유래 엑소좀 및 콜라겐을 유효성분으로 포함하는 조성물 및 이의 용도
WO2024043713A1 (ko) 자연살해세포 유래 엑소좀 및 생체적합성 고분자를 유효성분으로 포함하는 조성물 및 이의 용도
WO2024005593A1 (ko) 전방십자인대 유래 줄기세포를 포함하는 건의 인대화 유도용 조성물
WO2023121399A1 (ko) 피부유래 줄기세포의 배양방법 및 그의 용도
CN109810187A (zh) 一种动物蹄筋肌腱胶原蛋白的提取方法及应用
WO2023121400A1 (ko) 모낭유래 줄기세포의 배양방법 및 그의 용도
WO2023153776A1 (ko) 탈당화 재조합 케라틴을 포함하는 탈모 치료용 조성물
WO2022035145A1 (ko) 탈모방지 또는 발모촉진용 주사제 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17877740

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 12/09/2019)

122 Ep: pct application non-entry in european phase

Ref document number: 17877740

Country of ref document: EP

Kind code of ref document: A2