WO2018098480A1 - Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing - Google Patents

Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing Download PDF

Info

Publication number
WO2018098480A1
WO2018098480A1 PCT/US2017/063468 US2017063468W WO2018098480A1 WO 2018098480 A1 WO2018098480 A1 WO 2018098480A1 US 2017063468 W US2017063468 W US 2017063468W WO 2018098480 A1 WO2018098480 A1 WO 2018098480A1
Authority
WO
WIPO (PCT)
Prior art keywords
exon
human
composition
promoter
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/063468
Other languages
English (en)
French (fr)
Inventor
Yu Zhang
Chengzu LONG
Rhonda Bassel-Duby
Eric Olson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Texas System
University of Texas at Austin
Original Assignee
University of Texas System
University of Texas at Austin
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Texas System, University of Texas at Austin filed Critical University of Texas System
Priority to EP17817498.3A priority Critical patent/EP3545090A1/en
Priority to MX2019006157A priority patent/MX2019006157A/es
Priority to JP2019528478A priority patent/JP2019536782A/ja
Priority to US16/464,124 priority patent/US20200046854A1/en
Priority to AU2017364106A priority patent/AU2017364106A1/en
Priority to CN201780084906.8A priority patent/CN110382695A/zh
Priority to CA3044531A priority patent/CA3044531A1/en
Publication of WO2018098480A1 publication Critical patent/WO2018098480A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • A61P21/04Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/02Drugs for disorders of the nervous system for peripheral neuropathies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4707Muscular dystrophy
    • C07K14/4708Duchenne dystrophy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0603Embryonic cells ; Embryoid bodies
    • C12N5/0606Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0696Artificially induced pluripotent stem cells, e.g. iPS
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0306Animal model for genetic diseases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/33Alteration of splicing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/80Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/50Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • the present disclosure relates to the fields of molecular biology, medicine and genetics. More particularly, the disclosure relates to the use of genome editing to treat Duchenne muscular dystrophy (DMD).
  • DMD Duchenne muscular dystrophy
  • DMD Duchenne muscular dystrophy
  • rAAV recombinant adeno-associated virus
  • the disclosure provides a composition comprising a sequence encoding a Cpfl polypeptide and a sequence encoding a DMD guide RNA (gRNA), wherein the DMD gRNA targets a dystrophin splice site, and wherein the DMD gRNA comprises any one of SEQ ID No. 448 to 770.
  • the sequence encoding the Cpfl polypeptide is isolated or derived from a sequence encoding aLachnospiraceae Cpfl polypeptide.
  • the sequence encoding the Cpfl polypeptide is isolated or derived from a sequence encoding Acidaminococcus Cpfl polypeptide.
  • the sequence encoding the Cpfl polypeptide or the sequence encoding the DMD gRNA comprises an RNA sequence.
  • the RNA sequence is an mRNA sequence.
  • the RNA sequence comprises at least one chemically- modified nucleotide.
  • the sequence encoding the Cpfl polypeptide comprises a DNA sequence.
  • a first vector comprises the sequence encoding the Cpfl polypeptide and a second vector comprises the sequence encoding the DMD gRNA.
  • the first vector or the sequence encoding the Cpfl polypeptide further comprises a first polyA sequence.
  • the second vector or the sequence encoding the DMD gRNA further comprises a second polyA sequence.
  • the first vector or the second vector further comprises a sequence encoding a detectable marker.
  • the detectable marker is a fluorescent maker.
  • the first vector or the sequence encoding the Cpfl polypeptide further comprises a first promoter sequence.
  • the second vector or the sequence encoding the DMD gRNA further comprises a second promoter sequence.
  • the promoter first promoter sequence and the second promoter sequence are identical.
  • the first promoter sequence and the second promoter sequence are not identical.
  • the first promoter sequence or the second promoter sequence comprises a constitutive promoter.
  • the first promoter sequence or the second promoter sequence comprises an inducible promoter.
  • the first promoter sequence or the second promoter sequence comprises a muscle-cell specific promoter.
  • the muscle-cell specific promoter is a myosin light chain-2 promoter, an a-actin promoter, a troponin 1 promoter, a Na + /Ca 2+ exchanger promoter, a dystrophin promoter, an a7 integrin promoter, a brain natriuretic peptide promoter, an ⁇ -crystallin/small heat shock protein promoter, an a-myosin heavy chain promoter, or an ANF promoter.
  • the first vector or the second vector further comprises a sequence encoding 2A-like self-cleaving domain.
  • the sequence encoding 2A-like self-cleaving domain comprises a TaV-2A peptide.
  • the vector comprises the sequence encoding the Cpfl polypeptide and the sequence encoding the DMD gRNA. In embodiments, the vector further comprises a polyA sequence. In embodiments, the vector further comprises a promoter sequence. In embodiments, the promoter sequence comprises a constitutive promoter. In further embodiments, the promoter sequence comprises an inducible promoter. In embodiments, the promoter sequence comprises a muscle-cell specific promoter.
  • the muscle-cell specific promoter is a myosin light chain-2 promoter, an a- actin promoter, a troponin 1 promoter, a Na + /Ca 2+ exchanger promoter, a dystrophin promoter, an a7 integrin promoter, a brain natriuretic peptide promoter, an aB- crystallin/small heat shock protein promoter, an a-myosin heavy chain promoter, or an ANF promoter.
  • the composition comprises a sequence codon optimized for expression in a mammalian cell. In further embodiments, the composition comprises a sequence codon optimized for expression in a human cell. In embodiments, the sequence encoding the Cpfl polypeptide is codon optimized for expression in human cells.
  • the splice site is a splice donor site. In some embodiments, the splice site is a splice acceptor site.
  • the first vector or the second vector is a non- viral vector.
  • the non-viral vector is a plasmid.
  • a liposome or a nanoparticle comprises the first vector or the second vector.
  • the first vector or the second vector is a viral vector.
  • the viral vector is an adeno-associated viral (AAV) vector.
  • AAV vector is replication-defector or conditionally replication defective.
  • the AAV vector is a recombinant AAV vector.
  • the AAV vector comprises a sequence isolated or derived from an AAV vector of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV 8, AAV9, AAV10, AAV11 or any combination thereof.
  • the composition further comprises a single-stranded DMD oligonucleotide. In some embodiments, the composition further comprises a
  • the cell comprising a composition of the disclosure.
  • the cell is a muscle cell, a satellite cell or a precursor thereof.
  • the cell is an iPSC or an iCM.
  • composition comprising a cell of the instant disclosure.
  • Also provided is a method of correcting a dystrophin gene defect comprising contacting a cell and a composition of the disclosure under conditions suitable for expression of the Cpfl polypeptide and the gRNA, wherein the Cpfl polypeptide disrupts the dystrophin splice site; and wherein disruption of the splice site results in selective skipping of a mutant DMD exon.
  • the mutant DMD exon is exon 23.
  • the mutant DMD exon is exon 51.
  • the cell is in vivo, ex vivo, in vitro or in situ.
  • the disclosure also provides a of treating muscular dystrophy in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a composition according to the instant disclosure.
  • the composition is administered locally.
  • the composition is administered directly to a muscle tissue.
  • the composition is administered by intramuscular infusion or injection.
  • the muscle tissue comprises a tibialis anterior tissue, a quadricep tissue, a soleus tissue, a diaphragm tissue or a heart tissue.
  • the composition is administered systemically.
  • the composition is administered by intravenous infusion or injection.
  • the subject following administration of the composition, the subject exhibits normal dystrophin-positive myofibers, and mosaic dystrophin-positive myofibers containing centralized nuclei, or a combination thereof. In some embodiments, following administration of the composition, the subject exhibits an emergence or an increase in a level of abundance of normal dystrophin-positive myofibers when compared to an absence or a level of abundance of normal dystrophin-positive myofibers prior to administration of the composition.
  • the subject following administration of the composition, the subject exhibits an emergence or an increase in a level of abundance of mosaic dystrophin-positive myofibers containing centralized nuclei when compared to an absence or an level of abundance of mosaic dystrophin-positive myofibers containing centralized nuclei prior to administration of the composition. In some embodiments, the subject exhibits a decreased serum CK level when compared to a serum CK level prior to administration of the composition. In embodiments, following administration of the composition, the subject exhibits improved grip strength when compared to a grip strength prior to administration of the composition.
  • the method comprises administering a therapeutically effective amount of a composition disclosed herein, wherein the cell is autologous. In some embodiments, the method comprises administering a therapeutically effective amount of the composition, wherein the cell is allogeneic.
  • the subject is a neonate, an infant, a child, a young adult, or an adult.
  • the subject has muscular dystrophy.
  • the subject is a genetic carrier for muscular dystrophy.
  • the subject is male.
  • the subject is female.
  • the subject appears to be asymptomatic and wherein a genetic diagnosis reveals a mutation in one or both copies of a DMD gene that impairs function of the DMD gene product.
  • the subject presents an early sign or symptom of muscular dystrophy.
  • the early sign or symptom of muscular dystrophy comprises loss of muscle mass or proximal muscle weakness.
  • the loss of muscle mass or proximal muscle weakness occurs in one or both leg(s) and/or a pelvis, followed by one or more upper body muscle(s).
  • the early sign or symptom of muscular dystrophy further comprises pseudohypertrophy, low endurance, difficulty standing, difficulty walking, and/or difficulty ascending a staircase or a combination thereof.
  • the subject presents a progressive sign or symptom of muscular dystrophy.
  • the progressive sign or symptom of muscular dystrophy comprises muscle tissue wasting, replacement of muscle tissue with fat, or replacement of muscle tissue with fibrotic tissue.
  • the subject presents a later sign or symptom of muscular dystrophy.
  • the later sign or symptom of muscular dystrophy comprises abnormal bone development, curvature of the spine, loss of movement, and paralysis.
  • the subject presents a neurological sign or symptom of muscular dystrophy.
  • the neurological sign or symptom of muscular dystrophy comprises intellectual impairment and paralysis.
  • administration of the composition occurs prior to the subject presenting one or more progressive, later or neurological signs or symptoms of muscular dystrophy.
  • the subject is less than 10 years old. In some embodiments, the subject is less than 5 years old. In some embodiments, the subject is less than 2 years old.
  • the disclosure also provides a use of a therapeutically-effective amount of a composition for treating muscular dystrophy in a subject in need thereof.
  • FIGS. 1A-E Correction of DMD mutations by Cpfl -mediated genome editing.
  • FIG. 1A A DMD deletion of exons 48-50 results in splicing of exon 47 to 51, generating an out-of-frame mutation of dystrophin.
  • Two strategies were used for the restoration of dystrophin expression by Cpfl .
  • small INDELs in exon 51 restore the protein reading frame of dystrophin.
  • the “exon skipping” strategy is achieved by disruption of the splice acceptor of exon 51, which results in splicing of exon 47 to 52 and restoration of the protein reading frame.
  • FIG. IB The 3' end of an intron is T-rich, which generates Cpfl PAM sequences enabling genome cleavage by Cpfl .
  • the plasmid also encodes a Cpfl gRNA driven by the U6 promoter.
  • Cells transfected with this plasmid express GFP, allowing for selection of Cpfl -expressing cells by FACS.
  • FIG. IE T7E1 assays using human 293T cells or DMD iPSCs (RIKEN51) transfected with plasmid expressing LbCpfl or AsCpfl, gRNA and GFP show genome cleavage at DMD exon 51. Red arrowheads point to cleavage products. M, marker.
  • FIGS. 2A-I DMD iPSC-derived cardiomyocytes express dystrophin after Cpfl- mediated genome editing by reframing.
  • FIG. 2A DMD skin fibroblast-derived iPSCs were edited by Cpfl using gRNA (corrected DMD-iPSCs) and then differentiated into cardiomyocytes (corrected cardiomyocytes) for analysis of genetic correction of the DMD mutation.
  • FIG. 2B A DMD deletion of exons 48-50 results in splicing of exon 47 to 51, generating an out-of-frame mutation of dystrophin.
  • FIG. 2D Western blot analysis shows dystrophin expression in a mixture of DMD iPSC-derived cardiomyocytes edited by reframing with
  • FIG. 2F Western blot analysis shows dystrophin expression in single clones (#2 and #5) of iPSC-derived cardiomyocytes following clonal selection after LbCpfl -mediated reframing. aMHC is loading control.
  • OCR Basal oxygen consumption rate
  • FIGS. 3A-H DMD iPSC-derived cardiomyocytes express dystrophin after Cpfl- mediated exon skipping.
  • FIG. 3A Two gRNAs, either gRNA (g2 or g3), which target intron 50, and the other (gl), which targets exon 51, were used to direct Cpfl -mediated removal of the exon 51 splice acceptor site.
  • FIG. 3B T7E1 assay using 293T cells transfected with LbCpfl and gRNA2 (g2) or gRNA3 (g3) shows cleavage of the DMD locus at intron 50. Red arrowheads denote cleavage products. M, marker.
  • FIG. 3E RT-PCR of iPSC-derived cardiomyocytes using primer sets described in Fig. 2B.
  • the 700-bp band in the WT lane is the dystrophin transcript from exon 47-52; the 300-bp band in the uncorrected lane is the dystrophin transcript from exon 47-52 with exon 48-50 deletion; and the lower band in the gl+g2 mixture lane (edited by LbCpfl) shows exon 51 skipping.
  • FIG. 3F Sequence of the lower band from panel e (gl+g2 mixture lane) confirms skipping of exon 51, which reframed the DMD ORF.
  • FIG. 3G Western blot analysis shows dystrophin protein expression in iPSC-derived cardiomyocyte mixtures after exon 51 skipping by LbCpfl with gl + g2.
  • FIGS. 4A-D CRISPR-Cpfl-mediated editing of exon 23 of the mouse DMD gene.
  • FIG. 4A Illustration of mouse Dmd locus highlighting the mutation at exon 23. Sequence shows the nonsense mutation caused by C to T transition, which creates a premature stop codon.
  • FIG. 4B Illustration showing the targeting location of gRNAs (gl, g2 and g3) (shown in light blue) on exon 23 of the Dmd gene. Red line represents LbCpfl PAM.
  • FIGS. 5A-F CRISPR-LbCpf -mediated Dmd correction in mdx mice.
  • FIGS. 5A-F CRISPR-LbCpf -mediated Dmd correction in mdx mice.
  • FIGG 5A Strategy of gene correction in max mice by LbCpfl -mediated germline editing. Zygotes from intercrosses of max parents were injected with gene editing components (LbCpfl mRNA, g2 gRNA and ssODN) and reimplanted into pseudo-pregnant mothers, which gave rise to pups with gene correction (mdx-C).
  • FIG. 5B Illustration showing LbCpfl correction of mdx allele by HDR or NHEJ.
  • FIG. 5C Genotyping results of LbCpfl -edited mdx mice.
  • Top panel shows T7E1 assay.
  • Blue arrowhead denotes uncleaved DNA and red arrowhead shows T7E1 cleaved DNA.
  • Bottom panel shows Tsel RFLP assay. Blue arrowhead denotes uncorrected DNA. Red arrowhead points to Tsel cleavage indicating HDR correction, mdx- C1-C5 denotes LbCpfl -edited mdx mice.
  • FIG. 5D Top panel shows sequence of WT Dmd exon 23.
  • Middle panel shows sequence of mdx Dmd exon 23 with C to T mutation, which generates a STOP codon.
  • Bottom panel shows sequence of Dmd exon 23 with HDR correction by LbCpfl -mediated editing. Black arrow points to silent mutations introduced by the ssODN HDR template.
  • FIG. 5E H&E of tibialis anterior (TA) and
  • G/P gastrocnemius/plantaris
  • mdx-C gastrocnemius/plantaris
  • FIG. 5F Immunohistochemistry of TA and G/P muscles from WT, mdx and LbCpfl-edited mice (mdx-C) using antibody to dystrophin (red), mdx muscle showed fibrosis and inflammatory infiltration, whereas mdx-C muscle showed normal muscle structure.
  • FIGS. 6A-C Genome editing at DMD exon 51 by LbCpfl or AsCpfl.
  • FIGS. 6A-C Genome editing at DMD exon 51 by LbCpfl or AsCpfl.
  • FIGS. 6A-C Genome editing at DMD exon 51 by LbCpfl or AsCpfl.
  • FIGS. 6A-C Genome editing at DMD exon 51 by LbCpfl or AsCpfl.
  • FIGS. 6A-C Genome editing at DMD exon 51 by LbCpfl or AsCpfl.
  • FIGS. 6A-C Genome editing at DMD exon 51 by LbCpfl or AsCpfl.
  • FIGS. 7A-B Histological analysis of muscles from WT, mdx and LbCpfl-edited mice (mdx-C).
  • FIG. 7A Immunohistochemistry and H&E staining of whole tibialis anterior (TA) muscle. Dystrophin staining is red.
  • FIG. 7B Immunohistochemistry and H&E staining of whole gastrocnemius/plantaris (G/P) muscles. Dystrophin staining is red.
  • the CRISPR-Cas system represents an approach for correction of diverse genetic defects.
  • the CRISPR (clustered regularly interspaced short palindromic repeats) system functions as an adaptive immune system in bacteria and archaea that defends against phage infection.
  • an endonuclease is guided to specific genomic sequences by a single guide RNA (sgRNA), resulting in DNA cutting near a protospacer adjacent motif (PAM) sequence.
  • sgRNA single guide RNA
  • PAM protospacer adjacent motif
  • Streptococcus pyogenes Cas9 (SpCas9), currently the most widely used Cas9 endonuclease, has a G-rich PAM requirement (NGG) that excludes genome editing of AT-rich regions. Additionally, the large size of SpCas9 reduces the efficiency of packaging and delivery in low-capacity viral vectors, such as Adeno-associated virus (AAV) vectors.
  • the Cas9 endonuclease from Staphylococcus aureus (SaCas9) although smaller in size than SpCas9, has a PAM sequence (NNGRRT) that is longer and more complex, thus limiting the range of its genomic targets (Ran et al , 2015). Smaller CRISPR enzymes with greater flexibility in recognition sequence and comparable cutting efficiency would facilitate precision gene editing, especially for translational applications.
  • Cpfl CRISPR from Prevotella and Francisella 1
  • Cpfl CRISPR from Prevotella and Francisella 1
  • gRNA single and short crRNA
  • crRNA CRISPR RNA
  • tracrRNA a long trans-activating crRNA
  • Cpfl requires a G-rich PAM at the 3' end of the target sequence.
  • Cpfl- mediated cleavage produces a sticky end distal to the PAM site, which activates DNA repair machinery, while Cas9 cutting generates a blunt end.
  • Cpfl also has RNase activity, which can process precursor crRNAs to mature crRNAs.
  • DSB double-stranded break
  • NHEJ non-homologous end-joining
  • HDR homology-directed repair
  • Duchenne muscular dystrophy is a recessive X-linked form of muscular dystrophy, affecting around 1 in 3,500 boys, which results in muscle degeneration and premature death.
  • the disorder is caused by a mutation in the gene dystrophin (See GenBank Accession No. NC_000023.11), located on the human X chromosome, which codes for the protein dystrophin (GenBank Accession No. AAA53189; SEQ ID NO. 383), the sequence of which is reproduced below:
  • dystrophin mRNA contains 79 exons.
  • Dystrophin mRNA is known to be alternatively spliced, resulting in various isoforms.
  • Exemplary dystrophin isoforms are listed in Table 1.
  • dystrophin mRNA contains 79 exons.
  • Dystrophin mRNA is known to be alternatively spliced, resulting in various isoforms of the protein. Exemplary dystrophin isoforms are listed in Table 1.
  • the transcript includes the common exon 2 of transcript Dp427m and has a similar length of 14 kb.
  • the Dp427c isofonn contains a unique N-terminal MED sequence, instead of the
  • isofonn Dp427m (SEQ ID NO: 3) sequence of isofonn Dp427m. The remainder of isofonn Dp427c is identical to isofonn Dp427m.
  • Dp427m transcript Dp427m isofonn encodes the main dystrophin protein found in muscle.
  • exon 1 encodes a unique N- terminal
  • Dp427pl isofonn initiates from a unique promoter/exon 1 located in what corresponds to the first intron of transcript Dp427m.
  • the transcript adds the common exon 2 of Dp427m and has a similar length (14 kb).
  • the Dp427pl isofonn replaces the
  • isofonn transcript Dp260-1 uses exons 30-79, and Sequence Nucleic Acid Nucleic Protein Accession Protein Description
  • Dp260-1 contains a 95 bp exon 1 encoding a unique N- terminal 16 aa MTEIILLIFFPAYFLN- sequence that replaces amino acids 1-1357 of the full-length dystrophin product (Dp427m isoform).
  • Dp260-2 transcript Dp260-2 uses isoform exons 30-79, starting from a promoter/exon 1 sequence located in intron 29 of the dystrophin gene that is alternatively spliced and lacks N-terminal amino acids 1-1357 of the full length dystrophin (Dp427m isoform).
  • the Dp260-2 transcript encodes a unique N-terminal MSARKLRNLSYKK
  • Dp 140 isoform Dp 140 transcripts use exons 45-79, starting at a promoter/exon 1 located in intron 44. Dp 140 transcripts have a long (1 kb) 5' UTR since translation is initiated in exon 51 (corresponding to aa 2461 of dystrophin). In addition to the alternative promoter and exon 1, differential splicing of exons 71-74 and 78 produces at least five Dpl40 isoforms. Of these, this transcript (Dp 140) contains all of the exons.
  • Dpi 16 isoform transcript Dpi 16 uses exons 56-79, starting from a promoter/exon 1 Sequence Nucleic Acid Nucleic Protein Accession Protein Description
  • the Dp 116 isoform contains a unique N-terminal MLHRKTYHVK aa sequence, instead of aa 1-2739 of dystrophin. Differential splicing produces several Dpl l6-subtypes.
  • the Dpi 16 isoform is also known as S-dystrophin or apo-dystrophin-2.
  • Dp71 isoform Dp71 transcripts use exons 63-79 with a novel 80- to 100-nt exon containing an ATG start site for a new coding sequence of 17 nt.
  • the short coding sequence is in-frame with the consecutive dystrophin sequence from exon 63.
  • this transcript includes both exons 71 and 78.
  • Dp71b isoform Dp71 transcripts use exons 63-79 with a novel 80- to 100-nt exon containing an ATG start site for a new coding sequence of 17 nt.
  • the short coding sequence is in-frame with the consecutive dystrophin sequence from exon 63.
  • Dp71b this transcript (Dp71b) lacks exon 78 and encodes a protein with a different C- terminus than Dp71 and Dp7 la isoforms.
  • Dp7 la isoform Dp71 transcripts use Sequence Nucleic Acid Nucleic Protein Accession Protein Description
  • exons 63-79 with a novel 80- to 100-nt exon containing an ATG start site for a new coding sequence of 17 nt.
  • the short coding sequence is in-frame with the consecutive dystrophin sequence from exon 63.
  • Dp71ab isoform Dp71 transcripts use exons 63-79 with a novel 80- to 100-nt exon containing an ATG start site for a new coding sequence of 17 nt.
  • the short coding sequence is in-frame with the consecutive dystrophin sequence from exon 63.
  • Dp71ab this transcript (Dp71ab) lacks both exons 71 and 78 and encodes a protein with a C -terminus like isoform Dp7 lb.
  • Dp40 isoform transcript Dp40 uses exons 63-70.
  • the 5' UTR and encoded first 7 aa are identical to that in transcript Dp71, but the stop codon lies at the splice junction of the exon/intron 70.
  • the 3' UTR includes nt from intron 70 which includes an alternative polyadenylation site.
  • the Dp40 isoform lacks the normal C- terminal end of full- length dystrophin (aa 3409-3685).
  • Dp 140c isoform
  • Dp 140 transcripts use exons 45-79, starting at a promoter/exon 1 located in intron 44.
  • Dp 140 transcripts have a long (1 kb) 5' UTR since translation is initiated in exon 51 (corresponding to aa 2461 of dystrophin).
  • differential splicing of exons 71-74 and 78 produces at least five Dpl40 isoforms. Of these, this transcript (Dp 140c) lacks exons 71-74.
  • Dp 140b Dp 140 transcripts use isoform exons 45-79, starting at a promoter/exon 1 located in intron 44. Dp 140 transcripts have a long (1 kb) 5' UTR since translation is initiated in exon 51 (corresponding to aa 2461 of dystrophin). In addition to the alternative promoter and exon 1, differential splicing of exons 71-74 and 78 produces at least five Dpl40 isoforms. Of these, this transcript (Dp 140b) lacks exon 78 and encodes a protein with a unique C- terminus.
  • Dpl40ab Dp 140 transcripts use isoform exons 45-79, starting at a promoter/exon 1 located in intron 44. Dp 140 transcripts have a long (1 kb) 5' UTR since translation is initiated in exon 51 (corresponding to aa 2461 of dystrophin).
  • Dpl40bc Dp 140 transcripts use isoform exons 45-79, starting at a promoter/exon 1 located in intron 44. Dp 140 transcripts have a long (1 kb) 5' UTR since translation is initiated in exon 51 (corresponding to aa 2461 of dystrophin). In addition to the alternative promoter and exon 1, differential splicing of exons 71-74 and 78 produces at least five Dpl40 isoforms. Of these, this transcript (Dpl40bc) lacks exons 71-74 and 78 and encodes a protein with a unique C-terminus.
  • Dystrophin is an important component within muscle tissue that provides structural stability to the dystroglycan complex (DGC) of the cell membrane. While both sexes can carry the mutation, females are rarely affected with the skeletal muscle form of the disease.
  • DGC dystroglycan complex
  • Symptoms usually appear in boys between the ages of 2 and 3 and may be visible in early infancy. Even though symptoms do not appear until early infancy, laboratory testing can identify children who carry the active mutation at birth. Progressive proximal muscle weakness of the legs and pelvis associated with loss of muscle mass is observed first.
  • Duchenne muscular dystrophy a progressive neuromuscular disorder
  • Muscle weakness also occurs later, in the arms, neck, and other areas. Calves are often enlarged. Symptoms usually appear before age 6 and may appear in early infancy. Other physical symptoms are:
  • Lumbar hyperlordosis possibly leading to shortening of the hip-flexor muscles. This has an effect on overall posture and a manner of walking, stepping, or running.
  • a positive Gowers' sign reflects the more severe impairment of the lower extremities muscles. The child helps himself to get up with upper extremities: first by rising to stand on his arms and knees, and then "walking" his hands up his legs to stand upright. Affected children usually tire more easily and have less overall strength than their peers. Creatine kinase (CPK-MM) levels in the bloodstream are extremely high.
  • An electromyography CPK-MM
  • EMG shows that weakness is caused by destruction of muscle tissue rather than by damage to nerves. Genetic testing can reveal genetic errors in the Xp21 gene. A muscle biopsy (immunohistochemistry or immunoblotting) or genetic test (blood test) confirms the absence of dystrophin, although improvements in genetic testing often make this unnecessary.
  • Duchenne muscular dystrophy is caused by a mutation of the dystrophin gene at locus Xp21, located on the short arm of the X chromosome.
  • Dystrophin is responsible for connecting the cytoskeleton of each muscle fiber to the underlying basal lamina (extracellular matrix), through a protein complex containing many subunits. The absence of dystrophin permits excess calcium to penetrate the sarcolemma (the cell membrane). Alterations in calcium and signaling pathways cause water to enter into the mitochondria, which then burst.
  • mitochondrial dysfunction gives rise to an amplification of stress-induced cytosolic calcium signals and an amplification of stress-induced reactive- oxygen species (ROS) production.
  • ROS reactive- oxygen species
  • DMD is inherited in an X-linked recessive pattern.
  • Females will typically be carriers for the disease while males will be affected.
  • a female carrier will be unaware they carry a mutation until they have an affected son.
  • the son of a carrier mother has a 50% chance of inheriting the defective gene from his mother.
  • the daughter of a carrier mother has a 50% chance of being a carrier and a 50% chance of having two normal copies of the gene.
  • an unaffected father will either pass a normal Y to his son or a normal X to his daughter.
  • Female carriers of an X-linked recessive condition such as DMD, can show symptoms depending on their pattern of X-inactivation.
  • Duchenne muscular dystrophy has an incidence of 1 in 3,500 male infants. Mutations within the dystrophin gene can either be inherited or occur spontaneously during germline transmission.
  • Duchenne muscular dystrophy can be detected with about 95% accuracy by genetic studies performed during pregnancy.
  • DNA test The muscle-specific isoform of the dystrophin gene is composed of 79 exons, and DNA testing and analysis can usually identify the specific type of mutation of the exon or exons that are affected. DNA testing confirms the diagnosis in most cases.
  • Muscle biopsy If DNA testing fails to find the mutation, a muscle biopsy test may be performed. A small sample of muscle tissue is extracted (usually with a scalpel instead of a needle) and a dye is applied that reveals the presence of dystrophin. Complete absence of the protein indicates the condition.
  • DMD is carried by an X-linked recessive gene. Males have only one
  • Prenatal tests can tell whether their unborn child has the most common mutations. There are many mutations responsible for DMD, and some have not been identified, so genetic testing only works when family members with DMD have a mutation that has been identified.
  • Amniocentesis can be done after 15 weeks, and has a 0.5% risk of miscarriage. Fetal blood sampling can be done at about 18 weeks. Another option in the case of unclear genetic test results is fetal muscle biopsy.
  • Corticosteroids such as prednisolone and deflazacort increase energy and strength and defer severity of some symptoms.
  • Orthopedic appliances may improve mobility and the ability for self-care.
  • Form-fitting removable leg braces that hold the ankle in place during sleep can defer the onset of contractures.
  • DMD generally progresses through five stages, as outlined in Bushby et ctl, Lancet Neurol, 9(1): 77-93 (2010) and Bushby et ctl, Lancet Neurol, 9(2): 177-198 (2010), incorporated by reference in their entireties.
  • CDC Centers for Disease Control and Prevention
  • patients typically exhibit an increasingly labored gait and begin to lose the ability to climb stairs and rise from the floor.
  • patients are typically able to self-propel for some time, are able to maintain posture, and may develop scoliosis.
  • upper limb function and postural maintenance is increasingly limited.
  • treatment is initiated in the presymptomatic stage of the disease. In some embodiments, treatment is initiated in the early ambulatory stage. In some embodiments, treatment is initiated in the late ambulatory stage. In embodiments, treatment is initiated during the early non-ambulatory stage. In embodiments, treatment is initiated during the late non-ambulatory stage.
  • the ventilator may require an invasive endotracheal or tracheotomy tube through which air is directly delivered, but, for some people non-invasive delivery through a face mask or mouthpiece is sufficient. Positive airway pressure machines, particularly bi-level ones, are sometimes used in this latter way.
  • the respiratory equipment may easily fit on a ventilator tray on the bottom or back of a power wheelchair with an external battery for portability.
  • Ventilator treatment may start in the mid to late teens when the respiratory muscles can begin to collapse. If the vital capacity has dropped below 40% of normal, a volume ventilator/respirator may be used during sleeping hours, a time when the person is most likely to be under ventilating ("hypoventilating"). Hypoventilation during sleep is determined by a thorough history of sleep disorder with an oximetry study and a capillary blood gas (See Pulmonary Function Testing). A cough assist device can help with excess mucus in lungs by hyperinflation of the lungs with positive air pressure, then negative pressure to get the mucus up. If the vital capacity continues to decline to less than 30 percent of normal, a volume ventilator/respirator may also be needed during the day for more assistance. The person gradually will increase the amount of time using the ventilator/respirator during the day as needed. F. Prognosis
  • Duchenne muscular dystrophy is a progressive disease which eventually affects all voluntary muscles and involves the heart and breathing muscles in later stages. The life expectancy is currently estimated to be around 25, but this varies from patient to patient.
  • Muscular Dystrophy Campaign which is a leading UK charity focusing on all muscle disease, states that "with high standards of medical care young men with Duchenne muscular dystrophy are often living well into their 30s.”
  • ILM intrinsic laryngeal muscles
  • ILM have a calcium regulation system profile suggestive of a better ability to handle calcium changes in comparison to other muscles, and this may provide a mechanistic insight for their unique pathophysiological properties.
  • the ILM may facilitate the development of novel strategies for the prevention and treatment of muscle wasting in a variety of clinical scenarios.
  • CRISPRs (clustered regularly interspaced short palindromic repeats) are DNA loci containing short repetitions of base sequences. Each repetition is followed by short segments of "spacer DNA” from previous exposures to a virus.
  • CRISPRs are found in approximately 40% of sequenced eubacteria genomes and 90% of sequenced archaea. CRISPRs are often associated with cas genes that code for proteins related to CRISPRs.
  • the CRISPR/Cas system is a prokaryotic immune system that confers resistance to foreign genetic elements such as plasmids and phages and provides a form of acquired immunity. CRISPR spacers recognize and silence these exogenous genetic elements like RNAi in eukaryotic organisms.
  • CRISPR repeats range in size from 24 to 48 base pairs. They usually show some dyad symmetry, implying the formation of a secondary structure such as a hairpin, but are not truly palindromic. Repeats are separated by spacers of similar length. Some CRISPR spacer sequences exactly match sequences from plasmids and phages, although some spacers match the prokaryote's genome (self-targeting spacers). New spacers can be added rapidly in response to phage infection.
  • CRISPR-associated (cas) genes are often associated with CRISPR repeat-spacer arrays.
  • Cas protein families As of 2013, more than forty different Cas protein families had been described. Of these protein families, Casl appears to be ubiquitous among different CRISPR/Cas systems. Particular combinations of cas genes and repeat structures have been used to define 8 CRISPR subtypes (Ecoli, Ypest, Nmeni, Dvulg, Tneap, Hmari, Apem, and Mtube), some of which are associated with an additional gene module encoding repeat-associated mysterious proteins (RAMPs). More than one CRISPR subtype may occur in a single genome. The sporadic distribution of the CRISPR/Cas subtypes suggests that the system is subject to horizontal gene transfer during microbial evolution.
  • Exogenous DNA is apparently processed by proteins encoded by Cas genes into small elements (-30 base pairs in length), which are then somehow inserted into the CRISPR locus near the leader sequence.
  • RNAs from the CRISPR loci are constitutively expressed and are processed by Cas proteins to small RNAs composed of individual, exogenously-derived sequence elements with a flanking repeat sequence. The RNAs guide other Cas proteins to silence exogenous genetic elements at the RNA or DNA level.
  • Evidence suggests functional diversity among CRISPR subtypes.
  • the Cse (Cas subtype Ecoli) proteins (called CasA-E in E. coli) form a functional complex, Cascade, that processes CRISPR RNA transcripts into spacer-repeat units that Cascade retains.
  • Cas6 processes the CRISPR transcripts.
  • CRISPR-based phage inactivation in E. coli requires Cascade and Cas3, but not Casl and Cas2.
  • the Cmr (Cas RAMP module) proteins found in Pyrococcus furiosus and other prokaryotes form a functional complex with small CRISPR RNAs that recognizes and cleaves complementary target RNAs.
  • RNA-guided CRISPR enzymes are classified as type V restriction enzymes.
  • Cas9 is a nuclease, an enzyme specialized for cutting DNA, with two active cutting sites, one for each strand of the double helix. The team demonstrated that they could disable one or both sites while preserving Cas9's ability to locate its target DNA.
  • Cas9 proteins are highly enriched in pathogenic and commensal bacteria.
  • CRISPR/Cas-mediated gene regulation may contribute to the regulation of endogenous bacterial genes, particularly during bacterial interaction with eukaryotic hosts.
  • Cas protein Cas9 of Francisella novicida uses a unique, small, CRISPR/Cas-associated RNA (scaRNA) to repress an endogenous transcript encoding a bacterial lipoprotein that is critical for F. novicida to dampen host response and promote virulence.
  • scaRNA CRISPR/Cas-associated RNA
  • CRISPR/Cas are separated into three classes.
  • Class 1 uses several Cas proteins together with the CRISPR RNAs (crRNA) to build a functional endonuclease.
  • Class 2 CRISPR systems use a single Cas protein with a crRNA.
  • Cpfl has been recently identified as a Class II, Type V CRISPR/Cas systems containing a 1,300 amino acid protein. See also U.S. Patent Publication 2014/0068797, which is incorporated by reference in its entirety.
  • CRISPR/Cpfl Clustered Regularly Interspaced Short Palindromic Repeats from Prevotella and Francisella 1 or CRISPR/Cpfl is a DNA-editing technology which shares some similarities with the CRISPR/Cas9 system.
  • Cpfl is an RNA-guided endonuclease of a class II
  • Cpfl genes are associated with the CRISPR locus, coding for an endonuclease that use a guide RNA to find and cleave viral DNA.
  • Cpf 1 is a smaller and simpler endonuclease than Cas9, overcoming some of the
  • Cpfl appears in many bacterial species.
  • the ultimate Cpfl endonuclease that was developed into a tool for genome editing was taken from one of the first 16 species known to harbor it.
  • the Cpfl is a Cpfl enzyme from Acidaminococcus (species BV3L6, UniProt Accession No. U2UMQ6; SEQ ID NO. 442), having the sequence set forth below:
  • the Cpfl is a Cpfl enzyme from Lachnospiraceae (species ND2006, UniProt Accession No. A0A182DWE3; SEQ ID NO. 443), having the sequence set forth below:
  • the Cpfl is codon optimized for expression in mammalian cells. In some embodiments, the Cpfl is codon optimized for expression in human cells.
  • compositions of the disclosure include a small version of a
  • Cas9 from the bacterium Staphylococcus aureus.
  • the small version of the Cas9 provides advantages over wild type or full length Cas9.
  • the Cpfl locus contains a mixed alpha/beta domain, a RuvC-I followed by a helical region, a RuvC-II and a zinc finger-like domain.
  • the Cpfl protein has a RuvC-like endonuclease domain that is similar to the RuvC domain of Cas9. Furthermore, Cpfl does not have a HNH endonuclease domain, and the N-terminal of Cpfl does not have the alpha- helical recognition lobe of Cas9.
  • Cpfl CRISPR-Cas domain architecture shows that Cpfl is functionally unique, being classified as Class 2, type V CRISPR system.
  • the Cpfl loci encode Casl, Cas2 and Cas4 proteins more similar to types I and III than from type II systems.
  • Database searches suggest the abundance of Cpfl -family proteins in many bacterial species.
  • Functional Cpfl does not require a tracrRNA. Therefore, functional Cpfl gRNAs of the disclosure may comprise or consist of a crRNA. This benefits genome editing because Cpfl is not only a smaller nuclease than Cas9, but also it has a smaller sgRNA molecule (proximately half as many nucleotides as Cas9).
  • the Cpfl-gRNA (e.g. Cpfl-crRNA) complex cleaves target DNA or RNA by identification of a protospacer adjacent motif 5'-YTN-3' (where "Y” is a pyrimidine and “N” is any nucleobase) or 5'-TTN-3', in contrast to the G-rich PAM targeted by Cas9. After identification of PAM, Cpfl introduces a sticky-end-like DNA double- stranded break of 4 or 5 nucleotides overhang.
  • the CRISPR/Cpfl system comprises or consists of a Cpfl enzyme and a guide RNA that finds and positions the complex at the correct spot on the double helix to cleave target DNA.
  • CRISPR/Cpfl systems activity has three stages:
  • crRNAs processing of pre-cr-RNAs producing of mature crRNAs to guide the Cas protein
  • Interference in which the Cpfl is bound to a crRNA to form a binary complex to identify and cleave a target DNA sequence.
  • This system has been modified to utilize non-naturally occurring crRNAs, which guide Cpf 1 to a desired target sequence in a non-bacterial cell, such as a mammalian cell.
  • Cas9 As an RNA guided protein, Cas9 requires a short RNA to direct the recognition of
  • Cas9 preferentially interrogates DNA sequences containing a PAM sequence NGG it can bind here without a protospacer target.
  • the Cas9-gRNA complex requires a close match to the gRNA to create a double strand break.
  • CRISPR sequences in bacteria are expressed in multiple RNAs and then processed to create guide strands for RNA. Because Eukaryotic systems lack some of the proteins required to process CRISPR RNAs the synthetic construct gRNA was created to combine the essential pieces of RNA for Cas9 targeting into a single RNA expressed with the RNA polymerase type III promoter U6. Synthetic gRNAs are slightly over lOObp at the minimum length and contain a portion which is targets the 20 protospacer nucleotides immediately preceding the PAM sequence NGG; gRNAs do not contain a PAM sequence.
  • the gRNA targets a site within a wildtype dystrophin gene. In some embodiments, the gRNA targets a site within a mutant dystrophin gene. In some embodiments, the gRNA targets a dystrophin intron. In some embodiments, the gRNA targets dystrophin exon. In some embodiments, the gRNA targets a site in a dystrophin exon that is expressed and is present in one or more of the dystrophin isoforms shown in Table 1. In embodiments, the gRNA targets a dystrophin splice site. In some embodiments, the gRNA targets a splice donor site on the dystrophin gene. In embodiments, the gRNA targets a splice acceptor site on the dystrophin gene.
  • the guide RNA targets a mutant DMD exon. In some embodiments, the mutant exon is exon 23 or 51. In some embodiments, the guide RNA targets at least one of exons 1, 23, 41, 44, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 of the dystrophin gene. In embodiments, the guide RNA targets at least one of introns 44, 45, 50, 51, 52, 53, 54, or 55 of the dystrophin gene. In preferred embodiments, the guide RNAs are designed to induce skipping of exon 51 or exon 23. In embodiments, the gRNA is targeted to a splice acceptor site of exon 51 or exon 23.
  • gRNAs for use in the methods and compositions disclosed herein are provided as SEQ ID NOs. 60-382. (Table E).
  • the gRNA is selected from any one of SEQ ID No. 60 to SEQ ID No. 382.
  • gRNAs of the disclosure comprise a sequence that is complementary to a target sequence within a coding sequence or a non-coding sequence corresponding to the DMD gene, and, therefore, hybridize to the target sequence.
  • gRNAs for Cpfl comprise a single crRNA containing a direct repeat scaffold sequence followed by 24 nucleotides of guide sequence.
  • a "guide" sequence of the crRNA comprises a sequence of the gRNA that is complementary to a target sequence.
  • crRNA of the disclosure comprises a sequence of the gRNA that is not complementary to a target sequence.
  • "Scaffold" sequences of the disclosure link the gRNA to the Cpfl polypeptide.
  • "Scaffold” sequences of the disclosure are not equivalent to a tracrRNA sequence of a gRNA-Cas9 construct.
  • Cas9 requires two RNA molecules to cut DNA while Cpfl needs one.
  • the proteins also cut DNA at different places, offering researchers more options when selecting an editing site.
  • Cas9 cuts both strands in a DNA molecule at the same position, leaving behind 'blunt' ends.
  • Cpfl leaves one strand longer than the other, creating 'sticky' ends that are easier to work with.
  • Cpfl appears to be more able to insert new sequences at the cut site, compared to Cas9.
  • the CRISPR/Cas9 system can efficiently disable genes, it is challenging to insert genes or generate a knock-in.
  • Cpfl lacks tracrRNA, utilizes a T-rich PAM and cleaves DNA via a staggered DNA DSB.
  • Cpfl recognizes different PAMs, enabling new targeting possibilities, creates 4-5 nt long sticky ends, instead of blunt ends produced by Cas9, enhancing the efficiency of genetic insertions and specificity during NHEJ or HDR, and cuts target DNA further away from PAM, further away from the Cas9 cutting site, enabling new possibilities for cleaving the DNA.
  • the first step in editing the DMD gene using CRISPR/Cpfl is to identify the genomic target sequence.
  • the genomic target for the gRNAs of the disclosure can be any -24 nucleotide DNA sequence within the dystrophin gene, provided that the sequence is unique compared to the rest of the genome.
  • the genomic target sequence is in exon 51, exon 45, exon 44, exon 53, exon 46, exon 52, exon 50, exon 43, exon 6, exon 7, exon 8, and/or exon 55 of the human dystrophin gene.
  • the genomic target sequence is a 5' or 3' splice site of exon 51, exon 45, exon 44, exon 53, exon 46, exon 52, exon 50, exon 43, exon 6, exon 7, exon 8, and/or exon 55 of the human dystrophin gene.
  • the genomic target sequence is an intron immediately upstream or downstream of exon 51, exon 45, exon 44, exon 53, exon 46, exon 52, exon 50, exon 43, exon 6, exon 7, exon 8, and/or exon 55 of the human dystrophin gene. Exemplary genomic target sequences can be found in Table D.
  • Protospacer Adjacent Motif (PAM) sequences within the genetic region to be targeted utilizes a T-rich PAM sequence (TTTN, wherein N is any nucleotide).
  • TTTN T-rich PAM sequence
  • the target sequence must be immediately upstream of a PAM. Once all possible PAM sequences and putative target sites have been identified, the next step is to choose which site is likely to result in the most efficient on-target cleavage.
  • the gRNA targeting sequence needs to match the target sequence, and the gRNA targeting sequence must not match additional sites within the genome.
  • the gRNA targeting sequence has perfect homology to the target with no homology elsewhere in the genome. In some embodiments, a given gRNA targeting sequence will have additional sites throughout the genome where partial homology exists.
  • off-targets sites are called “off-targets” and should be considered when designing a gRNA.
  • off-target sites are not cleaved as efficiently when mismatches occur near the PAM sequence, so gRNAs with no homology or those with mismatches close to the PAM sequence will have the highest specificity.
  • on-target activity factors that maximize cleavage of the desired target sequence (on-target activity) must be considered. It is known to those of skill in the art that two gRNA targeting sequences, each having 100% homology to the target DNA may not result in equivalent cleavage efficiency. In fact, cleavage efficiency may increase or decrease depending upon the specific nucleotides within the selected target sequence.
  • the next step is to synthesize and clone desired gRNAs.
  • Targeting oligos can be synthesized, annealed, and inserted into plasmids containing the gRNA scaffold using standard restriction-ligation cloning.
  • the exact cloning strategy will depend on the gRNA vector that is chosen.
  • the gRNAs for Cpfl are notably simpler than the gRNAs for Cas9, and only consist of a single crRNA containing direct repeat scaffold sequence followed by -24 nucleotides of guide sequence.
  • Cpfl requires a minimum of 16 nucleotides of guide sequence to achieve detectable DNA cleavage, and a minimum of 18 nucleotides of guide sequence to achieve efficient DNA cleavage in vitro.
  • 20-24 nucleotides of guide sequence is used.
  • the seed region of the Cpfl gRNA is generally within the first 5 nucleotides on the 5' end of the guide sequence.
  • Cpfl makes a staggered cut in the target genomic DNA. In AsCpfl and LbCpfl, the cut occurs 19 bp after the PAM on the targeted (+) strand, and 23 bp on the other strand.
  • Each gRNA should then be validated in one or more target cell lines.
  • the genomic target region may be amplified using PCR and sequenced according to methods known to those of skill in the art.
  • gene editing may be performed in vitro or ex vivo.
  • cells are contacted in vitro or ex vivo with a Cpfl and a gRNA that targets a dystrophin splice site.
  • the cells are contacted with one or more nucleic acids encoding the Cpfl and the guide RNA.
  • the one or more nucleic acids are introduced into the cells using, for example, lipofection or electroporation.
  • Gene editing may also be performed in zygotes.
  • zygotes may be injected with one or more nucleic acids encoding Cpfl and a gRNA that targets a dystrophin splice site. The zygotes may subsequently be injected into a host.
  • the Cpfl is provided on a vector.
  • the vector contains a Cpfl sequence derived from a Lachnospiraceae bacterium. See, for example, Uniprot Accession No. A0A182DWE3; SEQ ID NO. 443.
  • the vector contains a Cpfl sequence derived from Acidaminococcus bacterium. See, for example, Uniprot Accession No. U2UMQ6; SEQ ID NO. 442.
  • the Cpfl sequence is codon optimized for expression in human cells.
  • the vector further contains a sequence encoding a fluorescent protein, such as GFP, which allows Cpfl- expressing cells to be sorted using fluorescence activated cell sorting (FACS).
  • FACS fluorescence activated cell sorting
  • the vector is a viral vector such as an adeno-associated viral vector.
  • the gRNA is provided on a vector.
  • the vector is a viral vector such as an adeno-associated viral vector.
  • the Cpfl and the guide RNA are provided on the same vector. In embodiments, the Cpfl and the guide RNA are provided on different vectors.
  • the cells are additionally contacted with a single-stranded
  • small INDELs restore the protein reading frame of dystrophin ("refraining" strategy).
  • the cells may be contacted with a single gRNA.
  • a splice donor or splice acceptor site is disrupted, which results in exon skipping and restoration of the protein reading frame (“exon skipping" strategy).
  • exon skipping strategy the cells may be contacted with two or more gRNAs.
  • Efficiency of in vitro or ex vivo Cpfl -mediated DNA cleavage may be assessed using techniques known to those of skill in the art, such as the T7 El assay. Restoration of DMD expression may be confirmed using techniques known to those of skill in the art, such as RT- PCR, western blotting, and immunocytochemistry.
  • in vitro or ex vivo gene editing is performed in a muscle or satellite cell.
  • gene editing is performed in iPSC or iCM cells.
  • the iPSC cells are differentiated after gene editing.
  • the iPSC cells may be differentiated into a muscle cell or a satellite cell after editing.
  • the iPSC cells are differentiated into cardiac muscle cells, skeletal muscle cells, or smooth muscle cells.
  • the iPSC cells are differentiated into cardiomyocytes. iPSC cells may be induced to differentiate according to methods known to those of skill in the art.
  • contacting the cell with the Cpfl and the gRNA restores dystrophin expression.
  • cells which have been edited in vitro or ex vivo, or cells derived therefrom show levels of dystrophin protein that is comparable to wild type cells.
  • the edited cells, or cells derived therefrom express dystrophin at a level that is 50%, 60%, 70%, 80%, 90%, 95% or any percentage in between of wild type dystrophin expression levels.
  • the cells which have been edited in vitro or ex vivo, or cells derived therefrom have a mitochondrial number that is comparable to that of wild type cells.
  • the edited cells, or cells derived therefrom have 50%, 60%, 70%, 80%, 90%, 95% or any percentage in between as many mitochondria as wild type cells. In embodiments, the edited cells, or cells derived therefrom, show an increase in oxygen consumption rate (OCR) compared to non-edited cells at baseline.
  • OCR oxygen consumption rate
  • expression cassettes are employed to express a transcription factor product, either for subsequent purification and delivery to a cell/subject, or for use directly in a genetic-based delivery approach.
  • expression vectors which contain one or more nucleic acids encoding Cpfl and at least one DMD guide RNA that targets a dystrophin splice site.
  • a nucleic acid encoding Cpfl and a nucleic acid encoding at least one guide RNA are provided on the same vector.
  • a nucleic acid encoding Cpfl and a nucleic acid encoding least one guide RNA are provided on separate vectors.
  • Expression requires that appropriate signals be provided in the vectors, and include various regulatory elements such as enhancers/promoters from both viral and mammalian sources that drive expression of the genes of interest in cells. Elements designed to optimize messenger RNA stability and translatability in host cells also are defined. The conditions for the use of a number of dominant drug selection markers for establishing permanent, stable cell clones expressing the products are also provided, as is an element that links expression of the drug selection markers to expression of the polypeptide.
  • various regulatory elements such as enhancers/promoters from both viral and mammalian sources that drive expression of the genes of interest in cells.
  • Elements designed to optimize messenger RNA stability and translatability in host cells also are defined.
  • the conditions for the use of a number of dominant drug selection markers for establishing permanent, stable cell clones expressing the products are also provided, as is an element that links expression of the drug selection markers to expression of the polypeptide.
  • expression cassette is meant to include any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed and translated, i.e., is under the control of a promoter.
  • a “promoter” refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene.
  • under transcriptional control means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene.
  • An “expression vector” is meant to include expression cassettes comprised in a genetic construct that is capable of replication, and thus including one or more of origins of replication, transcription termination signals, poly-A regions, selectable markers, and multipurpose cloning sites.
  • promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for RNA polymerase II.
  • Much of the thinking about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transcriptional activator or repressor proteins.
  • At least one module in each promoter functions to position the start site for RNA synthesis.
  • the best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.
  • the Cpfl constructs of the disclosure are expressed by a muscle-cell specific promoter.
  • This muscle-cell specific promoter may be constitutively active or may be an inducible promoter.
  • promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well.
  • the spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription.
  • viral promotes such as the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, the Rous sarcoma virus long terminal repeat, rat insulin promoter and glyceraldehyde-3-phosphate dehydrogenase can be used to obtain high-level expression of the coding sequence of interest.
  • CMV human cytomegalovirus
  • SV40 early promoter the Rous sarcoma virus long terminal repeat
  • rat insulin promoter and glyceraldehyde-3-phosphate dehydrogenase
  • glyceraldehyde-3-phosphate dehydrogenase can be used to obtain high-level expression of the coding sequence of interest.
  • the use of other viral or mammalian cellular or bacterial phage promoters which are well-known in the art to achieve expression of a coding sequence of interest is contemplated as well, provided that the levels of expression are sufficient for a given purpose.
  • Enhancers are genetic elements that increase transcription from a promoter located at a distant position on the same molecule of DNA. Enhancers are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins. The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and contiguous, often seeming to have a very similar modular organization.
  • the promoter and/or enhancer may be, for example, immunoglobulin light chain, immunoglobulin heavy chain, T-cell receptor, HLA DQ a and/or DQ ⁇ , ⁇ -interferon, interleukin-2, interleukin-2 receptor, MHC class II 5, MHC class II HLA-Dra, ⁇ -Actin, muscle creatine kinase (MCK), prealbumin (transthyretin), elastase I, metallothionein (MTII), collagenase, albumin, a-fetoprotein, t-globin, ⁇ -globin, c-fos, c-HA-ras, insulin, neural cell adhesion molecule (NCAM), ai-antitrypain, H2B (TH2B) histone, mouse and/or type I collagen, glucose-regulated proteins (GRP94 and GRP78), rat growth hormone, human serum amyloid A (SAA), troponin I (TN I), platelet-derived
  • inducible elements may be used.
  • the inducible element is, for example, MTII, MMTV (mouse mammary tumor virus), ⁇ - interferon, adenovirus 5 E2, collagenase, stromelysin, SV40, murine MX gene, GRP78 gene, ⁇ -2-macroglobulin, vimentin, MHC class I gene ⁇ -2 ⁇ >, HSP70, proliferin, tumor necrosis factor, and/or thyroid stimulating hormone a gene.
  • the inducer is phorbol ester (TFA), heavy metals, glucocorticoids, poly(rI)x, poly(rc), E1A, phorbol ester (TP A), interferon, Newcastle Disease Virus, A23187, IL-6, serum, interferon, SV40 large T antigen, PMA, and/or thyroid hormone.
  • TFA phorbol ester
  • TP A phorbol ester
  • Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.
  • muscle specific promoters include the myosin light chain-2 promoter, the a-actin promoter, the troponin 1 promoter; the Na + /Ca 2+ exchanger promoter, the dystrophin promoter, the a7 integrin promoter, the brain natriuretic peptide promoter and the ⁇ -crystallin/small heat shock protein promoter, a-myosin heavy chain promoter, and the ANF promoter.
  • the Cpfl-gRNA constructs of the disclosure are expressed by a muscle-cell specific promoter.
  • This muscle-cell specific promoter may be constitutively active or may be an inducible promoter.
  • polyadenylation signal to effect proper polyadenylation of the gene transcript.
  • the nature of the polyadenylation signal is not believed to be crucial to the successful practice of the methods disclosed herein, and any such sequence may be employed such as human growth hormone and SV40 polyadenylation signals.
  • a terminator Also contemplated as an element of the expression cassette is a terminator. These elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.
  • the inventor utilizes the 2A-like self-cleaving domain from the insect virus Thosea asigna (TaV 2A peptide; SEQ ID NO. 444; EGRGSLLTCGDVEENPGP). These 2A-like domains have been shown to function across Eukaryotes and cause cleavage of amino acids to occur co-translationally within the 2A-like peptide domain. Therefore, inclusion of TaV 2A peptide allows the expression of multiple proteins from a single mRNA transcript.
  • telomere domain of TaV when tested in eukaryotic systems have shown greater than 99% cleavage activity (Donnelly et al, 2001).
  • Other acceptable 2A-like peptides include, but are not limited to, equine rhinitis A virus (ERAV) 2A peptide (SEQ ID NO. 445;
  • porcine teschovirus-1 (PTV1) 2A peptide SEQ ID NO. 446; ATNF S LLKQ AGD VEENP GP
  • FMDV foot and mouth disease virus
  • the 2A peptide is used to express a reporter and a Cfpl simultaneously.
  • the reporter may be, for example, GFP.
  • peptides that may be used include, but are not limited to nuclear inclusion protein a (Nia) protease, a PI protease, a 3C protease, a L protease, a 3C-like protease, or modified versions thereof.
  • Nia nuclear inclusion protein a
  • PI PI protease
  • 3C protease 3C protease
  • L protease a 3C-like protease
  • the expression construct comprises a virus or engineered construct derived from a viral genome.
  • adenovirus expression vector is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to express an antisense polynucleotide that has been cloned therein. In this context, expression does not require that the gene product be synthesized.
  • the expression vector comprises a genetically engineered form of adenovirus.
  • adenovirus a 36 kB, linear, double-stranded DNA virus, allows substitution of large pieces of adenoviral DNA with foreign sequences up to 7 kB.
  • retrovirus the adenoviral infection of host cells does not result in chromosomal integration because adenoviral DNA can replicate in an episomal manner without potential genotoxicity.
  • adenoviruses are structurally stable, and no genome rearrangement has been detected after extensive amplification. Adenovirus can infect virtually all epithelial cells regardless of their cell cycle stage. So far, adenoviral infection appears to be linked only to mild disease such as acute respiratory disease in humans.
  • Adenovirus is particularly suitable for use as a gene transfer vector because of its midsized genome, ease of manipulation, high titer, wide target cell range and high infectivity. Both ends of the viral genome contain 100-200 base pair inverted repeats (ITRs), which are cis elements necessary for viral DNA replication and packaging.
  • ITRs inverted repeats
  • the early (E) and late (L) regions of the genome contain different transcription units that are divided by the onset of viral DNA replication.
  • the El region (El A and E1B) encodes proteins responsible for the regulation of transcription of the viral genome and a few cellular genes.
  • the expression of the E2 region results in the synthesis of the proteins for viral DNA replication. These proteins are involved in DNA replication, late gene expression and host cell shut-off.
  • the products of the late genes are expressed only after significant processing of a single primary transcript issued by the major late promoter (MLP).
  • MLP major late promoter
  • the MLP (located at 16.8 m.u.) is particularly efficient during the late phase of infection, and all the mRNA's issued from this promoter possess a 5'- tripartite leader (TPL) sequence which makes them preferred mRNA's for translation.
  • TPL 5'- tripartite leader
  • recombinant adenovirus is generated from homologous recombination between shuttle vector and provirus vector. Due to the possible recombination between two proviral vectors, wild-type adenovirus may be generated from this process. Therefore, it is critical to isolate a single clone of virus from an individual plaque and examine its genomic structure.
  • adenovirus vectors which are replication deficient, depend on a unique helper cell line, designated 293, which was transformed from human embryonic kidney cells by Ad5 DNA fragments and constitutively expresses El proteins. Since the E3 region is dispensable from the adenovirus genome, the current adenovirus vectors, with the help of 293 cells, carry foreign DNA in either the El, the D3 or both regions. In nature, adenovirus can package approximately 105% of the wild-type genome, providing capacity for about 2 extra kb of DNA.
  • the maximum capacity of the current adenovirus vector is under 7.5 kb, or about 15% of the total length of the vector. More than 80% of the adenovirus viral genome remains in the vector backbone and is the source of vector-borne cytotoxicity. Also, the replication deficiency of the El-deleted virus is incomplete.
  • Helper cell lines may be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal or epithelial cells.
  • the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus. Such cells include, e.g., Vero cells or other monkey embryonic mesenchymal or epithelial cells.
  • the preferred helper cell line is 293.
  • Racher et al. (1995) disclosed improved methods for culturing 293 cells and propagating adenovirus.
  • natural cell aggregates are grown by inoculating individual cells into 1 liter siliconized spinner flasks (Techne, Cambridge, UK) containing 100-200 ml of medium. Following stirring at 40 rpm, the cell viability is estimated with trypan blue.
  • Fibra-Cel microcarriers (Bibby Sterlin, Stone, UK) (5 g/1) is employed as follows.
  • the adenoviruses of the disclosure are replication defective or at least conditionally replication defective. Other than the requirement that the adenovirus vector be replication defective, or at least conditionally defective, the nature of the adenovirus vector is not believed to be crucial to the successful practice of the methods disclosed herein.
  • the adenovirus may be of any of the 42 different known serotypes or subgroups A-F. Adenovirus type 5 of subgroup C is the preferred starting material in order to obtain the conditional replication-defective adenovirus vector for use in the present disclosure.
  • the typical vector according to the present disclosure is replication defective and will not have an adenovirus El region.
  • the position of insertion of the construct within the adenovirus sequences is not critical.
  • the polynucleotide encoding the gene of interest may also be inserted in lieu of the deleted E3 region in E3 replacement vectors, as described by Karlsson et al. (1986), or in the E4 region where a helper cell line or helper virus complements the E4 defect.
  • Adenovirus is easy to grow and manipulate and exhibits broad host range in vitro and in vivo. This group of viruses can be obtained in high titers, e.g. , 10 9 -10 12 plaque-forming units per ml, and they are highly infective. The life cycle of adenovirus does not require integration into the host cell genome. The foreign genes delivered by adenovirus vectors are episomal and, therefore, have low genotoxicity to host cells. No side effects have been reported in studies of vaccination with wild-type adenovirus (Couch et al, 1963; Top et al, 1971), demonstrating their safety and therapeutic potential as in vivo gene transfer vectors.
  • Adenovirus vectors have been used in eukaryotic gene expression and vaccine development. Animal studies suggested that recombinant adenovirus could be used for gene therapy. Studies in administering recombinant adenovirus to different tissues include trachea instillation, muscle injection, peripheral intravenous injections and stereotactic inoculation into the brain.
  • the retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse-transcription. The resulting DNA then stably integrates into cellular chromosomes as a provirus and directs synthesis of viral proteins. The integration results in the retention of the viral gene sequences in the recipient cell and its descendants.
  • the retroviral genome contains three genes, gag, pol, and env that code for capsid proteins, polymerase enzyme, and envelope components, respectively.
  • a sequence found upstream from the gag gene contains a signal for packaging of the genome into virions.
  • Two long terminal repeat (LTR) sequences are present at the 5' and 3' ends of the viral genome. These contain strong promoter and enhancer sequences and are also required for integration in the host cell genome.
  • a nucleic acid encoding a gene of interest is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective.
  • a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed.
  • the packaging sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media.
  • the media containing the recombinant retroviruses is then collected, optionally concentrated, and used for gene transfer.
  • Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells.
  • a different approach to targeting of recombinant retroviruses may be used, in which biotinylated antibodies against a retroviral envelope protein and against a specific cell receptor are used.
  • the antibodies are coupled via the biotin components by using
  • retrovirus vectors usually integrate into random sites in the cell genome. This can lead to insertional mutagenesis through the interruption of host genes or through the insertion of viral regulatory sequences that can interfere with the function of flanking genes. Another concern with the use of defective retrovirus vectors is the potential appearance of wild-type replication-competent virus in the packaging cells.
  • viral vectors may be employed as expression constructs in the present disclosure.
  • Vectors derived from viruses such as vaccinia virus, adeno-associated virus (AAV) and herpesviruses may be employed. They offer several attractive features for various mammalian cells.
  • viruses such as vaccinia virus, adeno-associated virus (AAV) and herpesviruses may be employed. They offer several attractive features for various mammalian cells.
  • the AAV vector is replication-defector or conditionally replication defective.
  • the AAV vector is a recombinant AAV vector.
  • the AAV vector comprises a sequence isolated or derived from an AAV vector of serotype AAV1, AAV2, AAV3, AAV4, AAV 5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11 or any combination thereof.
  • the AAV vector is not an AAV9 vector.
  • a single viral vector is used to deliver a nucleic acid encoding Cpfl and at least one gRNA to a cell.
  • Cpfl is provided to a cell using a first viral vector and at least one gRNA is provided to the cell using a second viral vector.
  • the expression construct must be delivered into a cell.
  • the cell may be a muscle cell, a satellite cell, a mesangioblast, a bone marrow derived cell, a stromal cell or a mesenchymal stem cell.
  • the cell is a cardiac muscle cell, a skeletal muscle cell, or a smooth muscle cell.
  • the cell is a cell in the tibialis anterior, quadriceps, soleus, diaphragm or heart.
  • the cell is an induced pluripotent stem cell (iPSC) or inner cell mass cell (iCM).
  • iPSC induced pluripotent stem cell
  • iCM inner cell mass cell
  • the cell is a human iPSC or a human iCM.
  • human iPSCs or human iCMs of the disclosure may be derived from a cultured stem cell line, an adult stem cell, a placental stem cell, or from another source of adult or embryonic stem cells that does not require the destruction of a human embryo.
  • Delivery to a cell may be accomplished in vitro, as in laboratory procedures for transforming cells lines, or in vivo or ex vivo, as in the treatment of certain disease states.
  • One mechanism for delivery is via viral infection where the expression construct is encapsulated in an infectious viral particle.
  • the nucleic acid encoding the gene of interest may be positioned and expressed at different sites.
  • the nucleic acid encoding the gene may be stably integrated into the genome of the cell. This integration may be in the cognate location and orientation via homologous recombination (gene replacement) or it may be integrated in a random, non-specific location (gene augmentation).
  • the nucleic acid may be stably maintained in the cell as a separate, episomal segment of DNA. Such nucleic acid segments or
  • “episomes” encode sequences sufficient to permit maintenance and replication independent of or in synchronization with the host cell cycle. How the expression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of expression construct employed.
  • the expression construct may simply consist of naked recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned above which physically or chemically permeabilize the cell membrane.
  • Dubensky et al (1984) successfully injected polyomavirus DNA in the form of calcium phosphate precipitates into liver and spleen of adult and newborn mice demonstrating active viral replication and acute infection. Benvenisty and Neshif (1986) also demonstrated that direct intraperitoneal injection of calcium phosphate-precipitated plasmids results in expression of the transfected genes.
  • DNA encoding a gene of interest may also be transferred in a similar manner in vivo and express the gene product.
  • In still another embodiment for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA-coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them.
  • the expression construct is delivered directly to the liver, skin, and/or muscle tissue of a subject. This may require surgical exposure of the tissue or cells, to eliminate any intervening tissue between the gun and the target organ, i. e. , ex vivo treatment. Again, DNA encoding a particular gene may be delivered via this method and still be incorporated by the present disclosure.
  • the expression construct may be entrapped in a liposome.
  • Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers. Also contemplated are lipofectamine-DNA complexes.
  • Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful.
  • Wong et al, (1980) demonstrated the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells.
  • Nicolau et al, (1987) accomplished successful liposome-mediated gene transfer in rats after intravenous injection.
  • a reagent known as Lipofectamine 2000TM is widely used and commercially available.
  • the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA.
  • the liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-1).
  • HMG-1 nuclear non-histone chromosomal proteins
  • the liposome may be complexed or employed in conjunction with both HVJ and HMG-1.
  • expression constructs have been successfully employed in transfer and expression of nucleic acid in vitro and in vivo, then they are applicable for the present disclosure. Where a bacterial promoter is employed in the DNA construct, it also will be desirable to include within the liposome an appropriate bacterial polymerase.
  • receptor-mediated delivery vehicles which can be employed to deliver a nucleic acid encoding a particular gene into cells. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis in almost all eukaryotic cells. Because of the cell type-specific distribution of various receptors, the delivery can be highly specific.
  • Receptor-mediated gene targeting vehicles generally consist of two components: a cell receptor-specific ligand and a DNA-binding agent.
  • a cell receptor-specific ligand Several ligands have been used for receptor-mediated gene transfer. The most extensively characterized ligands are
  • ASOR asialoorosomucoid
  • transferrin A synthetic neoglycoprotein, which recognizes the same receptor as ASOR, has been used as a gene delivery vehicle and epidermal growth factor (EGF) has also been used to deliver genes to squamous carcinoma cells.
  • EGF epidermal growth factor
  • compositions are prepared in a form appropriate for the intended application. Generally, this entails preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.
  • Aqueous compositions of the present disclosure comprise an effective amount of the drug, vector or proteins, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.
  • pharmaceutically acceptable carrier includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans.
  • compositions of the present disclosure include classic pharmaceutical preparations.
  • Administration of these compositions according to the present disclosure may be via any common route so long as the target tissue is available via that route, but generally including systemic administration. This includes oral, nasal, or buccal. Alternatively, administration may be by intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection, or by direct injection into muscle tissue.
  • Such compositions are normally administered as pharmaceutically acceptable compositions, as described supra.
  • the active compounds may also be administered parenterally or intraperitoneally.
  • solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations generally contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • these preparations are sterile and fluid to the extent that easy injectability exists.
  • Preparations should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • Appropriate solvents or dispersion media may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • a coating such as lecithin
  • surfactants for example, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions may be prepared by incorporating the active compounds in an appropriate amount into a solvent along with any other ingredients (for example as enumerated above) as desired, followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the desired other ingredients, e.g., as enumerated above.
  • the preferred methods of preparation include vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient(s) plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • compositions of the present disclosure are formulated in a neutral or salt form.
  • Pharmaceutically-acceptable salts include, for example, acid addition salts (formed with the free amino groups of the protein) derived from inorganic acids (e.g., hydrochloric or phosphoric acids, or from organic acids (e.g. , acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups of the protein can also be derived from inorganic bases (e.g., sodium, potassium, ammonium, calcium, or ferric hydroxides) or from organic bases (e.g. , isopropylamine, trimethylamine, histidine, procaine and the like.
  • inorganic acids e.g., hydrochloric or phosphoric acids, or from organic acids (e.g. , acetic, oxalic, tartaric, mandelic, and the like.
  • Salts formed with the free carboxyl groups of the protein can also be
  • solutions are preferably administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • the formulations may easily be administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like.
  • aqueous solution for example, the solution generally is suitably buffered and the liquid diluent first rendered isotonic for example with sufficient saline or glucose.
  • aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
  • sterile aqueous media are employed as is known to those of skill in the art, particularly in light of the present disclosure.
  • a single dose may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's
  • the Cpfl and gRNAs described herein may be delivered to the patient using adoptive cell transfer (ACT).
  • adoptive cell transfer one or more expression constructs are provided ex vivo to cells which have originated from the patient (autologous) or from one or more individual(s) other than the patient (allogeneic). The cells are subsequently introduced or reintroduced into the patient.
  • one or more nucleic acids encoding Cpfl and a guide RNA that targets a dystrophin splice site are provided to a cell ex vivo before the cell is introduced or reintroduced to a patient.
  • nAsCpf1-F2 CTGAACAATCCTGAGAAGGAGCC
  • SEQ ID NO: 14 nAsCpf1-R2 GGCATAGTCGGGGACATCATATG
  • SEQ ID NO: 11 nCpf1-2A-GFP-F ATGATGTCCCCGACTATGCCgaattcGGCAGTGGAGAGGG
  • SEQ ID NO: 15 nCpf1-2A-GFP-R AGCGAGCTCTAGttagaattcCTTGTACAG
  • T7-Scaffold-F CACCAGCGCTGCTTAATACGACTCACTATAGGGAAAT (SEQ ID NO: 17)
  • T7-Scaffold-R AGTAGCGCTTCTAGACCCTCACTTCCTACTCAG (SEQ ID NO: 18)
  • T7-nLb-Rl TGGGGTTATAGTAGGCCATCC (SEQ ID NO: 20)
  • T7-nAs-Rl TCCTTCTCAGGATTGTTCAGGTCGTA (SEQ ID NO: 13)
  • T7-nAs-NLS-F2 CTGAACAATCCTGAGAAGGAGCC (SEQ ID NO: 14)
  • Human-Exon 51 15 1 GCAAAAACCCAAAATATTTTAGCT tttt 71
  • Human-Exon 45 7 1 tcaaatAAAAAGACATGGGGCTTC tttc 96 Human-Exon 45 8 1 TGTTTTGCCTTTTTGGTATCTTAC TTTT 97
  • Human-Exon 45 10 1 TTTTGCCTTTTTGGTATCTTACAG TTTG 99
  • Human-Exon 45 11 1 GCCTTTTTGGTATCTTACAGGAAC TTTT 100
  • Human-Exon 45 14 1 GGTATCTTACAGGAACTCCAGGAT TTTT 103
  • Human-Exon 45 29 1 GCAGACTTTTTAAGCTTTCTTTAG TTTA 118
  • Human-Exon 45 30 1 TAAGCTTTCTTTAGAAGAATATTT TTTT 119
  • Human-Exon 45 32 1 AGCTTTCTTTAGAAGAATATTTCA TTTA 121
  • Human-Exon 44 2 1 acataatccatctatttttcttga tttt 125
  • Human-Exon 44 1 ACCTGCAGGCGATTTGACAGATCT tttt 131
  • Human-Exon 44 15 1 ATTTGTTTTTTC GAAATTGT ATTT TTTG 138 Human-Exon 44 16 1 TTTTTTCGAAATTGTATTTATCTT TTTG 139
  • Human-Exon 44 24 1 ACTTCTTAAAGATCAGGTTCTGAA TTTA 147
  • Human-Exon 53 5 1 CCTTTTATTCTAGTTGAAAGAATT TTTT 154
  • Human-Exon 46 4 1 AATTGCCATGTTTGTGTCCCAGTT TTTA 170
  • Human-Exon 46 13 1 AGAACTATGTTGGaaaaaaaaaTA TTTG 179
  • Human-Exon 46 24 1 CTC A AATC CC CC AGGGC CTGCTTG TTTT 190
  • Human-Exon 46 25 1 TCAAATCCCCCAGGGCCTGCTTGC TTTC 191
  • Human-Exon 52 2 1 CTGTTAAATTGTTTTCTATAAACC TTTC 200
  • Human-Exon 52 8 1 TATTTCTAAAAGTGTTTTTTGGCTGG TTTT 206
  • Human-Exon 52 9 1 ATTTCTAAAAGTGTTTTGGCTGGT TTTT 207
  • Human-Exon 52 10 1 TTTCTAAAAGTGTTTTGGCTGGTC TTTA 208
  • Human-Exon 52 14 1 GGCTGGTCTCACAATTGTACTTTA TTTT 212
  • Human-Exon 52 24 1 TTAACAAGCATGGGACACACAAAG TTTT 222
  • Human-Exon 52 25 1 TAACAAGCATGGGACACACAAAGC TTTT 223
  • Human-Exon 50 4 1 CTGTTAAAGAGGAAGTTAGAAGAT TTTT 233
  • Human-Exon 50 5 1 TGTTAAAGAGGAAGTTAGAAGATC TTTC 234
  • Human-Exon 50 8 1 CTTCAAGAGCTGAGGGCAAAGCAG TTTA 237
  • Human-Exon 50 11 1 GCTCTAGCTATTTGTTCAAAAGTG TTTG 240
  • Human-Exon 43 21 -1 CAATGCTGCTGTCTTCTTGCTATG TTTG 264 Human-Exon 43 22 1 CAATGGGAAAAAGTTAACAAAATG TTTC 265
  • Human-Exon 43 32 1 AGGGAACTGTAGAATTTATTTCAG TTTC 275
  • Human-Exon 6 1 1 AGTTTGCATGGTTCTTGCTCAAGG TTTA 282
  • Human-Exon 6 4 1 CATGGTTCTTGCTCAAGGAATGCA TTTG 285
  • Human-Exon 6 9 1 TTATGAAAATTTATTTCCACATGT TTTC 290
  • Human-Exon 6 23 1 TCCCCAGTATGGTTCCAGATCATG TTTT 304
  • Human-Exon 6 24 1 CCCCAGTATGGTTCCAGATCATGT TTTT 305
  • Human-Exon 6 25 1 CCCAGTATGGTTCCAGATCATGTC TTTC 306
  • Human-Exon 7 1 1 TATTTGTCTTtgtgtatgtgtgta TTTA 307
  • Human-Exon 7 3 1 tgtatgtgtgtatgtgtatgtgtt TTtg 309
  • Human-Exon 7 4 1 AGGCCAGACCTATTTGACTGGAAT ttTT 310
  • Human-Exon 7 5 1 GGCCAGACCTATTTGACTGGAATA tTTA 311
  • Human-Exon 7 6 1 ACTGGAATAGTGTGGTTTGCCAGC TTTG 312
  • Human-Exon 8 2 1 ACTTTGATTTGTTCATTATCCTTT TTTA 320
  • Human-Exon 8 4 1 ATTTGTTCATTATCCTTTTAGAGT TTTG 322
  • Human-Exon 8 8 1 TTCATTATCCTTTTAGAGTCTCAA TTTG 326
  • Human-Exon 8 9 1 AGAGTCTCAAATATAGAAACCAAA TTTT 327
  • Human-Exon 8 25 1 TAGGTATTACGTGCACatatatat TTTT 343
  • Human-Exon 55 3 1 TCTTTTTATGGAGTTCACTAGGTG TTTC 348 Human-Exon 55 4 1 T ATGGAGTTC ACT AGGTGC AC CAT TTTT 349
  • Human-Gl -exon51 1 gCTCCTACTCAGACTGTTACTCTG TTTA 372
  • upper case letters represent nucleotides that align to the exon sequence of the gene.
  • Lower case letters represent nucleotides that align to the intron sequence of the gene.
  • Human-Exon 45 13 1 UCCUGGAGUUCCUGUAAGAUACCA TTTT 490
  • Human-Exon 45 14 1 AUCCUGGAGUUCCUGUAAGAUACC TTTT 491
  • Human-Exon 45 34 1 AUAAUCUCUCAUGAAAUAUUCUUC TTTA 511
  • Human-Exon 44 6 1 UGCAGGUaaaagcauauggaucaa tttc 517 Human-Exon 44 7 -1 CAGGCGAUUUGACAGAUCUGUUGA TTTC 518
  • Human-Exon 46 5 1 UAUUUGUUAAUGCAAACUGGGACA TTTG 559 Human-Exon 46 6 -1 ACAAAUAGUUUGAGAACUAUGUUG tttC 560
  • Human-Exon 46 15 1 CUUCUAGCCUGGAGAAAGAAGAAU TTTT 569
  • Human-Exon 46 25 1 GCAAGCAGGCCCUGGGGGAUUUGA TTTC 579
  • Human-Exon 52 15 1 GUAAAGUACAAUUGUGAGACCAGC TTTG 601 Human-Exon 52 16 1 GUAUUCCUUUUACAUAAUACAAAG TTTA 602
  • Human-Exon 50 4 1 AUCUUCUAACUUCCUCUUUAACAG TTTT 621
  • Human-Exon 43 12 1 UAAUAUAAAAAUUUUAAAACAGUA TTTT 643

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Neurology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Reproductive Health (AREA)
  • Cell Biology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Immunology (AREA)
  • Dermatology (AREA)
  • Transplantation (AREA)
  • Neurosurgery (AREA)
PCT/US2017/063468 2016-11-28 2017-11-28 Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing Ceased WO2018098480A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP17817498.3A EP3545090A1 (en) 2016-11-28 2017-11-28 Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing
MX2019006157A MX2019006157A (es) 2016-11-28 2017-11-28 Prevención de la distrofia muscular mediante la edición de genes mediada por crispr/cpf1.
JP2019528478A JP2019536782A (ja) 2016-11-28 2017-11-28 CRISPR/Cpf1媒介性遺伝子編集による筋ジストロフィーの予防
US16/464,124 US20200046854A1 (en) 2016-11-28 2017-11-28 Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing
AU2017364106A AU2017364106A1 (en) 2016-11-28 2017-11-28 Prevention of muscular dystrophy by CRISPR/Cpfl-mediated gene editing
CN201780084906.8A CN110382695A (zh) 2016-11-28 2017-11-28 通过crispr/cpf1介导的基因编辑来预防肌营养不良
CA3044531A CA3044531A1 (en) 2016-11-28 2017-11-28 Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662426853P 2016-11-28 2016-11-28
US62/426,853 2016-11-28

Publications (1)

Publication Number Publication Date
WO2018098480A1 true WO2018098480A1 (en) 2018-05-31

Family

ID=60703123

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/063468 Ceased WO2018098480A1 (en) 2016-11-28 2017-11-28 Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing

Country Status (8)

Country Link
US (1) US20200046854A1 (https=)
EP (1) EP3545090A1 (https=)
JP (1) JP2019536782A (https=)
CN (1) CN110382695A (https=)
AU (1) AU2017364106A1 (https=)
CA (1) CA3044531A1 (https=)
MX (1) MX2019006157A (https=)
WO (1) WO2018098480A1 (https=)

Cited By (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
WO2020165768A1 (en) * 2019-02-12 2020-08-20 Università Degli Studi Di Trento Cas12a guide rna molecules and uses thereof
EP3487523A4 (en) * 2016-07-19 2020-09-02 Duke University THERAPEUTIC APPLICATIONS OF THE CPF1-BASED GENOME EDITION
CN111718964A (zh) * 2019-08-01 2020-09-29 广东赤萌医疗科技有限公司 用于修复dmd基因突变的核酸序列及系统
WO2020225754A1 (en) * 2019-05-06 2020-11-12 Mcmullen Tara Crispr gene editing for autosomal dominant diseases
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US20210040460A1 (en) 2012-04-27 2021-02-11 Duke University Genetic correction of mutated genes
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
JPWO2020122104A1 (ja) * 2018-12-11 2021-10-21 国立大学法人京都大学 ゲノムdnaに欠失を誘導する方法
WO2021216674A1 (en) * 2020-04-24 2021-10-28 University Of Massachusetts Improved cas 12a/nls mediated therapeutic gene editing platforms
US11168141B2 (en) 2018-08-02 2021-11-09 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
WO2022056000A1 (en) * 2020-09-09 2022-03-17 Vertex Pharmaceuticals Incorporated Compositions and methods for treatment of duchenne muscular dystrophy
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
JP2022526669A (ja) * 2019-04-12 2022-05-25 デューク ユニバーシティ ジストロフィン機能を修復するためのCRISPR/Casをベースにした塩基編集組成物
US11369689B2 (en) 2018-08-02 2022-06-28 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
WO2022140340A1 (en) * 2020-12-22 2022-06-30 Vertex Pharmaceuticals Incorporated Compositions comprising an rna guide targeting dmd and uses thereof
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
WO2022251181A1 (en) * 2021-05-25 2022-12-01 The Board Of Regents Of The University Of Texas System Correction of duchenne muscular dystrophy mutations with all-in-one adeno-associated virus-delivered single-cut crispr
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11679161B2 (en) 2021-07-09 2023-06-20 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
EP4215614A1 (en) 2022-01-24 2023-07-26 Dynacure Combination therapy for dystrophin-related diseases
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
WO2023172927A1 (en) * 2022-03-08 2023-09-14 Vertex Pharmaceuticals Incorporated Precise excisions of portions of exon 44, 50, and 53 for treatment of duchenne muscular dystrophy
US11771776B2 (en) 2021-07-09 2023-10-03 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11787869B2 (en) 2018-08-02 2023-10-17 Dyne Therapeutics, Inc. Methods of using muscle targeting complexes to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy or a disease associated with muscle weakness
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11970710B2 (en) 2015-10-13 2024-04-30 Duke University Genome engineering with Type I CRISPR systems in eukaryotic cells
US11987809B2 (en) 2015-11-13 2024-05-21 Avellino Lab Usa, Inc. Methods for the treatment of corneal dystrophies
US12098399B2 (en) 2022-06-24 2024-09-24 Tune Therapeutics, Inc. Compositions, systems, and methods for epigenetic regulation of proprotein convertase subtilisin/kexin type 9 (PCSK9) gene expression
US12128109B2 (en) 2021-07-09 2024-10-29 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating dystrophinopathies
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12215366B2 (en) 2015-02-09 2025-02-04 Duke University Compositions and methods for epigenome editing
US12215345B2 (en) 2013-03-19 2025-02-04 Duke University Compositions and methods for the induction and tuning of gene expression
US12214054B2 (en) 2015-11-30 2025-02-04 Duke University Therapeutic targets for the correction of the human dystrophin gene by gene editing and methods of use
US12239717B2 (en) 2021-07-09 2025-03-04 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12428631B2 (en) 2016-04-13 2025-09-30 Duke University CRISPR/Cas9-based repressors for silencing gene targets in vivo and methods of use
US12428487B2 (en) 2018-08-02 2025-09-30 Dyne Therapeutics, Inc. Complexes comprising an anti-transferrin receptor antibody linked to an oligonicleotide and method of delivering oligonucleotide to a subject
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12509492B2 (en) 2018-01-19 2025-12-30 Duke University Genome engineering with CRISPR-Cas systems in eukaryotes
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3617311B1 (en) * 2017-03-30 2024-11-20 Kyoto University Method for inducing exon skipping by genome editing
CN115279184A (zh) * 2020-03-04 2022-11-01 雷杰纳荣制药公司 B4galt1介导的功能的啮齿动物模型
EP4149622A4 (en) * 2020-05-12 2024-12-18 Myogene Bio LLC IMMUNOSUPPRESSIVE AGENTS AND METHODS OF RE-DOSING VIRAL ADMINISTRATION FOR GENE THERAPY
JP2024527362A (ja) * 2021-07-09 2024-07-24 ダイン セラピューティクス,インコーポレーテッド 筋標的化複合体およびジストロフィノパチーを処置するためのその使用
CN114214360A (zh) * 2021-12-27 2022-03-22 西安英创生物技术有限公司 先天性肌无力小鼠模型、其构建方法及应用
CN120648680A (zh) * 2024-03-15 2025-09-16 迦进生物医药(上海)有限公司 治疗杜兴型肌营养不良症和贝克型肌营养不良症的药物
CN118086408A (zh) * 2024-04-25 2024-05-28 华南理工大学 一种可实现靶向肌肉细胞基因编辑的仿病毒颗粒及其制备方法和应用

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK99653C (da) 1959-06-24 1964-08-31 Skaanska Aettikfabriken Ab Pynteliste til brug som sammenfojningsliste, hjørneliste eller endeliste ved montering af beklædningsplader.
EP0273085A1 (en) 1986-12-29 1988-07-06 IntraCel Corporation A method for internalizing nucleic acids into eukaryotic cells
US20140068797A1 (en) 2012-05-25 2014-03-06 University Of Vienna Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
WO2014197748A2 (en) * 2013-06-05 2014-12-11 Duke University Rna-guided gene editing and gene regulation
WO2015138739A2 (en) * 2014-03-12 2015-09-17 Precision Biosciences, Inc. Dystrophin gene oxon deletion using engineered nucleases
WO2016025469A1 (en) * 2014-08-11 2016-02-18 The Board Of Regents Of The University Of Texas System Prevention of muscular dystrophy by crispr/cas9-mediated gene editing
US20160208243A1 (en) * 2015-06-18 2016-07-21 The Broad Institute, Inc. Novel crispr enzymes and systems
WO2017072590A1 (en) * 2015-10-28 2017-05-04 Crispr Therapeutics Ag Materials and methods for treatment of duchenne muscular dystrophy

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR122020021379B1 (pt) * 2008-10-24 2021-05-11 Sarepta Therapeutics, Inc. oligômero morfolino fosforodiamidato, composição que compreende o mesmo e uso do dito oligômero para tratar distrofia muscular
US20140329762A1 (en) * 2013-03-15 2014-11-06 Sarepta Therapeutics, Inc. Compositions for treating muscular dystrophy
JP6744019B2 (ja) * 2014-08-11 2020-08-19 ザ ボード オブ トラスティーズ オブ ザ ユニヴァーシティー オブ イリノイ 生物流体の表皮特性評価のためのデバイス及び関連する方法
WO2017035416A2 (en) * 2015-08-25 2017-03-02 Duke University Compositions and methods of improving specificity in genomic engineering using rna-guided endonucleases
WO2017049407A1 (en) * 2015-09-23 2017-03-30 UNIVERSITé LAVAL Modification of the dystrophin gene and uses thereof
JP7490211B2 (ja) * 2016-07-19 2024-05-27 デューク ユニバーシティ Cpf1に基づくゲノム編集の治療適用

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK99653C (da) 1959-06-24 1964-08-31 Skaanska Aettikfabriken Ab Pynteliste til brug som sammenfojningsliste, hjørneliste eller endeliste ved montering af beklædningsplader.
EP0273085A1 (en) 1986-12-29 1988-07-06 IntraCel Corporation A method for internalizing nucleic acids into eukaryotic cells
US20140068797A1 (en) 2012-05-25 2014-03-06 University Of Vienna Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
WO2014197748A2 (en) * 2013-06-05 2014-12-11 Duke University Rna-guided gene editing and gene regulation
WO2015138739A2 (en) * 2014-03-12 2015-09-17 Precision Biosciences, Inc. Dystrophin gene oxon deletion using engineered nucleases
WO2016025469A1 (en) * 2014-08-11 2016-02-18 The Board Of Regents Of The University Of Texas System Prevention of muscular dystrophy by crispr/cas9-mediated gene editing
US20160208243A1 (en) * 2015-06-18 2016-07-21 The Broad Institute, Inc. Novel crispr enzymes and systems
WO2017072590A1 (en) * 2015-10-28 2017-05-04 Crispr Therapeutics Ag Materials and methods for treatment of duchenne muscular dystrophy

Non-Patent Citations (261)

* Cited by examiner, † Cited by third party
Title
AARTSMA-RUS ET AL., HUM. MUTAT., vol. 30, 2009, pages 293 - 299
ANGEL ET AL., CELL, vol. 49, 1987, pages 729
ANGEL ET AL., MOL. CELL. BIOL., vol. 7, 1987, pages 2256
BAICHWAL; SUGDEN: "Gene Transfer", 1986, PLENUM PRESS, pages: 117 - 148
BANERJI ET AL., CELL, vol. 27, no. 2, 1981, pages 299 - 308
BANERJI ET AL., CELL, vol. 33, no. 3, 1983, pages 729 - 740
BARNES ET AL., J. BIOL. CHEM., vol. 272, no. 17, 1997, pages 11510 - 7
BASKIN ET AL., EMBO MOL MED, vol. 6, 2014, pages 1610 - 1621
BENVENISTY; NESHIF, PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 9551 - 9555
BERKHOUT ET AL., CELL, vol. 59, 1989, pages 273 - 282
BERND ZETSCHE ET AL: "Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System", CELL, vol. 163, no. 3, 1 October 2015 (2015-10-01), AMSTERDAM, NL, pages 759 - 771, XP055267511, ISSN: 0092-8674, DOI: 10.1016/j.cell.2015.09.038 *
BHAVSAR ET AL., GENOMICS, vol. 35, no. 1, 1996, pages 11 - 23
BIKARD ET AL., NUCLEIC ACIDS RES., vol. 41, no. 15, 2013, pages 7429 - 7437
BLANAR ET AL., EMBO J., vol. 8, 1989, pages 1139
BODINE; LEY, EMBO J., vol. 6, 1987, pages 2997
BOSHART ET AL., CELL, vol. 41, 1985, pages 521
BOSTICK ET AL., MOL THER, vol. 19, 2011, pages 1826 - 1832
BOSZE ET AL., EMBO J, vol. 5, no. 7, 1986, pages 1615 - 1623
BRADDOCK ET AL., CELL, vol. 58, 1989, pages 269
BULLA; SIDDIQUI, J. VIROL., vol. 62, 1986, pages 1437
BURRIDGE ET AL., NAT. METHODS, vol. 11, 2014, pages 855 - 860
BUSHBY ET AL., LANCET NEUROL., vol. 9, no. 1, 2010, pages 77 - 93
BUSHBY ET AL., LANCET NEUROL., vol. 9, no. 2, 2010, pages 177 - 198
C. LONG ET AL: "Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy", SCIENCE, vol. 351, no. 6271, 22 January 2016 (2016-01-22), pages 400 - 403, XP055454443, ISSN: 0036-8075, DOI: 10.1126/science.aad5725 *
C. LONG ET AL: "Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA", SCIENCE, vol. 345, no. 6201, 14 August 2014 (2014-08-14), pages 1184 - 1188, XP055159130, ISSN: 0036-8075, DOI: 10.1126/science.1254445 *
CAMPBELL; KAHL, NATURE, vol. 338, 1989, pages 259 - 262
CAMPBELL; VILLARREAL, MOL. CELL. BIOL., vol. 8, 1988, pages 1993
CAMPERE; TILGHMAN, GENES AND DEV., vol. 3, 1989, pages 537
CAMPO ET AL., NATURE, vol. 303, 1983, pages 77
CELANDER ET AL., J. VIROLOGY, vol. 62, 1988, pages 1314
CELANDER; HASELTINE, J. VIROLOGY, vol. 61, 1987, pages 269
CHANDLER ET AL., CELL, vol. 33, 1983, pages 489
CHANG ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 2153
CHANG ET AL., STEM CELLS., vol. 27, 2009, pages 1042 - 1049
CHATTERJEE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 9114
CHEN; OKAYAMA, MOL. CELL BIOL., vol. 7, 1987, pages 2745 - 2752
CHO ET AL., NAT. BIOTECHNOL., vol. 31, no. 3, 2013, pages 230 - 232
CHOI ET AL., CELL, vol. 53, 1988, pages 519
CIRAK ET AL., THE LANCET, vol. 378, 2011, pages 595 - 605
COFFIN ET AL.: "Virology", 1990, RAVEN PRESS, pages: 1437 - 1500
COHEN ET AL., J. CELL. PHYSIOL., vol. 5, 1987, pages 75
COSTA ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 81
COUCH ET AL., AM. REV. RESP. DIS., vol. 88, 1963, pages 394 - 403
COUPAR ET AL., GENE, vol. 68, 1988, pages 1 - 10
CRIPE ET AL., EMBO J, vol. 6, 1987, pages 3745
CULOTTA; HAMER, MOL. CELL. BIOL., vol. 9, 1989, pages 1376
DANDOLO ET AL., J. VIROLOGY, vol. 47, 1983, pages 55 - 64
DAVID G. OUSTEROUT ET AL: "Multiplex CRISPR/Cas9-based genome editing for correction of dystrophin mutations that cause Duchenne muscular dystrophy", NATURE COMMUNICATIONS, vol. 6, 18 February 2015 (2015-02-18), pages 6244, XP055196515, DOI: 10.1038/ncomms7244 *
DE VILLIERS ET AL., NATURE, vol. 312, no. 5991, 1984, pages 242 - 246
DESCHAMPS ET AL., SCIENCE, vol. 230, 1985, pages 1174 - 1177
DEWITT ET AL., SCI TRANSL MED, vol. 8, 2016, pages 360ra134 - 360ra134
DONNELLY ET AL., J. GEN. VIROL., vol. 82, 2001, pages 1027 - 1041
DUBENSKY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 7529 - 7533
EDBROOKE ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 1908
EDLUND ET AL., SCIENCE, vol. 230, 1985, pages 912 - 916
FECHHEIMER ET AL., PROC NATL. ACAD. SCI. USA, vol. 84, 1987, pages 8463 - 8467
FENG; HOLLAND, NATURE, vol. 334, 1988, pages 6178
FERKOL ET AL., FASEB J., vol. 7, 1993, pages 1081 - 1091
FIRAK; SUBRAMANIAN, MOL. CELL. BIOL., vol. 6, 1986, pages 3667
FOECKING; HOFSTETTER, GENE, vol. 45, no. 1, 1986, pages 101 - 105
FONFARA ET AL., NATURE, vol. 532, 2016, pages 517 - 521
FRALEY ET AL., PROC NATL. ACAD. SCI. USA, vol. 76, 1979, pages 3348 - 3352
FRANZ ET AL., CARDOSCIENCE, vol. 5, no. 4, 1994, pages 235 - 43
FRIEDMANN, SCIENCE, vol. 244, 1989, pages 1275 - 1281
FUJITA ET AL., CELL, vol. 49, 1987, pages 357
GHOSH; BACHHAWAT ET AL.: "Liver Diseases, Targeted Diagnosis and Therapy Using Specific Receptors andLigands", 1991, MARCEL DEKKER, pages: 87 - 104
GHOSH-CHOUDHURY ET AL., EMBO J., vol. 6, 1987, pages 1733 - 1739
GILLES ET AL., CELL, vol. 33, 1983, pages 717
GLOSS ET AL., EMBO J., vol. 6, 1987, pages 3735
GODBOUT ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 1169
GOMEZ-FOIX ET AL., J. BIOL. CHEM., vol. 267, 1992, pages 25129 - 25134
GONCALVES ET AL., MOL THER, vol. 19, no. 7, 2011, pages 1331 - 1341
GOODBOURN ET AL., CELL, vol. 45, 1986, pages 601
GOODBOURN; MANIATIS, PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 1447
GOPAL, MOL. CELL BIOL., vol. 5, 1985, pages 1188 - 1190
GOPAL-SRIVASTAVA ET AL., J. MOL. CELL. BIOL., vol. 15, no. 12, 1995, pages 7081 - 90
GRAHAM ET AL., J. GEN. VIROL., vol. 36, 1977, pages 59 - 72
GRAHAM; PREVEC: "Methods in Molecular Biology: Gene Transfer and Expression Protocol", vol. 7, 1991, HUMANA PRESS, pages: 109 - 128
GRAHAM; VAN DER EB, VIROLOGY, vol. 52, 1973, pages 456 - 467
GREENE ET AL., IMMUNOLOGY TODAY, vol. 10, 1989, pages 272
GROSSCHEDL; BALTIMORE, CELL, vol. 41, 1985, pages 885
GRUNHAUS; HORWITZ, SEMINAR IN VIROLOGY, vol. 3, 1992, pages 237 - 252
HARLAND; WEINTRAUB, J. CELL BIOL., vol. 101, 1985, pages 1094 - 1099
HASLINGER; KARIN, PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 8572
HAUBER; CULLEN, J. VIROLOGY, vol. 62, 1988, pages 673
HEN ET AL., NATURE, vol. 321, 1986, pages 249
HENSEL ET AL., LYMPHOKINE RES., vol. 8, 1989, pages 347
HERMONAT; MUZYCSKA, PROC. NAT'LACAD. SCI. USA, vol. 81, 1984, pages 6466 - 6470
HERR; CLARKE, CELL, vol. 45, 1986, pages 461
HERSDORFFER ET AL., DNA CELL BIOL., vol. 9, 1990, pages 713 - 723
HERZ; GERARD, PROC. NAT'L. ACAD. SCI. USA, vol. 90, 1993, pages 2812 - 2816
HIROCHIKA ET AL., J. VIROL., vol. 61, 1987, pages 2599
HOLBROOK ET AL., VIROLOGY, vol. 157, 1987, pages 211
HOLLINGER; CHAMBERLAIN, CURRENT OPINION IN NEUROLOGY, vol. 28, 2015, pages 522 - 527
HORLICK; BENFIELD, MOL. CELL. BIOL., vol. 9, 1989, pages 2396
HORWICH ET AL., J. VIROL., vol. 64, 1990, pages 642 - 650
HSU ET AL., NATL BIOTECHNOL., vol. 31, 2013, pages 827 - 832
HUANG ET AL., CELL, vol. 27, 1981, pages 245
HUG ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 3065
HWANG ET AL., MOL. CELL. BIOL., vol. 10, 1990, pages 585
IMAGAWA ET AL., CELL, vol. 51, 1987, pages 251
IMBRA; KARIN, NATURE, vol. 323, 1986, pages 555
IMLER ET AL., MOL. CELL. BIOL., vol. 7, 1987, pages 2558
IMPERIALE; NEVINS, MOL. CELL. BIOL., vol. 4, 1984, pages 875
JAKOBOVITS ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 2555
JAMEEL; SIDDIQUI, MOL. CELL. BIOL., vol. 6, 1986, pages 710
JAYNES ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 62
JINEK ET AL., SCIENCE, vol. 337, 2012, pages 816 - 821
JOHNSON ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 3393
JONES; SHENK, CELL, vol. 13, 1978, pages 181 - 188
KADESCH; BERG, MOL. CELL. BIOL., vol. 6, 1986, pages 2593
KANEDA ET AL., SCIENCE, vol. 243, 1989, pages 375 - 378
KARIN ET AL., MOL. CELL. BIOL., vol. 7, 1987, pages 606
KARLSSON ET AL., EMBO J., vol. 5, 1986, pages 2377 - 2385
KATINKA ET AL., CELL, vol. 20, 1980, pages 393
KATO ET AL., JBIOL CHEM., vol. 266, no. 6, 1991, pages 3361 - 3364
KAWAMOTO ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 267
KELLY ET AL., J. CELL BIOL., vol. 129, no. 2, 1995, pages 383 - 96
KILEDJIAN ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 145
KIM ET AL., NATURE BIOTECHNOLOGY, 2016, pages 1 - 2
KIM ET AL., NATURE BIOTECHNOLOGY, vol. 34, 2016, pages 876 - 881
KIMURA ET AL., DEV. GROWTH DIFFER., vol. 39, no. 3, 1997, pages 257 - 65
KLAMUT ET AL., MOL. CELL. BIOL., vol. 10, 1990, pages 193
KLEIN ET AL., NATURE, vol. 327, 1987, pages 70 - 73
KOCH ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 303
KRIEGLER ET AL., CELL, vol. 38, 1984, pages 483
KRIEGLER ET AL., CELL, vol. 53, 1988, pages 45
KRIEGLER; BOTCHAN, MOL. CELL. BIOL., vol. 3, 1983, pages 325
KRIEGLER; BOTCHAN: "Eukaryotic Viral Vectors", 1982, COLD SPRING HARBOR LABORATORY
KUHL ET AL., CELL, vol. 50, 1987, pages 1057
KUNZ ET AL., NUCL. ACIDS RES., vol. 17, 1989, pages 1121
LAPOINTE ET AL., HYPERTENSION, vol. 27, no. 3, 1996, pages 715 - 22
LAPOINTE ET AL., J. BIOL. CHEM., vol. 263, no. 19, 1988, pages 9075 - 8
LARSEN ET AL., PROC. NATL. ACAD. SCI. USA., vol. 83, 1986, pages 8283
LASPIA ET AL., CELL, vol. 59, 1989, pages 283
LATIMER ET AL., MOL. CELL. BIOL., vol. 10, 1990, pages 760
LE GAL LA SALLE ET AL., SCIENCE, vol. 259, 1993, pages 988 - 990
LEE ET AL., NATURE, vol. 294, 1981, pages 228
LEVINSON ET AL., NATURE, vol. 295, 1982, pages 79
LEVRERO ET AL., GENE, vol. 101, 1991, pages 195 - 202
LI XU ET AL: "CRISPR-mediated Genome Editing Restores Dystrophin Expression and Function in mdx Mice", MOLECULAR THERAPY : THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY, vol. 24, no. 3, 1 March 2016 (2016-03-01), US, pages 564 - 569, XP055419710, ISSN: 1525-0016, DOI: 10.1038/mt.2015.192 *
LIN ET AL., MOL. CELL. BIOL., vol. 10, 1990, pages 850
LONG ET AL., SCIENCE, vol. 345, 2014, pages 1184 - 1188
LONG ET AL., SCIENCE, vol. 351, 2016, pages 400 - 403
LONG ET AL.: "Genome Editing of Monogenic Neuromuscular Diseases: A Systematic Review", JAMA NEUROL, 2016
LURIA ET AL., EMBO J., vol. 6, 1987, pages 3307
LUSKY ET AL., MOL. CELL. BIOL., vol. 3, 1983, pages 1108
LUSKY; BOTCHAN, PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 3609
MAJORS; VARMUS, PROC. NATL. ACAD. SCI. USA, vol. 80, 1983, pages 5866
MALI ET AL., NAT METHODS, vol. 10, 2013, pages 957 - 963
MALI ET AL., NAT. BIOTECHNOL., vol. 31, 2013, pages 833 - 838
MALI ET AL., SCIENCE, vol. 339, 2013, pages 823 - 826
MANN ET AL., CELL, vol. 33, 1983, pages 153 - 159
MARESCA ET AL., GENOME RESEARCH, vol. 23, 2013, pages 539 - 546
MARKOWITZ ET AL., J. VIROL., vol. 62, 1988, pages 1120 - 1124
MARTARI, M. ET AL., HUM GENE THER, vol. 20, no. 7, 2009, pages 759 - 766
MCNEALL ET AL., GENE, vol. 76, 1989, pages 81
MIKSICEK ET AL., CELL, vol. 46, 1986, pages 203
MILLAY ET AL., NAT. MED., vol. 14, 2008, pages 442 - 447
MOJICA ET AL., J. MOL. EVOL., vol. 60, 2005, pages 174 - 182
MORDACQ; LINZER, GENES AND DEV., vol. 3, 1989, pages 760
MOREAU ET AL., NUCL. ACIDS RES., vol. 9, 1981, pages 6047
MOSS ET AL., J. GEN. PHYSIOL., vol. 108, no. 6, 1996, pages 473 - 84
MOURKIOTI ET AL., NATURE CELL BIOLOGY, vol. 15, 2013, pages 895 - 904
MUESING ET AL., CELL, vol. 48, 1987, pages 691
NELSON ET AL., SCIENCE, vol. 351, 2016, pages 403 - 407
NICOLAS; RUBINSTEIN: "Vectors: A survey of molecular cloning vectors and their uses", 1988, BUTTERWORTH, pages: 494 - 513
NICOLAU ET AL., METHODS ENZYMOL., vol. 149, 1987, pages 157 - 176
NICOLAU; SENE, BIOCHIM. BIOPHYS. ACTA, vol. 721, 1982, pages 185 - 190
ONDEK ET AL., EMBO J., vol. 6, 1987, pages 1017
ORNITZ ET AL., MOL. CELL. BIOL., vol. 7, 1987, pages 3466
PADGETT, R.A., TRENDS GENET, vol. 28, 2012, pages 147 - 154
PALMITER ET AL., CELL, vol. 29, 1982, pages 701
PALMITER ET AL., NATURE, vol. 300, 1982, pages 611
PASKIND ET AL., VIROLOGY, vol. 67, 1975, pages 242 - 248
PECH ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 396
PERALES ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, no. 9, 1994, pages 4086 - 4090
PEREZ-STABLE; CONSTANTINI, MOL. CELL. BIOL., vol. 10, 1990, pages 1116
PICARD; SCHAFFNER, NATURE, vol. 307, 1984, pages 83
PINKERT ET AL., GENES AND DEV., vol. 1, 1987, pages 268
PONTA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 1020
PORTON ET AL., MOL. CELL. BIOL., vol. 10, 1990, pages 1076
POTTER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 7161 - 7165
QUEEN; BALTIMORE, CELL, vol. 35, 1983, pages 741
QUINN ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 4713
RACHER ET AL., BIOTECH. TECHNIQUES, vol. 9, 1995, pages 169 - 174
RAGOT ET AL., NATURE, vol. 361, 1993, pages 647 - 650
RAN ET AL., NATURE, vol. 520, 2015, pages 186 - 191
REDONDO ET AL., SCIENCE, vol. 247, 1990, pages 1225
REISMAN; ROTTER, MOL. CELL. BIOL., vol. 9, 1989, pages 3571
REMINGTON'S PHARMACEUTICAL SCIENCES, pages 1035 - 1038,1570-1580
RENAN, RADIOTHER. ONCOL., vol. 19, 1990, pages 197 - 218
RESENDEZ JR. ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 4579
RICH ET AL., HUM. GENE THER., vol. 4, 1993, pages 461 - 476
RIDGEWAY: "Vectors: A survey of molecular cloning vectors and their uses", 1988, BUTTERWORTH, pages: 467 - 492
RIPE ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 2224
RIPPE ET AL., MOL. CELL BIOL., vol. 10, 1990, pages 689 - 695
RITTLING ET AL., NUC. ACIDS RES., vol. 17, 1989, pages 1619
ROSEN ET AL., CELL, vol. 41, 1988, pages 813
ROSENFELD ET AL., CELL, vol. 68, 1992, pages 143 - 155
ROSENFELD ET AL., SCIENCE, vol. 252, 1991, pages 431 - 434
ROUX ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 9079 - 9083
SAKAI ET AL., GENES AND DEV., vol. 2, 1988, pages 1144
SATAKE ET AL., J. VIROLOGY, vol. 62, 1988, pages 970
SCHAFFNER ET AL., J. MOL. BIOL., vol. 201, 1988, pages 81
SEARLE ET AL., MOL. CELL. BIOL., vol. 5, 1985, pages 1480
SHARP; MARCINIAK, CELL, vol. 59, 1989, pages 229
SHAUL; BEN-LEVY, EMBOJ., vol. 6, 1987, pages 1913
SHERMAN ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 50
SHIMIZU-MOTOHASHI ET AL., AM J TRANSL RES, vol. 8, 2016, pages 2471 - 2489
SLEIGH; LOCKETT, J. EMBO, vol. 4, 1985, pages 3831
SPALHOLZ ET AL., CELL, vol. 42, 1985, pages 183
SPANDAU; LEE, J. VIROLOGY, vol. 62, 1988, pages 427
SPANDIDOS; WILKIE, EMBO J., vol. 2, 1983, pages 1193
STEPHENS; HENTSCHEL, BIOCHEM. J., vol. 248, 1987, pages 1
STRATFORD-PERRICAUDET ET AL., HUM. GENE. THER., vol. 1, 1990, pages 241 - 256
STRATFORD-PERRICAUDET; PERRICAUDET: "Human Gene Transfer", 1991, JOHN LIBBEY EUROTEXT, pages: 51 - 61
STUART ET AL., NATURE, vol. 317, 1985, pages 828
SULLIVAN; PETERLIN, MOL. CELL. BIOL., vol. 7, 1987, pages 3315
SWARTZENDRUBER; LEHMAN, J. CELL. PHYSIOLOGY, vol. 85, 1975, pages 179
TABEBORDBAR ET AL., SCIENCE, vol. 351, 2016, pages 407 - 411
TAKEBE ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 466
TAVERNIER ET AL., NATURE, vol. 301, 1983, pages 634
TAYLOR ET AL., J. BIOL. CHEM., vol. 264, 1989, pages 15160
TAYLOR; KINGSTON, MOL. CELL. BIOL., vol. 10, 1990, pages 165
TAYLOR; KINGSTON, MOL. CELL. BIOL., vol. 10, 1990, pages 176
TEMIN: "Gene Transfer", 1986, PLENUM PRESS, pages: 149 - 188
THIESEN ET AL., J. VIROLOGY, vol. 62, 1988, pages 614
TOP ET AL., J. INFECT. DIS., vol. 124, 1971, pages 155 - 160
TOTH ET AL., BIOLOGY DIRECT, 2016, pages 1 - 14
TRONCHE ET AL., MOL. BIOL. MED., vol. 7, 1990, pages 173
TRUDEL; CONSTANTINI, GENES AND DEV., vol. 6, 1987, pages 954
TSAI ET AL., NATURE BIOTECHNOLOGY, vol. 34, 2016, pages 882 - 887
TUR-KASPA ET AL., MOL. CELL BIOL., vol. 6, 1986, pages 716 - 718
TYNDELL ET AL., NUC. ACIDS. RES., vol. 9, 1981, pages 6231
VANNICE; LEVINSON, J. VIROLOGY, vol. 62, 1988, pages 1305
VARMUS ET AL., CELL, vol. 25, 1981, pages 23 - 36
VASSEUR ET AL., PROC NATL. ACAD. SCI. U.S.A., vol. 77, 1980, pages 1068
WAGNER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, no. 9, 1990, pages 3410 - 3414
WANG ET AL., CELL, vol. 153, 2013, pages 910 - 910
WEBER ET AL., CELL, vol. 36, 1984, pages 983
WEINBERGER ET AL., MOL. CELL. BIOL., vol. 8, 1984, pages 988
WINOTO; BALTIMORE, CELL, vol. 59, 1989, pages 649
WONG ET AL., GENE, vol. 10, 1980, pages 87 - 94
WU ET AL., CELL STEM CELL, vol. 13, 2013, pages 659 - 662
WU ET AL., NAT BIOTECHNOL, vol. 32, 2014, pages 670 - 676
WU; WU, ADV. DRUG DELIVERY REV., vol. 12, 1993, pages 159 - 167
WU; WU, BIOCHEMISTRY, vol. 27, 1988, pages 887 - 892
WU; WU, J. BIOL. CHEM., vol. 262, 1987, pages 4429 - 4432
XU ET AL., MOL THER, vol. 24, 2016, pages 564 - 569
YAMAUCHI-TAKIHARA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, no. 10, 1989, pages 3504 - 3508
YANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 9568 - 9572
YIN ET AL., NAT BIOTECHNOL, vol. 32, 2014, pages 551 - 553
YIN ET AL., PHYSIOL REV, vol. 93, 2013, pages 23 - 67
YOUNG ET AL., CELL STEM CELL, vol. 18, 2016, pages 533 - 540
YU ZHANG ET AL: "CRISPR-Cpf1 correction of muscular dystrophy mutations in human cardiomyocytes and mice", SCIENCE, vol. 3, no. 4, 12 April 2017 (2017-04-12), pages e1602814, XP055454449, ISSN: 0036-8075, DOI: 10.1126/sciadv.1602814 *
YUTZEY ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 1397
ZECHNER ET AL., CELL METABOLISM, vol. 12, 2010, pages 633 - 642
ZELENIN ET AL., FEBS LETT., vol. 280, 1991, pages 94 - 96
ZETSCHE ET AL., CELL, vol. 163, 2015, pages 759 - 771
ZIOBER; KRAMER, J. BIO. CHEM., vol. 271, no. 37, 1996, pages 22915 - 22922

Cited By (119)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US20210040460A1 (en) 2012-04-27 2021-02-11 Duke University Genetic correction of mutated genes
US11976307B2 (en) 2012-04-27 2024-05-07 Duke University Genetic correction of mutated genes
US12215345B2 (en) 2013-03-19 2025-02-04 Duke University Compositions and methods for the induction and tuning of gene expression
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US12559737B2 (en) 2013-09-06 2026-02-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US12473573B2 (en) 2013-09-06 2025-11-18 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US12584118B2 (en) 2013-09-06 2026-03-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US12215365B2 (en) 2013-12-12 2025-02-04 President And Fellows Of Harvard College Cas variants for gene editing
US12398406B2 (en) 2014-07-30 2025-08-26 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12215366B2 (en) 2015-02-09 2025-02-04 Duke University Compositions and methods for epigenome editing
US11970710B2 (en) 2015-10-13 2024-04-30 Duke University Genome engineering with Type I CRISPR systems in eukaryotic cells
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US12344869B2 (en) 2015-10-23 2025-07-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11987809B2 (en) 2015-11-13 2024-05-21 Avellino Lab Usa, Inc. Methods for the treatment of corneal dystrophies
US12214054B2 (en) 2015-11-30 2025-02-04 Duke University Therapeutic targets for the correction of the human dystrophin gene by gene editing and methods of use
US12428631B2 (en) 2016-04-13 2025-09-30 Duke University CRISPR/Cas9-based repressors for silencing gene targets in vivo and methods of use
EP3487523A4 (en) * 2016-07-19 2020-09-02 Duke University THERAPEUTIC APPLICATIONS OF THE CPF1-BASED GENOME EDITION
EP4275747A3 (en) * 2016-07-19 2024-01-24 Duke University Therapeutic applications of cpf1-based genome editing
US12214056B2 (en) 2016-07-19 2025-02-04 Duke University Therapeutic applications of CPF1-based genome editing
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US12516308B2 (en) 2017-03-09 2026-01-06 President And Fellows Of Harvard College Suppression of pain by gene editing
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US12435331B2 (en) 2017-03-10 2025-10-07 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US12359218B2 (en) 2017-07-28 2025-07-15 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12509492B2 (en) 2018-01-19 2025-12-30 Duke University Genome engineering with CRISPR-Cas systems in eukaryotes
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof
US12005124B2 (en) 2018-08-02 2024-06-11 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11795233B2 (en) 2018-08-02 2023-10-24 Dyne Therapeutics, Inc. Muscle-targeting complex comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US12357703B2 (en) 2018-08-02 2025-07-15 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping
US11633496B2 (en) 2018-08-02 2023-04-25 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11497815B2 (en) 2018-08-02 2022-11-15 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11795234B2 (en) 2018-08-02 2023-10-24 Dyne Therapeutics, Inc. Methods of producing muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US11369689B2 (en) 2018-08-02 2022-06-28 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12428487B2 (en) 2018-08-02 2025-09-30 Dyne Therapeutics, Inc. Complexes comprising an anti-transferrin receptor antibody linked to an oligonicleotide and method of delivering oligonucleotide to a subject
US12263225B2 (en) 2018-08-02 2025-04-01 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of use thereof to target dystrophin and to treat Duchenne muscular dystrophy
US12325753B2 (en) 2018-08-02 2025-06-10 Dyne Therapeutics, Inc. Method of using an anti-transferrin receptor antibody to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy
US11833217B2 (en) 2018-08-02 2023-12-05 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12012460B2 (en) 2018-08-02 2024-06-18 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US11787869B2 (en) 2018-08-02 2023-10-17 Dyne Therapeutics, Inc. Methods of using muscle targeting complexes to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy or a disease associated with muscle weakness
US11248056B1 (en) 2018-08-02 2022-02-15 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11168141B2 (en) 2018-08-02 2021-11-09 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12478687B2 (en) 2018-08-02 2025-11-25 Dyne Therapeutics, Inc. United states
US12329825B1 (en) 2018-08-02 2025-06-17 Dyne Therapeutics, Inc. Muscle targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping of exon 44 of dystrophin in a subject
US12173079B2 (en) 2018-08-02 2024-12-24 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
JP7395159B2 (ja) 2018-12-11 2023-12-11 国立大学法人京都大学 ゲノムdnaに欠失を誘導する方法
US12522818B2 (en) 2018-12-11 2026-01-13 The University Of Osaka Method for inducing deletion in genomic DNA
JPWO2020122104A1 (ja) * 2018-12-11 2021-10-21 国立大学法人京都大学 ゲノムdnaに欠失を誘導する方法
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
WO2020165768A1 (en) * 2019-02-12 2020-08-20 Università Degli Studi Di Trento Cas12a guide rna molecules and uses thereof
CN113614231A (zh) * 2019-02-12 2021-11-05 特伦托大学 CAS12a向导RNA分子及其用途
US20220145305A1 (en) * 2019-02-12 2022-05-12 Universita' Degli Studi Di Trento CAS12a GUIDE RNA MOLECULES AND USES THEREOF
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12509680B2 (en) 2019-03-19 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12281303B2 (en) 2019-03-19 2025-04-22 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12570972B2 (en) 2019-03-19 2026-03-10 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
JP2022526669A (ja) * 2019-04-12 2022-05-25 デューク ユニバーシティ ジストロフィン機能を修復するためのCRISPR/Casをベースにした塩基編集組成物
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
WO2020225754A1 (en) * 2019-05-06 2020-11-12 Mcmullen Tara Crispr gene editing for autosomal dominant diseases
CN111718964A (zh) * 2019-08-01 2020-09-29 广东赤萌医疗科技有限公司 用于修复dmd基因突变的核酸序列及系统
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
WO2021216674A1 (en) * 2020-04-24 2021-10-28 University Of Massachusetts Improved cas 12a/nls mediated therapeutic gene editing platforms
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
WO2022056000A1 (en) * 2020-09-09 2022-03-17 Vertex Pharmaceuticals Incorporated Compositions and methods for treatment of duchenne muscular dystrophy
WO2022140340A1 (en) * 2020-12-22 2022-06-30 Vertex Pharmaceuticals Incorporated Compositions comprising an rna guide targeting dmd and uses thereof
WO2022251181A1 (en) * 2021-05-25 2022-12-01 The Board Of Regents Of The University Of Texas System Correction of duchenne muscular dystrophy mutations with all-in-one adeno-associated virus-delivered single-cut crispr
US11771776B2 (en) 2021-07-09 2023-10-03 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11679161B2 (en) 2021-07-09 2023-06-20 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US12397062B2 (en) 2021-07-09 2025-08-26 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11986537B2 (en) 2021-07-09 2024-05-21 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12440575B2 (en) 2021-07-09 2025-10-14 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12144868B2 (en) 2021-07-09 2024-11-19 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12239716B2 (en) 2021-07-09 2025-03-04 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11844843B2 (en) 2021-07-09 2023-12-19 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US12239717B2 (en) 2021-07-09 2025-03-04 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12329824B1 (en) 2021-07-09 2025-06-17 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12144867B2 (en) 2021-07-09 2024-11-19 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12403203B2 (en) 2021-07-09 2025-09-02 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12128109B2 (en) 2021-07-09 2024-10-29 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating dystrophinopathies
EP4215614A1 (en) 2022-01-24 2023-07-26 Dynacure Combination therapy for dystrophin-related diseases
WO2023172927A1 (en) * 2022-03-08 2023-09-14 Vertex Pharmaceuticals Incorporated Precise excisions of portions of exon 44, 50, and 53 for treatment of duchenne muscular dystrophy
US12098399B2 (en) 2022-06-24 2024-09-24 Tune Therapeutics, Inc. Compositions, systems, and methods for epigenetic regulation of proprotein convertase subtilisin/kexin type 9 (PCSK9) gene expression

Also Published As

Publication number Publication date
CN110382695A (zh) 2019-10-25
US20200046854A1 (en) 2020-02-13
MX2019006157A (es) 2019-11-21
JP2019536782A (ja) 2019-12-19
AU2017364106A1 (en) 2019-06-20
CA3044531A1 (en) 2018-05-31
EP3545090A1 (en) 2019-10-02

Similar Documents

Publication Publication Date Title
US20200046854A1 (en) Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing
US20220072156A1 (en) Prevention of muscular dystrophy by crispr/cas9-mediated gene editing
US10687520B2 (en) Generation and correction of a humanized mouse model with a deletion of dystrophin exon 44
EP3565897B1 (en) Optimized strategy for exon skipping modifications using crispr/cas9 with triple guide sequences
US20200370042A1 (en) Compositions and methods for correcting dystrophin mutations in human cardiomyocytes
US20190364862A1 (en) Dmd reporter models containing humanized duchenne muscular dystrophy mutations
US20210261962A1 (en) Correction of dystrophin exon 43, exon 45, or exon 52 deletions in duchenne muscular dystrophy
US20200260698A1 (en) Exon deletion correction of duchenne muscular dystrophy mutations in the dystrophin actin binding domain 1 using crispr genome editing
EP3735462A1 (en) Therapeutic crispr/cas9 compositions and methods of use
Class et al. Patent application title: PREVENTION OF MUSCULAR DYSTROPHY BY CRISPR/CAS9-MEDIATED GENE EDITING Inventors: Eric N. Olson (Dallas, TX, US) Eric N. Olson (Dallas, TX, US) Chengzu Long (Dallas, TX, US) John R. Mcanally (Dallas, TX, US) John M. Shelton (Dallas, TX, US) Rhonda Bassel-Duby (Dallas, TX, US)
OA20296A (en) Optimized strategy for exon skipping modifications using CRISPR/CAS9 with triple guide sequences.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17817498

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3044531

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2019528478

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017364106

Country of ref document: AU

Date of ref document: 20171128

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2017817498

Country of ref document: EP

Effective date: 20190628