WO2018098480A1 - Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing - Google Patents
Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing Download PDFInfo
- Publication number
- WO2018098480A1 WO2018098480A1 PCT/US2017/063468 US2017063468W WO2018098480A1 WO 2018098480 A1 WO2018098480 A1 WO 2018098480A1 US 2017063468 W US2017063468 W US 2017063468W WO 2018098480 A1 WO2018098480 A1 WO 2018098480A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- exon
- human
- composition
- promoter
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0075—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/02—Drugs for disorders of the nervous system for peripheral neuropathies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4707—Muscular dystrophy
- C07K14/4708—Duchenne dystrophy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
- C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0306—Animal model for genetic diseases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/33—Alteration of splicing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
Definitions
- the present disclosure relates to the fields of molecular biology, medicine and genetics. More particularly, the disclosure relates to the use of genome editing to treat Duchenne muscular dystrophy (DMD).
- DMD Duchenne muscular dystrophy
- DMD Duchenne muscular dystrophy
- rAAV recombinant adeno-associated virus
- the disclosure provides a composition comprising a sequence encoding a Cpfl polypeptide and a sequence encoding a DMD guide RNA (gRNA), wherein the DMD gRNA targets a dystrophin splice site, and wherein the DMD gRNA comprises any one of SEQ ID No. 448 to 770.
- the sequence encoding the Cpfl polypeptide is isolated or derived from a sequence encoding aLachnospiraceae Cpfl polypeptide.
- the sequence encoding the Cpfl polypeptide is isolated or derived from a sequence encoding Acidaminococcus Cpfl polypeptide.
- the sequence encoding the Cpfl polypeptide or the sequence encoding the DMD gRNA comprises an RNA sequence.
- the RNA sequence is an mRNA sequence.
- the RNA sequence comprises at least one chemically- modified nucleotide.
- the sequence encoding the Cpfl polypeptide comprises a DNA sequence.
- a first vector comprises the sequence encoding the Cpfl polypeptide and a second vector comprises the sequence encoding the DMD gRNA.
- the first vector or the sequence encoding the Cpfl polypeptide further comprises a first polyA sequence.
- the second vector or the sequence encoding the DMD gRNA further comprises a second polyA sequence.
- the first vector or the second vector further comprises a sequence encoding a detectable marker.
- the detectable marker is a fluorescent maker.
- the first vector or the sequence encoding the Cpfl polypeptide further comprises a first promoter sequence.
- the second vector or the sequence encoding the DMD gRNA further comprises a second promoter sequence.
- the promoter first promoter sequence and the second promoter sequence are identical.
- the first promoter sequence and the second promoter sequence are not identical.
- the first promoter sequence or the second promoter sequence comprises a constitutive promoter.
- the first promoter sequence or the second promoter sequence comprises an inducible promoter.
- the first promoter sequence or the second promoter sequence comprises a muscle-cell specific promoter.
- the muscle-cell specific promoter is a myosin light chain-2 promoter, an a-actin promoter, a troponin 1 promoter, a Na + /Ca 2+ exchanger promoter, a dystrophin promoter, an a7 integrin promoter, a brain natriuretic peptide promoter, an ⁇ -crystallin/small heat shock protein promoter, an a-myosin heavy chain promoter, or an ANF promoter.
- the first vector or the second vector further comprises a sequence encoding 2A-like self-cleaving domain.
- the sequence encoding 2A-like self-cleaving domain comprises a TaV-2A peptide.
- the vector comprises the sequence encoding the Cpfl polypeptide and the sequence encoding the DMD gRNA. In embodiments, the vector further comprises a polyA sequence. In embodiments, the vector further comprises a promoter sequence. In embodiments, the promoter sequence comprises a constitutive promoter. In further embodiments, the promoter sequence comprises an inducible promoter. In embodiments, the promoter sequence comprises a muscle-cell specific promoter.
- the muscle-cell specific promoter is a myosin light chain-2 promoter, an a- actin promoter, a troponin 1 promoter, a Na + /Ca 2+ exchanger promoter, a dystrophin promoter, an a7 integrin promoter, a brain natriuretic peptide promoter, an aB- crystallin/small heat shock protein promoter, an a-myosin heavy chain promoter, or an ANF promoter.
- the composition comprises a sequence codon optimized for expression in a mammalian cell. In further embodiments, the composition comprises a sequence codon optimized for expression in a human cell. In embodiments, the sequence encoding the Cpfl polypeptide is codon optimized for expression in human cells.
- the splice site is a splice donor site. In some embodiments, the splice site is a splice acceptor site.
- the first vector or the second vector is a non- viral vector.
- the non-viral vector is a plasmid.
- a liposome or a nanoparticle comprises the first vector or the second vector.
- the first vector or the second vector is a viral vector.
- the viral vector is an adeno-associated viral (AAV) vector.
- AAV vector is replication-defector or conditionally replication defective.
- the AAV vector is a recombinant AAV vector.
- the AAV vector comprises a sequence isolated or derived from an AAV vector of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV 8, AAV9, AAV10, AAV11 or any combination thereof.
- the composition further comprises a single-stranded DMD oligonucleotide. In some embodiments, the composition further comprises a
- the cell comprising a composition of the disclosure.
- the cell is a muscle cell, a satellite cell or a precursor thereof.
- the cell is an iPSC or an iCM.
- composition comprising a cell of the instant disclosure.
- Also provided is a method of correcting a dystrophin gene defect comprising contacting a cell and a composition of the disclosure under conditions suitable for expression of the Cpfl polypeptide and the gRNA, wherein the Cpfl polypeptide disrupts the dystrophin splice site; and wherein disruption of the splice site results in selective skipping of a mutant DMD exon.
- the mutant DMD exon is exon 23.
- the mutant DMD exon is exon 51.
- the cell is in vivo, ex vivo, in vitro or in situ.
- the disclosure also provides a of treating muscular dystrophy in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a composition according to the instant disclosure.
- the composition is administered locally.
- the composition is administered directly to a muscle tissue.
- the composition is administered by intramuscular infusion or injection.
- the muscle tissue comprises a tibialis anterior tissue, a quadricep tissue, a soleus tissue, a diaphragm tissue or a heart tissue.
- the composition is administered systemically.
- the composition is administered by intravenous infusion or injection.
- the subject following administration of the composition, the subject exhibits normal dystrophin-positive myofibers, and mosaic dystrophin-positive myofibers containing centralized nuclei, or a combination thereof. In some embodiments, following administration of the composition, the subject exhibits an emergence or an increase in a level of abundance of normal dystrophin-positive myofibers when compared to an absence or a level of abundance of normal dystrophin-positive myofibers prior to administration of the composition.
- the subject following administration of the composition, the subject exhibits an emergence or an increase in a level of abundance of mosaic dystrophin-positive myofibers containing centralized nuclei when compared to an absence or an level of abundance of mosaic dystrophin-positive myofibers containing centralized nuclei prior to administration of the composition. In some embodiments, the subject exhibits a decreased serum CK level when compared to a serum CK level prior to administration of the composition. In embodiments, following administration of the composition, the subject exhibits improved grip strength when compared to a grip strength prior to administration of the composition.
- the method comprises administering a therapeutically effective amount of a composition disclosed herein, wherein the cell is autologous. In some embodiments, the method comprises administering a therapeutically effective amount of the composition, wherein the cell is allogeneic.
- the subject is a neonate, an infant, a child, a young adult, or an adult.
- the subject has muscular dystrophy.
- the subject is a genetic carrier for muscular dystrophy.
- the subject is male.
- the subject is female.
- the subject appears to be asymptomatic and wherein a genetic diagnosis reveals a mutation in one or both copies of a DMD gene that impairs function of the DMD gene product.
- the subject presents an early sign or symptom of muscular dystrophy.
- the early sign or symptom of muscular dystrophy comprises loss of muscle mass or proximal muscle weakness.
- the loss of muscle mass or proximal muscle weakness occurs in one or both leg(s) and/or a pelvis, followed by one or more upper body muscle(s).
- the early sign or symptom of muscular dystrophy further comprises pseudohypertrophy, low endurance, difficulty standing, difficulty walking, and/or difficulty ascending a staircase or a combination thereof.
- the subject presents a progressive sign or symptom of muscular dystrophy.
- the progressive sign or symptom of muscular dystrophy comprises muscle tissue wasting, replacement of muscle tissue with fat, or replacement of muscle tissue with fibrotic tissue.
- the subject presents a later sign or symptom of muscular dystrophy.
- the later sign or symptom of muscular dystrophy comprises abnormal bone development, curvature of the spine, loss of movement, and paralysis.
- the subject presents a neurological sign or symptom of muscular dystrophy.
- the neurological sign or symptom of muscular dystrophy comprises intellectual impairment and paralysis.
- administration of the composition occurs prior to the subject presenting one or more progressive, later or neurological signs or symptoms of muscular dystrophy.
- the subject is less than 10 years old. In some embodiments, the subject is less than 5 years old. In some embodiments, the subject is less than 2 years old.
- the disclosure also provides a use of a therapeutically-effective amount of a composition for treating muscular dystrophy in a subject in need thereof.
- FIGS. 1A-E Correction of DMD mutations by Cpfl -mediated genome editing.
- FIG. 1A A DMD deletion of exons 48-50 results in splicing of exon 47 to 51, generating an out-of-frame mutation of dystrophin.
- Two strategies were used for the restoration of dystrophin expression by Cpfl .
- small INDELs in exon 51 restore the protein reading frame of dystrophin.
- the “exon skipping” strategy is achieved by disruption of the splice acceptor of exon 51, which results in splicing of exon 47 to 52 and restoration of the protein reading frame.
- FIG. IB The 3' end of an intron is T-rich, which generates Cpfl PAM sequences enabling genome cleavage by Cpfl .
- the plasmid also encodes a Cpfl gRNA driven by the U6 promoter.
- Cells transfected with this plasmid express GFP, allowing for selection of Cpfl -expressing cells by FACS.
- FIG. IE T7E1 assays using human 293T cells or DMD iPSCs (RIKEN51) transfected with plasmid expressing LbCpfl or AsCpfl, gRNA and GFP show genome cleavage at DMD exon 51. Red arrowheads point to cleavage products. M, marker.
- FIGS. 2A-I DMD iPSC-derived cardiomyocytes express dystrophin after Cpfl- mediated genome editing by reframing.
- FIG. 2A DMD skin fibroblast-derived iPSCs were edited by Cpfl using gRNA (corrected DMD-iPSCs) and then differentiated into cardiomyocytes (corrected cardiomyocytes) for analysis of genetic correction of the DMD mutation.
- FIG. 2B A DMD deletion of exons 48-50 results in splicing of exon 47 to 51, generating an out-of-frame mutation of dystrophin.
- FIG. 2D Western blot analysis shows dystrophin expression in a mixture of DMD iPSC-derived cardiomyocytes edited by reframing with
- FIG. 2F Western blot analysis shows dystrophin expression in single clones (#2 and #5) of iPSC-derived cardiomyocytes following clonal selection after LbCpfl -mediated reframing. aMHC is loading control.
- OCR Basal oxygen consumption rate
- FIGS. 3A-H DMD iPSC-derived cardiomyocytes express dystrophin after Cpfl- mediated exon skipping.
- FIG. 3A Two gRNAs, either gRNA (g2 or g3), which target intron 50, and the other (gl), which targets exon 51, were used to direct Cpfl -mediated removal of the exon 51 splice acceptor site.
- FIG. 3B T7E1 assay using 293T cells transfected with LbCpfl and gRNA2 (g2) or gRNA3 (g3) shows cleavage of the DMD locus at intron 50. Red arrowheads denote cleavage products. M, marker.
- FIG. 3E RT-PCR of iPSC-derived cardiomyocytes using primer sets described in Fig. 2B.
- the 700-bp band in the WT lane is the dystrophin transcript from exon 47-52; the 300-bp band in the uncorrected lane is the dystrophin transcript from exon 47-52 with exon 48-50 deletion; and the lower band in the gl+g2 mixture lane (edited by LbCpfl) shows exon 51 skipping.
- FIG. 3F Sequence of the lower band from panel e (gl+g2 mixture lane) confirms skipping of exon 51, which reframed the DMD ORF.
- FIG. 3G Western blot analysis shows dystrophin protein expression in iPSC-derived cardiomyocyte mixtures after exon 51 skipping by LbCpfl with gl + g2.
- FIGS. 4A-D CRISPR-Cpfl-mediated editing of exon 23 of the mouse DMD gene.
- FIG. 4A Illustration of mouse Dmd locus highlighting the mutation at exon 23. Sequence shows the nonsense mutation caused by C to T transition, which creates a premature stop codon.
- FIG. 4B Illustration showing the targeting location of gRNAs (gl, g2 and g3) (shown in light blue) on exon 23 of the Dmd gene. Red line represents LbCpfl PAM.
- FIGS. 5A-F CRISPR-LbCpf -mediated Dmd correction in mdx mice.
- FIGS. 5A-F CRISPR-LbCpf -mediated Dmd correction in mdx mice.
- FIGG 5A Strategy of gene correction in max mice by LbCpfl -mediated germline editing. Zygotes from intercrosses of max parents were injected with gene editing components (LbCpfl mRNA, g2 gRNA and ssODN) and reimplanted into pseudo-pregnant mothers, which gave rise to pups with gene correction (mdx-C).
- FIG. 5B Illustration showing LbCpfl correction of mdx allele by HDR or NHEJ.
- FIG. 5C Genotyping results of LbCpfl -edited mdx mice.
- Top panel shows T7E1 assay.
- Blue arrowhead denotes uncleaved DNA and red arrowhead shows T7E1 cleaved DNA.
- Bottom panel shows Tsel RFLP assay. Blue arrowhead denotes uncorrected DNA. Red arrowhead points to Tsel cleavage indicating HDR correction, mdx- C1-C5 denotes LbCpfl -edited mdx mice.
- FIG. 5D Top panel shows sequence of WT Dmd exon 23.
- Middle panel shows sequence of mdx Dmd exon 23 with C to T mutation, which generates a STOP codon.
- Bottom panel shows sequence of Dmd exon 23 with HDR correction by LbCpfl -mediated editing. Black arrow points to silent mutations introduced by the ssODN HDR template.
- FIG. 5E H&E of tibialis anterior (TA) and
- G/P gastrocnemius/plantaris
- mdx-C gastrocnemius/plantaris
- FIG. 5F Immunohistochemistry of TA and G/P muscles from WT, mdx and LbCpfl-edited mice (mdx-C) using antibody to dystrophin (red), mdx muscle showed fibrosis and inflammatory infiltration, whereas mdx-C muscle showed normal muscle structure.
- FIGS. 6A-C Genome editing at DMD exon 51 by LbCpfl or AsCpfl.
- FIGS. 6A-C Genome editing at DMD exon 51 by LbCpfl or AsCpfl.
- FIGS. 6A-C Genome editing at DMD exon 51 by LbCpfl or AsCpfl.
- FIGS. 6A-C Genome editing at DMD exon 51 by LbCpfl or AsCpfl.
- FIGS. 6A-C Genome editing at DMD exon 51 by LbCpfl or AsCpfl.
- FIGS. 6A-C Genome editing at DMD exon 51 by LbCpfl or AsCpfl.
- FIGS. 7A-B Histological analysis of muscles from WT, mdx and LbCpfl-edited mice (mdx-C).
- FIG. 7A Immunohistochemistry and H&E staining of whole tibialis anterior (TA) muscle. Dystrophin staining is red.
- FIG. 7B Immunohistochemistry and H&E staining of whole gastrocnemius/plantaris (G/P) muscles. Dystrophin staining is red.
- the CRISPR-Cas system represents an approach for correction of diverse genetic defects.
- the CRISPR (clustered regularly interspaced short palindromic repeats) system functions as an adaptive immune system in bacteria and archaea that defends against phage infection.
- an endonuclease is guided to specific genomic sequences by a single guide RNA (sgRNA), resulting in DNA cutting near a protospacer adjacent motif (PAM) sequence.
- sgRNA single guide RNA
- PAM protospacer adjacent motif
- Streptococcus pyogenes Cas9 (SpCas9), currently the most widely used Cas9 endonuclease, has a G-rich PAM requirement (NGG) that excludes genome editing of AT-rich regions. Additionally, the large size of SpCas9 reduces the efficiency of packaging and delivery in low-capacity viral vectors, such as Adeno-associated virus (AAV) vectors.
- the Cas9 endonuclease from Staphylococcus aureus (SaCas9) although smaller in size than SpCas9, has a PAM sequence (NNGRRT) that is longer and more complex, thus limiting the range of its genomic targets (Ran et al , 2015). Smaller CRISPR enzymes with greater flexibility in recognition sequence and comparable cutting efficiency would facilitate precision gene editing, especially for translational applications.
- Cpfl CRISPR from Prevotella and Francisella 1
- Cpfl CRISPR from Prevotella and Francisella 1
- gRNA single and short crRNA
- crRNA CRISPR RNA
- tracrRNA a long trans-activating crRNA
- Cpfl requires a G-rich PAM at the 3' end of the target sequence.
- Cpfl- mediated cleavage produces a sticky end distal to the PAM site, which activates DNA repair machinery, while Cas9 cutting generates a blunt end.
- Cpfl also has RNase activity, which can process precursor crRNAs to mature crRNAs.
- DSB double-stranded break
- NHEJ non-homologous end-joining
- HDR homology-directed repair
- Duchenne muscular dystrophy is a recessive X-linked form of muscular dystrophy, affecting around 1 in 3,500 boys, which results in muscle degeneration and premature death.
- the disorder is caused by a mutation in the gene dystrophin (See GenBank Accession No. NC_000023.11), located on the human X chromosome, which codes for the protein dystrophin (GenBank Accession No. AAA53189; SEQ ID NO. 383), the sequence of which is reproduced below:
- dystrophin mRNA contains 79 exons.
- Dystrophin mRNA is known to be alternatively spliced, resulting in various isoforms.
- Exemplary dystrophin isoforms are listed in Table 1.
- dystrophin mRNA contains 79 exons.
- Dystrophin mRNA is known to be alternatively spliced, resulting in various isoforms of the protein. Exemplary dystrophin isoforms are listed in Table 1.
- the transcript includes the common exon 2 of transcript Dp427m and has a similar length of 14 kb.
- the Dp427c isofonn contains a unique N-terminal MED sequence, instead of the
- isofonn Dp427m (SEQ ID NO: 3) sequence of isofonn Dp427m. The remainder of isofonn Dp427c is identical to isofonn Dp427m.
- Dp427m transcript Dp427m isofonn encodes the main dystrophin protein found in muscle.
- exon 1 encodes a unique N- terminal
- Dp427pl isofonn initiates from a unique promoter/exon 1 located in what corresponds to the first intron of transcript Dp427m.
- the transcript adds the common exon 2 of Dp427m and has a similar length (14 kb).
- the Dp427pl isofonn replaces the
- isofonn transcript Dp260-1 uses exons 30-79, and Sequence Nucleic Acid Nucleic Protein Accession Protein Description
- Dp260-1 contains a 95 bp exon 1 encoding a unique N- terminal 16 aa MTEIILLIFFPAYFLN- sequence that replaces amino acids 1-1357 of the full-length dystrophin product (Dp427m isoform).
- Dp260-2 transcript Dp260-2 uses isoform exons 30-79, starting from a promoter/exon 1 sequence located in intron 29 of the dystrophin gene that is alternatively spliced and lacks N-terminal amino acids 1-1357 of the full length dystrophin (Dp427m isoform).
- the Dp260-2 transcript encodes a unique N-terminal MSARKLRNLSYKK
- Dp 140 isoform Dp 140 transcripts use exons 45-79, starting at a promoter/exon 1 located in intron 44. Dp 140 transcripts have a long (1 kb) 5' UTR since translation is initiated in exon 51 (corresponding to aa 2461 of dystrophin). In addition to the alternative promoter and exon 1, differential splicing of exons 71-74 and 78 produces at least five Dpl40 isoforms. Of these, this transcript (Dp 140) contains all of the exons.
- Dpi 16 isoform transcript Dpi 16 uses exons 56-79, starting from a promoter/exon 1 Sequence Nucleic Acid Nucleic Protein Accession Protein Description
- the Dp 116 isoform contains a unique N-terminal MLHRKTYHVK aa sequence, instead of aa 1-2739 of dystrophin. Differential splicing produces several Dpl l6-subtypes.
- the Dpi 16 isoform is also known as S-dystrophin or apo-dystrophin-2.
- Dp71 isoform Dp71 transcripts use exons 63-79 with a novel 80- to 100-nt exon containing an ATG start site for a new coding sequence of 17 nt.
- the short coding sequence is in-frame with the consecutive dystrophin sequence from exon 63.
- this transcript includes both exons 71 and 78.
- Dp71b isoform Dp71 transcripts use exons 63-79 with a novel 80- to 100-nt exon containing an ATG start site for a new coding sequence of 17 nt.
- the short coding sequence is in-frame with the consecutive dystrophin sequence from exon 63.
- Dp71b this transcript (Dp71b) lacks exon 78 and encodes a protein with a different C- terminus than Dp71 and Dp7 la isoforms.
- Dp7 la isoform Dp71 transcripts use Sequence Nucleic Acid Nucleic Protein Accession Protein Description
- exons 63-79 with a novel 80- to 100-nt exon containing an ATG start site for a new coding sequence of 17 nt.
- the short coding sequence is in-frame with the consecutive dystrophin sequence from exon 63.
- Dp71ab isoform Dp71 transcripts use exons 63-79 with a novel 80- to 100-nt exon containing an ATG start site for a new coding sequence of 17 nt.
- the short coding sequence is in-frame with the consecutive dystrophin sequence from exon 63.
- Dp71ab this transcript (Dp71ab) lacks both exons 71 and 78 and encodes a protein with a C -terminus like isoform Dp7 lb.
- Dp40 isoform transcript Dp40 uses exons 63-70.
- the 5' UTR and encoded first 7 aa are identical to that in transcript Dp71, but the stop codon lies at the splice junction of the exon/intron 70.
- the 3' UTR includes nt from intron 70 which includes an alternative polyadenylation site.
- the Dp40 isoform lacks the normal C- terminal end of full- length dystrophin (aa 3409-3685).
- Dp 140c isoform
- Dp 140 transcripts use exons 45-79, starting at a promoter/exon 1 located in intron 44.
- Dp 140 transcripts have a long (1 kb) 5' UTR since translation is initiated in exon 51 (corresponding to aa 2461 of dystrophin).
- differential splicing of exons 71-74 and 78 produces at least five Dpl40 isoforms. Of these, this transcript (Dp 140c) lacks exons 71-74.
- Dp 140b Dp 140 transcripts use isoform exons 45-79, starting at a promoter/exon 1 located in intron 44. Dp 140 transcripts have a long (1 kb) 5' UTR since translation is initiated in exon 51 (corresponding to aa 2461 of dystrophin). In addition to the alternative promoter and exon 1, differential splicing of exons 71-74 and 78 produces at least five Dpl40 isoforms. Of these, this transcript (Dp 140b) lacks exon 78 and encodes a protein with a unique C- terminus.
- Dpl40ab Dp 140 transcripts use isoform exons 45-79, starting at a promoter/exon 1 located in intron 44. Dp 140 transcripts have a long (1 kb) 5' UTR since translation is initiated in exon 51 (corresponding to aa 2461 of dystrophin).
- Dpl40bc Dp 140 transcripts use isoform exons 45-79, starting at a promoter/exon 1 located in intron 44. Dp 140 transcripts have a long (1 kb) 5' UTR since translation is initiated in exon 51 (corresponding to aa 2461 of dystrophin). In addition to the alternative promoter and exon 1, differential splicing of exons 71-74 and 78 produces at least five Dpl40 isoforms. Of these, this transcript (Dpl40bc) lacks exons 71-74 and 78 and encodes a protein with a unique C-terminus.
- Dystrophin is an important component within muscle tissue that provides structural stability to the dystroglycan complex (DGC) of the cell membrane. While both sexes can carry the mutation, females are rarely affected with the skeletal muscle form of the disease.
- DGC dystroglycan complex
- Symptoms usually appear in boys between the ages of 2 and 3 and may be visible in early infancy. Even though symptoms do not appear until early infancy, laboratory testing can identify children who carry the active mutation at birth. Progressive proximal muscle weakness of the legs and pelvis associated with loss of muscle mass is observed first.
- Duchenne muscular dystrophy a progressive neuromuscular disorder
- Muscle weakness also occurs later, in the arms, neck, and other areas. Calves are often enlarged. Symptoms usually appear before age 6 and may appear in early infancy. Other physical symptoms are:
- Lumbar hyperlordosis possibly leading to shortening of the hip-flexor muscles. This has an effect on overall posture and a manner of walking, stepping, or running.
- a positive Gowers' sign reflects the more severe impairment of the lower extremities muscles. The child helps himself to get up with upper extremities: first by rising to stand on his arms and knees, and then "walking" his hands up his legs to stand upright. Affected children usually tire more easily and have less overall strength than their peers. Creatine kinase (CPK-MM) levels in the bloodstream are extremely high.
- An electromyography CPK-MM
- EMG shows that weakness is caused by destruction of muscle tissue rather than by damage to nerves. Genetic testing can reveal genetic errors in the Xp21 gene. A muscle biopsy (immunohistochemistry or immunoblotting) or genetic test (blood test) confirms the absence of dystrophin, although improvements in genetic testing often make this unnecessary.
- Duchenne muscular dystrophy is caused by a mutation of the dystrophin gene at locus Xp21, located on the short arm of the X chromosome.
- Dystrophin is responsible for connecting the cytoskeleton of each muscle fiber to the underlying basal lamina (extracellular matrix), through a protein complex containing many subunits. The absence of dystrophin permits excess calcium to penetrate the sarcolemma (the cell membrane). Alterations in calcium and signaling pathways cause water to enter into the mitochondria, which then burst.
- mitochondrial dysfunction gives rise to an amplification of stress-induced cytosolic calcium signals and an amplification of stress-induced reactive- oxygen species (ROS) production.
- ROS reactive- oxygen species
- DMD is inherited in an X-linked recessive pattern.
- Females will typically be carriers for the disease while males will be affected.
- a female carrier will be unaware they carry a mutation until they have an affected son.
- the son of a carrier mother has a 50% chance of inheriting the defective gene from his mother.
- the daughter of a carrier mother has a 50% chance of being a carrier and a 50% chance of having two normal copies of the gene.
- an unaffected father will either pass a normal Y to his son or a normal X to his daughter.
- Female carriers of an X-linked recessive condition such as DMD, can show symptoms depending on their pattern of X-inactivation.
- Duchenne muscular dystrophy has an incidence of 1 in 3,500 male infants. Mutations within the dystrophin gene can either be inherited or occur spontaneously during germline transmission.
- Duchenne muscular dystrophy can be detected with about 95% accuracy by genetic studies performed during pregnancy.
- DNA test The muscle-specific isoform of the dystrophin gene is composed of 79 exons, and DNA testing and analysis can usually identify the specific type of mutation of the exon or exons that are affected. DNA testing confirms the diagnosis in most cases.
- Muscle biopsy If DNA testing fails to find the mutation, a muscle biopsy test may be performed. A small sample of muscle tissue is extracted (usually with a scalpel instead of a needle) and a dye is applied that reveals the presence of dystrophin. Complete absence of the protein indicates the condition.
- DMD is carried by an X-linked recessive gene. Males have only one
- Prenatal tests can tell whether their unborn child has the most common mutations. There are many mutations responsible for DMD, and some have not been identified, so genetic testing only works when family members with DMD have a mutation that has been identified.
- Amniocentesis can be done after 15 weeks, and has a 0.5% risk of miscarriage. Fetal blood sampling can be done at about 18 weeks. Another option in the case of unclear genetic test results is fetal muscle biopsy.
- Corticosteroids such as prednisolone and deflazacort increase energy and strength and defer severity of some symptoms.
- Orthopedic appliances may improve mobility and the ability for self-care.
- Form-fitting removable leg braces that hold the ankle in place during sleep can defer the onset of contractures.
- DMD generally progresses through five stages, as outlined in Bushby et ctl, Lancet Neurol, 9(1): 77-93 (2010) and Bushby et ctl, Lancet Neurol, 9(2): 177-198 (2010), incorporated by reference in their entireties.
- CDC Centers for Disease Control and Prevention
- patients typically exhibit an increasingly labored gait and begin to lose the ability to climb stairs and rise from the floor.
- patients are typically able to self-propel for some time, are able to maintain posture, and may develop scoliosis.
- upper limb function and postural maintenance is increasingly limited.
- treatment is initiated in the presymptomatic stage of the disease. In some embodiments, treatment is initiated in the early ambulatory stage. In some embodiments, treatment is initiated in the late ambulatory stage. In embodiments, treatment is initiated during the early non-ambulatory stage. In embodiments, treatment is initiated during the late non-ambulatory stage.
- the ventilator may require an invasive endotracheal or tracheotomy tube through which air is directly delivered, but, for some people non-invasive delivery through a face mask or mouthpiece is sufficient. Positive airway pressure machines, particularly bi-level ones, are sometimes used in this latter way.
- the respiratory equipment may easily fit on a ventilator tray on the bottom or back of a power wheelchair with an external battery for portability.
- Ventilator treatment may start in the mid to late teens when the respiratory muscles can begin to collapse. If the vital capacity has dropped below 40% of normal, a volume ventilator/respirator may be used during sleeping hours, a time when the person is most likely to be under ventilating ("hypoventilating"). Hypoventilation during sleep is determined by a thorough history of sleep disorder with an oximetry study and a capillary blood gas (See Pulmonary Function Testing). A cough assist device can help with excess mucus in lungs by hyperinflation of the lungs with positive air pressure, then negative pressure to get the mucus up. If the vital capacity continues to decline to less than 30 percent of normal, a volume ventilator/respirator may also be needed during the day for more assistance. The person gradually will increase the amount of time using the ventilator/respirator during the day as needed. F. Prognosis
- Duchenne muscular dystrophy is a progressive disease which eventually affects all voluntary muscles and involves the heart and breathing muscles in later stages. The life expectancy is currently estimated to be around 25, but this varies from patient to patient.
- Muscular Dystrophy Campaign which is a leading UK charity focusing on all muscle disease, states that "with high standards of medical care young men with Duchenne muscular dystrophy are often living well into their 30s.”
- ILM intrinsic laryngeal muscles
- ILM have a calcium regulation system profile suggestive of a better ability to handle calcium changes in comparison to other muscles, and this may provide a mechanistic insight for their unique pathophysiological properties.
- the ILM may facilitate the development of novel strategies for the prevention and treatment of muscle wasting in a variety of clinical scenarios.
- CRISPRs (clustered regularly interspaced short palindromic repeats) are DNA loci containing short repetitions of base sequences. Each repetition is followed by short segments of "spacer DNA” from previous exposures to a virus.
- CRISPRs are found in approximately 40% of sequenced eubacteria genomes and 90% of sequenced archaea. CRISPRs are often associated with cas genes that code for proteins related to CRISPRs.
- the CRISPR/Cas system is a prokaryotic immune system that confers resistance to foreign genetic elements such as plasmids and phages and provides a form of acquired immunity. CRISPR spacers recognize and silence these exogenous genetic elements like RNAi in eukaryotic organisms.
- CRISPR repeats range in size from 24 to 48 base pairs. They usually show some dyad symmetry, implying the formation of a secondary structure such as a hairpin, but are not truly palindromic. Repeats are separated by spacers of similar length. Some CRISPR spacer sequences exactly match sequences from plasmids and phages, although some spacers match the prokaryote's genome (self-targeting spacers). New spacers can be added rapidly in response to phage infection.
- CRISPR-associated (cas) genes are often associated with CRISPR repeat-spacer arrays.
- Cas protein families As of 2013, more than forty different Cas protein families had been described. Of these protein families, Casl appears to be ubiquitous among different CRISPR/Cas systems. Particular combinations of cas genes and repeat structures have been used to define 8 CRISPR subtypes (Ecoli, Ypest, Nmeni, Dvulg, Tneap, Hmari, Apem, and Mtube), some of which are associated with an additional gene module encoding repeat-associated mysterious proteins (RAMPs). More than one CRISPR subtype may occur in a single genome. The sporadic distribution of the CRISPR/Cas subtypes suggests that the system is subject to horizontal gene transfer during microbial evolution.
- Exogenous DNA is apparently processed by proteins encoded by Cas genes into small elements (-30 base pairs in length), which are then somehow inserted into the CRISPR locus near the leader sequence.
- RNAs from the CRISPR loci are constitutively expressed and are processed by Cas proteins to small RNAs composed of individual, exogenously-derived sequence elements with a flanking repeat sequence. The RNAs guide other Cas proteins to silence exogenous genetic elements at the RNA or DNA level.
- Evidence suggests functional diversity among CRISPR subtypes.
- the Cse (Cas subtype Ecoli) proteins (called CasA-E in E. coli) form a functional complex, Cascade, that processes CRISPR RNA transcripts into spacer-repeat units that Cascade retains.
- Cas6 processes the CRISPR transcripts.
- CRISPR-based phage inactivation in E. coli requires Cascade and Cas3, but not Casl and Cas2.
- the Cmr (Cas RAMP module) proteins found in Pyrococcus furiosus and other prokaryotes form a functional complex with small CRISPR RNAs that recognizes and cleaves complementary target RNAs.
- RNA-guided CRISPR enzymes are classified as type V restriction enzymes.
- Cas9 is a nuclease, an enzyme specialized for cutting DNA, with two active cutting sites, one for each strand of the double helix. The team demonstrated that they could disable one or both sites while preserving Cas9's ability to locate its target DNA.
- Cas9 proteins are highly enriched in pathogenic and commensal bacteria.
- CRISPR/Cas-mediated gene regulation may contribute to the regulation of endogenous bacterial genes, particularly during bacterial interaction with eukaryotic hosts.
- Cas protein Cas9 of Francisella novicida uses a unique, small, CRISPR/Cas-associated RNA (scaRNA) to repress an endogenous transcript encoding a bacterial lipoprotein that is critical for F. novicida to dampen host response and promote virulence.
- scaRNA CRISPR/Cas-associated RNA
- CRISPR/Cas are separated into three classes.
- Class 1 uses several Cas proteins together with the CRISPR RNAs (crRNA) to build a functional endonuclease.
- Class 2 CRISPR systems use a single Cas protein with a crRNA.
- Cpfl has been recently identified as a Class II, Type V CRISPR/Cas systems containing a 1,300 amino acid protein. See also U.S. Patent Publication 2014/0068797, which is incorporated by reference in its entirety.
- CRISPR/Cpfl Clustered Regularly Interspaced Short Palindromic Repeats from Prevotella and Francisella 1 or CRISPR/Cpfl is a DNA-editing technology which shares some similarities with the CRISPR/Cas9 system.
- Cpfl is an RNA-guided endonuclease of a class II
- Cpfl genes are associated with the CRISPR locus, coding for an endonuclease that use a guide RNA to find and cleave viral DNA.
- Cpf 1 is a smaller and simpler endonuclease than Cas9, overcoming some of the
- Cpfl appears in many bacterial species.
- the ultimate Cpfl endonuclease that was developed into a tool for genome editing was taken from one of the first 16 species known to harbor it.
- the Cpfl is a Cpfl enzyme from Acidaminococcus (species BV3L6, UniProt Accession No. U2UMQ6; SEQ ID NO. 442), having the sequence set forth below:
- the Cpfl is a Cpfl enzyme from Lachnospiraceae (species ND2006, UniProt Accession No. A0A182DWE3; SEQ ID NO. 443), having the sequence set forth below:
- the Cpfl is codon optimized for expression in mammalian cells. In some embodiments, the Cpfl is codon optimized for expression in human cells.
- compositions of the disclosure include a small version of a
- Cas9 from the bacterium Staphylococcus aureus.
- the small version of the Cas9 provides advantages over wild type or full length Cas9.
- the Cpfl locus contains a mixed alpha/beta domain, a RuvC-I followed by a helical region, a RuvC-II and a zinc finger-like domain.
- the Cpfl protein has a RuvC-like endonuclease domain that is similar to the RuvC domain of Cas9. Furthermore, Cpfl does not have a HNH endonuclease domain, and the N-terminal of Cpfl does not have the alpha- helical recognition lobe of Cas9.
- Cpfl CRISPR-Cas domain architecture shows that Cpfl is functionally unique, being classified as Class 2, type V CRISPR system.
- the Cpfl loci encode Casl, Cas2 and Cas4 proteins more similar to types I and III than from type II systems.
- Database searches suggest the abundance of Cpfl -family proteins in many bacterial species.
- Functional Cpfl does not require a tracrRNA. Therefore, functional Cpfl gRNAs of the disclosure may comprise or consist of a crRNA. This benefits genome editing because Cpfl is not only a smaller nuclease than Cas9, but also it has a smaller sgRNA molecule (proximately half as many nucleotides as Cas9).
- the Cpfl-gRNA (e.g. Cpfl-crRNA) complex cleaves target DNA or RNA by identification of a protospacer adjacent motif 5'-YTN-3' (where "Y” is a pyrimidine and “N” is any nucleobase) or 5'-TTN-3', in contrast to the G-rich PAM targeted by Cas9. After identification of PAM, Cpfl introduces a sticky-end-like DNA double- stranded break of 4 or 5 nucleotides overhang.
- the CRISPR/Cpfl system comprises or consists of a Cpfl enzyme and a guide RNA that finds and positions the complex at the correct spot on the double helix to cleave target DNA.
- CRISPR/Cpfl systems activity has three stages:
- crRNAs processing of pre-cr-RNAs producing of mature crRNAs to guide the Cas protein
- Interference in which the Cpfl is bound to a crRNA to form a binary complex to identify and cleave a target DNA sequence.
- This system has been modified to utilize non-naturally occurring crRNAs, which guide Cpf 1 to a desired target sequence in a non-bacterial cell, such as a mammalian cell.
- Cas9 As an RNA guided protein, Cas9 requires a short RNA to direct the recognition of
- Cas9 preferentially interrogates DNA sequences containing a PAM sequence NGG it can bind here without a protospacer target.
- the Cas9-gRNA complex requires a close match to the gRNA to create a double strand break.
- CRISPR sequences in bacteria are expressed in multiple RNAs and then processed to create guide strands for RNA. Because Eukaryotic systems lack some of the proteins required to process CRISPR RNAs the synthetic construct gRNA was created to combine the essential pieces of RNA for Cas9 targeting into a single RNA expressed with the RNA polymerase type III promoter U6. Synthetic gRNAs are slightly over lOObp at the minimum length and contain a portion which is targets the 20 protospacer nucleotides immediately preceding the PAM sequence NGG; gRNAs do not contain a PAM sequence.
- the gRNA targets a site within a wildtype dystrophin gene. In some embodiments, the gRNA targets a site within a mutant dystrophin gene. In some embodiments, the gRNA targets a dystrophin intron. In some embodiments, the gRNA targets dystrophin exon. In some embodiments, the gRNA targets a site in a dystrophin exon that is expressed and is present in one or more of the dystrophin isoforms shown in Table 1. In embodiments, the gRNA targets a dystrophin splice site. In some embodiments, the gRNA targets a splice donor site on the dystrophin gene. In embodiments, the gRNA targets a splice acceptor site on the dystrophin gene.
- the guide RNA targets a mutant DMD exon. In some embodiments, the mutant exon is exon 23 or 51. In some embodiments, the guide RNA targets at least one of exons 1, 23, 41, 44, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 of the dystrophin gene. In embodiments, the guide RNA targets at least one of introns 44, 45, 50, 51, 52, 53, 54, or 55 of the dystrophin gene. In preferred embodiments, the guide RNAs are designed to induce skipping of exon 51 or exon 23. In embodiments, the gRNA is targeted to a splice acceptor site of exon 51 or exon 23.
- gRNAs for use in the methods and compositions disclosed herein are provided as SEQ ID NOs. 60-382. (Table E).
- the gRNA is selected from any one of SEQ ID No. 60 to SEQ ID No. 382.
- gRNAs of the disclosure comprise a sequence that is complementary to a target sequence within a coding sequence or a non-coding sequence corresponding to the DMD gene, and, therefore, hybridize to the target sequence.
- gRNAs for Cpfl comprise a single crRNA containing a direct repeat scaffold sequence followed by 24 nucleotides of guide sequence.
- a "guide" sequence of the crRNA comprises a sequence of the gRNA that is complementary to a target sequence.
- crRNA of the disclosure comprises a sequence of the gRNA that is not complementary to a target sequence.
- "Scaffold" sequences of the disclosure link the gRNA to the Cpfl polypeptide.
- "Scaffold” sequences of the disclosure are not equivalent to a tracrRNA sequence of a gRNA-Cas9 construct.
- Cas9 requires two RNA molecules to cut DNA while Cpfl needs one.
- the proteins also cut DNA at different places, offering researchers more options when selecting an editing site.
- Cas9 cuts both strands in a DNA molecule at the same position, leaving behind 'blunt' ends.
- Cpfl leaves one strand longer than the other, creating 'sticky' ends that are easier to work with.
- Cpfl appears to be more able to insert new sequences at the cut site, compared to Cas9.
- the CRISPR/Cas9 system can efficiently disable genes, it is challenging to insert genes or generate a knock-in.
- Cpfl lacks tracrRNA, utilizes a T-rich PAM and cleaves DNA via a staggered DNA DSB.
- Cpfl recognizes different PAMs, enabling new targeting possibilities, creates 4-5 nt long sticky ends, instead of blunt ends produced by Cas9, enhancing the efficiency of genetic insertions and specificity during NHEJ or HDR, and cuts target DNA further away from PAM, further away from the Cas9 cutting site, enabling new possibilities for cleaving the DNA.
- the first step in editing the DMD gene using CRISPR/Cpfl is to identify the genomic target sequence.
- the genomic target for the gRNAs of the disclosure can be any -24 nucleotide DNA sequence within the dystrophin gene, provided that the sequence is unique compared to the rest of the genome.
- the genomic target sequence is in exon 51, exon 45, exon 44, exon 53, exon 46, exon 52, exon 50, exon 43, exon 6, exon 7, exon 8, and/or exon 55 of the human dystrophin gene.
- the genomic target sequence is a 5' or 3' splice site of exon 51, exon 45, exon 44, exon 53, exon 46, exon 52, exon 50, exon 43, exon 6, exon 7, exon 8, and/or exon 55 of the human dystrophin gene.
- the genomic target sequence is an intron immediately upstream or downstream of exon 51, exon 45, exon 44, exon 53, exon 46, exon 52, exon 50, exon 43, exon 6, exon 7, exon 8, and/or exon 55 of the human dystrophin gene. Exemplary genomic target sequences can be found in Table D.
- Protospacer Adjacent Motif (PAM) sequences within the genetic region to be targeted utilizes a T-rich PAM sequence (TTTN, wherein N is any nucleotide).
- TTTN T-rich PAM sequence
- the target sequence must be immediately upstream of a PAM. Once all possible PAM sequences and putative target sites have been identified, the next step is to choose which site is likely to result in the most efficient on-target cleavage.
- the gRNA targeting sequence needs to match the target sequence, and the gRNA targeting sequence must not match additional sites within the genome.
- the gRNA targeting sequence has perfect homology to the target with no homology elsewhere in the genome. In some embodiments, a given gRNA targeting sequence will have additional sites throughout the genome where partial homology exists.
- off-targets sites are called “off-targets” and should be considered when designing a gRNA.
- off-target sites are not cleaved as efficiently when mismatches occur near the PAM sequence, so gRNAs with no homology or those with mismatches close to the PAM sequence will have the highest specificity.
- on-target activity factors that maximize cleavage of the desired target sequence (on-target activity) must be considered. It is known to those of skill in the art that two gRNA targeting sequences, each having 100% homology to the target DNA may not result in equivalent cleavage efficiency. In fact, cleavage efficiency may increase or decrease depending upon the specific nucleotides within the selected target sequence.
- the next step is to synthesize and clone desired gRNAs.
- Targeting oligos can be synthesized, annealed, and inserted into plasmids containing the gRNA scaffold using standard restriction-ligation cloning.
- the exact cloning strategy will depend on the gRNA vector that is chosen.
- the gRNAs for Cpfl are notably simpler than the gRNAs for Cas9, and only consist of a single crRNA containing direct repeat scaffold sequence followed by -24 nucleotides of guide sequence.
- Cpfl requires a minimum of 16 nucleotides of guide sequence to achieve detectable DNA cleavage, and a minimum of 18 nucleotides of guide sequence to achieve efficient DNA cleavage in vitro.
- 20-24 nucleotides of guide sequence is used.
- the seed region of the Cpfl gRNA is generally within the first 5 nucleotides on the 5' end of the guide sequence.
- Cpfl makes a staggered cut in the target genomic DNA. In AsCpfl and LbCpfl, the cut occurs 19 bp after the PAM on the targeted (+) strand, and 23 bp on the other strand.
- Each gRNA should then be validated in one or more target cell lines.
- the genomic target region may be amplified using PCR and sequenced according to methods known to those of skill in the art.
- gene editing may be performed in vitro or ex vivo.
- cells are contacted in vitro or ex vivo with a Cpfl and a gRNA that targets a dystrophin splice site.
- the cells are contacted with one or more nucleic acids encoding the Cpfl and the guide RNA.
- the one or more nucleic acids are introduced into the cells using, for example, lipofection or electroporation.
- Gene editing may also be performed in zygotes.
- zygotes may be injected with one or more nucleic acids encoding Cpfl and a gRNA that targets a dystrophin splice site. The zygotes may subsequently be injected into a host.
- the Cpfl is provided on a vector.
- the vector contains a Cpfl sequence derived from a Lachnospiraceae bacterium. See, for example, Uniprot Accession No. A0A182DWE3; SEQ ID NO. 443.
- the vector contains a Cpfl sequence derived from Acidaminococcus bacterium. See, for example, Uniprot Accession No. U2UMQ6; SEQ ID NO. 442.
- the Cpfl sequence is codon optimized for expression in human cells.
- the vector further contains a sequence encoding a fluorescent protein, such as GFP, which allows Cpfl- expressing cells to be sorted using fluorescence activated cell sorting (FACS).
- FACS fluorescence activated cell sorting
- the vector is a viral vector such as an adeno-associated viral vector.
- the gRNA is provided on a vector.
- the vector is a viral vector such as an adeno-associated viral vector.
- the Cpfl and the guide RNA are provided on the same vector. In embodiments, the Cpfl and the guide RNA are provided on different vectors.
- the cells are additionally contacted with a single-stranded
- small INDELs restore the protein reading frame of dystrophin ("refraining" strategy).
- the cells may be contacted with a single gRNA.
- a splice donor or splice acceptor site is disrupted, which results in exon skipping and restoration of the protein reading frame (“exon skipping" strategy).
- exon skipping strategy the cells may be contacted with two or more gRNAs.
- Efficiency of in vitro or ex vivo Cpfl -mediated DNA cleavage may be assessed using techniques known to those of skill in the art, such as the T7 El assay. Restoration of DMD expression may be confirmed using techniques known to those of skill in the art, such as RT- PCR, western blotting, and immunocytochemistry.
- in vitro or ex vivo gene editing is performed in a muscle or satellite cell.
- gene editing is performed in iPSC or iCM cells.
- the iPSC cells are differentiated after gene editing.
- the iPSC cells may be differentiated into a muscle cell or a satellite cell after editing.
- the iPSC cells are differentiated into cardiac muscle cells, skeletal muscle cells, or smooth muscle cells.
- the iPSC cells are differentiated into cardiomyocytes. iPSC cells may be induced to differentiate according to methods known to those of skill in the art.
- contacting the cell with the Cpfl and the gRNA restores dystrophin expression.
- cells which have been edited in vitro or ex vivo, or cells derived therefrom show levels of dystrophin protein that is comparable to wild type cells.
- the edited cells, or cells derived therefrom express dystrophin at a level that is 50%, 60%, 70%, 80%, 90%, 95% or any percentage in between of wild type dystrophin expression levels.
- the cells which have been edited in vitro or ex vivo, or cells derived therefrom have a mitochondrial number that is comparable to that of wild type cells.
- the edited cells, or cells derived therefrom have 50%, 60%, 70%, 80%, 90%, 95% or any percentage in between as many mitochondria as wild type cells. In embodiments, the edited cells, or cells derived therefrom, show an increase in oxygen consumption rate (OCR) compared to non-edited cells at baseline.
- OCR oxygen consumption rate
- expression cassettes are employed to express a transcription factor product, either for subsequent purification and delivery to a cell/subject, or for use directly in a genetic-based delivery approach.
- expression vectors which contain one or more nucleic acids encoding Cpfl and at least one DMD guide RNA that targets a dystrophin splice site.
- a nucleic acid encoding Cpfl and a nucleic acid encoding at least one guide RNA are provided on the same vector.
- a nucleic acid encoding Cpfl and a nucleic acid encoding least one guide RNA are provided on separate vectors.
- Expression requires that appropriate signals be provided in the vectors, and include various regulatory elements such as enhancers/promoters from both viral and mammalian sources that drive expression of the genes of interest in cells. Elements designed to optimize messenger RNA stability and translatability in host cells also are defined. The conditions for the use of a number of dominant drug selection markers for establishing permanent, stable cell clones expressing the products are also provided, as is an element that links expression of the drug selection markers to expression of the polypeptide.
- various regulatory elements such as enhancers/promoters from both viral and mammalian sources that drive expression of the genes of interest in cells.
- Elements designed to optimize messenger RNA stability and translatability in host cells also are defined.
- the conditions for the use of a number of dominant drug selection markers for establishing permanent, stable cell clones expressing the products are also provided, as is an element that links expression of the drug selection markers to expression of the polypeptide.
- expression cassette is meant to include any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed and translated, i.e., is under the control of a promoter.
- a “promoter” refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene.
- under transcriptional control means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene.
- An “expression vector” is meant to include expression cassettes comprised in a genetic construct that is capable of replication, and thus including one or more of origins of replication, transcription termination signals, poly-A regions, selectable markers, and multipurpose cloning sites.
- promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for RNA polymerase II.
- Much of the thinking about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transcriptional activator or repressor proteins.
- At least one module in each promoter functions to position the start site for RNA synthesis.
- the best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.
- the Cpfl constructs of the disclosure are expressed by a muscle-cell specific promoter.
- This muscle-cell specific promoter may be constitutively active or may be an inducible promoter.
- promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well.
- the spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription.
- viral promotes such as the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, the Rous sarcoma virus long terminal repeat, rat insulin promoter and glyceraldehyde-3-phosphate dehydrogenase can be used to obtain high-level expression of the coding sequence of interest.
- CMV human cytomegalovirus
- SV40 early promoter the Rous sarcoma virus long terminal repeat
- rat insulin promoter and glyceraldehyde-3-phosphate dehydrogenase
- glyceraldehyde-3-phosphate dehydrogenase can be used to obtain high-level expression of the coding sequence of interest.
- the use of other viral or mammalian cellular or bacterial phage promoters which are well-known in the art to achieve expression of a coding sequence of interest is contemplated as well, provided that the levels of expression are sufficient for a given purpose.
- Enhancers are genetic elements that increase transcription from a promoter located at a distant position on the same molecule of DNA. Enhancers are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins. The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and contiguous, often seeming to have a very similar modular organization.
- the promoter and/or enhancer may be, for example, immunoglobulin light chain, immunoglobulin heavy chain, T-cell receptor, HLA DQ a and/or DQ ⁇ , ⁇ -interferon, interleukin-2, interleukin-2 receptor, MHC class II 5, MHC class II HLA-Dra, ⁇ -Actin, muscle creatine kinase (MCK), prealbumin (transthyretin), elastase I, metallothionein (MTII), collagenase, albumin, a-fetoprotein, t-globin, ⁇ -globin, c-fos, c-HA-ras, insulin, neural cell adhesion molecule (NCAM), ai-antitrypain, H2B (TH2B) histone, mouse and/or type I collagen, glucose-regulated proteins (GRP94 and GRP78), rat growth hormone, human serum amyloid A (SAA), troponin I (TN I), platelet-derived
- inducible elements may be used.
- the inducible element is, for example, MTII, MMTV (mouse mammary tumor virus), ⁇ - interferon, adenovirus 5 E2, collagenase, stromelysin, SV40, murine MX gene, GRP78 gene, ⁇ -2-macroglobulin, vimentin, MHC class I gene ⁇ -2 ⁇ >, HSP70, proliferin, tumor necrosis factor, and/or thyroid stimulating hormone a gene.
- the inducer is phorbol ester (TFA), heavy metals, glucocorticoids, poly(rI)x, poly(rc), E1A, phorbol ester (TP A), interferon, Newcastle Disease Virus, A23187, IL-6, serum, interferon, SV40 large T antigen, PMA, and/or thyroid hormone.
- TFA phorbol ester
- TP A phorbol ester
- Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.
- muscle specific promoters include the myosin light chain-2 promoter, the a-actin promoter, the troponin 1 promoter; the Na + /Ca 2+ exchanger promoter, the dystrophin promoter, the a7 integrin promoter, the brain natriuretic peptide promoter and the ⁇ -crystallin/small heat shock protein promoter, a-myosin heavy chain promoter, and the ANF promoter.
- the Cpfl-gRNA constructs of the disclosure are expressed by a muscle-cell specific promoter.
- This muscle-cell specific promoter may be constitutively active or may be an inducible promoter.
- polyadenylation signal to effect proper polyadenylation of the gene transcript.
- the nature of the polyadenylation signal is not believed to be crucial to the successful practice of the methods disclosed herein, and any such sequence may be employed such as human growth hormone and SV40 polyadenylation signals.
- a terminator Also contemplated as an element of the expression cassette is a terminator. These elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.
- the inventor utilizes the 2A-like self-cleaving domain from the insect virus Thosea asigna (TaV 2A peptide; SEQ ID NO. 444; EGRGSLLTCGDVEENPGP). These 2A-like domains have been shown to function across Eukaryotes and cause cleavage of amino acids to occur co-translationally within the 2A-like peptide domain. Therefore, inclusion of TaV 2A peptide allows the expression of multiple proteins from a single mRNA transcript.
- telomere domain of TaV when tested in eukaryotic systems have shown greater than 99% cleavage activity (Donnelly et al, 2001).
- Other acceptable 2A-like peptides include, but are not limited to, equine rhinitis A virus (ERAV) 2A peptide (SEQ ID NO. 445;
- porcine teschovirus-1 (PTV1) 2A peptide SEQ ID NO. 446; ATNF S LLKQ AGD VEENP GP
- FMDV foot and mouth disease virus
- the 2A peptide is used to express a reporter and a Cfpl simultaneously.
- the reporter may be, for example, GFP.
- peptides that may be used include, but are not limited to nuclear inclusion protein a (Nia) protease, a PI protease, a 3C protease, a L protease, a 3C-like protease, or modified versions thereof.
- Nia nuclear inclusion protein a
- PI PI protease
- 3C protease 3C protease
- L protease a 3C-like protease
- the expression construct comprises a virus or engineered construct derived from a viral genome.
- adenovirus expression vector is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to express an antisense polynucleotide that has been cloned therein. In this context, expression does not require that the gene product be synthesized.
- the expression vector comprises a genetically engineered form of adenovirus.
- adenovirus a 36 kB, linear, double-stranded DNA virus, allows substitution of large pieces of adenoviral DNA with foreign sequences up to 7 kB.
- retrovirus the adenoviral infection of host cells does not result in chromosomal integration because adenoviral DNA can replicate in an episomal manner without potential genotoxicity.
- adenoviruses are structurally stable, and no genome rearrangement has been detected after extensive amplification. Adenovirus can infect virtually all epithelial cells regardless of their cell cycle stage. So far, adenoviral infection appears to be linked only to mild disease such as acute respiratory disease in humans.
- Adenovirus is particularly suitable for use as a gene transfer vector because of its midsized genome, ease of manipulation, high titer, wide target cell range and high infectivity. Both ends of the viral genome contain 100-200 base pair inverted repeats (ITRs), which are cis elements necessary for viral DNA replication and packaging.
- ITRs inverted repeats
- the early (E) and late (L) regions of the genome contain different transcription units that are divided by the onset of viral DNA replication.
- the El region (El A and E1B) encodes proteins responsible for the regulation of transcription of the viral genome and a few cellular genes.
- the expression of the E2 region results in the synthesis of the proteins for viral DNA replication. These proteins are involved in DNA replication, late gene expression and host cell shut-off.
- the products of the late genes are expressed only after significant processing of a single primary transcript issued by the major late promoter (MLP).
- MLP major late promoter
- the MLP (located at 16.8 m.u.) is particularly efficient during the late phase of infection, and all the mRNA's issued from this promoter possess a 5'- tripartite leader (TPL) sequence which makes them preferred mRNA's for translation.
- TPL 5'- tripartite leader
- recombinant adenovirus is generated from homologous recombination between shuttle vector and provirus vector. Due to the possible recombination between two proviral vectors, wild-type adenovirus may be generated from this process. Therefore, it is critical to isolate a single clone of virus from an individual plaque and examine its genomic structure.
- adenovirus vectors which are replication deficient, depend on a unique helper cell line, designated 293, which was transformed from human embryonic kidney cells by Ad5 DNA fragments and constitutively expresses El proteins. Since the E3 region is dispensable from the adenovirus genome, the current adenovirus vectors, with the help of 293 cells, carry foreign DNA in either the El, the D3 or both regions. In nature, adenovirus can package approximately 105% of the wild-type genome, providing capacity for about 2 extra kb of DNA.
- the maximum capacity of the current adenovirus vector is under 7.5 kb, or about 15% of the total length of the vector. More than 80% of the adenovirus viral genome remains in the vector backbone and is the source of vector-borne cytotoxicity. Also, the replication deficiency of the El-deleted virus is incomplete.
- Helper cell lines may be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal or epithelial cells.
- the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus. Such cells include, e.g., Vero cells or other monkey embryonic mesenchymal or epithelial cells.
- the preferred helper cell line is 293.
- Racher et al. (1995) disclosed improved methods for culturing 293 cells and propagating adenovirus.
- natural cell aggregates are grown by inoculating individual cells into 1 liter siliconized spinner flasks (Techne, Cambridge, UK) containing 100-200 ml of medium. Following stirring at 40 rpm, the cell viability is estimated with trypan blue.
- Fibra-Cel microcarriers (Bibby Sterlin, Stone, UK) (5 g/1) is employed as follows.
- the adenoviruses of the disclosure are replication defective or at least conditionally replication defective. Other than the requirement that the adenovirus vector be replication defective, or at least conditionally defective, the nature of the adenovirus vector is not believed to be crucial to the successful practice of the methods disclosed herein.
- the adenovirus may be of any of the 42 different known serotypes or subgroups A-F. Adenovirus type 5 of subgroup C is the preferred starting material in order to obtain the conditional replication-defective adenovirus vector for use in the present disclosure.
- the typical vector according to the present disclosure is replication defective and will not have an adenovirus El region.
- the position of insertion of the construct within the adenovirus sequences is not critical.
- the polynucleotide encoding the gene of interest may also be inserted in lieu of the deleted E3 region in E3 replacement vectors, as described by Karlsson et al. (1986), or in the E4 region where a helper cell line or helper virus complements the E4 defect.
- Adenovirus is easy to grow and manipulate and exhibits broad host range in vitro and in vivo. This group of viruses can be obtained in high titers, e.g. , 10 9 -10 12 plaque-forming units per ml, and they are highly infective. The life cycle of adenovirus does not require integration into the host cell genome. The foreign genes delivered by adenovirus vectors are episomal and, therefore, have low genotoxicity to host cells. No side effects have been reported in studies of vaccination with wild-type adenovirus (Couch et al, 1963; Top et al, 1971), demonstrating their safety and therapeutic potential as in vivo gene transfer vectors.
- Adenovirus vectors have been used in eukaryotic gene expression and vaccine development. Animal studies suggested that recombinant adenovirus could be used for gene therapy. Studies in administering recombinant adenovirus to different tissues include trachea instillation, muscle injection, peripheral intravenous injections and stereotactic inoculation into the brain.
- the retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse-transcription. The resulting DNA then stably integrates into cellular chromosomes as a provirus and directs synthesis of viral proteins. The integration results in the retention of the viral gene sequences in the recipient cell and its descendants.
- the retroviral genome contains three genes, gag, pol, and env that code for capsid proteins, polymerase enzyme, and envelope components, respectively.
- a sequence found upstream from the gag gene contains a signal for packaging of the genome into virions.
- Two long terminal repeat (LTR) sequences are present at the 5' and 3' ends of the viral genome. These contain strong promoter and enhancer sequences and are also required for integration in the host cell genome.
- a nucleic acid encoding a gene of interest is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective.
- a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed.
- the packaging sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media.
- the media containing the recombinant retroviruses is then collected, optionally concentrated, and used for gene transfer.
- Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells.
- a different approach to targeting of recombinant retroviruses may be used, in which biotinylated antibodies against a retroviral envelope protein and against a specific cell receptor are used.
- the antibodies are coupled via the biotin components by using
- retrovirus vectors usually integrate into random sites in the cell genome. This can lead to insertional mutagenesis through the interruption of host genes or through the insertion of viral regulatory sequences that can interfere with the function of flanking genes. Another concern with the use of defective retrovirus vectors is the potential appearance of wild-type replication-competent virus in the packaging cells.
- viral vectors may be employed as expression constructs in the present disclosure.
- Vectors derived from viruses such as vaccinia virus, adeno-associated virus (AAV) and herpesviruses may be employed. They offer several attractive features for various mammalian cells.
- viruses such as vaccinia virus, adeno-associated virus (AAV) and herpesviruses may be employed. They offer several attractive features for various mammalian cells.
- the AAV vector is replication-defector or conditionally replication defective.
- the AAV vector is a recombinant AAV vector.
- the AAV vector comprises a sequence isolated or derived from an AAV vector of serotype AAV1, AAV2, AAV3, AAV4, AAV 5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11 or any combination thereof.
- the AAV vector is not an AAV9 vector.
- a single viral vector is used to deliver a nucleic acid encoding Cpfl and at least one gRNA to a cell.
- Cpfl is provided to a cell using a first viral vector and at least one gRNA is provided to the cell using a second viral vector.
- the expression construct must be delivered into a cell.
- the cell may be a muscle cell, a satellite cell, a mesangioblast, a bone marrow derived cell, a stromal cell or a mesenchymal stem cell.
- the cell is a cardiac muscle cell, a skeletal muscle cell, or a smooth muscle cell.
- the cell is a cell in the tibialis anterior, quadriceps, soleus, diaphragm or heart.
- the cell is an induced pluripotent stem cell (iPSC) or inner cell mass cell (iCM).
- iPSC induced pluripotent stem cell
- iCM inner cell mass cell
- the cell is a human iPSC or a human iCM.
- human iPSCs or human iCMs of the disclosure may be derived from a cultured stem cell line, an adult stem cell, a placental stem cell, or from another source of adult or embryonic stem cells that does not require the destruction of a human embryo.
- Delivery to a cell may be accomplished in vitro, as in laboratory procedures for transforming cells lines, or in vivo or ex vivo, as in the treatment of certain disease states.
- One mechanism for delivery is via viral infection where the expression construct is encapsulated in an infectious viral particle.
- the nucleic acid encoding the gene of interest may be positioned and expressed at different sites.
- the nucleic acid encoding the gene may be stably integrated into the genome of the cell. This integration may be in the cognate location and orientation via homologous recombination (gene replacement) or it may be integrated in a random, non-specific location (gene augmentation).
- the nucleic acid may be stably maintained in the cell as a separate, episomal segment of DNA. Such nucleic acid segments or
- “episomes” encode sequences sufficient to permit maintenance and replication independent of or in synchronization with the host cell cycle. How the expression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of expression construct employed.
- the expression construct may simply consist of naked recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned above which physically or chemically permeabilize the cell membrane.
- Dubensky et al (1984) successfully injected polyomavirus DNA in the form of calcium phosphate precipitates into liver and spleen of adult and newborn mice demonstrating active viral replication and acute infection. Benvenisty and Neshif (1986) also demonstrated that direct intraperitoneal injection of calcium phosphate-precipitated plasmids results in expression of the transfected genes.
- DNA encoding a gene of interest may also be transferred in a similar manner in vivo and express the gene product.
- In still another embodiment for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA-coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them.
- the expression construct is delivered directly to the liver, skin, and/or muscle tissue of a subject. This may require surgical exposure of the tissue or cells, to eliminate any intervening tissue between the gun and the target organ, i. e. , ex vivo treatment. Again, DNA encoding a particular gene may be delivered via this method and still be incorporated by the present disclosure.
- the expression construct may be entrapped in a liposome.
- Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers. Also contemplated are lipofectamine-DNA complexes.
- Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful.
- Wong et al, (1980) demonstrated the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells.
- Nicolau et al, (1987) accomplished successful liposome-mediated gene transfer in rats after intravenous injection.
- a reagent known as Lipofectamine 2000TM is widely used and commercially available.
- the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA.
- the liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-1).
- HMG-1 nuclear non-histone chromosomal proteins
- the liposome may be complexed or employed in conjunction with both HVJ and HMG-1.
- expression constructs have been successfully employed in transfer and expression of nucleic acid in vitro and in vivo, then they are applicable for the present disclosure. Where a bacterial promoter is employed in the DNA construct, it also will be desirable to include within the liposome an appropriate bacterial polymerase.
- receptor-mediated delivery vehicles which can be employed to deliver a nucleic acid encoding a particular gene into cells. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis in almost all eukaryotic cells. Because of the cell type-specific distribution of various receptors, the delivery can be highly specific.
- Receptor-mediated gene targeting vehicles generally consist of two components: a cell receptor-specific ligand and a DNA-binding agent.
- a cell receptor-specific ligand Several ligands have been used for receptor-mediated gene transfer. The most extensively characterized ligands are
- ASOR asialoorosomucoid
- transferrin A synthetic neoglycoprotein, which recognizes the same receptor as ASOR, has been used as a gene delivery vehicle and epidermal growth factor (EGF) has also been used to deliver genes to squamous carcinoma cells.
- EGF epidermal growth factor
- compositions are prepared in a form appropriate for the intended application. Generally, this entails preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.
- Aqueous compositions of the present disclosure comprise an effective amount of the drug, vector or proteins, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.
- pharmaceutically acceptable carrier includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans.
- compositions of the present disclosure include classic pharmaceutical preparations.
- Administration of these compositions according to the present disclosure may be via any common route so long as the target tissue is available via that route, but generally including systemic administration. This includes oral, nasal, or buccal. Alternatively, administration may be by intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection, or by direct injection into muscle tissue.
- Such compositions are normally administered as pharmaceutically acceptable compositions, as described supra.
- the active compounds may also be administered parenterally or intraperitoneally.
- solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
- Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations generally contain a preservative to prevent the growth of microorganisms.
- the pharmaceutical forms suitable for injectable use include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
- these preparations are sterile and fluid to the extent that easy injectability exists.
- Preparations should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
- Appropriate solvents or dispersion media may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
- the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- a coating such as lecithin
- surfactants for example, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sorbic acid, thimerosal, and the like.
- isotonic agents for example, sugars or sodium chloride.
- Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
- Sterile injectable solutions may be prepared by incorporating the active compounds in an appropriate amount into a solvent along with any other ingredients (for example as enumerated above) as desired, followed by filtered sterilization.
- dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the desired other ingredients, e.g., as enumerated above.
- the preferred methods of preparation include vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient(s) plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- compositions of the present disclosure are formulated in a neutral or salt form.
- Pharmaceutically-acceptable salts include, for example, acid addition salts (formed with the free amino groups of the protein) derived from inorganic acids (e.g., hydrochloric or phosphoric acids, or from organic acids (e.g. , acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups of the protein can also be derived from inorganic bases (e.g., sodium, potassium, ammonium, calcium, or ferric hydroxides) or from organic bases (e.g. , isopropylamine, trimethylamine, histidine, procaine and the like.
- inorganic acids e.g., hydrochloric or phosphoric acids, or from organic acids (e.g. , acetic, oxalic, tartaric, mandelic, and the like.
- Salts formed with the free carboxyl groups of the protein can also be
- solutions are preferably administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
- the formulations may easily be administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like.
- aqueous solution for example, the solution generally is suitably buffered and the liquid diluent first rendered isotonic for example with sufficient saline or glucose.
- aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
- sterile aqueous media are employed as is known to those of skill in the art, particularly in light of the present disclosure.
- a single dose may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's
- the Cpfl and gRNAs described herein may be delivered to the patient using adoptive cell transfer (ACT).
- adoptive cell transfer one or more expression constructs are provided ex vivo to cells which have originated from the patient (autologous) or from one or more individual(s) other than the patient (allogeneic). The cells are subsequently introduced or reintroduced into the patient.
- one or more nucleic acids encoding Cpfl and a guide RNA that targets a dystrophin splice site are provided to a cell ex vivo before the cell is introduced or reintroduced to a patient.
- nAsCpf1-F2 CTGAACAATCCTGAGAAGGAGCC
- SEQ ID NO: 14 nAsCpf1-R2 GGCATAGTCGGGGACATCATATG
- SEQ ID NO: 11 nCpf1-2A-GFP-F ATGATGTCCCCGACTATGCCgaattcGGCAGTGGAGAGGG
- SEQ ID NO: 15 nCpf1-2A-GFP-R AGCGAGCTCTAGttagaattcCTTGTACAG
- T7-Scaffold-F CACCAGCGCTGCTTAATACGACTCACTATAGGGAAAT (SEQ ID NO: 17)
- T7-Scaffold-R AGTAGCGCTTCTAGACCCTCACTTCCTACTCAG (SEQ ID NO: 18)
- T7-nLb-Rl TGGGGTTATAGTAGGCCATCC (SEQ ID NO: 20)
- T7-nAs-Rl TCCTTCTCAGGATTGTTCAGGTCGTA (SEQ ID NO: 13)
- T7-nAs-NLS-F2 CTGAACAATCCTGAGAAGGAGCC (SEQ ID NO: 14)
- Human-Exon 51 15 1 GCAAAAACCCAAAATATTTTAGCT tttt 71
- Human-Exon 45 7 1 tcaaatAAAAAGACATGGGGCTTC tttc 96 Human-Exon 45 8 1 TGTTTTGCCTTTTTGGTATCTTAC TTTT 97
- Human-Exon 45 10 1 TTTTGCCTTTTTGGTATCTTACAG TTTG 99
- Human-Exon 45 11 1 GCCTTTTTGGTATCTTACAGGAAC TTTT 100
- Human-Exon 45 14 1 GGTATCTTACAGGAACTCCAGGAT TTTT 103
- Human-Exon 45 29 1 GCAGACTTTTTAAGCTTTCTTTAG TTTA 118
- Human-Exon 45 30 1 TAAGCTTTCTTTAGAAGAATATTT TTTT 119
- Human-Exon 45 32 1 AGCTTTCTTTAGAAGAATATTTCA TTTA 121
- Human-Exon 44 2 1 acataatccatctatttttcttga tttt 125
- Human-Exon 44 1 ACCTGCAGGCGATTTGACAGATCT tttt 131
- Human-Exon 44 15 1 ATTTGTTTTTTC GAAATTGT ATTT TTTG 138 Human-Exon 44 16 1 TTTTTTCGAAATTGTATTTATCTT TTTG 139
- Human-Exon 44 24 1 ACTTCTTAAAGATCAGGTTCTGAA TTTA 147
- Human-Exon 53 5 1 CCTTTTATTCTAGTTGAAAGAATT TTTT 154
- Human-Exon 46 4 1 AATTGCCATGTTTGTGTCCCAGTT TTTA 170
- Human-Exon 46 13 1 AGAACTATGTTGGaaaaaaaaaTA TTTG 179
- Human-Exon 46 24 1 CTC A AATC CC CC AGGGC CTGCTTG TTTT 190
- Human-Exon 46 25 1 TCAAATCCCCCAGGGCCTGCTTGC TTTC 191
- Human-Exon 52 2 1 CTGTTAAATTGTTTTCTATAAACC TTTC 200
- Human-Exon 52 8 1 TATTTCTAAAAGTGTTTTTTGGCTGG TTTT 206
- Human-Exon 52 9 1 ATTTCTAAAAGTGTTTTGGCTGGT TTTT 207
- Human-Exon 52 10 1 TTTCTAAAAGTGTTTTGGCTGGTC TTTA 208
- Human-Exon 52 14 1 GGCTGGTCTCACAATTGTACTTTA TTTT 212
- Human-Exon 52 24 1 TTAACAAGCATGGGACACACAAAG TTTT 222
- Human-Exon 52 25 1 TAACAAGCATGGGACACACAAAGC TTTT 223
- Human-Exon 50 4 1 CTGTTAAAGAGGAAGTTAGAAGAT TTTT 233
- Human-Exon 50 5 1 TGTTAAAGAGGAAGTTAGAAGATC TTTC 234
- Human-Exon 50 8 1 CTTCAAGAGCTGAGGGCAAAGCAG TTTA 237
- Human-Exon 50 11 1 GCTCTAGCTATTTGTTCAAAAGTG TTTG 240
- Human-Exon 43 21 -1 CAATGCTGCTGTCTTCTTGCTATG TTTG 264 Human-Exon 43 22 1 CAATGGGAAAAAGTTAACAAAATG TTTC 265
- Human-Exon 43 32 1 AGGGAACTGTAGAATTTATTTCAG TTTC 275
- Human-Exon 6 1 1 AGTTTGCATGGTTCTTGCTCAAGG TTTA 282
- Human-Exon 6 4 1 CATGGTTCTTGCTCAAGGAATGCA TTTG 285
- Human-Exon 6 9 1 TTATGAAAATTTATTTCCACATGT TTTC 290
- Human-Exon 6 23 1 TCCCCAGTATGGTTCCAGATCATG TTTT 304
- Human-Exon 6 24 1 CCCCAGTATGGTTCCAGATCATGT TTTT 305
- Human-Exon 6 25 1 CCCAGTATGGTTCCAGATCATGTC TTTC 306
- Human-Exon 7 1 1 TATTTGTCTTtgtgtatgtgtgta TTTA 307
- Human-Exon 7 3 1 tgtatgtgtgtatgtgtatgtgtt TTtg 309
- Human-Exon 7 4 1 AGGCCAGACCTATTTGACTGGAAT ttTT 310
- Human-Exon 7 5 1 GGCCAGACCTATTTGACTGGAATA tTTA 311
- Human-Exon 7 6 1 ACTGGAATAGTGTGGTTTGCCAGC TTTG 312
- Human-Exon 8 2 1 ACTTTGATTTGTTCATTATCCTTT TTTA 320
- Human-Exon 8 4 1 ATTTGTTCATTATCCTTTTAGAGT TTTG 322
- Human-Exon 8 8 1 TTCATTATCCTTTTAGAGTCTCAA TTTG 326
- Human-Exon 8 9 1 AGAGTCTCAAATATAGAAACCAAA TTTT 327
- Human-Exon 8 25 1 TAGGTATTACGTGCACatatatat TTTT 343
- Human-Exon 55 3 1 TCTTTTTATGGAGTTCACTAGGTG TTTC 348 Human-Exon 55 4 1 T ATGGAGTTC ACT AGGTGC AC CAT TTTT 349
- Human-Gl -exon51 1 gCTCCTACTCAGACTGTTACTCTG TTTA 372
- upper case letters represent nucleotides that align to the exon sequence of the gene.
- Lower case letters represent nucleotides that align to the intron sequence of the gene.
- Human-Exon 45 13 1 UCCUGGAGUUCCUGUAAGAUACCA TTTT 490
- Human-Exon 45 14 1 AUCCUGGAGUUCCUGUAAGAUACC TTTT 491
- Human-Exon 45 34 1 AUAAUCUCUCAUGAAAUAUUCUUC TTTA 511
- Human-Exon 44 6 1 UGCAGGUaaaagcauauggaucaa tttc 517 Human-Exon 44 7 -1 CAGGCGAUUUGACAGAUCUGUUGA TTTC 518
- Human-Exon 46 5 1 UAUUUGUUAAUGCAAACUGGGACA TTTG 559 Human-Exon 46 6 -1 ACAAAUAGUUUGAGAACUAUGUUG tttC 560
- Human-Exon 46 15 1 CUUCUAGCCUGGAGAAAGAAGAAU TTTT 569
- Human-Exon 46 25 1 GCAAGCAGGCCCUGGGGGAUUUGA TTTC 579
- Human-Exon 52 15 1 GUAAAGUACAAUUGUGAGACCAGC TTTG 601 Human-Exon 52 16 1 GUAUUCCUUUUACAUAAUACAAAG TTTA 602
- Human-Exon 50 4 1 AUCUUCUAACUUCCUCUUUAACAG TTTT 621
- Human-Exon 43 12 1 UAAUAUAAAAAUUUUAAAACAGUA TTTT 643
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Neurology (AREA)
- Developmental Biology & Embryology (AREA)
- Physical Education & Sports Medicine (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Reproductive Health (AREA)
- Cell Biology (AREA)
- Gynecology & Obstetrics (AREA)
- Immunology (AREA)
- Dermatology (AREA)
- Transplantation (AREA)
- Neurosurgery (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP17817498.3A EP3545090A1 (en) | 2016-11-28 | 2017-11-28 | Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing |
| MX2019006157A MX2019006157A (es) | 2016-11-28 | 2017-11-28 | Prevención de la distrofia muscular mediante la edición de genes mediada por crispr/cpf1. |
| JP2019528478A JP2019536782A (ja) | 2016-11-28 | 2017-11-28 | CRISPR/Cpf1媒介性遺伝子編集による筋ジストロフィーの予防 |
| US16/464,124 US20200046854A1 (en) | 2016-11-28 | 2017-11-28 | Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing |
| AU2017364106A AU2017364106A1 (en) | 2016-11-28 | 2017-11-28 | Prevention of muscular dystrophy by CRISPR/Cpfl-mediated gene editing |
| CN201780084906.8A CN110382695A (zh) | 2016-11-28 | 2017-11-28 | 通过crispr/cpf1介导的基因编辑来预防肌营养不良 |
| CA3044531A CA3044531A1 (en) | 2016-11-28 | 2017-11-28 | Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662426853P | 2016-11-28 | 2016-11-28 | |
| US62/426,853 | 2016-11-28 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018098480A1 true WO2018098480A1 (en) | 2018-05-31 |
Family
ID=60703123
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/063468 Ceased WO2018098480A1 (en) | 2016-11-28 | 2017-11-28 | Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US20200046854A1 (https=) |
| EP (1) | EP3545090A1 (https=) |
| JP (1) | JP2019536782A (https=) |
| CN (1) | CN110382695A (https=) |
| AU (1) | AU2017364106A1 (https=) |
| CA (1) | CA3044531A1 (https=) |
| MX (1) | MX2019006157A (https=) |
| WO (1) | WO2018098480A1 (https=) |
Cited By (60)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| WO2020165768A1 (en) * | 2019-02-12 | 2020-08-20 | Università Degli Studi Di Trento | Cas12a guide rna molecules and uses thereof |
| EP3487523A4 (en) * | 2016-07-19 | 2020-09-02 | Duke University | THERAPEUTIC APPLICATIONS OF THE CPF1-BASED GENOME EDITION |
| CN111718964A (zh) * | 2019-08-01 | 2020-09-29 | 广东赤萌医疗科技有限公司 | 用于修复dmd基因突变的核酸序列及系统 |
| WO2020225754A1 (en) * | 2019-05-06 | 2020-11-12 | Mcmullen Tara | Crispr gene editing for autosomal dominant diseases |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US20210040460A1 (en) | 2012-04-27 | 2021-02-11 | Duke University | Genetic correction of mutated genes |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| JPWO2020122104A1 (ja) * | 2018-12-11 | 2021-10-21 | 国立大学法人京都大学 | ゲノムdnaに欠失を誘導する方法 |
| WO2021216674A1 (en) * | 2020-04-24 | 2021-10-28 | University Of Massachusetts | Improved cas 12a/nls mediated therapeutic gene editing platforms |
| US11168141B2 (en) | 2018-08-02 | 2021-11-09 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| WO2022056000A1 (en) * | 2020-09-09 | 2022-03-17 | Vertex Pharmaceuticals Incorporated | Compositions and methods for treatment of duchenne muscular dystrophy |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| JP2022526669A (ja) * | 2019-04-12 | 2022-05-25 | デューク ユニバーシティ | ジストロフィン機能を修復するためのCRISPR/Casをベースにした塩基編集組成物 |
| US11369689B2 (en) | 2018-08-02 | 2022-06-28 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| WO2022140340A1 (en) * | 2020-12-22 | 2022-06-30 | Vertex Pharmaceuticals Incorporated | Compositions comprising an rna guide targeting dmd and uses thereof |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| WO2022251181A1 (en) * | 2021-05-25 | 2022-12-01 | The Board Of Regents Of The University Of Texas System | Correction of duchenne muscular dystrophy mutations with all-in-one adeno-associated virus-delivered single-cut crispr |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11679161B2 (en) | 2021-07-09 | 2023-06-20 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy |
| EP4215614A1 (en) | 2022-01-24 | 2023-07-26 | Dynacure | Combination therapy for dystrophin-related diseases |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| WO2023172927A1 (en) * | 2022-03-08 | 2023-09-14 | Vertex Pharmaceuticals Incorporated | Precise excisions of portions of exon 44, 50, and 53 for treatment of duchenne muscular dystrophy |
| US11771776B2 (en) | 2021-07-09 | 2023-10-03 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11787869B2 (en) | 2018-08-02 | 2023-10-17 | Dyne Therapeutics, Inc. | Methods of using muscle targeting complexes to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy or a disease associated with muscle weakness |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11970710B2 (en) | 2015-10-13 | 2024-04-30 | Duke University | Genome engineering with Type I CRISPR systems in eukaryotic cells |
| US11987809B2 (en) | 2015-11-13 | 2024-05-21 | Avellino Lab Usa, Inc. | Methods for the treatment of corneal dystrophies |
| US12098399B2 (en) | 2022-06-24 | 2024-09-24 | Tune Therapeutics, Inc. | Compositions, systems, and methods for epigenetic regulation of proprotein convertase subtilisin/kexin type 9 (PCSK9) gene expression |
| US12128109B2 (en) | 2021-07-09 | 2024-10-29 | Dyne Therapeutics, Inc. | Muscle targeting complexes and formulations for treating dystrophinopathies |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12215366B2 (en) | 2015-02-09 | 2025-02-04 | Duke University | Compositions and methods for epigenome editing |
| US12215345B2 (en) | 2013-03-19 | 2025-02-04 | Duke University | Compositions and methods for the induction and tuning of gene expression |
| US12214054B2 (en) | 2015-11-30 | 2025-02-04 | Duke University | Therapeutic targets for the correction of the human dystrophin gene by gene editing and methods of use |
| US12239717B2 (en) | 2021-07-09 | 2025-03-04 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12428631B2 (en) | 2016-04-13 | 2025-09-30 | Duke University | CRISPR/Cas9-based repressors for silencing gene targets in vivo and methods of use |
| US12428487B2 (en) | 2018-08-02 | 2025-09-30 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonicleotide and method of delivering oligonucleotide to a subject |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US12509492B2 (en) | 2018-01-19 | 2025-12-30 | Duke University | Genome engineering with CRISPR-Cas systems in eukaryotes |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3617311B1 (en) * | 2017-03-30 | 2024-11-20 | Kyoto University | Method for inducing exon skipping by genome editing |
| CN115279184A (zh) * | 2020-03-04 | 2022-11-01 | 雷杰纳荣制药公司 | B4galt1介导的功能的啮齿动物模型 |
| EP4149622A4 (en) * | 2020-05-12 | 2024-12-18 | Myogene Bio LLC | IMMUNOSUPPRESSIVE AGENTS AND METHODS OF RE-DOSING VIRAL ADMINISTRATION FOR GENE THERAPY |
| JP2024527362A (ja) * | 2021-07-09 | 2024-07-24 | ダイン セラピューティクス,インコーポレーテッド | 筋標的化複合体およびジストロフィノパチーを処置するためのその使用 |
| CN114214360A (zh) * | 2021-12-27 | 2022-03-22 | 西安英创生物技术有限公司 | 先天性肌无力小鼠模型、其构建方法及应用 |
| CN120648680A (zh) * | 2024-03-15 | 2025-09-16 | 迦进生物医药(上海)有限公司 | 治疗杜兴型肌营养不良症和贝克型肌营养不良症的药物 |
| CN118086408A (zh) * | 2024-04-25 | 2024-05-28 | 华南理工大学 | 一种可实现靶向肌肉细胞基因编辑的仿病毒颗粒及其制备方法和应用 |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK99653C (da) | 1959-06-24 | 1964-08-31 | Skaanska Aettikfabriken Ab | Pynteliste til brug som sammenfojningsliste, hjørneliste eller endeliste ved montering af beklædningsplader. |
| EP0273085A1 (en) | 1986-12-29 | 1988-07-06 | IntraCel Corporation | A method for internalizing nucleic acids into eukaryotic cells |
| US20140068797A1 (en) | 2012-05-25 | 2014-03-06 | University Of Vienna | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| WO2014197748A2 (en) * | 2013-06-05 | 2014-12-11 | Duke University | Rna-guided gene editing and gene regulation |
| WO2015138739A2 (en) * | 2014-03-12 | 2015-09-17 | Precision Biosciences, Inc. | Dystrophin gene oxon deletion using engineered nucleases |
| WO2016025469A1 (en) * | 2014-08-11 | 2016-02-18 | The Board Of Regents Of The University Of Texas System | Prevention of muscular dystrophy by crispr/cas9-mediated gene editing |
| US20160208243A1 (en) * | 2015-06-18 | 2016-07-21 | The Broad Institute, Inc. | Novel crispr enzymes and systems |
| WO2017072590A1 (en) * | 2015-10-28 | 2017-05-04 | Crispr Therapeutics Ag | Materials and methods for treatment of duchenne muscular dystrophy |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR122020021379B1 (pt) * | 2008-10-24 | 2021-05-11 | Sarepta Therapeutics, Inc. | oligômero morfolino fosforodiamidato, composição que compreende o mesmo e uso do dito oligômero para tratar distrofia muscular |
| US20140329762A1 (en) * | 2013-03-15 | 2014-11-06 | Sarepta Therapeutics, Inc. | Compositions for treating muscular dystrophy |
| JP6744019B2 (ja) * | 2014-08-11 | 2020-08-19 | ザ ボード オブ トラスティーズ オブ ザ ユニヴァーシティー オブ イリノイ | 生物流体の表皮特性評価のためのデバイス及び関連する方法 |
| WO2017035416A2 (en) * | 2015-08-25 | 2017-03-02 | Duke University | Compositions and methods of improving specificity in genomic engineering using rna-guided endonucleases |
| WO2017049407A1 (en) * | 2015-09-23 | 2017-03-30 | UNIVERSITé LAVAL | Modification of the dystrophin gene and uses thereof |
| JP7490211B2 (ja) * | 2016-07-19 | 2024-05-27 | デューク ユニバーシティ | Cpf1に基づくゲノム編集の治療適用 |
-
2017
- 2017-11-28 AU AU2017364106A patent/AU2017364106A1/en not_active Abandoned
- 2017-11-28 US US16/464,124 patent/US20200046854A1/en not_active Abandoned
- 2017-11-28 CA CA3044531A patent/CA3044531A1/en not_active Abandoned
- 2017-11-28 MX MX2019006157A patent/MX2019006157A/es unknown
- 2017-11-28 CN CN201780084906.8A patent/CN110382695A/zh active Pending
- 2017-11-28 EP EP17817498.3A patent/EP3545090A1/en not_active Withdrawn
- 2017-11-28 WO PCT/US2017/063468 patent/WO2018098480A1/en not_active Ceased
- 2017-11-28 JP JP2019528478A patent/JP2019536782A/ja active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK99653C (da) | 1959-06-24 | 1964-08-31 | Skaanska Aettikfabriken Ab | Pynteliste til brug som sammenfojningsliste, hjørneliste eller endeliste ved montering af beklædningsplader. |
| EP0273085A1 (en) | 1986-12-29 | 1988-07-06 | IntraCel Corporation | A method for internalizing nucleic acids into eukaryotic cells |
| US20140068797A1 (en) | 2012-05-25 | 2014-03-06 | University Of Vienna | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| WO2014197748A2 (en) * | 2013-06-05 | 2014-12-11 | Duke University | Rna-guided gene editing and gene regulation |
| WO2015138739A2 (en) * | 2014-03-12 | 2015-09-17 | Precision Biosciences, Inc. | Dystrophin gene oxon deletion using engineered nucleases |
| WO2016025469A1 (en) * | 2014-08-11 | 2016-02-18 | The Board Of Regents Of The University Of Texas System | Prevention of muscular dystrophy by crispr/cas9-mediated gene editing |
| US20160208243A1 (en) * | 2015-06-18 | 2016-07-21 | The Broad Institute, Inc. | Novel crispr enzymes and systems |
| WO2017072590A1 (en) * | 2015-10-28 | 2017-05-04 | Crispr Therapeutics Ag | Materials and methods for treatment of duchenne muscular dystrophy |
Non-Patent Citations (261)
| Title |
|---|
| AARTSMA-RUS ET AL., HUM. MUTAT., vol. 30, 2009, pages 293 - 299 |
| ANGEL ET AL., CELL, vol. 49, 1987, pages 729 |
| ANGEL ET AL., MOL. CELL. BIOL., vol. 7, 1987, pages 2256 |
| BAICHWAL; SUGDEN: "Gene Transfer", 1986, PLENUM PRESS, pages: 117 - 148 |
| BANERJI ET AL., CELL, vol. 27, no. 2, 1981, pages 299 - 308 |
| BANERJI ET AL., CELL, vol. 33, no. 3, 1983, pages 729 - 740 |
| BARNES ET AL., J. BIOL. CHEM., vol. 272, no. 17, 1997, pages 11510 - 7 |
| BASKIN ET AL., EMBO MOL MED, vol. 6, 2014, pages 1610 - 1621 |
| BENVENISTY; NESHIF, PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 9551 - 9555 |
| BERKHOUT ET AL., CELL, vol. 59, 1989, pages 273 - 282 |
| BERND ZETSCHE ET AL: "Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System", CELL, vol. 163, no. 3, 1 October 2015 (2015-10-01), AMSTERDAM, NL, pages 759 - 771, XP055267511, ISSN: 0092-8674, DOI: 10.1016/j.cell.2015.09.038 * |
| BHAVSAR ET AL., GENOMICS, vol. 35, no. 1, 1996, pages 11 - 23 |
| BIKARD ET AL., NUCLEIC ACIDS RES., vol. 41, no. 15, 2013, pages 7429 - 7437 |
| BLANAR ET AL., EMBO J., vol. 8, 1989, pages 1139 |
| BODINE; LEY, EMBO J., vol. 6, 1987, pages 2997 |
| BOSHART ET AL., CELL, vol. 41, 1985, pages 521 |
| BOSTICK ET AL., MOL THER, vol. 19, 2011, pages 1826 - 1832 |
| BOSZE ET AL., EMBO J, vol. 5, no. 7, 1986, pages 1615 - 1623 |
| BRADDOCK ET AL., CELL, vol. 58, 1989, pages 269 |
| BULLA; SIDDIQUI, J. VIROL., vol. 62, 1986, pages 1437 |
| BURRIDGE ET AL., NAT. METHODS, vol. 11, 2014, pages 855 - 860 |
| BUSHBY ET AL., LANCET NEUROL., vol. 9, no. 1, 2010, pages 77 - 93 |
| BUSHBY ET AL., LANCET NEUROL., vol. 9, no. 2, 2010, pages 177 - 198 |
| C. LONG ET AL: "Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy", SCIENCE, vol. 351, no. 6271, 22 January 2016 (2016-01-22), pages 400 - 403, XP055454443, ISSN: 0036-8075, DOI: 10.1126/science.aad5725 * |
| C. LONG ET AL: "Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA", SCIENCE, vol. 345, no. 6201, 14 August 2014 (2014-08-14), pages 1184 - 1188, XP055159130, ISSN: 0036-8075, DOI: 10.1126/science.1254445 * |
| CAMPBELL; KAHL, NATURE, vol. 338, 1989, pages 259 - 262 |
| CAMPBELL; VILLARREAL, MOL. CELL. BIOL., vol. 8, 1988, pages 1993 |
| CAMPERE; TILGHMAN, GENES AND DEV., vol. 3, 1989, pages 537 |
| CAMPO ET AL., NATURE, vol. 303, 1983, pages 77 |
| CELANDER ET AL., J. VIROLOGY, vol. 62, 1988, pages 1314 |
| CELANDER; HASELTINE, J. VIROLOGY, vol. 61, 1987, pages 269 |
| CHANDLER ET AL., CELL, vol. 33, 1983, pages 489 |
| CHANG ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 2153 |
| CHANG ET AL., STEM CELLS., vol. 27, 2009, pages 1042 - 1049 |
| CHATTERJEE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 9114 |
| CHEN; OKAYAMA, MOL. CELL BIOL., vol. 7, 1987, pages 2745 - 2752 |
| CHO ET AL., NAT. BIOTECHNOL., vol. 31, no. 3, 2013, pages 230 - 232 |
| CHOI ET AL., CELL, vol. 53, 1988, pages 519 |
| CIRAK ET AL., THE LANCET, vol. 378, 2011, pages 595 - 605 |
| COFFIN ET AL.: "Virology", 1990, RAVEN PRESS, pages: 1437 - 1500 |
| COHEN ET AL., J. CELL. PHYSIOL., vol. 5, 1987, pages 75 |
| COSTA ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 81 |
| COUCH ET AL., AM. REV. RESP. DIS., vol. 88, 1963, pages 394 - 403 |
| COUPAR ET AL., GENE, vol. 68, 1988, pages 1 - 10 |
| CRIPE ET AL., EMBO J, vol. 6, 1987, pages 3745 |
| CULOTTA; HAMER, MOL. CELL. BIOL., vol. 9, 1989, pages 1376 |
| DANDOLO ET AL., J. VIROLOGY, vol. 47, 1983, pages 55 - 64 |
| DAVID G. OUSTEROUT ET AL: "Multiplex CRISPR/Cas9-based genome editing for correction of dystrophin mutations that cause Duchenne muscular dystrophy", NATURE COMMUNICATIONS, vol. 6, 18 February 2015 (2015-02-18), pages 6244, XP055196515, DOI: 10.1038/ncomms7244 * |
| DE VILLIERS ET AL., NATURE, vol. 312, no. 5991, 1984, pages 242 - 246 |
| DESCHAMPS ET AL., SCIENCE, vol. 230, 1985, pages 1174 - 1177 |
| DEWITT ET AL., SCI TRANSL MED, vol. 8, 2016, pages 360ra134 - 360ra134 |
| DONNELLY ET AL., J. GEN. VIROL., vol. 82, 2001, pages 1027 - 1041 |
| DUBENSKY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 7529 - 7533 |
| EDBROOKE ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 1908 |
| EDLUND ET AL., SCIENCE, vol. 230, 1985, pages 912 - 916 |
| FECHHEIMER ET AL., PROC NATL. ACAD. SCI. USA, vol. 84, 1987, pages 8463 - 8467 |
| FENG; HOLLAND, NATURE, vol. 334, 1988, pages 6178 |
| FERKOL ET AL., FASEB J., vol. 7, 1993, pages 1081 - 1091 |
| FIRAK; SUBRAMANIAN, MOL. CELL. BIOL., vol. 6, 1986, pages 3667 |
| FOECKING; HOFSTETTER, GENE, vol. 45, no. 1, 1986, pages 101 - 105 |
| FONFARA ET AL., NATURE, vol. 532, 2016, pages 517 - 521 |
| FRALEY ET AL., PROC NATL. ACAD. SCI. USA, vol. 76, 1979, pages 3348 - 3352 |
| FRANZ ET AL., CARDOSCIENCE, vol. 5, no. 4, 1994, pages 235 - 43 |
| FRIEDMANN, SCIENCE, vol. 244, 1989, pages 1275 - 1281 |
| FUJITA ET AL., CELL, vol. 49, 1987, pages 357 |
| GHOSH; BACHHAWAT ET AL.: "Liver Diseases, Targeted Diagnosis and Therapy Using Specific Receptors andLigands", 1991, MARCEL DEKKER, pages: 87 - 104 |
| GHOSH-CHOUDHURY ET AL., EMBO J., vol. 6, 1987, pages 1733 - 1739 |
| GILLES ET AL., CELL, vol. 33, 1983, pages 717 |
| GLOSS ET AL., EMBO J., vol. 6, 1987, pages 3735 |
| GODBOUT ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 1169 |
| GOMEZ-FOIX ET AL., J. BIOL. CHEM., vol. 267, 1992, pages 25129 - 25134 |
| GONCALVES ET AL., MOL THER, vol. 19, no. 7, 2011, pages 1331 - 1341 |
| GOODBOURN ET AL., CELL, vol. 45, 1986, pages 601 |
| GOODBOURN; MANIATIS, PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 1447 |
| GOPAL, MOL. CELL BIOL., vol. 5, 1985, pages 1188 - 1190 |
| GOPAL-SRIVASTAVA ET AL., J. MOL. CELL. BIOL., vol. 15, no. 12, 1995, pages 7081 - 90 |
| GRAHAM ET AL., J. GEN. VIROL., vol. 36, 1977, pages 59 - 72 |
| GRAHAM; PREVEC: "Methods in Molecular Biology: Gene Transfer and Expression Protocol", vol. 7, 1991, HUMANA PRESS, pages: 109 - 128 |
| GRAHAM; VAN DER EB, VIROLOGY, vol. 52, 1973, pages 456 - 467 |
| GREENE ET AL., IMMUNOLOGY TODAY, vol. 10, 1989, pages 272 |
| GROSSCHEDL; BALTIMORE, CELL, vol. 41, 1985, pages 885 |
| GRUNHAUS; HORWITZ, SEMINAR IN VIROLOGY, vol. 3, 1992, pages 237 - 252 |
| HARLAND; WEINTRAUB, J. CELL BIOL., vol. 101, 1985, pages 1094 - 1099 |
| HASLINGER; KARIN, PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 8572 |
| HAUBER; CULLEN, J. VIROLOGY, vol. 62, 1988, pages 673 |
| HEN ET AL., NATURE, vol. 321, 1986, pages 249 |
| HENSEL ET AL., LYMPHOKINE RES., vol. 8, 1989, pages 347 |
| HERMONAT; MUZYCSKA, PROC. NAT'LACAD. SCI. USA, vol. 81, 1984, pages 6466 - 6470 |
| HERR; CLARKE, CELL, vol. 45, 1986, pages 461 |
| HERSDORFFER ET AL., DNA CELL BIOL., vol. 9, 1990, pages 713 - 723 |
| HERZ; GERARD, PROC. NAT'L. ACAD. SCI. USA, vol. 90, 1993, pages 2812 - 2816 |
| HIROCHIKA ET AL., J. VIROL., vol. 61, 1987, pages 2599 |
| HOLBROOK ET AL., VIROLOGY, vol. 157, 1987, pages 211 |
| HOLLINGER; CHAMBERLAIN, CURRENT OPINION IN NEUROLOGY, vol. 28, 2015, pages 522 - 527 |
| HORLICK; BENFIELD, MOL. CELL. BIOL., vol. 9, 1989, pages 2396 |
| HORWICH ET AL., J. VIROL., vol. 64, 1990, pages 642 - 650 |
| HSU ET AL., NATL BIOTECHNOL., vol. 31, 2013, pages 827 - 832 |
| HUANG ET AL., CELL, vol. 27, 1981, pages 245 |
| HUG ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 3065 |
| HWANG ET AL., MOL. CELL. BIOL., vol. 10, 1990, pages 585 |
| IMAGAWA ET AL., CELL, vol. 51, 1987, pages 251 |
| IMBRA; KARIN, NATURE, vol. 323, 1986, pages 555 |
| IMLER ET AL., MOL. CELL. BIOL., vol. 7, 1987, pages 2558 |
| IMPERIALE; NEVINS, MOL. CELL. BIOL., vol. 4, 1984, pages 875 |
| JAKOBOVITS ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 2555 |
| JAMEEL; SIDDIQUI, MOL. CELL. BIOL., vol. 6, 1986, pages 710 |
| JAYNES ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 62 |
| JINEK ET AL., SCIENCE, vol. 337, 2012, pages 816 - 821 |
| JOHNSON ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 3393 |
| JONES; SHENK, CELL, vol. 13, 1978, pages 181 - 188 |
| KADESCH; BERG, MOL. CELL. BIOL., vol. 6, 1986, pages 2593 |
| KANEDA ET AL., SCIENCE, vol. 243, 1989, pages 375 - 378 |
| KARIN ET AL., MOL. CELL. BIOL., vol. 7, 1987, pages 606 |
| KARLSSON ET AL., EMBO J., vol. 5, 1986, pages 2377 - 2385 |
| KATINKA ET AL., CELL, vol. 20, 1980, pages 393 |
| KATO ET AL., JBIOL CHEM., vol. 266, no. 6, 1991, pages 3361 - 3364 |
| KAWAMOTO ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 267 |
| KELLY ET AL., J. CELL BIOL., vol. 129, no. 2, 1995, pages 383 - 96 |
| KILEDJIAN ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 145 |
| KIM ET AL., NATURE BIOTECHNOLOGY, 2016, pages 1 - 2 |
| KIM ET AL., NATURE BIOTECHNOLOGY, vol. 34, 2016, pages 876 - 881 |
| KIMURA ET AL., DEV. GROWTH DIFFER., vol. 39, no. 3, 1997, pages 257 - 65 |
| KLAMUT ET AL., MOL. CELL. BIOL., vol. 10, 1990, pages 193 |
| KLEIN ET AL., NATURE, vol. 327, 1987, pages 70 - 73 |
| KOCH ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 303 |
| KRIEGLER ET AL., CELL, vol. 38, 1984, pages 483 |
| KRIEGLER ET AL., CELL, vol. 53, 1988, pages 45 |
| KRIEGLER; BOTCHAN, MOL. CELL. BIOL., vol. 3, 1983, pages 325 |
| KRIEGLER; BOTCHAN: "Eukaryotic Viral Vectors", 1982, COLD SPRING HARBOR LABORATORY |
| KUHL ET AL., CELL, vol. 50, 1987, pages 1057 |
| KUNZ ET AL., NUCL. ACIDS RES., vol. 17, 1989, pages 1121 |
| LAPOINTE ET AL., HYPERTENSION, vol. 27, no. 3, 1996, pages 715 - 22 |
| LAPOINTE ET AL., J. BIOL. CHEM., vol. 263, no. 19, 1988, pages 9075 - 8 |
| LARSEN ET AL., PROC. NATL. ACAD. SCI. USA., vol. 83, 1986, pages 8283 |
| LASPIA ET AL., CELL, vol. 59, 1989, pages 283 |
| LATIMER ET AL., MOL. CELL. BIOL., vol. 10, 1990, pages 760 |
| LE GAL LA SALLE ET AL., SCIENCE, vol. 259, 1993, pages 988 - 990 |
| LEE ET AL., NATURE, vol. 294, 1981, pages 228 |
| LEVINSON ET AL., NATURE, vol. 295, 1982, pages 79 |
| LEVRERO ET AL., GENE, vol. 101, 1991, pages 195 - 202 |
| LI XU ET AL: "CRISPR-mediated Genome Editing Restores Dystrophin Expression and Function in mdx Mice", MOLECULAR THERAPY : THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY, vol. 24, no. 3, 1 March 2016 (2016-03-01), US, pages 564 - 569, XP055419710, ISSN: 1525-0016, DOI: 10.1038/mt.2015.192 * |
| LIN ET AL., MOL. CELL. BIOL., vol. 10, 1990, pages 850 |
| LONG ET AL., SCIENCE, vol. 345, 2014, pages 1184 - 1188 |
| LONG ET AL., SCIENCE, vol. 351, 2016, pages 400 - 403 |
| LONG ET AL.: "Genome Editing of Monogenic Neuromuscular Diseases: A Systematic Review", JAMA NEUROL, 2016 |
| LURIA ET AL., EMBO J., vol. 6, 1987, pages 3307 |
| LUSKY ET AL., MOL. CELL. BIOL., vol. 3, 1983, pages 1108 |
| LUSKY; BOTCHAN, PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 3609 |
| MAJORS; VARMUS, PROC. NATL. ACAD. SCI. USA, vol. 80, 1983, pages 5866 |
| MALI ET AL., NAT METHODS, vol. 10, 2013, pages 957 - 963 |
| MALI ET AL., NAT. BIOTECHNOL., vol. 31, 2013, pages 833 - 838 |
| MALI ET AL., SCIENCE, vol. 339, 2013, pages 823 - 826 |
| MANN ET AL., CELL, vol. 33, 1983, pages 153 - 159 |
| MARESCA ET AL., GENOME RESEARCH, vol. 23, 2013, pages 539 - 546 |
| MARKOWITZ ET AL., J. VIROL., vol. 62, 1988, pages 1120 - 1124 |
| MARTARI, M. ET AL., HUM GENE THER, vol. 20, no. 7, 2009, pages 759 - 766 |
| MCNEALL ET AL., GENE, vol. 76, 1989, pages 81 |
| MIKSICEK ET AL., CELL, vol. 46, 1986, pages 203 |
| MILLAY ET AL., NAT. MED., vol. 14, 2008, pages 442 - 447 |
| MOJICA ET AL., J. MOL. EVOL., vol. 60, 2005, pages 174 - 182 |
| MORDACQ; LINZER, GENES AND DEV., vol. 3, 1989, pages 760 |
| MOREAU ET AL., NUCL. ACIDS RES., vol. 9, 1981, pages 6047 |
| MOSS ET AL., J. GEN. PHYSIOL., vol. 108, no. 6, 1996, pages 473 - 84 |
| MOURKIOTI ET AL., NATURE CELL BIOLOGY, vol. 15, 2013, pages 895 - 904 |
| MUESING ET AL., CELL, vol. 48, 1987, pages 691 |
| NELSON ET AL., SCIENCE, vol. 351, 2016, pages 403 - 407 |
| NICOLAS; RUBINSTEIN: "Vectors: A survey of molecular cloning vectors and their uses", 1988, BUTTERWORTH, pages: 494 - 513 |
| NICOLAU ET AL., METHODS ENZYMOL., vol. 149, 1987, pages 157 - 176 |
| NICOLAU; SENE, BIOCHIM. BIOPHYS. ACTA, vol. 721, 1982, pages 185 - 190 |
| ONDEK ET AL., EMBO J., vol. 6, 1987, pages 1017 |
| ORNITZ ET AL., MOL. CELL. BIOL., vol. 7, 1987, pages 3466 |
| PADGETT, R.A., TRENDS GENET, vol. 28, 2012, pages 147 - 154 |
| PALMITER ET AL., CELL, vol. 29, 1982, pages 701 |
| PALMITER ET AL., NATURE, vol. 300, 1982, pages 611 |
| PASKIND ET AL., VIROLOGY, vol. 67, 1975, pages 242 - 248 |
| PECH ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 396 |
| PERALES ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, no. 9, 1994, pages 4086 - 4090 |
| PEREZ-STABLE; CONSTANTINI, MOL. CELL. BIOL., vol. 10, 1990, pages 1116 |
| PICARD; SCHAFFNER, NATURE, vol. 307, 1984, pages 83 |
| PINKERT ET AL., GENES AND DEV., vol. 1, 1987, pages 268 |
| PONTA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 1020 |
| PORTON ET AL., MOL. CELL. BIOL., vol. 10, 1990, pages 1076 |
| POTTER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 7161 - 7165 |
| QUEEN; BALTIMORE, CELL, vol. 35, 1983, pages 741 |
| QUINN ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 4713 |
| RACHER ET AL., BIOTECH. TECHNIQUES, vol. 9, 1995, pages 169 - 174 |
| RAGOT ET AL., NATURE, vol. 361, 1993, pages 647 - 650 |
| RAN ET AL., NATURE, vol. 520, 2015, pages 186 - 191 |
| REDONDO ET AL., SCIENCE, vol. 247, 1990, pages 1225 |
| REISMAN; ROTTER, MOL. CELL. BIOL., vol. 9, 1989, pages 3571 |
| REMINGTON'S PHARMACEUTICAL SCIENCES, pages 1035 - 1038,1570-1580 |
| RENAN, RADIOTHER. ONCOL., vol. 19, 1990, pages 197 - 218 |
| RESENDEZ JR. ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 4579 |
| RICH ET AL., HUM. GENE THER., vol. 4, 1993, pages 461 - 476 |
| RIDGEWAY: "Vectors: A survey of molecular cloning vectors and their uses", 1988, BUTTERWORTH, pages: 467 - 492 |
| RIPE ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 2224 |
| RIPPE ET AL., MOL. CELL BIOL., vol. 10, 1990, pages 689 - 695 |
| RITTLING ET AL., NUC. ACIDS RES., vol. 17, 1989, pages 1619 |
| ROSEN ET AL., CELL, vol. 41, 1988, pages 813 |
| ROSENFELD ET AL., CELL, vol. 68, 1992, pages 143 - 155 |
| ROSENFELD ET AL., SCIENCE, vol. 252, 1991, pages 431 - 434 |
| ROUX ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 9079 - 9083 |
| SAKAI ET AL., GENES AND DEV., vol. 2, 1988, pages 1144 |
| SATAKE ET AL., J. VIROLOGY, vol. 62, 1988, pages 970 |
| SCHAFFNER ET AL., J. MOL. BIOL., vol. 201, 1988, pages 81 |
| SEARLE ET AL., MOL. CELL. BIOL., vol. 5, 1985, pages 1480 |
| SHARP; MARCINIAK, CELL, vol. 59, 1989, pages 229 |
| SHAUL; BEN-LEVY, EMBOJ., vol. 6, 1987, pages 1913 |
| SHERMAN ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 50 |
| SHIMIZU-MOTOHASHI ET AL., AM J TRANSL RES, vol. 8, 2016, pages 2471 - 2489 |
| SLEIGH; LOCKETT, J. EMBO, vol. 4, 1985, pages 3831 |
| SPALHOLZ ET AL., CELL, vol. 42, 1985, pages 183 |
| SPANDAU; LEE, J. VIROLOGY, vol. 62, 1988, pages 427 |
| SPANDIDOS; WILKIE, EMBO J., vol. 2, 1983, pages 1193 |
| STEPHENS; HENTSCHEL, BIOCHEM. J., vol. 248, 1987, pages 1 |
| STRATFORD-PERRICAUDET ET AL., HUM. GENE. THER., vol. 1, 1990, pages 241 - 256 |
| STRATFORD-PERRICAUDET; PERRICAUDET: "Human Gene Transfer", 1991, JOHN LIBBEY EUROTEXT, pages: 51 - 61 |
| STUART ET AL., NATURE, vol. 317, 1985, pages 828 |
| SULLIVAN; PETERLIN, MOL. CELL. BIOL., vol. 7, 1987, pages 3315 |
| SWARTZENDRUBER; LEHMAN, J. CELL. PHYSIOLOGY, vol. 85, 1975, pages 179 |
| TABEBORDBAR ET AL., SCIENCE, vol. 351, 2016, pages 407 - 411 |
| TAKEBE ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 466 |
| TAVERNIER ET AL., NATURE, vol. 301, 1983, pages 634 |
| TAYLOR ET AL., J. BIOL. CHEM., vol. 264, 1989, pages 15160 |
| TAYLOR; KINGSTON, MOL. CELL. BIOL., vol. 10, 1990, pages 165 |
| TAYLOR; KINGSTON, MOL. CELL. BIOL., vol. 10, 1990, pages 176 |
| TEMIN: "Gene Transfer", 1986, PLENUM PRESS, pages: 149 - 188 |
| THIESEN ET AL., J. VIROLOGY, vol. 62, 1988, pages 614 |
| TOP ET AL., J. INFECT. DIS., vol. 124, 1971, pages 155 - 160 |
| TOTH ET AL., BIOLOGY DIRECT, 2016, pages 1 - 14 |
| TRONCHE ET AL., MOL. BIOL. MED., vol. 7, 1990, pages 173 |
| TRUDEL; CONSTANTINI, GENES AND DEV., vol. 6, 1987, pages 954 |
| TSAI ET AL., NATURE BIOTECHNOLOGY, vol. 34, 2016, pages 882 - 887 |
| TUR-KASPA ET AL., MOL. CELL BIOL., vol. 6, 1986, pages 716 - 718 |
| TYNDELL ET AL., NUC. ACIDS. RES., vol. 9, 1981, pages 6231 |
| VANNICE; LEVINSON, J. VIROLOGY, vol. 62, 1988, pages 1305 |
| VARMUS ET AL., CELL, vol. 25, 1981, pages 23 - 36 |
| VASSEUR ET AL., PROC NATL. ACAD. SCI. U.S.A., vol. 77, 1980, pages 1068 |
| WAGNER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, no. 9, 1990, pages 3410 - 3414 |
| WANG ET AL., CELL, vol. 153, 2013, pages 910 - 910 |
| WEBER ET AL., CELL, vol. 36, 1984, pages 983 |
| WEINBERGER ET AL., MOL. CELL. BIOL., vol. 8, 1984, pages 988 |
| WINOTO; BALTIMORE, CELL, vol. 59, 1989, pages 649 |
| WONG ET AL., GENE, vol. 10, 1980, pages 87 - 94 |
| WU ET AL., CELL STEM CELL, vol. 13, 2013, pages 659 - 662 |
| WU ET AL., NAT BIOTECHNOL, vol. 32, 2014, pages 670 - 676 |
| WU; WU, ADV. DRUG DELIVERY REV., vol. 12, 1993, pages 159 - 167 |
| WU; WU, BIOCHEMISTRY, vol. 27, 1988, pages 887 - 892 |
| WU; WU, J. BIOL. CHEM., vol. 262, 1987, pages 4429 - 4432 |
| XU ET AL., MOL THER, vol. 24, 2016, pages 564 - 569 |
| YAMAUCHI-TAKIHARA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, no. 10, 1989, pages 3504 - 3508 |
| YANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 9568 - 9572 |
| YIN ET AL., NAT BIOTECHNOL, vol. 32, 2014, pages 551 - 553 |
| YIN ET AL., PHYSIOL REV, vol. 93, 2013, pages 23 - 67 |
| YOUNG ET AL., CELL STEM CELL, vol. 18, 2016, pages 533 - 540 |
| YU ZHANG ET AL: "CRISPR-Cpf1 correction of muscular dystrophy mutations in human cardiomyocytes and mice", SCIENCE, vol. 3, no. 4, 12 April 2017 (2017-04-12), pages e1602814, XP055454449, ISSN: 0036-8075, DOI: 10.1126/sciadv.1602814 * |
| YUTZEY ET AL., MOL. CELL. BIOL., vol. 9, 1989, pages 1397 |
| ZECHNER ET AL., CELL METABOLISM, vol. 12, 2010, pages 633 - 642 |
| ZELENIN ET AL., FEBS LETT., vol. 280, 1991, pages 94 - 96 |
| ZETSCHE ET AL., CELL, vol. 163, 2015, pages 759 - 771 |
| ZIOBER; KRAMER, J. BIO. CHEM., vol. 271, no. 37, 1996, pages 22915 - 22922 |
Cited By (119)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12006520B2 (en) | 2011-07-22 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US20210040460A1 (en) | 2012-04-27 | 2021-02-11 | Duke University | Genetic correction of mutated genes |
| US11976307B2 (en) | 2012-04-27 | 2024-05-07 | Duke University | Genetic correction of mutated genes |
| US12215345B2 (en) | 2013-03-19 | 2025-02-04 | Duke University | Compositions and methods for the induction and tuning of gene expression |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US12559737B2 (en) | 2013-09-06 | 2026-02-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US12473573B2 (en) | 2013-09-06 | 2025-11-18 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US12584118B2 (en) | 2013-09-06 | 2026-03-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US12215365B2 (en) | 2013-12-12 | 2025-02-04 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US12398406B2 (en) | 2014-07-30 | 2025-08-26 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US12215366B2 (en) | 2015-02-09 | 2025-02-04 | Duke University | Compositions and methods for epigenome editing |
| US11970710B2 (en) | 2015-10-13 | 2024-04-30 | Duke University | Genome engineering with Type I CRISPR systems in eukaryotic cells |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US12043852B2 (en) | 2015-10-23 | 2024-07-23 | President And Fellows Of Harvard College | Evolved Cas9 proteins for gene editing |
| US12344869B2 (en) | 2015-10-23 | 2025-07-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11987809B2 (en) | 2015-11-13 | 2024-05-21 | Avellino Lab Usa, Inc. | Methods for the treatment of corneal dystrophies |
| US12214054B2 (en) | 2015-11-30 | 2025-02-04 | Duke University | Therapeutic targets for the correction of the human dystrophin gene by gene editing and methods of use |
| US12428631B2 (en) | 2016-04-13 | 2025-09-30 | Duke University | CRISPR/Cas9-based repressors for silencing gene targets in vivo and methods of use |
| EP3487523A4 (en) * | 2016-07-19 | 2020-09-02 | Duke University | THERAPEUTIC APPLICATIONS OF THE CPF1-BASED GENOME EDITION |
| EP4275747A3 (en) * | 2016-07-19 | 2024-01-24 | Duke University | Therapeutic applications of cpf1-based genome editing |
| US12214056B2 (en) | 2016-07-19 | 2025-02-04 | Duke University | Therapeutic applications of CPF1-based genome editing |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11999947B2 (en) | 2016-08-03 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US12084663B2 (en) | 2016-08-24 | 2024-09-10 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US12516308B2 (en) | 2017-03-09 | 2026-01-06 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US12435331B2 (en) | 2017-03-10 | 2025-10-07 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US12359218B2 (en) | 2017-07-28 | 2025-07-15 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12509492B2 (en) | 2018-01-19 | 2025-12-30 | Duke University | Genome engineering with CRISPR-Cas systems in eukaryotes |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| US12005124B2 (en) | 2018-08-02 | 2024-06-11 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11795233B2 (en) | 2018-08-02 | 2023-10-24 | Dyne Therapeutics, Inc. | Muscle-targeting complex comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US12357703B2 (en) | 2018-08-02 | 2025-07-15 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping |
| US11633496B2 (en) | 2018-08-02 | 2023-04-25 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11497815B2 (en) | 2018-08-02 | 2022-11-15 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11795234B2 (en) | 2018-08-02 | 2023-10-24 | Dyne Therapeutics, Inc. | Methods of producing muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US11369689B2 (en) | 2018-08-02 | 2022-06-28 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12428487B2 (en) | 2018-08-02 | 2025-09-30 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonicleotide and method of delivering oligonucleotide to a subject |
| US12263225B2 (en) | 2018-08-02 | 2025-04-01 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of use thereof to target dystrophin and to treat Duchenne muscular dystrophy |
| US12325753B2 (en) | 2018-08-02 | 2025-06-10 | Dyne Therapeutics, Inc. | Method of using an anti-transferrin receptor antibody to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy |
| US11833217B2 (en) | 2018-08-02 | 2023-12-05 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12012460B2 (en) | 2018-08-02 | 2024-06-18 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US11787869B2 (en) | 2018-08-02 | 2023-10-17 | Dyne Therapeutics, Inc. | Methods of using muscle targeting complexes to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy or a disease associated with muscle weakness |
| US11248056B1 (en) | 2018-08-02 | 2022-02-15 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11168141B2 (en) | 2018-08-02 | 2021-11-09 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12478687B2 (en) | 2018-08-02 | 2025-11-25 | Dyne Therapeutics, Inc. | United states |
| US12329825B1 (en) | 2018-08-02 | 2025-06-17 | Dyne Therapeutics, Inc. | Muscle targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping of exon 44 of dystrophin in a subject |
| US12173079B2 (en) | 2018-08-02 | 2024-12-24 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| JP7395159B2 (ja) | 2018-12-11 | 2023-12-11 | 国立大学法人京都大学 | ゲノムdnaに欠失を誘導する方法 |
| US12522818B2 (en) | 2018-12-11 | 2026-01-13 | The University Of Osaka | Method for inducing deletion in genomic DNA |
| JPWO2020122104A1 (ja) * | 2018-12-11 | 2021-10-21 | 国立大学法人京都大学 | ゲノムdnaに欠失を誘導する方法 |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| WO2020165768A1 (en) * | 2019-02-12 | 2020-08-20 | Università Degli Studi Di Trento | Cas12a guide rna molecules and uses thereof |
| CN113614231A (zh) * | 2019-02-12 | 2021-11-05 | 特伦托大学 | CAS12a向导RNA分子及其用途 |
| US20220145305A1 (en) * | 2019-02-12 | 2022-05-12 | Universita' Degli Studi Di Trento | CAS12a GUIDE RNA MOLECULES AND USES THEREOF |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12509680B2 (en) | 2019-03-19 | 2025-12-30 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12281303B2 (en) | 2019-03-19 | 2025-04-22 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12570972B2 (en) | 2019-03-19 | 2026-03-10 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| JP2022526669A (ja) * | 2019-04-12 | 2022-05-25 | デューク ユニバーシティ | ジストロフィン機能を修復するためのCRISPR/Casをベースにした塩基編集組成物 |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| WO2020225754A1 (en) * | 2019-05-06 | 2020-11-12 | Mcmullen Tara | Crispr gene editing for autosomal dominant diseases |
| CN111718964A (zh) * | 2019-08-01 | 2020-09-29 | 广东赤萌医疗科技有限公司 | 用于修复dmd基因突变的核酸序列及系统 |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| WO2021216674A1 (en) * | 2020-04-24 | 2021-10-28 | University Of Massachusetts | Improved cas 12a/nls mediated therapeutic gene editing platforms |
| US12031126B2 (en) | 2020-05-08 | 2024-07-09 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| WO2022056000A1 (en) * | 2020-09-09 | 2022-03-17 | Vertex Pharmaceuticals Incorporated | Compositions and methods for treatment of duchenne muscular dystrophy |
| WO2022140340A1 (en) * | 2020-12-22 | 2022-06-30 | Vertex Pharmaceuticals Incorporated | Compositions comprising an rna guide targeting dmd and uses thereof |
| WO2022251181A1 (en) * | 2021-05-25 | 2022-12-01 | The Board Of Regents Of The University Of Texas System | Correction of duchenne muscular dystrophy mutations with all-in-one adeno-associated virus-delivered single-cut crispr |
| US11771776B2 (en) | 2021-07-09 | 2023-10-03 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11679161B2 (en) | 2021-07-09 | 2023-06-20 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy |
| US12397062B2 (en) | 2021-07-09 | 2025-08-26 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11986537B2 (en) | 2021-07-09 | 2024-05-21 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12440575B2 (en) | 2021-07-09 | 2025-10-14 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12144868B2 (en) | 2021-07-09 | 2024-11-19 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12239716B2 (en) | 2021-07-09 | 2025-03-04 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11844843B2 (en) | 2021-07-09 | 2023-12-19 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy |
| US12239717B2 (en) | 2021-07-09 | 2025-03-04 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12329824B1 (en) | 2021-07-09 | 2025-06-17 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12144867B2 (en) | 2021-07-09 | 2024-11-19 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12403203B2 (en) | 2021-07-09 | 2025-09-02 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12128109B2 (en) | 2021-07-09 | 2024-10-29 | Dyne Therapeutics, Inc. | Muscle targeting complexes and formulations for treating dystrophinopathies |
| EP4215614A1 (en) | 2022-01-24 | 2023-07-26 | Dynacure | Combination therapy for dystrophin-related diseases |
| WO2023172927A1 (en) * | 2022-03-08 | 2023-09-14 | Vertex Pharmaceuticals Incorporated | Precise excisions of portions of exon 44, 50, and 53 for treatment of duchenne muscular dystrophy |
| US12098399B2 (en) | 2022-06-24 | 2024-09-24 | Tune Therapeutics, Inc. | Compositions, systems, and methods for epigenetic regulation of proprotein convertase subtilisin/kexin type 9 (PCSK9) gene expression |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110382695A (zh) | 2019-10-25 |
| US20200046854A1 (en) | 2020-02-13 |
| MX2019006157A (es) | 2019-11-21 |
| JP2019536782A (ja) | 2019-12-19 |
| AU2017364106A1 (en) | 2019-06-20 |
| CA3044531A1 (en) | 2018-05-31 |
| EP3545090A1 (en) | 2019-10-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200046854A1 (en) | Prevention of muscular dystrophy by crispr/cpf1-mediated gene editing | |
| US20220072156A1 (en) | Prevention of muscular dystrophy by crispr/cas9-mediated gene editing | |
| US10687520B2 (en) | Generation and correction of a humanized mouse model with a deletion of dystrophin exon 44 | |
| EP3565897B1 (en) | Optimized strategy for exon skipping modifications using crispr/cas9 with triple guide sequences | |
| US20200370042A1 (en) | Compositions and methods for correcting dystrophin mutations in human cardiomyocytes | |
| US20190364862A1 (en) | Dmd reporter models containing humanized duchenne muscular dystrophy mutations | |
| US20210261962A1 (en) | Correction of dystrophin exon 43, exon 45, or exon 52 deletions in duchenne muscular dystrophy | |
| US20200260698A1 (en) | Exon deletion correction of duchenne muscular dystrophy mutations in the dystrophin actin binding domain 1 using crispr genome editing | |
| EP3735462A1 (en) | Therapeutic crispr/cas9 compositions and methods of use | |
| Class et al. | Patent application title: PREVENTION OF MUSCULAR DYSTROPHY BY CRISPR/CAS9-MEDIATED GENE EDITING Inventors: Eric N. Olson (Dallas, TX, US) Eric N. Olson (Dallas, TX, US) Chengzu Long (Dallas, TX, US) John R. Mcanally (Dallas, TX, US) John M. Shelton (Dallas, TX, US) Rhonda Bassel-Duby (Dallas, TX, US) | |
| OA20296A (en) | Optimized strategy for exon skipping modifications using CRISPR/CAS9 with triple guide sequences. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17817498 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3044531 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2019528478 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2017364106 Country of ref document: AU Date of ref document: 20171128 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2017817498 Country of ref document: EP Effective date: 20190628 |