WO2018079997A1 - 암 치료용 무당화 항체 Fc 영역 - Google Patents

암 치료용 무당화 항체 Fc 영역 Download PDF

Info

Publication number
WO2018079997A1
WO2018079997A1 PCT/KR2017/009153 KR2017009153W WO2018079997A1 WO 2018079997 A1 WO2018079997 A1 WO 2018079997A1 KR 2017009153 W KR2017009153 W KR 2017009153W WO 2018079997 A1 WO2018079997 A1 WO 2018079997A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
domain
amino acid
antibody
acid substitutions
Prior art date
Application number
PCT/KR2017/009153
Other languages
English (en)
French (fr)
Inventor
정상택
조미경
Original Assignee
국민대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020160141118A external-priority patent/KR101883886B1/ko
Priority claimed from KR1020160148002A external-priority patent/KR101900384B1/ko
Application filed by 국민대학교 산학협력단 filed Critical 국민대학교 산학협력단
Priority to AU2017348982A priority Critical patent/AU2017348982B2/en
Priority to GB1907421.0A priority patent/GB2571036B/en
Priority to DE112017005457.5T priority patent/DE112017005457T5/de
Priority to US16/345,062 priority patent/US11414493B2/en
Publication of WO2018079997A1 publication Critical patent/WO2018079997A1/ko
Priority to US17/861,920 priority patent/US20220348654A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/283—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against Fc-receptors, e.g. CD16, CD32, CD64
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39591—Stabilisation, fragmentation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B30/00—Methods of screening libraries
    • C40B30/04—Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/40—Immunoglobulins specific features characterized by post-translational modification
    • C07K2317/41—Glycosylation, sialylation, or fucosylation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52—Constant or Fc region; Isotype
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • the present invention relates to aglycosylated antibody Fc regions useful for the treatment of cancer and methods of making the same.
  • the therapeutic antibody is considered to be one of the most effective cancer treatment methods because it shows very high specificity to the target compared to the existing low molecular weight drugs, low biotoxicity and fewer side effects, and excellent blood half-life of about three weeks.
  • major pharmaceutical companies and research institutes around the world are speeding up research and development of therapeutic antibodies that specifically bind to and effectively eliminate cancer cells, including cancer-causing agents.
  • Pharmaceutical companies such as Roche, Amgen, Johnson & Johnson, Abbott, and BMS are the main development companies for therapeutic antibody medicines.
  • Roche is a herceptin, Avastin and Rituxan for anticancer treatment.
  • the three major therapeutic antibodies which generate revenues of approximately $ 19.5 billion in 2012, are leading the world's antibody market.
  • the Fc domain of the antibody plays a crucial role in the recruitment of immune cells and antibody-dependent cell-mediated cytotoxicity (ADCC).
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • FcR Fc receptor
  • the antibody of a mammal in which the Fc region is modified has an increased binding capacity to a specific Fc receptor, there is a problem of maintaining an undesirable immune response because it also maintains the binding strength to other Fc receptors.
  • Fc ⁇ Rs There are five major Fc ⁇ Rs in humans. Four of these receptors induce an immune activation or inflammatory response, and Fc ⁇ RIIb induces an immune inhibitory or anti-inflammatory response, with most naturally produced antibodies or recombinant glycosylated antibodies binding to both activated and inhibitory Fc receptors.
  • ADCC inducibility of an antibody depends on the ratio of the ability to bind activating Fc ⁇ R to the inhibitory Fc ⁇ RIIb (A / I ratio) (Boruchov et al, J Clin Invest , 115 (10): 2914-23, 2005) .
  • a / I ratio the ratio of the ability to bind activating Fc ⁇ R to the inhibitory Fc ⁇ RIIb
  • NK cells natural killer cells
  • NK cells are known to have the most potent cancer cell killing effects among various immune cells involved in cancer cell killing mechanisms using therapeutic IgG antibodies currently used in clinical trials.
  • NK cells express Fc ⁇ RIIIa on the surface and Fc ⁇ RI and Fc ⁇ RIIa, Fc ⁇ RIIb and Fc ⁇ RIIIb do not express them. Therefore, in order to maximize cancer cell killing mechanism to differentiate from the existing therapeutic antibody, it is essential to improve the affinity with Fc ⁇ RIIIa expressed on the surface of NK cell through optimization of Fc region of IgG antibody.
  • the present inventors have made diligent efforts to develop aglycosylated antibodies which have no heterogeneous problems of existing glycosylated antibodies and have improved binding ability with Fc ⁇ RIIIa expressed on the surface of NK cells.
  • the binding ability to Fc ⁇ RIIIa in the Fc receptor is significantly improved, thereby confirming that the cancer cell killing effect of NK cells is increased, thereby completing the present invention.
  • Another object of the present invention to provide an aglycosylated antibody comprising the polypeptide.
  • Still another object of the present invention is to provide a nucleic acid molecule encoding the polypeptide.
  • Still another object of the present invention is to provide a vector containing the nucleic acid molecule.
  • Another object of the present invention to provide a host cell comprising the vector.
  • Still another object of the present invention is to provide a composition comprising the polypeptide, aglycosylated antibody, nucleic acid molecule or vector.
  • Still another object of the present invention is to provide a method for preventing or treating cancer, comprising the step of administering the polypeptide, aglycosylated antibody, nucleic acid molecule or vector.
  • Another object of the present invention to provide a method for producing the polypeptide or an aglycosylated antibody.
  • Another object of the present invention is to provide a method for screening a polypeptide comprising an Fc domain that binds to Fc ⁇ RIIIa.
  • the invention provides a polypeptide comprising an Fc domain in which part of the amino acid sequence of a human antibody Fc domain is substituted with another amino acid sequence.
  • the present inventors have made diligent efforts to develop aglycosylated antibodies which have no heterogeneous problems of existing glycosylated antibodies and have improved binding ability with Fc ⁇ RIIIa expressed on the surface of NK cells. As a result, it was confirmed that by selectively substituting some amino acid sequences of wild-type Fc domains with other amino acid sequences, binding ability to Fc ⁇ RIIIa in Fc receptors was greatly improved, thereby increasing the cancer cell killing effect of NK cells.
  • Antibodies are proteins that specifically bind to specific antigens, and natural antibodies are usually about 150,000 Daltons heterodimeric glycoproteins, consisting of two identical light chains (L) and two identical heavy chains (H).
  • the human antibodies used in the present invention have five main classes of IgA, IgD, IgE, IgG and IgM, preferably IgG.
  • Papain digestion of antibodies forms two Fab fragments and one Fc fragment, and in human IgG molecules, the Fc region is produced by papain digesting the N-terminus of Cys 226 (Deisenhofer, Biochemistry 20: 2361-2370, 1981). .
  • the antibody Fc domain may be the Fc domain of an IgA, IgM, IgE, IgD, or IgG antibody, or a modification thereof.
  • the domain is an Fc domain of an IgG antibody (eg, an Fc domain of an IgG1, IgG2a, IgG2b, IgG3, or IgG4 antibody).
  • the Fc domain may be an IgG1 Fc domain (eg, an Fc domain of an antiHER2 antibody, more specifically an Fc domain of trastuzumab).
  • a polypeptide comprising an Fc domain of the present invention may not be glycosylated in its entirety or may be a glycosylated portion of the polypeptide (eg, an Fc domain).
  • the polypeptide may also include one or more regions derived from the antibody in addition to the Fc domain.
  • the polypeptide may include an antigen binding domain derived from an antibody, and a plurality of polypeptides may form an antibody or an antibody-type protein.
  • amino acid residue number of the antibody Fc domain herein is according to the Kabat numbering system commonly used in the art (Kabat et al., In “Sequences of Proteins of Immunological Interest”, 5th Ed., US Department) EU index number as in NIH Publication No. 91-3242, 1991).
  • the substituted Fc domain of the invention comprises the following eight amino acid substitutions according to the Kabat numbering system: S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L.
  • the aglycosylated Fc domain is mutated to bind to at least one of Fc ⁇ RIa, Fc ⁇ RIIa, Fc ⁇ RIIb, Fc ⁇ RIIc, Fc ⁇ RIIIa, Fc ⁇ RIIIb, or Fc ⁇ RI.
  • the mutated glycosylated Fc domain has a binding capacity to any one or more of the Fc receptors within 10%, within 20%, within 30%, within 40%, within 50%, within 60%, and in comparison to the wild type glycated Fc domain.
  • At least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times than the wild-type glycated Fc domain It may be increased by at least 9 times, at least 10 times, or at least 20 times.
  • the Fc domain included in the polypeptide of the present invention is improved binding ability to Fc ⁇ RIIIa compared to the Fc domain not substituted with the eight amino acids.
  • the Fc domain (Fc1004, US Pat. No. 8,952,132) in which only S298G, T299A, N390D, E382V and M428L is substituted does not bind Fc ⁇ RIIIa like wild type Fc domain, and T299A, K326I, A327Y and Fc domains substituted with only L328G (A / IYG, US Pat. No. 8,815,237) also have a weaker increase in binding to Fc ⁇ RIIIa compared to wild type Fc domains. It was confirmed that the binding capacity of the Fc domain including the eight amino acid substitutions of the present invention to Fc ⁇ RIIIa is greatly improved compared to the wild type Fc domain or Fc1004 or A / IYG (Examples 3 and 4).
  • said amino acid substitution of the invention is at least one selected from the group consisting of C226R, F243L, K246E, T250I, I253N, V264E, T307S, C347R, T350A, S400T and N421S according to the Kabat numbering system Additional amino acid substitutions.
  • the Fc domain in which the nine or more amino acids are substituted of the present invention is compared with the Fc domain in which only eight amino acids of S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L are substituted.
  • the binding to Fc ⁇ RIIIa is improved.
  • the Fc domain in which at least 9 amino acids were substituted was found to have a 40% or more increase in binding force to Fc ⁇ RIIIa compared to the Fc domain in which only 8 amino acids were substituted (MG42: At least 40% increase; MG61: at least 50% increase; MG54, MG59 and MG86: at least 200% increase; MG14 and MG87: at least 300% increase; MG48: at least 500% increase, etc .; FIGS. 6A-6C).
  • the substituted Fc domain of the invention comprises the following nine amino acid substitutions according to the Kabat numbering system: S298G, T299A, T307S, K326I, A327Y, L328G, E382V, N390D and M428L.
  • the substituted Fc domain of the invention comprises the following nine amino acid substitutions according to the Kabat numbering system: S298G, T299A, K326I, A327Y, L328G, C347R, E382V, N390D and M428L.
  • the substituted Fc domain of the invention comprises the following ten amino acid substitutions according to the Kabat numbering system: V264E, S298G, T299A, K326I, A327Y, L328G, T350A, E382V, N390D and M428L.
  • the substituted Fc domain of the invention comprises the following ten amino acid substitutions according to the Kabat numbering system: T250I, I253N, S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L.
  • the substituted Fc domain of the invention comprises the following ten amino acid substitutions according to the Kabat numbering system: V264E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D, N421S and M428L.
  • the substituted Fc domain of the invention comprises the following 11 amino acid substitutions according to the Kabat numbering system: V264E, S298G, T299A, K326I, A327Y, L328G, T350A, E382V, N390D, N421S and M428L.
  • the substituted Fc domain of the invention comprises the following 11 amino acid substitutions according to the Kabat numbering system: C226R, F243L, K246E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L.
  • the invention provides an aglycosylated antibody comprising the polypeptide.
  • antibody refers to polyclonal antibodies, monoclonal antibodies, human antibodies, and humanized antibodies and fragments thereof.
  • glycosylated antibodies can be mass-produced in bacteria and have excellent speed and cost.
  • N-linked glycan produced at the amino acid Asn297 of glycosylated antibody plays a decisive role in the structure and function of the antibody.
  • the glycosylated antibody Fc region is different from the glycosylated antibody Fc produced in animal cells. It has a closed structure or a very flexible structure, so that the glycosylated antibody does not bind to Fc ⁇ RIIIa, which plays a crucial role in NK cell recruitment and activation, and shows a mechanism of cancer cell death. You will not.
  • the present invention is free of glycosylation heterogeneity problems and is optimized through optimization of the glycosylated antibody Fc region (substituted with eight amino acids of S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L). It is possible to produce bacteria at cost and maximize the mechanism of cancer cell death through enhanced binding to Fc ⁇ RIIIa expressed on the surface of NK cells.
  • the present invention provides a nucleic acid molecule encoding the polypeptide, a vector comprising the nucleic acid molecule or a host cell comprising the vector.
  • the invention provides a method for producing a polypeptide comprising a human antibody Fc domain comprising the following steps:
  • the present invention provides a method for producing an unglycosylated antibody, comprising the following steps:
  • Nucleic acid molecules of the invention can be isolated or recombinant and include single and double stranded DNA and RNA as well as corresponding complementarity sequences.
  • An “isolated nucleic acid” is a nucleic acid isolated from a naturally occurring source, which is separated from the surrounding genetic sequence present in the genome of the individual from which the nucleic acid is isolated.
  • nucleic acids such as PCR products, cDNA molecules, or oligonucleotides synthesized enzymatically or chemically from a template
  • the nucleic acid resulting from this procedure can be understood as an isolated nucleic acid molecule.
  • Isolated nucleic acid molecules refer to nucleic acid molecules in the form of separate fragments or as components of larger nucleic acid constructs.
  • Nucleic acids are “operably linked” when placed in a functional relationship with other nucleic acid sequences.
  • the DNA of a presequence or secretion leader is operably linked to the DNA of a polypeptide when expressed as a preprotein, which is the form before the polypeptide is secreted, and the promoter or enhancer is a polypeptide sequence. Operably linked to a coding sequence when affecting the transcription of the ribosome binding site, or when the ribosome binding site is arranged to facilitate translation.
  • operably linked means that the DNA sequences to be linked are located contiguously, and in the case of a secretory leader, they are present in the same reading frame adjacently. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction enzyme sites. If such sites do not exist, the synthetic oligonucleotide adapters or linkers are used in accordance with conventional methods.
  • vector refers to a carrier capable of inserting a nucleic acid sequence for introduction into a cell capable of replicating the nucleic acid sequence.
  • Nucleic acid sequences can be exogenous or heterologous.
  • Vectors include, but are not limited to, plasmids, cosmids and viruses (eg bacteriophages).
  • plasmids include, but are not limited to, plasmids, cosmids and viruses (eg bacteriophages).
  • viruses eg bacteriophages.
  • One skilled in the art can construct vectors by standard recombinant techniques (Maniatis, et al., Molecular Cloning , A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY, 1988; and Ausubel et al., In: Current Protocols in Molecular Biology , John, Wiley & Sons, Inc, NY, 1994, etc.).
  • expression vector refers to a vector comprising a nucleic acid sequence encoding at least a portion of a gene product to be transcribed. In some cases, RNA molecules are then translated into proteins, polypeptides, or peptides. Expression vectors can include various regulatory sequences. In addition to regulatory sequences that regulate transcription and translation, vectors and expression vectors can also include nucleic acid sequences that provide additional functionality.
  • the term “host cell” refers to any transgenic organism that includes eukaryotes and prokaryotes and is capable of replicating the vector or expressing a gene encoded by the vector.
  • the host cell may be transfected or transformed by the vector, which means a process in which exogenous nucleic acid molecules are delivered or introduced into the host cell.
  • the host cell of the present invention is a bacterial cell, more preferably a Gram negative bacterial cell.
  • the cells are suitable for the practice of the present invention in that they have a periplasmic region between the inner membrane and the outer membrane.
  • Examples of preferred host cells of the present invention include E. coli , Pseudomonas aeruginosa , Vibrio cholera , Salmonella typhimurium , Shigella flexneri , Haemophilus influenza , Bordotella pertussi , Erwinia amylovora , Rhizobium sp . And the like, but are not limited thereto.
  • purification of the antibody may include filtration, HPLC, anion exchange or cation exchange, high performance liquid chromatography (HPLC), affinity chromatography, or a combination thereof, preferably Protein Affinity chromatography using A can be used.
  • the invention provides a method for screening a polypeptide comprising an Fc domain that binds to Fc ⁇ RIIIa comprising the following steps:
  • Substituted Fc domains of the present invention may include additional amino acid substitutions in addition to the eight amino acid substitutions described above.
  • the invention is directed to a method for screening a polypeptide comprising an Fc domain that binds to Fc ⁇ RIIIa comprising the following steps:
  • Fc libraries were constructed using bacterial cells (preferably E. coli), from which variants with high affinity with Fc ⁇ RIIIa were selected (Examples 5 and 6).
  • Additional amino acid substitutions of the Fc domain are not particularly limited and are preferably selected from the group consisting of amino acids 226, 243, 246, 250, 253, 264, 307, 347, 350, 400 and 421 according to the Kabat numbering system
  • One or more additional amino acid substitutions more preferably one or more additional amino acid substitutions selected from the group consisting of C226R, F243L, K246E, T250I, I253N, V264E, T307S, C347R, T350A, S400T and N421S.
  • the screening methods of the present invention can use fluorescence labeled cell separation (FACS) screening, or other automated flow cytometry techniques.
  • FACS fluorescence labeled cell separation
  • Instruments for performing flow cytometry are known to those skilled in the art. Examples of such devices are FACSAria, FACS Star Plus, FACScan and FACSort devices (Becton Dickinson, Foster City, CA), Epics C (Coulter Epics Division, Hialeah, FL), MOFLO (Cytomation, Colorado Springs, Colo.), MOFLO- XDP (Beckman Coulter, Indianapolis, IN).
  • Flow cytometry techniques generally include the separation of cells or other particles in a liquid sample.
  • a flow cytometer typically the purpose of a flow cytometer is to analyze the separated particles for their one or more properties (eg the presence of labeled ligands or other molecules). Particles are passed one by one by the sensor and are classified based on size, refraction, light scattering, opacity, roughness, shape, fluorescence, and the like.
  • the present invention provides a composition comprising a polypeptide comprising the Fc domain comprising the amino acid substitution, a nucleic acid molecule encoding the same, a vector comprising the same, a glycosylated antibody comprising the polypeptide to provide.
  • the composition of the present invention is a pharmaceutical composition for the prevention or treatment of cancer.
  • the pharmaceutical composition of the present invention comprises (a) the polypeptide, aglycosylated antibody, nucleic acid molecule or vector; And (b) a pharmaceutically acceptable carrier.
  • the present invention provides a method for preventing or treating cancer, comprising administering to the subject a pharmaceutically effective amount of the polypeptide, aglycosylated antibody, nucleic acid molecule or vector.
  • the present invention provides a polypeptide comprising an Fc domain comprising the amino acid substitution, a nucleic acid molecule encoding the same, a vector comprising the same, a cancer comprising a glycosylated antibody comprising the polypeptide.
  • a pharmaceutical composition for prophylaxis or treatment is provided.
  • the pharmaceutical composition of the present invention comprises (a) the polypeptide, aglycosylated antibody, nucleic acid molecule or vector; And (b) a pharmaceutically acceptable carrier.
  • the type of cancer to be prevented or treated by the present invention is not limited, leukemias and acute lymphocytic leukemia, acute nonlymphocytic leukemias, chronic lymphocytic leukemia, chronic lymphocytic leukemia Lymphomas, brain tumors, neuroblastoma, such as myelogenous leukemia, Hodgkin's Disease, non-Hodgkin's lymphomas, and multiple myeloma Childhood solid tumors such as retinoblastoma, Wilms Tumor, bone tumors and soft-tissue sarcomas, lung cancer, breast cancer cancer, prostate cancer, urinary cancers, uterine cancers, oral cancers, pancreatic cancer, melanoma and other skin cance rs, stomach cancer, ovarian cancer, brain tumors, liver cancer, laryngeal cancer, thyroid cancer, esophageal cancer and testicular cancer It may be administered to treat a number of cancers, including common solid tumors of adults
  • Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation, such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like It doesn't happen.
  • the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • a lubricant e.g., talc, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, a kaolin, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mann
  • compositions of the present invention may be administered orally or parenterally, preferably parenterally, for example, by intravenous infusion, topical infusion and intraperitoneal infusion.
  • Suitable dosages of the pharmaceutical compositions of the invention vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, condition of food, time of administration, route of administration, rate of excretion and response to reaction, Usually a skilled practitioner can easily determine and prescribe a dosage effective for the desired treatment or prophylaxis.
  • the daily dose of the pharmaceutical composition of the present invention is 0.0001-100 mg / kg.
  • compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container.
  • the formulation may be in the form of a solution, suspension or emulsion in an oil or an aqueous medium, or may be in the form of extracts, powders, granules, tablets or capsules, and may further include a dispersant or stabilizer.
  • the pharmaceutical composition of the present invention may be used as a single therapy, but may also be used in combination with other conventional chemotherapy or radiation therapy, and when the combination therapy is performed, cancer treatment may be more effectively performed.
  • Chemotherapeutic agents that can be used with the compositions of the present invention are cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, phospho Ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, diactinomycin, daunorubicin, doxorubicin , Bleomycin, plecomycin, mitomycin, etoposide, tamoxifen, taxol, transplatinum, 5-fluoro 5-fluorouracil, vincristin, vinblastin, methotrexate, and the like.
  • Radiation therapy that can be used with the composition of the present invention is X-ray irradiation and ⁇ -ray irradiation and the
  • the present invention provides a polypeptide comprising an Fc domain in which part of an amino acid sequence of a human antibody Fc domain is substituted with another amino acid sequence, or a glycosylated antibody comprising the same.
  • the present invention also provides a method for producing the polypeptide or an aglycosylated antibody.
  • the Fc domain of the present invention has excellent selective binding ability to Fc ⁇ RIIIa in the Fc receptor by optimizing the substitution of some amino acid sequences of the wild-type Fc domain with other amino acid sequences, and is useful for the treatment of cancer. It can be prepared as an antibody.
  • FIG. 1 shows the purification (left, SDS-PAGE) photograph of Tetrameric Fc ⁇ RIIIa and the result of ELISA (right) experiment for confirmation of activity.
  • Figure 2 shows the results of ELISA experiments to confirm the activity after tetrameric Fc ⁇ RIIIa fluorescent labeling using Alexa 488 Flour.
  • FIG. 3 shows a graph comparing the binding force of A / IYG with Fc1004 to Fc ⁇ RIIIa.
  • FIG. 5 shows a schematic diagram for constructing aglycosylated antibody Fc library based on Fc1004-IYG.
  • Figure 6 shows a graph comparing the binding capacity of Fc ⁇ RIIIa high affinity Fc variants discovered by library screening using flow cytometry (a and b: comparison of wild type, A / IYG, Fc1004-IYG, MG42, MG59, MG87 and MG48 c: comparison of wild type, A / IYG, Fc1004-IYG, MG61, MG86, MG54 and MG14).
  • Figure 7 shows the photos confirmed by SDS-PAGE of the soluble expression and purification of the excavated variants and controls (wild type, A / IYG).
  • FIG. 9 is a graph showing SPR analysis of the variants (a. Binding Analysis for Fc ⁇ RIIIa (V158). B. Binding Analysis for Fc ⁇ RIIIa (F158)).
  • Figure 10 shows the results confirming the degree of HER2 expression of MCF-7 and SKBR-3.
  • Figure 12 shows the results of analyzing the cancer cell killing effect of each variant using human PBMC, SKBR-3, MCF-7.
  • Example One Unsugared Full-length antibodies IgG Bacteria in the form Display on Intimacy for Fc Variant Cloning (A / IYG , Fc1004 - IYG )
  • Each Fc variant was prepared as a heavy chain plasmid for full-length IgG display of A / IYG (US Pat. No. 8,815,237) variant and Fc1004-IYG.
  • Two fragments are primer MJ # 36, MJ # 37 by using a PCR assembly process, and Sfi I (New England Biolab) cut , T4 DNA ligase (invitrogen) proceed with the ligation and then using the process pMopac12-PelB-VH-CH1- CH2-CH3 (T299A) -FLAG plasmid was prepared.
  • This plasmid was used as a template, and 326 IYG substitution was performed using the primers MJ # 36, MJ # 39 / MJ # 38, and MJ # 37 in the same manner as described above (pMopac12-PelB-VH-CH1-CH2-CH3 (A / IYG). -Made by FLAG).
  • pMAZ-Fc ⁇ RIIIa V158
  • pMAZ-Fc ⁇ RIIIa V158
  • pMAZ-Fc ⁇ RIIIa V158
  • pMAZ-Fc ⁇ RIIIa V158
  • pMAZ-Fc ⁇ RIIIa V158
  • pMAZ-Fc ⁇ RIIIa V158
  • pMAZ-Fc ⁇ RIIIa V158
  • pMAZ-Fc ⁇ RIIIa FLAG-Streptavidin-His plasmid
  • Purified protein was subjected to ELISA to confirm its activity through binding with Rituxan (Roche), and then 1 mg of the protein was fluorescently labeled using Alexa Fluor 488 Protein Labeling Kit (Thermo Fisher Scientific). Activity after fluorescence labeling was analyzed by ELISA (FIG. 2). As a result, a highly purified tetrameric Fc ⁇ RIIIa was successfully prepared, and the protein activity was maintained even after the Alexa 488 flour fluorescent material was labeled.
  • the clones to be analyzed were pMopac12-PelB-VH-CH1-CH2-CH3 (wild type) -FLAG, pMopac12-PelB-VH-CH1-CH2-CH3 (Fc1004) -FLAG, pMopac12-PelB-VH -CH1-CH2-CH3 (A / IYG) so -FLAG type E.
  • pMopac12-PelB-VH-CH1-CH2-CH3 (IYG) -FLAG was expressed in pBAD30-Km-PelB-VL in E. coli Jude 1 cells. Transformation was performed with the -Ck-NlpA-VL-Ck-His-cMyc plasmid so that heavy and light chains could be expressed in the periplasmic region, respectively. After incubation at 37 ° C.
  • the outer membrane was removed by resuspension with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] and rotation at 37 ° C. for 30 minutes. After discarding the supernatant by centrifugation, 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl 2 , 10 mM MOPS pH 6.8] was added, followed by resuspension and centrifugation. 1 ml of a solution containing 1 ml of Solution A and 20 ⁇ l of 50 mg / ml lysozyme solution was added and resuspensioned, followed by rotation at 37 ° C.
  • STE 0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)
  • the fluorescence signal intensity of Fc1004-IYG was 199.85, which is 8.4 times higher than that of wild type (23.92), indicating that A / IYG (41.24, wild type) showed the highest affinity to Fc ⁇ RIIIa among the known glycosylated antibody Fc variants. 1.7 times higher than that of Fc1004-IYG.
  • Example 5 Construction of aglycosylated antibody library based on Fc1004-IYG
  • the Fab (VH-CH1) part is conventional PCR using primers MJ # 36, MJ # 44 and Vent polymerase, and then assembles the Fab fragment and Fc fragment using the primers MJ # 36 and MJ # 46.
  • PCR was performed to prepare a whole heavy chain PCR product.
  • the strain was transformed to Jude 1 through Sfi I restriction enzyme treatment and ligation to prepare a deglycosylated antibody Fc library in the form of a heavy chain (library size: 1.14 x 10 9 , experimental error rate: 0.457%).
  • the gene was obtained from this library and transformed back into Jude 1 cells transformed with pBAD30-Km-PelB-VL-Ck-NlpA-VL-Ck-His-cMyc. Was constructed (FIG. 5).
  • Example 6 built libraries Flow cell Screen the analyzer and screen for variants such as MG42, MG48, MG59, MG87 (check binding for Fc ⁇ RIIIa)
  • Fc variant Point mutation A / IYG SEQ ID NO: 5 T299A, K326I, A327Y, L328G Fc1004 (SEQ ID NO: 3) S298G, T299A, E382V, N390D, M428L Fc1004-IYG (SEQ ID NO: 7) S298G, T299A, K326I, A327Y, L328G, E382V, N390D, M428L MG42 (SEQ ID NO: 9) (Fc1004-IYG) + 264E, 350A, 421S MG48 (SEQ ID NO: 11) (Fc1004-IYG) + 264E, 350A MG59 (SEQ ID NO: 13) (Fc1004-IYG) + 264E MG87 (SEQ ID NO: 15) (Fc1004-IYG) + 264E, 421S
  • the variants (MG61: (Fc1004-IYG) + T307S, MG86: (Fc1004-IYG) + C226R + F243L + K246E MG54: (Fc1004-IYG)) showed higher affinity with Fc ⁇ RIIIa than A / IYG. + T250I + I253N and MG14: (Fc1004-IYG) + C347R) were selected (FIG. 6C).
  • HEK 293F cells were co-transfected with pMAZ-IgL plasmid and transiently expressed on a 300 ml scale. The culture was terminated by centrifugation at 7000 rpm for 10 minutes, the supernatant was taken and equilibrated with 25x PBS. Filter using a bottle top filter with a 0.2 ⁇ m filter (Merck Millipore). A 1 ml slurry of Protein A agarose (Genscript) equilibrated with PBS was added, stirred at 4 ° C. for 16 hours and then flowed into a polypropylene column (Thermo Fisher Scientific).
  • the binding force of trastuzumab variants was measured using BIAcore T200 (GE Healthcare). Wild-type glycosylated antibody (Aglyco-T), A / IYG, wild-type glycosylated antibody (Glyco-T; produced through HEK 293F cell culture), and Herceptin (a clinical drug produced in CHO cells, MG48, MG59, respectively) using amine coupling Immobilized on CM5 chip, and dimeric Fc ⁇ RIIIa-V158-GST, Fc ⁇ RIIa-F158- using HBS-EP buffer (10 mM HEPES pH 7.4, 150 mM NaCl, 3.4 mM EDTA, and 0.005% P20 surfactant) (GE Healthcare) The binding force was analyzed by injecting GST (FIG.
  • CM5 chip was performed sequentially using 50 mM glycine pH 3.9, 50 mM glycine pH 9.5, and 3 M NaCl equilibrium dissociation constants (K) of monovalent receptor binding.
  • D The 2: 1 bivalent analyte model of BIAevaluation 3.2 software (GE Healthcare) was used to calculate D ) (Table 3).
  • Example 10 Experiment confirming the degree of HER2 expression of SKBR-3 and MCF-7, which are target cells
  • Cells (80% confluency) cultured in a 100 mm dish were incubated in 37 ° C. CO 2 incubator for 2-3 minutes by treatment with 1.5 ml of Accutase (Merck Millipore) after removing the culture medium and washing once with DPBS. After confirming that the cells fell from the bottom of the dish, 6 ml of cell culture medium was added. Using a 10 ml pipette, take all the solution including the cells, place it in a 15 ml tube, centrifuge at 1200 rpm for 3 minutes, remove all solutions in the 15 ml tube, mix 5 ml of DPBS in a 15 ml tube and mix well with the cells. After centrifugation at 1200 rpm for 3 minutes.
  • washing buffer was dispensed into the FACS tube and mixed well with the cells. Except for non-staining, 1 ⁇ g of isotype control and trastuzumab-alexa488 were added. After blocking with aluminum foil, the antibody was allowed to proceed at 4 ° C. for 30 minutes, and when the reaction was completed, the supernatant was removed, leaving only the cells by centrifugation. Washing buffer was added to 1 ml each and the washing process was repeated three times. 300 ⁇ l of Running Buffer (PBS) was added to each tube and mixed well with the cells, followed by FACS analysis.
  • PBS Running Buffer
  • SKBR-3 shows much higher HER2 expression than MCF-7 (FIG. 10). Therefore, in evaluating ADCC activity of antibody samples targeting HER2, SKBR-3, which has higher expression of HER2 than MCF-7, was identified as a more suitable target cell.
  • Example 11 ADCC for Effector cell ( PBMC ): Target cell ( SKBR -3, MCF - 7) Preliminary experiment for rate determination
  • PBMC PBMC (CTL, Table 4) was treated with DNase I at room temperature for 30 minutes by quick thawing in a 37 ° C. water bath, cells were counted, and the appropriate number of PBMCs were added according to the ratio per well.
  • Target cell ratio was 1.5625: 1, 3.125: 1, 6.25: 1, 12.5: 1, 25: 1, and centrifuged at 100xg for 1 minute, followed by 4 hours in 37 °C, CO 2 incubator. Incubated for After 4 hours, the plate was centrifuged at 300xg for 3 minutes, 50 ⁇ l of the supernatant was transferred to a SpectraPlate-96-well plate (PerkinElmer), and 50 ⁇ l of CytoTox 96 ® Reagent (Promega) was added to each well. Incubation at room temperature for minutes. 50 ⁇ l of Stop solution was added to terminate the reaction, and the absorbance was measured at 490 nm. The procedure was repeated three times with duplicates and the average value was taken.
  • ADCB assay using SKBR-3 (1 X 10 4 cells / well) with high HER2 expression as a target cell and PBMC as an effector cell showed an increase in effector cell number-dependent cytotoxicity, and MCF with low HER2 expression.
  • the effector cell number-dependent cytotoxicity was increased, but the increase rate was low compared to SKBR-3 having high HER2 expression (FIG. 11).
  • the cytotoxicity of SKBR-3 with high HER2 expression was higher than that of MCF-7 with low HER2 expression, indicating that cytotoxicity is HER2-specific, and considering the difference in distribution of Fc ⁇ RIIIa F / V variant of PBMCs used as effector cells.
  • the effector cell: target cell ratio for the evaluation of ADCC activity was found to be appropriate to use at least 25: 1 (Table 5).
  • Example 12 Comparative Evaluation of ADCC Activity of Herceptin Variants Using Human PBMC
  • SKBR-3 and MCF-7 Incubate SKBR-3 and MCF-7 and seed them in 96-well plates (V-bottom) at 1 x 10 4 cells / 50 ⁇ l per well, and then test materials 0, 0.032, 0.16, 0.8, 4, 20 10 ⁇ l of each well was added at ⁇ g / ml.
  • PBMC pooled five individual PBMCs and quick thawing in a 37 °C water bath, and then treated with DNase I for 30 minutes at room temperature. Cells were counted, 2.5 x 10 5 cells / 50 ⁇ l of PBMC were added to each well, and then the plate was centrifuged at 100xg for 1 minute and the reaction was performed by incubating for 4 hours in a 37 ° C CO 2 incubator.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Oncology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 인간 항체 Fc 도메인의 아미노산 서열 중 일부가 다른 아미노산 서열로 치환된 Fc 도메인을 포함하는 폴리펩타이드 또는 이를 포함하는 무당화 항체에 관한 것이다. 본 발명의 Fc 도메인은 야생형 Fc 도메인의 일부 아미노산 서열을 다른 아미노산 서열로 치환하여 최적화함으로써 Fc 수용체 중 FcγRIIIa에 선택적 결합력이 우수하여 암의 치료에 유용하며, 박테리아 배양을 통해서 균질의 무당화 항체로 제조될 수 있다.

Description

암 치료용 무당화 항체 Fc 영역
본 발명은 암치료에 유용한 무당화 항체 Fc 영역 및 이의 제조방법에 관한 것이다.
전 세계적으로 유전자 재조합, 세포 배양 등 생명공학기술의 발달에 따라 단백질의 구조와 기능에 대한 연구가 활발히 진행되어왔으며, 이는 생명현상에 대한 이해를 높일 뿐만 아니라, 각종 질병들의 발병 기작을 규명하는데 결정적 역할을 함으로써 효과적인 질병 진단과 치료의 길을 마련해 삶의 질 향상에 크게 기여 하고 있다. 특히, 1975년에 B 세포(B Cell)와 골수암 세포(Myeoloma cell)를 융합하여 단일클론항체를 생산하는 하이브리도마 기술(Hybridoma technology)이 개발(Kohler and Milstein, Nature, 256:495-497, 1975)되면서 암, 자가면역질환, 염증, 심혈관 질환, 감염 등의 임상 분야에서 치료용 항체를 이용한 면역 치료(Immunotherapy)에 대한 연구개발이 활발히 이루어지고 있다.
치료용 항체는 기존의 저분자 약물에 비해 타깃에 매우 높은 특이성을 보이며, 생체 독성이 낮고 부작용이 적을 뿐만 아니라, 약 3주의 우수한 혈중 반감기를 가지기 때문에 가장 효과적인 암 치료방법 중의 하나로 여겨지고 있다. 실제로 전 세계의 거대 제약회사들과 연구소들에서 암 발병 원인인자를 비롯한 암세포에 특이적으로 결합하여 효과적으로 제거하는 치료용 항체의 연구 개발에 박차를 가하고 있다. 치료용 항체 의약품 개발 기업으로는 로슈, 암젠, 존슨앤존슨, 애보트, 비엠에스 등의 제약 기업이 주를 이루고 있으며, 특히 로슈는 항암 치료 목적의 허셉틴(Herceptin), 아바스틴(Avastin), 리툭산(Rituxan) 등이 대표적 상품으로 이 세 가지 치료용 항체로 2012년 세계시장에서 약 195억 달러의 매출을 달성하는 등 큰 이윤을 창출하고 있을 뿐 아니라, 세계의 항체 의약품 시장을 이끌고 있다. 레미케이드(Remicade)를 개발한 존슨앤존슨 역시 매출의 증가로 세계 항체 시장에서 빠르게 성장해나가고 있으며, 애보트와 비엠에스 등의 제약 기업 역시 개발 막바지 단계의 치료용 항체를 다수 보유하고 있는 것으로 알려져 있다. 이에 따른 결과로 저분자 의약품이 주도권을 가지고 있던 세계 제약 시장에서 질병 타깃에 특이적이고 부작용이 낮은 치료용 항체를 포함한 바이오 의약품이 빠르게 그 자리를 대체해 나가고 있다.
치료용 항체의 가장 중요한 기작 중 하나는 면역세포들을 모집하여 타깃 항원으로 전달하는 기작인데, 항체의 Fc 도메인이 면역세포의 모집과 ADCC(antibody-dependent cell-mediated cytotoxicity)에 결정적인 역할을 한다. 특히, 항체의 ADCC 기능은 많은 세포의 표면에 존재하는 Fc 수용체(FcR)와의 상호작용에 의존한다. 사람의 Fc 수용체는 5가지로 분류되며, 항체가 어떠한 Fc 수용체에 결합되는지에 따라 모집되는 면역세포의 종류가 결정된다. 따라서, 특정한 세포를 모집할 수 있도록 항체를 변형하는 시도는 치료 분야에 있어서 매우 중요하다고 할 수 있다.
하지만, 현재까지 대부분의 시도는 포유동물이 발현하는 IgG 분자를 이용하여 Fc 도메인을 변형하는 것이었다. 포유동물의 항체는 당화(glycosylated)되어 있는데, 이러한 당화 항체 Fc 부위에 수식된 탄화수소 사슬이 단백질의 구조를 안정화 해주어 항체가 Fc 수용체에 결합할 수 있도록 한다. 이와 반대로, 박테리아에서 생산되는 무당화(aglycosylated) 항체는 Fc 부위에 결합된 탄화수소 사슬이 없기 때문에 Fc 수용체에 결합을 하지 못하여 ADCC 기능을 나타낼 수 없다. 따라서, Fc 수용체에 결합을 할 수 있는 무당화 항체가 개발된다면, 기존 동물세포가 아닌 박테리아를 이용한 생산이 가능하여 생산 원가를 절감할 수 있는 장점을 가질 수 있다.
또한, Fc 부위를 변형한 포유동물의 항체는 특정 Fc 수용체에 대한 결합력이 증가되지만, 다른 Fc 수용체에 대한 결합력도 유지를 하기 때문에 바람직하지 않은 면역반응을 여전히 유지하는 문제가 있다. 인간에게는 5 종류의 주요 FcγR가 존재한다. 상기 수용체 중 4가지는 면역 활성화 또는 염증 반응을 유도하고, FcγRIIb는 면역 저해 또는 항염증 반응을 유도하는데, 대부분의 자연적으로 생산된 항체 또는 재조합된 당화 항체는 활성화 및 저해 Fc 수용체에 모두 결합을 한다. 항체의 ADCC 유도능은 활성화 FcγR에 결합하는 능력과 저해 FcγRIIb에 결합하는 능력의 비율(A/I ratio)에 달려 있다(Boruchov et al, J Clin Invest, 115(10):2914-23, 2005). 하지만, FcγRIIb는 활성화 FcγR와 96%의 상동성을 갖는 문제로 인하여, 당화항체에 유전적 돌연변이를 도입하여 A/I ratio를 증가시키기 위한 노력은 큰 결실을 거두지 못하고 있는 실정이다.
추가적으로, 현재 임상에 이용되고 있는 치료용 IgG 항체를 이용한 암세포 사멸 작용기작에 관여하는 여러 가지의 면역세포들 중 자연살해세포(NK 세포)는 가장 강력한 암세포 사멸 효능을 가지고 있는 것으로 알려져 있는데, 다른 면역세포들(예:　monocytes, macrophages, dendritic cells)과는 달리 NK 세포는 표면에 FcγRIIIa를 발현하고, FcγRI과 FcγRIIa, FcγRIIb 및 FcγRIIIb는 발현하지 않는 특징을 갖는다. 따라서 기존의 치료용 항체와 차별화 할 수 있도록 암세포 사멸 작용기작을 극대화하기 위해서는 IgG 항체의 Fc 부위의 최적화를 통해 NK 세포 표면에 발현되는 FcγRIIIa와의 친화도를 향상시키는 것이 필수적이다.
상기한 배경기술로서 설명된 사항들은 본 발명의 배경에 대한 이해 증진을 위한 것일 뿐, 이 기술분야에서 통상의 지식을 가진 자에게 이미 알려진 종래기술에 해당함을 인정하는 것으로 받아들여져서는 안 될 것이다.
본 발명자들은 기존의 당화 항체가 갖는 비균질의 문제가 없고 NK 세포의 표면에 발현된 FcγRIIIa와의 향상된 결합력을 보유한 무당화 항체를 개발하고자 예의 노력을 하였다. 그 결과, 야생형 Fc 도메인의 일부 아미노산 서열을 다른 아미노산 서열로 치환하여 최적화함으로써 Fc 수용체 중 FcγRIIIa에 선택적으로 결합력이 크게 향상되고, 이를 통해 NK 세포의 암세포 사멸효과가 증대됨을 확인하여 본 발명을 완성하였다.
따라서, 본 발명의 목적은 인간 항체 Fc 도메인의 아미노산 서열 중 일부가 다른 아미노산 서열로 치환된 Fc 도메인을 포함하는 폴리펩타이드를 제공하는데 있다.
본 발명의 다른 목적은 상기 폴리펩타이드를 포함하는 무당화 항체를 제공하는데 있다.
본 발명의 또 다른 목적은 상기 폴리펩타이드를 코딩하는 핵산분자를 제공하는데 있다.
본 발명의 또 다른 목적은 상기 핵산분자를 포함하는 벡터를 제공하는데 있다.
본 발명의 또 다른 목적은 상기 벡터를 포함하는 숙주세포를 제공하는데 있다.
본 발명의 또 다른 목적은 상기 폴리펩타이드, 무당화 항체, 핵산분자 또는 벡터를 포함하는 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 폴리펩타이드, 무당화 항체, 핵산분자 또는 벡터를 투여하는 단계를 포함하는 암의 예방 또는 치료 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 폴리펩타이드 또는 무당화 항체의 제조방법을 제공하는데 있다.
본 발명의 또 다른 목적은 FcγRIIIa에 결합하는 Fc 도메인을 포함하는 폴리펩타이드의 스크리닝 방법을 제공하는데 있다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명의 일 양태에 따르면, 본 발명은 인간 항체 Fc 도메인의 아미노산 서열 중 일부가 다른 아미노산 서열로 치환된 Fc 도메인을 포함하는 폴리펩타이드를 제공한다.
본 발명자들은 기존의 당화 항체가 갖는 비균질의 문제가 없고 NK 세포의 표면에 발현된 FcγRIIIa와의 향상된 결합력을 보유한 무당화 항체를 개발하고자 예의 노력을 하였다. 그 결과, 야생형 Fc 도메인의 일부 아미노산 서열을 다른 아미노산 서열로 치환하여 최적화함으로써 Fc 수용체 중 FcγRIIIa에 선택적으로 결합력이 크게 향상되고, 이를 통해 NK 세포의 암세포 사멸효과가 증대됨을 확인하였다.
항체는 특정 항원에 특이적으로 결합을 나타내는 단백질로, 천연 항체는 통상 2개의 동일한 경쇄(L) 및 2개의 동일한 중쇄(H)로 구성된, 약 150,000 달톤의 헤테로다이머 당단백질이다.
본 발명에서 사용되는 인간 항체는 IgA, IgD, IgE, IgG 및 IgM의 5개의 주요 클래스가 있으며, 바람직하게는 IgG이다. 항체의 파파인 분해는 2개의 Fab 단편과 1개의 Fc 단편을 형성하며, 인간 IgG 분자에서, Fc 영역은 Cys 226의 N-말단을 파파인 분해함으로써 생성된다(Deisenhofer, Biochemistry 20: 2361-2370, 1981).
항체 Fc 도메인은 IgA, IgM, IgE, IgD, 또는 IgG 항체의 Fc 도메인, 혹은 이들의 변형일 수 있다. 일 실시 양태에 있어서는 상기 도메인은 IgG 항체의 Fc 도메인(예를 들면 IgG1, IgG2a, IgG2b, IgG3, 또는 IgG4 항체의 Fc 도메인)이다. 일 실시 양태에 있어서는 상기 Fc 도메인은 IgG1 Fc 도메인(예를 들면 항HER2 항체의 Fc 도메인, 보다 구체적으로는 트라스트주맙의 Fc 도메인)일 수 있다. 본 발명의 Fc 도메인을 포함하는 폴리펩타이드는 폴리펩타이드 전체가 당화되어 있지 않거나 폴리펩타이드의 일부(예를 들면, Fc 도메인)만이 당화되지 않을 수 있다. 또한, 폴리펩타이드에 Fc 도메인에 더해 항체에서 유래하는 하나 이상의 영역이 포함될 수도 있다. 추가적으로, 상기 폴리펩타이드에는 항체 유래의 항원 결합 도메인(antigen binding domain)이 포함될 수도 있으며, 복수의 폴리펩타이드가 항체 또는 항체형 단백질을 형성할 수도 있다.
본 명세서에서 항체 Fc 도메인의 아미노산 잔기 번호는 당업계에서 통상적으로 사용되는 카밧 넘버링 시스템(Kabat numbering system)에 따른다(Kabat et al., in “Sequences of Proteins of Immunological Interest”, 5th Ed., U.S. Department of Health and Human Services, NIH Publication No. 91-3242, 1991에서와 같은 EU 지수번호).
본 발명의 바람직한 구현예에 따르면, 본 발명의 치환된 Fc 도메인은 카밧 넘버링 시스템에 따른 하기의 8가지 아미노산 치환을 포함한다: S298G, T299A, K326I, A327Y, L328G, E382V, N390D 및 M428L.
본 발명의 일 실시 양태에 있어서는 무당화 Fc 도메인은 FcγRIa, FcγRIIa, FcγRIIb, FcγRIIc, FcγRIIIa, FcγRIIIb 또는 FcαRI 중의 하나 이상에 결합할 수 있도록 변이된다. 상기 변이된 무당화 Fc 도메인은 상기 Fc 수용체 중 어느 하나 이상에 대한 결합력이 야생형 당화 Fc 도메인과 비교하여 10% 이내, 20% 이내, 30% 이내, 40% 이내, 50% 이내, 60% 이내, 70% 이내, 80% 이내, 90% 이내 또는 100% 이내이거나, 야생형 당화 Fc 도메인 보다 2배 이상, 3배 이상, 4배 이상, 5배 이상, 6배 이상, 7배 이상, 8배 이상, 9배 이상, 10배 이상 또는 20배 이상 증가될 수 있다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 폴리펩타이드가 포함하는 Fc 도메인은 상기 8가지 아미노산으로 치환되지 않은 Fc 도메인과 비교하여 FcγRIIIa에 대한 결합력이 향상된 것이다.
본 발명의 실시예에 따르면, S298G, T299A, N390D, E382V 및 M428L만이 치환된 Fc 도메인(Fc1004, 미국 등록특허 제8,952,132호)은 야생형 Fc 도메인과 같이 FcγRIIIa와 결합하지 않고, T299A, K326I, A327Y 및 L328G만이 치환된 Fc 도메인(A/IYG, 미국 등록특허 제8,815,237호) 역시 야생형 Fc 도메인에 비해 FcγRIIIa에 대한 결합력 증가가 상당히 약하다. 본 발명의 상기 8가지 아미노산 치환을 포함하는 Fc 도메인의 FcγRIIIa에 대한 결합력은 야생형 Fc 도메인 또는 Fc1004나 A/IYG와 비교하여 크게 향상되는 것을 확인하였다(실시예 3 및 4).
본 발명의 바람직한 구현예에 따르면, 본 발명의 상기 아미노산 치환은 카밧 넘버링 시스템에 따른 C226R, F243L, K246E, T250I, I253N, V264E, T307S, C347R, T350A, S400T 및 N421S로 구성된 군으로부터 선택되는 1 이상의 추가적인 아미노산 치환을 포함한다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 상기 9가지 이상의 아미노산이 치환된 Fc 도메인은 S298G, T299A, K326I, A327Y, L328G, E382V, N390D 및 M428L의 8가지 아미노산만이 치환된 Fc 도메인과 비교하여 FcγRIIIa에 대한 결합력이 향상된 것이다.
본 발명의 일 실시예에 따르면, 상기 9가지 이상의 아미노산이 치환된 Fc 도메인은은 상기 8가지 아미노산만이 치환된 Fc 도메인과 비교하여 FcγRIIIa에 대한 결합력이 40% 이상 증가된 것을 확인하였다(MG42: 40% 이상 증가; MG61: 50% 이상 증가; MG54, MG59 및 MG86: 200% 이상 증가; MG14 및 MG87: 300% 이상 증가; MG48: 500% 이상 증가 등; 도 6a 내지 6c).
본 발명의 바람직한 구현예에 따르면, 본 발명의 치환된 Fc 도메인은 카밧 넘버링 시스템에 따른 하기의 9가지 아미노산 치환을 포함한다: S298G, T299A, T307S, K326I, A327Y, L328G, E382V, N390D 및 M428L.
본 발명의 바람직한 구현예에 따르면, 본 발명의 치환된 Fc 도메인은 카밧 넘버링 시스템에 따른 하기의 9가지 아미노산 치환을 포함한다: S298G, T299A, K326I, A327Y, L328G, C347R, E382V, N390D 및 M428L.
본 발명의 바람직한 구현예에 따르면, 본 발명의 치환된 Fc 도메인은 카밧 넘버링 시스템에 따른 하기의 10가지 아미노산 치환을 포함한다: V264E, S298G, T299A, K326I, A327Y, L328G, T350A, E382V, N390D 및 M428L.
본 발명의 바람직한 구현예에 따르면, 본 발명의 치환된 Fc 도메인은 카밧 넘버링 시스템에 따른 하기의 10가지 아미노산 치환을 포함한다: T250I, I253N, S298G, T299A, K326I, A327Y, L328G, E382V, N390D 및 M428L.
본 발명의 바람직한 구현예에 따르면, 본 발명의 치환된 Fc 도메인은 카밧 넘버링 시스템에 따른 하기의 10가지 아미노산 치환을 포함한다: V264E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D, N421S 및 M428L.
본 발명의 바람직한 구현예에 따르면, 본 발명의 치환된 Fc 도메인은 카밧 넘버링 시스템에 따른 하기의 11가지 아미노산 치환을 포함한다: V264E, S298G, T299A, K326I, A327Y, L328G, T350A, E382V, N390D, N421S 및 M428L.
본 발명의 바람직한 구현예에 따르면, 본 발명의 치환된 Fc 도메인은 카밧 넘버링 시스템에 따른 하기의 11가지 아미노산 치환을 포함한다: C226R, F243L, K246E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D 및 M428L.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 폴리펩타이드를 포함하는 무당화(aglycosylated) 항체를 제공한다.
본 명세서에서 용어 “항체”는 폴리클로날 항체, 모노클로날 항체, 인간항체 및 인간화 항체와 이들의 단편을 의미한다.
현재 상용화된 모든 치료용 항체들은 동물세포 배양을 통해 제조되고 있는데 항체를 생산할 때 다양한 당(carbohydrate) 변이체들이 항체 단백질에 수식되게 되고, 이로 인한 당화 비균질성(glycan heterogeniety)은 항체의 효능과 안정성에 변이를 유발하며, 항체 제조 공정 중 정제, 분석, QC(Quality Control)에 많은 비용을 요구하게 된다.
고가의 동물세포 배양 시스템이 요구되는 상기 당화 항체에 비해 무당화 항체(aglycosylated)는 박테리아에서 대량 생산이 가능하고 속도와 비용 면에서 탁월한 우수성을 지닌다. 하지만, 당화 항체의 Asn297 아미노산에 생성된 N-linked glycan은 항체의 구조와 기능에 결정적인 역할을 하는데, 무당화 항체 Fc 영역은 동물세포에서 생산이 되는 당화(glycosylated) 항체 Fc와 다르게 상위 CH2 영역이 닫혀져 있는 구조(closed structure) 혹은 아주 가변적인 구조 (flexible structure)를 가지게 되며, 이에 따라 무당화 항체는 NK 세포 모집과 활성화에 결정적인 역할을 담당하는 FcγRIIIa에 결합을 하지 못하고, 암세포 사멸 작용기작을 보이지 못하게 된다.
본 발명의 바람직한 구현예에 따르면, 본 발명은 무당화 항체 Fc 영역의 최적화(S298G, T299A, K326I, A327Y, L328G, E382V, N390D 및 M428L의 8가지 아미노산으로 치환)를 통해 당화 비균질성 문제가 없고 저렴한 비용으로 박테리아에서도 생산이 가능함과 동시에 NK 세포의 표면에 발현된 FcγRIIIa와의 향상된 결합력으로 암세포 사멸 작용기작을 극대화할 수 있다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 폴리펩타이드를 코딩하는 핵산분자, 상기 핵산분자를 포함하는 벡터 또는 상기 벡터를 포함하는 숙주세포를 제공한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 하기의 단계를 포함하는 인간 항체 Fc 도메인을 포함하는 폴리펩타이드의 제조방법을 제공한다:
a) 상기 폴리펩타이드를 코딩하는 핵산분자를 포함하는 벡터를 포함하는 숙주세포를 배양하는 단계; 및
b) 상기 숙주세포에 의해 발현된 폴리펩타이드를 회수하는 단계.
본 발명의 또 다른 양태에 따르면, 본 발명은 하기의 단계를 포함하는 무당화 항체의 제조방법을 제공한다:
a) 상기 폴리펩타이드를 포함하는 무당화 항체를 발현하는 숙주세포를 배양하는 단계; 및
b) 상기 숙주세포로부터 발현된 항체를 정제하는 단계.
본 발명의 핵산분자는 단리된 것이거나 재조합된 것일 수 있으며, 단일쇄 및 이중쇄 형태의 DNA 및 RNA뿐만 아니라 대응하는 상보성 서열이 포함된다. “단리된 핵산”은 천연 생성 원천에서 단리된 핵산의 경우, 핵산이 단리된 개체의 게놈에 존재하는 주변 유전 서열로부터 분리된 핵산이다. 주형으로부터 효소적으로 또는 화학적으로 합성된 핵산, 예컨대 PCR 산물, cDNA 분자, 또는 올리고뉴클레오타이드의 경우, 이러한 절차로부터 생성된 핵산이 단리된 핵산분자로 이해될 수 있다. 단리된 핵산분자는 별도 단편의 형태 또는 더 큰 핵산 구축물의 성분으로서의 핵산 분자를 나타낸다. 핵산은 다른 핵산 서열과 기능적 관계로 배치될 때 “작동가능하게 연결”된다. 예를 들면, 전서열 또는 분비 리더(leader)의 DNA는 폴리펩타이드가 분비되기 전의 형태인 전단백질(preprotein)로서 발현되는 경우 폴리펩타이드의 DNA에 작동가능하게 연결되고, 프로모터 또는 인핸서는 폴리펩타이드 서열의 전사에 영향을 주는 경우 코딩 서열에 작동가능하게 연결되며, 또는 리보솜 결합 부위는 번역을 촉진하도록 배치될 때 코딩 서열에 작동가능하게 연결된다. 일반적으로 “작동가능하게 연결된”은 연결될 DNA 서열들이 인접하여 위치함을 의미하며, 분비 리더의 경우 인접하여 동일한 리딩 프레임 내에 존재하는 것을 의미한다. 그러나 인핸서는 인접하여 위치할 필요는 없다. 연결은 편리한 제한 효소 부위에서 라이게이션에 의해 달성된다. 이러한 부위가 존재하지 않는 경우, 합성 올리고뉴클레오타이드 어댑터 또는 링커를 통상적인 방법에 따라 사용한다.
본 명세서에서 용어 “벡터”는 핵산 서열을 복제할 수 있는 세포로의 도입을 위해서 핵산 서열을 삽입할 수 있는 전달체를 의미한다. 핵산 서열은 외생(exogenous) 또는 이종(heterologous)일 수 있다. 벡터로서는 플라스미드, 코스미드 및 바이러스(예를 들면 박테리오파지)를 들 수 있으나, 이에 제한되지 않는다. 당업자는 표준적인 재조합 기술에 의해 벡터를 구축할 수 있다(Maniatis, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1988; 및 Ausubel et al., In: Current Protocols in Molecular Biology, John, Wiley & Sons, Inc, NY, 1994 등).
본 명세서에서 용어 “발현 벡터”는 전사되는 유전자 산물 중 적어도 일부분을 코딩하는 핵산 서열을 포함한 벡터를 의미한다. 일부의 경우에는 그 후 RNA 분자가 단백질, 폴리펩타이드, 또는 펩타이드로 번역된다. 발현 벡터에는 다양한 조절서열을 포함할 수 있다. 전사 및 번역을 조절하는 조절서열과 함께 벡터 및 발현 벡터에는 또 다른 기능도 제공하는 핵산 서열도 포함될 수 있다.
본 명세서에서 용어 “숙주세포”는 진핵생물 및 원핵생물을 포함하며, 상기 벡터를 복제할 수 있거나 벡터에 의해 코딩되는 유전자를 발현할 수 있는 임의의 형질 전환 가능한 생물을 의미한다. 숙주세포는 상기 벡터에 의해 형질감염(transfected) 또는 형질전환(transformed) 될 수 있으며, 이는 외생의 핵산분자가 숙주세포 내에 전달되거나 도입되는 과정을 의미한다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 숙주세포는 세균(bacteria)세포, 보다 바람직하게는 그람 음성 세균세포이다. 상기 세포는 내막과 외막 사이에 원형질막 주위 공간 영역(periplasmic region)을 가지는 점에서 본 발명의 실시에 적합하다. 본 발명의 바람직한 숙주세포의 예로는 E. coli, Pseudomonas aeruginosa, Vibrio cholera, Salmonella typhimurium, Shigella flexneri, Haemophilus influenza, Bordotella pertussi, Erwinia amylovora, Rhizobium sp .등 이 포함되나, 이에 제한되는 것은 아니다.
본 발명의 제조방법에 있어서, 항체의 정제는 여과, HPLC, 음이온 교환 또는 양이온 교환, 고속 액체 크로마토그래피(HPLC), 친화도 크로마토그래피, 또는 이들의 조합을 하는 것이 포함될 수 있으며, 바람직하게는 Protein A를 사용하는 친화도 크로마토그래피를 이용할 수 있다.
본 발명의 또 다른 양태에 따르면, 본 발명은 하기의 단계를 포함하는 FcγRIIIa에 결합하는 Fc 도메인을 포함하는 폴리펩타이드의 스크리닝 방법을 제공한다:
a) 상기 8가지 아미노산 치환(S298G, T299A, K326I, A327Y, L328G, E382V, N390D 및 M428L)을 포함하는 Fc 도메인에 무작위적인 점 돌연변이를 가하는 단계를 포함하는 Fc 도메인을 포함하는 폴리펩타이드의 라이브러리를 구축하는 단계; 및
b) 상기 라이브러리에서 FcγRIIIa에 결합하는 Fc 도메인을 포함하는 폴리펩타이드를 선별하는 단계.
본 발명의 치환된 Fc 도메인은 상기 8가지 아미노산 치환과 더불어, 추가적인 아미노산 치환을 포함할 수 있다.
본 발명의 바람직한 구현예에 따르면, 본 발명은 하기의 단계를 포함하는 FcγRIIIa에 결합하는 Fc 도메인을 포함하는 폴리펩타이드의 스크리닝 방법에 고나한 것이다:
a) 카밧 넘버링 시스템에 따른 S298G, T299A, K326I, A327Y, L328G, E382V, N390D 및 M428L의 8가지 아미노산 치환을 포함하는 Fc 도메인에 추가적으로 무작위적인 점 돌연변이를 가한 Fc 도메인을 포함하는 폴리펩타이드의 라이브러리를 구축하는 단계; 및
b) 상기 라이브러리에서, 상기 8가지 아미노산이 치환된 Fc 도메인보다 FcγRIIIa에 결합력이 향상된 Fc 도메인을 포함하는 폴리펩타이드를 선별하는 단계.
본 발명의 일 실시예에 따르면, 박테리아 세포(바람직하게는, 대장균)를 이용하여 Fc 라이브러리를 구축하였으며, 이로부터 FcγRIIIa와 높은 친화도를 보이는 변이체들을 선별하였다(실시예 5 및 6).
상기 Fc 도메인의 추가적인 아미노산 치환은 특별히 제한되지 않으며, 바람직하게는 카밧 넘버링 시스템에 따른 226, 243, 246, 250, 253, 264, 307, 347, 350, 400 및 421번 아미노산으로 구성된 군으로부터 선택되는 1 이상의 추가적인 아미노산 치환, 보다 바람직하게는 C226R, F243L, K246E, T250I, I253N, V264E, T307S, C347R, T350A, S400T 및 N421S로 구성된 군으로부터 선택되는 1 이상의 추가적인 아미노산 치환을 포함한다.
본 발명의 스크리닝 방법은 형광표지세포분리(FACS) 스크리닝, 또는 다른 자동화된 유세포 분석 기술을 사용할 수 있다. 유세포 분석기를 실시하기 위한 기기는 당업자에게 공지이다. 그러한 기기의 예로는 FACSAria, FACS Star Plus, FACScan 및 FACSort 기기(Becton Dickinson, Foster City, CA), Epics C(Coulter Epics Division, Hialeah, FL), MOFLO(Cytomation, Colorado Springs, Colo.), MOFLO-XDP (Beckman Coulter, Indianapolis, IN)를 들 수 있다. 일반적으로 유세포 분석기 기술에는 액체 시료 중의 세포 또는 다른 입자의 분리가 포함된다. 전형적으로는 유세포 분석기의 목적은 분리된 입자를 이들의 하나 이상의 특성(예를 들면 표지된 리간드 또는 다른 분자의 존재)에 대해서 분석하는 것이다. 입자는 센서에 의해 하나씩 통과되며, 크기, 굴절, 광산란, 불투명도, 조도, 형상, 형광 등에 기초하여 분류된다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 아미노산 치환을 포함하는 Fc 도메인을 포함하는 폴리펩타이드, 이를 코딩하는 핵산분자, 이를 포함하는 벡터, 폴리펩타이드를 포함하는 무당화 항체를 포함하는 조성물을 제공한다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 조성물은 암의 예방 또는 치료용 약제학적 조성물이다.
본 발명의 약제학적 조성물은 (a) 상기 폴리펩타이드, 무당화 항체, 핵산분자 또는 벡터; 및 (b) 약제학적으로 허용되는 담체를 포함할 수 있다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 폴리펩타이드, 무당화 항체, 핵산분자 또는 벡터의 약제학적 유효량을 객체(subject)에 투여하는 단계를 포함하는 암의 예방 또는 치료 방법을 제공한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 아미노산 치환을 포함하는 Fc 도메인을 포함하는 폴리펩타이드, 이를 코딩하는 핵산분자, 이를 포함하는 벡터, 폴리펩타이드를 포함하는 무당화 항체를 포함하는 암의 예방 또는 치료용 약제학적 조성물의 용도를 제공한다.
본 발명의 약제학적 조성물은 (a) 상기 폴리펩타이드, 무당화 항체, 핵산분자 또는 벡터; 및 (b) 약제학적으로 허용되는 담체를 포함할 수 있다.
본 발명이 예방 또는 치료하고자 하는 암의 종류는 제한되지 않으며, 백혈병(leukemias) 및 급성 림프구 백혈병(acute lymphocytic leukemia), 급성 비림프구 백혈병(acute nonlymphocytic leukemias), 만성 림프구 백혈병(chronic lymphocytic leukemia), 만성 골수 백혈병(chronic myelogenous leukemia), 호지킨 병(Hodgkin's Disease), 비호지킨 림프종(non-Hodgkin's lymphomas) 및 다발 골수종(multiple myeloma) 등과 같은 림프종(lymphomas), 뇌종양(brain tumors), 신경모세포종(neuroblastoma), 망막모세포종(retinoblastoma), 윌름즈종양(Wilms Tumor), 골종양(bone tumors) 및 연부조직육종(soft-tissue sarcomas) 등과 같은 소아 고형 종양(childhood solid tumors), 폐암(lung cancer), 유방암(breast cancer), 전립선암(prostate cancer), 요로암(urinary cancers), 자궁암(uterine cancers), 구강암(oral cancers), 췌장암(pancreatic cancer), 흑색종(melanoma) 및 기타 피부암(skin cancers), 위암(stomach cancer), 난소암(ovarian cancer), 뇌종양(brain tumors), 간암(liver cancer), 후두암(laryngeal cancer), 갑상선암(thyroid cancer), 식도암(esophageal cancer) 및 고환암(testicular cancer) 등과 같은 성인들의 통상의 고형 종양(common solid tumors)들을 포함하여 다수의 암들을 치료하도록 투여될 수 있다.
본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.
본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고, 바람직하게는 비경구 투여이며, 예컨대, 정맥 내 주입, 국소 주입 및 복강 주입 등으로 투여할 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 바람직한 구현예에 따르면, 본 발명의 약제학적 조성물의 1일 투여량은 0.0001-100 ㎎/㎏이다.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 약제학적 조성물은 단독의 요법으로 이용될 수 있으나, 다른 통상적인 화학 요법 또는 방사 요법과 함께 이용될 수도 있으며, 이러한 병행 요법을 실시하는 경우에는 보다 효과적으로 암 치료를 할 수 있다. 본 발명의 조성물과 함께 이용될 수 있는 화학 요법제는 시스플라틴(cisplatin), 카르보플라틴(carboplatin), 프로카르바진(procarbazine), 메클로레타민(mechlorethamine), 시클로포스파미드(cyclophosphamide), 이포스파미드(ifosfamide), 멜팔란(melphalan), 클로라부실(chlorambucil), 비술판(bisulfan), 니트로소우레아(nitrosourea), 디악티노마이신(dactinomycin), 다우노루비신(daunorubicin), 독소루비신(doxorubicin), 블레오마이신(bleomycin), 플리코마이신(plicomycin), 미토마이신(mitomycin), 에토포시드(etoposide), 탁목시펜(tamoxifen), 택솔(taxol), 트랜스플라티눔(transplatinum), 5-플루오로우라실(5-fluorouracil), 빈크리스틴(vincristin), 빈블라스틴(vinblastin) 및 메토트렉세이트(methotrexate) 등을 포함한다. 본 발명의 조성물과 함께 이용될 수 있는 방사 요법은 X-선 조사 및 γ-선 조사 등이다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(i) 본 발명은 인간 항체 Fc 도메인의 아미노산 서열 중 일부가 다른 아미노산 서열로 치환된 Fc 도메인을 포함하는 폴리펩타이드 또는 이를 포함하는 무당화 항체를 제공한다.
(ii) 또한, 본 발명은 상기 폴리펩타이드 또는 무당화 항체의 제조방법을 제공한다.
(iii) 본 발명의 Fc 도메인은 야생형 Fc 도메인의 일부 아미노산 서열을 다른 아미노산 서열로 치환하여 최적화함으로써 Fc 수용체 중 FcγRIIIa에 선택적 결합력이 우수하여 암의 치료에 유용하며, 박테리아 배양을 통해서 균질의 무당화 항체로 제조될 수 있다.
도 1은 Tetrameric FcγRIIIa의 정제(왼쪽, SDS-PAGE) 사진과 활성 확인을 위한 ELISA(오른쪽) 실험결과를 나타낸다.
도 2는 Alexa 488 Flour를 이용한 tetrameric FcγRIIIa 형광 표지 후 활성 확인을 위한 ELISA 실험결과를 나타낸다.
도 3은 A/IYG와 Fc1004의 FcγRIIIa에 대한 결합력을 비교한 그래프를 나타낸다.
도 4는 A/IYG와 Fc1004-IYG의 FcγRIIIa에 대한 결합력을 비교한 그래프를 나타낸다.
도 5는 Fc1004-IYG를 기반으로 한 무당화 항체 Fc 라이브러리 구축에 관한 모식도를 나타낸다.
도 6은 유세포 분석기를 이용한 라이브러리 스크리닝을 통해 발굴한 FcγRIIIa high affinity Fc 변이체의 결합력을 비교한 그래프를 나타낸다(a 및 b: 야생형, A/IYG, Fc1004-IYG, MG42, MG59, MG87 및 MG48의 비교; c: 야생형, A/IYG, Fc1004-IYG, MG61, MG86, MG54 및 MG14의 비교).
도 7은 발굴한 변이체 및 대조군(야생형, A/IYG)의 soluble expression 및 정제를 SDS-PAGE로 확인한 사진을 나타낸다.
도 8은 ELISA를 통한 변이체들의 다양한 FcγRs에 대한 친화도 분석 결과를 나타낸다.
도 9는 변이체들의 SPR 분석을 나타낸 그래프이다(a. FcγRIIIa(V158)에 대한 결합력 분석. b. FcγRIIIa(F158)에 대한 결합력 분석).
도 10은 MCF-7과 SKBR-3의 HER2 발현 정도를 확인인 결과를 나타낸다.
도 11은 Effector cell: Target cell의 비율에 따른 ADCC 경향성 분석을 나타낸다.
도 12는 인간 PBMC와 SKBR-3, MCF-7을 이용한 각 변이체들의 암세포 사멸 효과를 분석한 결과를 나타낸다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
실시예 1: 무당화 항체를 full-length IgG 형태로 박테리아 내막에 디스플레이 하기 위한 Fc 변이체 클로닝 (A/ IYG , Fc1004 - IYG )
A/IYG(미국특허등록번호 제8,815,237호) 변이체와 Fc1004-IYG를 full-length IgG 디스플레이 하기 위하여 각 Fc 변이체를 중쇄 형태의 플라스미드로 제작하였다. pMopac12-PelB-VH-CH1-CH2-CH3(wild type)-FLAG 플라스미드에 T299A 치환이 이루어지도록 2개의 절편으로 나눈 뒤 각각의 가닥을 프라이머 MJ#36, MJ#43/MJ#42, MJ#37를 이용하여 Vent polymerase(New England Biolab)로 증폭하였다. 두 개의 절편은 프라이머 MJ#36, MJ#37을 이용하여 assembly PCR 과정 및 SfiI(New England Biolab) cut, T4 DNA ligase(invitrogen)을 이용한 라이게이션 과정을 차례로 진행해 pMopac12-PelB-VH-CH1-CH2-CH3(T299A)-FLAG 플라스미드를 제작하였다. 이 플라스미드를 주형으로 하고 프라이머 MJ#36, MJ#39/MJ#38, MJ#37을 사용해 위와 동일한 방법으로 326IYG 치환을 가하였다(pMopac12-PelB-VH-CH1-CH2-CH3(A/IYG)-FLAG 제작). 동일한 프라이머인 MJ#36, MJ#39/MJ#38, MJ#37을 사용하여 pMopac12-PelB-VH-CH1-CH2-CH3(Fc1004)-FLAG에 326IYG 점 돌연변이를 도입해 pMopac12-PelB-VH-CH1-CH2-CH3(Fc1004-IYG)-FLAG을 제작하였다.
실험에 사용한 프라이머
프라이머 # 뉴클레오타이드 서열 (5’→3’)
MJ#36 (서열목록 제17서열) CGCAGCGAGGCCCAGCCGGCCATGGCGGAGGTTCAATTAGTGGAATCTG
MJ#43 (서열목록 제18서열) GGACGCTGACCACACGGTACGCGCTGTTGTACTGCTCCTCCCG
MJ#42 (서열목록 제19서열) CGGGAGGAGCAGTACAACAGCGCGTACCGTGTGGTCAGCGTCC
MJ#37 (서열목록 제20서열) CGCAATTCGGCCCCCGAGGCCCCTTTACCCGGGGACAGGGAG
MJ#39 (서열목록 제21서열) GGTTTTCTCGATGGGGGCTGGGCCATAAATGTTGGAGACCTTGCATTTGTACTCCTTG
MJ#38 (서열목록 제22서열) CAAGGAGTACAAATGCAAGGTCTCCAACATTTATGGCCCAGCCCCCATCGAGAAAACC
MJ#45 (서열목록 제23서열) CGACAAGAAAGTTGAGCCCAAATCTTGT
MJ#46 (서열목록 제24서열) CGCAATTCCGGCCCCCGAGGCCCC
MJ#44 (서열목록 제25서열) ACAAGATTTGGGCTCAACTTTCTTGTCG
MJ#2 (서열목록 제26서열) CTGCCCATGTTGACGATTG
MJ#49 (서열목록 제27서열) CGCAGCGAGCGCGCACTCCATGGCGGAGGTTCAATTAGTGGAATCTG
MJ#50 (서열목록 제28서열) CCCTAAAATCTAGACCTTTACCCGGGGACAGGGAG
실시예 2: Tetrameric FcγRIIIa의 제조와 Alexa488 fluor를 이용한 형광 표지
pMAZ-FcγRIIIa(V158)-FLAG-Streptavidin-His 플라스미드를 HEK 293F 세포에 300 ㎖ 규모로 임시 발현하여 1 ㎖의 Ni-NTA agarose(Qiagen) 슬러리를 이용한 친화도 크로마토그래피를 수행하였다. 배양이 끝난 현탁배양액은 7000 rpm, 10 분간 원심분리를 통해 세포를 제거하고 상등액을 취해 25x PBS를 이용해 평형을 맞추고 bottle top filter를 이용해 0.2 μm 필터(Merck Millipore)로 여과하였다. PBS로 평형을 맞춘 Ni-NTA 슬러리를 첨가해 4℃, 16 시간 교반한 다음 폴리프로필렌 칼럼(Thermo Fisher Scientific)에 흘려주었다. pass-through solution을 취해 한 번 더 레진에 흘려서 바인딩 시킨 뒤, 50 ㎖의 1x PBS, 25 ㎖의 10 mM 이미다졸 버퍼, 25 ㎖의 20 mM 이미다졸 버퍼, 200 ㎕의 250 mM 이미다졸 버퍼 순으로 세척 과정을 수행하였다. 2.5 ㎖의 250 mM 이미다졸 버퍼로 elution을 받아 Amicon Ultra-4(Merck Millipore)을 통해 PBS로 버퍼를 교체한 후 농축 과정을 거쳐 SDS-PAGE를 통해 정제된 단백질을 확인하였다(도 1). 정제된 단백질은 ELISA를 실시하여 Rituxan(Roche)과의 결합 여부 분석을 통해 활성을 확인한 후, 1 ㎎을 취하여 Alexa Fluor 488 Protein Labeling Kit(Thermo Fisher Scientific)을 이용해 형광 표지 하였다. 형광 표지 후 활성 여부를 ELISA를 통해 분석하였다(도 2). 이로써 고순도의 active한 tetrameric FcγRIIIa를 성공적으로 제조하였으며, Alexa 488 flour 형광 물질을 표지한 이후에도 단백질의 활성이 유지되는 것을 확인하였다.
실시예 3: 야생형과 Fc1004 및 A/IYG의 FcγRIIIa에 대한 결합력 비교
분석할 클론들은 중쇄를 코딩하는 플라스미드인 pMopac12-PelB-VH-CH1-CH2-CH3(wild type)-FLAG, pMopac12-PelB-VH-CH1-CH2-CH3(Fc1004)-FLAG, pMopac12-PelB-VH-CH1-CH2-CH3(A/IYG)-FLAG 형태 이므로 E . coli Jude 1 세포(F' [ Tn10 (Tetr ) proAB+ lacI qΔ(lacZ)M15] mcrA Δ(mrr-hsdRMS-mcrBC)80dlacZΔM15 ΔlacX74 deoR recA1 araD139 Δ(ara leu)7697 galU galKrpsLendA1nupG) (Kawarasaki et al, 2003)에 pBAD30-Km-PelB-VL-Ck-NlpA-VL-Ck-His-cMyc 플라스미드와 함께 transformation하여 중쇄 및 경쇄가 각각 원형질막 주위 공간 영역(periplasmic region)에 발현될 수 있도록 준비하였다. Terrific broth(TB, BD)에 glucose(Sigma-Aldrich)가 2% 함유된 배지 5 ㎖에서 각각 37℃, 16 시간 배양한 후 TB 5.5 ㎖을 100 ㎖ 플라스크에 분주하여 1:100 접종하였다. OD600=0.6까지 배양한 후 20 분간 25℃, 250 rpm에서 cooling 과정을 거친 후 0.2% arabinose, 1 mM IPTG를 첨가하여 25℃, 250 rpm, 20 시간 동안 과발현 하였다. 과발현 후 OD600 normalize를 통해 균일한 양 만큼씩 14000 rpm, 1 분간 원심분리를 통해 세포를 수확하였다. 1 ㎖의 10 mM Tris-HCl(pH 8.0)을 첨가해 세포를 resuspension하고 1 분간 원심분리하는 세척 과정을 2회 반복하였다. 1 ㎖의 STE[0.5 M sucrose, 10 mM Tris-HCl, 10mM EDTA(pH 8.0)]로 resuspension하여 37℃, 30 분간 rotation을 통해 세포 외막을 제거하였다. 원심분리하여 상등액을 버린 후 1 ㎖의 Solution A[0.5 M sucrose, 20 mM MgCl2, 10 mM MOPS pH 6.8]을 첨가해 resuspension과 원심분리를 하였다. 1 ㎖의 Solution A와 50 ㎎/㎖ lysozyme solution 20 ㎕를 혼합한 용액을 1 ㎖ 첨가해 resuspension한 뒤 37℃, 15 분 간 rotation하여 펩티도글리칸 층을 제거하였다. 원심분리 후 상등액을 제거하고 1 ㎖의 PBS로 resuspension한 뒤 300 ㎕를 취해 700 ㎕의 PBS와 형광 표지 된 tetrameric FcγRIIIa-Alexa 488 flour 프로브를 함께 넣고 상온에서 rotation하여 spheroplast에 형광 프로브를 표지하였다. 표지 후 1 ㎖의 PBS로 1회 세척한 후 Guava(Merck Millipore) 장비를 이용해 분석하였다(도 3). 그 결과 야생형 Fc와 A/IYG, Fc1004 모두가 각각 30-42의 mean 값을 나타내어 FcγRIIIa와 잘 결합하지 않는다는 것을 확인하였다.
실시예 4: A/IYG와 Fc1004-IYG의 FcγRIIIa에 대한 결합력 비교
pMopac12-PelB-VH-CH1-CH2-CH3(IYG)-FLAG, pMopac12-PelB-VH-CH1-CH2-CH3(Fc1004-IYG)-FLAG는 E. coli Jude 1 세포에 pBAD30-Km-PelB-VL-Ck-NlpA-VL-Ck-His-cMyc 플라스미드와 함께 transformation하여 중쇄 및 경쇄가 각각 원형질막 주위 공간 영역(periplasmic region)에 발현될 수 있도록 준비하였다. TB에 glucose가 2% 함유된 배지 5 ㎖에서 각각 37℃, 16 시간 배양한 후 TB 5.5 ㎖을 100 ㎖ 플라스크에 분주하여 1:100 접종하였다. OD600=0.6까지 배양한 후 20 분간 25℃, 250 rpm에서 cooling 과정을 거친 후 0.2% arabinose, 1 mM IPTG를 첨가하여 25℃, 250 rpm, 20 시간 동안 과발현하였다. 과발현 후 OD600 normalize를 통해 동일한 양 만큼씩 14000 rpm, 1 분간 원심분리를 통해 세포를 수확하였다. 1 ㎖의 10 mM Tris-HCl(pH 8.0)을 첨가해 세포를 resuspension하고 1 분간 원심분리하는 세척 과정을 2회 반복하였다. 1 ㎖의 STE[0.5 M sucrose, 10 mM Tris-HCl, 10mM EDTA(pH 8.0)]로 resuspension하여 37℃, 30 분간 rotation을 통해 세포 외막을 제거하였다. 원심분리하여 상등액을 버린 후 1 ㎖의 Solution A[0.5 M sucrose, 20 mM MgCl2, 10 mM MOPS pH 6.8]을 첨가해 resuspension과 원심분리를 하였다. 1 ㎖의 Solution A와 50 ㎎/㎖ lysozyme solution 20 ㎕를 혼합한 용액을 1 ㎖ 첨가해 resuspension한 뒤 37℃, 15 분 간 rotation하여 펩티도글리칸 층을 제거하였다. 원심분리 후 상등액을 제거하고 1 ㎖의 PBS로 resuspension한 뒤 300 ㎕를 취해 700 ㎕의 PBS와 형광 표지된 tetrameric FcγRIIIa-Alexa 488 flour 프로브를 함께 넣고 상온에서 rotation하여 spheroplast에 형광 프로브를 표지하였다. 표지 후 1 ㎖의 PBS로 1회 세척한 후 Guava(Merck Millipore) 장비를 이용해 분석하였다(도 4). 분석 결과 Fc1004-IYG의 형광 신호 세기는 199.85로써 야생형(23.92)에 비해 8.4배 증가되어, 지금까지 알려진 무당화 항체 Fc 변이체들 중 FcγRIIIa에 가장 높은 친화도를 보이는 것으로 알려진 A/IYG(41.24, 야생형에 비해 1.7배 증가)와 비교하여, Fc1004-IYG의 결합력이 크게 향상되는 것을 확인하였다.
실시예 5: Fc1004-IYG를 기반으로 한 무당화 항체 라이브러리 구축
Fc1004-IYG를 기반으로 한 무당화 항체 Fc 라이브러리를 제작하기 위하여 pMopac12-PelB-VH-CH1-CH2-CH3(Fc1004-IYG)-FLAG을 주형으로 하여 error prone PCR 및 assemble PCR을 진행하였다. Fc(CH2-CH3)부분에 무작위적인 점 돌연변이를 가하기 위한 방법으로 Taq polymerase(Invitrogen)을 이용한 error prone PCR 기법을 사용하였으며, 프라이머 MJ#45, MJ#46를 사용하여 전제 Fc 유전자에서 0.5%의 뉴클레오타이드에 점 돌연변이가 도입되도록 하였다. 또한 이 Fc의 앞부분은 Fab와 중첩되도록 디자인하여 중쇄 형태로 assembly가 가능하도록 제작하였다. 따라서 Fab(VH-CH1)부분은 프라이머 MJ#36, MJ#44와 Vent polymerase를 이용하여 conventional PCR을 진행한 뒤, 프라이머 MJ#36, MJ#46을 사용하여 Fab fragment와 Fc fragment를 연결해 주는 assemble PCR을 수행하여 전체 heavy chain 형태의 PCR product를 제작하였다. 그런 다음 SfiI 제한효소 처리 및 라이게이션 과정을 거쳐 Jude 1에 transformation하여 중쇄 형태의 무당화 항체 Fc 라이브러리를 제작하였다(라이브러리 크기: 1.14 x 109,experimental error rate:0.457%). 이 라이브러리에서 유전자를 확보하고 pBAD30-Km-PelB-VL-Ck-NlpA-VL-Ck-His-cMyc가 transformation되어 있는 Jude 1 세포에 다시 transformation함으로써 대장균의 내막에 full-length IgG가 디스플레이 되는 라이브러리를 구축하였다(도 5).
실시예 6: 구축된 라이브러리와 유세포 분석기를 스크리닝 및 MG42, MG48, MG59, MG87 등의 변이체 선별(FcγRIIIa에 대한 결합력 확인)
구축된 라이브러리는 250 ㎖ 플라스크에서 TB+2% glucose 배지 25 ㎖에 1 vial(1 ㎖)을 풀어 37℃, 4 시간 배양한 후 2.5 ℓ 플라스크에 TB 110 ㎖을 분주하여 1:100 접종하였다. OD600=0.6까지 배양한 후 20 분간 25℃, 250 rpm에서 cooling 과정을 거친 후 0.2% arabinose, 1 mM IPTG를 첨가하여 25℃, 250 rpm, 20 시간 동안 과발현 하였다. 과발현 후 OD600값을 측정하여 normalize된 양 만큼씩 14000 rpm, 1 분간 원심분리를 통해 세포를 수확하였다. 위의 spheroplast 제조 과정을 그대로 진행 한 후 tetrameric FcγRIIIa-Alexa 488 flour로 표지 후 1 ㎖의 PBS로 1회 세척하였다. 최종적으로 1 ㎖의 PBS로 resuspension한 샘플을 20 ㎖의 PBS에 희석하여 S3 Cell sorter(BioRad)를 이용해 상위 3%의 신호를 내는 세포들만 분리하여 취하였다. 분리한 세포들은 한 번 더 sorting을 진행하여 걸러내는 작업을 수행하였다. 걸러낸 세포들은 MJ#36, MJ#2 프라이머와 Taq polymerase(Biosesang)을 이용해 PCR로 유전자를 증폭하고 SfiI 제한효소 처리 라이게이션, transformation 과정을 거쳐 선별된 세포의 유전자들이 증폭된 서브라이브러리를 제작하였다. 이 과정을 총 5라운드에 걸쳐 반복한 후, 90여개의 individual 클론들을 각각 분석하여 FcγRIIIa와 높은 친화도를 보이는 변이체들을 선별하였다(도 6a 및 6b, 표 2, 돌연변이 위치는 Kabat EU 넘버링 시스템(Kabat et al., in “Sequences of Proteins of Immunological Interest”, 5th Ed., U.S. Department of Health and Human Services, NIH Publication No. 91-3242, 1991에서와 같은 EU 지수번호에 따름).
주요 변이체들의 점 돌연변이
Fc 변이체 점 돌연변이
A/IYG (서열목록 제5서열) T299A, K326I, A327Y, L328G
Fc1004 (서열목록 제3서열) S298G, T299A, E382V, N390D, M428L
Fc1004-IYG (서열목록 제7서열) S298G, T299A, K326I, A327Y, L328G, E382V, N390D, M428L
MG42 (서열목록 제9서열) (Fc1004-IYG)+264E, 350A, 421S
MG48 (서열목록 제11서열) (Fc1004-IYG)+264E, 350A
MG59 (서열목록 제13서열) (Fc1004-IYG)+264E
MG87 (서열목록 제15서열) (Fc1004-IYG)+264E, 421S
또한, 상기 변이체 이외에도 추가적으로 A/IYG보다 FcγRIIIa와 높은 친화도를 보이는 변이체들(MG61: (Fc1004-IYG)+T307S, MG86: (Fc1004-IYG)+C226R+F243L+K246E MG54: (Fc1004-IYG)+T250I+I253N 및 MG14:(Fc1004-IYG)+C347R)을 선별하였다(도 6c).
실시예 7: 발굴한 변이체를 동물세포에서 발현하기 위한 클로닝 및 발현 정제
발굴한 변이체들 중 MG59, MG87, MG48을 포함하여 대조군으로 사용할 야생형과 A/IYG를 HEK293F 세포에서 soluble한 IgG 형태로 제조하기 위하여 중쇄를 코딩하고 있는 'VH-CH1-CH2-CH3' 부분을 Vent polymerase와 프라이머 MJ#49, MJ#50을 사용해 PCR로 증폭한 뒤 BssHII, XbaI(New England Biolab)으로 제한효소 처리, 라이게이션하여 pMAZ-IgH(wild type), pMAZ-IgH(A/IYG), pMAZ-IgH(MG59), pMAZ-IgH(MG87), pMAZ-IgH(MG48)를 제작하였다. IgG 형태로 발현을 위해 pMAZ-IgL플라스미드와 함께 HEK 293F 세포에 co-transfection하고 300 ㎖ 규모로 임시발현 하였다. 배양이 끝난 배양액은 7000 rpm, 10 분간 원심분리를 통해 제거하고 상등액을 취해 25x PBS를 이용해 평형을 맞추었다. bottle top filter를 이용해 0.2 ㎛ 필터(Merck Millipore)로 여과하였다. PBS로 평형을 맞춘 Protein A agarose(Genscript) 1 ㎖ 슬러리를 첨가해 4℃, 16 시간 교반한 다음 폴리프로필렌 칼럼(Thermo Fisher Scientific)에 흘려주었다. pass-through solution을 취해 한 번 더 레진에 흘려서 바인딩 시킨 뒤, 1x PBS를 10 CV(Column Volume) 이상 흘려주어 세척하였다. 3 ㎖의 100 mM glycine-HCl(pH 2.7)로 elution을 받고 그 즉시 1 ㎖의 1 M Tris(pH 8.0)로 중성화 하였다. Amicon Ultra-4(Merck Millipore)을 통해 PBS로 버퍼를 교체한 후 농축 과정을 거쳐 SDS-PAGE(BioRad)를 통해 정제된 단백질을 확인하였다(도 7). SDS-PAGE 상에서 IgG 형태의 단백질(150 kDa)이 고순도로 정제되었음이 확인되었다.
실시예 8: 변이체들의 FcRs에 대한 결합력 확인을 위한 ELISA 분석
0.05 M Na2CO3 pH 9.6에 4 ㎍/㎖로 희석한 IgG Fc 변이체를 각각 50 ㎕ 씩 Flat Bottom Polystyrene High Bind 96 well microplate(costar)에 4℃, 16 시간 동안 고정화 한 후 100 ㎕의 5% BSA(in 0.05% PBST)로 상온에서 2 시간 동안 블로킹하였다. 0.05% PBST 180 ㎕로 4 회씩 세척한 뒤 blocking solution으로 serially dilution 된 FcRs를 50 ㎕ 각 well에 분주하여 상온에서 1 시간 동안 반응시켰다. 세척 과정 후 anti-His-HRP conjugate (Sigma-Aldrich), anti-GST-HRP conjugate (GE Healthcare) 50 ㎕ 씩을 이용해 상온에서 1 시간 동안 항체 반응을 진행하고 세척 과정을 수행하였다. 1-Step Ultra TMB-ELISA Substrate Solution(Thermo Fisher Scientific) 50 ㎕ 씩 첨가해 발색 한 뒤 2 M H2SO4 50 ㎕ 씩 넣어주어 반응을 종료 시킨 다음 Epoch Microplate Spectrophotometer(BioTek)을 이용해 분석하였다(도 8). 각 실험은 모두 duplicate으로 진행하였으며 ELISA 결과 각각의 FcRs[FcγRI, FcγRIIa(H), FcγRIIa(R), FcγRIIb, FcRn)에 대한 결합력을 확인할 수 있었다.
실시예 9: SPR을 통한 FcγRIIIa와 trastuzumab 변이체들의 KD value측정
BIAcore T200(GE Healthcare)을 사용하여 trastuzumab 변이체들의 결합력을 측정하였다. 야생형 무당화 항체(Aglyco-T), A/IYG, 야생형 당화 항체(Glyco-T; HEK 293F 세포 배양을 통해 생산), Herceptin(CHO 세포에서 생산된 임상 약물, MG48, MG59를 각각 amine coupling을 이용하여 CM5 chip에 고정화 하고, HBS-EP buffer(10 mM HEPES pH 7.4, 150 mM NaCl, 3.4 mM EDTA, and 0.005% P20 surfactant)(GE Healthcare)를 사용하여 dimeric FcγRIIIa-V158-GST, FcγRIIa-F158-GST를 주입하여 결합력을 분석하였다(도 9). CM5 chip의 regeneration은 50 mM glycine pH 3.9와 50 mM glycine pH 9.5, 3 M NaCl을 이용해 순차적으로 진행하였다. Monovalent receptor binding 상태의 equilibrium dissociation constants(KD)를 계산하기 위하여 BIAevaluation 3.2 software(GE Healthcare)의 2:1 bivalent analyte model을 활용하였다(표 3).
변이체들의 SPR KD value
KD(M) Fold increase(V / F)
FcγRIIIa(158V) FcγRIIIa(158F)
Aglyco-T N.D N.D 0
A/IYG 1.110 X 10-6 1.737 X 10-5 1
Glyco-T (HEK) 1.200 X 10-7 5.782 X 10-6 9.25 / 3.00
Herceptin (CHO) 8.418 X 10-8 5.142 X 10-6 13.19 / 3.38
MG48 6.793 X 10-8 6.763 X 10-7 16.34 / 25.68
MG59 1.070 X 10-7 1.049 X 10-6 10.37 / 16.56
그 결과 본 연구를 통해 발굴한 MG48과 MG59가 A/IYG와 비교하여 FcγRIIIa-V158에 대해서는 최고 16배, FcγRIIa-F158에 대해서는 최고 25배 이상 결합력이 증가된 것을 확인할 수 있었다.
실시예 10: Target cell인 SKBR-3와 MCF-7의 HER2 발현 정도 확인 실험
100 mm dish에 배양된 세포(80% confluency)는 배양액을 제거하고 DPBS로 1회 세척 후 Accutase(Merck Millipore) 1.5 ㎖를 처리하여 2-3 분간 37℃ CO2 incubator에 incubation 하였다. 세포가 dish의 바닥에서 떨어진 것을 확인한 후 세포배양 배지 6 ㎖을 첨가하였다. 10 ㎖ 피펫을 이용하여 세포를 포함한 모든 solution을 취한 후 15 ㎖ tube에 담아 1200 rpm, 3 분간 원심분리 한 후 15 ㎖ tube 내의 solution을 모두 제거하고 DPBS 5 ㎖을 15 ㎖ tube에 넣고 세포와 잘 혼합한 뒤 1200 rpm, 3 분간 원심분리 하였다. Tube 내 DPBS를 제거하고 washing buffer (PBS+1% BSA) 3 ㎖를 15 ㎖ tube에 넣고 세포와 잘 혼합한 후 1200 rpm, 3 분간 원심분리 후 tube 내 washing buffer를 제거한다. 위의 세척 과정을 2회 반복한 후, 최종 1 ㎖의 washing buffer를 첨가하여 세포와 잘 혼합하였다. FACS tube(Falcon)는 각 세포마다 non-staining, isotype control(normal human IgG-Alexa488), trastuzumab-alexa488로 표기하여 준비하였다. 세포를 계수하여 tube 당 1 X 105 cell/300 ㎕씩 분주하였다. 4℃에서 15 분간 블로킹을 실시하고 원심분리를 통해 cell down 시키고 상층액은 제거하였다. FACS tube에 washing buffer 100 ㎕씩 분주한 후 세포와 잘 혼합하였다. Non-staining을 제외하고 isotype control과 trastuzumab-alexa488을 1 ㎍씩 첨가하였다. 알루미늄 호일로 차광한 후 30 분 동안 4℃에서 항체 반응을 진행한 다음 반응이 완료되면 원심분리를 통해 세포만 남기고 상층액을 제거한다. Washing buffer 1 ㎖씩 첨가하여 세척 과정을 3 회 반복 실시하였다. Running buffer(PBS) 300 ㎕를 각 tube에 첨가하여 세포와 잘 혼합한 후 FACS 분석을 실시하였다. 그 결과 SKBR-3는 MCF-7에 비해 훨씬 높은 HER2 발현을 보이는 것을 확인하였다(도 10). 따라서 HER2를 표적으로 하는 항체 시료의 ADCC 활성 평가에는 MCF-7에 비해 HER2의 발현이 높은 SKBR-3가 보다 적합한 target cell로 확인되었다.
실시예 11: ADCC를 위한 Effector cell( PBMC ): Target cell ( SKBR -3, MCF - 7)의 비율 결정을 위한 예비실험
Target cell인 SKBR-3, MCF-7을 배양하고 Target cell을 1 X 104 cells/50 ㎕/well로 96-well V-bottom plate(Corning)에 seeding한 후 trastuzumab(20 ㎍/ml)을 well당 10 ㎕씩 첨가한다. PBMC(CTL, 표 4)는 37℃ water bath에서 quick thawing하여 상온에서 DNase I을 30분간 처리하고 세포를 계수한 후, 각 well 당 비율에 따라 적정 수의 PBMC를 첨가하였다.
PBMC 공여자 정보
Sample ID# Ethnicity Age Gender ABO/PH
20091026 Caucasian 24 Male A/POS
20100412 Hispanic 30 Male A/POS
HHU20120530 African/American 35 Male AB/POS
HHU20130318 Asian 38 Male A/POS
HHU20150924 Asian/Filipino 40 Male A/POS
Effector cell: Target cell 비율은 1.5625:1, 3.125:1, 6.25:1, 12.5:1, 25:1로 하여 진행하였으며, 100xg, 1 분간 원심분리를 한 뒤, 37℃, CO2 incubator에서 4 시간 동안 배양하였다. 4 시간 후, plate를 300xg, 3 분간 원심분리 한 뒤 상층액 50 ㎕를 취하여 SpectraPlate-96-well plate(PerkinElmer)에 옮긴 후, CytoTox 96® Reagent(Promega)를 각 well당 50 ㎕ 씩 첨가하여 30 분간 상온에서 incubation 하였다. 50 ㎕의 Stop solution을 첨가하여 반응을 종료 시킨 다음 490 nm에서 흡광도를 측정하였다. 본 과정을 duplicate로 3회 반복 시험하여 평균값을 취하였다. 그 결과 HER2 발현이 높은 SKBR-3(1 X 104 cells/well)을 target cell로 사용하고, effector cell로 PBMC를 사용한 ADCC assay에서 effector cell 수 의존적인 cytotoxicity 증가를 보였으며, HER2 발현이 낮은 MCF-7의 경우도 effector cell수 의존적인 cytotoxicity 증가를 보였으나, HER2 발현이 높은 SKBR-3에 비해서는 낮은 증가율을 보였다(도 11). HER2 발현이 높은 SKBR-3에 대한 cytotoxicity가 HER2 발현이 낮은 MCF-7에 비해 높아, cytotoxicity가 HER2 특이적임을 보여주고 있으며, effector cell로 사용하는 PBMC의 FcγRIIIa F/V variant 분포 차를 고려하여, ADCC 활성 평가를 위한 effector cell:target cell 비율은 최소 25:1 이상으로 사용하는 것이 적절하다고 확인하였다(표 5).
Effector: Target cell 비율에 따른 ADCC 정도
Effector: Target % Cytotoxicity
SKBR-3 MCF-7
1.5625 : 1 1.65 0.23
3.125 : 1 2.00 0.98
6.25 : 1 13.54 1.01
12.5 : 1 17.47 7.00
25 : 1 40.21 10.38
실시예 12: Human PBMC를 사용한 Herceptin variants의 ADCC 활성 비교 평가
SKBR-3와 MCF-7을 배양하고 96-well plate(V-bottom)에 well당 1 x 104 cells/50 ㎕)로 seeding한 후, 시험물질을 0, 0.032, 0.16, 0.8, 4, 20 ㎍/㎖로 각 well당 10 ㎕ 씩 첨가하였다. PBMC는 5개 individual PBMC를 pooling 하여 37℃ water bath에서 quick thawing한 후, DNase I을 실온에서 30 분간 처리하였다. 세포를 계수하고, 각 well 당 2.5 x 105 cells/50 ㎕의 PBMC를 첨가한 다음 plate를 100xg에서 1 분간 원심분리, 37℃ CO2 incubator에서 4 시간 배양을 통해 반응을 진행하였다. 4 시간 후, plate를 꺼내 300xg에서 3 분간 원심분리하고 상층액 50 ㎕를 취하여 SpectraPlate-96-well plate에 옮긴 후, 각 well 당 CytoTox 96® Reagent 50 ㎕를 첨가하여 30 분간 실온에서 반응을 진행하였다. Stop solution 50 ㎕를 첨가하여 반응을 종료시킨 후, 490 nm에서 흡광도를 측정하였다. 본 과정을 duplicate로 독립적인 3회의 반복 시험 후 평균값을 % Cytotoxicity로 나타내었다. HER2 고발현 세포주인 SKBR-3에서는 % Cytotoxicity가 4-31%로 높게 나타나고 HER2 저발현 세포주인 MCF-7에서는 2-15%로 낮게 나타나는 것으로 보아 시험물질의 표적 특이적인 세포 독성을 확인하였으며, 야생형 무당화 항체와 인간 IgG 항체에 비해 암세포 사멸 효과가 월등히 향상된 것을 확인하였다(도 12).
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (21)

  1. 인간 항체 Fc 도메인을 포함하는 폴리펩타이드로서, 상기 Fc 도메인은 카밧 넘버링 시스템(Kabat numbering system)에 따른 아미노산 치환을 포함하는 것을 특징으로 하는 폴리펩타이드:
    a) S298G, T299A, K326I, A327Y, L328G, E382V, N390D 및 M428L의 8가지 아미노산 치환; 및
    b) C226R, F243L, K246E, T250I, I253N, V264E, T307S, C347R, T350A, S400T 및 N421S로 구성된 군으로부터 선택되는 1 이상의 추가적인 아미노산 치환.
  2. 제 1 항에 있어서, 상기 폴리펩타이드는 하기의 9가지 아미노산 치환을 포함하는 것을 특징으로 하는 폴리펩타이드: V264E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D 및 M428L.
  3. 제 1 항에 있어서, 상기 폴리펩타이드는 하기의 9가지 아미노산 치환을 포함하는 것을 특징으로 하는 폴리펩타이드: S298G, T299A, T307S, K326I, A327Y, L328G, E382V, N390D 및 M428L.
  4. 제 1 항에 있어서, 상기 폴리펩타이드는 하기의 9가지 아미노산 치환을 포함하는 것을 특징으로 하는 폴리펩타이드: S298G, T299A, K326I, A327Y, L328G, C347R, E382V, N390D 및 M428L.
  5. 제 1 항에 있어서, 상기 폴리펩타이드는 하기의 10가지 아미노산 치환을 포함하는 것을 특징으로 하는 폴리펩타이드: V264E, S298G, T299A, K326I, A327Y, L328G, T350A, E382V, N390D 및 M428L.
  6. 제 1 항에 있어서, 상기 폴리펩타이드는 하기의 10가지 아미노산 치환을 포함하는 것을 특징으로 하는 폴리펩타이드: T250I, I253N, S298G, T299A, K326I, A327Y, L328G, E382V, N390D 및 M428L.
  7. 제 1 항에 있어서, 상기 폴리펩타이드는 하기의 10가지 아미노산 치환을 포함하는 것을 특징으로 하는 폴리펩타이드: V264E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D, N421S 및 M428L.
  8. 제 1 항에 있어서, 상기 폴리펩타이드는 하기의 11가지 아미노산 치환을 포함하는 것을 특징으로 하는 폴리펩타이드: V264E, S298G, T299A, K326I, A327Y, L328G, T350A, E382V, N390D, N421S 및 M428L.
  9. 제 1 항에 있어서, 상기 폴리펩타이드는 하기의 11가지 아미노산 치환을 포함하는 것을 특징으로 하는 폴리펩타이드: C226R, F243L, K246E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D 및 M428L.
  10. 제 1 항에 있어서, 상기 아미노산 치환을 포함하는 Fc 도메인은 S298G, T299A, K326I, A327Y, L328G, E382V, N390D 및 M428L의 8가지 아미노산만이 치환된 Fc 도메인과 비교하여 FcγRIIIa에 대한 결합력이 향상된 것을 특징으로 하는 폴리펩타이드.
  11. 제 1 항의 폴리펩타이드를 포함하는 무당화 항체.
  12. 제 1 항의 폴리펩타이드를 코딩하는 핵산분자.
  13. 제 12 항의 핵산분자를 포함하는 벡터.
  14. 제 13 항의 벡터를 포함하는 숙주세포.
  15. 제 14 항에 있어서, 상기 숙주세포는 세균세포인 것을 특징으로 하는 숙주세포.
  16. 제 1 항의 폴리펩타이드, 제 11 항의 무당화 항체, 제 12 항의 핵산분자 또는 제 13 항의 벡터를 포함하는 조성물.
  17. 제 16 항에 있어서 상기 조성물은 암의 예방 또는 치료용 약제학적 조성물인 것을 특징으로 하는 조성물.
  18. 제 1 항의 폴리펩타이드, 제 11 항의 무당화 항체, 제 12 항의 핵산분자 또는 제 13 항의 벡터의 약제학적 유효량을 객체(subject)에 투여하는 단계를 포함하는 암의 예방 또는 치료 방법.
  19. 하기의 단계를 포함하는 인간 항체 Fc 도메인을 포함하는 폴리펩타이드의 제조방법:
    a) 제 1 항의 폴리펩타이드를 코딩하는 핵산분자를 포함하는 벡터를 포함하는 숙주세포를 배양하는 단계; 및
    b) 상기 숙주세포에 의해 발현된 폴리펩타이드를 회수하는 단계.
  20. 하기의 단계를 포함하는 무당화 항체의 제조방법:
    a) 제 1 항의 폴리펩타이드를 포함하는 무당화 항체를 발현하는 숙주세포를 배양하는 단계; 및
    b) 상기 숙주세포로부터 발현된 항체를 정제하는 단계.
  21. 하기의 단계를 포함하는 FcγRIIIa에 결합하는 Fc 도메인을 포함하는 폴리펩타이드의 스크리닝 방법:
    a) 카밧 넘버링 시스템에 따른 S298G, T299A, K326I, A327Y, L328G, E382V, N390D 및 M428L의 8가지 아미노산 치환을 포함하는 Fc 도메인에 추가적으로 무작위적인 점 돌연변이를 가한 Fc 도메인을 포함하는 폴리펩타이드의 라이브러리를 구축하는 단계; 및
    b) 상기 라이브러리에서, 상기 8가지 아미노산이 치환된 Fc 도메인보다 FcγRIIIa에 결합력이 향상된 Fc 도메인을 포함하는 폴리펩타이드를 선별하는 단계.
PCT/KR2017/009153 2016-10-27 2017-08-22 암 치료용 무당화 항체 Fc 영역 WO2018079997A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU2017348982A AU2017348982B2 (en) 2016-10-27 2017-08-22 Aglycosylated antibody Fc region for treating cancer
GB1907421.0A GB2571036B (en) 2016-10-27 2017-08-22 Aglycosylated antibody Fc region for treating cancer
DE112017005457.5T DE112017005457T5 (de) 2016-10-27 2017-08-22 Fc-bereich von aglykosylierten antikörpern zur krebsbehandlung
US16/345,062 US11414493B2 (en) 2016-10-27 2017-08-22 Aglycosylated antibody Fc region for treating cancer
US17/861,920 US20220348654A1 (en) 2016-10-27 2022-07-11 AGLYCOSYLATED ANTIBODY Fc REGION FOR TREATING CANCER

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR1020160141118A KR101883886B1 (ko) 2016-10-27 2016-10-27 암 치료용 무당화 항체 Fc 영역
KR10-2016-0141118 2016-10-27
KR1020160148002A KR101900384B1 (ko) 2016-11-08 2016-11-08 Ｆｃγ 수용체에 대한 결합 특이성이 향상된 무당화 항체 Ｆｃ 영역
KR10-2016-0148002 2016-11-08

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/345,062 A-371-Of-International US11414493B2 (en) 2016-10-27 2017-08-22 Aglycosylated antibody Fc region for treating cancer
US17/861,920 Division US20220348654A1 (en) 2016-10-27 2022-07-11 AGLYCOSYLATED ANTIBODY Fc REGION FOR TREATING CANCER

Publications (1)

Publication Number Publication Date
WO2018079997A1 true WO2018079997A1 (ko) 2018-05-03

Family

ID=62023781

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/009153 WO2018079997A1 (ko) 2016-10-27 2017-08-22 암 치료용 무당화 항체 Fc 영역

Country Status (5)

Country Link
US (2) US11414493B2 (ko)
AU (1) AU2017348982B2 (ko)
DE (1) DE112017005457T5 (ko)
GB (1) GB2571036B (ko)
WO (1) WO2018079997A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113121677B (zh) * 2019-12-31 2023-06-27 周易 一种得到高纯度异源抗体的方法

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050054832A1 (en) * 2002-03-01 2005-03-10 Xencor, Inc. Optimized Fc variants and methods for their generation
US20090136936A1 (en) * 2007-05-01 2009-05-28 George Georgiou Immunoglobulin fc libraries
US20100184959A1 (en) * 2007-03-19 2010-07-22 Medimmune Limited Polypeptide Variants
US8815237B2 (en) * 2007-12-05 2014-08-26 Massachusetts Institute Of Technology Aglycosylated immunoglobulin mutants

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6737056B1 (en) * 1999-01-15 2004-05-18 Genentech, Inc. Polypeptide variants with altered effector function
WO2008092117A2 (en) 2007-01-25 2008-07-31 Xencor, Inc. Immunoglobulins with modifications in the fcr binding region
AU2012214643B2 (en) * 2011-02-07 2016-12-15 Research Development Foundation Engineered immunoglobulin Fc polypeptides
US20160215061A1 (en) * 2013-10-08 2016-07-28 Merck Sharp & Dohme Corp. Fc CONTAINING POLYPEPTIDES HAVING INCREASED BINDING TO FcGammaRIIB
KR101926263B1 (ko) 2017-06-16 2018-12-06 션쩐 맨내이 코스메틱 컴퍼니 리미티드 마조람, 몰로키아 및 레몬밤 혼합 발효추출물을 함유하는 피부 개선용 화장료 조성물

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050054832A1 (en) * 2002-03-01 2005-03-10 Xencor, Inc. Optimized Fc variants and methods for their generation
US20100184959A1 (en) * 2007-03-19 2010-07-22 Medimmune Limited Polypeptide Variants
US20090136936A1 (en) * 2007-05-01 2009-05-28 George Georgiou Immunoglobulin fc libraries
US8815237B2 (en) * 2007-12-05 2014-08-26 Massachusetts Institute Of Technology Aglycosylated immunoglobulin mutants

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
JO, MIGYEONG: "Isolation of Aglycosylated IgG Antibody Fc Variants for NK Cell -mediated Tumor Cell Killing", GRADUATE SCHOOL OF KOOKMIN UNIVERSITY, MASTER'S THESIS, December 2015 (2015-12-01), pages i - vii and 1-41 *

Also Published As

Publication number Publication date
US20190352396A1 (en) 2019-11-21
GB2571036B (en) 2022-09-07
AU2017348982B2 (en) 2021-12-16
DE112017005457T5 (de) 2019-07-11
US11414493B2 (en) 2022-08-16
US20220348654A1 (en) 2022-11-03
GB2571036A (en) 2019-08-14
GB201907421D0 (en) 2019-07-10
AU2017348982A1 (en) 2019-05-23

Similar Documents

Publication Publication Date Title
WO2018186717A1 (ko) 혈중 반감기 향상을 위한 항체 Fc 변이체들
JP2022106950A (ja) モノクローナル抗ＩＬ－１ＲＡｃＰ抗体
JP2016014020A (ja) 最適化されたＦｃ変異株
JP2016082962A (ja) 糖鎖切断抗体の製造方法及び均一糖鎖抗体
JP2020508666A (ja) 認知障害を治療または予防するためのヒト化抗体、その製造プロセス、及びそれを用いた認知障害を治療または予防するための薬剤
US20220348654A1 (en) AGLYCOSYLATED ANTIBODY Fc REGION FOR TREATING CANCER
KR101900384B1 (ko) Ｆｃγ 수용체에 대한 결합 특이성이 향상된 무당화 항체 Ｆｃ 영역
KR101883886B1 (ko) 암 치료용 무당화 항체 Fc 영역
WO2020116963A1 (ko) 엔도텔린 수용체 a 활성 조절 항체
WO2020242200A1 (ko) 엔도텔린 수용체 a 결합력이 향상된 항체
WO2022216014A1 (ko) 항-cntn4 항체 및 그의 용도
WO2019078591A1 (ko) 세포막 유동성을 이용한 다중체 단백질 디스플레이 시스템
WO2022131889A1 (ko) Taci 단백질의 용도
CN114805592A (zh) 一种三特异性抗体的设计、制备及用途
WO2023043124A1 (ko) Fcγrⅲa 결합력이 향상된 당화 fc 변이체들
WO2023043123A1 (ko) Fcγrⅲa 선택적 결합력 향상 당화 fc 변이체들
WO2023043127A1 (ko) Fc 감마 수용체와의 결합력이 증대된 fc 변이체
WO2023043125A1 (ko) 다양한 fc 감마 수용체들과의 결합력이 증대된 fc 변이체
WO2023191117A1 (ko) 친화도가 성숙된 cd47에 특이적인 인간화 항체
WO2024005423A1 (ko) 인간 FCγRS 결합력이 제거된 당화 FC 변이체들
WO2023068710A1 (ko) PH-의존 FCRN 결합력과 FCγRⅢA 결합 선택성이 향상된 FC 변이체들
WO2023101438A1 (ko) Smo 인간 항체
TWI839729B (zh) 與Fc受體結合改變的Fc突變體
WO2022124764A1 (ko) Cd47에 특이적인 항체 및 이의 용도
WO2022233320A1 (zh) 与Fc受体结合改变的Fc突变体

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17865970

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017348982

Country of ref document: AU

Date of ref document: 20170822

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 201907421

Country of ref document: GB

Kind code of ref document: A

Free format text: PCT FILING DATE = 20170822

122 Ep: pct application non-entry in european phase

Ref document number: 17865970

Country of ref document: EP

Kind code of ref document: A1