WO2018067879A1 - Alk4:actriib heteromultimers and uses thereof - Google Patents

Alk4:actriib heteromultimers and uses thereof Download PDF

Info

Publication number
WO2018067879A1
WO2018067879A1 PCT/US2017/055426 US2017055426W WO2018067879A1 WO 2018067879 A1 WO2018067879 A1 WO 2018067879A1 US 2017055426 W US2017055426 W US 2017055426W WO 2018067879 A1 WO2018067879 A1 WO 2018067879A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
position corresponding
alk4
amino acid
actriib
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/055426
Other languages
English (en)
French (fr)
Inventor
Ravindra Kumar
Asya Grinberg
Dianne S. Sako
Roselyne CASTONGUAY
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Acceleron Pharma Inc
Original Assignee
Acceleron Pharma Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Acceleron Pharma Inc filed Critical Acceleron Pharma Inc
Priority to EP17859224.2A priority Critical patent/EP3522913A4/en
Priority to CA3039573A priority patent/CA3039573A1/en
Priority to AU2017338921A priority patent/AU2017338921A1/en
Priority to CN201780075170.8A priority patent/CN110678195A/zh
Priority to KR1020197012900A priority patent/KR20190075078A/ko
Priority to BR112019006993A priority patent/BR112019006993A2/pt
Priority to JP2019518299A priority patent/JP7219705B2/ja
Publication of WO2018067879A1 publication Critical patent/WO2018067879A1/en
Anticipated expiration legal-status Critical
Priority to JP2022157844A priority patent/JP2022177286A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/04Drugs for skeletal disorders for non-specific disorders of the connective tissue
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K19/00Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • C07K2317/526CH3 domain
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/32Fusion polypeptide fusions with soluble part of a cell surface receptor, "decoy receptors"
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11Protein-serine/threonine kinases (2.7.11)
    • C12Y207/1103Receptor protein serine/threonine kinase (2.7.11.30)
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • TGF-beta The transforming growth factor-beta (TGF-beta) superfamily contains a variety of growth factors that share common sequence elements and structural motifs. These proteins are known to exert biological effects on a large variety of cell types in both vertebrates and invertebrates. Members of the superfamily perform important functions during embryonic development in pattern formation and tissue specification and can influence a variety of differentiation processes, including adipogenesis, myogenesis, chondrogenesis,
  • TGF-beta family members have diverse, often complementary biological effects. By manipulating the activity of a member of the TGF-beta family, it is often possible to cause significant physiological changes in an organism.
  • GDF8 also called myostatin
  • inactive alleles of GDF8 are associated with increased muscle mass and, reportedly, exceptional strength [Schuelke et al. (2004) N Engl J Med 350:2682-8].
  • Changes in fibrosis, muscle, bone, fat, and other tissues may be achieved by enhancing or inhibiting intracellular signaling (e.g., SMAD 1, 2, 3, 5, and/or 8) that is mediated by ligands of the TGF-beta family.
  • intracellular signaling e.g., SMAD 1, 2, 3, 5, and/or 8
  • an ALK4:ActRIIB heterodimer protein is a unique antagonist of ligands of the TGF-beta superfamily, exhibiting a different ligand-binding profile/selectivity compared to corresponding ActRIIB and ALK4
  • an exemplary ALK4:ActRIIB heterodimer displays enhanced binding to activin B compared to either homodimer, retains strong binding to activin A, GDF8, and GDFl 1 as observed with ActRIIB homodimer, and exhibits substantially reduced binding to BMP9, BMP10, and GDF3.
  • the ALK4: ActRIIB heterodimer displays low to no observable affinity for BMP9, whereas this ligand binds strongly to ActRIIB homodimer. See Figure 4.
  • ALK4 ActRIIB heterodimers are a more selective antagonists (inhibitors) of certain ligands of the TGF-beta superfamily compared to ActRIIB homodimers. Accordingly, an ALK4: ActRIIB
  • heterodimer will be more useful than an ActRIIB homodimer in certain applications where such selective antagonism is advantageous.
  • Examples include therapeutic applications where it is desirable to antagonize one or more of activin (e.g., activin A, activin B, activin AB, activin AC), GDF8, and GDFl 1 with decreased antagonism of one or more of BMP9, BMP 10, and GDF3.
  • ALK4:ActRIIB heterodimer produced certain biological effects strikingly similar to those of an ActRIIB homodimer despite differential ligand selectivity of the two complexes.
  • ALK4:ActRIIB heterodimer exerts beneficial anabolic effects on skeletal muscle and bone as well as catabolic effects on adipose tissue, very similar to those of an ActRIIB-Fc homodimer.
  • ActRIIB :ALK4 heterodimer exhibits only low-affinity or transient binding to BMP9 and BMP 10 and so should have little to no concurrent inhibition on processes mediated by those ligands, such as angiogenesis.
  • ALK4:ActRIIB heterodimer had various beneficial effects in a mouse model of kidney disease, particularly on treating or preventing kidney damage, inflammation, and fibrosis.
  • ALK4:ActRIIB heteromultimers as well as variants thereof, that bind to/inhibit at least one or more of activin (e.g., activin A, activin B, activin AB, and activin AC), GDF8, and/or GDFl 1 will be useful agents for promoting beneficial anabolic effects on skeletal muscle and bone, catabolic effects on adipose tissue, and beneficial effects on kidney disease.
  • activin e.g., activin A, activin B, activin AB, and activin AC
  • GDF8 and/or GDFl 1 will be useful agents for promoting beneficial anabolic effects on skeletal muscle and bone, catabolic effects on adipose tissue, and beneficial effects on kidney disease.
  • the present disclosure relates, in part, to heteromultimer complexes
  • ALK4 polypeptides comprising at least one ALK4 polypeptide and at least one ActRIIB polypeptide (ALK4:ActRIIB heteromultimers).
  • ALK4 polypeptides comprise a ligand-binding domain of an ALK4 receptor, for example, a portion of the ALK4
  • ActRIIB polypeptides generally comprise a ligand-binding domain of an ActRIIB receptor, for example, a portion of the ActRIIB extracellular domain.
  • ALK4 and ActRIIB polypeptides, as well as resultant heteromultimers thereof are soluble.
  • such ALK4 and ActRIIB polypeptides, as well as resultant heteromultimers thereof are recombinant proteins.
  • such ALK4 and ActRIIB polypeptides, as well as resultant heteromultimers thereof are isolated proteins.
  • an ALK4: ActRIIB heteromultimer comprises an ALK4 domain comprising an amino acid sequence that is at least 70% identical to a polypeptide that begins at any one of amino acids 24-34 of SEQ ID NO: 9 (e.g., amino acids 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, and 34) and ends at any one of amino acids 101-126 of SEQ ID NO: 9 (e.g., amino acids 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, and 126).
  • ALK4: ActRIIB heteromultimers may comprise an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to amino acids 34-101 of SEQ ID NO: 9.
  • ALK4: ActRIIB heteromultimers may comprise an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to amino acids 24-126 of SEQ ID NO: 9.
  • ALK4: ActRIIB heteromultimers may comprise an ALK4 amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 10.
  • an ALK4: ActRIIB heteromultimer comprises an ALK4 domain comprising an amino acid sequence that is at least 70% identical to a polypeptide that begins at any one of amino acids 24-34 of SEQ ID NO: 19 (e.g., amino acids 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, and 34) and ends at any one of amino acids 101-126 of SEQ ID NO: 19 (e.g., amino acids 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, and 126).
  • ALK4: ActRIIB heteromultimers may comprise an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to amino acids 34-101 of SEQ ID NO: 19.
  • ALK4:ActRIIB heteromultimers may comprise an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to amino acids 24-126 of SEQ ID NO: 19.
  • ALK4:ActRIIB heteromultimers may comprise an ALK4 amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 20.
  • an ALK4:ActRIIB heteromul timer comprises an ActRIIB domain comprising an amino acid sequence that is at least 70% identical to a polypeptide that begins at any one of amino acids 20-29 of SEQ ID NO: 1 (e.g., amino acids 20, 21, 22, 23, 24, 25, 26, 27, 28, and 29) and ends at any one of amino acids 109-134 (109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, and 134) of SEQ ID NO: 1.
  • ALK4: ActRIIB heteromultimers may comprise an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to amino acids 29-109 of SEQ ID NO: 1.
  • ALK4: ActRIIB heteromultimers may comprise an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to amino acids 25-131 of SEQ ID NO: 1.
  • ALK4: ActRIIB heteromultimers may comprise an ActRIIB amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2.
  • ALK4:ActRIIB heteromultimers may comprise an ActRIIB amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3.
  • ALK4:ActRIIB heteromultimers do not comprise an ActRIIB polypeptide comprising an acidic amino acid (e.g., the naturally occurring amino acids E or D or an artificial acidic amino acid) at the position corresponding to L79 of SEQ ID NO: 1.
  • an acidic amino acid e.g., the naturally occurring amino acids E or D or an artificial acidic amino acid
  • an ALK4: ActRIIB heteromul timer comprises an ActRIIB domain comprising an amino acid sequence that is at least 70% identical to a polypeptide that begins at any one of amino acids 20-29 of SEQ ID NO: 4 (e.g., amino acids 20, 21, 22, 23, 24, 25, 26, 27, 28, and 29) and ends at any one of amino acids 109-134 (109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, and 134) of SEQ ID NO: 4.
  • SEQ ID NO: 4 e.g., amino acids 20, 21, 22, 23, 24, 25, 26, 27, 28, and 29
  • ALK4:ActRIIB heteromultimers may comprise an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to amino acids 29-109 of SEQ ID NO: 4.
  • ALK4:ActRIIB heteromultimers may comprise an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to amino acids 25-131 of SEQ ID NO: 4.
  • ALK4:ActRIIB heteromultimers may comprise an ActRIIB amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 5.
  • ALK4:ActRIIB heteromultimers may comprise an ActRIIB amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 6.
  • ALK4:ActRIIB heteromultimers do not comprise an ActRIIB polypeptide comprising an acidic amino acid (e.g., the naturally occurring amino acids E or D or an artificial acidic amino acid) at the position corresponding to L79 of SEQ ID NO: 1.
  • an acidic amino acid e.g., the naturally occurring amino acids E or D or an artificial acidic amino acid
  • ALK4:ActRIIB heteromultimer structures include, for example, heterodimers, heterotrimers, heterotetramers, heteropentamers, and higher order
  • heteromultimer complexes See, e.g., Figure 6.
  • Figure 6 In certain preferred embodiments,
  • ALK4 ActRIIB heteromultimers are heterodimers.
  • ALK4 and/or ActRIIB polypeptides may be fusion proteins.
  • an ALK4 polypeptide may be a fusion protein comprising an ALK4 polypeptide domain and one or more heterologous (non-ALK4) polypeptide domains (e.g., ALK4-Fc fusion proteins).
  • an ActRIIB polypeptide may be a fusion protein comprising an ActRIIB polypeptide domain and one or more heterologous (non-ActRIIB) polypeptide domains (ActRIIB-Fc fusion proteins).
  • ALK4 polypeptides are fusion proteins that comprise an Fc domain of an immunoglobulin.
  • ActRIIB polypeptides are fusion proteins that comprise an Fc domain of an immunoglobulin.
  • Traditional Fc fusion proteins and antibodies are examples of unguided interaction pairs, whereas a variety of engineered Fc domains have been designed as asymmetric interaction pairs [Spiess et al (2015) Molecular Immunology 67(2A): 95-106]. Therefore, a first member and/or a second member of an interaction pair described herein may comprise a constant domain of an immunoglobulin, including, for example, the Fc portion of an immunoglobulin.
  • a first member of an interaction pair may comprise an amino acid sequence that is derived from an Fc domain of an IgG (IgGl, IgG2, IgG3, or IgG4), IgA (IgAl or IgA2), IgE, or IgM immunoglobulin.
  • immunoglobulin domains may comprise one or more amino acid modifications (e.g., deletions, additions, and/or substitutions) that promote ALK4:ActRIIB heteromultimer formation.
  • a second member of an interaction pair may comprise an amino acid sequence that is derived from an Fc domain of an IgG (IgGl, IgG2, IgG3, or IgG4), IgA (IgAl or IgA2), IgE, or IgM.
  • immunoglobulin domains may comprise one or more amino acid modifications (e.g., deletions, additions, and/or substitutions) that promote ALK4:ActRIIB heteromultimer formation.
  • the second member of an interaction pair may comprise, consist essentially of, or consist of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any one of SEQ ID NOs: 23-37.
  • a first member and a second member of an interaction pair comprise Fc domains derived from the same immunoglobulin class and subtype.
  • a first member and a second member of an interaction pair comprise Fc domains derived from different immunoglobulin classes or subtypes.
  • the disclosure relates to ALK4:ActRIIB heteromultimers comprising at least one ALK4-Fc fusion protein and at least one ActRIIB-Fc fusion protein wherein the ALK4-Fc fusion protein comprises one or more amino acid modifications (e.g., amino acid substitution, cationization, deamination, carboxyl-terminal amino acid heterogeneity, phosphorylation, and glycosylation) that alter the isoelectric point (pi) of the ALK4-Fc fusion protein and/or the ActRIIB-Fc fusion protein comprises one or more amino acid modifications that alter the pi of the ActRIIB-Fc fusion protein.
  • amino acid modifications e.g., amino acid substitution, cationization, deamination, carboxyl-terminal amino acid heterogeneity, phosphorylation, and glycosylation
  • the the one or more amino acid modifications in the ALK4-Fc fusion protein confers increased difference in pis between the ALK4-Fc fusion protein and the ActRIIB-Fc fusion protein. In other embodiments, the one or more amino acid modifications in the ActRIIB-Fc fusion protein confers increased difference in pis between the ActRIIB-Fc fusion protein and the ALK4-Fc fusion protein.
  • the one or more amino acid modifications in the ALK4-Fc fusion protein confers increased difference in pis between the ALK4-FC fusion protein and the ActRIIB-Fc fusion protein
  • the one or more amino acid modifications in the ActRIIB-Fc fusion protein confers increased difference in pis between the ActRIIB-Fc fusion protein and the ALK4-Fc fusion protein.
  • ALK4-FC fusion protein comprises one or more amino acid modifications that alter pi by at least 0.1 (e.g., by at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.7, 0.8. 0.9, 1.0, 1.3, 1.5, 1.7, 2.0, 2.3, 2.5,
  • the ActRIIB-Fc fusion protein comprises one or more amino acid modifications that alter pi by at least 0.1 (e.g., by at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.7, 0.8. 0.9, 1.0, 1.3, 1.5, 1.7, 2.0, 2.3, 2.5, 2.7, 3.0, 3.3, 3.5, 3.7, or at least by 4.0).
  • the ALK4-Fc fusion protein comprises one or more amino acid modifications that alter pi by at least 0.1 (e.g., by at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.7, 0.8.
  • the ActRIIB-Fc fusion protein comprises one or more amino acid modifications that alter pi by at least 0.1 (e.g., by at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.7, 0.8. 0.9, 1.0, 1.3, 1.5, 1.7, 2.0, 2.3, 2.5, 2.7, 3.0, 3.3, 3.5, 3.7, or at least by 4.0).
  • the ALK4-Fc fusion protein and the ActRIIB-Fc fusion protein have at least a 0.7 difference in pi (e.g., at least 0.7, 0.8, 0.9, 1.0, 1.1, 1.2., 1.3. 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, or at least 4.0 or more difference in pi).
  • a 0.7 difference in pi e.g., at least 0.7, 0.8, 0.9, 1.0, 1.1, 1.2., 1.3. 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6,
  • an ALK4:ActRIIB heteromultimer of the disclosure comprises an ALK4-FC fusion protein comprising one or more amino acid modifications that increase the pi of the ALK4-Fc fusion protein; and an ActRIIB-Fc fusion protein comprising one or more amino acid modifications that decrease the pi of the ActRIIB-Fc fusion protein.
  • an ALK4-FC fusion protein may be modified by substituting one or more neutral or negatively charged amino acids with one or more positively charged amino acids [e.g., an arginine (R), lysine (K), or histidine (H)].
  • an ActRIIB-Fc fusion protein may be modified by substituting one or more neutral or positively charged amino acids with one or more negatively charged amino acids [e.g., aspartic acid (E) or glutamic acid (D)].
  • the ALK4-Fc fusion protein Fc domain is an IgGl Fc domain that comprises one or more amino acid modifications that alter the pi of the ALK4-Fc fusion protein.
  • the ALK4-Fc fusion protein IgGl Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), or more identical to the amino acid sequence of SEQ ID NO: 31.
  • the ALK4-FC fusion protein IgGl Fc domain comprises one or more amino acid substitutions selected from: a) an amino acid substitution at the position corresponding to N162 of SEQ ID NO: 31; b) an amino acid substitution at the position corresponding to D179 of SEQ ID NO: 31; and c) an amino acid substitution at the position corresponding to N162 of SEQ ID NO: 31 and an amino acid substitution at the position corresponding to D179 of SEQ ID NO: 31.
  • the ALK4-Fc fusion protein IgGl Fc domain comprises one or more amino acid substitutions selected from: a) an arginine, lysine, or histidine substitution at the position corresponding to N162 of SEQ ID NO: 31 (N162R, N162K, or N162H); b) an arginine, lysine, or histidine substitution at the position corresponding to D 179 of SEQ ID NO: 31 (D179R, D179K, or D179H); and c) an arginine, lysine, or histidine substitution at the position corresponding to N162 of SEQ ID NO: 31 (N162R, N162K.
  • the ALK4-Fc fusion protein IgGl Fc domain comprises one or more amino acid substitutions selected from: a) an arginine substitution at the position corresponding to N162 of SEQ ID NO: 31 (N162R); b) an arginine substitution at the position corresponding to D179 of SEQ ID NO: 31 (D179R); and c) an arginine substitution at the position corresponding to N162 of SEQ ID NO: 31 (N162R) and an arginine substitution at the position corresponding to D179 of SEQ ID NO: 31
  • the ALK4-Fc fusion protein Fc domain is an IgG2 Fc domain that comprises one or more amino acid modifications that alter the pi of the ALK4-Fc fusion protein.
  • the ALK4-Fc fusion protein IgG2 Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 32.
  • the ALK4-Fc fusion protein IgG2 Fc domain comprises one or more amino acid substitutions selected from: a) an amino acid substitution at the position corresponding to N160 of SEQ ID NO: 32; b) an amino acid substitution at the position corresponding to D177 of SEQ ID NO: 32; and c) an amino acid substitution at the position corresponding to N160 of SEQ ID NO: 32 and an amino acid substitution at the position corresponding to D177 of SEQ ID NO: 32.
  • the ALK4-Fc fusion protein IgG2 Fc domain comprises one or more amino acid substitutions selected from: a) an arginine, lysine, or histidine substitution at the position corresponding to N160 of SEQ ID NO: 32 (N160R, N160K, or N160H); b) an arginine, lysine, or histidine substitution at the position corresponding to D177 of SEQ ID NO: 32 (D177R, D177K, or D177H); and c) an arginine, lysine, or histidine substitution at the position corresponding to N160 of SEQ ID NO: 32 (N160R, N160K, or N160H) and an arginine, lysine, or histidine substitution at the position corresponding to D177 of SEQ ID NO: 32 (D177R, D177K.
  • the ALK4-Fc fusion protein Fc domain is an IgG3 Fc domain that comprises one or more amino acid modifications that alter the pi of the ALK4-Fc fusion protein.
  • the ALK4-Fc fusion protein IgG3 Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), or more identical to the amino acid sequence of SEQ ID NO: 33.
  • the ALK4-FC fusion protein IgG3 Fc domain comprises one or more amino acid substitutions selected from: a) an amino acid substitution at the position corresponding to S169 of SEQ ID NO: 33; b) an amino acid substitution at the position corresponding to D186 of SEQ ID NO: 33; and c) an amino acid substitution at the position corresponding to S169 of SEQ ID NO: 33 and an amino acid substitution at the position corresponding to D186 of SEQ ID NO: 33.
  • the ALK4-Fc fusion protein IgG3 Fc domain comprises one or more amino acid substitutions selected from: a) an arginine, lysine, or histidine substitution at the position corresponding to SI 69 of SEQ ID NO: 33 (S169R, S169K, or S169H); b) an arginine, lysine, or histidine substitution at the position corresponding to D 186 of SEQ ID NO: 33 (D186R, D186K, or D186H); and c) an arginine, lysine, or histidine substitution at the position corresponding to SI 69 of SEQ ID NO: 33 (S169R, S169K, or S169H) and an arginine, lysine, or histidine substitution at the position corresponding to D 186 of SEQ ID NO: 33 (D186R, D186K, or D186H).
  • the ALK4-Fc fusion protein Fc domain is an IgG4 Fc domain that comprises one or more amino acid modifications that alter the pi of the ALK4-Fc fusion protein.
  • the ALK4-Fc fusion protein IgG4 Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 35.
  • the ALK4-Fc fusion protein IgG4 Fc domain comprises one or more amino acid substitutions selected from: a) an amino acid substitution at the position corresponding to N166 of SEQ ID NO: 35; b) an amino acid substitution at the position corresponding to D183 of SEQ ID NO: 35; and c) an amino acid substitution at the position corresponding to N166 of SEQ ID NO: 35 and an amino acid substitution at the position corresponding to D183 of SEQ ID NO: 35.
  • the ALK4-FC fusion protein IgG4 Fc domain comprises one or more amino acid substitutions selected from: a) an arginine, lysine, or histidine substitution at the position corresponding to N166 of SEQ ID NO: 35 (N166R, N166K, or N166H); b) an arginine, lysine, or histidine substitution at the position corresponding to D183 of SEQ ID NO: 35 (D183R, D183K, or D183H); and c) an arginine, lysine, or histidine substitution at the position corresponding to N166 of SEQ ID NO: 35 (N166R, N166K, or N166H) and an arginine, lysine, or histidine substitution at the position corresponding to D183 of SEQ ID NO: 32 (D183R, D183K.
  • the ActRIIB-Fc fusion protein Fc domain is an IgGl Fc domain that comprises one or more amino acid modifications that alter the pi of the ActRIIB- Fc fusion protein.
  • the ActRIIB-Fc fusion protein IgGl Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 31.
  • the ActRIIB-Fc fusion protein IgGl Fc domain comprises one or more amino acid substitutions selected from: a) an amino acid substitution at the position corresponding to K138 of SEQ ID NO: 31 ; b) an amino acid substitution at the position corresponding to K217 of SEQ ID NO: 31 ; and c) an amino acid substitution at the position corresponding to K138 of SEQ ID NO: 31 and an amino acid substitution at the position corresponding to K217 of SEQ ID NO: 31.
  • the ActRIIB-Fc fusion protein IgGl Fc domain comprises one or more amino acid substitutions selected from: a) an aspartic acid or glutamic acid substitution at the position corresponding to K138 of SEQ ID NO: 31 (K138E or K138D); b) an aspartic acid or glutamic acid substitution at the position corresponding to K217 of SEQ ID NO: 31 (K217E or K217D); and c) an aspartic acid or glutamic acid substitution at the position corresponding to K138 of SEQ ID NO: 31 (K138E or K138D) and an aspartic acid or glutamic acid substitution at the position corresponding to K217 of SEQ ID NO: 31 (K217E or K217D).
  • the ALK4-FC fusion protein IgGl Fc domain comprises one or more amino acid substitutions selected from: a) a glutamic acid substitution at the position corresponding to K138 of SEQ ID NO: 31 (K138E); b) an aspartic acid substitution at the position corresponding to K217 of SEQ ID NO: 31 (K217D); and c) a glutamic acid substitution at the position corresponding to K138 of SEQ ID NO: 31 (K138E) and an aspartic acid substitution at the position
  • the ActRIIB-Fc fusion protein Fc domain is an IgG2 Fc domain that comprises one or more amino acid modifications that alter the pi of the ActRIIB-Fc fusion protein.
  • the ActRIIB-Fc fusion protein IgG2 Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 32.
  • the ActRIIB-Fc fusion protein IgG2 fusion Fc domain comprises one or more amino acid substitutions selected from: a) an amino acid substitution at the position corresponding to K136 of SEQ ID NO: 32; b) an amino acid substitution at the position corresponding to K215 of SEQ ID NO: 32; and c) an amino acid substitution at the position corresponding to K136 of SEQ ID NO: 32 and an amino acid substitution at the position corresponding to K215 of SEQ ID NO: 32.
  • the ActRIIB-Fc fusion protein IgG2 Fc domain comprises one or more amino acid substitutions selected from: a) an aspartic acid or glutamic acid substitution at the position corresponding to K136 of SEQ ID NO: 32 (K136E or K136D); b) an aspartic acid or glutamic acid substitution at the position corresponding to K215 of SEQ ID NO: 32 (K215E or K215D); and c) an aspartic acid or glutamic acid substitution at the position corresponding to K136 of SEQ ID NO: 32 (K136E or K136D) and an aspartic acid or glutamic acid substitution at the position corresponding to K215 of SEQ ID NO: 32 (K215E or K215D).
  • the ActRIIB-Fc fusion protein Fc domain is an IgG3 Fc domain that comprises one or more amino acid modifications that alter the pi of the ActRIIB-Fc fusion protein.
  • the ActRIIB-Fc fusion protein IgG3 Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%), 98%), 99%), or more identical to the amino acid sequence of SEQ ID NO: 33.
  • the ActRIIB-Fc fusion protein IgG3 fusion Fc domain comprises one or more amino acid substitutions selected from: a) an amino acid substitution at the position
  • the modified ActRIIB-Fc fusion protein IgG3 Fc domain comprises one or more amino acid substitutions selected from: a) an aspartic acid or glutamic acid substitution at the position corresponding to K145 of SEQ ID NO: 33 (K145E or K145D); b) an aspartic acid or glutamic acid substitution at the position corresponding to K224 of SEQ ID NO: 33 (K224E or K224D); and c) an aspartic acid or glutamic acid substitution at the position corresponding to K145 of SEQ ID NO: 33 (K145E or K145D) and an aspartic acid or glutamic acid substitution at the position corresponding to K224 of SEQ ID NO: 33 (K224E or K224D).
  • the ActRIIB-Fc fusion protein Fc domain is an IgG4 Fc domain that comprises one or more amino acid modifications that alter the pi of the ActRIIB-Fc fusion protein.
  • the ActRIIB-Fc fusion protein IgG4 Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), or more identical to the amino acid sequence of SEQ ID NO: 35.
  • the ActRIIB-Fc fusion protein IgG4 fusion Fc domain comprises one or more amino acid substitutions selected from: a) an amino acid substitution at the position corresponding to
  • the ActRIIB-Fc fusion protein IgG4 Fc domain comprises one or more amino acid substitutions selected from: a) an aspartic acid or glutamic acid substitution at the position corresponding to K142 of SEQ ID NO: 35 (K142E or
  • K142D K142D
  • an ALK4:ActRIIB heteromultimer of the disclosure comprises an ActRIIB-Fc fusion protein comprising one or more amino acid modifications that increase the pi of the ActRIIB-Fc fusion protein; and an ALK4-Fc fusion protein comprising one or more amino acid modifications that decrease the pi of the ALK-Fc fusion protein.
  • an ActRIIB-Fc fusion protein may be modified by substituting one or more neutral or negatively charged amino acids with one or more positively charged amino acids [e.g., an arginine (R), lysine (K), or histidine (H)].
  • an ALK4-Fc fusion protein may be modified by substituting one or more neutral or positively charged amino acids with one or more negatively charged amino acids [e.g., aspartic acid (E) or glutamic acid (D)].
  • the ActRIIB-Fc fusion protein Fc domain is an IgGl Fc domain that comprises one or more amino acid modifications that alter the pi of the ALK4-Fc fusion protein.
  • the ActRIIB-Fc fusion protein IgGl Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), or more identical to the amino acid sequence of SEQ ID NO: 31. In some embodiments, the ActRIIB-Fc fusion protein IgGl Fc domain comprises one or more amino acid
  • substitutions selected from: a) an amino acid substitution at the position corresponding to N162 of SEQ ID NO: 31; b) an amino acid substitution at the position corresponding to D179 of SEQ ID NO: 31; and c) an amino acid substitution at the position corresponding to N162 of SEQ ID NO: 31 and an amino acid substitution at the position corresponding to D179 of SEQ ID NO: 31.
  • tthe ActRIIB-Fc fusion protein IgGl Fc domain comprises one or more amino acid substitutions selected from: a) an arginine, lysine, or histidine substitution at the position corresponding to N162 of SEQ ID NO: 31 (N162R, N162K, or N162H); b) an arginine, lysine, or histidine substitution at the position
  • the ActRIIB-Fc fusion protein IgGl Fc domain comprises one or more amino acid substitutions selected from: a) an arginine substitution at the position corresponding to N162 of SEQ ID NO: 31 (N162R); b) an arginine substitution at the position corresponding to D179 of SEQ ID NO: 31 (D179R); and c) an arginine substitution at the position corresponding to N162 of SEQ ID NO: 31 (N162R) and an arginine substitution at the position corresponding to D179 of SEQ ID NO: 31 (D179R).
  • the ActRIIB-Fc fusion protein Fc domain is an IgG2 Fc domain that comprises one or more amino acid modifications that alter the pi of the ActRIIB-Fc fusion protein.
  • the ActRIIB-Fc fusion protein IgG2 Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), or more identical to the amino acid sequence of SEQ ID NO: 32.
  • the ActRIIB-Fc fusion protein IgG2 Fc domain comprises one or more amino acid
  • substitutions selected from: a) an amino acid substitution at the position corresponding to N160 of SEQ ID NO: 32; b) an amino acid substitution at the position corresponding to D177 of SEQ ID NO: 32; and c) an amino acid substitution at the position corresponding to N160 of SEQ ID NO: 32 and an amino acid substitution at the position corresponding to D177 of SEQ ID NO: 32.
  • the ActRIIB-Fc fusion protein IgG2 Fc domain comprises one or more amino acid substitutions selected from: a) an arginine, lysine, or histidine substitution at the position corresponding to N160 of SEQ ID NO: 32 (N160R, N160K, or N160H); b) an arginine, lysine, or histidine substitution at the position
  • the ActRIIB-Fc fusion protein Fc domain is an IgG3 Fc domain that comprises one or more amino acid modifications that alter the pi of the ActRIIB-Fc fusion protein.
  • the ActRIIB-Fc fusion protein IgG3 Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), or more identical to the amino acid sequence of SEQ ID NO: 33.
  • the ActRIIB-Fc fusion protein IgG3 Fc domain comprises one or more amino acid
  • substitutions selected from: a) an amino acid substitution at the position corresponding to S169 of SEQ ID NO: 33; b) an amino acid substitution at the position corresponding to D186 of SEQ ID NO: 33; and c) an amino acid substitution at the position corresponding to S169 of SEQ ID NO: 33 and an amino acid substitution at the position corresponding to D186 of SEQ ID NO: 33.
  • the modified ActRIIB-Fc fusion protein IgG3 Fc domain comprises one or more amino acid substitutions selected from: a) an arginine, lysine, or histidine substitution at the position corresponding to S169 of SEQ ID NO: 33 (S169R, S169K, or S169H); b) an arginine, lysine, or histidine substitution at the position
  • the ActRIIB-Fc fusion protein Fc domain is an IgG4 Fc domain that comprises one or more amino acid modifications that alter the pi of the ActRIIB-Fc fusion protein.
  • the ActRIIB-Fc fusion protein IgG4 Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), or more identical to the amino acid sequence of SEQ ID NO: 35.
  • the ActRIIB-Fc fusion protein IgG4 Fc domain comprises one or more amino acid
  • substitutions selected from: a) an amino acid substitution at the position corresponding to
  • N166 of SEQ ID NO: 35 b) an amino acid substitution at the position corresponding to D183 of SEQ ID NO: 35; and c) an amino acid substitution at the position corresponding to N166 of SEQ ID NO: 35 and an amino acid substitution at position D183 of SEQ ID NO: 35.
  • the ActRIIB-Fc fusion protein IgG4 Fc domain comprises one or more amino acid substitutions selected from: a) an arginine, lysine, or histidine substitution at the position corresponding to N166 of SEQ ID NO: 35 (N166R, N166K, or N166H); b) an arginine, lysine, or histidine substitution at the position corresponding to D 183 of SEQ ID NO: 35 (D183R, D183K, or D183H); and c) an arginine, lysine, or histidine substitution at the position corresponding to N166 of SEQ ID NO: 35 (N166R, N166K, or N166H) and an arginine, lysine, or histidine substitution at the position corresponding to D 183 of SEQ ID NO: 35 (D183R, D183K, or D183H).
  • the ALK4-Fc fusion protein Fc domain is an IgGl Fc domain that comprises one or more amino acid modifications that alter the pi of the ALK4-Fc fusion protein.
  • the ALK4-Fc fusion protein IgGl Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 31.
  • the ALK4-Fc fusion protein IgGl fusion Fc domain comprises one or more amino acid substitutions selected from: a) an amino acid substitution at the position corresponding to K138 of SEQ ID NO: 31 ; b) an amino acid substitution at the position corresponding to K217 of SEQ ID NO: 31; and c) an amino acid substitution at the position corresponding to K138 of SEQ ID NO: 31 and an amino acid substitution at the position corresponding to K217 of SEQ ID NO: 31.
  • the ALK4-FC fusion protein IgGl Fc domain comprises one or more amino acid substitutions selected from: a) an aspartic acid or glutamic acid substitution at the position corresponding to Kl 38 of SEQ ID NO: 31 (K138E or K138D); b) an aspartic acid or glutamic acid substitution at the position corresponding to K217 of SEQ ID NO: 31 (K217E or K217D); and c) an aspartic acid or glutamic acid substitution at the position corresponding to K138 of SEQ ID NO: 31 (K138E or K138D) and an aspartic acid or glutamic acid substitution at the position corresponding to K217 of SEQ ID NO: 31 (K217E or K217D).
  • amino acid substitutions selected from: a) an aspartic acid or glutamic acid substitution at the position corresponding to Kl 38 of SEQ ID NO: 31 (K138E or K138D); b) an aspartic acid or glutamic acid substitution at the position corresponding to K
  • the ALK4-Fc fusion protein IgGl Fc domain comprises one or more amino acid substitutions selected from: a) a glutamic acid substitution at the position corresponding to K138 of SEQ ID NO: 31 (K138E); b) an aspartic acid substitution at the position corresponding to K217 of SEQ ID NO: 31 (K217D); and c) a glutamic acid substitution at the position corresponding to K138 of SEQ ID NO: 31 (K138E) and an aspartic acid substitution at the position corresponding to K217 of SEQ ID NO: 31 (K217D).
  • the ALK4-Fc fusion protein Fc domain is an IgG2 Fc domain that comprises one or more amino acid modifications that alter the pi of the ALK4-Fc fusion protein.
  • the ALK4-Fc fusion protein IgG2 Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), or more identical to the amino acid sequence of SEQ ID NO: 32.
  • the ALK4-FC fusion protein IgG2 fusion Fc domain comprises one or more amino acid substitutions selected from: a) an amino acid substitution at the position corresponding to K136 of SEQ ID NO: 32; b) an amino acid substitution at the position corresponding to K215 of SEQ ID NO: 32; and c) an amino acid substitution at the position corresponding to K136 of SEQ ID NO: 32 and an amino acid substitution at the position corresponding to K215 of SEQ ID NO: 32.
  • the ALK4-Fc fusion protein IgG2 Fc domain comprises one or more amino acid substitutions selected from: a) an aspartic acid or glutamic acid substitution at the position corresponding to K136 of SEQ ID NO: 32 (K136E or
  • the ALK4-Fc fusion protein Fc domain is an IgG3 Fc domain that comprises one or more amino acid modifications that alter the pi of the ALK4-Fc fusion protein.
  • the ALK4-Fc fusion protein IgG31 Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 33.
  • the ALK4-Fc fusion protein IgG3 fusion Fc domain comprises one or more amino acid substitutions selected from: a) an amino acid substitution at the position corresponding to K145 of SEQ ID NO: 33; b) an amino acid substitution at the position corresponding to K224 of SEQ ID NO: 33; and c) an amino acid substitution at the position corresponding to K145 of SEQ ID NO: 33 and an amino acid substitution at the position corresponding to K224 of SEQ ID NO: 33.
  • the ALK4-Fc fusion protein IgG3 Fc domain comprises one or more amino acid substitutions selected from: a) an aspartic acid or glutamic acid substitution at the position corresponding to K 145 of SEQ ID NO: 33 (K145E or K145D); b) an aspartic acid or glutamic acid substitution at the position corresponding to K224 of SEQ ID NO: 33 (K224E or K224D); and c) an aspartic acid or glutamic acid substitution at the position corresponding to K145 of SEQ ID NO: 33 (K145E or K145D) and an aspartic acid or glutamic acid substitution at the position corresponding to K224 of SEQ ID NO: 33 (K224E or K224D).
  • an aspartic acid or glutamic acid substitution at the position corresponding to K 145 of SEQ ID NO: 33 K145E or K145D
  • an aspartic acid or glutamic acid substitution at the position corresponding to K224 of SEQ ID NO: 33 K224E or K224D
  • the ALK4-Fc fusion protein Fc domain is an IgG4 Fc domain that comprises one or more amino acid modifications that alter the pi of the ALK4-Fc fusion protein.
  • the ALK4-Fc fusion protein IgG4 Fc domain comprises an amino acid sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), or more identical to the amino acid sequence of SEQ ID NO: 35.
  • the ALK4-FC fusion protein IgG4 fusion Fc domain comprises one or more amino acid substitutions selected from: a) an amino acid substitution at the position corresponding to K142 of SEQ ID NO: 35; b) an amino acid substitution at the position corresponding to K221 of SEQ ID NO: 35; and c) an amino acid substitution at the position corresponding to K142 of SEQ ID NO: 35 and an amino acid substitution at the position corresponding to K221 of SEQ ID NO: 35.
  • the ALK4-Fc fusion protein IgG4 Fc domain comprises one or more amino acid substitutions selected from: a) an aspartic acid or glutamic acid substitution at the position corresponding to K142 of SEQ ID NO: 35 (K142E or
  • K142D K142D
  • ALK4-Fc fusion proteins and/or ActRIIB-Fc fusion proteins may comprise one or more modifications that promote heteromultimer formation (e.g., ALK4- Fc: ActRIIB-Fc heterodimerization).
  • ALK4-Fc fusion proteins and/or ActRIIB-Fc fusion proteins may comprise one or more modifications that inhibit homomultimer formation (e.g., ALK4-Fc:ActRIIB-Fc homodimerization).
  • ALK4-Fc fusion proteins and/or ActRIIB-Fc fusion proteins may comprise one or more modifications that promote heteromultimer formation and comprise one or more modifications that inhibit homomultimer formation.
  • an ALK4:ActRIIB heteromultimer comprises: a) an ALK4-Fc fusion protein having an IgGl Fc domain comprising a cysteine substitution at position S132 of SEQ ID NO: 31 (S132C) and a tryptophan substitution at position T144 of SEQ ID NO: 31 (T144W); and b) an ActRIIB-Fc fusion protein having an IgGl Fc domain comprising a cysteine substitution at position Y127 of SEQ ID NO: 31 (Y127C), a serine substitution at position T144 of SEQ ID NO: 31 (T144S), an alanine substitution at position L146 of SEQ ID NO: 31 (L146A), and a valine substitution at position Y185 of SEQ ID NO: 31 (Y185V).
  • an ALK4-Fc fusion protein having an IgGl Fc domain comprising a cysteine substitution at position S132 of SEQ ID NO: 31 (S132C) and a tryptophan substitution at position
  • ALK4:ActRIIB heteromultimer comprises: a) an ActRIIB-Fc fusion protein having an IgGl Fc domain comprising a cysteine substitution at position S132 of SEQ ID NO: 31 (S132C) and a tryptophan substitution at position T144 of SEQ ID NO: 31 (T144W); and b) an ALK4- Fc fusion protein having an IgGl Fc domain comprising a cysteine substitution at position Y127 of SEQ ID NO: 31 (Y127C), a serine substitution at position T144 of SEQ ID NO: 31 (T144S), an alanine substitution at position L146 of SEQ ID NO: 31 (L146A), and a valine substitution at position Y185 of SEQ ID NO: 31 (Y185V).
  • an ALK4:ActRIIB heteromultimer comprises: a) an ALK4-Fc fusion protein having an IgG2 Fc domain comprising a cysteine substitution at position S130 of SEQ ID NO: 32 (S130C) and a tryptophan substitution at position T142 of SEQ ID NO: 32 (T142W); and b) an ActRIIB-Fc fusion protein having an IgG2 Fc domain comprising a cysteine substitution at position Y125 of SEQ ID NO: 32 (Y125C), a serine substitution at position T142 of SEQ ID NO: 32 (T142S), an alanine substitution at position L144 of SEQ ID NO: 32 (L144A), and a valine substitution at position Y183 of SEQ ID NO: 32 (Y183V).
  • an ALK4:ActRIIB heteromultimer comprises: a) an ActRIIB-Fc fusion protein having an IgG2 Fc domain comprising a cysteine substitution at position S130 of SEQ ID NO: 32 (S130C) and a tryptophan substitution at position T142 of SEQ ID NO: 32 (T142W); and b) an ALK4- Fc fusion protein having an IgG2 Fc domain comprising a cysteine substitution at position Y125 of SEQ ID NO: 32 (Y125C), a serine substitution at position T142 of SEQ ID NO: 32 (T142S), an alanine substitution at position L144 of SEQ ID NO: 32 (L144A), and a valine substitution at position Y183 of SEQ ID NO: 32 (Y183V).
  • an ALK4:ActRIIB heteromultimer comprises: a) an ALK4-Fc fusion protein having an IgG3 Fc domain comprising a cysteine substitution at position S139 of SEQ ID NO: 33 (S139C) and a tryptophan substitution at position T151 of SEQ ID NO: 33 (T151W); and b) the ActRIIB-Fc fusion protein having an IgG3 Fc domain comprising a cysteine substitution at position Y134 of SEQ ID NO: 33 (Y134C), a serine substitution at position T151 of SEQ ID NO: 33 (T151 S), an alanine substitution at position L153 of SEQ ID NO: 33 (L153A), and a valine substitution at position Y192 of SEQ ID NO: 33 (Y192V).
  • an ALK4:ActRIIB heteromultimer comprises: a) an ActRIIB-Fc fusion protein having an IgG3 Fc domain comprising a cysteine substitution at position S139 of SEQ ID NO: 33 (S139C) and a tryptophan substitution at position T151 of SEQ ID NO: 33 (T151W); and b) an ALK4- Fc fusion protein having an IgG3 Fc domain comprising a cysteine substitution at position Y134 of SEQ ID NO: 33 (Y134C), a serine substitution at position T151 of SEQ ID NO: 33 (T151 S), an alanine substitution at position L153 of SEQ ID NO: 33 (L153A), and a valine substitution at position Y192 of SEQ ID NO: 33 (Y192V).
  • an ALK4:ActRIIB heteromultimer comprises: a) an ALK4-Fc fusion protein having an IgG4 Fc domain comprises a cysteine substitution at position S136 of SEQ ID NO: 35 (S136C) and a tryptophan substitution at position T148 of SEQ ID NO: 35(T148W); and b) an ActRIIB-Fc fusion protein having an IgG4 Fc domain comprises a cysteine substitution at position Y131 of SEQ ID NO: 35 (Y131C), a serine substitution at position T148 of SEQ ID NO: 35 (T148S), an alanine substitution at position L150 of SEQ ID NO: 35 (L150A), and a valine substitution at position Y189 of SEQ ID NO: 35 (Y189V).
  • an ALK4:ActRIIB heteromultimer comprises: a) an ActRIIB-Fc fusion protein having an IgG4 Fc domain comprising a cysteine substitution at position S136 of SEQ ID NO: 35 (S136C) and a tryptophan substitution at position T148 of SEQ ID NO: 35 (T148W); and b) an ALK4- Fc fusion protein having an IgG4 Fc domain comprising a cysteine substitution at position Y131 of SEQ ID NO: 35 (Y131C), a serine substitution at position T148 of SEQ ID NO: 35 (T148S), an alanine substitution at position L150 of SEQ ID NO: 35 (L150A), and a valine substitution at position Y189 of SEQ ID NO: 35 (Y189V).
  • an ALK4:ActRIIB heteromultimer of the disclosure comprises: a) an ALK4-FC fusion protein having an Fc domain that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 66; and b) an ActRIIB-Fc fusion protein having an Fc domain that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 67.
  • the ALK4-Fc fusion protein Fc domain comprises one or more amino acid substitutions selected from: a) a glutamic acid at the position corresponding to 138 of SEQ ID NO: 66; b) an aspartic acid at the position corresponding to 217 of SEQ ID NO: 66; and c) a glutamic acid at the position corresponding to 138 of SEQ ID NO: 66 and an aspartic acid at the position corresponding to 217 of SEQ ID NO: 66.
  • the ALK4-Fc fusion protein Fc domain further comprises a cysteine at the position corresponding to 132 of SEQ ID NO: 66 and a
  • the ActRIIB-Fc fusion protein Fc domain comprises one or more amino acid substitutions selected from: a) an arginine at the position corresponding to 162 of SEQ ID NO: 67; b) an arginine at the position corresponding to 179 of SEQ ID NO: 67; and c) an arginine at the position corresponding to 162 of SEQ ID NO: 67 and an arginine at the position
  • the ActRIIB-Fc fusion protein Fc domain further comprises a cysteine at the position corresponding to 127 of SEQ ID NO: 67, a serine at the position corresponding to 144 of SEQ ID NO: 67, an alanine at the position corresponding to 146 of SEQ ID NO: 67, and a valine at the position corresponding to 185 of SEQ ID NO: 67.
  • an ALK4:ActRIIB heteromultimer of the disclosure comprises: a) an ActRIIB-Fc fusion protein having an Fc domain that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 66; and b) an ALK4-Fc fusion protein having an Fc domain that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 67.
  • the ActRIIB-Fc fusion protein Fc domain comprises one or more amino acid substitutions selected from: a) a glutamic acid at the position corresponding to 138 of SEQ ID NO: 66; b) an aspartic acid at the position corresponding to 217 of SEQ ID NO: 66; and c) a glutamic acid at the position corresponding to 138 of SEQ ID NO: 66 and an aspartic acid at the position corresponding to 217 of SEQ ID NO: 66.
  • the ActRIIB-Fc fusion protein Fc domain further comprises a cysteine at the position corresponding to 132 of SEQ ID NO: 66 and a
  • the ALK4-FC fusion protein Fc domain comprises one or more amino acid substitutions selected from: a) an arginine at the position corresponding to 162 of SEQ ID NO: 67; b) an arginine at the position corresponding to 179 of SEQ ID NO: 67; and c) an arginine at the position corresponding to 162 of SEQ ID NO: 67 and an arginine at the position
  • the ALK4-Fc fusion protein Fc domain further comprises a cysteine at the position corresponding to 127 of SEQ ID NO: 67, a serine at the position corresponding to 144 of SEQ ID NO: 67, an alanine at the position corresponding to 146 of SEQ ID NO: 67, and a valine at the position corresponding to 185 of SEQ ID NO: 67.
  • the disclosure relates to a recombinant ALK4:ActRIIB
  • the ALK4-Fc fusion protein comprises an IgGl Fc domain comprising a cysteine at the position corresponding to S132 of SEQ ID NO: 31 (S132C), a tryptophan at the position corresponding to T 144 of SEQ ID NO: 31 (T144W), and an acidic amino acid at the position corresponding to H213 of SEQ ID NO: 31; and b) the ActRIIB-Fc fusion protein comprises an IgGl Fc domain comprising a cysteine at the position
  • the acidic amino acid at the position corresponding to H213 of SEQ ID NO: 31 is an aspartic acid. In some embodiments, the acidic amino acid at the position corresponding to H213 of SEQ ID NO: 31 is a glutamic acid.
  • the ALK4-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 31.
  • the ActRIIB-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 31.
  • the disclosure relates to a recombinant ALK4:ActRIIB
  • the ActRIIB-Fc fusion protein comprises an IgGl Fc domain comprising a cysteine at the position corresponding to S132 of SEQ ID NO: 31 (S132C), a tryptophan at the position corresponding to T 144 of SEQ ID NO: 31 (T144W), and an acidic amino acid at the position corresponding to H213 of SEQ ID NO: 31; and b) the ALK4-Fc fusion protein comprises an IgGl Fc domain comprising a cysteine at the position
  • the acidic amino acid at the position corresponding to H213 of SEQ ID NO: 31 is an aspartic acid. In some embodiments, the acidic amino acid at the position corresponding to H213 of SEQ ID NO: 31 is a glutamic acid.
  • the ALK4-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 31.
  • the ActRIIB-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 31.
  • the disclosure relates to a recombinant ALK4:ActRIIB heteromultimer comprising at least one ALK4-Fc fusion protein and at least one ActRIIB-Fc fusion protein, wherein: a) the ALK4-Fc fusion protein comprises an IgGl Fc domain comprising a cysteine at the position corresponding to S132 of SEQ ID NO: 31 (S132C), and a tryptophan at the position corresponding to T144 of SEQ ID NO: 31 (T144W); and b) the ActRIIB-Fc fusion protein comprises an IgGl Fc domain comprising a cysteine at the position corresponding to Y127 of SEQ ID NO: 31 (Y127C), a serine at the position corresponding to T144 of SEQ ID NO: 31 (T144S), an alanine at the position corresponding to LI 46 of SEQ ID NO: 31 (LI 46 A), a valine at the position corresponding to Y185 of SEQ ID NO:
  • the acidic amino acid at the position corresponding to H213 of SEQ ID NO: 31 is an aspartic acid. In some embodiments, the acidic amino acid at the position corresponding to H213 of SEQ ID NO: 31 is a glutamic acid. In some embodiments, the ALK4-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 31.
  • the ActRIIB- Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 31.
  • the disclosure relates to a recombinant ALK4:ActRIIB heteromultimer comprising at least one ALK4-Fc fusion protein and at least one ActRIIB-Fc fusion protein, wherein: a) the ActRIIB-Fc fusion protein comprises an IgGl Fc domain comprising a cysteine at the position corresponding to S132 of SEQ ID NO: 31 (S132C), and a tryptophan at the position corresponding to T 144 of SEQ ID NO: 31 (T144W); and b) the ALK4-Fc fusion protein comprises an IgGl Fc domain comprising a cysteine at the position
  • Y127C a serine at the position corresponding to T144 of SEQ ID NO: 31 (T144S), an alanine at the position corresponding to L146 of SEQ ID NO: 31 (L146A), and a valine at the position corresponding to Y185 of SEQ ID NO: 31 (Y185V), and an acidic amino acid at the position corresponding to H213 of SEQ ID NO: 31.
  • the acidic amino acid at the position corresponding to H213 of SEQ ID NO: 31 is an aspartic acid.
  • the acidic amino acid at the position corresponding to H213 of SEQ ID NO: 31 is a glutamic acid.
  • the ALK4-FC fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 31.
  • the ActRIIB-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 31.
  • the disclosure relates to a recombinant ALK4:ActRIIB
  • the ALK4-Fc fusion protein comprises an IgG2 Fc domain comprising a cysteine at the position corresponding to S130 of SEQ ID NO: 32 (S130C), a tryptophan at the position corresponding to T142 of SEQ ID NO: 32 (T142W), and an acidic amino acid at the position corresponding to H211 of SEQ ID NO: 32; and b) the ActRIIB-Fc fusion protein comprises an IgG2 Fc domain comprising a cysteine at the position
  • the acidic amino acid at the position corresponding to H211 of SEQ ID NO: 32 is an aspartic acid. In some embodiments, the acidic amino acid at the position corresponding to H211 of SEQ ID NO: 32 is a glutamic acid.
  • the ALK4-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 32.
  • the ActRIIB-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 32.
  • the disclosure relates to a recombinant ALK4:ActRIIB
  • the ActRIIB-Fc fusion protein comprises an IgG2 Fc domain comprising a cysteine at the position corresponding to S130 of SEQ ID NO: 32 (S130C), a tryptophan at the position corresponding to T142 of SEQ ID NO: 32 (T142W), and an acidic amino acid at the position corresponding to H211 of SEQ ID NO: 32; and b) the ALK4-Fc fusion protein comprises an IgG2 Fc domain comprising a cysteine at the position
  • the acidic amino acid at the position corresponding to H211 of SEQ ID NO: 32 is an aspartic acid. In some embodiments, the acidic amino acid at the position corresponding to H211 of SEQ ID NO: 32 is a glutamic acid.
  • the ALK4-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 32.
  • the ActRIIB-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 32.
  • the disclosure relates to a recombinant ALK4:ActRlTB
  • the ALK4-Fc fusion protein comprises an IgG2 Fc domain comprising a cysteine at the position corresponding to S130 of SEQ ID NO: 32 (S130C), and a tryptophan at the position corresponding to T142 of SEQ ID NO: 32 (T142W); and b) the ActRIIB-Fc fusion protein comprises an IgG2 Fc domain comprising a cysteine at the position corresponding to Y125 of SEQ ID NO: 32 (Y125C), a serine at the position corresponding to T142 of SEQ ID NO: 32 (T142S), an alanine at the position corresponding to L144 of SEQ ID NO: 32 (L144A), a valine at the position corresponding to Y183 of SEQ ID NO: 32 (Y183 V), and an acidic amino acid at the position corresponding to H211 of SEQ
  • the corresponding to H211 of SEQ ID NO: 32 is an aspartic acid.
  • the acidic amino acid at the position corresponding to H211 of SEQ ID NO: 32 is a glutamic acid.
  • the ALK4-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 32.
  • the ActRIIB-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 32.
  • the disclosure relates to a recombinant ALK4:ActRHB
  • the ActRIIB-Fc fusion protein comprises an IgG2 Fc domain comprising a cysteine at the position corresponding to S130 of SEQ ID NO: 32 (S130C), and a tryptophan at the position corresponding to T142 of SEQ ID NO: 32 (T142W); and b) the ALK4-FC fusion protein comprises an IgG2 Fc domain comprising a cysteine at the position corresponding to Y125 of SEQ ID NO: 32 (Y125C), a serine at the position corresponding to T142 of SEQ ID NO: 32 (T142S), an alanine at the position corresponding to L144 of SEQ ID NO: 32 (L144A), a valine at the position corresponding to Y183 of SEQ ID NO: 32 (Y183V), and an acidic amino acid at the position corresponding to H211 of SEQ ID NO
  • the acidic amino acid at the position corresponding to H211 of SEQ ID NO: 32 is an aspartic acid. In some embodiments, the acidic amino acid at the position corresponding to H211 of SEQ ID NO: 32 is a glutamic acid. In some embodiments, the ALK4-FC fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 32.
  • the ActRIIB-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 32.
  • the disclosure relates to a recombinant ALK4:ActRIIB
  • the ALK4-Fc fusion protein comprises an IgG4 Fc domain comprising a cysteine at the position corresponding to S136 of SEQ ID NO: 35 (S136C), a tryptophan at the position corresponding to T 148 of SEQ ID NO: 35 (T148W), and an acidic amino acid at the position corresponding to H217 of SEQ ID NO: 35; and b) the ActRIIB-Fc fusion protein comprises an IgG4 Fc domain comprising a cysteine at the position
  • the acidic amino acid at the position corresponding to H217 of SEQ ID NO: 35 is an aspartic acid. In some embodiments, the acidic amino acid at the position corresponding to H217 of SEQ ID NO: 35 is a glutamic acid.
  • the ALK4-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 35.
  • the ActRIIB-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 35.
  • the disclosure relates to a recombinant ALK4:ActRIIB
  • the ActRIIB-Fc fusion protein comprises an IgG4 Fc domain comprising a cysteine at the position corresponding to S136 of SEQ ID NO: 35 (S136C), a tryptophan at the position corresponding to T 148 of SEQ ID NO: 35 (T148W), and an acidic amino acid at the position corresponding to H217 of SEQ ID NO: 35; and b) the ALK4-Fc fusion protein comprises an IgG4 Fc domain comprising a cysteine at the position corresponding to Y131 of SEQ ID NO: 35 (Y131C), a serine at the position corresponding to T148 of SEQ ID NO: 35 (T148S), an alanine at the position corresponding to L150 of SEQ ID NO: 35 (L150A), and a valine at the position corresponding to Y189 of SEQ ID NO:
  • the acidic amino acid at the position corresponding to H217 of SEQ ID NO: 35 is an aspartic acid. In some embodiments, the acidic amino acid at the position corresponding to H217 of SEQ ID NO: 35 is a glutamic acid. In some embodiments, the ALK4-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 35.
  • the ActRIIB-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 35.
  • the disclosure relates to recombinant ALK4:ActRIIB
  • the ALK4-Fc fusion protein comprises an IgG4 Fc domain comprising a cysteine at the position corresponding to S136 of SEQ ID NO: 35 (S136C), and a tryptophan at the position corresponding to T148 of SEQ ID NO: 35 (T148W); and b) the ActRIIB-Fc fusion protein comprises an IgG4 Fc domain comprising a cysteine at the position corresponding to Y131 of SEQ ID NO: 35 (Y131C), a serine at the position corresponding to T 148 of SEQ ID NO: 35 (T148S), an alanine at the position corresponding to L150 of SEQ ID NO: 35 (L150A), a valine at the position corresponding to Y189 of SEQ ID NO: 35 (Y189V), and an acidic amino acid at the position corresponding to H217 of S
  • the corresponding to H217 of SEQ ID NO: 35 is an aspartic acid.
  • the acidic amino acid at the position corresponding to H217 of SEQ ID NO: 35 is a glutamic acid.
  • the ALK4-Fc fusion protein Fc domain is at least 75%, 80%, 85%,
  • the ActRIIB-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 35.
  • the disclosure relates to recombinant ALK4:ActRIIB
  • the ActRIIB-Fc fusion protein comprises an IgG4 Fc domain comprising a cysteine at the position corresponding to S136 of SEQ ID NO: 35 (S136C), and a tryptophan at the position corresponding to T148 of SEQ ID NO: 35 (T148W); and b) the ALK4-Fc fusion protein comprises an IgG4 Fc domain comprising a cysteine at the position corresponding to Y131 of SEQ ID NO: 35 (Y131C), a serine at the position corresponding to T148 of SEQ ID NO: 35 (T148S), an alanine at the position corresponding to L150 of SEQ ID NO: 35 (L150A), a valine at the position corresponding to Y189 of SEQ ID NO: 35 (Y189V), and an acidic amino acid at the position corresponding to H217 of SEQ
  • the acidic amino acid at the position corresponding to H217 of SEQ ID NO: 35 is an aspartic acid. In some embodiments, the acidic amino acid at the position corresponding to H217 of SEQ ID NO: 35 is a glutamic acid. In some embodiments, the ALK4-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 35.
  • the ActRIIB-Fc fusion protein Fc domain is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the amino acid sequence of SEQ ID NO: 35.
  • ALK4 polypeptides are connected directly (fused) to one or more heterologous domains, or an intervening sequence, such as a linker, may be positioned between the amino acid sequence of the ALK4 polypeptide and the one or more heterologous domains (e.g., an Fc domain of an immunoglobulin).
  • the ActRIIB polypeptide may be connected directly (fused) to one or more heterologous domains, or an intervening sequence, such as a linker, may be positioned between the amino acid sequence of the
  • Linkers may correspond to the roughly 15 amino acid unstructured region at the C-terminal end of the extracellular domain of ActRIIB or ALK4 (the "tail"), or it may be an artificial sequence of between 5 and 15, 20, 30, 50, 100 or more amino acids that are relatively free of secondary structure.
  • a linker may be rich in glycine and proline residues and may, for example, contain repeating sequences of threonine/serine and glycines.
  • linkers include, but are not limited to, the sequences TGGG (SEQ ID NO: 17), SGGG (SEQ ID NO: 18), TGGGG (SEQ ID NO: 15), SGGGG (SEQ ID NO: 16), GGGGS (SEQ ID NO: 58), GGGG (SEQ ID NO: 14), and GGG (SEQ ID NO: 13).
  • the disclosure relates to a recombinant ALK4:ActRIIB
  • heteromultimer comprising at least one ALK4-Fc fusion protein and at least one ActRIIB-Fc fusion protein
  • the ALK4-Fc fusion protein comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to the amino acid sequence of SEQ ID NO: 76
  • the ActRIIB-Fc fusion protein comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to the amino acid sequence of SEQ ID NO: 72.
  • the ALK4-Fc fusion protein comprises one or more amino acid selected from: a) a cysteine at the position corresponding to 234 of SEQ ID NO: 76, a serine at the position corresponding to 251 of SEQ ID NO: 76, an alanine at the position corresponding to 253 of SEQ ID NO: 76, and a valine at the position corresponding to 292 of SEQ ID NO: 76; b) a positively charged amino acid at the position corresponding to 269 of SEQ ID NO: 76; c) a positively charged amino acid at the position corresponding to D286 of SEQ ID NO: 76; d) a positively charged amino acid at the position corresponding to 269 of SEQ ID NO: 76 and a positively charged amino acid at the position corresponding to 286 of SEQ ID NO: 76; e) a cysteine at the position corresponding to 234 of SEQ ID NO: 76, a serine at the position corresponding to 251 of
  • the ActRIIB-Fc fusion protein comprises one or more amino acid selected from: a) a cysteine at the position corresponding to 250 of SEQ ID NO: 72, and a tryptophan at position 262 of SEQ ID NO: 72; b) a negatively charged amino acid at the position corresponding to 256 of SEQ ID NO: 72; c) a negatively charged amino acid at the position corresponding to 335 of SEQ ID NO: 72; d) a negatively charged amino acid at the position corresponding to 256 of SEQ ID NO: 72 and a negatively charged amino acid at the position corresponding to 335 of SEQ ID NO: 72; e) a cysteine at the position corresponding to 250 of SEQ ID NO: 72, a tryptophan at position 262 of SEQ ID NO: 72, and a negatively charged amino acid at the position corresponding to 256 of SEQ ID NO: 72; f) a cysteine at the position corresponding to 250 of SEQ ID NO: 72, a tryptophan at position
  • the positively charged amino acid residue is a modified or naturally occurring (e.g., R, K, or H) amino acid. In some embodiments, the positively charged amino acid residue is R. In some embodiments, the negatively charged amino acid residue is a modified or naturally occurring (e.g., D or E) amino acid. In some embodiments, the negatively charged amino acid residue is D. In some embodiments, the negatively charged amino acid residue is E.
  • the disclosure relates to a recombinant ALK4-Fc fusion protein comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to the amino acid sequence of SEQ ID NO: 76.
  • the ALK4-Fc fusion protein Fc domain comprises one or more amino acid selected from: a) a cysteine at the position corresponding to 234 of SEQ ID NO: 76, a serine at the position corresponding to 251 of SEQ ID NO: 76, an alanine at the position corresponding to 253 of SEQ ID NO: 76, and a valine at the position corresponding to 292 of SEQ ID NO: 76; b) a positively charged amino acid at the position corresponding to 269 of SEQ ID NO: 76; c) a positively charged amino acid at the position corresponding to 286 of SEQ ID NO: 76; d) a positively charged amino acid at the position corresponding to 269 of SEQ ID NO: 76 and a positively charged amino acid at the position corresponding to 286 of SEQ ID NO: 76; e) a cysteine at the position corresponding to 234 of SEQ ID NO: 76, a serine at the position corresponding to 251
  • the disclosure relates to a recombinant ActRIIB-Fc fusion protein comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to the amino acid sequence of SEQ ID NO: 72.
  • the fusion protein comprises one or more amino acid selected from: a) a cysteine at the position corresponding to 250 of SEQ ID NO: 72 and a tryptophan at the position corresponding to 262 of SEQ ID NO: 72; b) a negatively charged amino acid at the position corresponding to 256 of SEQ ID NO: 72; c) a negatively charged amino acid at the position corresponding to 335 of SEQ ID NO: 72; d) a negatively charged amino acid at the position corresponding to 256 of SEQ ID NO: 72 and a negatively charged amino acid at the position corresponding to 335 of SEQ ID NO: 72; e) a cysteine at the position corresponding to 250 of SEQ ID NO: 72, a tryptophan at position 262 of SEQ ID NO: 72, and a negatively charged amino acid at the position corresponding to 256 of SEQ ID NO: 72; f) a cysteine at the position corresponding to 250 of SEQ ID NO: 72, a tryptophan at position corresponding to 26
  • the disclosure relates to a recombinant ALK4-Fc fusion protein comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to the amino acid sequence of SEQ ID NO: 74.
  • the ALK4-Fc fusion protein Fc domain comprises one or more amino acid selected from: a) a cysteine at the position corresponding to 258 of SEQ ID NO: 74, a serine at the position corresponding to 275 of SEQ ID NO: 74, an alanine at the position corresponding to 277 of SEQ ID NO: 74, and a valine at position 316 of SEQ ID NO: 74; b) a positively charged amino acid at the position corresponding to 293 of SEQ ID NO: 74; c) a positively charged amino acid at the position corresponding to 310 of SEQ ID NO: 74; d) a positively charged amino acid at the position corresponding to a serine at the position corresponding to 275 of SEQ ID NO: 74, an alanine at the position corresponding to 277 of SEQ ID NO: 74, a valine at position 316 of SEQ ID NO: 74, and a positively charged amino acid at the position corresponding to 293
  • the disclosure relates to a recombinant ActRIIB-Fc fusion protein comprises an amino acid sequence that is at least 70%, 75%, 80%>, 85%, 86%>, 87%, 88%>, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to the amino acid sequence of SEQ ID NO: 70.
  • the ActRIIB-Fc fusion protein Fc domain comprises one or more amino acid selected from: a) a cysteine at the position corresponding to 275 of SEQ ID NO: 70 and a tryptophan at the position corresponding to 287 of SEQ ID NO: 70; b) a negatively charged amino acid at the position corresponding to 281 of SEQ ID NO: 70; c) a negatively charged amino acid at the position corresponding to 360 of SEQ ID NO: 70; d) a negatively charged amino acid at the position corresponding to 281 of SEQ ID NO: 70 and a negatively charged amino acid at the position corresponding to 360 of SEQ ID NO: 70; e) a cysteine at the position corresponding to 275 of SEQ ID NO: 70, a tryptophan at the position corresponding to 287of SEQ ID NO: 70, and a negatively charged amino acid at the position corresponding to 281 of SEQ ID NO: 70; f) a cysteine at the position corresponding to 275 of
  • the negatively charged amino acid residue is a modified or naturally occurring (e.g., D or E) amino acid. In some embodiments, the negatively charged amino acid residue is D. In some embodiments, the negatively charged amino acid residue is E.
  • the disclosure relates to a recombinant ALK4:ActRIIB
  • heteromultimer comprising at least one ALK4-Fc fusion protein and at least one ActRIIB-Fc fusion protein
  • the ALK4-Fc fusion protein comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to the amino acid sequence of SEQ ID NO: 48
  • the ActRIIB-Fc fusion protein comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to the amino acid sequence of SEQ ID NO: 80.
  • the ALK4-Fc fusion protein Fc domain comprises a cysteine at the position corresponding to 234 of SEQ ID NO: 48, a serine at the position corresponding to 251 of SEQ ID NO: 48, an alanine at the position corresponding to 253 of SEQ ID NO: 48, and a valine at position 292 of SEQ ID NO: 48.
  • the ActRIIB-Fc fusion protein Fc domain comprises a cysteine at the position corresponding to 250 of SEQ ID NO: 80, a tryptophan at the position corresponding to 262 of SEQ ID NO: 80, and a arginine at the position corresponding to 331 of SEQ ID NO: 80.
  • the disclosure relates to a recombinant ALK4-Fc fusion protein comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to the amino acid sequence of SEQ ID NO: 48.
  • the ALK4-Fc fusion protein Fc domain comprises a cysteine at the position corresponding to 234 of SEQ ID NO: 48, a serine at the position corresponding to 251 of SEQ ID NO: 48, an alanine at the position corresponding to 253 of SEQ ID NO: 48, and a valine at position 292 of SEQ ID NO: 48.
  • the disclosure relates to a recombinant ActRIIB-Fc fusion protein comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to the amino acid sequence of SEQ ID NO: 80.
  • the ActRIIB-Fc fusion protein Fc domain comprises a cysteine at the position corresponding to 250 of SEQ ID NO: 80, a tryptophan at the position corresponding to 262 of SEQ ID NO: 80, and a arginine at the position corresponding to 331 of SEQ ID NO: 80.
  • the disclosure relates to a recombinant ALK4-Fc fusion protein comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to the amino acid sequence of SEQ ID NO: 47.
  • the ALK4-Fc fusion protein Fc domain comprises a cysteine at the position corresponding to 258 of SEQ ID NO: 47, a serine at the position corresponding to 275 of SEQ ID NO: 47, an alanine at the position corresponding to 277 of SEQ ID NO: 47, and a valine at position 316 of SEQ ID NO: 47.
  • the disclosure relates to a recombinant ActRIIB-Fc fusion protein comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to the amino acid sequence of SEQ ID NO: 78.
  • the ActRIIB-Fc fusion protein Fc domain comprises a cysteine at the position corresponding to 275 of SEQ ID NO: 78, a tryptophan at the position corresponding to 287 of SEQ ID NO: 78, and a arginine at the position corresponding to 356 of SEQ ID NO: 78.
  • the disclosure relates to a recombinant ALK4:ActRIIB
  • heteromultimer comprising at least one ALK4-Fc fusion protein and at least one ActRIIB-Fc fusion protein
  • the ALK4-Fc fusion protein comprises an amino acid sequence that is at least 90%, 95%, 97% or 99% identical to the amino acid sequence of SEQ ID NO: 76
  • the ActRIIB-Fc fusion protein comprises an amino acid sequence that is at least 90%, 95%, 97% or 99% identical to the amino acid sequence of SEQ ID NO: 72.
  • the ALK4-Fc fusion protein comprises the amino acid sequence of SEQ ID NO: 76
  • the ActRIIB-Fc fusion protein comprises the amino acid sequence of SEQ ID NO: 72.
  • the ActRIIB-Fc fusion protein comprises the leader sequence of SEQ ID NO: 38. In some embodiments, the ActRIIB-Fc fusion protein comprises an amino acid sequence that is at least 90%, 95%, 97% or 99% identical to the amino acid sequence of SEQ ID NO: 70. In some embodiments, the ActRIIB-Fc fusion protein comprises the amino acid sequence of SEQ ID NO: 70. In some embodiments, the ALK4-Fc fusion protein comprises the leader sequence of SEQ ID NO: 38. In some embodiments, the ALK4-FC fusion protein comprises an amino acid sequence that is at least 90%, 95%, 97% or 99% identical to the amino acid sequence of SEQ ID NO: 74.
  • the ALK4-FC fusion protein comprises the amino acid sequence of SEQ ID NO: 74.
  • the ALK4-Fc fusion protein comprises the amino acid sequence of SEQ ID NO: 74
  • the ActRIIB-Fc fusion protein comprises the amino acid sequence of SEQ ID NO: 70.
  • an ALK4 and/or ActRIIB polypeptide comprises one or more modified amino acid residues selected from: a glycosylated amino acid, a PEGylated amino acid, a farnesylated amino acid, an acetylated amino acid, a biotinylated amino acid, an amino acid conjugated to a lipid moiety, and an amino acid conjugated to an organic derivatizing agent.
  • ALK4 and/or ActRIIB polypeptides may comprise at least one N-linked sugar, and may include two, three or more N-linked sugars. Such polypeptides may also comprise O-linked sugars.
  • ALK4 and/or ActRIIB polypeptides may be produced in a variety of cell lines that glycosylate the protein in a manner that is suitable for patient use, including engineered insect or yeast cells, and mammalian cells such as COS cells, CHO cells, HEK cells and NSO cells.
  • an ALK4 and/or ActRIIB polypeptide is glycosylated and has a glycosylation pattern obtainable from a Chinese hamster ovary cell line.
  • a Chinese hamster ovary cell line Preferably
  • ALK4:ActRIIB heteromultimer complexes of the disclosure exhibit a serum half-life of at least 4, 6, 12, 24, 36, 48, or 72 hours in a mammal (e.g., a mouse or a human).
  • ALK4:ActRIIB heteromultimers may exhibit a serum half-life of at least 6, 8, 10, 12, 14, 20, 25, or 30 days in a mammal (e.g., a mouse or a human).
  • ALK4: ActRIIB heteromultimers of the disclosure bind to one or more TGF-beta superfamily ligands.
  • ALK4:ActRIIB heteromultimers bind to one or more of these ligands with a KD of less than or equal to 10 "8 , 10 "9 , 10 "10 , 10 "11 , or 10 "12 M.
  • ALK4:ActRIIB heteromultimers bind to activin B.
  • ALK4:ActRIIB heteromultimers bind to activin A.
  • ALK4:ActRIIB heteromultimers bind to activin AB.
  • ALK4:ActRIIB heteromultimers bind to activin C. In some embodiments, ALK4:ActRIIB heteromultimers bind to activin AC. In some embodiments, ALK4:ActRIIB heteromultimers bind to activin BC. In some embodiments, ALK4:ActRIIB heteromultimers bind to activin BC. In some embodiments, ALK4:ActRIIB heteromultimers bind to activin BE. In some embodiments, ALK4: ActRIIB heteromultimers bind to GDF11. In some embodiments, ALK4: ActRIIB heteromultimers bind to GDF8. In some embodiments, ALK4: ActRIIB heteromultimers bind to BMP6.
  • ALK4:ActRIIB heteromultimers bind to GDF3. In some embodiments, ALK4:ActRIIB heteromultimers bind to BMP10. In some embodiments, ALK4: ActRIIB heteromultimers do not bind to, or do not substantially
  • ALK4:ActRIIB heteromultimers bind to activin B with stronger affinity compared to a corresponding ActRIIB homomultimer. In some embodiments,
  • ALK4:ActRIIB heteromultimers bind to GDF3 with weaker affinity compared to a corresponding ActRIIB homomultimer. In some embodiments, ALK4:ActRIIB heteromultimers bind to BMP 10 with weaker affinity compared to a corresponding ActRIIB homomultimer. In some embodiments, ALK4:ActRIIB heteromultimers bind to BMP9 with weaker affinity compared to a corresponding ActRIIB homomultimer.
  • ALK4:ActRIIB heteromultimers of the disclosure antagonize (inhibit) one or more activities of at least one TGF-beta superfamily ligand, and such alterations in activity may be measured using various assays known in the art, including, for example, a cell-based assay such as those described herein.
  • ALK4:ActRIIB heteromultimers may be used to inhibit signaling (e.g., Smad 2/3 and/or Smad 1/5/8 signaling) mediated by one or more TGFp superfamily ligands in, for example, a cell-based assay.
  • ALK4:ActRIIB heteromultimers inhibit activin signaling in a cell-based assay.
  • ALK4:ActRIIB heteromultimers inhibit activin signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers inhibit activin A signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers inhibit activin B signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers inhibit activin AB signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers inhibit activin C signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers inhibit activin AC signaling in a cell-based assay.
  • ALK4:ActRIIB heteromultimers inhibit activin BC signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers inhibit activin E signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers inhibit activin AE signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers inhibit activin CE signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers inhibit GDF11 signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers inhibit GDF8 signaling in a cell-based assay.
  • ALK4: ActRIIB heteromultimers inhibit BMP6 signaling in a cell- based assay. In some embodiments, ALK4:ActRIIB heteromultimers inhibit GDF3 signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers inhibit BMP10 signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers does not inhibit, or does not substantially inhibit, BMP9 signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers are stronger inhibitors of activin B signaling in a cell-based assay.
  • ALK4:ActRIIB heteromultimers are weaker inhibitors of GDF3 signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers are weaker inhibitors of BMP 10 signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers are weaker inhibitors of BMP9 signaling in a cell-based assay.
  • compositions may be formulated as a pharmaceutical preparation (compositions).
  • pharmaceutical preparations comprise a pharmaceutically acceptable carrier.
  • a pharmaceutical preparation will be pyrogen-free (meaning pyrogen free to the extent required by regulations governing the quality of products for therapeutic use).
  • a pharmaceutical preparation may also include one or more additional compounds such as a compound that is used to treat a disorder/condition described herein.
  • ALK4:ActRIIB is formulated as a pharmaceutical preparation (compositions).
  • pharmaceutical preparations comprise a pharmaceutically acceptable carrier.
  • a pharmaceutical preparation will be pyrogen-free (meaning pyrogen free to the extent required by regulations governing the quality of products for therapeutic use).
  • a pharmaceutical preparation may also include one or more additional compounds such as a compound that is used to treat a disorder/condition described herein.
  • heteromultimer pharmaceutical preparations are substantially free of ALK4 and/or ActRIIB horn care timers.
  • ALK4:ActRIIB heteromultimer pharmaceutical preparations comprise less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or less than about 1% ALK4 homomultimers.
  • ALK4:ActRIIB heteromultimer pharmaceutical preparations comprise less than about 10%, 9%, 8%, 7%, 6%, 5%), 4%), 3%), 2%), or less than about 1% ActRIIB homomultimers.
  • ALK4:ActRIIB heteromultimer pharmaceutical preparations comprise less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or less than about 1% ALK4 homomultimers and less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or less than about 1% ActRIIB homomultimers.
  • an ActRIIB nucleic acid may comprise of a nucleic acid that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of 73-396 of SEQ ID NO: 7 or one that hybridizes under stringent conditions to the complement of nucleotides 73-396 of SEQ ID NO: 7.
  • Such an nucleic acid may be one that comprises the sequence of SEQ ID NOs: 8.
  • an ActRIIB nucleic acids comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 71.
  • an ActRIIB nucleic acids comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 73.
  • an ActRIIB nucleic acids comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 79.
  • an ActRIIB nucleic acids comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 81.
  • an ALK4 nucleic acid may comprise, consists essentially of, or consists of a nucleic acid that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of 70-378 of SEQ ID NO: 11 or one that hybridizes under stringent conditions to the complement of nucleotides 70-378 of SEQ ID NO: 11.
  • an ALK4 nucleic acids comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 75.
  • an ALK4 nucleic acids comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 77.
  • an ALK4 nucleic acids comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 82.
  • an ALK4 nucleic acids comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 83.
  • nucleic acids sequence comprising a coding sequence for and ALK4 polypeptide and a coding sequence for the ActRIIB
  • nucleic acids of the disclosure a) comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 71, 73, 79, and77
  • b) comprises, consists essentially of, or consists of a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID Nos: 75, 77, 82, and 83.
  • ALK4 and/or ActRIIB nucleic acids are isolated and/or recombinant nucleic acids. Nucleic acids disclosed herein may be operably linked to a promoter for expression.
  • the present disclosure further provides vectors comprising such ALK4 and/or ActRIIB polynucleotides as well as cells (e.g., CHO cells), preferably cells isolated from a human or other vertebrate species, comprising such ALK4 and/or ActRIIB polynucleotides as well as vectors comprising such ALK4 and/or ActRIIB polynucleotides.
  • an ALK4 polypeptides and/or ActRIIB polypeptides may be expressed in a mammalian cell line, optionally a cell line that mediates suitably natural glycosylation of the ActRIIB or ALK4 protein so as to diminish the likelihood of an unfavorable immune response in a patient (including the possibility of veterinary patients).
  • Human and CHO cell lines have been used successfully, and it is expected that other common mammalian expression vectors will be useful.
  • cultured cells comprising any of the nucleic acids disclosed herein.
  • Such cells may be mammalian cells, including CHO cells, NSO cells, HEK cells and COS cells. Other cells may be chosen depending on the species of the intended patient. Other cells are disclosed herein. Cultured cells are understood to mean cells maintained in laboratory or other man-made conditions (e.g., frozen, or in media) and not part of a living organism.
  • the disclosure provides methods for making any of the ALK4 and ActRIIB polypeptides described herein as well as ALK4:ActRIIB heteromultimer complexes comprising such polypeptides.
  • Such a method may include expressing any of the nucleic acids disclosed herein in a suitable cell (e.g., CHO cell or a COS cell).
  • a method of making a heteromultimer comprising an ALK4 polypeptide and an ActRIIB polypeptide comprises: culturing a cell under conditions suitable for expression of an ALK4 polypeptide and an ActRIIB polypeptide, wherein the cell comprises an ALK4 polynucleotide and an ActRIIB polynucleotide; optionally recovering the heteromultimer so expressed.
  • a method of making a heteromultimer comprising an ALK4 polypeptide and an ActRIIB polypeptide may comprise: a) culturing a first cell under conditions suitable for expression of an ALK4 polypeptide, wherein the first cell comprises an ALK4 polynucleotide; b) recovering the ALK4 polypeptide so expressed; c) culturing a second cell under conditions suitable for expression of an ActRIIB polypeptide, wherein the second cell comprises an ActRIIB polynucleotide; d) recovering the ActRIIB polypeptide so expressed; e) combining the recovered ALK4 polypeptide and the recovered ActRIIB polypeptide under conditions suitable for ALK4:ActRIIB heteromultimer formation;
  • ALK4 and/or ActRIIB polypeptides are expressed using a TPA leader sequence (e.g., SEQ ID NO: 38).
  • ALK4 and/or ActRIIB polypeptides are expressed in a CHO cell.
  • ALK4 and ActRIIB polypeptides described herein, as well as protein complexes of the same may be recovered as crude, partially purified, or highly purified fractions using any of the well-known techniques for obtaining protein from cell cultures. In general, such methods result in ALK4:ActRIIB heteromultimers that substantially free of ALK4 and/or ActRIIB homomultimers.
  • methods for producing ALK4:ActRIIB heteromultimers result in less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or less than about 1% ALK4 homomultimers.
  • methods for producing ALK4: ActRIIB heteromultimers result in less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%), 2%), or less than about 1% ActRIIB homomultimers.
  • methods for producing ALK4 result in less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or less than about 1% ALK4 homomultimers and less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or less than about 1% ActRIIB homomultimers.
  • the disclosure further provides methods and ALK4: ActRIIB heteromultimers for use in the treatment or prevention of various ALK4:ActRIIB-associated diseases and conditions associated with, for example, muscle, bone, fat, red blood cells, and other tissues.
  • diseases and disorders include, but are not limited to, disorders associated with muscle loss or insufficient muscle growth (e.g., muscle atrophy; muscular dystrophy, including Duchenne muscular dystrophy, Becker muscular dystrophy, and facioscapulohumeral muscular dystrophy; amyotrophic lateral sclerosis; sporadic inclusion body myositis, hereditary inclusion body myositis, and cachexia) and disorders associated with undesirable weight gain (e.g., obesity, type 2 diabetes or non-insulin dependent diabetes mellitus (NIDDM), cardiovascular dissease, hypertension, osteoarthritis, stroke, respiratory problems, and gall bladder disease).
  • NIDDM non-insulin dependent diabetes mellitus
  • ALK4:ActRIIB heteromultimers may be used to decrease body fat content or reduce the rate of increase in body fat content in a subject in need thereof. In some embodiments, ALK4:ActRIIB heteromultimers may be used to reduce cholesterol and/or triglyceride levels in a patient. In some embodiments, ALK4: ActRIIB heteromultimers may be used to treat or prevent fibrosis or a fibrosis-associated disorder or condition (e.g., renal failure, chronic renal disease, cystic fibrosis, and myelofibrosis).
  • fibrosis or a fibrosis-associated disorder or condition e.g., renal failure, chronic renal disease, cystic fibrosis, and myelofibrosis.
  • the disclosure further provides methods and ALK4: ActRIIB heteromultimers for use in the treatment or prevention of various ALK4:ActRIIB-associated diseases and conditions associated with, for example, the kidney.
  • diseases or conditions include, for example, chronic kidney disease or failure, acute kidney disease or failure, patients that have stage 1 kidney disease, patients that have stage 2 kidney disease, patients that have stage 3 kidney disease, patients that have stage 4 kidney disease, patients that have stage 5 kidney disease, non-diabetic kidney diseases, glomerulonephritis, interstitial nephritis, diabetic kidney diseases, diabetic nephropathy, glomerulosclerosis, rapid progressive glomerulonephritis, renal fibrosis, Alport syndrome, IDDM nephritis, mesangial proliferative glomerulonephritis, membranoproliferative glomerulonephritis, crescentic glomerulonephritis, renal interstitial fibrosis, focal segmental glomerulo
  • glomerulonephritis chronic allograft nephropathy, nephrotoxicity, renal toxicity, kidney necrosis, kidney damage, glomerular and tubular injury, kidney dysfunction, nephritic syndrome, acute renal failure, chronic renal failure, proximal tubal dysfunction, acute kidney transplant rejection, chronic kidney transplant rejection, non-IgA mesangioproliferative glomerulonephritis, postinfectious glomerulonephritis, vasculitides with renal involvement of any kind, any hereditary renal disease, any interstitial nephritis, renal transplant failure, kidney cancer, kidney disease associated with other conditions (e.g., hypertension, diabetes, and autoimmune disease), Dent's disease, nephrocytinosis, Heymann nephritis, a primary kidney disease, a collapsing glomerulopathy, a dense deposit disease, a cryoglobulinemia- associated glomerulonephritis, an Henoch-Schon
  • glomerulonephritis a bacterial endocarditis, a microscopic polyangitis, a Churg-Strauss syndrome, an anti-GBM-antibody mediated glomerulonephritis, amyloidosis, a monoclonal immunoglobulin deposition disease, a fibrillary glomerulonephritis, an immunotactoid glomerulopathy, ischemic tubular injury, a medication-induced tubulo-interstitial nephritis, a toxic tubulo-interstitial nephritis, an infectious tubulo-interstitial nephritis, a bacterial pyelonephritis, a viral infectious tubulo-interstitial nephritis which results from a
  • a metabolic-induced tubulo-interstitial disease a mixed connective disease
  • a cast nephropathy a crystal nephropathy which may results from urate or oxalate or drug-induced crystal deposition
  • an acute cellular tubulo-interstitial allograft rejection a tumoral infiltrative disease which results from a lymphoma or a post- transplant lymphoproliferative disease
  • an obstructive disease of the kidney vascular disease, a thrombotic microangiopathy, a nephroangiosclerosis, an atheroembolic disease, a mixed connective tissue disease, a polyarteritis nodosa, a calcineurin-inhibitor induced-vascular disease, an acute cellular vascular allograft rejection, an acute humoral allograft rejection, early renal function decline (ERFD), end stage renal disease (ESRD), renal vein thrombosis, acute tubular necros
  • the disclosure further provides methods and ALK4: ActRIIB antagonists for use in delaying or preventing progression from: stage 1 to stage 2 kidney disease, stage 2 to stage 3 kidney disease, stage 3 to stage 4 kidney disease, or stage 4 to stage 5 kidney disease.
  • the disclosure further provides methods and ALK4: ActRIIB heteromultimers for use in preventing or reducing kidney inflammation.
  • the disclosure further provides methods and ALK4: ActRIIB heteromultimers for use in preventing or reducing kidney damage. In some embodiments, the disclosure further provides methods and ALK4: ActRIIB heteromultimers for use in preventing or reducing kidney fibrosis.
  • the disclosure relates to methods of treating pulmonary arterial hypertension comprising administering to a patient in need thereof an effective amount of an ALK4:ActRIIB heteromultimer such as those described herein (e.g., an ALK4:ActRIIB heterodimer).
  • administration of the ALK4:ActRIIB heteromultimer decreases ventricle hypertrophy in the patient.
  • administration of the ALK4:ActRIIB heteromultimer decreases ventricle hypertrophy in the patient by at least 10% (e.g., 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or at least 80%).
  • administration of the ALK4:ActRIIB heteromultimer decreases smooth muscle hypertrophy in the patient. In some embodiments, administration of the ALK4: ActRIIB heteromultimer decreases smooth muscle hypertrophy in the patient by at least 10% (e.g., 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%), or at least 80%). In some embodiments, administration of the ALK4:ActRIIB heteromultimer decreases pulmonary arteriole muscularity in the patient. In some
  • administration of the ALK4:ActRIIB heteromultimer decreases pulmonary arteriole muscularity in the patient by at least 10% (e.g., 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or at least 80%). In some embodiments, administration of the ALK4:ActRIIB heteromultimer decreases pulmonary vascular resistance in the patient. In some embodiments, administration of the ALK4:ActRIIB heteromultimer decreases pulmonary vascular resistance in the patient by at least 10% (e.g., 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or at least 80%)).
  • administration of the ALK4:ActRIIB heteromultimer decreases pulmonary vascular resistance in the patient by at least 25-30%).
  • the patient has pulmonary arterial hypertension and has Functional Class II or Class III pulmonary hypertension in accordance with the World Health Organization's functional classification system for pulmonary hypertension.
  • the patient has pulmonary arterial hypertension that is classified as one or more subtypes selected from the group consisting of: idiopathic or heritable pulmonary arterial hypertension, drug- and/or toxin-induced pulmonary hypertension, pulmonary hypertension associated with connective tissue disease, and pulmonary hypertension associated with congenital systemic-to- pulmonary shunts at least 1 year following shunt repair.
  • the patient has been treated with one or more vasodilators.
  • the patient has been treated with one or more agents selected from the group consisting of: phosphodiesterase type 5 inhibitors, soluble guanylate cyclase stimulators, prostacyclin receptor agonist, and endothelin receptor antagonists.
  • the one or more agents is selected from the group consisting of: bosentan, sildenafil, beraprost, macitentan, selexipag, epoprostenol, treprostinil, iloprost, ambrisentan, and tadalafil.
  • the method further comprises administration of one or more vasodilators.
  • the method further comprises administration of one or more agents selected from the group consisting of: phosphodiesterase type 5 inhibitors, soluble guanylate cyclase stimulators, prostacyclin receptor agonist, and endothelin receptor antagonists.
  • the one or more agents is selected from the group consisting of: bosentan, sildenafil, beraprost, macitentan, selexipag, epoprostenol, treprostinil, iloprost, ambrisentan, and tadalafil.
  • the patient has a 6-minute walk distance from 150 to 400 meters.
  • the method increases the patient's 6-minute walk distance by at least 10 meters (e.g., at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, or more than 400 meters).
  • the patient has a hemoglobin level from >8 and ⁇ 15 g/dl.
  • the method delays clinical worsening of pulmonary arterial hypertension.
  • the method delays clinical worsening of pulmonary hypertension in accordance with the World Health Organization's functional classification system for pulmonary hypertension.
  • the method reduces the risk of hospitalization for one or more complications associated with pulmonary arterial
  • the present disclosure relates to methods of treating pulmonary hypertension comprising administering to a patient in need thereof an effective amount of an ALK4:ActRIIB heteromultimer. In certain aspects, the disclosure relates to methods of preventing pulmonary hypertension comprising administering to a patient in need thereof an effective amount of an ALK4:ActRIIB heteromultimer. In certain aspects, the disclosure relates to methods of reducing the progression rate of pulmonary hypertension comprising administering to a patient in need thereof an effective amount of an ALK4:ActRIIB heteromultimer. In some embodiments, the disclosure provides for a method of treating an interstitial lung disease, comprising administering to a patient in need thereof an effective amount of an ALK4:ActRIIB heteromultimer.
  • the disclosure provides for a method of treating, preventing, or reducing the progression rate and/or severity of one or more complications of an interstitial lung disease, comprising administering to a patient in need thereof an effective amount of an ALK4:ActRIIB heteromultimer.
  • the interstitial lung disease is idiopathic pulmonary fibrosis.
  • the disclosure relates to methods of reducing the severity of pulmonary hypertension comprising administering to a patient in need thereof an effective amount of an
  • the disclosure relates to methods of treating one or more complications (e.g., smooth muscle and/or endothelial cell proliferation in the pulmonary artery, angiogenesis in the pulmonary artery, dyspnea, chest pain, pulmonary vascular remodeling, right ventricular hypertrophy, and pulmonary fibrosis) of pulmonary hypertension comprising administering to a patient in need thereof an effective amount of an ALK4:ActRIIB heteromultimer.
  • one or more complications e.g., smooth muscle and/or endothelial cell proliferation in the pulmonary artery, angiogenesis in the pulmonary artery, dyspnea, chest pain, pulmonary vascular remodeling, right ventricular hypertrophy, and pulmonary fibrosis
  • the disclosure relates to methods of preventing one or more complication of pulmonary hypertension (e.g., smooth muscle and/or endothelial cell proliferation in the pulmonary artery, angiogenesis in the pulmonary artery, dyspnea, chest pain, pulmonary vascular remodeling, right ventricular hypertrophy, and pulmonary fibrosis) comprising administering to a patient in need thereof an effective amount an ALK4:ActRIIB heteromultimer.
  • pulmonary hypertension e.g., smooth muscle and/or endothelial cell proliferation in the pulmonary artery, angiogenesis in the pulmonary artery, dyspnea, chest pain, pulmonary vascular remodeling, right ventricular hypertrophy, and pulmonary fibrosis
  • the disclosure relates to methods of reducing the progression rate of one or more complication of pulmonary hypertension (e.g., smooth muscle and/or endothelial cell proliferation in the pulmonary artery, angiogenesis in the pulmonary artery, dyspnea, chest pain, pulmonary vascular remodeling, right ventricular hypertrophy, and pulmonary fibrosis) comprising administering to a patient in need thereof an effective amount an ALK4:ActRIIB heteromultimer.
  • the disclosure relates to methods of reducing the severity of one or more pulmonary hypertension (e.g., smooth muscle and/or endothelial cell proliferation in the pulmonary artery, angiogenesis in the pulmonary artery, dyspnea, chest pain, pulmonary vascular remodeling, right ventricular hypertrophy, and pulmonary fibrosis) comprising administering to a patient in need thereof an effective amount an ALK4:ActRIIB heteromultimer.
  • the disclosure relates to methods of reducing the severity of one or more
  • pulmonary hypertension e.g., smooth muscle and/or endothelial cell proliferation in the pulmonary artery, angiogenesis in the pulmonary artery, dyspnea, chest pain, pulmonary vascular remodeling, right ventricular hypertrophy, and pulmonary fibrosis
  • administering comprising administering to a patient in need thereof an effective amount of an
  • methods described herein relate to a patient having pulmonary arterial hypertension.
  • methods described herein relate to a patient having a resting pulmonary arterial pressure (PAP) of at least 25 mm Hg (e.g., at least 25, 30, 35, 40, 45, or 50 mm Hg).
  • PAP resting pulmonary arterial pressure
  • the methods described herein reduce PAP in a patient having pulmonary hypertension.
  • the method may reduce PAP by at least 3 mmHg (e.g., at least 3, 5, 7, 10, 12, 15, 20, or 25 mm Hg) in a patient having pulmonary hypertension.
  • the methods described herein reduce pulmonary vascular resistance in a patient having
  • the methods described herein increase pulmonary capillary wedge pressure in a patient having pulmonary hypertension. In some embodiments, the methods described herein increase left ventricular end-diastolic pressure in a patient having pulmonary hypertension. In some embodiments, the methods described herein increase (improves) exercise capacity (ability, tolerance) in a patient having
  • the method may increase 6-minute walk distance in a patient having pulmonary hypertension, optionally increasing 6-minute walk distance by at least 10 meters (e.g., at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more meters).
  • the method may reduce the patient's Borg dyspnea index (BDI), which optionally may be assessed after a 6-minute walk test.
  • the method reduces the patient's Borg dyspnea inde (BDI) by at least 0.5 index points (e.g., at least 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 index points).
  • BDI Borg dyspnea index
  • the methods described herein relate to a patient having Class I, Class II, Class III, or Class IV pulm nary hypertension as recognized by the World Health Organization.
  • the methods described herein relate to delaying clinical progression (worsening) of pulmonary hypertension (e.g., progression as measured by the World Health Organization standard).
  • the method prevents or delays pulmonary hypertension Class progression (e.g., prevents or delays progression from Class I to Class II, Class II to Class III, or Class III to Class IV pulmonary hypertension as recognized by the World Health Organization).
  • the method promotes or increases pulmonary hypertension Class regression (e.g., promotes or increases regression from Class IV to Class III, Class III to Class II, or Class II to Class I pulmonary hypertension as recognized by the World Health Organization).
  • the patient is further administered one or more supportive therapies or active agents for treating pulmonary hypertension in addition to the one or more GDF BMP antagonist.
  • the patient also may be administered one or more supportive therapies or active agents selected from the group consisting of: prostacyclin and derivatives thereof (e.g., epoprostenol, treprostinil, and iloprost); prostacyclin receptor agonists (e.g., selexipag); endothelin receptor antagonists (e.g., thelin, ambrisentan, macitentan, and bosentan); calcium channel blockers (e.g., amlodipine, diltiazem, and nifedipine; anticoagulants (e.g., warfarin); diuretics; oxygen therapy; atrial septostomy; pulmonary thromboendarterectomy; phosphodiesterase type 5 inhibitors (e,g., sildenafil and tadalafil); activators of soluble guanylate cyclase (e.g., cinaciguat and riociguat); ASK-1 inhibitor
  • Figure 1 shows an alignment of extracellular domains of human ActRIIA (SEQ ID NO: 49) and human ActRIIB (SEQ ID NO: 2) with the residues that are deduced herein, based on composite analysis of multiple ActRIIB and ActRIIA crystal structures, to directly contact ligand indicated with boxes.
  • Figure 2 shows a multiple sequence alignment of various vertebrate ActRIIB precursor proteins without their intracellular domains (SEQ ID NOs: 50-55, respectively) human ActRIIA precursor protein without its intracellular domain (SEQ ID NO: 56), and a consensus ActRII precursor protein (SEQ ID NO: 57).
  • Figure 3 shows multiple sequence alignment of Fc domains from human IgG isotypes using Clustal 2.1. Hinge regions are indicated by dotted underline. Double underline indicates examples of positions engineered in IgGl Fc to promote asymmetric chain pairing and the corresponding positions with respect to other isotypes IgG2, IgG3 and IgG4.
  • Figure 4 shows comparative ligand binding data for an ALK4-Fc: ActRIIB-Fc heterodimeric protein complex compared to ActRIIB-Fc homodimer and ALK4-Fc homodimer.
  • ligands are ranked by k 0ff , a kinetic constant that correlates well with ligand signaling inhibition, and listed in descending order of binding affinity (ligands bound most tightly are listed at the top).
  • yellow, red, green, and blue lines indicate magnitude of the off-rate constant.
  • Solid black lines indicate ligands whose binding to heterodimer is enhanced or unchanged compared with homodimer, whereas dashed red lines indicate substantially reduced binding compared with homodimer.
  • the ALK4-Fc: ActRIIB-Fc heterodimer displays enhanced binding to activin B compared with either homodimer, retains strong binding to activin A, GDF8, and GDF11 as observed with ActRIIB-Fc homodimer, and exhibits substantially reduced binding to BMP9, BMP 10, and GDF3.
  • the heterodimer retains intermediate-level binding to BMP6.
  • Figure 5 shows a multiple sequence alignment of ALK4 extracellular domains derived from various vertebrate species (SEQ ID NOs: 59-65).
  • Figures 6A-6D show schematic examples of heteromeric protein complexes comprising an ALK4 polypeptide and an ActRIIB polypeptide.
  • the ALK4 polypeptide (from left to right) is part of a fusion polypeptide that comprises a first member of an interaction pair ("Ci")
  • the ActRIIB polypeptide is part of a fusion polypeptide that comprises a second member of an interaction pair ("C 2 ").
  • Suitable interaction pairs included, for example, heavy chain and/or light chain immunoglobulin interaction pairs, truncations, and variants thereof such as those described herein [e.g., Spiess et al (2015) Molecular Immunology 67(2A): 95-106].
  • a linker may be positioned between the ALK4 or ActRIIB polypeptide and the corresponding member of the interaction pair.
  • the first and second members of the interaction pair may be unguided, meaning that the members of the pair may associate with each other or self-associate without substantial preference, and they may have the same or different amino acid sequences.
  • the interaction pair may be a guided (asymmetric) pair, meaning that the members of the pair associate preferentially with each other rather than self-associate.
  • Figure 6B Complexes of higher order can be envisioned.
  • Figure 6C and 6D Figure 7 shows comparative ALK4-Fc: ActRIIB-Fc heterodimer/ActRIIB-
  • Fc ActRIIB-Fc homodimer IC 5 o data as determined by an A-204 Reporter Gene Assay as described herein.
  • ALK4-Fc ActRIIB-Fc heterodimer inhibits activin A, activin B, GDF8, and GDF11 signaling pathways similarly to the ActRIIB-Fc: ActRIIB-Fc heterodimer.
  • ALK4-Fc ActRIIB-Fc heterodimer inhibition of BMP9 and BMP 10 signaling pathways is significantly reduced compared to the ActRIIB-Fc: ActRIIB-Fc heterodimer.
  • Figures 8A-8C shows gene expression profiles of fibrotic genes (Collal, Fibronectin, PAI-1, CTGF, and a-SMA), inflammatory genes (T F-alpha, and MCP1), cytokine genes (TGF-beta 1, GF-beta 2, TGF-beta 3, and activin A), kidney injury gene (NGAL), Hypoxia- inducible factor 1 -alpha (HIFla), and activin A receptor (Acvr2A) from mouse kidneys subjected to unilateral ureteral obstruction (UUO). Samples from the contralateral, non- surgery kidney were used as a control (Ctrl). Gene expression profiles were obtained at 17 days post-surgery.
  • mice were administered either PBS or an ALK4-Fc:ActRIIB-Fc homodimer at days 3, 7, 10, and 14 post-surgery.
  • ($) denotes a statistical difference between UUO kidneys at 17 days in mice administered only PBS compared UUO kidneys at 17 days in mice administered the ALK7-Fc: ActRIIB-Fc homodimer.
  • (@) denotes that no transcript was detected.
  • Figures 9A and 9B shows proteinuria levels in Col4a3 and Col4a5 Alport mice treated with vehicle (Col4a3-Veh and Col4a5-Veh) or an ALK4-Fc:ActRIIB-Fc fusion protein (Col4a3-IIB/ALK4 and Col4a5-IIB/ALK4).
  • Figure 9A shows that ALK4- Fc: ActRIIB-Fc treatment significantly reduced proteinuria levels compared to vehicle in the Col4a3 Alport mice.
  • Figure 9B shows that ALK4-Fc: ActRIIB-Fc treatment significantly reduced proteinuria levels compared to vehicle in the Col4a5 Alport mice.
  • Figures lOA-lOC show histological analysis of kidney tissue from Col4a3-/- Alport mice treated with vehicle (Col4a3-Veh) or an ALK4-Fc:ActRIIB-Fc heterodimer (Col4a3- IIB/ALK4).
  • Figure 10A represents the percentage of tissue fibrosis as revealed by collagen-I staining. Collagen-I staining indicates that ALK4-Fc: ActRIIB-Fc treatment significantly reduced kidney fibrosis in this Alport mouse model.
  • Figure 10B represents the percentage of tissue fibrosis as revealed by trichrome staining.
  • Trichrome staining indicates that ALK4- Fc:ActRIIB-Fc treatment significantly reduced kidney fibrosis in this Alport mouse model.
  • Figure IOC represents the percentage of sclerotic glomeruli as revealed by histological analysis. The data indicate that ALK4-Fc: ActRIIB-Fc treatment significantly reduced sclerotic glomeruli in this Alport mouse model.
  • heteromultimers comprising a TGFP superfamily type I receptor polypeptide and a TGFP superfamily type II receptor polypeptide, uses thereof, and methods of making such heteromultimers. See, e.g., Figure 6.
  • heteromultimers comprise an extracellular domain of a TGFp superfamily type I receptor polypeptide and an extracellular domain of a TGFP superfamily type II receptor polypeptide.
  • the disclosure provides heteromultimers that comprise an ALK4 polypeptide and an ActRIIB polypeptide.
  • ALK4 polypeptides comprise a ligand-binding domain of an ALK4 receptor and such ActRIIB polypeptides comprise a ligand-binding domain of an ActRIIB receptor.
  • ALK4:ActRIIB heteromultimers of the disclosure have an altered TGFp superfamily ligand binding profile/specificity compared to a corresponding sample of a homomultimer (e.g., an ALK4:ActRIIB heterodimer compared to an ActRIIB: ActRIIB homodimer or an ALK4:ALK4 homodimer).
  • the TGF- ⁇ superfamily is comprised of over 30 secreted factors including TGF-betas, activins, nodals, bone morphogenetic proteins (BMPs), growth and differentiation factors (GDFs), and anti-Mullerian hormone (AMH) [Weiss et al. (2013) Developmental Biology, 2(1): 47-63].
  • BMPs bone morphogenetic proteins
  • GDFs growth and differentiation factors
  • AH anti-Mullerian hormone
  • TGF- ⁇ superfamily proteins are key mediators of stem cell self-renewal, gastrulation, differentiation, organ morphogenesis, and adult tissue homeostasis. Consistent with this ubiquitous activity, aberrant TGF-beta superfamily signaling is associated with a wide range of human pathologies including, for example, autoimmune disease, cardiovascular disease, fibrotic disease, and cancer.
  • Ligands of the TGF-beta superfamily share the same dimeric structure in which the central 3-1/2 turn helix of one monomer packs against the concave surface formed by the beta-strands of the other monomer.
  • the majority of TGF-beta family members are further stabilized by an intermolecular disulfide bond. This disulfide bonds traverses through a ring formed by two other disulfide bonds generating what has been termed a 'cysteine knot' motif [Lin et al. (2006) Reproduction 132: 179-190; and Hinck et al. (2012) FEBS Letters 586: 1860-1870].
  • TGF-beta superfamily signaling is mediated by heteromeric complexes of type I and type II serine/threonine kinase receptors, which phosphorylate and activate downstream SMAD proteins (e.g., SMAD proteins 1, 2, 3, 5, and 8) upon ligand stimulation [Massague (2000) Nat. Rev. Mol. Cell Biol. 1 : 169-178].
  • SMAD proteins e.g., SMAD proteins 1, 2, 3, 5, and 8
  • type I receptors mediate intracellular signaling while the type II receptors are required for binding TGF-beta superfamily ligands.
  • Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors.
  • the TGF-beta family can be divided into two phylogenetic branches based on the type I receptors they bind and the Smad proteins they activate.
  • the other branch comprises the more distantly related proteins of the superfamily and includes, e.g., BMP2, BMP4, BMP5, BMP6, BMP7, BMP 8 a, BMP 8b, BMP9, BMP 10, GDF1, GDF5, GDF6, and GDF7, which signal through Smads 1, 5, and 8.
  • BMP2, BMP4, BMP5, BMP6, BMP7, BMP 8 a, BMP 8b, BMP9, BMP 10, GDF1, GDF5, GDF6, and GDF7 which signal through Smads 1, 5, and 8.
  • Activins are members of the TGF-beta superfamily and were initially discovered as regulators of secretion of follicle-stimulating hormone, but subsequently various reproductive and non-reproductive roles have been characterized.
  • the human genome also encodes an activin C and an activin E, which are primarily expressed in the liver, and heterodimeric forms containing ⁇ ⁇ or ⁇ ⁇ are also known.
  • activins are unique and multifunctional factors that can stimulate hormone production in ovarian and placental cells, support neuronal cell survival, influence cell-cycle progress positively or negatively depending on cell type, and induce mesodermal differentiation at least in amphibian embryos [DePaolo et al. (1991) Proc Soc Ep Biol Med. 198:500-512; Dyson et al. (1997) Curr Biol. 7:81-84; and Woodruff (1998) Biochem Pharmacol. 55:953-963]. In several tissues, activin signaling is antagonized by its related heterodimer, inhibin.
  • activin promotes FSH synthesis and secretion, while inhibin reduces FSH synthesis and secretion.
  • Other proteins that may regulate activin bioactivity and/or bind to activin include follistatin (FS), follistatin-related protein (FSRP, also known as FLRG or FSTL3), and a 2 -macroglobulin.
  • agents that bind to "activin A” are agents that specifically bind to the PA subunit, whether in the context of an isolated PA subunit or as a dimeric complex (e.g., a PAPA homodimer or a PAPB heterodimer).
  • agents that bind to "activin A” are specific for epitopes present within the PA subunit, but do not bind to epitopes present within the non-p A subunit of the complex (e.g., the PB subunit of the complex).
  • agents disclosed herein that antagonize (inhibit) "activin A” are agents that inhibit one or more activities as mediated by a PA subunit, whether in the context of an isolated PA subunit or as a dimeric complex (e.g., a PAPA homodimer or a PAPB heterodimer).
  • agents that inhibit "activin A” are agents that specifically inhibit one or more activities of the PA subunit, but do not inhibit the activity of the non-PA subunit of the complex (e.g., the PB subunit of the complex). This principle applies also to agents that bind to and/or inhibit "activin B", "activin C", and "activin E”.
  • Agents disclosed herein that antagonize "activin AB” are agents that inhibit one or more activities as mediated by the PA subunit and one or more activities as mediated by the PB subunit. The same principle also applies to agent that bind to and/or inhibit "activin AC", “activin BC”, “activin AE”, and "activin BE”.
  • the BMPs and GDFs together form a family of cysteine-knot cytokines sharing the characteristic fold of the TGF-beta superfamily [Rider et al. (2010) Biochem J., 429(1): 1-12].
  • This family includes, for example, BMP2, BMP4, BMP6, BMP7, BMP2a, BMP3, BMP3b (also known as GDF10), BMP4, BMP5, BMP6, BMP7, BMP8, BMP 8 a, BMP 8b, BMP9 (also known as GDF2), BMP10, BMP11 (also known as GDF11), BMP 12 (also known as GDF7), BMP 13 (also known as GDF6), BMP 14 (also known as GDF5), BMP15, GDF1, GDF3 (also known as VGR2), GDF8 (also known as myostatin), GDF9, GDF15, and decapentaplegic.
  • BMP2a BMP3, BMP3b
  • BMP9 also known
  • BMP/GDFs display morphogenetic activities in the development of a wide range of tissues.
  • BMP/GDF homo- and hetero-dimers interact with combinations of type I and type II receptor dimers to produce multiple possible signaling complexes, leading to the activation of one of two competing sets of SMAD transcription factors.
  • BMP/GDFs have highly specific and localized functions. These are regulated in a number of ways, including the developmental restriction of BMP/GDF expression and through the secretion of several specific BMP antagonist proteins that bind with high affinity to the cytokines. Curiously, a number of these antagonists resemble TGF-beta superfamily ligands.
  • GDF8 Growth and differentiation factor-8
  • GDF8 is a negative regulator of skeletal muscle mass and is highly expressed in developing and adult skeletal muscle.
  • the GDF8 null mutation in transgenic mice is characterized by a marked hypertrophy and hyperplasia of skeletal muscle [McPherron et al. Nature (1997) 387:83-90].
  • Similar increases in skeletal muscle mass are evident in naturally occurring mutations of GDF8 in cattle and, strikingly, in humans [Ashmore et al. (1974) Growth, 38:501-507;
  • GDF8 can modulate the production of muscle-specific enzymes ⁇ e.g., creatine kinase) and modulate myoblast cell proliferation [International Patent Application Publication No. WO 00/43781].
  • the GDF8 propeptide can noncovalently bind to the mature GDF8 domain dimer, inactivating its biological activity [Miyazono et al. (1988) J. Biol. Chem., 263 : 6407-6415; Wakefield et al. (1988) J. Biol. Chem., 263; 7646-7654; and Brown et al. (1990) Growth Factors, 3 : 35-43].
  • Other proteins which bind to GDF8 or structurally related proteins and inhibit their biological activity include follistatin, and potentially, follistatin-related proteins [Gamer et al. (1999) Dev. Biol., 208: 222-232].
  • GDF11 also known as BMP11, is a secreted protein that is expressed in the tail bud, limb bud, maxillary and mandibular arches, and dorsal root ganglia during mouse
  • GDF11 plays a unique role in patterning both mesodermal and neural tissues [Gamer et al. (1999) Dev Biol., 208:222-32]. GDF11 was shown to be a negative regulator of chondrogenesis and myogenesis in developing chick limb [Gamer et al. (2001) Dev Biol., 229:407-20]. The expression of GDF11 in muscle also suggests its role in regulating muscle growth in a similar way to GDF8.
  • GDF11 may have in vitro and in vivo applications in the treatment of diseases such as muscle diseases and neurodegenerative diseases (e.g., amyotrophic lateral sclerosis).
  • the ALK4:ActRIIB heterodimer displays enhanced binding to activin B compared with either homodimer, and retains strong binding to activin A, GDF8, and GDF 1 1 as observed with the ActRIIB homodimer.
  • the ALK4:ActRIIB heterodimer exhibits substantially reduced binding to BMP9, BMP 10, and GDF3 compared to the ActRIIB homodimer.
  • BMP9 displays low or no observable affinity for the ALK4: ActRIIB heterodimer, whereas this ligand binds strongly to ActRIIB homodimer.
  • ALK4: ActRIIB heterodimers are more selective antagonists of activin A, activin B, GDF8, and GDF1 1 compared to ActRIIB homodimers. Accordingly, an ALK4: ActRIIB heterodimer will be more useful than an ActRIIB homodimer in certain applications where such selective antagonism is advantageous. Examples include therapeutic applications where it is desirable to retain antagonism of one or more of activin (e.g., activin A, activin B, activin AC, activin AB), GDF8, and GDF 1 1 but minimize antagonism of one or more of BMP9, BMP 10, and BMP6.
  • activin e.g., activin A, activin B, activin AC, activin AB
  • ALK4:ActRIIB heterodimers exert beneficial anabolic effects on skeletal muscle and bone as well as catabolic effects on adipose tissue, very similar to those of an ActRIIB homodimer.
  • an ActRIIB :ALK4 heterodimer exhibits only low-affinity or transient binding to BMP9 and BMP 10 and so will have little to no concurrent inhibition on processes mediated by those ligands, such as angiogenesis.
  • This novel selectivity will be useful, for example, in treating patients in need of stimulatory effects on, e.g., muscle and bone, and inhibitory effects on fat, but not in need of altered angiogenesis.
  • heteromer or “heteromultimer” is a complex comprising at least a first polypeptide chain and a second polypeptide chain, wherein the second polypeptide chain differs in amino acid sequence from the first polypeptide chain by at least one amino acid residue.
  • the heteromer can comprise a "heterodimer” formed by the first and second polypeptide chains or can form higher order structures where one or more polypeptide chains in addition to the first and second polypeptide chains are present.
  • heteromultimer examples include heterodimers, heterotrimers, heterotetramers and further oligomeric structures.
  • Heterodimers are designated herein as X: Y or equivalently as X-Y, where X represents a first polypeptide chain and Y represents a second polypeptide chain.
  • Higher-order heteromers and oligomeric structures are designated herein in a corresponding manner.
  • a heteromultimer is recombinant (e.g., one or more polypeptide components may be a recombinant protein), isolated and/or purified.
  • the term “homologous,” when modified with an adverb such as "highly,” may refer to sequence similarity and may or may not relate to a common evolutionary origin.
  • sequence similarity in all its grammatical forms, refers to the degree of identity or correspondence between nucleic acid or amino acid sequences that may or may not share a common evolutionary origin.
  • Percent (%) sequence identity with respect to a reference polypeptide (or nucleotide) sequence is defined as the percentage of amino acid residues (or nucleic acids) in a candidate sequence that are identical to the amino acid residues (or nucleic acids) in the reference polypeptide (nucleotide) sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
  • Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, however, % amino acid (nucleic acid) sequence identity values are generated using the sequence comparison computer program ALIGN-2.
  • the ALIGN-2 sequence comparison computer program was authored by Genentech, Inc., and the source code has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U. S.
  • the ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, Calif, or may be compiled from the source code.
  • the ALIGN-2 program should be compiled for use on a UNIX operating system, including digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
  • Alternize in all its grammatical forms, refers to the process of activating a protein and/or gene (e.g., by activating or amplifying that protein's gene expression or by inducing an inactive protein to enter an active state) or increasing a protein' s and/or gene's activity.
  • “Antagonize”, in all its grammatical forms, refers to the process of inhibiting a protein and/or gene (e.g., by inhibiting or decreasing that protein's gene expression or by inducing an active protein to enter an inactive state) or decreasing a protein' s and/or gene's activity.
  • the terms “about” and “approximately” may mean values that are within an order of magnitude, preferably ⁇ 5 -fold and more preferably ⁇ 2-fold of a given value.
  • ALK4 ActRIIB Heteromultimers
  • the present disclosure relates to heteromultimers comprising one or more ALK4 receptor polypeptides (e.g., SEQ ID NOs: 9, 10, 19, 20, 42, 44, 47, 48, 74, and 76) and one or more ActRIIB receptor polypeptides (e.g., SEQ ID NOs: 1, 2, 3, 4, 5, 6, 39, 41, 45, 46, 70, 72, 78, and 80) which are generally referred to herein as "ALK4: ActRIIB heteromultimer complexes" or "ALK4:ActRIIB heteromultimers”.
  • ALK4 receptor polypeptides e.g., SEQ ID NOs: 9, 10, 19, 20, 42, 44, 47, 48, 74, and 76
  • ActRIIB receptor polypeptides e.g., SEQ ID NOs: 1, 2, 3, 4, 5, 6, 39, 41, 45, 46, 70, 72, 78, and 80
  • ALK4 ActRIIB heteromultimer complexes
  • ALK4:ActRIIB heteromultimers of the disclosure are soluble, for example, a heteromultimer may comprises a soluble portion (domain) of an ALK4 receptor and a soluble portion
  • heteromultimers of the disclosure comprise an extracellular domain of an ALK4 receptor and an extracellular domain of an ActRIIB receptor.
  • Example extracellular domains ALK4 and ActRIIB receptors are disclosed herein and such sequences, as well as fragments, functional variants, and modified forms thereof, may be used in accordance with the inventions of the disclosure (e.g., ALK4:ActRIIB heteromultimer compositions and uses thereof).
  • ALK4:ActRIIB heteromultimers of the disclosure include, e.g., heterodimers, heterotrimers, heterotetramers and higher order oligomeric structures. See, e.g., Figure 6.
  • heteromultimers of the disclosure are ALK4:ActRIIB heterodimers.
  • ALK4:ActRIIB heteromultimers of the disclosure bind to one or more
  • ALK4:ActRIIB heteromultimers may bind to one or more of activin (e.g., activin A, activin B, activin C, activin E, activin AC, activin AB, activin BC, activin AE, and activin BE), GDF8, GDF11, BMP6, GDF3, and BMP10.
  • activin e.g., activin A, activin B, activin C, activin E, activin AC, activin AB, activin BC, activin AE, and activin BE
  • ALK4:ActRIIB heteromultimers bind to activin A.
  • ALK4:ActRIIB heteromultimers bind to activin B.
  • ALK4:ActRIIB heteromultimers bind to activin C.
  • ALK4:ActRIIB heteromultimers bind to activin E. In some embodiments, ALK4:ActRIIB heteromultimers bind to activin AB. In some embodiments, ALK4:ActRIIB heteromultimers bind to activin AC. In some embodiments, ALK4:ActRIIB heteromultimers bind to activin AE. In some embodiments, ALK4:ActRIIB heteromultimers bind to activin BC. In some embodiments, ALK4:ActRIIB heteromultimers bind to activin BE. In some embodiments, ALK4:ActRIIB heteromultimers bind to GDF11. In some embodiments, ALK4: ActRIIB heteromultimers bind to GDF8.
  • ALK4:ActRIIB heteromultimers bind to BMP6. In some embodiments, ALK4:ActRIIB heteromultimers bind to GDF3. In some embodiments, ALK4:ActRIIB heteromultimers bind to BMP10. In some embodiments, ALK4:ActRIIB heteromultimers do not bind to, or no not substantially bind to BMP9 (e.g., have
  • ALK4:ActRIIB heteromultimers binds with stronger affinity to activin B compared to a corresponding ActRIIB homomultimer. In some embodiments, ALK4:ActRIIB heteromultimers binds with weaker affinity to GDF3 compared to a corresponding ActRIIB homomultimer. In some embodiments,
  • ALK4 ActRIIB heteromultimers binds with weaker affinity to BMP9 compared to a corresponding ActRIIB homomultimer.
  • ALK4:ActRIIB heteromultimers binds with weaker affinity to BMP 10 compared to a corresponding ActRIIB homomultimer.
  • ALK4:ActRIIB heteromultimers may further bind to one or more of BMP2, BMP2/7, BMP3, BMP4, BMP4/7, BMP5, BMP7, BMP 8 a, BMP8b, GDF5, GDF6/BMP13, GDF7, GDF9b/BMP15, GDF15/MIC1, TGF- ⁇ , TGF-P2, TGF-P3, nodal, glial cell-derived neurotrophic factor (GD F), neurturin, artemin, persephin, MIS, and Lefty.
  • GD F glial cell-derived neurotrophic factor
  • ALK4:ActRIIB heteromultimers may be used to inhibit (antagonize) signaling (e.g., Smad 2/3 and/or Smad 1/5/8 signaling) mediated by one or more TGFP superfamily ligands.
  • ALK4:ActRIIB heteromultimers of the disclosure may be used to inhibit intracellular signaling by one or more TGFP superfamily ligands in, for example, a cell-based assay such as those described herein.
  • ALK4:ActRIIB heteromultimers may inhibit signaling mediated by one or more of activin (e.g., activin A, activin B, activin C, activin E, activin AC, activin AB, activin BC, activin AE, and activin BE), GDF8, GDF11, BMP6, GDF3, and BMP 10 in a cell-based assay.
  • activin e.g., activin A, activin B, activin C, activin E, activin AC, activin AB, activin BC, activin AE, and activin BE
  • GDF8 GDF11 e.g., GDF11, BMP6, GDF3, and BMP 10
  • ALK4:ActRIIB heteromultimers may inhibit activin A signaling in a cell-based assay.
  • ALK4:ActRIIB heteromultimers may inhibit activin B signaling in a cell-based assay.
  • ALK4:ActRIIB heteromultimers may inhibit activin C signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers may inhibit activin D signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers may inhibit activin E signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers may inhibit activin AB signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers may inhibit activin AC signaling in a cell-based assay.
  • ALK4:ActRIIB heteromultimers may inhibit activin BC signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers may inhibit activin AE signaling in a cell-based assay. In some embodiments, ALK4:ActRlTB heteromultimers may inhibit activin BE signaling in a cell-based assay. In some embodiments, ALK4: ActRIIB heteromultimers may inhibit GDF11 signaling in a cell- based assay. In some embodiments, ALK4:ActRIIB heteromultimers may inhibit GDF8 signaling in a cell-based assay.
  • ALK4:ActRHB heteromultimers may inhibit BMP6 signaling in a cell-based assay. In some embodiments, ALK4: ActRIIB heteromultimers may inhibit GDF3 signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers may inhibit BMP9 signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB heteromultimers do not inhibit, or do not substantially inhibit BMP9 signaling in a cell-based assay. In some embodiments, ALK4:ActRIIB
  • heteromultimers are stronger inhibitors of activin B signaling in a cell-based assay compared to a corresponding ActRIIB homomultimer.
  • ALK4:ActRIIB heteromultimers are weaker inhibitors of BMP 10 signaling in a cell-based assay compared to a corresponding ActRIIB homomultimer.
  • heteromultimers are stronger inhibitors of GDF3 signaling in a cell-based assay compared to a corresponding ActRIIB homomultimer.
  • ALK4:ActRIIB heteromultimers are stronger inhibitors of BMP9 signaling in a cell-based assay compared to a corresponding ActRIIB homomultimer.
  • ALK4:ActRIIB heteromultimers may further inhibit intracellular signaling by one or more of BMP2, BMP2/7, BMP3, BMP4, BMP4/7, BMP5, BMP7, BMP 8 a, BMP8b, GDF5, GDF6/BMP13, GDF7, GDF9b/BMP15, GDF15/MIC1, TGF- ⁇ , TGF-P2, TGF-P3, nodal, glial cell-derived neurotrophic factor (GDNF), neurturin, artemin, persephin, MIS, and Lefty in a cell-based assay.
  • GDNF glial cell-derived neurotrophic factor
  • ActRIIB refers to a family of activin receptor type 1 ⁇ (ActRIIB) proteins from any species and variants derived from such ActRIIB proteins by mutagenesis or other modification. Reference to ActRIIB herein is understood to be a reference to any one of the currently identified forms. Members of the ActRIIB family are generally transmembrane proteins, composed of a ligand-binding extracellular domain comprising a cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine kinase activity.
  • ActRIIB polypeptide includes polypeptides comprising any naturally occurring polypeptide of an ActRIIB family member as well as any variants thereof
  • the human ActRIIB precursor protein sequence is as follows:
  • the signal peptide is indicated with a single underline; the extracellular domain is indicated in bold font; and the potential, endogenous N-linked glycosylation sites are indicated with a double underline.
  • the processed extracellular ActRIIB polypeptide sequence is as follows:
  • the protein may be produced with an "SGR" sequence at the
  • a form of ActRIIB with an alanine at position 64 of SEQ ID NO: 1 is also reported in the literature See, e.g., Hilden et al. (1994) Blood, 83(8): 2163-2170. Applicants have ascertained that an ActRIIB-Fc fusion protein comprising an extracellular domain of ActRIIB with the A64 substitution has a relatively low affinity for activin and GDF11. By contrast, the same ActRIIB-Fc fusion protein with an arginine at position 64 (R64) has an affinity for activin and GDF11 in the low nanomolar to high picomolar range. Therefore, sequences with an R64 are used as the "wild-type" reference sequence for human ActRIIB this disclosure.
  • the signal peptide is indicated by single underline and the extracellular domain is indicated by bold font.
  • the processed extracellular ActRIIB polypeptide sequence of the alternative A64 form is as follows:
  • the protein may be produced with an "SGR" sequence at the N-terminus.
  • the C-terminal "tail" of the extracellular domain is indicated by single underline.
  • the sequence with the "tail” deleted (a ⁇ 15 sequence) is as follows:
  • a nucleic acid sequence encoding the human ActRIIB precursor protein is shown below (SEQ ID NO: 7), representing nucleotides 25-1560 of Genbank Reference Sequence NM 001106.3, which encode amino acids 1-513 of the ActRIIB precursor.
  • the sequence as shown provides an arginine at position 64 and may be modified to provide an alanine instead.
  • the signal sequence is underlined.
  • a nucleic acid sequence encoding processed extracellular human ActRIIB polypeptide is as follows (SEQ ID NO: 8). The sequence as shown provides an arginine at position 64, and may be modified to provide an alanine instead.
  • FIG. 1 An alignment of the amino acid sequences of human ActRIIB extracellular domain and human ActRIIA extracellular domain are illustrated in Figure 1. This alignment indicates amino acid residues within both receptors that are believed to directly contact ActRII ligands.
  • the composite ActRII structures indicated that the ActRIIB -ligand binding pocket is defined, in part, by residues Y31, N33, N35, L38 through T41, E47, E50, Q53 through K55, L57, H58, Y60, S62, K74, W78 through N83, Y85, R87, A92, and E94 through F101. At these positions, it is expected that conservative mutations will be tolerated.
  • an active, human ActRIIB variant polypeptide useful in accordance with the presently disclosed methods may include one or more amino acids at corresponding positions from the sequence of another vertebrate
  • ActRIIB may include a residue that is similar to that in the human or other vertebrate sequences. Without meaning to be limiting, the following examples illustrate this approach to defining an active ActRIIB variant.
  • L46 in the human extracellular domain is a valine m Xenopus ActRIIB (SEQ ID NO: 55), and so this position may be altered, and optionally may be altered to another hydrophobic residue, such as V, I or F, or a non- polar residue such as A.
  • E52 in the human extracellular domain is a K in Xenopus, indicating that this site may be tolerant of a wide variety of changes, including polar residues, such as E, D, K, R, H, S, T, P, G, Y and probably A.
  • T93 in the human extracellular domain is a K in Xenopus, indicating that a wide structural variation is tolerated at this position, with polar residues favored, such as S, K, R, E, D, H, G, P, G and Y.
  • F108 in the human extracellular domain is a Y in Xenopus, and therefore Y or other hydrophobic group, such as I, V or L should be tolerated.
  • El 11 in the human extracellular domain is K in Xenopus, indicating that charged residues will be tolerated at this position, including D, R, K and H, as well as Q and N.
  • Rl 12 in the human extracellular domain is K in Xenopus, indicating that basic residues are tolerated at this position, including R and H.
  • a at position 119 in the human extracellular domain is relatively poorly conserved, and appears as P in rodents and V in Xenopus, thus essentially any amino acid should be tolerated at this position.
  • ActRII proteins have been characterized in the art in terms of structural and functional characteristics, particularly with respect to ligand binding [Attisano et al. (1992) Cell 68(1):97-108; Greenwald et al. (1999) Nature Structural Biology 6(1): 18-22; Allendorph et al. (2006) PNAS 103(20: 7643-7648; Thompson et al. (2003) The EMBO Journal 22(7): 1555-1566; as well as U.S. Patent Nos: 7,709,605, 7,612,041, and 7,842,663].
  • these references provide amply guidance for how to generate ActRIIB variants that retain one or more normal activities (e.g., ligand-binding activity).
  • a defining structural motif known as a three-finger toxin fold is important for ligand binding by type I and type II receptors and is formed by conserved cysteine residues located at varying positions within the extracellular domain of each monomelic receptor [Greenwald et al. (1999) Nat Struct Biol 6: 18-22; and Hinck (2012) FEBS Lett 586: 1860-1870]. Accordingly, the core ligand-binding domains of human ActRIIB, as demarcated by the outermost of these conserved cysteines, corresponds to positions 29-109 of SEQ ID NO: 1 (ActRIIB precursor).
  • the structurally less-ordered amino acids flanking these cysteine-demarcated core sequences can be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 residues at the N-terminus and/or by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 residues at the C-terminus without necessarily altering ligand binding.
  • Exemplary ActRIIB extracellular domains for N-terminal and/or C-terminal truncation include SEQ ID NOs: 2, 3, 5, and 6. Attisano et al.
  • An ActRIIB- Fc fusion protein containing amino acids 20-119 of present SEQ ID NO: 1, "ActRIIB(20- 119)-Fc”, has reduced binding to GDF11 and activin relative to an ActRIIB(20-134)-Fc, which includes the proline knot region and the complete juxtamembrane domain (see, e.g., U.S. Patent No. 7,842,663).
  • an ActRIIB(20-129)-Fc protein retains similar, but somewhat reduced activity, relative to the wild-type, even though the proline knot region is disrupted.
  • ActRIIB extracellular domains that stop at amino acid 134, 133, 132, 131, 130 and 129 are all expected to be active, but constructs stopping at 134 or 133 may be most active.
  • mutations at any of residues 129-134 are not expected to alter ligand-binding affinity by large margins.
  • mutations of P129 and P130 do not substantially decrease ligand binding.
  • an ActRIIB polypeptide of the present disclosure may end as early as amino acid 109 (the final cysteine), however, forms ending at or between 109 and 119 (e.g., 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, or 119) are expected to have reduced ligand binding.
  • Amino acid 119 (with respect to present SEQ ID NO: 1) is poorly conserved and so is readily altered or truncated.
  • ActRIIB polypeptides ending at 128 (with respect to SEQ ID NO: 1) or later should retain ligand- binding activity.
  • ActRIIB polypeptides ending at or between 119 and 127 e.g., 119, 120, 121, 122, 123, 124, 125, 126, or 127, with respect to SEQ ID NO: 1, will have an
  • ActRIIB polypeptides beginning at position 20, 21, 22, 23, and 24 should retain general ligand-biding activity
  • ActRIIB polypeptides beginning at positions 25, 26, 27, 28, and 29 are also expected to retain ligand-biding activity. It has been demonstrated, e.g., U.S. Patent No. 7,842,663, that, surprisingly, an ActRIIB construct beginning at 22, 23, 24, or 25 will have the most activity.
  • ActRIIB a general formula for an active portion (e.g., ligand-binding portion) of ActRIIB comprises amino acids 29-109 of SEQ ID NO: 1. Therefore ActRIIB
  • polypeptides may, for example, comprise, consist essentially of, or consist of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a portion of ActRIIB beginning at a residue corresponding to any one of amino acids 20-29 (e.g., beginning at any one of amino acids 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29) of SEQ ID NO: 1 and ending at a position corresponding to any one amino acids 109-134 (e.g., ending at any one of amino acids 109,
  • Other examples include polypeptides that begin at a position from 20-29 (e.g., any one of positions 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29) or 21-29 (e.g., any one of positions 21, 22, 23, 24, 25, 26, 27, 28, or 29) of SEQ ID NO: 1 and end at a position from 1 19-134 (e.g., any one of positions 1 19, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, or 134), 1 19-133 (e.g., any one of positions 1 19, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, or 133), 129-134 (e.g., any one of positions 129, 130, 131, 132, 133, or 134), or 129-
  • SEQ ID NO: 1 Other examples include constructs that begin at a position from 20-24 (e.g., any one of positions 20, 21, 22, 23, or 24), 21-24 (e.g., any one of positions 21, 22, 23, or 24), or 22-25 (e.g., any one of positions 22, 22, 23, or 25) of SEQ ID NO: 1 and end at a position from 109-134 (e.g., any one of positions 109, 1 10, 1 1 1, 1 12, 1 13, 1 14, 1 15, 1 16, 1 17, 1 18, 1 19, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, or 134), 1 19-134 (e.g., any one of positions 1 19, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, or 134) or 129-134 (e.g., any one of positions 1 19, 120, 121, 122, 123
  • ActRIIB variants comprise no more than 1, 2, 5, 6, 7, 8, 9, 10 or 15
  • conservative amino acid changes in the ligand-binding pocket and zero, one, or more non- conservative alterations at positions 40, 53, 55, 74, 79 and/or 82 in the ligand-binding pocket.
  • Sites outside the binding pocket include the amino and carboxy termini of the extracellular domain (as noted above), and positions 42-46 and 65-73 (with respect to SEQ ID NO: 1).
  • An asparagine-to-alanine alteration at position 65 (N65 A) actually improves ligand binding in the A64 background, and is thus expected to have no detrimental effect on ligand binding in the R64 background [U.S. Patent No. 7,842,663].
  • SEQ ID NO: 1 these include position 80 (acidic or hydrophobic amino acid), position 78 (hydrophobic, and particularly tryptophan), position 37 (acidic, and particularly aspartic or glutamic acid), position 56 (basic amino acid), position 60 (hydrophobic amino acid, particularly phenylalanine or tyrosine).
  • positions that may be desirable to conserve are as follows: position 52 (acidic amino acid), position 55 (basic amino acid), position 81 (acidic), 98 (polar or charged, particularly E, D, R or K), all with respect to SEQ ID NO: 1.
  • the disclosure relates to heteromultimers that comprise at least one ActRIIB polypeptide, which includes fragments, functional variants, and modified forms thereof.
  • ActRIIB polypeptides for use in accordance with inventions of the disclosure are soluble (e.g., an extracellular domain of ActRIIB).
  • ActRIIB polypeptides for use in accordance with the disclosure bind to one or more TGF-beta superfamily ligands. Therefore, in some embodiments, ActRIIB
  • heteromultimers of the disclosure comprise at least one ActRIIB polypeptide that comprise, consist essentially of, or consist of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to a portion of ActRIIB beginning at a residue corresponding to amino acids 20-29 (e.g., beginning at any one of amino acids 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29) of SEQ ID NO: 1 and ending at a position corresponding to amino acids 109-134 (e.g., ending at any one of amino acids 109, 110, 111, 112, 113, 114, 115, 116, 117,
  • heteromultimers of the disclosure comprise at least one ActRIIB polypeptide that comprises, consists, or consists essentially of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical amino acids 29-109 of SEQ ID NO: 1
  • heteromultimer complexes of the disclosure comprise at least one ActRIIB polypeptide that comprises, consists of, or consists essentially of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical amino acids 25-131 of SEQ ID NO: 1.
  • heteromultimers of the disclosure comprise at least one ActRIIB polypeptide that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 39, 41, 45, or 46.
  • heteromultimers of the disclosure comprise do not comprise an ActRIIB polypeptide wherein the position corresponding to L79 of SEQ ID NO: 1 is an acidic amino acid (i.e., is not a naturally occurring D or E amino acid residue or artificial acidic amino acid).
  • the present disclosure relates to protein complexes that comprise an ALK4 polypeptide.
  • ALK4 refers to a family of activin receptor- like kinase-4 proteins from any species and variants derived from such ALK4 proteins by mutagenesis or other modification. Reference to ALK4 herein is understood to be a reference to any one of the currently identified forms. Members of the ALK4 family are generally transmembrane proteins, composed of a ligand-binding extracellular domain with a cysteine- rich region, a transmembrane domain, and a cytoplasmic domain with predicted
  • ALK4 polypeptide includes polypeptides comprising any naturally occurring polypeptide of an ALK4 family member as well as any variants thereof (including mutants, fragments, fusions, and peptidomimetic forms) that retain a useful activity.
  • Numbering of amino acids for all ALK4-related polypeptides described herein is based on the numbering of the human ALK4 precursor protein sequence below (SEQ ID NO: 9), unless specifically designated otherwise.
  • a human ALK4 precursor protein sequence (NCBI Ref Seq NP 004293) is as follows: 1 MAESAGASSF FPLVVLLLAG SGGSGPRGVQ ALLCACTSCL QANYTCETDG ACMVSIF LD
  • the signal peptide is indicated by a single underline and the extracellular domain is indicated in bold font.
  • a processed extracellular human ALK4 polypeptide sequence is as follows:
  • NM 004302.4 The signal sequence is underlined and the extracellular domain is indicated in bold font.
  • isoform C (NCBI Ref Seq P_064733.3)
  • the signal peptide is indicated by a single underline and the extracellular domain is indicated in bold font.
  • a processed extracellular ALK4 polypeptide sequence (isoform C) is as follows:
  • a nucleic acid sequence encoding the ALK4 precursor protein (isoform C) is shown below (SEQ ID NO: 21), corresponding to nucleotides 78-1715 of Genbank Reference Sequence NM 020328.3. The signal sequence is underlined and the extracellular domain is indicated in bold font.
  • a nucleic acid sequence encoding an extracellular ALK4 polypeptide is as follows: TCCGGGCCCCGGGGGGTCCAGGCTCTGCTGTGTGCGTGCACCAGCTGCCTCCAGGCCAACTA CACGTGTGAGACAGATGGGGCCTGCATGGTTTCCATTTTCAATCTGGATGGGATGGAGCACC ATGTGCACCTGCATCCCCAAAGTGGAGCTGGTCCCTGCCGGGAAGCCCTTCTACTGCCTG AGCTCGGAGGACCTGCGCAACACCCACTGCTGCTACACTGACTACTGCAACAGGATCGACTT GAGGGTGCCCAGTGGTCACCTCAAGGAGCCTGAGCACCCGTCCATGTGGGGCCCGGTGGAG
  • the disclosure relates to heteromultimers that comprise at least one ALK4 polypeptide, which includes fragments, functional variants, and modified forms thereof.
  • ALK4 polypeptides for use in accordance with inventions of the disclosure e.g., heteromultimers comprising an ALK4 polypeptide and uses thereof
  • ALK4 polypeptides for use in accordance with the inventions of the disclosure bind to and/or inhibit (antagonize) activity (e.g., Smad signaling) of one or more TGF-beta superfamily ligands.
  • heteromultimers of the disclosure comprise at least one ALK4 polypeptide that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 9, 10, 19, 20, 42, 44, 47, 48, 74, and 76.
  • heteromultimer complexes of the disclosure consist or consist essentially of at least one ALK4 polypeptide that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 9, 10, 19, 20, 42, 44, 47, 48, 74, and 76.
  • FIG. 5 depicts a multi- sequence alignment of a human ALK4 extracellular domain compared to various ALK4 orthologs. Many of the ligands that bind to ALK4 are also highly conserved. Accordingly, from these alignments, it is possible to predict key amino acid positions within the ligand-binding domain that are important for normal ALK4-ligand binding activities as well as to predict amino acid positions that are likely to be tolerant to substitution without significantly altering normal ALK4-ligand binding activities.
  • an active, human ALK4 variant polypeptide useful in accordance with the presently disclosed methods may include one or more amino acids at corresponding positions from the sequence of another vertebrate ALK4, or may include a residue that is similar to that in the human or other vertebrate sequences. Without meaning to be limiting, the following examples illustrate this approach to defining an active ALK4 variant.
  • V6 in the human ALK4 extracellular domain is isoleucine mMus muculus ALK4 (SEQ ID NO: 63), and so the position may be altered, and optionally may be altered to another hydrophobic residue such as L, I, or F, or a non-polar residue such as A, as is observed in Gallus gallus ALK4 (SEQ ID NO: 62).
  • extracellular domain is K in Gallus gallus ALK4, indicating that this site may be tolerant of a wide variety of changes, including polar residues, such as E, D, K, R, H, S, T, P, G, Y, and probably a non-polar residue such as A.
  • S15 in the human extracellular domain is D in Gallus gallus ALK4, indicating that a wide structural variation is tolerated at this position, with polar residues favored, such as S, T, R, E, K, H, G, P, G and Y.
  • E40 in the human extracellular domain is K in Gallus gallus ALK4, indicating that charged residues will be tolerated at this position, including D, R, K, H, as well as Q and N.
  • R80 in the human extracellular domain is K in Condylura cristata ALK4 (SEQ ID NO: 60), indicating that basic residues are tolerated at this position, including R, K, and H.
  • Y77 in the human extracellular domain is F in Sus scrofa ALK4 (SEQ ID NO: 64), indicating that aromatic residues are tolerated at this position, including F, W, and Y.
  • P93 in the human extracellular domain is relatively poorly conserved, appearing as S in Erinaceus europaeus ALK4 (SEQ ID NO: 61) and N in Gallus gallus ALK4, thus essentially any amino acid should be tolerated at this position.
  • ALK4 proteins have been characterized in the art in terms of structural and functional characteristics, particularly with respect to ligand binding [e.g., Harrison et al. (2003) J Biol Chem 278(23):21129-21135; Romano et al. (2012) J Mol Model 18(8):3617- 3625; and Calvanese et al. (2009) 15(3): 175-183].
  • these references provide amply guidance for how to generate ALK4 variants that retain one or more normal activities (e.g., ligand-binding activity).
  • a defining structural motif known as a three-finger toxin fold is important for ligand binding by type I and type II receptors and is formed by conserved cysteine residues located at varying positions within the extracellular domain of each monomelic receptor [Greenwald et al. (1999) Nat Struct Biol 6: 18-22; and Hinck (2012) FEBS Lett 586: 1860-1870]. Accordingly, the core ligand-binding domains of human ALK4, as demarcated by the outermost of these conserved cysteines, corresponds to positions 34-101 of SEQ ID NO: 9 (ALK4 precursor).
  • the structurally less-ordered amino acids flanking these cysteine-demarcated core sequences can be truncated by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, residues at the N-terminus or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 residues at the C-terminus without necessarily altering ligand binding.
  • Exemplary ALK4 extracellular domains for N-terminal and/or C-terminal truncation include SEQ ID NOs: 10 and 20.
  • ALK4 polypeptides may, for example, comprise, consists essentially of, or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), or 100%) identical to a portion of ALK4 beginning at a residue corresponding to any one of amino acids 24-34 (e.g., beginning at any one of amino acids 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34) of SEQ ID NO: 1 and ending at a position corresponding to any one amino acids 101-126 (e.g., ending at any one of amino acids 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115
  • constructs that begin at a position from 24-34 (e.g., any one of positions 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34), 25-34 (e.g., any one of positions 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34), or 26-34 (e.g., any one of positions 26, 27, 28, 29, 30, 31, 32, 33, or 34) of SEQ ID NO: 9 and end at a position from 101-126 (e.g., any one of positions 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, or 126), 102-126 (e.g., anyone of positions 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118,
  • Variants within these ranges are also contemplated, particularly those having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the corresponding portion of SEQ ID NO: 9.
  • ALK4 variants comprise no more than 1, 2, 5, 6, 7, 8, 9, 10 or 15 conservative amino acid changes in the ligand-binding pocket.
  • Sites outside the binding pocket, at which variability may be particularly well tolerated, include the amino and carboxy termini of the extracellular domain (as noted above),
  • the present disclosure contemplates making functional variants by modifying the structure of an ALK4 polypeptide and/or an ActRIIB polypeptide.
  • Variants can be produced by amino acid substitution, deletion, addition, or combinations thereof. For instance, it is reasonable to expect that an isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid (e.g., conservative mutations) will not have a major effect on the biological activity of the resulting molecule.
  • Conservative replacements are those that take place within a family of amino acids that are related in their side chains.
  • Whether a change in the amino acid sequence of a polypeptide of the disclosure results in a functional homolog can be readily determined by assessing the ability of the variant polypeptide to produce a response in cells in a fashion similar to the wild-type polypeptide, or to bind to one or more TGF-beta superfamily ligands including, for example, BMP2, BMP2/7, BMP3, BMP4, BMP4/7, BMP 5, BMP6, BMP7, BMP 8 a, BMP 8b, BMP9, BMP10, GDF3, GDF5, GDF6/BMP13, GDF7, GDF8, GDF9b/BMP15, GDF1 1/BMP1 1, GDF 15/MIC1, TGF- ⁇ , TGF-P2, TGF-P3, activin A, activin B, activin C, activin E, activin AB, activin AC, activin BC, activin AE, activin BE, nodal, glial cell-derived neurotrophic factor (GDNF), neur
  • the present disclosure contemplates making functional variants by modifying the structure of an ALK4 and/or ActRIIB polypeptide for such purposes as enhancing therapeutic efficacy or stability (e.g., increase shelf-life and/or resistance to proteolytic degradation).
  • the present disclosure contemplates specific mutations of an ALK4 polypeptide and/or an ActRIIB polypeptide so as to alter the glycosylation of the polypeptide.
  • Such mutations may be selected so as to introduce or eliminate one or more glycosylation sites, such as O-linked or N-linked glycosylation sites.
  • Asparagine-linked glycosylation recognition sites generally comprise a tripeptide sequence, asparagine-X- threonine or asparagine-X-serine (where "X" is any amino acid) which is specifically recognized by appropriate cellular glycosylation enzymes.
  • the alteration may also be made by the addition of, or substitution by, one or more serine or threonine residues to the sequence of the polypeptide (for O-linked glycosylation sites).
  • a variety of amino acid substitutions or deletions at one or both of the first or third amino acid positions of a glycosylation recognition site (and/or amino acid deletion at the second position) results in non- glycosylation at the modified tripeptide sequence.
  • Another means of increasing the number of carbohydrate moieties on a polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide.
  • the sugar(s) may be attached to (a) arginine and histidine; (b) free carboxyl groups; (c) free sulfhydryl groups such as those of cysteine; (d) free hydroxyl groups such as those of serine, threonine, or hydroxyproline; (e) aromatic residues such as those of phenylalanine, tyrosine, or tryptophan; or (f) the amide group of glutamine. Removal of one or more carbohydrate moieties present on a polypeptide may be accomplished chemically and/or enzymatically.
  • Chemical deglycosylation may involve, for example, exposure of a polypeptide to the compound trifluoromethanesulfonic acid, or an equivalent compound. This treatment results in the cleavage of most or all sugars except the linking sugar (N-acetylglucosamine or N- acetylgalactosamine), while leaving the amino acid sequence intact.
  • Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exo-glycosidases as described by Thotakura et al. [Meth. Enzymol. (1987) 138:350].
  • sequence of a polypeptide may be adjusted, as appropriate, depending on the type of expression system used, as mammalian, yeast, insect, and plant cells may all introduce differing glycosylation patterns that can be affected by the amino acid sequence of the peptide.
  • heteromeric complexes of the present disclosure for use in humans may be expressed in a mammalian cell line that provides proper glycosylation, such as HEK293 or CHO cell lines, although other mammalian expression cell lines are expected to be useful as well.
  • the present disclosure further contemplates a method of generating mutants, particularly sets of combinatorial mutants of an ALK4 and/or an ActRIIB polypeptide as well as truncation mutants. Pools of combinatorial mutants are especially useful for identifying functionally active (e.g., TGF-beta superfamily ligand binding) ALK4 and/or ActRIIB sequences.
  • the purpose of screening such combinatorial libraries may be to generate, for example, polypeptides variants which have altered properties, such as altered pharmacokinetic or altered ligand binding.
  • a variety of screening assays are provided below, and such assays may be used to evaluate variants.
  • ALK4:ActRIIB complex variants may be screened for ability to bind to one or more TGF-beta superfamily ligands to prevent binding of a TGF-beta superfamily ligand to a TGF-beta superfamily receptor, and/or to interfere with signaling caused by an TGF-beta superfamily ligand.
  • ALK4:ActRIIB heteromultimer The activity of a ALK4:ActRIIB heteromultimer may be tested, for example, in a cell- based or in vivo assay. For example, the effect of an ALK4:ActRIIB heteromultimer on the expression of genes or activity of proteins involved in muscle production in a muscle cell may be assessed. This may, as needed, be performed in the presence of one or more TGF- beta superfamily ligands, and cells may be transfected so as to produce an ALK4:ActRIIB heteromultimer, and optionally, a TGF-beta superfamily ligand. Likewise, an ALK4:ActRIIB heteromultimer is assessed, for example, in a cell- based or in vivo assay. For example, the effect of an ALK4:ActRIIB heteromultimer on the expression of genes or activity of proteins involved in muscle production in a muscle cell may be assessed. This may, as needed, be performed in the presence of one or more TGF- beta superfamily
  • ALK4:ActRIIB heteromultimer may be administered to a mouse or other animal, and one or more measurements, such as muscle formation and strength may be assessed using art- recognized methods.
  • the activity of an ALK4: ActRIIB heteromultimer, or variants thereof may be tested, for example, in osteoblasts, adipocytes, and/or neuronal cells for any effect on growth of these cells, for example, by the assays as described herein and those of common knowledge in the art.
  • a SMAD-responsive reporter gene may be used in such cell lines to monitor effects on downstream signaling.
  • Combinatorial-derived variants can be generated which have increased selectivity or generally increased potency relative to a reference ALK4:ActRIIB heteromultimer.
  • variants when expressed from recombinant DNA constructs, can be used in gene therapy protocols.
  • mutagenesis can give rise to variants which have intracellular half-lives dramatically different than the corresponding unmodified ALK4: ActRIIB heteromultimer.
  • the altered protein can be rendered either more stable or less stable to proteolytic degradation or other cellular processes which result in destruction, or otherwise inactivation, of an unmodified polypeptide.
  • variants, and the genes which encode them can be utilized to alter polypeptide complex levels by modulating the half-life of the polypeptide.
  • a short half-life can give rise to more transient biological effects and, when part of an inducible expression system, can allow tighter control of recombinant polypeptide complex levels within the cell.
  • mutations may be made in the linker (if any) and/or the Fc portion to alter one or more activities of the ALK4:ActRIIB heteromultimer including, for example, immunogenicity, half-life, and solubility.
  • a combinatorial library may be produced by way of a degenerate library of genes encoding a library of polypeptides which each include at least a portion of potential ALK4 and/or ActRIIB sequences.
  • a mixture of synthetic oligonucleotides can be enzymatically ligated into gene sequences such that the degenerate set of potential ALK4 and/or ActRIIB encoding nucleotide sequences are expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display).
  • the library of potential homologs can be generated from a degenerate oligonucleotide sequence.
  • Chemical synthesis of a degenerate gene sequence can be carried out in an automatic DNA synthesizer, and the synthetic genes can then be ligated into an appropriate vector for expression.
  • the synthesis of degenerate oligonucleotides is well known in the art [Narang, SA (1983) Tetrahedron 39:3; Itakura et al. (1981) Recombinant DNA, Proc. 3rd Cleveland Sympos. Macromolecules, ed. AG Walton, Amsterdam: Elsevier pp273-289; Itakura et al. (1984) Annu. Rev. Biochem.
  • ALK4:ActRIIB heteromultimers can be generated and isolated from a library by screening using, for example, alanine scanning mutagenesis [Ruf et al. (1994) Biochemistry 33 : 1565-1572; Wang et al. (1994) J. Biol. Chem. 269:3095-3099; Balint et al. (1993) Gene 137: 109-118; Grodberg et al. (1993) Eur. J. Biochem. 218:597-601; Nagashima et al. (1993) J. Biol. Chem. 268:2888-2892; Lowman et a/. (1991) Biochemistry 30: 10832- 10838; and Cunningham et al. (1989) Science 244: 1081-1085], by linker scanning
  • mutagenesis [Gustin et al. (1993) Virology 193 :653-660; and Brown et al. (1992) Mol. Cell Biol. 12:2644-2652; McKnight et al. (1982) Science 232:316], by saturation mutagenesis [Meyers et al, (1986) Science 232:613]; by PCR mutagenesis [Leung et al. (1989) Method Cell Mol Biol 1 : 11-19]; or by random mutagenesis, including chemical mutagenesis [Miller et al. (1992) A Short Course in Bacterial Genetics, CSHL Press, Cold Spring Harbor, NY; and Greener et al.
  • Linker scanning mutagenesis is an attractive method for identifying truncated (bioactive) forms of ALK4 and/or ActRlTB polypeptides.
  • combinatorial mutagenesis of ALK4 ActRIIB heteromul timers.
  • the most widely used techniques for screening large gene libraries typically comprise cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates relatively easy isolation of the vector encoding the gene whose product was detected.
  • Preferred assays include TGF-beta superfamily ligand (e.g., BMP2, BMP2/7, BMP3, BMP4, BMP4/7, BMP5, BMP6, BMP7, BMP 8 a, BMP8b, BMP9, BMP10, GDF3, GDF5, GDF6/BMP13, GDF7, GDF8, GDF9b/BMP15, GDF1 1/BMP1 1,
  • TGF-beta superfamily ligand e.g., BMP2, BMP2/7, BMP3, BMP4, BMP4/7, BMP5, BMP6, BMP7, BMP 8 a, BMP8b, BMP9, BMP10, GDF3, GDF5, GDF6/BMP13, GDF7, GDF8, GDF9b/BMP15, GDF1 1/BMP1 1
  • GDF 15/MIC1 TGF- ⁇ , TGF-P2, TGF-P3, activin A, activin B, activin C, activin E, activin AB, activin AC, activin BC, activin AE, activin BE, nodal, glial cell-derived neurotrophic factor (GDNF), neurturin, artemin, persephin, MIS, and Lefty) binding assays and/or TGF- beta ligand-mediated cell signaling assays.
  • GDNF glial cell-derived neurotrophic factor
  • neurturin artemin
  • persephin persephin
  • MIS lefty
  • ALK4:ActRlTB heteromultimers may further comprise post- translational modifications in addition to any that are naturally present in the ALK4 and/or ActRIIB polypeptide. Such modifications include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
  • ALK4:ActRlTB heteromultimers may comprise non-amino acid elements, such as polyethylene glycols, lipids, polysaccharide or monosaccharide, and phosphates. Effects of such non-amino acid elements on the functionality of a heteromultimer complex may be tested as described herein for other heteromultimer variants.
  • heteromultimers described herein comprise at least one ALK4 polypeptide associated, covalently or non-covalently, with at least one ActRIIB polypeptide.
  • polypeptides disclosed herein form heterodimeric complexes, although higher order heteromultimeric complexes are also included such as, but not limited to, heterotrimers, heterotetramers, and further oligomeric structures (see, e.g., Figure 6).
  • ALK4 and/or ActRIIB polypeptides comprise at least one
  • multimerization domain refers to an amino acid or sequence of amino acids that promote covalent or non-covalent interaction between at least a first polypeptide and at least a second polypeptide.
  • Polypeptides disclosed herein may be joined covalently or non-covalently to a multimerization domain.
  • a multimerization domain promotes interaction between a first polypeptide (e.g., an ALK4 polypeptide) and a second polypeptide (e.g., an ActRIIB polypeptide) to promote
  • heteromultimer formation e.g., heterodimer formation
  • optionally hinders or otherwise disfavors homomultimer formation e.g., homodimer formation
  • homomultimer formation e.g., homodimer formation
  • non-naturally occurring disulfide bonds may be constructed by replacing on a first polypeptide (e.g., an ALK4 polypeptide) a naturally occurring amino acid with a free thiol-containing residue, such as cysteine, such that the free thiol interacts with another free thiol-containing residue on a second polypeptide (e.g., an ActRIIB polypeptide) such that a disulfide bond is formed between the first and second polypeptides.
  • a first polypeptide e.g., an ALK4 polypeptide
  • a naturally occurring amino acid with a free thiol-containing residue, such as cysteine, such that the free thiol interacts with another free thiol-containing residue on a second polypeptide (e.g., an ActRIIB polypeptide) such that a disulfide bond is formed between the first and second polypeptides.
  • a second polypeptide e.g., an ActRIIB polypeptid
  • a multimerization domain may comprise one component of an interaction pair.
  • the polypeptides disclosed herein may form protein complexes comprising a first polypeptide covalently or non-covalently associated with a second polypeptide, wherein the first polypeptide comprises the amino acid sequence of an ALK4 polypeptide and the amino acid sequence of a first member of an interaction pair; and the second polypeptide comprises the amino acid sequence of an ActRIIB polypeptide and the amino acid sequence of a second member of an interaction pair.
  • the interaction pair may be any two polypeptide sequences that interact to form a complex, particularly a
  • heterodimeric complex although operative embodiments may also employ an interaction pair that can form a homodimeric complex.
  • One member of the interaction pair may be fused to an ALK4 or ActRIIB polypeptide as described herein, including for example, a polypeptide sequence comprising, consisting essentially of, or consisting of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of any one of SEQ ID NOs: 2, 3, 5, 6, 10, and 20.
  • An interaction pair may be selected to confer an improved property/activity such as increased serum half-life, or to act as an adaptor on to which another moiety is attached to provide an improved property/activity.
  • a polyethylene glycol moiety may be attached to one or both components of an interaction pair to provide an improved property/activity such as improved serum half-life.
  • the first and second members of the interaction pair may be an asymmetric pair, meaning that the members of the pair preferentially associate with each other rather than self- associate. Accordingly, first and second members of an asymmetric interaction pair may associate to form a heterodimeric complex (see, e.g., Figure 6).
  • the interaction pair may be unguided, meaning that the members of the pair may associate with each other or self-associate without substantial preference and thus may have the same or different amino acid sequences. Accordingly, first and second members of an unguided interaction pair may associate to form a homodimer complex or a heterodimeric complex.
  • the first member of the interaction pair (e.g., an asymmetric pair or an unguided interaction pair) associates covalently with the second member of the interaction pair.
  • the first member of the interaction pair (e.g., an asymmetric pair or an unguided interaction pair) associates non-covalently with the second member of the interaction pair.
  • the present disclosure provides fusion proteins comprising ALK4 or ActRIIB fused to a polypeptide comprising a constant domain of an
  • immunoglobulin such as a CHI, CH2, or CH3 domain of an immunoglobulin or an Fc domain.
  • Fc domains derived from human IgGl, IgG2, IgG3, and IgG4 are provided herein.
  • Other mutations are known that decrease either CDC or ADCC activity, and collectively, any of these variants are included in the disclosure and may be used as advantageous components of a heteromultimeric complex of the disclosure.
  • the IgGl Fc domain of SEQ ID NO: 31 has one or more mutations at residues such as Asp-265, Lys-322, and Asn-434 (numbered in accordance with the corresponding full-length IgGl).
  • the mutant Fc domain having one or more of these mutations has reduced ability of binding to the Fey receptor relative to a wildtype Fc domain.
  • the mutant Fc domain having one or more of these mutations e.g., Asn-434 mutation
  • GIFc human IgGl
  • SEQ ID NO: 31 An example of a native amino acid sequence that may be used for the Fc portion of human IgGl (GIFc) is shown below (SEQ ID NO: 31). Dotted underline indicates the hinge region, and solid underline indicates positions with naturally occurring variants.
  • the disclosure provides polypeptides comprising, consisting essentially of, or consisting of amino acid sequences with 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 31.
  • Naturally occurring variants in GIFc would include E134D and M136L according to the numbering system used in SEQ ID NO: 31 (see Uniprot P01857).
  • SEQ ID NO: 32 An example of a native amino acid sequence that may be used for the Fc portion of human IgG2 (G2Fc) is shown below (SEQ ID NO: 32). Dotted underline indicates the hinge region and double underline indicates positions where there are data base conflicts in the sequence (according to UniProt P01859).
  • the disclosure provides polypeptides comprising, consisting essential of, or consisting of amino acid sequences with 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 32.
  • G3Fc Two examples of amino acid sequences that may be used for the Fc portion of human IgG3 (G3Fc) are shown below.
  • the hinge region in G3Fc can be up to four times as long as in other Fc chains and contains three identical 15-residue segments preceded by a similar 17- residue segment.
  • the first G3Fc sequence shown below (SEQ ID NO: 33) contains a short hinge region consisting of a single 15-residue segment, whereas the second G3Fc sequence (SEQ ID NO: 34) contains a full-length hinge region.
  • dotted underline indicates the hinge region
  • solid underline indicates positions with naturally occurring variants according to UniProt P01859.
  • polypeptides comprising, consisting essential of, or consisting of amino acid sequences with 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NOs: 33 and 34.
  • Naturally occurring variants in G3Fc include E68Q, P76L, E79Q, Y81F, D97N, N100D, T124A, S169N, S169del, F221Y when converted to the numbering system used in SEQ ID NO: 33, and the present disclosure provides fusion proteins comprising G3Fc domains containing one or more of these variations.
  • the human immunoglobulin IgG3 gene (IGHG3) shows a structural polymorphism
  • variant WIS is lacking most of the V region and all of the CHI region. It has an extra interchain disulfide bond at position 7 in addition to the 11 normally present in the hinge region.
  • variant ZUC lacks most of the V region, all of the CHI region, and part of the hinge.
  • variant OMM may represent an allelic form or another gamma chain subclass.
  • the present disclosure provides additional fusion proteins comprising G3Fc domains containing one or more of these variants.
  • G4Fc human IgG4
  • SEQ ID NO: 35 An example of a native amino acid sequence that may be used for the Fc portion of human IgG4 (G4Fc) is shown below (SEQ ID NO: 35). Dotted underline indicates the hinge region.
  • the disclosure provides polypeptides comprising, consisting essential of, or consisting of amino acid sequences with 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 35.
  • a given amino acid position in an immunoglobulin sequence consisting of hinge, CR2, and CR3 regions will be identified by a different number than the same position when numbering encompasses the entire IgGl heavy-chain constant domain (consisting of the CHI, hinge, CH2, and CH3 regions) as in the Uniprot database.
  • correspondence between selected CR3 positions in a human GIFc sequence (SEQ ID NO: 31), the human IgGl heavy chain constant domain (Uniprot P01857), and the human IgGl heavy chain is as follows.
  • chain association issue A problem that arises in large-scale production of asymmetric immunoglobulin-based proteins from a single cell line is known as the "chain association issue".
  • the chain association issue concerns the challenge of efficiently producing a desired multichain protein from among the multiple combinations that inherently result when different heavy chains and/or light chains are produced in a single cell line [Klein et al (2012) mAbs 4:653-663].
  • This problem is most acute when two different heavy chains and two different light chains are produced in the same cell, in which case there are a total of 16 possible chain combinations (although some of these are identical) when only one is typically desired. Nevertheless, the same principle accounts for diminished yield of a desired multichain fusion protein that incorporates only two different (asymmetric) heavy chains.
  • Methods to obtain desired pairing of Fc-containing chains include, but are not limited to, charge-based pairing (electrostatic steering), "knobs- into-holes” steric pairing, SEEDbody pairing, and leucine zipper-based pairing [Ridgway et al (1996) Protein Eng 9:617-621; Merchant et al (1998) Nat Biotech 16:677-681; Davis et al (2010) Protein Eng Des Sel 23 : 195-202; Gunasekaran et al (2010); 285: 19637-19646; Wranik et al (2012) J Biol Chem 287:43331-43339; US5932448; WO 1993/011162; WO 2009/089004, and WO 2011/034605]. As described herein, these methods may be used to generate ALK4-Fc:ActRIIB-Fc heteromultimer complexes. See Figure 6.
  • protuberance-into-cavity knock-into-holes
  • protuberances are constructed by replacing small amino acid side chains from the interface of the first polypeptide ⁇ e.g., a first interaction pair) with larger side chains ⁇ e.g., tyrosine or tryptophan).
  • Complementary "cavities" of identical or similar size to the protuberances are optionally created on the interface of the second polypeptide ⁇ e.g., a second interaction pair) by replacing large amino acid side chains with smaller ones ⁇ e.g., alanine or threonine).
  • protein complexes disclosed herein make use of the attractive interactions for promoting heteromultimer formation ⁇ e.g., heterodimer formation), and optionally repulsive interactions for hindering homodimer formation ⁇ e.g., homodimer formation) by carrying out site directed mutagenesis of charged interface residues.
  • the IgGl CH3 domain interface comprises four unique charge residue pairs involved in domain-domain interactions: Asp356-Lys439', Glu357-Lys370', Lys392- Asp399', and Asp399-Lys409' [residue numbering in the second chain is indicated by (')].
  • the numbering scheme used here to designate residues in the IgGl CH3 domain conforms to the EU numbering scheme of Kabat. Due to the 2-fold symmetry present in the CH3-CH3 domain interactions, each unique interaction will represented twice in the structure ⁇ e.g., Asp-399-Lys409' and Lys409-Asp399').
  • K409-D399' favors both heterodimer and homodimer formation.
  • a single mutation switching the charge polarity ⁇ e.g., K409E; positive to negative charge) in the first chain leads to unfavorable interactions for the formation of the first chain homodimer. The unfavorable interactions arise due to the repulsive interactions occurring between the same charges (negative-negative; K409E-D399' and D399-K409E').
  • a similar mutation switching the charge polarity (D399K'; negative to positive) in the second chain leads to unfavorable interactions (K409'-D399K' and D399K-K409') for the second chain homodimer formation. But, at the same time, these two mutations (K409E and D399K') lead to favorable interactions (K409E-D399K' and D399-K409') for the heterodimer formation.
  • the electrostatic steering effect on heterodimer formation and homodimer discouragement can be further enhanced by mutation of additional charge residues which may or may not be paired with an oppositely charged residue in the second chain including, for example, Arg355 and Lys360.
  • additional charge residues which may or may not be paired with an oppositely charged residue in the second chain including, for example, Arg355 and Lys360.
  • the table below lists possible charge change mutations that can be used, alone or in combination, to enhance ALK4:ActRIIB heteromultimer formation.
  • one or more residues that make up the CH3-CH3 interface in a fusion protein of the instant application are replaced with a charged amino acid such that the interaction becomes electrostatically unfavorable.
  • a positive-charged amino acid in the interface e.g., a lysine, arginine, or histidine
  • a negatively charged amino acid e.g., aspartic acid or glutamic acid
  • a negative-charged amino acid in the interface is replaced with a positive-charged amino acid.
  • the amino acid is replaced with a non-naturally occurring amino acid having the desired charge characteristic.
  • the disclosure provides desired pairing of asymmetric Fc-containing
  • Fc sequences engineered to be complementary on the basis of charge pairing (electrostatic steering).
  • charge pairing electrostatic steering
  • One of a pair of Fc sequences with electrostatic complementarity can be arbitrarily fused to the ALK4 or ActRIIB polypeptide of the construct, with or without an optional linker, to generate an ALK4: ActRIIB heteromultimer.
  • This single chain can be coexpressed in a cell of choice along with the Fc sequence
  • SEQ ID NO: 23 [human GlFc(E134K/D177K)] and SEQ ID NO: 24 [human GlFc(K170D/K187D)] are examples of complementary Fc sequences in which the engineered amino acid substitutions are double underlined, and the TGF-beta superfamily type I or type II receptor polypeptide of the construct can be fused to either SEQ ID NO: 23 or SEQ ID NO: 24, but not both.
  • the disclosure provides desired pairing of asymmetric Fc-containing polypeptide chains using Fc sequences engineered for steric complementarity.
  • the disclosure provides knobs-into-holes pairing as an example of steric complementarity.
  • One of a pair of Fc sequences with steric complementarity can be arbitrarily fused to the ALK4 or ActRIIB polypeptide of the construct, with or without an optional linker, to generate an ALK4:ActRIIB heteromultimer.
  • This single chain can be co-expressed in a cell of choice along with the Fc sequence complementary to the first Fc to favor generation of the desired multi-chain construct.
  • SEQ ID NO: 25 [human GlFc(T144Y)]
  • SEQ ID NO: 26 [human GlFc(Y185T)] are examples of complementary Fc sequences in which the engineered amino acid substitutions are double underlined, and the ALK4 or ActRIIB polypeptide of the construct can be fused to either SEQ ID NO: 25 or SEQ ID NO: 26, but not both.
  • Fc complementarity based on knobs-into-holes pairing combined with an engineered disulfide bond is disclosed in SEQ ID NO: 27 [hGlFc(S132C/T144W)] and SEQ ID NO: 28 [hGlFc(Y127C/T144S/L146A/Y185V)].
  • the engineered amino acid substitutions in these sequences are double underlined, and the TGF-beta superfamily type I or type II polypeptide of the construct can be fused to either SEQ ID NO: 27 or SEQ ID NO: 28, but not both.
  • the disclosure provides desired pairing of asymmetric Fc-containing polypeptide chains using Fc sequences engineered to generate interdigitating ⁇ -strand segments of human IgG and IgA CH3 domains.
  • SEEDbody fusion proteins [Davis et al. (2010) Protein Eng Design Sel 23 : 195-202].
  • One of a pair of Fc sequences with SEEDbody complementarity can be arbitrarily fused to the ALK4 or ActllB of the construct, with or without an optional linker, to generate an ALK4 or ActRIIB fusion polypeptide.
  • This single chain can be co-expressed in a cell of choice along with the Fc sequence complementary to the first Fc to favor generation of the desired multichain construct.
  • Sb SEEDbody
  • [hGlFc(SbAo)] and SEQ ID NO: 30 [hGlFc(SboA)] are examples of complementary IgG Fc sequences in which the engineered amino acid substitutions from IgA Fc are double underlined, and the ALK4 or ActRIIB polypeptide of the construct can be fused to either SEQ ID NO: 29 or SEQ ID NO: 30, but not both.
  • the disclosure provides desired pairing of asymmetric Fc-containing polypeptide chains with a cleavable leucine zipper domain attached at the C-terminus of the Fc CH3 domains. Attachment of a leucine zipper is sufficient to cause preferential assembly of heterodimeric antibody heavy chains [Wranik et al (2012) J Biol Chem 287:43331-43339].
  • one of a pair of Fc sequences attached to a leucine zipper-forming strand can be arbitrarily fused to the ALK4 or ActRIIB polypeptide of the construct, with or without an optional linker, to generate an ALK4 or ActRIIB fusion polypeptide. This single chain can be co-expressed in a cell of choice along with the Fc sequence attached to a
  • SEQ ID NO: 36 [hGlFc-Apl (acidic)] and SEQ ID NO: 37 [hGlFc-Bpl (basic)] are examples of complementary IgG Fc sequences in which the engineered complimentary leucine zipper sequences are underlined, and the ALK4 or ActRIIB polypeptide of the construct can be fused to either SEQ ID NO: 36 or SEQ ID NO: 37, but not both.
  • the disclosure relates to ALK4 polypeptides (e.g., ALK4-Fc fusion proteins) comprising one or more amino acid modifications that alter the isoelectric point (pi) of the ALK4 polypeptide and/or ActRIIB polypeptides (e.g., ActRIIB-Fc fusion proteins) comprising one or more amino acid modifications that alter the isoelectric point of the ActRIIB polypeptide.
  • ALK4 polypeptides e.g., ALK4-Fc fusion proteins
  • ActRIIB polypeptides e.g., ActRIIB-Fc fusion proteins
  • one or more candidate domains that have a pi value higher than about 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0 are selected for construction of the full multidomain protein.
  • one or more candidate domains that have a pi value less than about 9.0, 8.5, 8.0, 7.5, 7.0, 6.5, 6.0, 5.5, or 5.0 are selected for construction of the full multidomain protein. It will be understood by one skilled in the art that a single protein will have multiple charge forms. Without wishing to be bound by any particular theory, the charge of a protein can be modified by a number of different mechanisms including but not limited to, amino acid substitution, cationization, deamination, carboxyl-terminal amino acid heterogeneity, phosphorylation and glycosylation.
  • the pi of a protein may be determined by a variety of methods including but not limited to, isoelectric focusing and various computer algorithms (see for example Bjellqvist et al., 1993, Electrophoresis 14: 1023). In one embodiment, pi is determined using a
  • Pharmacia Biotech Multiphor 2 electrophoresis system with a multi temp refrigerated bath recirculation unit and an EPS 3501 XL power supply.
  • Pre-cast ampholine gels e.g., Amersham Biosciences, pi range 2.5-10
  • Broad range pi marker standards e.g., Amersham, pi range 3-10, 8 .mu.L
  • Electrophoresis is performed, for example, at 1500 V, 50 mA for 105 minutes.
  • the gel is fixed using, for example, a Sigma fixing solution (5x) diluted with purified water to lx Staining is performed, for example, overnight at room temperature using Simply Blue stain (Invitrogen).
  • Destaining is carried out, for example, with a solution that consisted of 25% ethanol, 8% acetic acid and 67% purified water. Isoelectric points are determined using, for example, a Bio-Rad Densitometer relative to calibration curves of the standards.
  • the one or more metrics may further include metrics characterizing stability of the domain under one or more different conditions selected from the group consisting of different pH values, different temperatures, different shear stresses, and different freeze/thaw cycles.
  • the disclosure provides desired pairing of asymmetric Fc-containing polypeptide chains by methods described above in combination with additional mutations in the Fc domain which facilitate purification of the desired heteromeric species.
  • An example is complementarity of Fc domains based on knobs-into-holes pairing combined with an engineered disulfide bond, as disclosed in SEQ ID NOs: 27-28, plus additional substitution of two negatively charged amino acids (aspartic acid or glutamic acid) in one Fc-containing polypeptide chain and two positively charged amino acids (e.g., arginine) in the
  • SEQ ID NOs: 66-67 complementary Fc-containing polypeptide chain
  • SEQ ID NOs: 66-67 complementary Fc-containing polypeptide chain
  • These four amino acid substitutions facilitate selective purification of the desired heteromeric fusion protein from a heterogeneous polypeptide mixture based on differences in isoelectric point or net molecular charge.
  • the engineered amino acid substitutions in these sequences are double underlined below, and the ALK4 or ActRIIB polypeptide of the construct can be fused to either SEQ ID NO: 66 or SEQ ID NO: 67, but not both.
  • Another example involves complementarity of Fc domains based on knobs-into-holes pairing combined with an engineered disulfide bond, as disclosed in SEQ ID NOs: 27-28, plus a histidine-to-arginine substitution at position 213 in one Fc-containing polypeptide chain (SEQ ID NO: 68).
  • This substitution (denoted H435R in the numbering system of Kabat et al.) facilitates separation of desired heteromer from undesirable homodimer based on differences in affinity for protein A.
  • the engineered amino acid substitution is indicated by double underline, and the ALK4 or ActRIIB polypeptide of the construct can be fused to either SEQ ID NO: 68 or SEQ ID NO: 28, but not both.
  • SEQ ID NO: 31 SEQ ID NO: 35 SEQ ID NO: 32 SEQ ID NO: 33
  • THT begins at ESK... begins at VEC... begins at EPK...
  • fusion proteins e.g., immunoglobulin Fc fusion proteins
  • elements of the fusion proteins may be arranged in any manner that is consistent with desired
  • an ALK4 and/or ActRIIB polypeptide domain may be placed C- terminal to a heterologous domain, or alternatively, a heterologous domain may be placed C- terminal to an ALK4 and/or ActRIIB polypeptide domain.
  • the ALK4 and/or ActRIIB polypeptide domain and the heterologous domain need not be adjacent in a fusion protein, and additional domains or amino acid sequences may be included C- or N-terminal to either domain or between the domains.
  • an ALK4 and/or ActRIIB receptor fusion protein may comprise an amino acid sequence as set forth in the formula A-B-C.
  • the B portion corresponds to an ALK4 or ActRIIB polypeptide domain.
  • the A and C portions may be independently zero, one, or more than one amino acid, and both the A and C portions when present are heterologous to B.
  • the A and/or C portions may be attached to the B portion via a linker sequence.
  • a linker may be rich in glycine (e.g., 2-10, 2-5, 2-4, 2-3 glycine residues) or glycine and proline residues and may, for example, contain a single sequence of
  • threonine/serine and glycines or repeating sequences of threonine/serine and/or glycines e.g., GGG (SEQ ID NO: 13), GGGG (SEQ ID NO: 14), TGGGG (SEQ ID NO: 15), SGGGG (SEQ ID NO: 16), T GGG (SEQ ID NO: 17), SGGG (SEQ ID NO: 18), or GGGGS (SEQ ID NO: 58) singlets, or repeats.
  • an ALK4 and/or ActRIIB fusion protein comprises an amino acid sequence as set forth in the formula A-B-C, wherein A is a leader (signal) sequence, B consists of an ALK4 and/or ActRIIB polypeptide domain, and C is a polypeptide portion that enhances one or more of in vivo stability, in vivo half-life, uptake/administration, tissue localization or distribution, formation of protein complexes, and/or purification.
  • an ALK4 and/or ActRIIB fusion protein comprises an amino acid sequence as set forth in the formula A-B-C, wherein A is a TPA leader sequence, B consists of a ALK4 or ActRIIB receptor polypeptide domain, and C is an immunoglobulin Fc domain.
  • Preferred fusion proteins comprise the amino acid sequence set forth in any one of SEQ ID NOs: 39, 41, 42, 44, 45, 46, 47, 48, 70, 72, 74, 76, 78, and 80.
  • ALK4:ActRIIB heteromultimers further comprise one or more heterologous portions (domains) so as to confer a desired property.
  • some fusion domains are particularly useful for isolation of the fusion proteins by affinity chromatography.
  • Well-known examples of such fusion domains include, but are not limited to, polyhistidine, Glu-Glu, glutathione S-transferase (GST), thioredoxin, protein A, protein G, an immunoglobulin heavy-chain constant region (Fc), maltose binding protein (MBP), or human serum albumin.
  • matrices for affinity chromatography such as glutathione-, amylase-, and nickel- or cobalt- conjugated resins are used. Many of such matrices are available in "kit” form, such as the Pharmacia GST purification system and the QIAexpressTM system (Qiagen) useful with (HISe) fusion partners.
  • kit such as the Pharmacia GST purification system and the QIAexpressTM system (Qiagen) useful with (HISe) fusion partners.
  • a fusion domain may be selected so as to facilitate detection of the ligand trap polypeptides. Examples of such detection domains include the various
  • the fusion domains have a protease cleavage site, such as for factor Xa or thrombin, which allows the relevant protease to partially digest the fusion proteins and thereby liberate the recombinant proteins therefrom. The liberated proteins can then be isolated from the fusion domain by subsequent protease cleavage site, such as for factor Xa or thrombin, which allows the relevant protease to partially digest the fusion proteins and thereby liberate the recombinant proteins therefrom. The liberated proteins can then be isolated from the fusion domain by subsequent
  • ALK4 and/or ActRIIB polypeptides may contain one or more modifications that are capable of stabilizing the polypeptides.
  • modifications that are capable of stabilizing the polypeptides.
  • such modifications such as, such
  • stabilizing modifications include, but are not limited to, fusion proteins (including, for example, fusion proteins comprising an ALK4 and/or ActRIIB polypeptide domain and a stabilizer domain), modifications of a glycosylation site (including, for example, addition of a glycosylation site to a polypeptide of the disclosure), and modifications of carbohydrate moiety (including, for example, removal of carbohydrate moieties from a polypeptide of the disclosure).
  • stabilizer domain not only refers to a fusion domain ⁇ e.g., an immunoglobulin Fc domain) as in the case of fusion proteins, but also includes nonproteinaceous modifications such as a carbohydrate moiety, or nonproteinaceous moiety, such as polyethylene glycol.
  • ALK4:ActRIIB heteromultimers to be used in accordance with the methods described herein are isolated complexes.
  • an isolated protein (or protein complex) or polypeptide (or polypeptide complex) is one which has been separated from a component of its natural environment.
  • a component of its natural environment In some embodiments, a
  • heteromultimer of the disclosure is purified to greater than 95%, 96%, 97%, 98%, or 99% purity as determined by, for example, electrophoretic (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis) or chromatographic (e.g., ion exchange or reverse phase HPLC).
  • electrophoretic e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis
  • chromatographic e.g., ion exchange or reverse phase HPLC.
  • ALK4:ActRIIB heteromultimer preparations comprise less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or less than 1% ALK4 homomultimers. In some embodiments, ALK4:ActRIIB heteromultimer preparations comprise less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or less than 1% ActRIIB homomultimers.
  • ALK4:ActRIIB heteromultimer preparations comprise less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or less than 1% ALK4 homomultimers and less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or less than 1% ActRIIB homomultimers.
  • heteromultimers comprising the same, of the disclosure can be produced by a variety of art- known techniques.
  • polypeptides can be synthesized using standard protein chemistry techniques such as those described in Bodansky, M. Principles of Peptide
  • the polypeptides may be recombinantly produced using various expression systems [E. coli, Chinese Hamster Ovary (CHO) cells, COS cells, baculovirus] as is well known in the art.
  • the modified or unmodified polypeptides may be produced by digestion of recombinantly produced full-length ALK4 and/or ActRIIB polypeptides by using, for example, a protease, e.g., trypsin, thermolysin, chymotrypsin, pepsin, or paired basic amino acid converting enzyme (PACE).
  • PACE paired basic amino acid converting enzyme
  • Computer analysis using commercially available software, e.g., Mac Vector, Omega, PCGene, Molecular Simulation, Inc. can be used to identify proteolytic cleavage sites.
  • nucleic Acids Encoding ALK4 and/or ActRIIB polypeptides the present disclosure provides isolated and/or recombinant nucleic acids encoding ALK4 and/or ActRIIB polypeptides (including fragments, functional variants, and fusion proteins thereof) disclosed herein.
  • SEQ ID NO: 11 encodes a naturally occurring human ALK4 precursor polypeptide
  • SEQ ID NO: 12 encodes a processed extracellular domain of ALK4.
  • the subject nucleic acids may be single- stranded or double stranded.
  • Such nucleic acids may be DNA or RNA molecules. These nucleic acids may be used, for example, in methods for making ALK4:ActRIIB
  • isolated nucleic acid(s) refers to a nucleic acid molecule that has been separated from a component of its natural environment.
  • An isolated nucleic acid includes a nucleic acid molecule contained in cells that ordinarily contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.
  • nucleic acids encoding ALK4 and/or ActRIIB polypeptides of the present disclosure are understood to include any one of SEQ ID NOs: 7, 8, 11, 12, 21, 22, 40, 43, 71, 73, 75, 77, 79, 81, 82, or 83, as well as variants thereof.
  • Variant nucleotide sequences include sequences that differ by one or more nucleotide substitutions, additions, or deletions including allelic variants, and therefore, will include coding sequences that differ from the nucleotide sequence designated in any one of SEQ ID NOs: 7, 8, 11, 12, 21, 22, 40, 43, 71, 73, 75, 77, 79, 81, 82, or 83.
  • ALK4 and/or ActRIIB polypeptides of the present disclosure are encoded by isolated or recombinant nucleic acid sequences that comprise, consist essentially of, or consists of a sequence that is least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 7, 8, 11, 12, 21, 22, 40, 43, 71, 73, 75, 77, 79, 81, 82, or 83.
  • nucleic acid sequences that comprise, consist essentially of, or consists of a sequence complementary to a sequence that is least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 7, 8, 11, 12, 21, 22, 40, 43, 71, 73, 75, 77, 79, 81, 82, or 83 also within the scope of the present disclosure.
  • the nucleic acid sequences of the disclosure can be isolated, recombinant, and/or fused with a heterologous nucleotide sequence or in a DNA library.
  • nucleic acids of the present disclosure also include nucleotide sequences that hybridize under stringent conditions to the nucleotide sequence designated in SEQ ID NOs: 7, 8, 11, 12, 21, 22, 40, 43, 71, 73, 75, 77, 79, 81, 82, or 83, the complement sequence of SEQ ID NOs: 7, 8, 11, 12, 21, 22, 40, 43, 71, 73, 75, 77, 79, 81, 82, or 83, or fragments thereof.
  • SEQ ID NOs: 7, 8, 11, 12, 21, 22, 40, 43, 71, 73, 75, 77, 79, 81, 82, or 83 or fragments thereof.
  • the hybridization at 6.0 x sodium chloride/sodium citrate (SSC) at about 45 °C, followed by a wash of 2.0 x SSC at 50 °C.
  • the salt concentration in the wash step can be selected from a low stringency of about 2.0 x SSC at 50 °C to a high stringency of about 0.2 x SSC at 50 °C.
  • the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22 °C, to high stringency conditions at about 65 °C. Both temperature and salt may be varied, or temperature or salt concentration may be held constant while the other variable is changed.
  • the disclosure provides nucleic acids which hybridize under low stringency conditions of 6 x SSC at room temperature followed by a wash at 2 x SSC at room temperature. Isolated nucleic acids which differ from the nucleic acids as set forth in SEQ ID NOs:
  • nucleotides up to about 3-5% of the nucleotides
  • nucleic acids encoding a particular protein may exist among individuals of a given species due to natural allelic variation. Any and all such nucleotide variations and resulting amino acid polymorphisms are within the scope of this disclosure.
  • the recombinant nucleic acids of the disclosure may be operably linked to one or more regulatory nucleotide sequences in an expression construct. Regulatory nucleotide sequences will generally be appropriate to the host cell used for expression. Numerous types of appropriate expression vectors and suitable regulatory sequences are known in the art for a variety of host cells.
  • said one or more regulatory nucleotide sequences may include, but are not limited to, promoter sequences, leader or signal sequences, ribosomal binding sites, transcriptional start and termination sequences, translational start and termination sequences, and enhancer or activator sequences. Constitutive or inducible promoters as known in the art are contemplated by the disclosure.
  • the promoters may be either naturally occurring promoters, or hybrid promoters that combine elements of more than one promoter.
  • An expression construct may be present in a cell on an episome, such as a plasmid, or the expression construct may be inserted in a chromosome.
  • the expression vector contains a selectable marker gene to allow the selection of transformed host cells. Selectable marker genes are well known in the art and will vary with the host cell used.
  • the subject nucleic acid is provided in an expression vector comprising a nucleotide sequence encoding an ALK4 and/or ActRIIB polypeptide and operably linked to at least one regulatory sequence.
  • Regulatory sequences are art-recognized and are selected to direct expression of ALK4 and/or ActRIIB polypeptide. Accordingly, the term regulatory sequence includes promoters, enhancers, and other expression control elements. Exemplary regulatory sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, CA (1990).
  • any of a wide variety of expression control sequences that control the expression of a DNA sequence when operatively linked to it may be used in these vectors to express DNA sequences encoding a ALK4 and/or ActRIIB polypeptides.
  • useful expression control sequences include, for example, the early and late promoters of SV40, tet promoter, adenovirus or cytomegalovirus immediate early promoter, RSV promoters, the lac system, the trp system, the TAC or TRC system, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of phage lambda , the control regions for fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e.g., Pho5, the promoters of the yeast a-mating factors, the polyhedron promoter of the baculovirus system and other sequences known
  • the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of protein desired to be expressed. Moreover, the vector's copy number, the ability to control that copy number and the expression of any other protein encoded by the vector, such as antibiotic markers, should also be considered.
  • a recombinant nucleic acid of the present disclosure can be produced by ligating the cloned gene, or a portion thereof, into a vector suitable for expression in either prokaryotic cells, eukaryotic cells (yeast, avian, insect or mammalian), or both.
  • Expression vehicles for production of a recombinant ALK4 and/or ActRIIB polypeptides include plasmids and other vectors.
  • suitable vectors include plasmids of the following types: pBR322- derived plasmids, pEMBL-derived plasmids, pEX-derived plasmids, pBTac-derived plasmids and pUC-derived plasmids for expression in prokaryotic cells, such as E. coli.
  • Some mammalian expression vectors contain both prokaryotic sequences to facilitate the propagation of the vector in bacteria, and one or more eukaryotic transcription units that are expressed in eukaryotic cells.
  • the pcDNAI/amp, pcDNAI/neo, pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfr, pTk2, pRSVneo, pMSG, pSVT7, pko-neo and pHyg derived vectors are examples of mammalian expression vectors suitable for transfection of eukaryotic cells.
  • vectors are modified with sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug resistance selection in both prokaryotic and eukaryotic cells.
  • bacterial plasmids such as pBR322
  • derivatives of viruses such as the bovine papilloma virus (BPV-1), or Epstein- Barr virus (pHEBo, pREP-derived and p205) can be used for transient expression of proteins in eukaryotic cells.
  • BBV-1 bovine papilloma virus
  • pHEBo Epstein- Barr virus
  • examples of other viral (including retroviral) expression systems can be found below in the description of gene therapy delivery systems.
  • the various methods employed in the preparation of the plasmids and in transformation of host organisms are well known in the art.
  • baculovirus expression systems include pVL-derived vectors (such as pVL1392, pVL1393 and pVL941), pAcUW-derived vectors (such as pAcUWl), and pBlueBac-derived vectors (such as the B-gal containing pBlueBac III).
  • a vector will be designed for production of the subject ALK4 and/or ActRIIB polypeptides in CHO cells, such as a Pcmv-Script vector (Stratagene, La Jolla, Calif), pcDNA4 vectors (Invitrogen, Carlsbad, Calif.) and pCI-neo vectors
  • the subject gene constructs can be used to cause expression of the subject ALK4 and/or ActRIIB polypeptide in cells propagated in culture, e.g., to produce proteins, including fusion proteins or variant proteins, for purification.
  • This disclosure also pertains to a host cell transfected with a recombinant gene including a coding sequence for one or more of the subject ALK4 and/or ActRIIB
  • the host cell may be any prokaryotic or eukaryotic cell.
  • an ALK4 and/or ActRIIB polypeptide may be expressed in bacterial cells such as E. coli, insect cells (e.g., using a baculovirus expression system), yeast, or mammalian cells [e.g. a Chinese hamster ovary (CHO) cell line].
  • bacterial cells such as E. coli, insect cells (e.g., using a baculovirus expression system), yeast, or mammalian cells [e.g. a Chinese hamster ovary (CHO) cell line].
  • insect cells e.g., using a baculovirus expression system
  • yeast e.g., Chinese hamster ovary (CHO) cell line
  • mammalian cells e.g. a Chinese hamster ovary (CHO) cell line.
  • Other suitable host cells are known to those skilled in the art.
  • the present disclosure further pertains to methods of producing the subject ALK4 and/or ActRIIB polypeptides.
  • a host cell transfected with an expression vector encoding an ALK4 and/or ActRIIB polypeptide can be cultured under appropriate conditions to allow expression of the ALK4 and/or ActRIIB polypeptide to occur.
  • the polypeptide may be secreted and isolated from a mixture of cells and medium containing the polypeptide.
  • ALK4 and/or ActRIIB polypeptide may be isolated from a cytoplasmic or membrane fraction obtained from harvested and lysed cells.
  • a cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well known in the art.
  • the subject polypeptides can be isolated from cell culture medium, host cells, or both, using techniques known in the art for purifying proteins, including ion- exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, immunoaffinity purification with antibodies specific for particular epitopes of ALK4 and/or ActRIIB polypeptides and affinity purification with an agent that binds to a domain fused to ALK4 and/or ActRIIB polypeptide ⁇ e.g., a protein A column may be used to purify ALK4-Fc and/or ActRIIB-Fc fusion proteins).
  • the ALK4 and/or ActRIIB polypeptide is a fusion protein containing a domain which facilitates its purification.
  • purification is achieved by a series of column chromatography steps, including, for example, three or more of the following, in any order: protein A chromatography, Q sepharose chromatography, phenyl sepharose chromatography, size exclusion chromatography, and cation exchange chromatography.
  • the purification could be completed with viral filtration and buffer exchange.
  • An ALK4 and/or ActRIIB polypeptides, as well as fusion proteins thereof, may be purified to a purity of >90%, >95%, >96%, >98%, or >99% as determined by size exclusion chromatography and >90%, >95%, >96%, >98%, or >99% as determined by SDS PAGE.
  • the target level of purity should be one that is sufficient to achieve desirable results in mammalian systems, particularly non-human primates, rodents (mice), and humans.
  • a fusion gene coding for a purification leader sequence such as a poly-(His)/enterokinase cleavage site sequence at the N-terminus of the desired portion of the recombinant ALK4 and/or ActRIIB polypeptide, can allow purification of the expressed fusion protein by affinity chromatography using a Ni metal resin. The purification leader sequence can then be subsequently removed by treatment with
  • enterokinase to provide the purified ALK4 and/or ActRIIB polypeptide, as well as heteromultimers thereof [Hochuli et al. (1987) J. Chromatography 411 : 177; and Janknecht et al. (1991) PNAS USA 88:8972].
  • fusion genes are well known. Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation.
  • the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
  • PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed to generate a chimeric gene sequence. See, e.g., Current Protocols in Molecular Biology, eds. Ausubel et al, John Wiley & Sons: 1992.
  • an ALK4:ActRID3 heteromultimer e.g., ALK4:ActRID3 heterodimers
  • ALK4:ActRID3 heterodimers can be used to treat or prevent a disease or condition that is associated with abnormal activity of an ALK4: ActRIIB -binding ligand.
  • diseases, disorders, or conditions are generally referred to herein as "ALK4:ActRIIB-associated conditions" or "ALK4:ActRIIB-associated disorders.”
  • the present disclosure provides methods of treating or preventing an ALK4:ActRID3-associated condition in an individual by administering to an individual in need thereof a therapeutically effective amount of an ALK4:ActRIIB heteromultimer.
  • ALK4:ActRIIB heteromultimers of the disclosure can potentially be employed individually or in combination for therapeutic uses disclosed herein. These methods are particularly aimed at therapeutic and prophylactic treatments of mammals including, for example, rodents, primates, and humans.
  • a therapeutic that "prevents" a disorder or condition refers to a compound that, in a statistical sample, reduces the occurrence of the disorder or condition in the treated sample relative to an untreated control sample, or delays the onset or reduces the severity of one or more symptoms of the disorder or condition relative to the untreated control sample.
  • treating includes amelioration or elimination of the condition once it has been established. In either case, prevention or treatment may be discerned in the diagnosis provided by a physician or other health care provider and the intended result of administration of the therapeutic agent.
  • an effective amount of an agent refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result.
  • a “therapeutically effective amount” of an agent of the present disclosure may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the agent to elicit a desired response in the individual.
  • a “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result.
  • ALK4 and ActRIIB receptor-ligand complexes play essential roles in tissue growth as well as early developmental processes such as the correct formation of various structures or in one or more post-developmental capacities including sexual development, pituitary hormone production, and creation of bone and cartilage.
  • ALK4:ActRIIB-associated conditions include, but are not limited to, abnormal tissue growth and developmental defects.
  • ALK4:ActRIIB-associated conditions include, but are not limited to, disorders of cell growth and differentiation such as inflammation, allergy, autoimmune diseases, and tumors.
  • ALK4:ActRIIB-associated conditions include neuromuscular disorders (e.g., muscular dystrophy and muscle atrophy), congestive obstructive pulmonary disease (and muscle wasting associated with COPD), muscle wasting syndrome, sarcopenia, cachexia, adipose tissue disorders (e.g., obesity), type 2 diabetes (NIDDM, adult-onset diabetes), and bone degenerative disease (e.g., osteoporosis).
  • neuromuscular disorders e.g., muscular dystrophy and muscle atrophy
  • congestive obstructive pulmonary disease and muscle wasting associated with COPD
  • muscle wasting syndrome e.g., sarcopenia
  • cachexia e.g., obesity
  • type 2 diabetes e.g., adult-onset diabetes
  • bone degenerative disease e.g., osteoporosis
  • ALK4:ActRIIB-associated conditions include musculodegenerative and neuromuscular disorders, tissue repair (e.g., wound healing), neurodegenerative diseases (e.g., amyotrophic lateral sclerosis), and immunologic disorders (e.g., disorders related to abnormal proliferation or function of lymphocytes).
  • the ALK4:ActRIIB-associated condition is an interstitial lung disease (e.g., idiopathic pulmonary fibrosis).
  • the interstitial lung disease is pulmonary fibrosis.
  • the interstitial lung disease is caused by any one of the following: silicosis, asbestosis, berylliosis, hypersensitivity pneumonitis, drug use (e.g., antibiotics, chemotherapeutic drugs, antiarrhythmic agents, statins), systemic sclerosis, polymyositis, dermatomyositis, systemic lupus erythematosus, rheumatoid arthritis, an infection (e.g., atypical pneumonia, Pneumocystis pneumonia, tuberculosis, chlamydia trachomatis, and/or respiratory syncytial virus), lymphangitic carcinomatosis, cigarette smoking, or developmental disorders.
  • drug use e.g., antibiotics, chemotherapeutic drugs, antiarrhythmic agents, statins
  • systemic sclerosis polymyositis, dermatomyositis, systemic lupus erythematosus, rheum
  • the interstitial lung disease is idiopathic (e.g., sarcoidosis, idiopathic pulmonary fibrosis, Hamman-Rich syndrome, and/or anti synthetase syndrome).
  • the interstitial lung disease is idiopathic pulmonary fibrosis.
  • the treatment for idiopathic pulmonary fibrosis is administered in combination with an additional therapeutic agent.
  • the additional therapeutic agent is selected from the group consisting of:
  • pirfenidone N-acetylcysteine, prednisone, azathioprine, nintedanib, derivatives thereof and combinations thereof.
  • an ALK4:ActRIIB heteromultimer of the disclosure may be used as part of a treatment for a muscular dystrophy.
  • muscle dystrophy refers to a group of degenerative muscle diseases characterized by gradual weakening and deterioration of skeletal muscles and sometimes the heart and respiratory muscles. Muscular dystrophies are genetic disorders characterized by progressive muscle wasting and weakness that begin with microscopic changes in the muscle. As muscles degenerate over time, the person's muscle strength declines.
  • Exemplary muscular dystrophies that can be treated with a regimen including the subject TGF-beta superfamily heteromultimer complexes include: Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), Emery-Dreifuss muscular dystrophy (EDMD), limb-girdle muscular dystrophy (LGMD),
  • DMD Duchenne muscular dystrophy
  • BMD Becker muscular dystrophy
  • EDMD Emery-Dreifuss muscular dystrophy
  • LGMD limb-girdle muscular dystrophy
  • FSH or FSHD facioscapulohumeral muscular dystrophy
  • MMD myotonic dystrophy
  • OPMD oculopharyngeal muscular dystrophy
  • DD distal muscular dystrophy
  • CMD congenital muscular dystrophy
  • DMD Duchenne muscular dystrophy
  • BMD Becker muscular dystrophy
  • DMD is one of the most frequent inherited diseases in males, affecting one in 3,500 boys.
  • DMD occurs when the dystrophin gene, located on the short arm of the X chromosome, is defective. Since males only carry one copy of the X chromosome, they only have one copy of the dystrophin gene. Without the dystrophin protein, muscle is easily damaged during cycles of contraction and relaxation. While early in the disease muscle compensates by regeneration, later on muscle progenitor cells cannot keep up with the ongoing damage and healthy muscle is replaced by non-functional fibro-fatty tissue.
  • BMD results from different mutations in the dystrophin gene.
  • BMD patients have some dystrophin, but it is either of insufficient quantity or poor quality.
  • the presence of some dystrophin protects the muscles of patients with BMD from degenerating as severely or as quickly as those of patients with DMD.
  • ALK4:ActRIIB antagonists of the disclosure may act as GDF8 inhibitors (antagonists), and constitute an alternative means of blocking signaling by GDF8 and/or related TGFp superfamily ligands in vivo in DMD and BMD patients.
  • ALK4:ActRIIB heteromultimers of the disclosure may provide an effective means to increase muscle mass in other disease conditions that are in need of muscle growth.
  • ALS amyotrophic lateral sclerosis
  • Lou Gehrig's disease or motor neuron disease is a chronic, progressive, and incurable CNS disorder that attacks motor neurons, which are components of the central nervous system required for initiation of skeletal muscle contraction.
  • motor neurons deteriorate and eventually die, and though a person's brain normally remains fully functioning and alert, initiation of muscle contraction is blocked at the spinal level.
  • Individuals who develop ALS are typically between 40 and 70 years old, and the first motor neurons to degenerate are those innervating the arms or legs.
  • ALK4:ActRIIB heteromultimers of the disclosure may be used to treat inflammatory muscle diseases/disorders such as dermatomyositis, inclusion body myositis or polymyositis.
  • the inflammatory muscle disease/disorder is dermatomyositis.
  • the inflammatory muscle disease/disorder is polymyositis. In some embodiments, the inflammatory muscle disease/disorder is inclusion body myositis. In some embodiments, the inclusion body myositis is hereditary inclusion body myositis. In some embodiments, the inclusion body myositis is sporadic inclusion body myositis.
  • sporadic inclusion body myositis is characterized by progressive quadriceps femoris and deep flexors weakness and atrophy. Many patients become wheelchair dependent and severely disabled 10-15 years after symptom onset. Patients also frequently display dysphagia due to esophageal and pharyngeal muscle involvement. Diagnosis for sporadic inclusion body myositis is usually based on some combination of factors such as elevated creatine kinase levels in the blood, abnormal electromyography results; or muscle biopsies displaying inflammatory cell invasion of muscle, vacuolar degeneration and/or inclusions of plaques of abnormal proteins.
  • ALK4 ActRIIB heteromultimera may further be used as a therapeutic agent for slowing or preventing the development of obesity and type 2 diabetes.
  • Cancer anorexia-cachexia syndrome is among the most debilitating and life- threatening aspects of cancer. This syndrome is a common feature of many types of cancer - present in approximately 80% of cancer patients at death - and is responsible not only for a poor quality of life and poor response to chemotherapy but also a shorter survival time than is found in patients with comparable tumors but without weight loss. Cachexia is typically suspected in patients with cancer if an involuntary weight loss of greater than five percent of premorbid weight occurs within a six-month period. Associated with anorexia, wasting of fat and muscle tissue, and psychological distress, cachexia arises from a complex interaction between the cancer and the host.
  • Cancer cachexia affects cytokine production, release of lipid-mobilizing and proteoly sis-inducing factors, and alterations in intermediary metabolism. Although anorexia is common, a decreased food intake alone is unable to account for the changes in body composition seen in cancer patients, and increasing nutrient intake is unable to reverse the wasting syndrome. Currently, there is no treatment to control or reverse the cachexic process. Since systemic overexpression of GDF8 in adult mice was found to induce profound muscle and fat loss analogous to that seen in human cachexia syndromes (Zimmers et al., supra), the subject ALK4:ActRIIB heteromultimers may be beneficially used to prevent, treat, or alleviate the symptoms of the cachexia syndrome, where muscle growth is desired. An example of a heteromeric complex useful for preventing, treating, or alleviating muscle loss as described above is an ALK4:ActRIIB heterodimer.
  • an ALK4:ActRIIB heteromultimer of the present disclosure may be used in methods of inducing bone and/or cartilage formation, preventing bone loss, increasing bone mineralization, preventing the demineralization of bone, and/or increasing bone density.
  • ALK4:ActRIIB heteromultimers may be useful in patients who are diagnosed with subclinical low bone density, as a protective measure against the development of osteoporosis.
  • an ALK4:ActRIIB heteromultimer of the present disclosure may find medical utility in the healing of bone fractures and cartilage defects in humans and other animals.
  • the subject methods and compositions may also have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints.
  • an osteogenic agent is useful for repair of craniofacial defects that are congenital, trauma-induced, or caused by oncologic resection, and is also useful in cosmetic plastic surgery. Further, methods and compositions of the invention may be used in the treatment of periodontal disease and in other tooth repair processes.
  • an ALK4: ActRIIB heteromultimer may provide an environment to attract bone- forming cells, stimulate growth of bone-forming cells, or induce differentiation of progenitors of bone-forming cells.
  • An ALK4:ActRIIB heteromultimer of the disclosure may also be useful in the treatment of osteoporosis. Further, ALK4:ActRIIB heteromultimers may be used in repair of cartilage defects and prevention/reversal of osteoarthritis. Examples of heteromeric complexes useful for inducing bone formation, preventing bone loss, increasing bone mineralization, preventing the demineralization of bone, and/or increasing bone density as described herein are ALK4:ActRIIB heterodimers.
  • osteoporosis hyperparathyroidism
  • chronic kidney disease mineral bone disorder e.g. chronic kidney disease mineral bone disorder
  • sex hormone deprivation or ablation e.g. androgen and/or estrogen
  • glucocorticoid treatment e.g. androgen and/or estrogen
  • rheumatoid arthritis severe burns
  • hyperparathyroidism hypercalcemia, hypocalcemia, hypophosphatemia, osteomalacia (including tumor-induced osteomalacia)
  • hyperphosphatemia a malignant neoplasm originating from a malignant neoplasm originating from a malignant neoplasm originating from a malignant neoplasm originating from a malignant neoplasm originating from a malignant neoplasm originating from a malignant neoplasm originating from a malignant neoplasm originating from a malignant neoplasm originating from a tumor metastases to bone, bone loss as a consequence of a tumor or chemotherapy, tumors of the bone and bone marrow (e.g., multiple myeloma), ischemic bone disorders, periodontal disease and oral bone loss,
  • Methods and compositions of the invention may also be applied to conditions characterized by a failure of bone formation or healing, including non-union fractures, fractures that are otherwise slow to heal, fetal and neonatal bone dysplasias (e.g., hypocalcemia, hypercalcemia, calcium receptor defects and vitamin D deficiency), osteonecrosis (including osteonecrosis of the jaw) and osteogenesis imperfecta. Additionally, the anabolic effects will cause such antagonists to diminish bone pain associated with bone damage or erosion.
  • such antagonists may be useful to treat disorders of abnormal bone formation, such as osteoblastic tumor metastases (e.g., associated with primary prostate or breast cancer), osteogenic osteosarcoma, osteopetrosis, progressive diaphyseal dysplasia, endosteal hyperostosis, osteopoikilosis, and melorheostosis.
  • disorders of abnormal bone formation such as osteoblastic tumor metastases (e.g., associated with primary prostate or breast cancer), osteogenic osteosarcoma, osteopetrosis, progressive diaphyseal dysplasia, endosteal hyperostosis, osteopoikilosis, and melorheostosis.
  • Other disorders that may be treated include fibrous dysplasia and chondrodysplasias.
  • the disclosure provides a therapeutic method and composition for repairing fractures and other conditions related to cartilage and/or bone defects or periodontal diseases.
  • the invention further provides therapeutic methods and compositions for wound healing and tissue repair.
  • the types of wounds include, but are not limited to, burns, incisions and ulcers. See, e.g., PCT Publication No. WO 84/01106.
  • Such compositions comprise a therapeutically effective amount of at least one of the
  • ALK4:ActRIIB heteromultimers of the disclosure in admixture with a pharmaceutically acceptable vehicle, carrier, or matrix.
  • an ALK4:ActRIIB heteromultimer of the disclosure can be applied to conditions causing bone loss such as osteoporosis, hyperparathyroidism, Cushing's disease, thyrotoxicosis, chronic diarrheal state or malabsorption, renal tubular acidosis, or anorexia nervosa.
  • bone loss such as osteoporosis, hyperparathyroidism, Cushing's disease, thyrotoxicosis, chronic diarrheal state or malabsorption, renal tubular acidosis, or anorexia nervosa.
  • osteoporosis loss of bone mineral density, leading to fracture risk.
  • osteoporosis can also result from the long-term use of certain medications. Osteoporosis resulting from drugs or another medical condition is known as secondary osteoporosis.
  • phenytoin Dioxyribonucleic acid
  • barbiturates that are used to prevent seizures
  • methotrexate Renidextrin
  • cyclosporine Session-inhibitor
  • heparin Calciparine, Liquaemin
  • cholestyramine Questran
  • colestipol colestipol
  • Bone loss resulting from cancer therapy is widely recognized and termed cancer therapy-induced bone loss (CTIBL). Bone metastases can create cavities in the bone that may be corrected by treatment with an osteoporosis.
  • CTIBL cancer therapy-induced bone loss
  • Bone loss can also be caused by gum disease, a chronic infection in which bacteria located in gum recesses produce toxins and harmful enzymes.
  • the present disclosure provides methods and therapeutic agents for treating diseases or disorders associated with abnormal or unwanted bone growth.
  • diseases or disorders associated with abnormal or unwanted bone growth For example, patients with the congenital disorder fibrodysplasia ossificans progressiva (FOP) are afflicted by progressive ectopic bone growth in soft tissues spontaneously or in response to tissue trauma, with a major impact on quality of life. Additionally, abnormal bone growth can occur after hip replacement surgery and thus ruin the surgical outcome. This is a more common example of pathological bone growth and a situation in which the subject methods and compositions may be therapeutically useful.
  • FOP fibrodysplasia ossificans progressiva
  • compositions may also be useful for treating other forms of abnormal bone growth (e.g., pathological growth of bone following trauma, burns or spinal cord injury), and for treating or preventing the undesirable conditions associated with the abnormal bone growth seen in connection with metastatic prostate cancer or osteosarcoma.
  • abnormal bone growth e.g., pathological growth of bone following trauma, burns or spinal cord injury
  • undesirable conditions associated with the abnormal bone growth seen in connection with metastatic prostate cancer or osteosarcoma e.g., pathological growth of bone following trauma, burns or spinal cord injury
  • an ALK4:ActRIIB heteromultimer of the disclosure may be used to promote bone formation in patients with cancer.
  • Patients having certain tumors e.g. prostate, breast, multiple myeloma or any tumor causing hyperparathyroidism
  • Such patients may be treated with a TGF-beta superfamily heteromultimer complex, or a combination of complexes, even in the absence of evidence of bone loss or bone metastases.
  • Patients may also be monitored for evidence of bone loss or bone metastases, and may be treated with an ALK4: ActRIIB heteromultimer in the event that indicators suggest an increased risk.
  • BSAP Bone specific alkaline phosphatase
  • Blood levels of BSAP are increased in patients with bone metastasis and other conditions that result in increased bone remodeling.
  • Osteocalcin and procollagen peptides are also associated with bone formation and bone metastases. Increases in BSAP have been detected in patients with bone metastasis caused by prostate cancer, and to a lesser degree, in bone metastases from breast cancer.
  • BMP7 levels are high in prostate cancer that has metastasized to bone, but not in bone metastases due to bladder, skin, liver, or lung cancer.
  • Type I carboxy-terminal telopeptide ICTP
  • ICTP carboxy-terminal telopeptide
  • NTx Another collagen crosslink, Type I N-terminal telopeptide (NTx), is produced along with ICTP during bone turnover.
  • NTx is increased in bone metastasis caused by many different types of cancer including lung, prostate, and breast cancer. Also, the levels of NTx increase with the progression of the bone metastasis. Therefore, this marker can be used to both detect metastasis as well as measure the extent of the disease.
  • Other markers of resorption include pyridinoline and deoxypyridinoline. Any increase in resorption markers or markers of bone metastases indicate the need for therapy with an ALK4: ActRIIB heteromultimer in a patient.
  • an ALK4:ActRIIB heteromultimer may be used in patients with chronic kidney disease mineral bone disorder (CKD-MBD), a broad syndrome of interrelated skeletal, cardiovascular, and mineral-metabolic disorders arising from kidney disease.
  • CKD-MBD encompasses various skeletal pathologies often referred to as renal osteodystrophy (ROD), which is a preferred embodiment for treatment with, an
  • ALK4:ActRIIB heteromultimer Depending on the relative contribution of different pathogenic factors, ROD is manifested as diverse pathologic patterns of bone remodeling (Hruska et al., 2008, Chronic kidney disease mineral bone disorder (CKD-MBD); in Rosen et al. (ed) Primer on the Metabolic Bone Diseases and Disorders of Mineral Metabolism, 7th ed. American Society for Bone and Mineral Research, Washington D.C., pp 343-349). At one end of the spectrum is ROD with uremic osteodystrophy and low bone turnover,
  • ALK4:ActRIIB heteromultimer may exert both anabolic and antiresorptive effects, these agents may be useful in patients across the ROD pathology spectrum.
  • An ALK4:ActRIIB heteromultimer of the disclosure may be conjointly administered with other bone-active pharmaceutical agents. Conjoint administration may be accomplished by administration of a single co-formulation, by simultaneous administration, or by administration at separate times. ALK4:ActRIIB heteromultimers may be particularly advantageous if administered with other bone-active agents.
  • a patient may benefit from conjointly receiving an ALK4:ActRIIB heteromultimer and taking calcium supplements, vitamin D, appropriate exercise and/or, in some cases, other medication. Examples of other medications incude, bisphosphonates (alendronate, ibandronate and risedronate), calcitonin, estrogens, parathyroid hormone and raloxifene.
  • the bisphosphonates (alendronate, ibandronate and risedronate), calcitonin, estrogens and raloxifene affect the bone remodeling cycle and are classified as anti-resorptive medications.
  • Bone remodeling consists of two distinct stages: bone resorption and bone formation. Anti-resorptive medications slow or stop the bone-resorbing portion of the bone-remodeling cycle but do not slow the bone-forming portion of the cycle. As a result, new formation continues at a greater rate than bone resorption, and bone density may increase over time.
  • Teriparatide a form of parathyroid hormone, increases the rate of bone formation in the bone remodeling cycle.
  • Alendronate is approved for both the prevention (5 mg per day or 35 mg once a week) and treatment (10 mg per day or 70 mg once a week) of postmenopausal osteoporosis. Alendronate reduces bone loss, increases bone density and reduces the risk of spine, wrist and hip fractures.
  • Alendronate also is approved for treatment of glucocorticoid-induced osteoporosis in men and women as a result of long-term use of these medications (i.e., prednisone and cortisone) and for the treatment of osteoporosis in men.
  • Alendronate plus vitamin D is approved for the treatment of osteoporosis in postmenopausal women (70 mg once a week plus vitamin D), and for treatment to improve bone mass in men with osteoporosis.
  • Ibandronate is approved for the prevention and treatment of postmenopausal osteoporosis. Taken as a once-a-month pill (150 mg), ibandronate should be taken on the same day each month.
  • Ibandronate reduces bone loss, increases bone density and reduces the risk of spine fractures.
  • Risedronate is approved for the prevention and treatment of postmenopausal osteoporosis. Taken daily (5 mg dose) or weekly (35 mg dose or 35 mg dose with calcium), risedronate slows bone loss, increases bone density and reduces the risk of spine and non-spine fractures.
  • Risedronate also is approved for use by men and women to prevent and/or treat glucocorticoid-induced osteoporosis that results from long-term use of these medications (i.e., prednisone or cortisone).
  • Calcitonin is a naturally occurring hormone involved in calcium regulation and bone metabolism.
  • Calcitonin slows bone loss, increases spinal bone density, and may relieve the pain associated with bone fractures. Calcitonin reduces the risk of spinal fractures. Calcitonin is available as an injection (50-100 IU daily) or nasal spray (200 IU daily).
  • a patient may also benefit from conjointly receiving an ALK4:ActRIIB
  • Estrogen therapy (ET)/hormone therapy (HT) is approved for the prevention of osteoporosis.
  • ET has been shown to reduce bone loss, increase bone density in both the spine and hip, and reduce the risk of hip and spinal fractures in postmenopausal women.
  • ET is administered most commonly in the form of a pill or skin patch that delivers a low dose of approximately 0.3 mg daily or a standard dose of approximately 0.625 mg daily and is effective even when started after age 70. When estrogen is taken alone, it can increase a woman's risk of developing cancer of the uterine lining (endometrial cancer).
  • Raloxifene increases bone mass and reduces the risk of spine fractures.
  • Data are not yet available to demonstrate that raloxifene can reduce the risk of hip and other non-spine fractures.
  • Teriparatide a form of parathyroid hormone, is approved for the treatment of osteoporosis in postmenopausal women and men who are at high risk for a fracture. This medication stimulates new bone formation and significantly increases bone mineral density.
  • fracture reduction was noted in the spine, hip, foot, ribs and wrist.
  • fracture reduction was noted in the spine, but there were insufficient data to evaluate fracture reduction at other sites.
  • Teriparatide is self-administered as a daily injection for up to 24 months.
  • an ALK4:ActRIIB heteromultimer can be used for regulating body fat content in an animal and for treating or preventing conditions related thereto, and particularly, health-compromising conditions related thereto.
  • to regulate (control) body weight can refer to reducing or increasing body weight, reducing or increasing the rate of weight gain, or increasing or reducing the rate of weight loss, and also includes actively maintaining, or not significantly changing body weight (e.g., against external or internal influences which may otherwise increase or decrease body weight).
  • One embodiment of the present disclosure relates to regulating body weight by administering to an animal (e.g., a human) in need thereof a ALK4:ActRIIB heteromultimers.
  • an ALK4:ActRIIB heteromultimer of the present disclosure can be used for reducing body weight and/or reducing weight gain in an animal, and more particularly, for treating or ameliorating obesity in patients at risk for or suffering from obesity.
  • the present invention is directed to methods and compounds for treating an animal that is unable to gain or retain weight (e.g., an animal with a wasting syndrome). Such methods are effective to increase body weight and/or mass, or to reduce weight and/or mass loss, or to improve conditions associated with or caused by undesirably low (e.g., unhealthy) body weight and/or mass.
  • disorders of high cholesterol e.g., hypercholesterolemia or dislipidemia
  • an ALK4:ActRIIB heteromultimer of the present disclosure can be used for reducing body weight and/or reducing weight gain in an animal, and more particularly, for treating or ameliorating obesity in patients at risk for or suffering from obesity.
  • the present invention is directed to methods and compounds for treating an animal that is unable to gain or retain weight (e.g.
  • an ALK4:ActRIIB heteromultimer can be used for regulating body fat content in an animal and for treating or preventing conditions related thereto, and particularly, health-compromising conditions related thereto.
  • to regulate (control) body weight can refer to reducing or increasing body weight, reducing or increasing the rate of weight gain, or increasing or reducing the rate of weight loss, and also includes actively maintaining, or not significantly changing body weight (e.g., against external or internal influences which may otherwise increase or decrease body weight).
  • One embodiment of the present disclosure relates to regulating body weight by administering to an animal (e.g., a human) in need thereof an ALK4:ActRIIB heteromultimer.
  • an ALK4:ActRIIB heteromultimer may be used to treat or prevent a disorder or condition sleeted from obesity (e.g., abdominal obesity); overweight; insulin resistance; metabolic syndrome and other metabolic diseases or conditions; a lipid disorder such as, low HDL levels, high LDL levels, hyperlipidemia, hypertriglyceridemia or dyslipidemia; lipoprotein aberrations; decreased triglycerides; inflammation (e.g., liver inflammation and/or inflammation of adipose tissue), fatty liver disease; non-alcoholic fatty liver disease; hyperglycemia; impaired glucose tolerance (IGT); hyperinsulinemia; high cholesterol (e.g., high LDL levels and hypercholesterolemia); cardiovascular disease such as, heart disease including coronary heart disease, congestive heart failure, stroke, peripheral vascular disease, atherosclerosis; arteriosclerosis, and hypertension; Syndrome X; vascular restenosis; neuropathy; retinopathy; neurodegenerative disease; endothelial dysfunction, respiratory dysfunction
  • a lipid disorder
  • the disclosure provides a method of reducing body weight comprising administering to a subject desiring to reduce body weight, or in need thereof, an effective amount of an ALK4:ActRIIB heteromultimer.
  • the subject is overweight (e.g., pre-obese).
  • the subject has a body mass index
  • BMI bodyMI 2 2
  • the subject has a BMI of 25 kg/m to 29.9 kg/m 2 , 30 kg/m 2 to 39.9 kg/m 2 , 25 kg/m 2 to 39.9 kg/m 2 , or 25 kg/m 2 to 50 kg/m 2 .
  • the subject is obese.
  • the subject has a BMI of 30
  • the subject is morbidly obese. In some embodiments, the subject has a BMI of 40 kg/m or
  • the subject has a BMI of 40 kg/m to 45 kg/m , or 40 kg/m to 50 kg/m .
  • the subject has central obesity (e.g., excess adiposity in the abdominal region, including belly fat and/or visceral fat).
  • the subject has a waist/hip circumference ratio (WHR) of 0.85 or greater.
  • WHR waist/hip circumference ratio
  • the subject has peripheral obesity (e.g., excess adiposity on the hips).
  • the subject has type 2 diabetes mellitus.
  • the ALK4:ActRIIB heteromultimer may administered alone or as a combination therapy other type of supportive therapy.
  • the supportive therapy is diet and/or exercise.
  • the disclosure provides a method of reducing weight gain comprising administering to a subject desiring to reduce weight gain, or in need thereof, an effective amount of an ALK4:ActRIIB heteromultimer.
  • the subject is overweight (e.g., pre-obese).
  • the subject has a BMI of 25 kg/m or
  • the subject has a BMI of 25 kg/m to 29.9 kg/m , 30 kg/m
  • the 2 subject is obese.
  • the subject has a BMI of 30 kg/m or greater (e.g.,
  • the subject is morbidly obese. In some embodiments, the subject has a BMI of 40 kg/m or greater. In further
  • the subject has a BMI of 40 kg/m to 45 kg/m , or 40 kg/m to 50 kg/m .
  • the subject has type 2 diabetes mellitus.
  • the treated or prevented disease or condition is obesity.
  • the treated or prevented disease or condition is insulin resistance.
  • the treated or prevented disease or condition is a member selected from the group consisting of: dyslipidemia, hyperlipidemia (total cholesterol level >240 mg/dL), hypercholesterolemia (e.g., total cholesterol level of >200 mg/dL, >220 mg/dL, >240 mg/dL, >250 mg/dL, or >275 mg/dL), low HDL serum level (e.g., ⁇ 40mg/dL, ⁇ 45 mg/dL, or ⁇ 50 mg/dL), high LDL serum level (e.g., > 100 mg/dL, > 130 mg/dL, > 160 mg/dL, or > 190 mg/dL), and hypertriglyceridemia (e.g., a fasting TG level of > 150 mg/dL, > 175 mg/dL, > 200 mg/dL, > 300 mg/dL, > 400 mg/dL, or > 499 mg/dL).
  • the ALK4 ActRIIB antagonists treatment
  • the disclosure provides a method of reducing body weight in a subject who is overweight.
  • the method includes administering to an overweight subject an effective amount of an ALK4:ActRIIB heteromultimer.
  • the subject has a body mass index (BMI) of 25 kg/m or greater.
  • BMI body mass index
  • the subject has a BMI of 25 kg/m 2 to 29.9 kg/m 2 , 30 kg/m 2 to 39.9 kg/m 2 , 25 kg/m 2 to 39.9 kg/m 2 , or 25
  • the subject is obese. In some embodiments,
  • the subject has a BMI of 30 kg/m or greater (e.g., 30 to 39.9 kg/m or 30
  • the ALK4:ActRIIB heteromultimer is administered alone or as a combination therapy. In some embodiments, the ALK4:ActRIIB heteromultimer treatment is an adjunct to diet and/or exercise.
  • the disclosure provides a method of reducing body weight in an obese subject.
  • the method includes administering to the subj ect an effective amount of an ALK4: ActRIIB heteromultimer.
  • the subject has a BMI of 30 kg/m or
  • the subject has a BMI of 40 kg/m or greater.
  • the subject has central obesity (e.g., excess adiposity in the abdominal region, including belly fat and/or visceral fat).
  • the subject has a waist/hip circumference ratio (WHR) of 0.85 or greater.
  • WHR waist/hip circumference ratio
  • the subject has peripheral obesity (e.g., excess adiposity on the hips).
  • the ALK4:ActRIIB heteromultimer treatment is an adjunct to diet and/or exercise.
  • the disclosure provides a method of treating and/or ameliorating obesity or a disease or condition associated with obesity, comprising administering to an obese subject, an effective amount of an ALK4:ActRIIB heteromultimer.
  • the subject has a BMI of 30 kg/m or greater.
  • the subject has a BMI of 30 to 39.9 kg/m or 30 kg/m to 50 kg/m . In some embodiments, the subject is morbidly obese. In some embodiments, the subject has a body BMI of 40
  • the subject has a BMI of 40 kg/m to 45 kg/m , or
  • the subject has type 2 diabetes mellitus. In some embodiments, the subject has type 2 diabetes mellitus.
  • the subject has a BMI of 30 kg/m or greater (e.g., 30 to 39.9 kg/m ). In some embodiments, the subject has a BMI of at least 40 kg/m . In some embodiments, the subject has central obesity (e.g., excess adiposity in the abdominal region, including belly fat and/or visceral fat). In some embodiments, the subject has a waist/hip circumference ratio (WHR) of 0.85 or greater. In some embodiments, the subject has peripheral obesity (e.g., excess adiposity on the hips). In some embodiments, the ALK4:ActRIIB heteromultimer treatment is an adjunct to diet and/or exercise.
  • the treated or prevented disease or condition is a member selected from the group consisting of: dyslipidemia, hyperlipidemia (total cholesterol level >240 mg/dL), hypercholesterolemia (e.g., total cholesterol level of >200 mg/dL, >220 mg/dL, >240 mg/dL, >250 mg/dL, or >275 mg/dL), low HDL serum level (e.g., ⁇ 40mg/dL, ⁇ 45 mg/dL, or ⁇ 50 mg/dL), high LDL serum level (e.g., > 100 mg/dL, > 130 mg/dL, > 160 mg/dL, or > 190 mg/dL), and hypertriglyceridemia (e.g., a fasting TG level of > 150 mg/
  • the treated or prevented disease or condition is cardiovascular disease.
  • the treated or prevented disease or condition is hypertension (high blood pressure), myocardial infarction, peripheral artery disease, vasoregulatoin dysfunction, arteriosclerosis congestive heart failure, atherosclerosis, coronary heart disease, or microvascular disease.
  • the treated or prevented disease or condition is liver disease.
  • the treated or prevented liver disease or condition is NAFLD.
  • the liver disease is fatty liver.
  • the liver disease is NASH.
  • the treated or prevented disease or condition is a member selected from the group: steatohepatitis, steatosis, fibrosis, and/or cirrhosis.
  • the ALK4:ActRIIB heteromultimer treatment is an adjunct to diet and/or exercise.
  • the disclosure provides a method of treating, ameliorating, and/or preventing type 2 diabetes mellitus or a disease or condition associated with diabetes comprising administering to a subject having type 2 diabetes mellitus, or at risk of developing type 2 diabetes, an effective amount of an heteromultimer.
  • the subject having type 2 diabetes mellitus, or at risk of developing type 2 diabetes, an effective amount of an heteromultimer.
  • the subject has a body mass index BMI of 30 kg/m or greater (e.g., 30 to 39.9 kg/m ). In some embodiments, the subject has a BMI of at least 40 kg/m . In some embodiments, the subject has central obesity (e.g., excess adiposity in the abdominal region, including belly fat and/or visceral fat). In some embodiments, the subject has a WHR of 0.85 or greater. In some embodiments, the subject has peripheral obesity (e.g., excess adiposity on the hips). In some embodiments, the ALK4:ActRIIB heteromultimer treatment is an adjunct to diet and/or exercise.
  • the treated or prevented disease or condition is a member selected from the group consisting of: dyslipidemia, hyperlipidemia (total cholesterol level >240 mg/dL), hypercholesterolemia (e.g., total cholesterol level of >200 mg/dL, >220 mg/dL, >240 mg/dL, >250 mg/dL, or >275 mg/dL), low HDL serum level (e.g., ⁇ 40mg/dL, ⁇ 45 mg/dL, or ⁇ 50 mg/dL), high LDL serum level (e.g., > 100 mg/dL, > 130 mg/dL, > 160 mg/dL, or > 190 mg/dL), and hypertriglyceridemia (e.g., a fasting TG level of > 150 mg/dL, > 175
  • the treated or prevented disease or condition is cardiovascular disease.
  • the treated or prevented disease or condition is hypertension (high blood pressure), myocardial infarction, peripheral artery disease, vasoregulatoin dysfunction, or arteriosclerosis.
  • the treated or prevented disease or condition is liver disease.
  • the treated or prevented disease or condition is a member selected from the group: fatty liver disease, steatohepatitis, steatosis, and/or cirrhosis.
  • the treated or prevented disease or condition is a member selected from the group consisting of: cataracts, obstructive sleep apnea, phlebitis, gout, osteoarthritis, gallbladder disease, and high cholesterol.
  • the ALK4:ActRIIB heteromultimer treatment is an adjunct to diet and/or exercise.
  • the disclosure also provides a method for improving the blood-lipid profile in a subject, comprising administering to a subject in need of such treatment an effective amount of an ALK4:ActRIIB heteromultimer.
  • the disclosure provides a method for reducing levels of LDL cholesterol or increasing levels of HDL-cholesterol.
  • the subject has dyslipidemia.
  • the subject has elevated serum lipids (e.g., cholesterol (hypercholesterolemia) and/or triglycerides (e.g., hypertriglyceridemia).
  • the subject has an LDL-C > 100 mg/dL, > 130 mg/dL, or > 160 mg/dL).
  • the subject has a TG > 150 mg/dL, > 160 mg/dL, > 170 mg/dL).
  • the subject has elevated plasma insulin levels (hyperinsulinemia; e.g., fasting insulin level of >20 ug/ml can exceed 100).
  • the subject has type II diabetes.
  • the disclosure provides a method of treating or preventing a metabolic disease or disorder or a condition associated with a metabolic disease or disorder, comprising administering an ALK4:ActRIIB heteromultimer to a subject in need thereof.
  • the treated metabolic disease, disorder, or condition is hyperglycemia (e.g., > 130 mg/dL in the fasting state or following glucose administration during an oral glucose tolerance test).
  • the treated metabolic disease, disorder, or condition is a lipid metabolism disease, disorder, or condition.
  • the treated metabolic disease, disorder, or condition is dislipidemia.
  • the lipid metabolism disease, disorder, or condition is a member selected from: low HDL levels, high LDL levels, high triglyceride levels, hyperlipidemia, and a lipoprotein aberration.
  • the subject has a total cholesterol level of >200 mg/dL, >220 mg/dL, >240 mg/dL, >250 mg/dL, or >275 mg/dL.
  • the subject has a HDL serum level of ⁇ 40mg/dL, ⁇ 45 mg/dL, or ⁇ 50 mg/dL).
  • the subject has a LDL serum level > 100 mg/dL, > 130 mg/dL, > 160 mg/dL, or > 190 mg/dL.
  • the subject has fasting TG level of > 150 mg/dL, > 175 mg/dL, > 200 mg/dL, > 300 mg/dL, > 400 mg/dL, or > 499 mg/dL.
  • the treated metabolic disease, disorder, or condition is a glucose metabolism disease, disorder, or condition.
  • the glucose metabolism disease, disorder, or condition is a member selected from: glucose intolerance, insulin resistance, impaired glucose tolerance (IGT), impaired fasting glucose (IFG).
  • the treated metabolic disease, disorder, or condition is a member selected from the group consisting of: high uric acid levels, NAFLD, fatty liver, NASH, and polycystic ovarian syndrome.
  • the treated subject has hyperinsulinemia.
  • the treated subject is obese (e.g., the subject has abdominal obesity).
  • the treated subject has type II diabetes.
  • Metabolic syndrome is a condition involving a set of disorders that enhances the risk of heart disease.
  • the major components of metabolic syndrome are excess weight, the cardiovascular parameters (high blood pressure, dyslipidemia, high levels of triglycerides and/or low levels of HDL in the blood), atherosclerosis, diabetes, and/or insulin resistance.
  • a subject having several of these components, i.e. metabolic syndrome is highly prone to heart disease, though each component is a risk factor.
  • the disclosure also provides a method for treating or preventing 1, 2, 3, or more of the above components of metabolic syndrome, comprising administering to a subject in need of treatment an effective amount of an ALK4:ActRIIB heteromultimer.
  • the treated, prevented, or ameliorated cardiovascular disease or condition is atherosclerosis.
  • the treated, prevented, or ameliorated cardiovascular disease or condition is hypertension (e.g., blood pressure >130/80 mmHg or > 140/90 mmHg, in a resting state.
  • the cardiovascular disease is atherosclerosis (coronary heart disease disease).
  • the disclosure provides a method for treating and/or ameliorating an inflammatory liver disease or condition that comprises administering an ALK4:ActRIIB heteromultimer, to a subject in need thereof.
  • the disease or condition is NAFLD.
  • the disease or condition is fatty liver.
  • the disease or condition is steatosis (e.g., nonalcoholic steatohepatitis (NASH)).
  • the disease or condition is alcoholic fatty liver disease.
  • This disclosure also provides a method of improving glycemic control, comprising administering to a subject in need of treatment an effective amount of an ALK4:ActRIIB heteromultimer.
  • the subject is administered has a fasting blood sugar level of >130, >135, >140, >145, or >150 mg/dL.
  • the subject is administered has a postprandial blood sugar level of >180, >185, >190, >195, or >200 mg/dL 2 hours after eating.
  • the ALK4:ActRIIB heteromultimer treatment is an adjunct to diet and/or exercise.
  • the administration can also reduce body weight or treat obesity.
  • the subject has type 2 diabetes mellitus.
  • the subject has a BMI of 27 to 40 kg/ni2. In certain instances, the subject has a BMI of 30 to 39.9 kg/m2. In certain instances, the subject has a BMI of at least 40. In certain instances, the subject is overweight. In certain instances, the subject is obese. An improvement in glycemic control can be assessed using techniques known in the art such as a mixed-meal test.
  • compositions and methods for treating, preventing or ameliorating hyperglycemia or a condition associated with hyperglycemia in a subject comprising administering to a subject in need of such treatment an effective amount of an ALK4:ActRIIB heteromultimer.
  • the subject is administered has a fasting blood sugar level of >130, >135, >140, >145, or >150 mg/dL.
  • the subject is administered has a postprandial blood sugar level of >180, >185, >190, >195, or >200 mg/dL 2 hours after eating.
  • the result of the treatment, prevention or amelioration is a member selected from the group consisting of: a decrease in serum levels of glucose, a decrease in serum levels of triglycerides, a decrease in serum levels of insulin, and/or a decrease in serum levels of non-esterified fatty acids, as compared to serum levels in the subject prior to treatment.
  • the result of the treatment, prevention or amelioration is an increase in body temperature of about 0.4°C to 1°C as compared to body temperature of the subject prior to treatment.
  • the ALK4:ActRIIB treatment also reduces body weight of the subject.
  • the disclosure provides a method of decreasing plasma insulin levels in a subject, comprising administering an effective amount of an ALK4:ActRIIB heteromultimer to a subject in need of such treatment.
  • the subject has a fasting blood sugar level of >130, >135, >140, >145, or >150 mg/dL.
  • the subject has a postprandial blood sugar level of >180, >185, >190, >195, or >200 mg/dL 2 hours after eating.
  • the subject is overweight.
  • the subject is obese.
  • the subject has type 2 diabetes.
  • compositions and methods for treating, preventing or ameliorating hyperglycemia or a condition associated with hyperglycemia in a subject comprising administering to a subject in need of such treatment an effective amount of an ALK4:ActRIIB heteromultimer.
  • the subject has a fasting blood sugar level of >130, >135, >140, >145, or >150 mg/dL.
  • the subject has a postprandial blood sugar level of >180, >185, >190, >195, or >200 mg/dL 2 hours after eating.
  • the result of the treatment, prevention or amelioration is a member selected from the group consisting of: a decrease in serum levels of glucose, a decrease in serum levels of triglycerides, a decrease in serum levels of insulin, and/or a decrease in serum levels of non-esterified fatty acids, as compared to serum levels in the subject prior to treatment.
  • the result of the treatment, prevention or amelioration is an increase in body temperature of about 0.4°C to 1°C as compared to body temperature of the subject prior to treatment.
  • the ALK4:ActRIIB heteromultimer treatment also reduces body weight of the subject.
  • the disclosure provides a method of decreasing plasma insulin levels in a subject, comprising administering an effective amount of an ALK4:ActRIIB heteromultimer to a subject in need of such treatment.
  • the subject has a fasting blood sugar level of >130, >135, >140, >145, or >150 mg/dL.
  • the subject is overweight.
  • the subject is obese.
  • the subject has type 2 diabetes.
  • the disclosure provides a method of treating, preventing, or ameliorating liver disease in a subject, comprising administering an effective amount of an ALK4:ActRIIB heteromultimer to a subject having a liver disease.
  • the subject has inflammation of the liver.
  • the subject has NAFLD.
  • the subject has fatty liver.
  • the subject has NASH.
  • the subject has fatty liver.
  • the subject has alcoholic fatty liver disease.
  • the treated, prevented or ameliorated liver disease is fibrosis, scarring, cirrhosis, or liver failure.
  • the treated, prevented or ameliorated liver disease is liver cancer.
  • the subject is overweight.
  • the subject is obese.
  • the subject has type 2 diabetes.
  • Fibrosis generally refers to an excessive deposition of both collagen fibers and extracellular matrix combined with a relative decrease of cell number in an organ or tissue. While this process is an important feature of natural wound healing following injury, fibrosis can lead to pathological damage in various tissue and organs including, for example, the lungs, kidneys, liver, bone, muscle, and skin. The role TGF-beta in fibrosis has been extensively study.
  • an ALK4:ActRIIB heteromultimer of the present disclosure can be used to treat fibrosis, particularly fibrosis-associated disorders and conditions.
  • an ALK4:ActRIIB heteromultimer may be used to treat or prevent one or more of: pulmonary fibrosis, hypersensitivity pneumonitis, idiopathic fibrosis, tuberculosis, pneumonia, cystic fibrosis, asthma, chronic obstructive pulmonary disease (COPD), emphysema, renal (kidney) fibrosis, renal (kidney) failure, chronic renal (kidney) disease, bone fibrosis, myelofibrosis, rheumatoid arthritis, systemic lupus erythematosus, scleroderma, sarcoidosis, granulomatosis with polyangiitis, Peyronie's disease, liver fibrosis, Wilson' s disease, glycogen storage diseases (particularly types III, IV, IX, and X), iron-overload, Gaucher disease, Zellweger syndrome, nonalcoholic and alcoholic steatohepatitis, biliary
  • the kidneys maintain many features of the blood, including volume, pH balance, electrolyte concentrations, and blood pressure, as well as bearing responsibility for toxin and waste filtration. These functions depend upon the intricate structure of the kidney nephrons, constant flow of blood through the various capillaries of the kidney, and the regulation of the kidney by signals from the rest of the body, including endocrine hormones. Problems with kidney function manifest by direct mechanisms (e.g. genetic defects, infection, or toxin exposure) and by indirect mechanisms progressively proceeding from long term stressors like hypertrophy and hyperfiltration (themselves often a result of more direct insults to kidney function).
  • direct mechanisms e.g. genetic defects, infection, or toxin exposure
  • indirect mechanisms progressively proceeding from long term stressors like hypertrophy and hyperfiltration (themselves often a result of more direct insults to kidney function).
  • kidney-associated disease manifestations are many and varied; they can be reviewed in Harrison' s Principles of Internal Medicine, 18 th edition, McGraw Hill, N.Y., Part 13, Chp 277-289.
  • an ALK4:ActRIIB heteromultimer had various beneficial effects in a kidney disease model.
  • treatment with an ALK4:ActRIIB heteromultimer reduced kidney tissue damage, inflammation, and fibrosis in subjects having unilateral ureteral obstruction.
  • ALK4:ActRIIB heteromultimer may be used to treat or prevent kidney disease, particularly treating or preventing various complications (manifestations) of kidney disease including, for example, kidney tissue damage,
  • kidney-associated disease or condition can refer to any disease, disorder, or condition that affects the kidneys or the renal system.
  • kidney-associated diseases or conditions include, but are not limited to, chronic kidney diseases (or failure), acute kidney diseases (or failure), primary kidney diseases, non-diabetic kidney diseases, glomerulonephritis, interstitial nephritis, diabetic kidney diseases, diabetic nephropathy, glomerulosclerosis, rapid progressive glomerulonephritis, renal fibrosis, Alport syndrome, IDDM nephritis, mesangial proliferative glomerulonephritis,
  • membranoproliferative glomerulonephritis crescentic glomerulonephritis, renal interstitial fibrosis, focal segmental glomerulosclerosis, membranous nephropathy, minimal change disease, pauci-immune rapid progressive glomerulonephritis, IgA nephropathy, polycystic kidney disease, Dent's disease, nephrocytinosis, Heymann nephritis, autosomal dominant (adult) polycystic kidney disease, autosomal recessive (childhood) polycystic kidney disease, acute kidney injury, nephrotic syndrome, renal ischemia, podocyte diseases or disorders, proteinuria, glomerular diseases, membranous glomerulonephritis, focal segmental glomerulonephritis, pre-eclampsia, eclampsia, kidney lesions, collagen vascular diseases, benign orthostatic (postural) proteinuria, IgM n
  • glomerulonephritis chronic allograft nephropathy, nephrotoxicity, renal toxicity, kidney necrosis, kidney damage, glomerular and tubular injury, kidney dysfunction, nephritic syndrome, acute renal failure, chronic renal failure, proximal tubal dysfunction, acute kidney transplant rejection, chronic kidney transplant rejection, non-IgA mesangioproliferative glomerulonephritis, postinfectious glomerulonephritis, vasculitides with renal involvement of any kind, any hereditary renal disease, any interstitial nephritis, renal transplant failure, kidney cancer, kidney disease associated with other conditions (e.g., hypertension, diabetes, and autoimmune disease), Dent's disease, nephrocytinosis, Heymann nephritis, a primary kidney disease, a collapsing glomerulopathy, a dense deposit disease, a cryoglobulinemia- associated glomerulonephritis, an Henoch-Schon
  • glomerulonephritis a bacterial endocarditis, a microscopic polyangitis, a Churg-Strauss syndrome, an anti-GBM-antibody mediated glomerulonephritis, amyloidosis, a monoclonal immunoglobulin deposition disease, a fibrillary glomerulonephritis, an immunotactoid glomerulopathy, ischemic tubular injury, a medication-induced tubulo-interstitial nephritis, a toxic tubulo-interstitial nephritis, an infectious tubulo-interstitial nephritis, a bacterial pyelonephritis, a viral infectious tubulo-interstitial nephritis which results from a
  • a metabolic-induced tubulo-interstitial disease a mixed connective disease
  • a cast nephropathy a crystal nephropathy which may results from urate or oxalate or drug-induced crystal deposition
  • an acute cellular tubulo-interstitial allograft rejection a tumoral infiltrative disease which results from a lymphoma or a post- transplant lymphoproliferative disease
  • an obstructive disease of the kidney vascular disease, a thrombotic microangiopathy, a nephroangiosclerosis, an atheroembolic disease, a mixed connective tissue disease, a polyarteritis nodosa, a calcineurin-inhibitor induced-vascular disease, an acute cellular vascular allograft rejection, an acute humoral allograft rejection, early renal function decline (ERFD), end stage renal disease (ESRD), renal vein thrombosis, acute tubular necros
  • tubulointerstitial nephritis tubulointerstitial nephritis, reflux nephropathy, kidney stones, Goodpasture's syndrome, normocytic normochromic anemia, renal anemia, diabetic chronic kidney disease, IgG4- related disease, von Hippel-Lindau syndrome, tuberous sclerosis, nephronophthisis, medullary cystic kidney disease, renal cell carcinoma, adenocarcinoma, nephroblastoma, lymphoma, leukemia, hyposialylation disorder, chronic cyclosporine nephropathy, renal reperfusion injury, renal dysplasia, azotemia, bilateral arterial occlusion, acute uric acid nephropathy, hypovolemia, acute bilateral obstructive uropathy, hypercalcemic nephropathy, hemolytic uremic syndrome, acute urinary retention, malignant nephrosclerosis, postpartum glomerulosclerosis, scler
  • an ALK4:ActRIIB heteromultimer of the present disclosure may be used to treat or prevent chronic kidney disease, optionally in combination with one or more supportive therapies for treating chronic kidney disease.
  • an ALK4:ActRIIB heteromultimer of the present disclosure may be used to treat or prevent one or more complications (symptoms or manifestations) of chronic kidney disease, optionally in combination with one or more supportive therapies for treating chronic kidney disease.
  • an ALK4:ActRIIB heteromultimer of the present disclosure may be used to treat or prevent end-stage kidney failure, optionally in combination with one or more supportive therapies for treating end-stage kidney disease.
  • Chronic kidney disease (CKD) also known as chronic renal disease, is a progressive loss in renal function over a period of months or years.
  • kidney function may include feeling generally unwell and experiencing a reduced appetite.
  • chronic kidney disease is diagnosed as a result of screening of people known to be at risk of kidney problems, such as those with high blood pressure or diabetes and those with a blood relative with CKD. This disease may also be identified when it leads to one of its recognized complications, such as cardiovascular disease, anemia, or pericarditis.
  • Recent professional guidelines classify the severity of CKD in five stages, with stage 1 being the mildest and usually causing few symptoms and stage 5 being a severe illness with poor life expectancy if untreated.
  • Stage 5 CKD is often called end-stage kidney disease, end-stage renal disease, or end-stage kidney failure, and is largely synonymous with the now outdated terms chronic renal failure or chronic kidney failure; and usually means the patient requires renal replacement therapy, which may involve a form of dialysis, but ideally constitutes a kidney transplant.
  • CKD is initially without specific symptoms and is generally only detected as an increase in serum creatinine or protein in the urine. As the kidney function decreases and various symptoms may manifest as described below. Blood pressure may be increased due to fluid overload and production of vasoactive hormones created by the kidney via the renin-angiotensin system, increasing one's risk of developing hypertension and/or suffering from congestive heart failure.
  • Urea may accumulate, leading to azotemia and ultimately uremia (symptoms ranging from lethargy to pericarditis and encephalopathy). Due to its high systemic circulation, urea is excreted in eccrine sweat at high concentrations and crystallizes on skin as the sweat evaporates ("uremic frost"). Potassium may accumulate in the blood (hyperkalemia with a range of symptoms including malaise and potentially fatal cardiac arrhythmias). Hyperkalemia usually does not develop until the glomerular filtration rate falls to less than 20-25 ml/min/1.73 m2, at which point the kidneys have decreased ability to excrete potassium. Hyperkalemia in CKD can be exacerbated by acidemia (which leads to extracellular shift of potassium) and from lack of insulin. Erythropoietin synthesis may be decreased causing anemia. Fluid volume overload symptoms may occur, ranging from mild edema to life-threatening pulmonary edema.
  • Hyperphosphatemia due to reduced phosphate excretion, may occur generally following the decrease in glomerular filtration. Hyperphosphatemia is associated with increased cardiovascular risk, being a direct stimulus to vascular calcification. Hypocalcemia may manifest, which is generally caused by stimulation of fibroblast growth factor-23. Osteocytes are responsible for the increased production of FGF23, which is a potent inhibitor of the enzyme 1-alpha-hydroxylase (responsible for the conversion of 25-hydroxycholecalciferol into 1,25 dihydroxyvitamin D3). Later, this progresses to secondary hyperparathyroidism, renal osteodystrophy, and vascular calcification that further impairs cardiac function.
  • Metabolic acidosis due to accumulation of sulfates, phosphates, uric acid etc. may occur and cause altered enzyme activity by excess acid acting on enzymes; and also increased excitability of cardiac and neuronal membranes by the promotion of hyperkalemia due to excess acid (acidemia). Acidosis is also due to decreased capacity to generate enough ammonia from the cells of the proximal tubule. Iron deficiency anemia, which increases in prevalence as kidney function decreases, is especially prevalent in those requiring
  • haemodialysis It is multifactoral in cause, but includes increased inflammation, reduction in erythropoietin, and hyperuricemia leading to bone marrow suppression.
  • People with CKD suffer from accelerated atherosclerosis and are more likely to develop cardiovascular disease than the general population. Patients afflicted with CKD and cardiovascular disease tend to have significantly worse prognoses than those suffering only from the latter.
  • in combination with refers to any form of administration such that additional therapies (e.g., second, third, fourth, etc.) are still effective in the body (e.g., multiple compounds are simultaneously effective in the patient, which may include synergistic effects of those compounds). Effectiveness may not correlate to measurable concentration of the agent in blood, serum, or plasma.
  • the different therapeutic compounds can be administered either in the same formulation or in separate formulations, either concomitantly or sequentially, and on different schedules. Thus, an individual who receives such treatment can benefit from a combined effect of different therapies.
  • ALK4: ActRIIB heteromultimer of the disclosure can be administered concurrently with, prior to, or subsequent to, one or more other additional agents or supportive therapies.
  • each therapeutic agent will be administered at a dose and/or on a time schedule determined for that particular agent.
  • the particular combination to employ in a regimen will take into account compatibility of the antagonist of the present disclosure with the therapy and/or the desired.
  • any of the ALK4: ActRIIB heteromultimers disclosed herein may be administered in combination with one or more of: eteplirsen, a corticosteroid (e.g.,
  • steroids e.g., prednisone
  • a blood pressure and/or heart medication e.g., angiotensin converting enzyme inhibitors, beta blockers, and diuretics
  • an anti-asthmatic e.g., albuterol
  • a vitamin/neutrient/anti oxidant e.g., amino acids, carnitine, coenzyme Q10, creatine, fish oil, green tea extracts, vitamin E
  • any of the ALK4:ActRIIB heteromultimers disclosed herein may be administered in combination with one or more of: albuterol, speech therapy, surgery, walking aid, back brace, a T-cell inhibitor (e.g., truncated histidyl-tRNA synthetase), stem cell therapy, gene therapy, and/or foot support devices.
  • albuterol e.g., a truncated histidyl-tRNA synthetase
  • stem cell therapy e.g., truncated histidyl-tRNA synthetase
  • ALK4:ActRIIB heteromultimers disclosed herein may be administered in combination with one or more of: riluzole, edaravone, masitinib, an antioxidant, physical therapy, speech therapy, nutritional support, breathing support (e.g., a non-invasive ventilator), stem cell therapy, and/or gene therapy.
  • any of the ALK4:ActRIIB heteromultimers disclosed herein may be administered in combination with one or more of: corticosteroids, prednisone, oxandrolone, methotrexate, mycophenolate mofetil, intravenous immunoglobulin, beta interferon- la, etanercept, alemtuzumab, follistatin, lithium, bimagrumab, arimoclomol, rapamycin, antioxidants, carnitine, coenzyme Q10, physical therapy, occupational therapy, stem cell therapy, and/or gene therapy.
  • any of the ALK4: ActRIIB heteromultimers disclosed herein may be administered in combination with one or more of: an angiotensin converting enzyme (ACE) inhibitor (e.g., benazepril, cilazapril, enalapril, fosinopril, Lisinopril, perinopril, ramapril and quinapril), an angiotensin receptor blocker (e.g., candesartan, epresartan, irbesartan, losartan, telmisartan and valsartan), a statin (e.g., fluvastatin), a non-dihydropyridine calcium channel blocker (e.g., diltiazem), cyclosporine, and/or aldosterone inhibitors.
  • ACE angiotensin converting enzyme
  • an angiotensin receptor blocker e.g., candesartan, epresartan, ir
  • any of the ALK4:ActRIIB heteromultimers disclosed herein may be administered in combination with one or more of: urocortin II, hormone replacement therapy (e.g., testosterone or human growth hormone), creatine, vitamin D, exercise, diet, and/or strength training.
  • hormone replacement therapy e.g., testosterone or human growth hormone
  • creatine e.g., creatine, vitamin D, exercise, diet, and/or strength training.
  • Pulmonary hypertension (PH) has been previously classified as primary (idiopathic) or secondary.
  • WHO World Health Organization
  • Group 1 pulmonary arterial hypertension (PAH)
  • Group 2 pulmonary hypertension with left heart disease
  • Group 3 pulmonary hypertension with lung disease and/or hypoxemia
  • Group 4 pulmonary hypertension due to chronic thrombotic and/or embolic disease
  • Group 5 miscellaneous conditions (e.g., sarcoidosis,
  • the disclosure relates to methods of treating, preventing, or reducing the progression rate and/or severity of pulmonary hypertension (e.g., treating, preventing, or reducing the progression rate and/or severity of one or more complications of pulmonary hypertension) comprising administering to a patient in need thereof an effective amount of an ALK4:ActRIIB heteromultimer.
  • the method relates to pulmonary hypertension patients that have pulmonary arterial hypertension.
  • the method relates pulmonary hypertension patients that have pulmonary hypertension with left heart disease.
  • the method relates to pulmonary hypertension patients that have lung disease and/or hypoxemia.
  • the method relates to pulmonary hypertension patients that have chronic thrombotic and/or embolic disease. In some embodiments, the method relates to pulmonary hypertension patients that have sarcoidosis, histiocytosis X, or lymphangiomatosis and compression of pulmonary vessels.
  • Pulmonary arterial hypertension is a serious, progressive and life-threatening disease of the pulmonary vasculature, characterized by profound vasoconstriction and an abnormal proliferation of smooth muscle cells in the walls of the pulmonary arteries. Severe constriction of the blood vessels in the lungs leads to very high pulmonary arterial pressures. These high pressures make it difficult for the heart to pump blood through the lungs to be oxygenated. Patients with PAH suffer from extreme shortness of breath as the heart struggles to pump against these high pressures. Patients with PAH typically develop significant increases in pulmonary vascular resistance (PVR) and sustained elevations in pulmonary artery pressure (PAP), which ultimately lead to right ventricular failure and death. Patients diagnosed with PAH have a poor prognosis and equally compromised quality of life, with a mean life expectancy of 2 to 5 years from the time of diagnosis if untreated.
  • PVR pulmonary vascular resistance
  • PAP pulmonary artery pressure
  • pulmonary hypertension occurs primarily by proliferation of arterial endothelial cells and smooth muscle cells of patients with pulmonary hypertension. Overexpression of various cytokines is believed to promote pulmonary hypertension. Further, it has been found that pulmonary hypertension may rise from the hyperproliferation of pulmonary arterial smooth cells and pulmonary endothelial cells. Still further, advanced PAH may be characterized by muscularization of distal pulmonary arterioles, concentric intimal thickening, and obstruction of the vascular lumen by proliferating endothelial cells. Pietra et al., J. Am. Coll. Cardiol., 43 :255-325 (2004).
  • the disclosure relates to methods of treating, preventing, or reducing the progression rate and/or severity of pulmonary hypertension (e.g., treating, preventing, or reducing the progression rate and/or severity of one or more complications of pulmonary hypertension) comprising administering to a patient in need thereof an effective amount an ALK4:ActRIIB heteromultimer, wherein the patient has resting pulmonary arterial pressure (PAP) of at least 25 mm Hg (e.g., 25, 30, 35, 40, 45, or 50 mm Hg).
  • PAP pulmonary arterial pressure
  • the method relates to patients having a resting PAP of at least 25 mm Hg.
  • the method relates to patients having a resting PAP of at least 30 mm Hg.
  • the method relates to patients having a resting PAP of at least 35 mm Hg. In some embodiments, the method relates to patients having a resting PAP of at least 40 mm Hg. In some embodiments, the method relates to patients having a resting PAP of at least 45 mm Hg. In some embodiments, the method relates to patients having a resting PAP of at least 50 mm Hg.
  • the disclosure relates to methods of adjusting one or more hemodynamic parameters in the PH patient toward a more normal level (e.g., normal as compared to healthy people of similar age and sex), comprising administering to a patient in need thereof an effective amount of an ALK4:ActRIIB heteromultimer.
  • a more normal level e.g., normal as compared to healthy people of similar age and sex
  • the method relates to reducing PAP. In some embodiments, the method relates to reducing the patient's PAP by at least 3 mmHg. In certain embodiments, the method relates to reducing the patient's PAP by at least 5 mmHg. In certain embodiments, the method relates to reducing the patient's PAP by at least 7 mmHg. In certain embodiments, the method relates to reducing the patient's PAP by at least 10 mmHg. In certain
  • the method relates to reducing the patient's PAP by at least 12 mmHg. In certain embodiments, the method relates to reducing the patient's PAP by at least 15 mmHg. In certain embodiments, the method relates to reducing the patient's PAP by at least 20 mmHg. In certain embodiments, the method relates to reducing the patient's PAP by at least 25 mmHg. In some embodiments, the method relates to reducing pulmonary vascular resistance (PVR). In some embodiments, the method relate to increasing pulmonary capillary wedge pressure (PCWP). In some embodiments, the method relate to increasing left ventricular end-diastolic pressure (LVEDP).
  • PVR pulmonary vascular resistance
  • PCWP pulmonary capillary wedge pressure
  • LEDP left ventricular end-diastolic pressure
  • the disclosure relates to methods of treating, preventing, or reducing the progression rate and/or severity of one or more complications of pulmonary hypertension comprising administering to a patient in need thereof an effective amount of an ALK4:ActRIIB heteromultimer.
  • the method relates to treating, preventing, or reducing the progression rate and/or severity of cell proliferation in the pulmonary artery of a pulmonary hypertension patient.
  • the method relates to treating, preventing, or reducing the progression rate and/or severity of smooth muscle and/or endothelial cells proliferation in the pulmonary artery of a pulmonary hypertension patient.
  • the method relates to treating, preventing, or reducing the progression rate and/or severity of angiogenesis in the pulmonary artery of a pulmonary hypertension patient. In some embodiments, the method relates to increasing physical activity of a patient having pulmonary hypertension. In some embodiments, the method relates to treating, preventing, or reducing the progression rate and/or severity of dyspnea in a pulmonary hypertension patient. In some embodiments, the method relates to treating, preventing, or reducing the progression rate and/or severity of chest pain in a pulmonary hypertension patient. In some embodiments, the method relates to treating, preventing, or reducing the progression rate and/or severity of fatigue in a pulmonary hypertension patient.
  • the method relates to treating, preventing, or reducing the progression rate and/or severity of pulmonary fibrosis in a pulmonary hypertension patient. In some embodiments, the method relates to treating, preventing, or reducing the progression rate and/or severity of fibrosis in a pulmonary hypertension patient. In some embodiments, the method relates to treating, preventing, or reducing the progression rate and/or severity of pulmonary vascular remodeling in a pulmonary hypertension patient. In some embodiments, the method relates to treating, preventing, or reducing the progression rate and/or severity of right ventricular hypertrophy in a pulmonary hypertension patient.
  • the disclosure relates to methods of increasing exercise capacity in a patient having pulmonary hypertension comprising administering to a patient in need thereof an effective amount of an ALK4:ActRIIB heteromultimer.
  • Any suitable measure of exercise capacity can be used.
  • exercise capacity in a 6-minute walk test (6MWT) which measures how far the subject can walk in 6 minutes, i.e., the 6-minute walk distance (6MWD)
  • 6MWT 6-minute walk test
  • the Borg dyspnea index (BDI) is a numerical scale for assessing perceived dyspnea (breathing discomfort). It measures the degree of breathlessness, for example, after completion of the 6MWT, where a BDI of 0 indicates no breathlessness and 10 indicates maximum breathlessness.
  • the method relates to increasing 6MWD by at least 10 meters in the patient having pulmonary hypertension. In some embodiments, the method relates to increasing 6MWD by at least 20 meters in the patient having pulmonary hypertension. In some embodiments, the method relates to increasing 6MWD by at least 30 meters in the patient having pulmonary hypertension. In some embodiments, the method relates to increasing 6MWD by at least 40 meters in the patient having pulmonary hypertension. In some embodiments, the method relates to increasing 6MWD by at least 50 meters in the patient having pulmonary hypertension. In some embodiments, the method relates to increasing 6MWD by at least 60 meters in the patient having pulmonary hypertension.
  • the method relates to increasing 6MWD by at least 70 meters in the patient having pulmonary hypertension. In some embodiments, the method relates to increasing 6MWD by at least 80 meters in the patient having pulmonary hypertension. In some embodiments, the method relates to increasing 6MWD by at least 90 meters in the patient having pulmonary hypertension. In some embodiments, the method relates to increasing 6MWD by at least 100 meters in the patient having pulmonary hypertension. In some embodiments, the method relate to lowering BDI by at least 0.5 index points in the patient having pulmonary hypertension. In some embodiments, the method relate to lowering BDI by at least 1 index points in the patient having pulmonary
  • the method relate to lowering BDI by at least 1.5 index points in the patient having pulmonary hypertension. In some embodiments, the method relate to lowering BDI by at least 2 index points in the patient having pulmonary hypertension.
  • the method relate to lowering BDI by at least 2.5 index points in the patient having pulmonary hypertension. In some embodiments, the method relate to lowering BDI by at least 3 index points in the patient having pulmonary hypertension.
  • the method relate to lowering BDI by at least 3.5 index points in the patient having pulmonary hypertension. In some embodiments, the method relate to lowering BDI by at least 4 index points in the patient having pulmonary hypertension.
  • the method relate to lowering BDI by at least 4.5 index points in the patient having pulmonary hypertension. In some embodiments, the method relate to lowering BDI by at least 5 index points in the patient having pulmonary hypertension.
  • the method relate to lowering BDI by at least 5.5 index points in the patient having pulmonary hypertension. In some embodiments, the method relate to lowering BDI by at least 6 index points in the patient having pulmonary hypertension.
  • the method relate to lowering BDI by at least 6.5 index points in the patient having pulmonary hypertension. In some embodiments, the method relate to lowering BDI by at least 7 index points in the patient having pulmonary hypertension.
  • the method relate to lowering BDI by at least 7.5 index points in the patient having pulmonary hypertension. In some embodiments, the method relate to lowering BDI by at least 8 index points in the patient having pulmonary hypertension.
  • the method relate to lowering BDI by at least 8.5 index points in the patient having pulmonary hypertension. In some embodiments, the method relate to lowering BDI by at least 9 index points in the patient having pulmonary hypertension.
  • the method relate to lowering BDI by at least 9.5 index points in the patient having pulmonary hypertension. In some embodiments, the method relate to lowering BDI by at least 3 index points in the patient having pulmonary hypertension.
  • the method relate to lowering BDI by 10 index points in the patient having pulmonary hypertension.
  • Pulmonary hypertension at baseline can be mild, moderate or severe, as measured for example by World Health Organization (WHO) functional class, which is a measure of disease severity in patients with pulmonary hypertension.
  • WHO functional classification is an adaptation of the New York Heart Association (NYHA) system and is routinely used to qualitatively assess activity tolerance, for example in monitoring disease progression and response to treatment (Rubin (2004) Chest 126:7-10).
  • Class I pulmonary hypertension without resulting limitation of physical activity; ordinary physical activity does not cause undue dyspnea or fatigue, chest pain or near syncope
  • Class II pulmonary hypertension resulting in slight limitation of physical activity; patient comfortable at rest; ordinary physical activity causes undue dyspnea or fatigue, chest pain or near syncope
  • Class III pulmonary hypertension resulting in marked limitation of physical activity; patient comfortable at rest; less than ordinary activity causes undue dyspnea or fatigue, chest pain or near syncope
  • Class IV pulmonary hypertension resulting in inability to carry out any physical activity without symptoms; patient manifests signs of right-heart failure; dyspnea and/or fatigue may be present even at rest; discomfort is increased by any physical activity.
  • the disclosure relates to methods of treating, preventing, or reducing the progression rate and/or severity of pulmonary hypertension (e.g., treating, preventing, or reducing the progression rate and/or severity of one or more complications of pulmonary hypertension) comprising administering to a patient in need thereof an effective amount of an ALK4:ActRIIB heteromultimer, wherein the patient has Class I, Class II, Class III, or Class IV pulmonary hypertension as recognized by the WHO.
  • the method relates to a patient that has Class I pulmonary hypertension as recognized by the WHO.
  • the method relates to a patient that has Class II pulmonary hypertension as recognized by the WHO.
  • the method relates to preventing or delaying patient progression from Class I pulmonary hypertension to Class II pulmonary hypertension as recognized by the WHO. In some embodiments, the method relates to promoting or increasing patient regression from Class II pulmonary hypertension to Class I pulmonary hypertension as recognized by the WHO. In some embodiments, the method relates to a patient that has Class III pulmonary hypertension as recognized by the WHO. In some embodiments, the method relates to preventing or delaying patient progression from Class II pulmonary hypertension to Class III pulmonary hypertension as recognized by the WHO. In some embodiments, the method relates to promoting or increasing patient regression from Class III pulmonary hypertension to Class II pulmonary hypertension as recognized by the WHO.
  • the method relates to promoting or increasing patient regression from Class III pulmonary hypertension to Class I pulmonary hypertension as recognized by the WHO. In some embodiments, the method relates to a patient that has Class IV pulmonary hypertension as recognized by the WHO. In some embodiments, the method relates to preventing or delaying patient progression from Class III pulmonary hypertension to Class IV pulmonary hypertension as recognized by the WHO. In some embodiments, the method relates to promoting or increasing patient regression from Class IV pulmonary hypertension to Class III pulmonary hypertension as recognized by the WHO. In some embodiments, the method relates to promoting or increasing patient regression from Class IV pulmonary hypertension to Class II pulmonary hypertension as recognized by the WHO. In some embodiments, the method relates to promoting or increasing patient regression from Class IV pulmonary hypertension to Class I pulmonary hypertension as recognized by the WHO.
  • vasodilators such as prostacyclin, epoprostenol, and sildenafil
  • endothelin receptor antagonists such as bosentan
  • calcium channel blockers such as amlodipine, diltiazem, and nifedipine
  • anticoagulants such as warfarin; and diuretics.
  • Treatment of pulmonary hypertension has also been carried out using oxygen therapy, atrial septostomy, pulmonary thromboendarterectomy, and lung and/or heart transplantation.
  • the method relate to treating, preventing, or reducing the progression rate and/or severity of pulmonary hypertension (e.g., treating, preventing, or reducing the progression rate and/or severity of one or more complications of pulmonary hypertension) comprising administering to a patient in need thereof an effective amount of an ALK4:ActRIIB heteromultimer in combination (e.g., administered at the same time or different times, but generally in such a manner as to achieve overlapping
  • vasodilators such as prostacyclin, epoprostenol, and sildenafil
  • endothelin receptor antagonists such as bosentan
  • calcium channel blockers such as amlodipine, diltiazem, and nifedipine
  • anticoagulants such as warfarin; diuretics; oxygen therapy; atrial septostomy; pulmonary thromboendarterectomy: and lung and/or heart transplantation
  • BMP9 polypeptides such as prostacyclin, epoprostenol, and sildenafil
  • endothelin receptor antagonists such as bosentan
  • calcium channel blockers such as amlodipine, diltiazem, and nifedipine
  • anticoagulants such as warfarin; diuretics
  • oxygen therapy oxygen therapy; atrial septostomy; pulmonary thromboendarterectomy: and lung and/or heart transplantation
  • BMP9 polypeptides such as protriptiazem
  • ALK4:ActRIIB heteromultimers of the present disclosure can be administered alone or as a component of a pharmaceutical formulation (also referred to as a therapeutic composition or pharmaceutical composition).
  • a pharmaceutical formation refers to a preparation which is in such form as to permit the biological activity of an active ingredient (e.g., an agent of the present disclosure) contained therein to be effective and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered.
  • the subject compounds may be formulated for administration in any convenient way for use in human or veterinary medicine.
  • one or more agents of the present disclosure may be formulated with a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is generally nontoxic to a subject.
  • a pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, and/or preservative.
  • pharmaceutical formulations for use in the present disclosure are in a pyrogen-free, physiologically-acceptable form when administered to a subject.
  • Therapeutically useful agents other than those described herein, which may optionally be included in the formulation as described above, may be
  • compositions will be administered parenterally [e.g., by intravenous (IV.) injection, intraarterial injection, intraosseous injection, intramuscular injection, intrathecal injection, subcutaneous injection, or intradermal injection].
  • IV. intravenous
  • intraarterial injection intraarterial injection
  • intraosseous injection intramuscular injection
  • intrathecal injection subcutaneous injection, or intradermal injection.
  • compositions suitable for parenteral administration may comprise one or more agents of the disclosure in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use.
  • injectable solutions or dispersions may contain antioxidants, buffers, bacteriostats, suspending agents, thickening agents, or solutes which render the formulation isotonic with the blood of the intended recipient.
  • aqueous and nonaqueous carriers examples include water, ethanol, polyols (e.g., glycerol, propylene glycol, polyethylene glycol, etc.), vegetable oils (e.g., olive oil), injectable organic esters (e.g., ethyl oleate), and suitable mixtures thereof.
  • polyols e.g., glycerol, propylene glycol, polyethylene glycol, etc.
  • vegetable oils e.g., olive oil
  • injectable organic esters e.g., ethyl oleate
  • suitable mixtures thereof Proper fluidity can be maintained, for example, by the use of coating materials (e.g., lecithin), by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • a therapeutic method of the present disclosure includes administering the pharmaceutical composition systemically, or locally, from an implant or device. Further, the pharmaceutical composition may be encapsulated or injected in a form for delivery to a target tissue site (e.g., bone marrow or muscle).
  • compositions of the present disclosure may include a matrix capable of delivering one or more of the agents of the present disclosure to a target tissue site (e.g., bone marrow or muscle), providing a structure for the developing tissue and optimally capable of being resorbed into the body. For example, the matrix may provide slow release of one or more agents of the present disclosure.
  • Such matrices may be formed of materials presently in use for other implanted medical applications.
  • the choice of matrix material may be based on one or more of: biocompatibility, biodegradability, mechanical properties, cosmetic appearance, and interface properties.
  • Potential matrices for the compositions may be biodegradable and chemically defined calcium sulfate, tricalciumphosphate, hydroxyapatite, polylactic acid, and polyanhydrides.
  • Other potential materials are biodegradable and biologically well-defined including, for example, bone or dermal collagen.
  • Further matrices are comprised of pure proteins or extracellular matrix components.
  • Other potential matrices are non-biodegradable and chemically defined including, for example, sintered hydroxyapatite, bioglass, aluminates, or other ceramics.
  • Matrices may be comprised of combinations of any of the above mentioned types of material including, for example, polylactic acid and hydroxyapatite or collagen and tricalciumphosphate.
  • the bioceramics may be altered in composition (e.g., calcium - aluminate-phosphate) and processing to alter one or more of pore size, particle size, particle shape, and biodegradability.
  • compositions of present disclosure can be administered topically.
  • Topical application or “topically” means contact of the
  • topical pharmaceutical compositions with body surfaces including, for example, the skin, wound sites, and mucous membranes.
  • the topical pharmaceutical compositions can have various application forms and typically comprises a drug-containing layer, which is adapted to be placed near to or in direct contact with the tissue upon topically administering the
  • compositions suitable for topical administration may comprise one or more one or more ALK4: ActRIIB heteromultimers of the disclosure in combination formulated as a liquid, a gel, a cream, a lotion, an ointment, a foam, a paste, a putty, a semisolid, or a solid.
  • Compositions in the liquid, gel, cream, lotion, ointment, foam, paste, or putty form can be applied by spreading, spraying, smearing, dabbing or rolling the composition on the target tissue.
  • the compositions also may be impregnated into sterile dressings, transdermal patches, plasters, and bandages.
  • Compositions of the putty, semi-solid or solid forms may be deformable. They may be elastic or non-elastic (e.g., flexible or rigid).
  • the composition forms part of a composite and can include fibers, particulates, or multiple layers with the same or different compositions.
  • Topical compositions in the liquid form may include pharmaceutically acceptable solutions, emulsions, microemulsions, and suspensions.
  • pharmaceutically acceptable solutions emulsions, microemulsions, and suspensions.
  • the liquid dosage form may contain an inert diluent commonly used in the art including, for example, water or other solvent, a solubilizing agent and/or emulsifier [e.g., ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, or 1,3-butylene glycol, an oil (e.g., cottonseed, groundnut, corn, germ, olive, castor, and sesame oil), glycerol, tetrahydrofuryl alcohol, a polyethylene glycol, a fatty acid ester of sorbitan, and mixtures thereof].
  • an inert diluent commonly used in the art including, for example, water or other solvent, a solubilizing agent and/or emulsifier [e.g., ethyl alcohol, isopropyl alcohol, ethyl carbonate, e
  • Topical gel, cream, lotion, ointment, semi-solid or solid compositions may include one or more thickening agents, such as a polysaccharide, synthetic polymer or protein-based polymer.
  • the gelling agent herein is one that is suitably nontoxic and gives the desired viscosity.
  • the thickening agents may include polymers, copolymers, and monomers of: vinylpyrrolidones, methacrylamides, acrylamides N- vinylimidazoles, carboxy vinyls, vinyl esters, vinyl ethers, silicones, polyethyleneoxides, polyethyleneglycols, vinylalcohols, sodium acrylates, acrylates, maleic acids, N- dimethylacrylamides, diacetone acrylamides, acrylamides, acryloyl morpholine, pluronic, collagens, polyacrylamides, polyacrylates, polyvinyl alcohols, polyvinyl enes, polyvinyl silicates, polyacrylates substituted with a sugar (e.g., sucrose, glucose, glucosamines, galactose, trehalose, mannose, or lactose), acylamidopropane sulfonic acids,
  • a sugar e.g., sucrose, glucose, glucosamines, galacto
  • tetramethoxyorthosilicates methyltrimethoxyorthosilicates, tetraalkoxyorthosilicates, trialkoxyorthosilicates, glycols, propylene glycol, glycerine, polysaccharides, alginates, dextrans, cyclodextrin, celluloses, modified celluloses, oxidized celluloses, chitosans, chitins, guars, carrageenans, hyaluronic acids, inulin, starches, modified starches, agarose,
  • methylcelluloses methylcelluloses, plant gums, hylaronans, hydrogels, gelatins, glycosaminoglycans, carboxymethyl celluloses, hydroxyethyl celluloses, hydroxy propyl methyl celluloses, pectins, low-methoxy pectins, cross-linked dextrans, starch-acrylonitrile graft copolymers, starch sodium polyacrylate, hydroxyethyl methacrylates, hydroxyl ethyl acrylates, polyvinylene, polyethylvinylethers, polymethyl methacrylates, polystyrenes, polyurethanes, polyalkanoates, polylactic acids, polylactates, poly(3-hydroxybutyrate), sulfonated hydrogels, AMPS (2- acrylamido-2-methyl-l-propanesulfonic acid), SEM (sulfoethylmethacrylate), SPM
  • compositions of present disclosure can be administered orally, for example, in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis such as sucrose and acacia or tragacanth), powders, granules, a solution or a suspension in an aqueous or non-aqueous liquid, an oil-in-water or water-in-oil liquid emulsion, or an elixir or syrup, or pastille (using an inert base, such as gelatin and glycerin, or sucrose and acacia), and/or a mouth wash, each containing a predetermined amount of a compound of the present disclosure and optionally one or more other active ingredients.
  • a compound of the present disclosure and optionally one or more other active ingredients may also be administered as a bolus, electuary, or paste.
  • one or more compounds of the present disclosure may be mixed with one or more pharmaceutically acceptable carriers including, for example, sodium citrate, dicalcium phosphate, a filler or extender (e.g., a starch, lactose, sucrose, glucose, mannitol, and silicic acid), a binder (e.g.
  • carboxymethylcellulose an alginate, gelatin, polyvinyl pyrrolidone, sucrose, and acacia
  • a humectant e.g., glycerol
  • a disintegrating agent e.g., agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, a silicate, and sodium carbonate
  • a solution retarding agent e.g. paraffin
  • an absorption accelerator e.g.
  • the pharmaceutical formulation may also comprise a buffering agent.
  • a wetting agent e.g., cetyl alcohol and glycerol monostearate
  • an absorbent e.g., kaolin and bentonite clay
  • a lubricant e.g., a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate
  • a coloring agent e.g., a quaternary ammonium compound
  • a wetting agent e.g., cetyl alcohol and glycerol monostearate
  • an absorbent e.g., kaolin and bentonite clay
  • a lubricant e.g., a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate
  • a coloring agent e.g., a coloring agent, and mixtures thereof.
  • the pharmaceutical formulation may also comprise
  • Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using one or more excipients including, e.g., lactose or a milk sugar as well as a high molecular-weight polyethylene glycol.
  • Liquid dosage forms for oral administration of the pharmaceutical composition may include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs.
  • the liquid dosage form may contain an inert diluent commonly used in the art including, for example, water or other solvent, a solubilizing agent and/or emulsifier [e.g., ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, or 1,3-butylene glycol, an oil (e.g., cottonseed, groundnut, corn, germ, olive, castor, and sesame oil), glycerol, tetrahydrofuryl alcohol, a polyethylene glycol, a fatty acid ester of sorbitan, and mixtures thereof].
  • a solubilizing agent and/or emulsifier e.g., ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene
  • the oral formulation can also include an adjuvant including, for example, a wetting agent, an emulsifying and suspending agent, a sweetening agent, a flavoring agent, a coloring agent, a perfuming agent, a preservative agent, and combinations thereof.
  • an adjuvant including, for example, a wetting agent, an emulsifying and suspending agent, a sweetening agent, a flavoring agent, a coloring agent, a perfuming agent, a preservative agent, and combinations thereof.
  • Suspensions in addition to the active compounds, may contain suspending agents including, for example, an ethoxylated isostearyl alcohol, polyoxyethylene sorbitol, a sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, tragacanth, and combinations thereof.
  • suspending agents including, for example, an ethoxylated isostearyl alcohol, polyoxyethylene sorbitol, a sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, tragacanth, and combinations thereof.
  • antibacterial and antifungal agents including, for example, paraben, chlorobutanol, and phenol sorbic acid.
  • an isotonic agent including, for example, a sugar or sodium chloride into the compositions.
  • prolonged absorption of an injectable pharmaceutical form may be brought about by the inclusion of an agent that delay absorption including, for example, aluminum monostearate and gelatin.
  • the dosage regimen will be determined by the attending physician considering various factors which modify the action of the one or more of the agents of the present disclosure.
  • various factors may include, but are not limited to, the patient's red blood cell count, hemoglobin level, the desired target red blood cell count, the patient's age, the patient's sex, the patient's diet, the severity of any disease that may be contributing to a depressed red blood cell level, the time of administration, and other clinical factors.
  • the addition of other known active agents to the final composition may also affect the dosage. Progress can be monitored by periodic assessment of one or more of red blood cell levels, hemoglobin levels, reticulocyte levels, and other indicators of the hematopoietic process.
  • the present disclosure also provides gene therapy for the in vivo production of one or more of the agents of the present disclosure.
  • Such therapy would achieve its therapeutic effect by introduction of the agent sequences into cells or tissues having one or more of the disorders as listed above.
  • Delivery of the agent sequences can be achieved, for example, by using a recombinant expression vector such as a chimeric virus or a colloidal dispersion system.
  • Preferred therapeutic delivery of one or more of agent sequences of the disclosure is the use of targeted liposomes.
  • Various viral vectors which can be utilized for gene therapy as taught herein include adenovirus, herpes virus, vaccinia, or an RNA virus ⁇ e.g., a retrovirus).
  • the retroviral vector may be a derivative of a murine or avian retrovirus.
  • retroviral vectors in which a single foreign gene can be inserted include, but are not limited to: Moloney murine leukemia virus (MoMuLV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), and Rous Sarcoma Virus (RSV).
  • MoMuLV Moloney murine leukemia virus
  • HaMuSV Harvey murine sarcoma virus
  • MuMTV murine mammary tumor virus
  • RSV Rous Sarcoma Virus
  • a number of additional retroviral vectors can incorporate multiple genes. All of these vectors can transfer or incorporate a gene for a selectable marker so that transduced cells can be identified and generated.
  • Retroviral vectors can be made target-specific by attaching, for example, a sugar, a glycolipid, or a protein. Preferred targeting is accomplished by using an antibody. Those of skill in the art will recognize that specific polynucleotide sequences can be inserted into the retroviral genome or attached to a viral envelope to allow target specific delivery of the retroviral vector containing one or more of the agents of the present disclosure.
  • tissue culture cells can be directly transfected with plasmids encoding the retroviral structural genes (gag, pol, and env), by conventional calcium phosphate transfection. These cells are then transfected with the vector plasmid containing the genes of interest. The resulting cells release the retroviral vector into the culture medium.
  • colloidal dispersion system Another targeted delivery system for one or more of the agents of the present disclosure is a colloidal dispersion system.
  • Colloidal dispersion systems include, for example, macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • the preferred colloidal system of this disclosure is a liposome.
  • Liposomes are artificial membrane vesicles which are useful as delivery vehicles in vitro and in vivo. RNA, DNA, and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form [Fraley, et al. (1981) Trends Biochem. Sci., 6:77].
  • the composition of the liposome is usually a combination of phospholipids, which may include a steroid ⁇ e.g. cholesterol).
  • phospholipids which may include a steroid ⁇ e.g. cholesterol.
  • the physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.
  • Other phospholipids or other lipids may also be used including, for example a phosphatidyl compound ⁇ e.g.,
  • phosphatidylglycerol phosphatidylcholine
  • phosphatidylserine phosphatidylethanolamine
  • a sphingolipid a cerebroside, and a ganglioside
  • egg phosphatidylcholine egg phosphatidylcholine
  • the targeting of liposomes is also possible based on, for example, organ-specificity, cell-specificity, and organelle-specificity and is known in the art.
  • Example 1 Generation of an ALK4:ActRIIB heterodimer Soluble ALK4-Fc: ActRIIB-Fc heteromeric complexes comprising the extracellular domains of human ActRIIB and human ALK4, which are each separately fused to an Fc domain with a linker positioned between the extracellular domain and the Fc domain, were constructed.
  • the individual constructs are referred to as ActRIIB-Fc fusion polypeptide and ALK4-FC fusion polypeptide, respectively, and the sequences for each are provided below.
  • a methodology for promoting formation of ALK4-Fc is to introduce alterations in the amino acid sequence of the Fc domains to guide the formation of asymmetric heteromeric complexes.
  • Many different approaches to making asymmetric interaction pairs using Fc domains are described in this disclosure.
  • ActRIIB-Fc and ALK4-Fc polypeptide sequences of SEQ ID NOs: 39-41 and 42-44 respectively, one Fc domain is altered to introduce cationic amino acids at the interaction face, while the other Fc domain is altered to introduce anionic amino acids at the interaction face.
  • ActRIIB-Fc fusion polypeptide and ALK4-Fc fusion polypeptide each employ the tissue plasminogen activator (TP A) leader:
  • MDAMKRGLCCVLLLCGAVFVS P SEQ I D NO : 38 .
  • the ActRIIB-Fc polypeptide sequence (SEQ ID NO: 39) is shown below:
  • the leader (signal) sequence and linker are underlined.
  • ALK4-Fc ActRIIB-Fc heterodimer rather than either of the possible homodimeric complexes
  • two amino acid substitutions can be introduced into the Fc domain of the ActRIIB fusion protein as indicated by double underline above.
  • the amino acid sequence of SEQ ID NO: 39 may optionally be provided with lysine (K) removed from the C-terminus.
  • This ActRIIB-Fc fusion protein is encoded by the following nucleic acid sequence (SEQ ID NO: 40):
  • the mature ActRIIB-Fc fusion polypeptide (SEQ ID NO: 41) is as follows, and may optionally be provided with lysine (K) removed from the C-terminus.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Neurology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Neurosurgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • General Engineering & Computer Science (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Hospice & Palliative Care (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Psychiatry (AREA)
  • Biophysics (AREA)
  • Child & Adolescent Psychology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2017/055426 2016-10-05 2017-10-05 Alk4:actriib heteromultimers and uses thereof Ceased WO2018067879A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP17859224.2A EP3522913A4 (en) 2016-10-05 2017-10-05 ALK4 HETEROMULTIMERS: ACTRIIB AND THEIR USES
CA3039573A CA3039573A1 (en) 2016-10-05 2017-10-05 Alk4:actriib heteromultimers and uses thereof
AU2017338921A AU2017338921A1 (en) 2016-10-05 2017-10-05 ALK4:ActRIIB heteromultimers and uses thereof
CN201780075170.8A CN110678195A (zh) 2016-10-05 2017-10-05 ALK4:ActRIIB异多聚体及其用途
KR1020197012900A KR20190075078A (ko) 2016-10-05 2017-10-05 ALK4:ActRIIB 이형다량체 및 이의 용도
BR112019006993A BR112019006993A2 (pt) 2016-10-05 2017-10-05 heteromultímeros de alk4:actriib e usos dos mesmos
JP2019518299A JP7219705B2 (ja) 2016-10-05 2017-10-05 ALK4:ActRIIBヘテロ多量体およびその使用
JP2022157844A JP2022177286A (ja) 2016-10-05 2022-09-30 ALK4:ActRIIBヘテロ多量体およびその使用

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201662404727P 2016-10-05 2016-10-05
US62/404,727 2016-10-05
US201762510417P 2017-05-24 2017-05-24
US62/510,417 2017-05-24

Publications (1)

Publication Number Publication Date
WO2018067879A1 true WO2018067879A1 (en) 2018-04-12

Family

ID=61831282

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/055426 Ceased WO2018067879A1 (en) 2016-10-05 2017-10-05 Alk4:actriib heteromultimers and uses thereof

Country Status (11)

Country Link
US (3) US10934532B2 (https=)
EP (1) EP3522913A4 (https=)
JP (2) JP7219705B2 (https=)
KR (1) KR20190075078A (https=)
CN (1) CN110678195A (https=)
AU (1) AU2017338921A1 (https=)
BR (1) BR112019006993A2 (https=)
CA (1) CA3039573A1 (https=)
MA (1) MA46472A (https=)
TW (1) TW201813978A (https=)
WO (1) WO2018067879A1 (https=)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019213446A1 (en) * 2018-05-03 2019-11-07 Acceleron Pharma Inc. NOVEL BINDERS OF TGFβ-SUPERFAMILY LIGANDS AND USES THEREOF
CN111269943A (zh) * 2019-08-10 2020-06-12 湖南文理学院 一种通过基因敲除技术增加斑马鱼生长速度的方法
WO2021183819A1 (en) * 2020-03-13 2021-09-16 Acceleron Pharma Inc. Single-arm actriia and actriib heteromultimers and methods for treating renal diseases or conditions
WO2021257655A1 (en) * 2020-06-17 2021-12-23 Acceleron Pharma Inc. Actrii-alk4 antagonists and methods of treating heart failure
WO2022192420A3 (en) * 2021-03-10 2022-10-13 Acceleron Pharma Inc. Actrii proteins and uses thereof
WO2023108137A1 (en) * 2021-12-10 2023-06-15 Biogen Ma Inc. Modified actriib proteins and methods of use thereof
WO2024238950A1 (en) * 2023-05-18 2024-11-21 Keros Therapeutics, Inc. Methods of using activin receptor type ii variants
US12440539B2 (en) 2020-03-20 2025-10-14 Keros Therapeutics, Inc. Methods of using activin receptor type IIB variants
US12522646B2 (en) 2020-03-20 2026-01-13 Keros Therapeutics, Inc. Activin receptor type II chimeras and methods of use thereof

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107849114B (zh) 2015-04-06 2021-08-20 阿塞勒隆制药公司 单臂i型和ii型受体融合蛋白和其用途
MA41919A (fr) 2015-04-06 2018-02-13 Acceleron Pharma Inc Hétéromultimères alk4:actriib et leurs utilisations
US10227392B2 (en) 2015-04-06 2019-03-12 Acceleron Pharma Inc. ALK7:ActRIIB heteromultimers and uses thereof
WO2017177013A1 (en) 2016-04-06 2017-10-12 Acceleron Pharma Inc. Alk7 antagonists and uses thereof
BR112019006993A2 (pt) 2016-10-05 2019-09-03 Acceleron Pharma Inc heteromultímeros de alk4:actriib e usos dos mesmos
US11440949B2 (en) 2016-10-05 2022-09-13 Acceleron Pharma Inc. TGF-beta superfamily type I and type II receptor heteromultimers and uses thereof
JP7280182B2 (ja) 2016-10-05 2023-05-23 アクセルロン ファーマ インコーポレイテッド バリアントActRIIBタンパク質およびその使用
EP4073101A4 (en) * 2019-12-10 2024-01-10 Acceleron Pharma Inc. SINGLE-ARM ACTRIIA AND ACTRIIB HETEROMULTIMERS AND METHOD FOR TREATING PULMONARY HYPERTENSION
EP4100431A4 (en) * 2020-02-03 2024-10-16 Acceleron Pharma Inc. Variant actriib proteins and uses thereof
US20220288226A1 (en) * 2020-08-27 2022-09-15 Enosi Life Sciences Corp. Methods and compositions to treat autoimmune diseases and cancer
US20250064952A1 (en) * 2021-03-10 2025-02-27 Acceleron Pharma Inc. Actrii-alk4 antagonists and methods of treating heart failure
JP2024511315A (ja) * 2021-03-10 2024-03-13 アクセルロン ファーマ インコーポレイテッド Actrii-alk4アンタゴニスト及び心不全の治療方法
WO2025183964A1 (en) * 2024-02-27 2025-09-04 Alivegen Usa, Inc Methods of treating myostatin-related or activin a-related disorders using novel hybrid actriib ligand trap proteins

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008097541A2 (en) * 2007-02-02 2008-08-14 Acceleron Pharma Inc. Variants derived from actriib and uses therefor
US20130171095A1 (en) * 2011-10-10 2013-07-04 Xencor, Inc. Method for Purifying Antibodies
WO2016164497A1 (en) * 2015-04-06 2016-10-13 Acceleron Pharma Inc. Alk4:actriib heteromultimers and uses thereof
US20170240639A1 (en) * 2016-02-22 2017-08-24 Acceleron Pharma Inc. Actrii antagonists for use in increasing immune activity

Family Cites Families (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0368684B2 (en) 1988-11-11 2004-09-29 Medical Research Council Cloning immunoglobulin variable domain sequences.
US5932448A (en) 1991-11-29 1999-08-03 Protein Design Labs., Inc. Bispecific antibody heterodimers
US7592428B1 (en) 1992-11-17 2009-09-22 Ludwig Institute For Cancer Research Antibodies which bind specifically to activin receptor like kinases
KR950704485A (ko) 1992-11-17 1995-11-20 로이드 제이. 오울드·에드워드 에이, 맥더모 2세 액티빈 리셉터-유사 키나제, 세린 트레오닌 키나제 도메인을 갖는 단백질 및 이들의 용도(activin receptor-like kinases, proteins having serine threonine kinase domains and their use)
US5731168A (en) 1995-03-01 1998-03-24 Genentech, Inc. Method for making heteromultimeric polypeptides
US20020062010A1 (en) 1997-05-02 2002-05-23 Genentech, Inc. Method for making multispecific antibodies having heteromultimeric and common components
US6927044B2 (en) 1998-09-25 2005-08-09 Regeneron Pharmaceuticals, Inc. IL-1 receptor based cytokine traps
AU772694B2 (en) 1999-01-21 2004-05-06 Metamorphix International, Inc. Growth differentiation factor inhibitors and uses therefor
GB0209896D0 (en) * 2002-04-30 2002-06-05 Molmed Spa Conjugate
US20040223966A1 (en) 2002-10-25 2004-11-11 Wolfman Neil M. ActRIIB fusion polypeptides and uses therefor
CA2539116C (en) 2003-09-15 2014-11-18 Research Development Foundation Cripto antagonism of activin and tgf-b signaling
US7833971B2 (en) 2006-12-08 2010-11-16 Acceleron Pharma Inc. Uses of cerberus, coco and derivatives thereof
EP1771470B1 (en) 2004-07-23 2013-06-26 Acceleron Pharma Inc. Actrii receptor polypeptides, methods and compositions
KR20190006086A (ko) 2005-11-23 2019-01-16 악셀레론 파마 인코포레이티드 액티빈-actrⅱa 길항제 및 골 성장을 촉진하기 위한 이들의 용도
WO2007147901A1 (en) 2006-06-22 2007-12-27 Novo Nordisk A/S Production of bispecific antibodies
EP2108017A2 (en) 2007-01-30 2009-10-14 Biogen Idec MA, Inc. Imidazolone compounds as tgf-beta family type i receptors, alk5 and/or alk4 antagonists
TWI573802B (zh) 2007-03-06 2017-03-11 安美基公司 變異之活動素受體多肽及其用途
ES2449753T3 (es) 2007-03-19 2014-03-21 National Research Council Of Canada Proteínas de fusión que comprenden dos dominios de unión tgf-beta
ES2563027T3 (es) 2008-01-07 2016-03-10 Amgen Inc. Método para fabricación de moléculas heterodímeras Fc de anticuerpos utilizando efectos de conducción electrostática
SMT202300222T1 (it) 2008-08-14 2023-09-06 Acceleron Pharma Inc Trappole di gdf
US8216997B2 (en) 2008-08-14 2012-07-10 Acceleron Pharma, Inc. Methods for increasing red blood cell levels and treating anemia using a combination of GDF traps and erythropoietin receptor activators
EP2326670A4 (en) 2008-09-17 2014-04-16 Nat Res Council Canada HETERO MULTIVALENT BINDING AGENT FOR ELEMENTS OF THE TGF-BETA SUPERFAMILY
SG10201703067QA (en) 2008-11-26 2017-05-30 Amgen Inc Variants Of Activin IIB Receptor Polypeptides And Uses Thereof
US8138142B2 (en) 2009-01-13 2012-03-20 Acceleron Pharma Inc. Methods for increasing adiponectin in a patient in need thereof
EP2440577A4 (en) 2009-06-12 2013-01-23 Acceleron Pharma Inc SHORTEN ACTRIIB FC FUSION PROTEINS
KR20120108967A (ko) 2009-09-16 2012-10-05 제넨테크, 인크. 코일드 코일 및/또는 테더 함유 단백질 복합체 및 그의 용도
FR2951408B1 (fr) 2009-10-15 2012-01-13 Renault Sa Cadre moteur pour moteur electrique de vehicule automobile
US8999343B2 (en) 2010-08-16 2015-04-07 Amgen Inc. Antibodies that bind myostatin, compositions and methods
WO2012088302A2 (en) 2010-12-22 2012-06-28 Abbott Laboratories Half immunoglobulin binding proteins and uses thereof
CN102850458B (zh) 2011-06-28 2014-10-01 华博生物医药技术(上海)有限公司 新型重组双功能融合蛋白及其制法和用途
WO2013055809A1 (en) 2011-10-10 2013-04-18 Xencor, Inc. A method for purifying antibodies
PL2831105T3 (pl) 2012-03-28 2018-01-31 Univ Texas Fuzje receptora tgf typu ii - typu iii
JP6631865B2 (ja) 2014-08-11 2020-01-15 日本化薬株式会社 TGFβ阻害機能を持つキメラタンパク質
WO2016090035A2 (en) 2014-12-02 2016-06-09 La Jolla Institute For Allergy And Immunology Modulators of activin and methods for modulating immune responses and t follicular helper cells
AU2016238254B2 (en) * 2015-03-26 2022-05-05 Acceleron Pharma Inc. Follistatin-related fusion proteins and uses thereof
CN107849114B (zh) 2015-04-06 2021-08-20 阿塞勒隆制药公司 单臂i型和ii型受体融合蛋白和其用途
US10227392B2 (en) 2015-04-06 2019-03-12 Acceleron Pharma Inc. ALK7:ActRIIB heteromultimers and uses thereof
PT3286206T (pt) 2015-04-22 2021-04-01 Biogen Ma Inc Novas proteínas híbridas bloqueadoras de ligando actriib para tratar doenças de desgaste muscular
WO2016205370A1 (en) 2015-06-15 2016-12-22 Santa Maria Biotherapeutics, Inc. Methods of using activin receptor iib-based proteins
US20200231652A1 (en) 2015-08-31 2020-07-23 National Research Council Of Canada Tgf-b-receptor ectodomain fusion molecules and uses thereof
WO2017177013A1 (en) 2016-04-06 2017-10-12 Acceleron Pharma Inc. Alk7 antagonists and uses thereof
AU2017293778B2 (en) 2016-07-07 2022-03-24 Acceleron Pharma Inc. TGF-beta superfamily heteromultimers and uses thereof
WO2018009732A1 (en) 2016-07-08 2018-01-11 Regeneron Pharmaceuticals, Inc. Anti-activin a antibodies and methods of use thereof for treating pulmonary arterial hypertension
BR112019006993A2 (pt) 2016-10-05 2019-09-03 Acceleron Pharma Inc heteromultímeros de alk4:actriib e usos dos mesmos
JOP20190085A1 (ar) 2016-10-20 2019-04-17 Biogen Ma Inc طرق علاج الضمور العضلي ومرض العظام باستخدام بروتينات احتجاز مركب ترابطي actriib هجين حديثة

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008097541A2 (en) * 2007-02-02 2008-08-14 Acceleron Pharma Inc. Variants derived from actriib and uses therefor
US20130171095A1 (en) * 2011-10-10 2013-07-04 Xencor, Inc. Method for Purifying Antibodies
WO2016164497A1 (en) * 2015-04-06 2016-10-13 Acceleron Pharma Inc. Alk4:actriib heteromultimers and uses thereof
US20170240639A1 (en) * 2016-02-22 2017-08-24 Acceleron Pharma Inc. Actrii antagonists for use in increasing immune activity

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
RECOMBINANT HUMAN ACTIVIN A RECEPTOR, TYPE 1B (ACVR1B), GIBCO, 16 June 2011 (2011-06-16), Retrieved from the Internet <URL:https://assets.thermofisher.com/TFS-Assets/LSG/manuals/RecHuActivinR1b_man.pdfdownloaded> [retrieved on 20171106] *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019213446A1 (en) * 2018-05-03 2019-11-07 Acceleron Pharma Inc. NOVEL BINDERS OF TGFβ-SUPERFAMILY LIGANDS AND USES THEREOF
US12168683B2 (en) 2018-05-03 2024-12-17 Acceleron Pharma Inc. Binders of TGFβ-superfamily ligands and uses thereof
CN111269943A (zh) * 2019-08-10 2020-06-12 湖南文理学院 一种通过基因敲除技术增加斑马鱼生长速度的方法
WO2021183819A1 (en) * 2020-03-13 2021-09-16 Acceleron Pharma Inc. Single-arm actriia and actriib heteromultimers and methods for treating renal diseases or conditions
US12440539B2 (en) 2020-03-20 2025-10-14 Keros Therapeutics, Inc. Methods of using activin receptor type IIB variants
US12522646B2 (en) 2020-03-20 2026-01-13 Keros Therapeutics, Inc. Activin receptor type II chimeras and methods of use thereof
WO2021257655A1 (en) * 2020-06-17 2021-12-23 Acceleron Pharma Inc. Actrii-alk4 antagonists and methods of treating heart failure
WO2022192420A3 (en) * 2021-03-10 2022-10-13 Acceleron Pharma Inc. Actrii proteins and uses thereof
WO2023108137A1 (en) * 2021-12-10 2023-06-15 Biogen Ma Inc. Modified actriib proteins and methods of use thereof
WO2024238950A1 (en) * 2023-05-18 2024-11-21 Keros Therapeutics, Inc. Methods of using activin receptor type ii variants

Also Published As

Publication number Publication date
US10934532B2 (en) 2021-03-02
JP2022177286A (ja) 2022-11-30
CN110678195A (zh) 2020-01-10
CA3039573A1 (en) 2018-04-12
US20250084388A1 (en) 2025-03-13
EP3522913A4 (en) 2020-10-28
MA46472A (fr) 2019-08-14
JP7219705B2 (ja) 2023-02-08
US20180163187A1 (en) 2018-06-14
JP2019536438A (ja) 2019-12-19
TW201813978A (zh) 2018-04-16
KR20190075078A (ko) 2019-06-28
EP3522913A1 (en) 2019-08-14
US20210363502A1 (en) 2021-11-25
US12054753B2 (en) 2024-08-06
AU2017338921A1 (en) 2019-04-18
BR112019006993A2 (pt) 2019-09-03

Similar Documents

Publication Publication Date Title
US20250084388A1 (en) Alk4:actriib heteromultimers and uses thereof
US11827689B2 (en) ALK7:ActRIIB heteromultimers and uses thereof
US20250197469A1 (en) Alk4:actriib heteromultimers and uses thereof
US12024563B2 (en) ALK7 antagonists and uses thereof
AU2016246602A1 (en) Single-arm type I and type II receptor fusion proteins and uses thereof
EP3606562A1 (en) Compositions and methods for treating spinal muscular atrophy
WO2018067873A2 (en) Tgf-beta superfamily type i and type ii receptor heteromultimers and uses thereof
US20230183319A1 (en) Variant actriib proteins and uses thereof
EP4100430A1 (en) Compositions and methods for treating pulmonary hypertension
EA040176B1 (ru) Гетеромультимеры alk4:actriib и их использование

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17859224

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3039573

Country of ref document: CA

Ref document number: 2019518299

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019006993

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2017338921

Country of ref document: AU

Date of ref document: 20171005

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20197012900

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2017859224

Country of ref document: EP

Effective date: 20190506

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112019006993

Country of ref document: BR

Free format text: APRESENTAR O RELATORIO DESCRITIVO.

REG Reference to national code

Ref country code: BR

Ref legal event code: B01Y

Ref document number: 112019006993

Country of ref document: BR

Kind code of ref document: A2

Free format text: ANULADA A PUBLICACAO CODIGO 1.5 NA RPI NO 2529 DE 25/06/2019 POR TER SIDO INDEVIDA.

ENP Entry into the national phase

Ref document number: 112019006993

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190405