WO2018050828A1 - Methods for performing multiplexed real-time pcr - Google Patents

Methods for performing multiplexed real-time pcr Download PDF

Info

Publication number
WO2018050828A1
WO2018050828A1 PCT/EP2017/073293 EP2017073293W WO2018050828A1 WO 2018050828 A1 WO2018050828 A1 WO 2018050828A1 EP 2017073293 W EP2017073293 W EP 2017073293W WO 2018050828 A1 WO2018050828 A1 WO 2018050828A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
oligonucleotide
tag portion
quenching
moiety
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2017/073293
Other languages
English (en)
French (fr)
Inventor
Igor Kozlov
Amar Gupta
Randall Saiki
Alison Tsan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
F Hoffmann La Roche AG
Roche Diagnostics GmbH
Roche Molecular Systems Inc
Original Assignee
F Hoffmann La Roche AG
Roche Diagnostics GmbH
Roche Molecular Systems Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=59901522&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2018050828(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by F Hoffmann La Roche AG, Roche Diagnostics GmbH, Roche Molecular Systems Inc filed Critical F Hoffmann La Roche AG
Priority to CN201780056666.0A priority Critical patent/CN109689884A/zh
Priority to KR1020197007697A priority patent/KR102468633B1/ko
Priority to ES17768768T priority patent/ES2933176T3/es
Priority to EP17768768.8A priority patent/EP3512960B1/en
Priority to JP2019514212A priority patent/JP7063886B2/ja
Priority to CA3033250A priority patent/CA3033250C/en
Priority to AU2017328617A priority patent/AU2017328617B2/en
Publication of WO2018050828A1 publication Critical patent/WO2018050828A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6804Nucleic acid analysis using immunogens
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6811Selection methods for production or design of target specific oligonucleotides or binding molecules
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/6818Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/6823Release of bound markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10Modifications characterised by
    • C12Q2525/161Modifications characterised by incorporating target specific and non-target specific sites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00Reactions demanding special reaction conditions
    • C12Q2527/107Temperature of melting, i.e. Tm
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00Reactions of nucleic acids characterised by
    • C12Q2531/10Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/113PCR
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00Nucleic acid detection characterised by assay method
    • C12Q2561/113Real time assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/10Detection mode being characterised by the assay principle
    • C12Q2565/101Interaction between at least two labels
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Definitions

  • the present invention relates to methods for polymerase chain reaction (PCR) particularly to methods for performing multiplexed real-time PCR.
  • PCR polymerase chain reaction
  • PCR polymerase chain reaction
  • a "real-time" PCR assay is able to simultaneously amplify and detect and quantify the starting amount of the target sequence.
  • the basic TaqMan real-time PCR assay using the 5'-to-3' nuclease activity of the DNA polymerase is described in Holland et al, (1991) Proc.
  • a typical real-time PCR protocol with fluorescent probes involves the use of a labeled probe, specific for each target sequence.
  • the probe is preferably labeled with one or more fluorescent moieties, which absorb and emit light at specific wavelengths.
  • the probe Upon hybridizing to the target sequence or its amplicon, the probe exhibits a detectable change in fluorescent emission as a result of probe hybridization or hydrolysis.
  • the major challenge of the real-time assay however remains the ability to analyze numerous targets in a single tube.
  • the number of loci of interest increases rapidly. For example, multiple loci must be analyzed in forensic DNA profiling, pathogenic microorganism detection, multi-locus genetic disease screening and multi-gene expression studies, to name a few.
  • the ability to multiplex an assay is limited by the detection instruments. Specifically, the use of multiple probes in the same reaction requires the use of distinct fluorescent labels. To simultaneously detect multiple probes, an instrument must be able to discriminate among the light signals emitted by each probe.
  • the majority of current technologies on the market do not permit detection of more than four to seven separate wavelengths in the same reaction vessel. Therefore, using one uniquely-labeled probe per target, no more than four to seven separate targets can be detected in the same vessel.
  • at least one target is usually a control nucleic acid. Accordingly, in practice, no more than three to six experimental targets can be detected in the same tube.
  • a post-PCR melting assay An additional ability to multiplex a real-time amplification reaction is provided by a post-PCR melting assay. See U.S. patent application Serial No. 11/474,071, filed on June 23, 2006.
  • a melting assay the amplified nucleic acid is identified by its unique melting profile.
  • a melting assay involves determining the melting temperature (melting point) of a double-stranded target, or a duplex between the labeled probe and the target. As described in U.S. Patent No.
  • a duplex between the target nucleic acid and the probe is gradually heated (or cooled) in a controlled temperature program.
  • the dissociation of the duplex changes the distance between interacting fiuorophores or between fiuorophore and quencher.
  • the interacting fiuorophores may be conjugated to separate probe molecules, as described in U.S. Patent No. 6,174,670.
  • one fiuorophore may be conjugated to a probe, while the other fiuorophore may be intercalated into a nucleic acid duplex, as described in U.S. Patent No. 5,871,908.
  • the fiuorophores may be conjugated to a single probe
  • the fluorescence is quenched as the fiuorophore to the quencher are brought together in the now single-stranded probe.
  • the melting of the nucleic acid duplex is monitored by measuring the associated change in fluorescence.
  • the change in fluorescence may be represented on a graph referred to as "melting profile.”
  • melting profile a graph referred to as "melting profile.”
  • different probe-target duplexes may be designed to melt (or reanneal) at different temperatures, each probe will generate a unique melting profile.
  • Properly designed probes would have melting temperatures that are clearly distinguishable from those of the other probes in the same assay.
  • Many existing software tools enable one to design probes for a same-tube multiplex assay with these goals in mind. For example, Visual OMP TM software (DNA Software, Inc., Ann Arbor, Mich.) enables one to determine melting temperatures of nucleic acid duplexes under various reaction conditions.
  • the post-amplification melting assay is most commonly used for qualitative purposes, i.e. to identify target nucleic acids, see U.S. Patent Nos. 6,174,670, 6,427,156 and 5,871,908. It is known to obtain a melting peak by differentiating the melting curve function. Ririe et al. ("Product differentiation by analysis of DNA melting curves during the polymerase chain reaction,” (1997) Anal. Biochem. 245:154-160) observed that differentiation helps resolve melting curves generated by mixtures of products. After differentiation, the melting peaks generated by each component of the mixture become easily distinguishable. It was also previously known that the post-amplification melting signal, i.e. melting peak, is higher in proportion to the amount of the nucleic acid in the sample.
  • U.S. Patent No. 6,245,514 teaches a post-amplification melt assay using a duplex-intercalating dye, to generate a derivative melting peak, and then, using proprietary software, to integrate the peak.
  • the integration provides information about the efficiency of amplification and relative amount of the amplified nucleic acid.
  • the ability to quantify the amount of target is useful in clinical applications, such as determination of viral load in a patient's serum, measuring the level of expression of a gene in response to drug therapy or determining the molecular signature of a tumor to predict its response to therapy.
  • the signal generated by the labeled probe can be used to estimate the amount of input target nucleic acid.
  • the existing methods are limited in their ability to simultaneously quantify multiple targets.
  • the limiting factor is the availability of spectrally-resolvable fluorophores.
  • state-of-the- art fluorescent label technology is not able to obtain distinct signals from more than six or seven separate fluorescently labeled probes in the same tube. Therefore a radically different experimental approach is needed to permit amplification and detection of numerous nucleic acid targets during real-time PCR.
  • PTO Probing and Tagging Oligonucleotide
  • CTO Capturing and Templating Oligonucleotide
  • the present invention provides for novel methods for nucleic acid sequence detection, particularly detection of multiple target nucleic acids using a real-time PCR assay.
  • the methods are performed by the use of novel oligonucleotide probes having two unique features, a non-complementary tag portion and a quenching molecule.
  • the invention provides for a method for amplification and detection of a target nucleic acid in a sample comprising the steps of: (a) contacting the sample containing the target nucleic acid in a single reaction vessel with ( i) one pair of oligonucleotide primers, each oligonucleotide primer capable of hybridizing to opposite strands of a subsequence of the target nucleic acid; (ii) an oligonucleotide probe that comprises an annealing portion and a tag portion, wherein the tag portion comprises a nucleotide sequence non-complementary to the target nucleic acid sequence or a non- nucleotide molecule, wherein the annealing portion comprises a nucleotide sequence at least partially complementary to the target nucleic acid sequence and hybridizes to a region of the subsequence of the target nucleic acid that is bounded by the pair of oligonucleotide primers, wherein the probe further
  • the tag portion comprises a modification such that it is not capable of being extended by a nucleic acid polymerase.
  • the reporter moiety is on the tag portion of the oligonucleotide probe. In another embodiment, the reporter moiety is located on the annealing portion of the oligonucleotide probe and is able to interact in a temperature-dependent manner to the quenching molecule that comprises the second quencher moiety.
  • the tag portion comprises a nucleotide sequence non-complementary to the target nucleic acid sequence and the quenching molecule is an oligonucleotide comprising a nucleotide sequence at least partially complementary to the tag portion of the oligonucleotide probe and binds to the tag portion by hybridization.
  • the tag portion of the oligonucleotide probe or the quenching molecule or both the tag portion and the quenching molecule contain one or more nucleotide modifications.
  • the one or more nucleotide modifications is selected from the group consisting of Locked Nucleic Acid (LNA), Peptide Nucleic Acid (PNA), Bridged Nucleic Acid (BNA), 2' -0 alkyl substitution, L-enantiomeric nucleotide, or
  • the reporter moiety is a fluorescent dye and the quencher moiety quenches a detectable signal from the fluorescent dye.
  • the invention provides for a method for detecting two or more target nucleic acid sequences in a sample comprising the steps of: (a) contacting the sample suspected of containing the two or more target nucleic acid sequences in a single reaction vessel with (i) a first pair of oligonucleotide primers with nucleotide sequences that are complementary to each strand of a first target nucleic acid sequence, and a second pair of oligonucleotide primers with nucleotide sequences that are
  • a first oligonucleotide probe comprising a nucleotide sequence at least partially complementary to the first target nucleic acid sequence and anneals within the first target nucleic acid sequence bounded by the first pair of oligonucleotide primers, wherein the first oligonucleotide probe comprises a fluorescent moiety capable of generating a detectable signal and a first quencher moiety capable of quenching the detectable signal generated by the fluorescent moiety, wherein the fluorescent moiety is separated the first quencher moiety by a nuclease susceptible cleavage site ; (iii) a second oligonucleotide probe comprising two distinct portions, an annealing portion comprising a nucleotide sequence at least partially complementary to the second target nucleic acid sequence and anneals within the second target nucleic acid sequence bounded by the second pair of oligonucleotide primers,
  • oligonucleotide is hybridized to the tag portion from the second oligonucleotide probe; (d) increasing temperature to a second temperature, which is higher than the first temperature, at which the quenching oligonucleotide is not hybridized to the tag portion from the second oligonucleotide probe; (e) measuring a fluorescent signal at the second temperature; (f) obtaining a calculated signal value by subtracting the fluorescent signal detected at the first temperature from the fluorescent signal detected at the second temperature; (g) repeating steps (b) through (f) in multiple PCR cycles to produce desired quantity of amplification products from the first and second target nucleic acid sequences; (h) determining the presence of the first target nucleic acid sequence from the fluorescent signals detected at the first temperature from the multiple PCR cycles and the presence of the second target nucleic acid sequence from the calculated signal values from the multiple PCR cycles.
  • the tag portion comprises a modification such that it is not capable of being extended by a nucleic acid polymerase.
  • the tag portion is attached to the 5' terminus of the annealing portion.
  • the tag portion is attached to the 3' terminus of the annealing portion.
  • the tag portion is attached via a linker to a region of the annealing portion.
  • oligonucleotide probe or the quenching oligonucleotide or both the tag portion and the quenching oligonucleotide contain one or more nucleotide modifications.
  • the one or more nucleotide modifications is selected from the group consisting of Locked Nucleic Acid (LNA), Peptide Nucleic Acid (PNA), Bridged Nucleic Acid (BNA), 2' -0 alkyl substitution, L-enantiomeric nucleotide, or
  • the invention provides for a method for detecting two or more target nucleic acid sequences in a sample comprising the steps of: (a) contacting the sample suspected of containing the two or more target nucleic acid sequences in a single reaction vessel with (i) a first pair of oligonucleotide primers with sequences that are complementary to each strand of a first target nucleic acid sequence, and a second pair of oligonucleotide primers with sequences that are complementary to each strand of a second target nucleic acid sequence; (ii) a first oligonucleotide probe comprising two distinct portions, a first annealing portion comprising a sequence at least partially complementary to the first target nucleic acid sequence and anneals within the first target nucleic acid sequence bounded by the first pair of oligonucleotide primers, wherein the first annealing portion comprises a first quencher moiety; and a first tag portion attached to the 5' terminus
  • the first tag portion and the second tag portion both comprise a modification such that both tag portions are not capable of being extended by a nucleic acid polymerase.
  • the first tag portion is attached to the 3' terminus of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached to the 3' terminus of the second annealing portion of the second
  • the first tag portion is attached to the 3' terminus of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached to the 5' terminus of the second annealing portion of the second oligonucleotide probe.
  • the first tag portion is attached to the 3' terminus of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached via a linker to a region of the second annealing portion of the second oligonucleotide probe.
  • the first tag portion is attached to the 5' terminus of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached to the 5' terminus of the second annealing portion of the second
  • the first tag portion is attached to the 5' terminus of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached to the 3' terminus of the second annealing portion of the second oligonucleotide probe.
  • the first tag portion is attached to the 5' terminus of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached via a linker to a region of the second annealing portion of the second oligonucleotide probe.
  • the first tag portion is attached via a linker to a region of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached to the 5' terminus of the second annealing portion of the second
  • the first tag portion is attached via a linker to a region of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached to the 3' terminus of the second annealing portion of the second oligonucleotide probe.
  • the first tag portion is attached via a linker to a region of the first annealing portion of the first oligonucleotide probe and the second tag portion is attached via a linker to a region of the second annealing portion of the second oligonucleotide probe.
  • any of the first tag portion of the first oligonucleotide probe or the first quenching oligonucleotide or the second tag portion of the second oligonucleotide probe or the second quenching oligonucleotide or any combinations thereof contains one or more nucleotide modifications.
  • the one or more nucleotide modifications is selected from the group consisting of Locked Nucleic Acid (LNA), Peptide Nucleic Acid (PNA), Bridged Nucleic Acid (BNA), X -O alkyl substitution, L- enantiomeric nucleotide, or combinations theoreof.
  • the invention provides for a kit for detecting two or more target nucleic acid sequences in a sample comprising: (a) two or more pairs of oligonucleotide primers with sequences that are complementary to each strand of the two or more target nucleic acid sequences; (b) at least one oligonucleotide probe comprising two distinct portions, an annealing portion comprising a sequence at least partially complementary to one of the more than one target nucleic acid sequences and anneals within said one of the more than one target nucleic acid sequences, wherein the annealing portion comprises a first quencher moiety; and a tag portion attached to the 5' terminus or to the 3' terminus of the first annealing portion or attached via a linker to a region of the annealing portion, and comprising a nucleotide sequence that is non-complementary to the more than one target nucleic acid sequences, wherein the tag portion comprises a fluorescent moiety whose detectable signal is
  • oligonucleotide or both the tag portion of the oligonucleotide probe and the quenching oligonucleotide contains one more nucleotide modifications wherein the one or more nucleotide modifications is selected from the group consisting of Locked Nucleic Acid (LNA), Peptide Nucleic Acid (PNA), Bridged Nucleic Acid (BNA), T -O alkyl substitution, L-enantiomeric nucleotide, or combinations theoreof.
  • LNA Locked Nucleic Acid
  • PNA Peptide Nucleic Acid
  • BNA Bridged Nucleic Acid
  • T -O alkyl substitution L-enantiomeric nucleotide, or combinations theoreof.
  • FIG. 1 is a graphical description of one embodiment of the oligonucleotide probe used to perform the methods of the invention.
  • FIG. 2 is a graphical representation of the method of the invention that shows the separation of the tag portion and subsequent dissociation of the quenching
  • FIG. 3 is a description of one embodiment of the methods of the present invention.
  • FIG. 4 shows the signal detection temperatures using another embodiment of the methods of the present invention.
  • FIG. 5 shows different embodiments of the oligonucleotide probes used to practice the methods of the present invention.
  • FIG. 6 shows the results of the hybridization and dissociation at two temperatures between a quenching oligonucleotide and a fluorescently labeled complementary oligonucleotide as described in Example 1.
  • FIG 7 shows the PCR growth curves generated from an internal control template (GIC) at 0, 100, 1,000 or 10,000 cp/rxn using a standard TaqMan * probe GO and FAM fluorescence readings at 58°C and in the absence of HIV- 1 Group M template (HIM) (FIG 7A) or in the presence of HIM at 10 cp/rxn (FIG 7B), 100 cp/rxn (FIG 7C) and 1,000 cp/rxn (FIG 7D).
  • GIC internal control template
  • FIG. 6 shows the results of the hybridization and dissociation at two temperatures between a quenching oligonucleotide and a fluorescently labeled complementary oligonucleotide as described in Example 1.
  • FIG 7 shows the PCR
  • FIG 8 shows the PCR growth curves generated from HIM at 0, 10, 100 or 1,000 cp/rxn using a tagged probe (L24) with a complementary quenching oligonucleotide (Q9) and FAM fluorescence readings at 80°C and in the absence of GIC (FIG 8A) or in the presence of GIC at 100 cp/rxn (FIG 8B), 1,000 cp/rxn (FIG 8C) and 10,000 cp/rxn (FIG 8D).
  • FIG. 1 shows the PCR growth curves generated from HIM at 0, 10, 100 or 1,000 cp/rxn using a tagged probe (L24) with a complementary quenching oligonucleotide (Q9) and FAM fluorescence readings at 80°C and in the absence of GIC (FIG 8A) or in the presence of GIC at 100 cp/rxn (FIG 8B), 1,000 cp/rxn (FIG 8C) and 10,000 cp/
  • FIG 9 shows the derived growth curves from HIM at 0, 10, 100 or 1,000 cp/rxn generated by having 84% of the 58°C fluorescence signals subtracted from the 80°C fluorescence signals in the absence of GIC (FIG 9A) or in the presence of GIC at 100 cp/rxn (FIG 9B), 1 ,000 cp/rxn (FIG 9C) and 10,000 cp/rxn (FIG 9D).
  • FIGs. 10A and 10B show the PCR growth curves generated from an internal control template (GIC) or an HIV template (HIV), or both GIC and HIV templates (G+H) using a standard TaqMan ® GIC probe (GO) and a tagged HIV probe (L24) with complementary quenching oligonucleotide (Q9) in which both probes are labeled with FAM (FIG. 10A, top row), with HEX (FIG. 10A, bottom row), with JA270 dye (FIG. 10B top row) or with Cy5.5 (FIG. 10B, bottom row).
  • GIC internal control template
  • HIV HIV template
  • G+H HIV templates
  • GO TaqMan ® GIC probe
  • L24 a tagged HIV probe
  • Q9 complementary quenching oligonucleotide
  • FIGs. 11 A, 1 IB and 11C show the PCR growth curves of the experiment as described in Example 4 in which the L24 tagged probe contains L-DNA instead of D-DNA with FAM fluorescence readings at 58°C (FIG. 11 A), FAM fluorescence readings at 80°C (FIG. 11B) and 84% of the 58°C fluorescence signals subtracted from the 80°C fluorescence signals (FIG. 11C).
  • FIG. 12 shows the PCR growth curves of the experiment as described in Example 5 in which fluorescence signal detection was measured at 58°C, 75°C, 88°C or 97°C in the presence of a standard TaqMan * GIC probe (IC-QF), a tagged HIV probe (L24) with a quenching oligonucleotide that has A and G nucleotides modified with 2" -OMe substitutions (Q9-OMe A/G), a tagged HIV probe that has all nucleotides modified with 2OMe substitutions (L24-OMe) with a quenching oligonucleotide (Q9-OMe A/G), and a tagged HIV probe (L24-OMe) with a quenching oligonucleotide that has all nucleotides modified with 2" -OMe substitutions (Q9-OMe).
  • IC-QF TaqMan * GIC probe
  • L24 tagged HIV probe with a quenching
  • sample includes a specimen or culture (e.g., microbiological cultures) that includes nucleic acids.
  • sample is also meant to include both biological and environmental samples.
  • a sample may include a specimen of synthetic origin.
  • Biological samples include whole blood, serum, plasma, umbilical cord blood, chorionic villi, amniotic fluid, cerebrospinal fluid, spinal fluid, lavage fluid (e.g., bronchioalveolar, gastric, peritoneal, ductal, ear, arthroscopic), biopsy sample, urine, feces, sputum, saliva, nasal mucous, prostate fluid, semen, lymphatic fluid, bile, tears, sweat, breast milk, breast fluid, embryonic cells and fetal cells.
  • lavage fluid e.g., bronchioalveolar, gastric, peritoneal, ductal, ear, arthroscopic
  • biopsy sample urine, feces, sputum, saliva, nasal mucous, prostate fluid, semen, lymphatic fluid, bile, tears, sweat, breast milk, breast fluid, embryonic cells and fetal cells.
  • the biological sample is blood, and more preferably plasma.
  • blood encompasses whole blood or any fractions of blood, such as serum and plasma as conventionally defined.
  • Blood plasma refers to the fraction of whole blood resulting from centrifugation of blood treated with anticoagulants.
  • Blood serum refers to the watery portion of fluid remaining after a blood sample has coagulated.
  • Environmental samples include environmental material such as surface matter, soil, water and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non- disposable items. These examples are not to be construed as limiting the sample types applicable to the present invention.
  • a target includes essentially any molecule for which a detectable probe (e.g., oligonucleotide probe) or assay exists, or can be produced by one skilled in the art.
  • a target may be a biomolecule, such as a nucleic acid molecule, a polypeptide, a lipid, or a carbohydrate, which is capable of binding with or otherwise coming in contact with a detectable probe (e.g., an antibody), wherein the detectable probe also comprises nucleic acids capable of being detected by methods of the invention.
  • detectable probe refers to any molecule or agent capable of hybridizing or annealing to a target biomolecule of interest and allows for the specific detection of the target biomolecule as described herein.
  • the target is a nucleic acid
  • the detectable probe is an oligonucleotide.
  • nucleic acid and “nucleic acid molecule” may be used interchangeably throughout the disclosure.
  • oligonucleotides refer to oligonucleotides, oligos, polynucleotides, deoxyribonucleotide (DNA), genomic DNA, mitochondrial DNA (mtDNA), complementary DNA (cDNA), bacterial DNA, viral DNA, viral RNA, RNA, message RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), siRNA, catalytic RNA, clones, plasmids, Ml 3, PI, cosmid, bacteria artificial chromosome (BAC), yeast artificial chromosome (YAC), amplified nucleic acid, amplicon, PCR product and other types of amplified nucleic acid, RNA/DNA hybrids and polyamide nucleic acids (PNAs), all of which can be in either single- or double-stranded form, and unless otherwise limited, would encompass known analogs of natural nucleotides that can function in a similar manner as naturally occurring nucleotides and combinations and/or mixtures thereof.
  • nucleotides refers to both naturally-occurring and modified/nonnaturally-occurring nucleotides, including nucleoside tri, di, and monophosphates as well as monophosphate monomers present within polynucleic acid or oligonucleotide.
  • a nucleotide may also be a ribo; 2'-deoxy; 2',3'-deoxy as well as a vast array of other nucleotide mimics that are well-known in the art.
  • Mimics include chain-terminating nucleotides, such as 3'-0-methyl, halogenated base or sugar substitutions; alternative sugar structures including nonsugar, alkyl ring structures; alternative bases including inosine; deaza-modified; chi, and psi, linker-modified; mass label-modified; phosphodiester modifications or replacements including
  • phosphorothioate methylphosphonate, boranophosphate, amide, ester, ether; and a basic or complete internucleotide replacements, including cleavage linkages such a photocleavable nitrophenyl moieties.
  • a target can come in a variety of different forms including, for example, simple or complex mixtures, or in substantially purified forms.
  • a target can be part of a sample that contains other components or can be the sole or major component of the sample. Therefore, a target can be a component of a whole cell or tissue, a cell or tissue extract, a fractionated lysate thereof or a substantially purified molecule.
  • a target can have either a known or unknown sequence or structure.
  • amplification reaction refers to any in vitro means for multiplying the copies of a target sequence of nucleic acid.
  • “Amplifying” refers to a step of submitting a solution to conditions sufficient to allow for amplification.
  • Components of an amplification reaction may include, but are not limited to, e.g., primers, a polynucleotide template, polymerase, nucleotides, dNTPs and the like.
  • amplifying typically refers to an "exponential" increase in target nucleic acid. However, “amplifying” as used herein can also refer to linear increases in the numbers of a select target sequence of nucleic acid, but is different than a one-time, single primer extension step.
  • PCR Polymerase chain reaction
  • Oligonucleotide refers to linear oligomers of natural or modified nucleosidic monomers linked by phosphodiester bonds or analogs thereof.
  • Oligonucleotides include deoxyribonucleosides, ribonucleosides, anomeric forms thereof, peptide nucleic acids (PNAs), and the like, capable of specifically binding to a target nucleic acid.
  • PNAs peptide nucleic acids
  • monomers are linked by phosphodiester bonds or analogs thereof to form oligonucleotides ranging in size from a few monomeric units, e.g., 3-4, to several tens of monomeric units, e.g., 40-60.
  • oligonucleotide is represented by a sequence of letters, such as "ATGCCTG,” it will be understood that the nucleotides are in 5'-3' order from left to right and that "A” denotes deoxyadenosine, “C” denotes deoxycytidine, “G” denotes deoxyguanosine, “T” denotes deoxythymidine, and “U” denotes the ribonucleoside, uridine, unless otherwise noted.
  • A denotes deoxyadenosine
  • C denotes deoxycytidine
  • G denotes deoxyguanosine
  • T denotes deoxythymidine
  • U denotes the ribonucleoside, uridine, unless otherwise noted.
  • oligonucleotides comprise the four natural deoxynucleotides; however, they may also comprise ribonucleosides or non-natural nucleotide analogs.
  • an enzyme has specific oligonucleotide or polynucleotide substrate requirements for activity, e.g., single stranded DNA, RNA/DNA duplex, or the like, then selection of appropriate composition for the oligonucleotide or polynucleotide substrates is well within the knowledge of one of ordinary skill.
  • oligonucleotide primer refers to a polynucleotide sequence that hybridizes to a sequence on a target nucleic acid template and facilitates the detection of an oligonucleotide probe.
  • an oligonucleotide primer serves as a point of initiation of nucleic acid synthesis.
  • an oligonucleotide primer may be used to create a structure that is capable of being cleaved by a cleavage agent.
  • Primers can be of a variety of lengths and are often less than 50 nucleotides in length, for example 12- 25 nucleotides, in length. The length and sequences of primers for use in PCR can be designed based on principles known to those of skill in the art.
  • oligonucleotide probe refers to a polynucleotide sequence capable of hybridizing or annealing to a target nucleic acid of interest and allows for the specific detection of the target nucleic acid.
  • a “reporter moiety” or “reporter molecule” is a molecule that confers a detectable signal. The detectable phenotype can be colorimetric, fluorescent or luminescent, for example.
  • a “quencher moiety” or “quencher molecule” is a molecule that is able to quench the detectable signal from the reporter moiety.
  • a “mismatched nucleotide” or a “mismatch” refers to a nucleotide that is not complementary to the target sequence at that position or positions.
  • An oligonucleotide probe may have at least one mismatch, but can also have 2, 3, 4, 5, 6 or 7 or more mismatched nucleotides.
  • polymorphism refers to an allelic variant. Polymorphisms can include single nucleotide polymorphisms (SNP's) as well as simple sequence length polymorphisms. A polymorphism can be due to one or more nucleotide substitutions at one allele in comparison to another allele or can be due to an insertion or deletion, duplication, inversion and other alterations known to the art.
  • modification refers to alterations of the oligonucleotide probe at the molecular level (e.g., base moiety, sugar moiety or phosphate backbone).
  • Nucleoside modifications include, but are not limited to, the introduction of cleavage blockers or cleavage inducers, the introduction of minor groove binders, isotopic enrichment, isotopic depletion, the introduction of deuterium, and halogen
  • Nucleoside modifications may also include moieties that increase the stringency of hybridization or increase the melting temperature of the oligonucleotide probe.
  • a nucleotide molecule may be modified with an extra bridge connecting the 2' and 4' carbons resulting in locked nucleic acid (LNA) nucleotide that is resistant to cleavage by a nuclease (as described in Imanishi et al., U.S. Patent No. 6,268,490 and in Wengel et al., U.S. Patent No. 6,794,499).
  • LNA locked nucleic acid
  • compositions of the tag portion of the oligonucleotide probe and of the quenching oligonucleotide molecule are only restricted by their ability to form stable duplexes.
  • These oligonucleotides can therefore comprise of DNA, L-DNA, RNA, L-RNA, LNA, L-LNA, PNA (peptide nucleic acid, as described in Nielsen et al, U.S. Patent No. 5,539,082), BNA (bridged nucleic acid, for example, 2',4'-BNA(NC) [2'-0,4'-C-aminomethylene bridged nucleic acid] as described in Rahman et al, J. Am. Chem. Soc.
  • L-BNA L-BNA etc.
  • L-XXX refers to the L-enantiomer of the sugar unit of the nucleic acids
  • nucleoside modifications include various 2" substitutions such as halo, alkoxy and allyloxy groups that are introduced in the sugar moiety of
  • specific or “specificity” in reference to the binding of one molecule to another molecule, such as a probe for a target polynucleotide refers to the recognition, contact, and formation of a stable complex between the two molecules, together with substantially less recognition, contact, or complex formation of that molecule with other molecules.
  • anneal refers to the formation of a stable complex between two molecules.
  • a probe is "capable of annealing" to a nucleic acid sequence if at least one region of the probe shares substantial sequence identity with at least one region of the complement of the nucleic acid sequence.
  • “Substantial sequence identity” is a sequence identity of at least about 80%, preferably at least about 85%, more preferably at least about 90%, 95% or 99%, and most preferably 100%.
  • U and T often are considered the same nucleotide.
  • a probe comprising the sequence ATCAGC is capable of hybridizing to a target RNA sequence comprising the sequence GCUGAU.
  • cleavage agent refers to any means that is capable of cleaving an oligonucleotide probe to yield fragments, including but not limited to enzymes.
  • the cleavage agent may serve solely to cleave, degrade or otherwise separate the second portion of the oligonucleotide probe or fragments thereof.
  • the cleavage agent may be an enzyme.
  • the cleavage agent may be natural, synthetic, unmodified or modified.
  • the cleavage agent is preferably an enzyme that possesses synthetic (or polymerization) activity and nuclease activity.
  • an enzyme is often a nucleic acid amplification enzyme.
  • An example of a nucleic acid amplification enzyme is a nucleic acid polymerase enzyme such as Thermus aquaticus (Taq) DNA polymerase (TaqMan * ) or E. coli DNA polymerase I.
  • the enzyme may be naturally occurring, unmodified or modified.
  • a "nucleic acid polymerase” refers to an enzyme that catalyzes the incorporation of nucleotides into a nucleic acid.
  • Exemplary nucleic acid polymerases include DNA polymerases, RNA polymerases, terminal transferases, reverse transcriptases, telomerases and the like.
  • thermostable DNA polymerase refers to a DNA polymerase that is stable (i.e., resists breakdown or denaturation) and retains sufficient catalytic activity when subjected to elevated temperatures for selected periods of time.
  • a thermostable DNA polymerase retains sufficient activity to effect subsequent primer extension reactions, when subjected to elevated temperatures for the time necessary to denature double-stranded nucleic acids. Heating conditions necessary for nucleic acid denaturation are well known in the art and are exemplified in U.S. Pat. Nos. 4,683,202 and 4,683,195.
  • a thermostable polymerase is typically suitable for use in a temperature cycling reaction such as the polymerase chain reaction ("PCR").
  • the examples of thermostable nucleic acid polymerases include Thermus aquaticus Taq DNA polymerase, Thermus sp. Z05 polymerase, Thermus flavus polymerase,
  • Thermotoga maritima polymerases such as TMA-25 and TMA-30 polymerases, Tth DNA polymerase, and the like.
  • a “modified" polymerase refers to a polymerase in which at least one monomer differs from the reference sequence, such as a native or wild-type form of the polymerase or another modified form of the polymerase. Exemplary modifications include monomer insertions, deletions, and substitutions. Modified polymerases also include chimeric polymerases that have identifiable component sequences (e.g., structural or functional domains, etc.) derived from two or more parents. Also included within the definition of modified polymerases are those comprising chemical modifications of the reference sequence.
  • modified polymerases include G46E E678G CS5 DNA polymerase, G46E L329A E678G CS5 DNA polymerase, G46E L329A D640G S671F CS5 DNA polymerase, G46E L329A D640G S671F E678G CS5 DNA polymerase, a G46E E678G CS6 DNA polymerase, Z05 DNA polymerase, ⁇ 05 polymerase, ⁇ 05- Gold polymerase, AZ05R polymerase, E615G Taq DNA polymerase, E678G TMA-25 polymerase, E678G TMA-30 polymerase, and the like.
  • 5' to 3' nuclease activity or "5'-3' nuclease activity” refers to an activity of a nucleic acid polymerase, typically associated with the nucleic acid strand synthesis, whereby nucleotides are removed from the 5' end of nucleic acid strand, e.g., E. coli DNA polymerase I has this activity, whereas the Klenow fragment does not.
  • Some enzymes that have 5' to 3' nuclease activity are 5' to 3' exonucleases. Examples of such 5' to 3' exonucleases include: Exonuclease from B.
  • subtilis Phosphodiesterase from spleen, Lambda exonuclease, Exonuclease II from yeast, Exonuclease V from yeast, and Exonuclease from Neurospora crassa.
  • the term "propanediol” or “propanediol spacer” refers to 1,3-Propanediol and is synonymous with Propane-l,3-diol, 1,3-Dihydroxypropane, and Trimethylene glycol.
  • HEG or "HEG spacer” refers to hexaethylene glycol, which is synonymous with 3,6,9,12,15 -Pentaoxaheptadecane- 1 , 17-diol.
  • Various aspects of the present invention are based on a special property of nucleic acid polymerases. Nucleic acid polymerases can possess several activities, among them, a 5' to 3' nuclease activity whereby the nucleic acid polymerase can cleave mononucleotides or small oligonucleotides from an oligonucleotide annealed to its larger,
  • an upstream oligonucleotide In order for cleavage to occur efficiently, an upstream oligonucleotide must also be annealed to the same larger polynucleotide.
  • the detection of a target nucleic acid utilizing the 5' to 3' nuclease activity can be performed by a "TaqMan ® " or "5 '-nuclease assay", as described in U.S. Pat. Nos.
  • amplification is performed using a DNA polymerase having 5' to 3' exonuclease activity.
  • any probe which hybridizes to the target nucleic acid downstream from the primer being extended is degraded by the 5' to 3' exonuclease activity of the DNA polymerase.
  • the synthesis of a new target strand also results in the degradation of a probe, and the accumulation of degradation product provides a measure of the synthesis of target sequences.
  • any method suitable for detecting degradation product can be used in a 5' nuclease assay.
  • the detection probe is labeled with two fluorescent dyes, one of which is capable of quenching the fluorescence of the other dye.
  • the dyes are attached to the probe, typically with the reporter or detector dye attached to the 5' terminus and the quenching dye attached to an internal site, such that quenching occurs when the probe is in an unhybridized state and such that cleavage of the probe by the 5' to 3' exonuclease activity of the DNA polymerase occurs in between the two dyes.
  • Amplification results in cleavage of the probe between the dyes with a concomitant elimination of quenching and an increase in the fluorescence observable from the initially quenched dye.
  • the accumulation of degradation product is monitored by measuring the increase in reaction fluorescence.
  • U.S. Pat. Nos. 5,491,063 and 5,571,673 describe alternative methods for detecting the degradation of probe which occurs concomitant with amplification.
  • a 5' nuclease assay for the detection of a target nucleic acid can employ any polymerase that has a 5' to 3' exonuclease activity.
  • the polymerases with 5'-nuclease activity are thermostable and thermoactive nucleic acid polymerases.
  • thermostable polymerases include, but are not limited to, native and recombinant forms of polymerases from a variety of species of the eubacterial genera Thermus, Thermatoga, and Thermosipho, as well as chimeric forms thereof
  • Thermus species polymerases that can be used in the methods of the invention include Thermus aquaticus (Taq) DNA polymerase, Thermus thermophilus (Tth) DNA polymerase, Thermus species Z05 (Z05) DNA polymerase, Thermus species spsl7 (spsl7), and Thermus species Z05 (e.g., described in U.S. Pat. Nos.
  • Thermatoga polymerases that can be used in the methods of the invention include, for example, Thermatoga maritima DNA polymerase and Thermatoga neapoUtana DNA polymerase, while an example of a Thermosipho polymerase that can be used is Thermosipho africanus DNA polymerase.
  • the sequences of Thermatoga maritima and Thermosipho africanus DNA polymerases are published in International Patent Application No. PCT/US91/07035 with
  • the amplification detection is typically concurrent with amplification (i.e., "real-time"). In some embodiments the amplification detection is quantitative, and the amplification detection is real-time. In some embodiments, the amplification detection is qualitative (e.g., end-point detection of the presence or absence of a target nucleic acid). In some embodiments, the amplification detection is subsequent to amplification. In some embodiments, the amplification detection is qualitative, and the amplification detection is subsequent to amplification.
  • real-time PCR amplification and detection of two or more target nucleic acid in a single reaction vessel may be performed using a standard TaqMan * oligonucleotide probe for detecting the presence of the first target and one or more novel TaqMan * oligonucleotide probes for detecting the presence of the second, third or more targets, with all the probes containing the same fluorescent label.
  • the novel TaqMan * oligonucleotide probes may be used for detecting the presence of all the target nucleic acids.
  • the novel probes have two distinguishing features.
  • the first feature of the novel probe is that it comprises two distinct portions.
  • the first portion is referred as an annealing portion and comprises a sequence that is at least partially complementary to a target nucleic acid sequence such that it is capable of being hybridized with the target sequence.
  • the annealing portion also contains a quencher moiety.
  • the annealing portion contains a reporter moiety such as a fluorescent dye that is capable of being quenched the quencher moiety and is separated from the quencher moiety by a nuclease susceptible cleavage site.
  • the second portion of the oligonucleotide probe is referred as a tag portion.
  • the tag portion is attached to the 5' terminus of the annealing portion.
  • the tag portion is attached to the 3' terminus of the annealing portion. In another embodiment, the tag portion is attached anywhere between the 5' terminus and the 3' terminus of the annealing portion via a linker.
  • the tag portion may comprise a nucleotide sequence that is not complementary to the target nucleic acid sequence and forms a "flap" region that is not capable of binding to the target nucleic acid (see FIG. 1 for a graphical representation of a 5' flap probe).
  • the tag portion may also be comprised of non-nucleotides such as any organic moieties, or repeat units (e.g.
  • the tag portion contains a reporter moiety such as a fluorescent dye that is capable of being quenched by the quencher moiety on the annealing portion.
  • the annealing and tag portions of the oligonucleotide probe may optionally be separated by a non- nucleotide "linker".
  • This linker can be comprised of carbon, carbon and oxygen, carbon and nitrogen, or any combination of these and can be of any length.
  • the linker can be comprised of a linear moiety or a cyclic moiety.
  • the linker may be derived from a single unit or from multiple identical or different units separated by phosphate linkages.
  • the purpose of the linker is to create a region at the junction of the annealing and tag portions of the oligonucleotide probe.
  • the linker may also prevent the tag portion from being extended by a nucleic acid polymerase. Alternatively, another modification on the separated tag portion renders it non-extendible by the nucleic acid polymerase.
  • the second feature of the novel probe is that the tag portion binds to a quenching molecule.
  • the quenching molecule may be an oligonucleotide that is fully or partially complementary to the nucleotide sequence of the tag portion and hybridizes to the tag portion.
  • the quenching molecule also contains or is associated with a quencher moiety, i.e. a second quencher moiety, which is also capable of quenching the signal from the reporter moiety (e.g. fluorescent dye) on the tag portion.
  • the quencher moiety on or associated with the quenching molecule (the second quencher moiety) can be the same as or different from the quencher moiety on the annealing portion (the first quencher moiety). Therefore, prior to performing PCR amplification, the reporter moiety on the tag portion is quenched by both the quencher moiety on the annealing portion of the probe and by the quencher moiety on or associated with the quenching molecule (e.g. by a quenching oligonucleotide as shown in FIG. 1).
  • a sample suspected of containing the target nucleic acid is provided.
  • the sample is then contacted inside a single reaction vessel (e.g. a single test tube or a single well in a multi- well microplate) with PCR reagents that contain both the oligonucleotide primers capable of generating amplicons of the target nucleic acid and the novel oligonucleotide probe.
  • a single reaction vessel e.g. a single test tube or a single well in a multi- well microplate
  • PCR amplification begins by using a nucleic acid polymerase having 5' to 3' nuclease activity such that during the extension step of each PCR cycle, the nuclease activity of the polymerase allows cleavage and separation of the tag portion from the quenching moiety on the annealing portion of the probe.
  • the separated tag portion may optionally contain a modification (such as the non-nucleotide linker) such that it is not capable of being extended by a nucleic acid polymerase.
  • the signal from the reporter moiety on the separated tag portion is measured at a first temperature, usually, the annealing and/or extension temperature, at which the quenching molecule is still bound to the tag portion. Due to the presence of the quencher moiety on or associated with the quenching molecule, the signal from the reporter moiety (e.g. a fluorescent dye) on the tag portion is still quenched. Then, as a normal step in a PCR cycle, the temperature is gradually raised to the denaturation temperature. As the temperature increases from the extension temperature to the denaturation temperature, a temperature point is reached at which the quenching molecule is no longer bound to the tag portion.
  • a first temperature usually, the annealing and/or extension temperature
  • the quenching molecule is an oligonucleotide that has sequences complementary to the nucleotide sequence of the tag portion, this dissociation occurs at the melting temperature (Tm) of the duplex formation between the quenching oligonucleotide molecule and the tag portion.
  • Tm melting temperature
  • the second temperature is above the Tm temperature to ensure that close to 100% of the tag portion are in single-stranded form.
  • the calculated signal value may optionally be normalized for correction of signals that may be affected by temperature. For example, fluorescent signals are known to decrease at higher temperatures, and therefore, standards can be used to normalize the signal values obtained at different temperatures.
  • the determined cumulative signal values can be used to determine not only the presence or absence but also the quantity of the target nucleic acid by determining the threshold value (Ct value) from a PCR growth curve generated from the signal values calculated plotted against PCR cycle number.
  • the signal measurements and calculations are performed at each PCR cycle. Multiplex PCR assays using only one reporter moiety (e.g. one fluorescent dye) is possible by designing oligonucleotide probes that have tag portions hybridized to their respective quenching oligonucleotide molecules at various Tm temperatures.
  • amplification and detection of three target nucleic acid in one reaction can be achieved by using three oligonucleotide probes all labeled with the same fiuorophore.
  • a standard TaqMan * oligonucleotide probe may be used to detect the first target by measuring the fluorescent signal at a first temperature (usually the annealing temperature of a PCR cycle).
  • a first "tagged" probe with a low Tm tag-quenching oligonucleotide duplex may be used to detect the second target by measuring the calculated fluorescent value at a second temperature at or above its Tm temperature and that is higher than the first temperature.
  • a second "tagged" probe with a high Tm tag- quenching oligonucleotide duplex may be used to detect the third target by measuring the calculated fluorescent value at a third temperature at or above its Tm temperature and that is higher than the second temperature, (see FIG. 4)
  • reporter moieties e.g. fluorescent dyes
  • novel probes of the present invention can be designed such that the tag portion is a nucleotide sequence and is connected to aquenching oligonucleotide to form a hairpin (i.e. a stem-loop structure).
  • the "stem” portion will consist of the complementary regions between the tag portion and the quenching oligonucleotide while the "loop” portion may be comprised of non-complementary nucleotides or non-nucleotides such as linkers as previously described.
  • novel probes of the present invention have been described as having the reporter moiety located on the tag portion of the probes, it is also possible to position the reporter moiety on the annealing portion and place the first quencher moiety on the tag portion, as long as the reporter moiety can reversibly interact with the second quencher moiety on the quenching molecule.
  • the reporter moiety is designed and positioned in the probe oligonucleotide in such a way that it is separated from the first quenching moiety on the annealing portion during the 5' nuclease (TaqMan * ) assay and further designed to reversibly interact with the second quenching moiety on the quenching molecule.
  • both the tag portion and the quenching molecule are comprised of nucleotide sequences.
  • both the tag portion and the quenching oligonucleotide should not hybridize specifically to the target nucleic acid sequence but they should be fully or partially complementary to each other to allow hybridization at the desired temperatures. Both may include a modification at their 3' termini in order to not be extended by the nucleic acid polymerase during PCR amplification.
  • Both the reporter moiety e.g.
  • the fluorescent dye) on the tag portion and the quencher moiety on the quenching oligonucleotide can be located at the 5' terminus, the 3' terminus or at any position between the 5' and 3' termini but they must be located in proximity to each other when the tag portion is hybridized to the quenching oligonucleotide to allow the quenching moiety to quench the detectable signal from the reporter moiety.
  • modified nucleotides can be introduced at all or some positions on either the tag portions, on the quenching oligonucleotides or on both the tag portions and the quenching oligonucleotides such that oligonucleotide length can be shortened.
  • nucleotide modifications that serve to increase the melting temperature include LNA, PNA, G-clamp (9-
  • the tag portion of the oligonucleotide probe and the quenching molecular are comprised of non-nucleotide molecules that reversibly interact with each other in a temperature-dependent manner.
  • non- nucleotide interactions include but are not limited to protein-protein interactions, protein-peptide interactions (e.g. peptide aptamers), protein-small molecule interactions, peptide-small molecule interactions, small molecule-small molecule interactions.
  • biotin and avidin can be exploited by modifying either the biotin moiety (e.g. desthiobiotin) or the avidin moiety (see, Nordlund et al., J. Biol. Chem., 2003, 278 (4) 2479-2483) or both in order to make the interaction reversible and temperature dependent.
  • the interaction between the tag portion and the quenching molecule may involve interaction between a nucleotide sequence (or nucleotide sequences) and a non-nucleotide molecule in a sequence specific manner.
  • these types of interactions include but are not limited to nucleic acid aptamers, DNA binding proteins or peptides and DNA minor groove binders.
  • sequence-specific DNA-binding molecules have been described in several papers (see e.g. Dervan, Science, 1986, 232, 464-471; White et al, Nature, 1998, 391, 468-471) and these methods may be used to generate interactions between the tag portion and the quenching molecule that are temperature-dependent.
  • the 9FAM9 TAG oligonucleotide was incubated without a quenching oligonucleotide (QX) or with the QO or Ql quenching oligonucleotide at 1:5 molar ratio.
  • QX quenching oligonucleotide
  • HIV-1 Group M HIV-1 Group M
  • a standard TaqMan * hydrolysis probe (GO) that hybridizes to the GIC sequence and a tagged probe (L24) with a complementary quenching oligonucleotide (Q9) and an annealing portion that hybridizes to the HIM sequence were used to detect the amplification products generated from these two templates. Both probes were labeled with FAM and Table 3 shows their sequences and the sequence of the quenching oligonucleotide.
  • PCR reagents and cycle conditions were as described in Example 1 and Table 2 with the exception that ⁇ of the GO and L24 probes and 200 nM of the Q9 quenching oligonucleotide were used in the reactions. Fluorescence readings from the FAM label were taken at 58°C and at 80°C for each cycle beginning from cycle #6 (see Table 2).
  • FIGs 7-9 The results of these experiments are shown on FIGs 7-9.
  • the fluorescence readings at 58°C are shown as growth curves in FIG 7.
  • FIG 7A shows the growth curves generated with no HIM present and with 0, 100, 1,000 or 10,000 cp/rxn GIC.
  • Ct Cycle threshold
  • FIG 8A shows the growth curves generated with no GIC present and with 0, 10, 100 or 1,000 cp/rxn HIM.
  • the fluorescence can now be detected from the FAM label on the L24 probe because it is no longer quenched by both the quencher on the "annealing portion" of the probe (due to hydrolysis by the nuclease) and the quencher on the quenching oligonucleotide (Q9) due to strand dissociation at this high temperature.
  • the fluorescence intensity from the L24 probe is considerably lower than that of the GO probe, it is still sufficient to calculate the Ct values that correspond to the starting concentrations of HIM.
  • HIM and GIC are both present, the fluorescence readings at 80°C generate complex curves due to the stronger fluorescence that is detected from the GO probe, (see FIG 8B, 8C, 8D).
  • Example 2 A series of experiments were performed as described in Example 2 except that the GO and L24 probes were labeled with FAM dye in the first set, with HEX dye in the second set, with JA270 dye in the third set and with Cy5.5 dye in the fourth set.
  • PCR amplification was performed with only GIC template present at 100 cp/rxn, only HIV template present at 1000 cp/rxn or with both GIC (100 cp/rxn) and HIV (1000 cp/rxn) templates present. The results of the experiment are shown in FIG. 10.
  • Example 5 Real-Time PCR with Tagged Probes and Quenching Oligonucleotides Having 2 -O Methyl Modifications
  • Example 2 An experiment similar to the one described in Example 2 was performed except that tagged probes and quenching oligonucleotides having nucleotide modifications were used.
  • the tagged probe, L24-OME was generated in which every nucleotide in the tag portion of the probe (shown in TABLE 3 as the underlined portion of L24) was modified by having an O-Methyl substituent on the 2 s position of the ribose moiety ( -OMe).
  • Two modified Q9 quenching oligonucleotides for hybridizing to the tag portion of L24 were also generated.
  • Q9-OME had every nucleotide modified by a 2 s - OMe substituent, and Q9-OME (A/G) had only the A and G nucleotides modified by a 2 s -OMe substituent.
  • Detection of the HIM template was performed using three different combinations of the tag portion and quenching oligonucleotide: L24 with Q9- OME (A/G), L24-OME with Q9-OME (A/G) and L24-OME with Q9-OME. Results of this experiment are shown in FIG. 12.
  • SEQ ID NO 2 Q0 quenching oligonucleotide sequence (no quencher) CCGGAGCTGACTGGCGACG
  • SEQ ID NO 3 Ql quenching oligonucleotide sequence (BHQ-1 quencher on 5' terminus)
  • SEQ ID NO 4 GO TaqMan probe oligonucleotide sequence (FAM/BHQ/phosphate) TGCGCGTCCCGTTTTGATACTTCGTAACGGTGC
  • SEQ ID NO 5 L24 Tagged probe oligonucleotide sequence (BHQ/FAM/phosphate)
  • SEQ ID NO 6 Q9 quenching oligonucleotide sequence (quencher on 3' terminus)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/EP2017/073293 2016-09-15 2017-09-15 Methods for performing multiplexed real-time pcr Ceased WO2018050828A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
CN201780056666.0A CN109689884A (zh) 2016-09-15 2017-09-15 用于进行多重实时pcr的方法
KR1020197007697A KR102468633B1 (ko) 2016-09-15 2017-09-15 멀티플렉스 실시간 pcr 수행 방법
ES17768768T ES2933176T3 (es) 2016-09-15 2017-09-15 Procedimientos para realizar PCR ultrarrápida multiplexada
EP17768768.8A EP3512960B1 (en) 2016-09-15 2017-09-15 Methods for performing multiplexed real-time pcr
JP2019514212A JP7063886B2 (ja) 2016-09-15 2017-09-15 マルチプレックスリアルタイムpcrを実施する方法
CA3033250A CA3033250C (en) 2016-09-15 2017-09-15 Methods for performing multiplexed real-time pcr
AU2017328617A AU2017328617B2 (en) 2016-09-15 2017-09-15 Methods for performing multiplexed real-time PCR

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201662395325P 2016-09-15 2016-09-15
US62/395,325 2016-09-15
US201662435595P 2016-12-16 2016-12-16
US62/435,595 2016-12-16
US201762536871P 2017-07-25 2017-07-25
US62/536,871 2017-07-25

Publications (1)

Publication Number Publication Date
WO2018050828A1 true WO2018050828A1 (en) 2018-03-22

Family

ID=59901522

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/EP2017/073288 Ceased WO2018050824A1 (en) 2016-09-15 2017-09-15 Methods for performing multiplexed pcr
PCT/EP2017/073293 Ceased WO2018050828A1 (en) 2016-09-15 2017-09-15 Methods for performing multiplexed real-time pcr

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/073288 Ceased WO2018050824A1 (en) 2016-09-15 2017-09-15 Methods for performing multiplexed pcr

Country Status (10)

Country Link
US (3) US11034997B2 (enExample)
EP (2) EP3512959B1 (enExample)
JP (2) JP7063886B2 (enExample)
KR (2) KR102468174B1 (enExample)
CN (2) CN109689884A (enExample)
AU (2) AU2017328613B2 (enExample)
CA (2) CA3033250C (enExample)
DK (1) DK3512959T3 (enExample)
ES (2) ES2933176T3 (enExample)
WO (2) WO2018050824A1 (enExample)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3575406A4 (en) * 2017-01-25 2021-02-24 Sequoia Genetics Co. Ltd. SPECIFIC IDENTIFICATION PROCESS OF DNA SEQUENCES
EP3512960B1 (en) 2016-09-15 2022-10-19 Roche Diagnostics GmbH Methods for performing multiplexed real-time pcr
WO2024234030A1 (en) * 2023-05-15 2024-11-21 Speedx Pty Ltd Target detection using temperature controlled probes
US12385082B2 (en) 2021-09-30 2025-08-12 Gen-Probe Incorporated Temperature-selectable fret cassette signaling

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022269023A1 (en) 2021-06-25 2022-12-29 F. Hoffmann-La Roche Ag Methods for performing temperature multiplexed pcr with increased sensitivity
US20190093155A1 (en) * 2017-05-25 2019-03-28 Roche Molecular Systems, Inc. Multiplex Nucleic Acid Amplification Assay
CN111629831A (zh) 2018-01-22 2020-09-04 卢米耐克斯公司 用于离散解链分析的方法和组合物
US20190292596A1 (en) 2018-03-21 2019-09-26 Roche Molecular Systems, Inc. Modified nucleoside phosphates with high thermal stability
AU2019255933B2 (en) 2018-04-20 2022-08-25 Seegene, Inc. . Method and apparatus for detecting a plurality of target nucleic acid sequences in sample
US11384376B2 (en) 2018-05-31 2022-07-12 Roche Molecular Systems, Inc. Reagents and methods for post-synthetic modification of nucleic acids
WO2020031156A1 (en) 2018-08-09 2020-02-13 Speedx Pty Ltd Multiplex detection of nucleic acids
US11371080B2 (en) 2018-11-30 2022-06-28 Luminex Corporation Methods and probes for performing PCR with melt analysis for increased multiplexing
EP3899035B1 (en) * 2018-12-20 2025-04-16 F. Hoffmann-La Roche AG Detection of target nucleic acid by solid-phase molography
US11441167B2 (en) 2019-11-20 2022-09-13 Roche Molecular Systems, Inc. Compositions and methods for rapid identification and phenotypic antimicrobial susceptibility testing of bacteria and fungi
CN114787286A (zh) 2019-12-09 2022-07-22 豪夫迈·罗氏有限公司 双阳离子荧光染料
CN111534518B (zh) * 2020-05-18 2021-07-23 纳昂达(南京)生物科技有限公司 通用封闭序列及其应用
CA3181184A1 (en) * 2020-06-30 2020-10-15 Speedx Pty Ltd Multiplex detection of nucleic acids using mixed reporters
CN112195221B (zh) * 2020-09-13 2021-08-06 武汉纳诺德医疗科技有限公司 一种多温度单荧光通道多重实时荧光定量pcr仪及其检测方法
AU2021343471A1 (en) * 2020-09-16 2023-05-04 Bruker Spatial Biology, Inc. Chemical compositions and methods of using the same
JP2024500169A (ja) 2020-12-22 2024-01-04 エフ. ホフマン-ラ ロシュ アーゲー 大ストークスシフト蛍光色素を使用して多重化リアルタイムpcrを行うための方法
WO2024002924A2 (en) 2022-06-28 2024-01-04 F. Hoffmann-La Roche Ag Fluorescent dyes with large stokes shift
WO2024106890A1 (ko) * 2022-11-16 2024-05-23 주식회사 씨젠 퀀칭-pto 절단 및 연장(quenching-pto cleavage and extension; q-ptoce) 어세이에 의한 타겟 핵산의 검출
AR132405A1 (es) * 2023-04-19 2025-06-25 Consejo Nacional De Investigaciones Cientificas Y Tecn Conicet Métodos y sistemas para seleccionar biomarcadores basados en metilación del adn para la detección de cáncer colorrectal
WO2025053620A1 (ko) * 2023-09-08 2025-03-13 주식회사 씨젠 3개의 프로브를 이용하여 타겟 핵산을 검출하는 방법
WO2025141105A1 (en) 2023-12-27 2025-07-03 bioMérieux Specific probes for the detection of nucleic acids, methods and uses
EP4606908A1 (en) 2024-02-21 2025-08-27 Roche Diagnostics GmbH Method of increasing the number of usable channels in multiplex pcr

Citations (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4889818A (en) 1986-08-22 1989-12-26 Cetus Corporation Purified thermostable enzyme
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US5079352A (en) 1986-08-22 1992-01-07 Cetus Corporation Purified thermostable enzyme
WO1992006200A1 (en) 1990-09-28 1992-04-16 F. Hoffmann-La-Roche Ag 5' to 3' exonuclease mutations of thermostable dna polymerases
US5210015A (en) 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5352600A (en) 1986-08-22 1994-10-04 Hoffmann-La Roche Inc. Purified thermostable enzyme
US5405774A (en) 1986-08-22 1995-04-11 Hoffmann-La Roche Inc. DNA encoding a mutated thermostable nucleic acid polymerase enzyme from thermus species sps17
US5466591A (en) 1986-08-22 1995-11-14 Hoffmann-La Roche Inc. 5' to 3' exonuclease mutations of thermostable DNA polymerases
US5491063A (en) 1994-09-01 1996-02-13 Hoffmann-La Roche Inc. Methods for in-solution quenching of fluorescently labeled oligonucleotide probes
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5538848A (en) 1994-11-16 1996-07-23 Applied Biosystems Division, Perkin-Elmer Corp. Method for detecting nucleic acid amplification using self-quenching fluorescence probe
US5571673A (en) 1994-11-23 1996-11-05 Hoffmann-La Roche Inc. Methods for in-solution quenching of fluorescently labeled oligonucleotide probes
WO1997009451A1 (en) 1995-09-08 1997-03-13 Life Technologies, Inc. Cloned dna polymerases from thermotoga and mutants thereof
US5618711A (en) 1986-08-22 1997-04-08 Hoffmann-La Roche Inc. Recombinant expression vectors and purification methods for Thermus thermophilus DNA polymerase
US5674738A (en) 1986-08-22 1997-10-07 Roche Molecular Systems, Inc. DNA encoding thermostable nucleic acid polymerase enzyme from thermus species Z05
US5795762A (en) 1986-08-22 1998-08-18 Roche Molecular Systems, Inc. 5' to 3' exonuclease mutations of thermostable DNA polymerases
US5871908A (en) 1992-02-05 1999-02-16 Evotec Biosystems Gmbh Process for the determination of in vitro amplified nucleic acids
US6174670B1 (en) 1996-06-04 2001-01-16 University Of Utah Research Foundation Monitoring amplification of DNA during PCR
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
US6427156B1 (en) 1997-01-21 2002-07-30 Xilinx, Inc. Configurable logic block with AND gate for efficient multiplication in FPGAS
US6472156B1 (en) 1999-08-30 2002-10-29 The University Of Utah Homogeneous multiplex hybridization analysis by color and Tm
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
US20050053939A1 (en) 2001-11-09 2005-03-10 Ahmed Chenna Methods and compositions for enhancing detection in determinations employing cleavable electrophoretic tag reagents
WO2008021446A2 (en) * 2006-08-15 2008-02-21 Genetag Technology, Inc. Probe-antiprobe compositions and methods for dna or rna detection
WO2008104791A1 (en) * 2007-03-01 2008-09-04 Oxitec Limited Methods for detecting nucleic acid sequences
WO2010013017A1 (en) * 2008-07-31 2010-02-04 Oxitec Limited Multiplex amplification and detection
WO2010139937A1 (en) * 2009-06-01 2010-12-09 Oxitec Limited Multiplex amplification and detection
US8133701B2 (en) 2006-12-05 2012-03-13 Sequenom, Inc. Detection and quantification of biomolecules using mass spectrometry
WO2012067831A1 (en) * 2010-11-15 2012-05-24 Exact Sciences Corporation Real time cleavage assay
US8809239B2 (en) 2011-01-11 2014-08-19 Seegene, Inc. Detection of target nucleic acid sequences by PTO cleavage and extension assay
US20140272955A1 (en) 2013-03-15 2014-09-18 Roche Molecular Systems, Inc. Nucleic acid target identification by strucutre based probe cleavage
US20150176075A1 (en) 2013-12-20 2015-06-25 Roche Molecular Systems, Inc. Multiplexed nucleic acid target identification by strucutre based probe cleavage
US20150376681A1 (en) 2013-03-15 2015-12-31 Roche Molecular Systems, Inc. Nucleic acid target identification by strucutre based probe cleavage

Family Cites Families (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4250257A (en) * 1978-08-24 1981-02-10 Technicon Instruments Corporation Whole blood analyses in porous media
US5541311A (en) 1992-12-07 1996-07-30 Third Wave Technologies, Inc. Nucleic acid encoding synthesis-deficient thermostable DNA polymerase
US5843691A (en) * 1993-05-15 1998-12-01 Lifescan, Inc. Visually-readable reagent test strip
US7381532B2 (en) 1999-10-29 2008-06-03 Stratagene California Compositions and methods for the detection of a nucleic acid using a cleavage reaction
US7585632B2 (en) * 1999-10-29 2009-09-08 Hologic, Inc. Compositions and methods for the detection of a nucleic acid using a cleavage reaction
US6893819B1 (en) 2000-11-21 2005-05-17 Stratagene California Methods for detection of a nucleic acid by sequential amplification
BRPI0613592A2 (pt) 2005-07-20 2011-01-18 Bayer Healthcare Llc amperometria conectada por porta
US7833716B2 (en) * 2006-06-06 2010-11-16 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
WO2008046930A1 (en) * 2006-10-20 2008-04-24 Clondiag Gmbh Assay devices and methods for the detection of analytes
US7902345B2 (en) 2006-12-05 2011-03-08 Sequenom, Inc. Detection and quantification of biomolecules using mass spectrometry
WO2008083261A1 (en) 2006-12-29 2008-07-10 Applera Corporation Systems and methods for detecting nucleic acids
US10150990B2 (en) 2008-04-21 2018-12-11 Roche Molecular Systems, Inc. Ribonucleotide tag nucleic acid detection
US20120252015A1 (en) * 2011-02-18 2012-10-04 Bio-Rad Laboratories Methods and compositions for detecting genetic material
KR101073875B1 (ko) * 2008-11-28 2011-10-14 한국생명공학연구원 대장암 진단 마커 및 이를 이용한 대장암 진단방법
US8385895B2 (en) 2008-12-18 2013-02-26 Verizon Patent And Licensing Inc. Updating an operating parameter
US8039215B2 (en) * 2009-03-10 2011-10-18 Roche Molecular Systems, Inc. Multiplex quantitative nucleic acid amplification and melting assay
KR101177320B1 (ko) * 2010-02-26 2012-09-10 문우철 Y형 프로브 및 이것의 변형형, 및 이를 이용한 dna 마이크로어레이, 키트 및 유전자 분석방법
KR20130101952A (ko) * 2012-02-02 2013-09-16 주식회사 씨젠 Pto 절단과 연장-의존적 혼성화를 이용한 타겟 핵산서열의 검출
US20140378327A1 (en) 2013-06-19 2014-12-25 Luminex Corporation Real-time multiplexed hydrolysis probe assay using spectrally identifiable microspheres
WO2015147370A1 (en) 2014-03-28 2015-10-01 Seegene, Inc. Detection of target nucleic acid sequences using different detection temperatures
KR102465287B1 (ko) 2014-08-11 2022-11-09 루미넥스 코포레이션 핵산 검정에서 개선된 용융 판별 및 멀티플렉싱을 위한 프로브
KR102016747B1 (ko) 2014-12-09 2019-09-02 주식회사 씨젠 상이한 검출 온도 및 기준값을 사용한 타겟 핵산 서열의 검출
KR102084405B1 (ko) 2014-12-09 2020-03-04 주식회사 씨젠 타겟 핵산 서열에 대한 시그널의 구별
JP2018500932A (ja) 2014-12-22 2018-01-18 アナーパ バイオテック エー/エス 標的核酸のマルチプレックス検出のためのデュアルクエンチングアッセイ
US10590469B2 (en) * 2016-09-15 2020-03-17 Roche Molecular Svstems, Inc. Methods for performing multiplexed real-time PCR in a self-contained nucleic acid analysis pouch
JP7063886B2 (ja) 2016-09-15 2022-05-09 エフ.ホフマン-ラ ロシュ アーゲー マルチプレックスリアルタイムpcrを実施する方法

Patent Citations (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (enExample) 1985-03-28 1990-11-27 Cetus Corp
US4683195B1 (enExample) 1986-01-30 1990-11-27 Cetus Corp
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US5795762A (en) 1986-08-22 1998-08-18 Roche Molecular Systems, Inc. 5' to 3' exonuclease mutations of thermostable DNA polymerases
US4889818A (en) 1986-08-22 1989-12-26 Cetus Corporation Purified thermostable enzyme
US5079352A (en) 1986-08-22 1992-01-07 Cetus Corporation Purified thermostable enzyme
US5618711A (en) 1986-08-22 1997-04-08 Hoffmann-La Roche Inc. Recombinant expression vectors and purification methods for Thermus thermophilus DNA polymerase
US5674738A (en) 1986-08-22 1997-10-07 Roche Molecular Systems, Inc. DNA encoding thermostable nucleic acid polymerase enzyme from thermus species Z05
US5352600A (en) 1986-08-22 1994-10-04 Hoffmann-La Roche Inc. Purified thermostable enzyme
US5405774A (en) 1986-08-22 1995-04-11 Hoffmann-La Roche Inc. DNA encoding a mutated thermostable nucleic acid polymerase enzyme from thermus species sps17
US5466591A (en) 1986-08-22 1995-11-14 Hoffmann-La Roche Inc. 5' to 3' exonuclease mutations of thermostable DNA polymerases
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US5210015A (en) 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5487972A (en) 1990-08-06 1996-01-30 Hoffmann-La Roche Inc. Nucleic acid detection by the 5'-3'exonuclease activity of polymerases acting on adjacently hybridized oligonucleotides
US5804375A (en) 1990-08-06 1998-09-08 Roche Molecular Systems, Inc. Reaction mixtures for detection of target nucleic acids
WO1992006200A1 (en) 1990-09-28 1992-04-16 F. Hoffmann-La-Roche Ag 5' to 3' exonuclease mutations of thermostable dna polymerases
US5871908A (en) 1992-02-05 1999-02-16 Evotec Biosystems Gmbh Process for the determination of in vitro amplified nucleic acids
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5491063A (en) 1994-09-01 1996-02-13 Hoffmann-La Roche Inc. Methods for in-solution quenching of fluorescently labeled oligonucleotide probes
US5538848A (en) 1994-11-16 1996-07-23 Applied Biosystems Division, Perkin-Elmer Corp. Method for detecting nucleic acid amplification using self-quenching fluorescence probe
US5571673A (en) 1994-11-23 1996-11-05 Hoffmann-La Roche Inc. Methods for in-solution quenching of fluorescently labeled oligonucleotide probes
WO1997009451A1 (en) 1995-09-08 1997-03-13 Life Technologies, Inc. Cloned dna polymerases from thermotoga and mutants thereof
US6174670B1 (en) 1996-06-04 2001-01-16 University Of Utah Research Foundation Monitoring amplification of DNA during PCR
US6245514B1 (en) 1996-06-04 2001-06-12 University Of Utah Research Foundation Fluorescent donor-acceptor pair with low spectral overlap
US6427156B1 (en) 1997-01-21 2002-07-30 Xilinx, Inc. Configurable logic block with AND gate for efficient multiplication in FPGAS
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
US6472156B1 (en) 1999-08-30 2002-10-29 The University Of Utah Homogeneous multiplex hybridization analysis by color and Tm
US20050053939A1 (en) 2001-11-09 2005-03-10 Ahmed Chenna Methods and compositions for enhancing detection in determinations employing cleavable electrophoretic tag reagents
WO2008021446A2 (en) * 2006-08-15 2008-02-21 Genetag Technology, Inc. Probe-antiprobe compositions and methods for dna or rna detection
US8133701B2 (en) 2006-12-05 2012-03-13 Sequenom, Inc. Detection and quantification of biomolecules using mass spectrometry
WO2008104791A1 (en) * 2007-03-01 2008-09-04 Oxitec Limited Methods for detecting nucleic acid sequences
WO2010013017A1 (en) * 2008-07-31 2010-02-04 Oxitec Limited Multiplex amplification and detection
WO2010139937A1 (en) * 2009-06-01 2010-12-09 Oxitec Limited Multiplex amplification and detection
WO2012067831A1 (en) * 2010-11-15 2012-05-24 Exact Sciences Corporation Real time cleavage assay
US8809239B2 (en) 2011-01-11 2014-08-19 Seegene, Inc. Detection of target nucleic acid sequences by PTO cleavage and extension assay
US20140272955A1 (en) 2013-03-15 2014-09-18 Roche Molecular Systems, Inc. Nucleic acid target identification by strucutre based probe cleavage
US20150376681A1 (en) 2013-03-15 2015-12-31 Roche Molecular Systems, Inc. Nucleic acid target identification by strucutre based probe cleavage
US20150176075A1 (en) 2013-12-20 2015-06-25 Roche Molecular Systems, Inc. Multiplexed nucleic acid target identification by strucutre based probe cleavage

Non-Patent Citations (16)

* Cited by examiner, † Cited by third party
Title
"PCR Applications", 1999, ACADEMIC PRESS
"PCR Protocols", 1990, ACADEMIC PRESS
"PCR Strategies", 1995, ACADEMIC PRESS
"PCR Technology", 1989, STOCKTON PRESS
DERVAN, SCIENCE, vol. 232, 1986, pages 464 - 471
HOLLAND ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1988, pages 7276 - 7280
HOLLAND ET AL., PROC. NATL. ACAD. SCI., vol. 88, 1991, pages 7276 - 7280
HUANG SHIHAI ET AL: "Thermodynamically modulated partially double-stranded linear DNA probe design for homogeneous real-time PCR", NUCLEIC ACIDS RESEARCH, INFORMATION RETRIEVAL LTD, vol. 35, no. 16, 1 January 2007 (2007-01-01), pages E101 - 1, XP002545144, ISSN: 0305-1048, [retrieved on 20070809], DOI: 10.1093/NAR/GKM551 *
IKEHARA ET AL., NUCLEIC ACIDS RES., vol. 5, 1978, pages 3315
INNIS ET AL: "PCR Protocols: A Guide to Methods and Applications", 1990
INOUE ET AL., NUCLEIC ACIDS RES., vol. 15, 1987, pages 6131
NORDLUND ET AL., J. BIOL. CHEM., vol. 278, no. 4, 2003, pages 2479 - 2483
RAHMAN ET AL., J. AM. CHEM. SOC., vol. 130, no. 14, 2008, pages 4886 - 4896
RIRIE ET AL.: "Product differentiation by analysis of DNA melting curves during the polymerase chain reaction", ANAL. BIOCHEM., vol. 245, 1997, pages 154 - 160, XP002996474, DOI: doi:10.1006/abio.1996.9916
SPARANO ET AL.: "Development of the 21-gene assay and its application in clinical practice and clinical trials", J. CLIN. ONCOL., vol. 26, no. 5, 2008, pages 721 - 728, XP009132686
WHITE ET AL., NATURE, vol. 391, 1998, pages 468 - 471

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3512960B1 (en) 2016-09-15 2022-10-19 Roche Diagnostics GmbH Methods for performing multiplexed real-time pcr
EP3575406A4 (en) * 2017-01-25 2021-02-24 Sequoia Genetics Co. Ltd. SPECIFIC IDENTIFICATION PROCESS OF DNA SEQUENCES
US12385082B2 (en) 2021-09-30 2025-08-12 Gen-Probe Incorporated Temperature-selectable fret cassette signaling
WO2024234030A1 (en) * 2023-05-15 2024-11-21 Speedx Pty Ltd Target detection using temperature controlled probes

Also Published As

Publication number Publication date
CA3036119C (en) 2022-09-20
KR102468174B1 (ko) 2022-11-17
AU2017328613A1 (en) 2019-03-07
ES2893411T3 (es) 2022-02-09
CA3033250A1 (en) 2018-03-22
AU2017328613B2 (en) 2023-05-18
US11345958B2 (en) 2022-05-31
CA3033250C (en) 2023-08-15
CN109689884A (zh) 2019-04-26
JP7221199B2 (ja) 2023-02-20
EP3512959B1 (en) 2021-08-11
AU2017328617A1 (en) 2019-02-28
JP2019528726A (ja) 2019-10-17
CA3036119A1 (en) 2018-03-22
US20210269857A1 (en) 2021-09-02
JP2019532628A (ja) 2019-11-14
EP3512959A1 (en) 2019-07-24
US11034997B2 (en) 2021-06-15
EP3512960B1 (en) 2022-10-19
KR102468633B1 (ko) 2022-11-18
KR20190046881A (ko) 2019-05-07
WO2018050824A1 (en) 2018-03-22
DK3512959T3 (da) 2021-10-18
US20180073064A1 (en) 2018-03-15
US11028433B2 (en) 2021-06-08
EP3512960A1 (en) 2019-07-24
JP7063886B2 (ja) 2022-05-09
ES2933176T3 (es) 2023-02-02
US20180073056A1 (en) 2018-03-15
KR20190046880A (ko) 2019-05-07
CN109689889A (zh) 2019-04-26
AU2017328617B2 (en) 2023-06-29

Similar Documents

Publication Publication Date Title
US11345958B2 (en) Methods for performing multiplexed real-time PCR
US11198903B2 (en) Methods for performing multiplexed real-time PCR
EP3682030B1 (en) Improved polynucleotide sequence detection method
EP4359561A1 (en) Methods for performing temperature multiplexed pcr with increased sensitivity
EP3899035B1 (en) Detection of target nucleic acid by solid-phase molography
US20250382664A1 (en) Improved detection of lamp amplification products
US20240287584A1 (en) Methods for performing temperature multiplexed pcr with increased sensitivity
WO2023118399A1 (en) Improved detection of lamp amplification products

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17768768

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3033250

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2017328617

Country of ref document: AU

Date of ref document: 20170915

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019514212

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20197007697

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017768768

Country of ref document: EP

Effective date: 20190415