WO2018021761A1 - 구강 세균의 군집을 이용한 대사증후군 또는 대사증후군 관련 질환 위험 예측 또는 진단용 조성물 - Google Patents

구강 세균의 군집을 이용한 대사증후군 또는 대사증후군 관련 질환 위험 예측 또는 진단용 조성물 Download PDF

Info

Publication number
WO2018021761A1
WO2018021761A1 PCT/KR2017/007841 KR2017007841W WO2018021761A1 WO 2018021761 A1 WO2018021761 A1 WO 2018021761A1 KR 2017007841 W KR2017007841 W KR 2017007841W WO 2018021761 A1 WO2018021761 A1 WO 2018021761A1
Authority
WO
WIPO (PCT)
Prior art keywords
metabolic syndrome
strain
sample
risk
oral
Prior art date
Application number
PCT/KR2017/007841
Other languages
English (en)
French (fr)
Inventor
고광표
시지연
이정훈
Original Assignee
주식회사 고바이오랩
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 고바이오랩, 서울대학교 산학협력단 filed Critical 주식회사 고바이오랩
Priority to US16/316,662 priority Critical patent/US11365452B2/en
Priority to EP17834703.5A priority patent/EP3489365A4/en
Publication of WO2018021761A1 publication Critical patent/WO2018021761A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/025—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56911—Bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/205—Aptamer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/04—Endocrine or metabolic disorders
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/50—Determining the risk of developing a disease

Definitions

  • Obesity refers to the accumulation of unnecessary excess fat, and has a wide range of complications including cardiovascular disease, diabetes, arthritis, hyperlipidemia. They are caused by a combination of environmental and genetic factors due to Western dietary changes and lack of exercise, and metabolic syndrome is known to have multiple risk factors. All factors of metabolic syndrome are related to insulin resistance and therefore insulin resistance is considered to be the most convincing cause of metabolic syndrome along with obesity.
  • the criteria used to define metabolic syndrome vary in value and content from institution to organ, so the prevalence and risk vary according to the criteria used.
  • the World Health Organization ( ⁇ 0) and the European Society for the Study of Resistance to Resistance (EGIR) define Zune, which focuses primarily on insulin resistance, but _ and national collaborative education programs (NCEP ATP). III) is practical to meet abdominal obesity but does not reflect insulin resistance.
  • Ambiguous diagnostic criteria are problematic at the time of defining patients with metabolic syndrome, but also cause difficulties in establishing metabolic syndrome specific treatment. Therefore, the development of existing incomplete diagnostic criteria and the development of new diagnostic methods covering all criteria The need is raised.
  • the present invention relates to the metabolic syndrome or metabolic syndrome in a non-invasive manner using one or more microorganisms selected from the group consisting of Neisseria genus strains, Granulicatella strains and Peptococcus strains.
  • An object of the present invention is to provide a composition for predicting or diagnosing a metabolic syndrome or metabolic syndrome-related disease risk for predicting or diagnosing a risk of a disease, or a kit for predicting or diagnosing a metabolic syndrome or metabolic syndrome-related disease risk.
  • Another object of the present invention after treating the candidate agent for treating metabolic syndrome or metabolic syndrome-related diseases, Neisseria spp., Granullicatella spp. And Peptococcus spp. It provides a screening method for treating a metabolic syndrome or metabolic syndrome-related disease treatment, comprising detecting a change in at least one microbial community selected from the group consisting of strains.
  • Ney sser ia strains are Gram-negative (Gram-negat ive) bacteria, for example, Neisseria iltongata (N. elongata) Neisseria meningitides (N. meningi t ides) and Neisseria gonoria (N. ronorrhoeae), preferably The Neisseria genus strain may be Neisseria iltonggatile ' . Strains of the genus Granul i catel la were initially classified as nutr it ional ly var i ant streptococcus (NVS), and are mainly found in the respiratory, gastrointestinal, and genital organs and have been reported to cause endocarditis clinically. It is becoming.
  • the genus of the strains of the genus Granullycatella may include, for example, Granullycatella adiasense, which has a stronger infectivity than other oral bacteria. Strong adhesion is known to be
  • the Neisseria spp., Granulica castella spp. And Peptococcus spp. Strains are microorganisms in the oral cavity, and accordingly, the composition of the present invention is applied to metabolic syndrome or metabolic syndrome, characterized in that it is applied to a sample collected in the oral cavity. It may be a risk predictive or diagnostic composition.
  • diagnostic marker or diagnostic marker 1 used in the present invention is a substance used as a standard for distinguishing a condition between a metabolic syndrome and a non-diabetic condition, and in a sample having a metabolic syndrome or metabolic syndrome-related disease compared to a normal sample. Various organic biomolecules showing an increase or decrease, etc.
  • the diagnostic markers of the present invention are characterized by specific high or low levels of expression in a sample of a patient with metabolic syndrome or metabolic syndrome related disease. — Neacera spp., Granulica: Telaxe spp., And / or Tococcus spp. Microorganism or community.
  • the detectable agent refers to a substance that can be used to detect the presence of Neisseria, Granullia catella and / or peptococcus which are diagnostic markers of metabolic syndrome or metabolic syndrome related disease in a sample.
  • Organics such as proteins, nucleic acids, lipids, glycolipids, glycoproteins, or sugars (monosaccharides, disaccharides, oligosaccharides, etc.) that are specifically present in Neisseria, Granulya catella and / or peptococcus.
  • the primer used in the present invention is a genus of Neisseria (Farrel 1, J., et al., Variations of oral microbiota are associated with pancreatic diseases including pancreat ic cancer.GUT, 2012.61: p. 582-588) Nuricatella genus strains (Farrell, J., et al., Variations of oral microbiota are associated with pancreatic diseases including pancreatic cancer.GUT, 2012.61: p.
  • the 16s rRNA is an rRNA constituting the 30S subunit of prokaryotic ribosomes. Most of the nucleotide sequence is preserved considerably, while high nucleotide sequence diversity is shown in some sections. In particular, since there is little diversity among homogeneous species, while diversity appears among other species, prokaryotes can be usefully identified by comparing sequences of 16S rRNA.
  • the metabolic syndrome may be at least one selected from the group consisting of obesity, hypertension, hyperglycemia, hyperlipidemia, for example hypertriglyceridemia and low HDL cholesterol, preferably three, more preferably five It may be a condition having abnormal symptoms.
  • the metabolic disease (metabolic di sease, met abolic di order) means a disease originating from metabolic abnormalities such as glucose fat, protein, and the like.
  • composition of the present invention can be used for predicting or diagnosing the risk of metabolic syndrome satisfying one or more, preferably three or more criteria selected from the group consisting of 1) to 5).
  • HDL cholesterol content in blood less than 40 mg / dL for men, less than 50 mg / dL for women;
  • the selection criteria may be used to predict or diagnose the risk of metabolic syndrome or metabolic syndrome related disease when the subject is an Asian.
  • the risk prediction refers to determining whether a test subject is likely to develop a metabolic syndrome or a metabolic syndrome-related disease, and the time of onset through special and appropriate management of a subject at high risk of developing a metabolic syndrome or metabolic syndrome-related disease. It can be used clinically to make treatment decisions by delaying or preventing the onset of disease, or by selecting the most appropriate treatment mode.
  • diagnosis means confirming the presence or characteristics of a pathological condition, For the purpose, diagnosis can mean confirming the development of metabolic disease.
  • the microorganism detection agent of the present invention Composition comprising, may be provided in the form of a metabolic syndrome or metabolic syndrome related disease risk prediction or diagnostic kit form.
  • the kit of the present invention not only comprises a detection agent for primers, probes, antisense oligonucleotides, aptamers and / or antibodies for detecting the microorganisms, but also one or more other component compositions, solutions, or devices suitable for analytical methods. May be included.
  • Matters regarding the metabolic syndrome or metabolic syndrome-related disease risk prediction or diagnostic composition may be applied to the metabolic syndrome or metabolic syndrome-related disease risk prediction or diagnostic kit.
  • the kit may be applied to a sample collected in the oral cavity. Specifically, the kit may predict or diagnose a risk of metabolic syndrome or metabolic syndrome-related diseases by a non-invasive method.
  • the kit may further include at least one oral sampling device selected from the group consisting of an absorbent pad, a cotton swab, an eyedropper, a spoon, a swab, and a toothpick for oral sampling of a subject. Anything that can be collected is not limited thereto.
  • the kit may further include instructions to collect a sample of the subject in the oral cavity in order to predict or diagnose the risk of metabolic syndrome or metabolic syndrome-related diseases.
  • the present invention is to provide information necessary for predicting or diagnosing the risk of metabolic syndrome or metabolic syndrome-related diseases, strains of Neisseria, Granula Catella spp. And Peptococcus spp. It relates to a method for detecting one or more microorganisms selected from the group consisting of strains.
  • the method includes detecting at least one microorganism selected from the group consisting of Neisseria spp., Granullycatella spp.
  • Peptococcus spp . risk of metabolic syndrome or metabolic syndrome related disease.
  • Methods for predicting or diagnosing or providing information necessary for predicting or diagnosing the risk of metabolic syndrome or metabolic syndrome related diseases are provided. Matters relating to the composition for predicting or diagnosing the risk of metabolic syndrome or metabolic syndrome-related disease may be provided by the microorganism detection method, or the method of predicting or diagnosing the metabolic syndrome risk, or providing the information necessary to predict or diagnose the metabolic syndrome or metabolic syndrome-related disease risk.
  • the method comprises the steps of: taking a sample of the subject; (b) extracting genomic DNA from the sample; (c) reacting the extracted genomic DNA with a primer specific for one or more microorganisms selected from the group consisting of Neisseria spp., Granullycatella spp. and Peptococcus spp. And (d) amplifying the counterungmul.
  • sample 1 of the subject is taken from the body of a patient with metabolic syndrome or metabolic syndrome-related disease or a person with metabolic syndrome or metabolic syndrome-related disease, tissue, cells, whole blood, serum , Samples such as plasma saliva or urine, and the like, for example, the oral cavity of the test subject, preferably oral epithelial cells, oral blood, oral saliva, oral tartar, oral plasma, and a solution containing the same It may be a tissue sample collected from one or more selected from the group consisting of.
  • the method used for diagnosing metabolic syndrome has a problem of causing additional stress due to invasive blood collection and fasting blood glucose measurement.
  • the present invention uses a non-invasive method, in particular, a sample collected by an oral sampling method. This can reduce the stress of the subject.
  • Extraction of genomic DNA from the test subject's sample in step (b) may be carried out by applying general techniques known in the art, and in step (c) Neisseria spp., Granulicatella spp. And / or Primers specific for the peptococcus strain are as described above.
  • the method of amplifying the reaction product in step (d) may include general amplification techniques known in the art, such as polymerase chain reaction, SYBR real-time PCR, reverse transcriptase-polymerase chain reaction, multiplex PCR, touchdown PCR, hot Start PCR, nested PCR, booster PCR, real-time PCR, fractional display PCR, rapid amplification of cDNA ends, inverse PCR, backtore PCR, TAIL-PCR, ligase chain reaction, repair chain reaction, transcription-mediated amplification, self-maintenance Sequence replication, selective amplification of the target sequence can be used, but the scope of the present invention is not limited thereto.
  • general amplification techniques known in the art, such as polymerase chain reaction, SYBR real-time PCR, reverse transcriptase-polymerase chain reaction, multiplex PCR, touchdown PCR, hot Start PCR, nested PCR, booster PCR, real-time PCR, fractional display PCR, rapid amplification of
  • the step of comparing the amount of amplification products of the reactant with the amplification product of the normal control sample may be further performed, and the amplification product of the test subject sample is significantly compared to the amplification product of the normal control sample. If it is judged to be increased or decreased, the subject may predict that there is a risk of metabolic syndrome or metabolic syndrome-related disease or that there is a metabolic syndrome.
  • the amplification product of one or more microorganisms selected from the group consisting of Neisseria spp. And Granulicatella spp. Strain of the test subject is higher than the normal control sample, there is a risk of metabolic syndrome or metabolic syndrome-related disease. It can be predicted or diagnosed as having metabolic syndrome.
  • the absolute quantitative value of (P) is 1.01 To 5.00, preferably 1.01 to 2.00, or 2.00 to 3.50, it may be predicted that there is a risk of metabolic syndrome or metabolic syndrome-related disease or diagnosed as having a metabolic syndrome or metabolic syndrome-related disease. For example, when the P value is 2.00 to 3.50, it may be predicted that there is a risk of high blood pressure or diagnosed as having high blood pressure.
  • P (absolute quantitative value of the genomic DNA amplification product of the strain in the detection sample) / (absolute quantitative value of the genomic DNA amplification product of the strain in the normal sample)
  • P value of the generated Neisseria strains is 1. 1 or more, preferably The risk of metabolic syndrome or metabolic syndrome-related disease may be predicted or diagnosed when P is 1. 1 and / or when the P-value of the genus Granulincaella is greater than or equal to 1.4, preferably 1.4.
  • the amount of amplification products of the peptococcus strain of the test subject sample is lower than that of the normal prairie sample, it may be predicted that there is a risk of metabolic syndrome or metabolic syndrome-related disease or diagnosed as having a metabolic syndrome or metabolic syndrome-related disease. Can be. ⁇
  • the absolute quantitative value of the amplification product of the peptococcus strain of the normal control sample except the outlier is excluded. If the absolute quantitative value (P) of the amplified product of the detection sample of the subject is 0.01 to 0.99, preferably 0.05 to 0.90, it is predicted that there is a risk of metabolic syndrome or metabolic syndrome-related disease or a disease related to metabolic syndrome or metabolic syndrome. It can be diagnosed as having. For example, when the P value is 0.05 to 0.90, it may be predicted that there is a risk of hypertension or diagnosed as having hypertension.
  • the P value of the strain of peptococcus is less than 0.6, or more preferably 0.6, it may be predicted or diagnosed as a risk of metabolic syndrome. have.
  • Strain of the test subject sample absolute quantitative value of the peptococcus strain amplification product in the sample: the absolute quantification of the Granulica cata strain amplification product in the sample. If the value is lower than the normal control sample, it may be predicted that there is a risk of metabolic syndrome or metabolic syndrome-related disease or diagnosed as having metabolic syndrome or metabolic syndrome-related disease.
  • the genomic DNA amplification step may include a lower limit value selected from the group consisting of 0.01, 0.03, 0.05, and 0.22 of the amplification products of the peptococcus strain and the Granulellicatella strain by SYBR real-time detection.
  • a range consisting of 0.62, 1.4, and 1.5 selected upper limits may predict that there is a risk of metabolic syndrome or metabolic syndrome-related disease or be diagnosed with metabolic syndrome or metabolic syndrome-related disease.
  • genomic DNA sequencing is performed by large-scale sequencing, the genome frequency ratio of the strains of the genus Peptococcus and the genus Granullycatella is estimated to be at risk of metabolic syndrome or metabolic syndrome-related diseases. Or metabolic syndrome or metabolic syndrome-related diseases.
  • the present invention was first identified that the population of Neisseria spp., Granulicatella spp. And / or Peptococcus spp. Specifically increases or decreases in patients with metabolic syndrome or metabolic syndrome-related disease.
  • the disease can be used for metabolic syndrome or metabolic syndrome-for treatment of related diseases-by using the link between the populations of the Granullycatella genus and / or the Tempococcus strain. . ⁇ ⁇ -In one preferred embodiment, the present invention is a group of one or more microorganisms selected from the group consisting of Neisseria spp., Granullycatella spp. And Peptococcus spp. After treating candidates for preventing or treating metabolic syndrome.
  • the present invention provides a method for comparing the change of Neisseria spp., Granullycatella spp. And / or Peptococcus spp. Strain in the sample in the presence or absence of a candidate for preventing or treating metabolic syndrome or metabolic syndrome-related diseases. It can be applied to screening for the prevention or treatment of metabolic syndrome. In other words, in the presence or absence of candidates for the prevention or treatment of metabolic syndrome, the degree of colonization of the strains of Neisseria spp., Granulicatella spp. And / or Peptococcus spp. If the formation of colonies further decreases when a substance is present, the candidate can be developed as a preventive or therapeutic agent for metabolic syndrome.
  • the candidate substance includes various low molecular weight compounds, high molecular weight compounds, nucleic acid molecules (eg, DNA, RNA, PNA, etc.), proteins, sugars, and lipids, which may be agents for preventing or treating metabolic syndrome or diseases related to metabolic syndrome. It is not limited.
  • nucleic acid molecules eg, DNA, RNA, PNA, etc.
  • the composition of the present invention provides a strain of Neisseria spp., Granulicatella spp. And / or Peptococcus spp. As a new biomarker for predicting or diagnosing the risk of metabolic syndrome or metabolic syndrome-related diseases. How to increase the accuracy of prevention or diagnosis. In addition to being able to sample in a non-invasive manner, it is useful because it does not require fasting conditions before sampling. In addition, it can be used as a target for the development and control of new drugs for the prevention or treatment of metabolic syndrome or metabolic syndrome-related diseases. [Brief Description of Drawings]
  • 2 is a result of analyzing the colony structure of the oral flora according to the metabolic syndrome.
  • 3 is a result of analyzing the cluster characteristics of the oral flora through network analysis.
  • Figure 5 shows the oral bacteria increase in the metabolic syndrome group and the normal control group using LEfSE software, a univariate analysis tool.
  • Figure 6 shows the relationship between metabolic syndrome and specific oral bacteria using MaAsLin, a multivariate analysis tool that corrects bilateral relationships, sex, and age.
  • Figure 8 is the result of the absolute change of granulellicatella bacteria according to each clinical indicator that can define metabolic syndrome.
  • Figure 9 is the result of measuring the ratio of peptococcus and granulin catella resulting from the absolute quantitative analysis of oral bacteria.
  • Figure 10 is the result of measuring the ratio of the peptococcus and Granullycatella relative quantitative value as a result of oral micronasal analysis.
  • the first molar calculus in the oral cavity was obtained by selecting patients with healthy metabolic syndrome and healthy subjects. Tartar samples collected with sterilized toothpicks were stored frozen at -80 in a salt solution containing 0.9% NaCl. The criteria used to select the metabolic syndrome patients were selected as patients with metabolic syndrome when three or more of the following five criteria were satisfied.
  • blood triglyceride content 150 mg / dL or more
  • blood HDL cholesterol content male less than 40 mg / dL, female less than 50 mg / dL;
  • Example 3 Oral Bacteria 16S rRNA Gene Sequencing Using Next-Generation Sequencing
  • DNA extracted in Example 2 was PCR amplified using 515F / 806R primer (Macrogen, Ultra-high-throughput microbial community analysis on the 11 lumina HiSeq and MiSeq platforms) targeting the V4 region of bacteria.
  • the primers include a forward primer consisting of SEQ ID NO: 4 and a reverse primer consisting of SEQ ID NO: 5, using the PCR amplification. Table 2
  • the forward primer sequence is from left to right in the adapter sequence (5 ′ ⁇ AATGATACGGCGACCACCGAGATCTACAC-3 ′), pad sequence (5′-TATGGTAATT-3 ′), linker sequence (5′-GT-3 ′), and conserved bacterial primers 515F (5'- GTGCCAGCMGCCGCGGTAA-3 '), the reverse primer sequence from left to right is Illumina MiSeq compatible adapter sequence (5'- CAAGCAGAAGACGGCATACGAGAT-3'), 12-barcode sequence, pad sequence (5'— AGTCAGTCAG-3 ′), linker sequence (5′-CC-3 ′), and conserved bacterial primer 806R (5′-GGACTACHVGGGTWTCTAAT-3 ′).
  • the PCR mixture was 50ul in total with 10 X half-buffer, 2.5mM dNTP, 12.5pmole primer, 2.5U G-Taq polymerase
  • PCR reactions consisted of denaturation at 94 for 3 minutes, 45 at 94, 45 at 50, 60 seconds and 72 at 90 seconds, and final extension at 72 to 10 minutes.
  • the amplification products were sequenced using Illumina's MiSeq instrument.
  • Example 4 Oral Bacteria Total Analysis Using 16S rRNA
  • Example 6 Oral Bacterial Biomarker Analysis for Metabolic Syndrome Diagnosis Univariate analysis was performed using LEfSe to identify oral bacterial biomarkers for diagnosing metabolic syndrome.
  • LEfSe is an analytical tool that identifies microbial biomarkers through Kruskal-Wi 11 is analysis and then verifies the initial analysis results through Wilcoxon rank-sum analysis. After biomarker verification, the effect of biomarker was identified through linear discriminant analysis (LDA) analysis of LEfSe software (Segata, N., et al., Metagenomic biomarker discovery and explanation.Genome Biol., 2011. 12 (6): p. R60.). Through univariate analysis Oral bacterial biomarker analysis showed that Neisseria spp.
  • LDA linear discriminant analysis
  • SYBR real-t ime PCR one of the methods of quantitative PCR to confirm the possibility of metabolic syndrome detection by detecting three oral bacterial guns that were analyzed as being significantly related to metabolic syndrome in Examples 6 and 7
  • the absolute amounts of Neisseria spp., Granullycatella spp. And Peptokoccus spp. Strains each subject actually possessed were measured.
  • cultured strains of peptococcus, neisseria, and granulica telella (type strain) extracted DNA, amplified by PCR, and 10 times continuous product from cloning Dilution was used.
  • Real-time PCR was performed on the DNA of bacteria extracted in Example 2 together with the prepared standard curve.
  • Real ⁇ time PCR mixture consists of 25ul of SYBR master mix (Appl ied Biosystems, Foster Ci ty, CA), 50pmole primer, PCR reaction denatured from 95 to 15 minutes, 95 to 30 seconds, 60 to 1 minute And 40 repetitions of 72 to 30 seconds Was done.
  • the ratios of peptococcus and granulin catella of normal and metabolic syndrome groups were calculated using the genome copy number of bacteria calculated by real-ime PCR analysis. The ratio was calculated by dividing the number of genome copies of the peptococcus by the number of genome copies of Granullycatella. In addition, the same analysis was performed based on the oral bacteria and relative frequency calculated by large-scale sequencing.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Virology (AREA)
  • Food Science & Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Toxicology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 대사증후군 또는 대사증후군 관련 질환의 위험성을 예측하거나 진단할 수 있는 마커 및 이의 이용에 관한 것이다. 보다 상세하게, 본 발명은 검체 시료로부터 네이세리아 속 균주, 그란눌리아카텔라 속 균주 및 /또는 펩토코커스 속 균주를 검출함으로써, 대사증후군 또는 대사증후군 관련 질환의 위험성의 예측 또는 진단용 조성물, 키트 및 진단 방법에 관한 것이다.

Description

【명세서】
【발명의 명칭】
구강 세균의 군집을 이용한 대사증후군 또는 대사증후군 관련 질환 위험 예측 또는 진단용 조성물
【기술분야】
본 발명은 구강 미생물 (oral microbiome)을 활용하여 대사증후군 또는 대사증후군 관련 질환의 위험도 예측 또는 진단을 위한 바이오마커 및 이를 이용한 대사성 증후군 또는 대사증후군 관련 질환의 위험도를 비침습적으로 예측 또는 진단하는 용도에 관한 것이다.
【배경기술】
비만이란 불필요한 과다지방이 축적된 상태를 의미하며， 심혈관계 질환, 당뇨， 관절염， 고지혈증을 아우르는 폭넓은 합병증을 가지고 있다. 이들은 서구식 식단변화와 운동부족으로 인한 환경적 요인과 유전적 요인이 복합적인 원인으로 작용하여 발병하게 되는데 특히 이러한 질병의 위험인자를 동시다발적으로 가지고 있는 경우를 대사증후군이라 한다. 대사증후군의 모든 요소는 인술린 저항성과 관련이 있으며 따라서 인슐린 저항성이 비만과 더불어 대사증후군의 가장 설득력 있는 원인으로 지목되고 있다.
대사증후군을 정의하기 위해 사용되는 기준은 기관마다 수치와 내용을 달리하므로 사용된 기준에 따라 유병를과 위험도가 바뀌게 된다. 예를 들어, 세계보건기구 (冊 0)와 유럽인슬린저항성연구회 (EGIR)는 인술린 저항성에 주로—초점을 맞춘 zᅵ준을―정의ᅭ를 하고 있으나 _， 국가 콜ᅵ레스테를 교육프로그램 (NCEP ATP I I I )의 경우 복부비만에 기준을 맞춰 실용적이지만 인술린 저항성을 잘 반영하지 못한다. 기준치의 근거가 모호한 진단 기준은 대사증후군 환자를 정의하는 시점부터 문제가 되지만 대사증후군 특이적 치료방법을 구축하는데도 어려움을 야기시킨다. 따라서 기존의 블완전한 진단 기준을 발전시키고 모든 기준을 아우르는 새로운 진단 방법의 필요성이 제기되고 있다.
차세대 염기서열 분석방법을 이용하는 미생물 분석을 통해 비배양성을 포함한 모든 미생물총의 분석으로 미생물의 종을 알아낼 수 있다. 이는 모든 박테리아에 공통적으로 존재하는 보존영역인 16S ribosomal RNA gene (16S rRNA)과 초가변영역 (hypervar iable region)을 이용하여 미생물의 종을 알아내는 방법으로써 미생물 유전체의 다양성과 질환과의 연관성을 규명하는 연구가 시행되고 있다. 이러한 미생물 분석은 기존의 박테리아와 질병과의 연관성을 배양가능성이라는 제한점에서 해방시켜 전체적인 관점에서 재조명시켰다는데 큰 발전을 가져왔으며 특히 장내 미생물과 비만의 역학관계를 입증시키기도 하였다.
【발명의 상세한 설명】
【기술적 과제】
본 발명은 네이세리아 (Neisseria)속 균주， 그란눌리카텔라 (Granulicatella)속 균주 및 펩토코커스 (Peptococcus)속 균주로 이루어진 군에서 선택된 1종 이상의 미생물을 이용하여 비침습적 방법으로 대사증후군 또는 대사증후군 관련 질환의 위험도를 예측하거나 진단하기 위한 대사증후군 또는 대사증후군 관련 질환 위험도 예측 또는 진단용 조성물， 또는 이를 포함하는 대사증후군 또는 대사증후군 관련 질환 위험도 예측 또는 진단용 키트를 제공하는 것을 목적으로 한다.
본 발명의 또 다른 목적은 대사증후군 또는 대사증후군 관련 질환의 위험도 예측 또는 진단에 필요한 정보를 제공하기 위하여， 피시험자의 시료로부터 네이세리아 (Neisseria)속 균주， 그란눌리카텔라 (Granulicatella)속 균주 및 펩토코커스 (Peptococcus)속 균주로 이루어진 군에서 선택된 1종 이상의 미생물을 검출하는 방법 또는 검출용 키트를 제공하는 것이다.
본 발명의 또 다른 목적은， 대사증후군 또는 대사증후군 관련 질환 치료제 후보물질을 처리한 후 네이세리아 (Neisseria)속 균주， 그란눌리카텔라 (Granulicatella)속 균주 및 펩토코커스 (Peptococcus)속 균주로 이루어진 군에서 선택된 1종 이상의 미생물 군집의 변화를 검출하는 단계를 포함하는， 대사증후군 또는 대사증후군 관련 질환 치료제의 스크리닝 방법을 제공하는 것이다. 【기술적 해결방법】
이에 본 발명자들은 상기 목적을 달성하기 위하여， 건강한 한국인 쌍등이를 대상으로 하여 미생물과 대사증후군의 임상 의학적 지표들의 관련성을 규명하였으며， 이를 토대로 대사증후군의 발생 및 위험도 등을 조기에 진단하는 기술을 개발하였다.
본 발명의 일 예는 네이세리아 (Nei sser i a) 속 균주， 그란눌리카텔라 (Granul icatel l a)속 균주 및 펩토코커스 (Peptococcus)속 균주로 이루어진 군에서 선택된 1 이상의 미생물을 검출할 수 있는 제제를 포함하는， 대사증후군 또는 대사증후군 관련 질환 위험도의 예측 또는 진단용 조성물에 관한 것이다.
본 발명은 대사증후군을 겪는 환자의 구강 내 네이세리아 속 균주， 그란눌리카텔라 속 균주 및 펩토코커스 속 균주의 _ 군집이 특이적으로 증가하고， 펩토코커스의 군집이 특이적으로 감소함을 규명하고， 이에 기초하여， 네이세리아 속 균주， 그란눌리카텔라 속 균주 및 펩토코커스 속 균주로 이루어진 군에서 선택되는 1종 이상의 미생물을 대사증후군 또는 대사증후군 관련 질환 의 위험도 예측 또는 진단하기 위한 바이오 마커로 제공함을 특징으로 한다.
본 발명의 구체적인 실시예에서는， 인간의 유전적， 생리적 요인이 구강 미생물 군집에 미치는 영향을 배제하고 구강 미생물 군집과 대사증후군 또는 대사증후군 관련 질환과의 관계를 알아보기 위해 쌍등이를 대상으로 연구를 진행하였고， 그 결과 대사증후군 환자군에서 네이세리아 속 균주 및 그란눌리카텔라 속 균주의 군집이 특이적으로 높게 검출되고， 펩토코커스 속 균주의 군집이 특이적으로 낮게 검출되는 것을 확인하였다 (실시예 5 및 6) .
네이세리아 (Nei sser i a)속 균주는 점막에 존재하는 그람 음성 (Gram-negat ive) 균으로 예를 들어， 네이세리아 일통가타 (N . elongata) 네이세리아 메닝지티디스 (N. meningi t ides )와 네이세리아 고노리아 (N. ronorrhoeae)를 포함하며， 바람직하게는 상기 네이세리아 속 균주는 네이세리아 일통가타일' 수 있다. 그란눌리카텔라 (Granul i catel la) 속 균주는 초기에 nutr i t ional ly var i ant streptococcus (NVS)로 분류되었으며， 주로 호흡기， 위 장내， 생식기에 서식하며 임상적 연관성으로는 심내막염을 일으키는 것으로 보고되고 있다. 본 발의 그란눌리카텔라 속 균주는 예를 들어， 그란눌리카텔라 아디아센스 (G. adi acens)를 포함할 수 있으며， 그란눌리카텔라 아디아센스는 다른 구강균보다 강한 감염력을 가지는데 해당 균의 강한 부착력이 하나의 요인으로 알려져 있다.
펩토코커스 (Peptococcus)속 균주는 그람 양성 (Gram-pos i t ive)의 구형 (coccoid)균으로 주로 구강, 대장， 호흡기 등의 점막에서 상재하는 것을 특징으로 한다.
상기 네이세리아 속 균주， 그란눌리카텔라 속 균주 및 펩토코커스 속 균주는 구강 내 미생물이며, 이에 따라 본 발명의 조성물은 구강 내에서 채취된 시료에 적용되는 것을 특징으로 한 대사증후군 또는 대사증후군 관련 질환 위험도 예측 또는 진단용 조성물일 수 있다.
본 발명에서 사용되는 용어， "진단용 마커， 또는 진단 마커1 '란 대사증후군에 걸린 상태와 걸리지 않은 상태를 구분하는 기준이 되는 물질로, 정상 시료에 비하여 대사증후군 또는 대사증후군 관련 질환 을 가진 시료에서 증가 또는 감소를 보이는 각종 유기 생체 분자 등을 포함한다. 본 발명의 목적상， 본 발명의 진단 마커는， 대사성 증후군 또는 대사증후군 관련 질환 을 가진 환자의 시료에서 특이적으로 높거나 낮은 수준의 발현을 — 네아세라아 속 균주， 그란눌리카:텔라ᅳ속 균주 .및 /또는 토코커스ᅳ속 균주 미생물 또는 군집을 말한다.
종래 대사증후군의 위험성을 예측하거나 진단하는 방법은 기관마다 수치와 내용을 달리할 뿐 아니라 인슐린 저항성 또는 복부 비만 등 특정 증상을 지표로하여 위험성 예측 또는 진단이 이루어져， 대사증후군의 전체 특성을 반영하지 못하는 등 진단 기준이 불완전하다는 문제점이 있었으나， 본원발명은 특정 증상에 한정되지 않고도 예측 또는 진단할 수 있다는 장점이 있다.
바람직하게는， 상기 검출할 수 있는 제제는 시료 내에서 대사증후군 또는 대사증후군 관련 질환 의 진단 마커인 네이세리아， 그란눌리아카텔라 및 /또는 펩토코커스의 존재를 검출하기 위하여 사용될 수 있는 물질을 의미한다ᅳ 예를 들어， 네이세리아， 그란눌리아카텔라 및 /또는 펩토코커스에 특이적으로 존재하는 단백질, 핵산， 지질, 당지질， 당단백질 또는 당 (단당류， 이당류， 을리고당류 등) 등과 같은 유기 생체 분자를 특이적으로 검출할 수 있는 프라이머， 프로브, 안티센스 을리고뉴클레오티드， 압타머 및 항체로 이루어진 군에서 선택된 1 이상일 수 있다.
본 발명에서 미생물 검출 제제는, 항체일 수 있으며， 항원 -항체 반응을 기반으로 한 면역학적 방법을 사용하여 해당 미생물을 검출할 수 있다. 이를 위한 분석 방법으로는 웨스턴 블랏， ELISA(enzyme l inked immunosorbent asay) , 방사선면역분석 (RIA : Radioimmunoassay)，방사면역확산법 (radioimmunodi f fus ion)，오우크
테로니 (Ouchter lony) 면역 확산법 , 로케이트 (rocket )면역전기영동， 조직면역 염색， 면역침전 분석법 ( nmunoprecipi tat ion assay) , 보체고정분석법 (Complement Fixat ion Assay) , FACS(Fluorescence act ivated cel l sorter ) , 단백질 칩 (protein chip) 등이 있으나， 이에 제한되는 것은 아니다.
바람직하게 상기 미생물을 검출할 수 있는 제제는 미생물에 특이적인 프라이머이고， "프라이머 "란, 주형 가닥에 상보적인 염기쌍 (base pai r )을 형성할 수 있고， 주형 가닥 복사를 위한 시작 지점으로 기능하는 7개 내지 50개의 핵산서열을 의미한다. 프라이머는 보통 합성하지만 자연적으로 생성된 핵산에서 이용할 수도 있다. 프라이머의 서열은 반드시 주형의 서열과 정확히 같을 필요는 없으며， 충분히 상보적이어서 주형과 흔성화될 수 있으면 된다. 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 흔입할 수 있다. 흔입할 수 있는 추가의 특징의 예로 메틸화， 캡화， 하나 이상의 핵산을 동족체로의 치환 및 핵산 간의 변형 등이 있으나, 이에 제한되지 않는다. 바람직하게는 본 발명에서 사용되는 프라이머는 네이세리아 속 균주 (Farrel 1 , J. , et al . , Variations of oral microbiota are associated with pancreatic diseases including pancreat ic cancer . GUT, 2012.61: p. 582-588) 그란눌리카텔라 속 균주 (Farrell , J . , et al . , Variations of oral microbiota are associated with pancreatic diseases including pancreatic cancer . GUT, 2012.61： p. 582-588) 및 /또는 펩토코커스 속 균주 (Rekha, . , et al . , Designing and validation of genusᅳ speci f ic primers for human gut flora study. Electron J Biotechnol, 2005.9(5)： p. 0—0)의 16S rRNA를 증폭할 수 있는 프라이머일 수 있다. 바람직하게는 상기 프라이머는 하기 표 1의 프라이머일 수 있다.
【표 1]
Figure imgf000008_0001
상기 16s rRNA 는, 원핵생물 리보솜의 30S 소단위체를 구성하고 있는 rRNA로, 염기서열이 대부분상당히 보존되어 있는 한편 일부 구간에서는 높은 염기서열 다양성이 나타난다. 특히 동종 간에는 다양성이 거의 없는 반면에 타종 간에는 다양성이 나타나므로 16S rRNA의 서열을 비교하여 원핵생물을 유용하게 동정할 수 있다.
상기 대사성 증후군 관련 질환은 비만, 고혈압, 당뇨, 인술린 내성 증후군, 고지혈증， 고콜레스테롤증， 암, 심혈관질환， 염증성 장질환， 아토피， 및 알러지 질환으로 이루어진 군에서 선택된 1 이상일 수 있다. 바람직하게는 상기 대사성 증후군 관련 질환은 고혈압일 수 있다.
예를 들어 상기 비만， 예를 들어 복부 비만은 허리둘레가 남성은 90cm 이상， 여성은 85cm 이상인 상태를， 상기 고혈압은 혈압이 130/85mmHg인 상태를, 상기 당뇨는 공복 혈당이 100mg/dL 이상인 상태를 의미할 수 있다. 또한, 상기 고중성지방혈증은 혈중 중성지방 함량이 150mg/dL 이상인 경우， 상기 .고콜레스테를증은 혈중 HDL 콜레스테롤 함량이 남성은 40mg/dL 미만， 여성은 50mg/dL 미만인 상태를 의미할 수 있다. 또한 상기 대사증후군은 비만， 고혈압， 혈당 장애， 고지방혈증, 예를 들어 고중성지방혈증 및 낮은 HDL 콜레스테롤혈증으로 이루어진 군에서 선택된 1종 이상일 수 있으며， 바람직하게는 3종， 더욱 바람직하게는 5종 이상의 증상을 갖는 상태일 수 있다. 상기 대사성 질환 (metabol i c di sease , met abol ic di sorder)이란 포도당 지방， 단백질 등의 대사 이상에서 기원하는 질병을 의미한다.
예를 들어 본 발명의 조성물은 1) 내지 5)로 이루어진 군에서 선택된 1종 이상， 바람직하게는 3종 이상의 기준을 만족하는 대사증후군의 위험도 예측 또는 진단에 사용될 수 있다.
1) 허리둘레: 남성 90cm이상， 여성 85cm이상;
2) 혈증 중성지방 함량: 150mg/dL이상;
3) 혈중 HDL콜레스테롤 함량: 남성 40mg/dL미만， 여성 50mg/dL미만;
4) 혈압: 130/85隱 Hg이상; 및
5) 공복혈당 100 mg/dL 이상
예를 들어 선정 기준은, 피시험자가 동양인인 경우의 대사증후군 또는 대사증후군 관련 질환의 위험도 예측 또는 진단에 사용될 수 있다. 상기 위험도 예측이란 피시험자가 대사증후군 또는 대사증후군 관련 질환을 발병할 가능성이 있는지를 판별하는 것을 말하고， 대사증후군 또는 대사증후군 관련 질환의 발병 위험성이 높은 피시험자자를 특별하고 적절한 관리를 통하여 발병 시기를 늦추거나 발병하지 않도록 하거나， 가장 적절한 치료 방식을 선택함으로써 치료 결정을 하기 위해 임상적으로 사용될 수 있다ᅳ 또한， "진단"이란， 병리 상태의 존재 또는 특징을 확인하는 것을 의미하며， 본 발명의 목적상， 진단은 대사성 질환의 발병 여부를 확인하는 것을 의미할 수 있다.
본 발명의 또 다른 일 예로서， 본 발명의 상기 미생물 검출 제제를 포함하는 조성물은， 대사증후군 또는 대사증후군 관련 질환 위험도 예측 또는 진단용 키트 형태로 구현되어 제공될 수 있다. 본 발명의 키트는 해당 미생물들을 검출하기 위한 프라이머, 프로브， 안티센스 올리고뉴클레오티드， 압타머 및 /또는 항체의 검출 제제를 포함할 뿐만 아니라， 분석 방법에 적합한 1종 이상의 다른 구성성분 조성물， 용액， 또는 장치가 포함될 수 있다.
상기 대사증후군 또는 대사증후군 관련 질환 위험도 예측 또는 진단용 조성물에 관한 사항은 대사증후군 또는 대사증후군 관련 질환 위험도 예측 또는 진단용 키트에 적용될 수 있다.
구체적인 일례로， 본 발명에서 해당 미생물에 특이적인 프라이머를 포함하는 키트는， PCR 및 등의 증폭 반웅을 수행하기 위한 필수 요소들을 포함하는 키트 일 수 있다. 예를 들어，상기 PCR용 키트는 테스트 류브 또는 다른 적절한 컨테이너， 반웅 완층액， 데옥시뉴클레오타이드 (dNTPs ) , Taq-폴리머라아제 역전사효소와 같은 효소， DNase , RNAse 억제제， DEPC-수 (DEPC-water ) , 멸균수 등을 포함할 수 있다.
상기 키트는 구강 내에서 채취된 시료에 적용되는 것을 특징으로 할 수 있으며， 구체적으로 상기 키트는 비침습적 방법으로 대사증후군 또는 대사증후군 관련 질환의 위험도 예측 또는 진단을 할 수 있으다
상기 키트는 피시험자의 구강 내 시료 채취를 위한 흡수성 패드, 면봉， 스포이드， 스푼， 스왑 및 이쑤시개로 이루어진 군에서 선택된 1종 이상의 구강 시료 채취용 포집 기구를 추가로 포함할 수 있으나， 구강 내 시료를 포집할 수 있는 것이라면 이에 한정되지 않는다.
또한 상기 키트는 대사증후군 또는 대사증후군 관련 질환의 위험도 예측 또는 진단을 위하여 피시험자의 시료를 구강 내에서 채취하라는 설명서를 추가로 포함할 수 있다. 또 다른 예로서， 본 발명은 대사증후군 또는 대사증후군 관련 질환의 위험도 예측 또는 진단에 필요한 정보를 제공하기 위하여， 피시험자의 시료로부터 네이세리아 속 균주， 그란눌라카텔라 속 균주 및 펩토코커스 속 균주로 이루어진 군에서 선택된 1종 이상의 미생물을 검출하는 방법에 관한 것이다. 본 발명의 또 다른 예로서， 네이세리아 속 균주， 그란눌리카텔라 속 균주 및 펩토코커스 속 균주로 이루어진 군에서 선택된 1종 이상의 미생물을 검출하는 단계를 포함하는； 대사증후군 또는 대사증후군 관련 질환의 위험도 예측 또는 진단 방법， 또는 대사증후군 또는 대사증후군 관련 질환의 위험도 예측 또는 진단에 필요한 정보를 제공하는 방법을 제공한다. 상기 대사증후군 또는 대사증후군 관련 질환 위험도 예측 또는 진단용 조성물에 관한 사항은 상기 미생물 검출 방법, 또는 대사증후군 위험도 예측 또는 진단 방법， 또는 대사증후군 또는 대사증후군 관련 질환 위험도 예측 또는 진단에 필요한 정보를 제공하는 방법에 적용될 수 있다. 바람직하게는 상기 방법은 )피시험자의 시료를 채취하는 단계; (b) 상기 시료로부터 게놈 DNA를 추출하는 단계; (c) 상기 추출된 게놈 DNA에 네이세리아 속 균주， 그란눌리카텔라 속 균주 및 펩토코커스 속 균주로 이루어진 군에서 선택된 1 이상의 미생물에 특이적인 프라이머를 반응시키는 단계; 및 (d) 상기 반웅물을 증폭시키는 단계를 포함하는 방법을 포함하여 구현될 수 있다.
상기 단계 (a) 에서, "피시험자의 시료1 '란， 대사증후군 또는 대사증후군 관련 질환 환자 또는 대사증후군 또는 대사증후군 관련 질환이 예상되는 사람의 몸에서 채취 된 것으로， 조직， 세포， 전혈， 혈청, 혈장 타액 또는 뇨와 같은 시료 등을 포함하나， 예를 들어 피시험자의 구강， 바람직하게는 구강 내 상피세포， 구강 내 혈액，구강 내 타액， 구강 내 치석， 구강 내 혈장， 및 이를 포함하는 용액으로 이루어진 군에서 선택된 1이상에서 채취된 조직 시료일 수 있다.
종래 대사증후군 진단에 사용되는 방법은 침습적인 혈액 채취와 공복조건의 혈당 측정으로 인한 부가적인 스트레스를 야기하는 문제점이 있었으나 본 발명은 비침습성 방법， 특히 구강 내 시료 채취 방법에 의해 채취된 시료를 사용할 수 있어 피시험자의 스트레스를 줄일 수 있다. 상기 단계 (b) 에서 피시험자의 시료로부터 게놈 DNA의 추출은 당업계에 알려진 일반적인 기술을 적용하여 수행할 수 있으며， 상기 단계 (c)에서 네이세리아 속 균주， 그란눌리카텔라 속 균주 및 /또는 펩토코커스 속 균주에 특이적인 프라이머는 상기 설명한 바와 같다.
상기 단계 (d)에서 반웅물을 증폭시키는 방법은 당업계에 알려진 일반적인 증폭 기술들， 예를 들어 중합효소 연쇄반웅， SYBR 실시간 PCR , 역전사-중합효소 연쇄반웅， 멀티플렉스 PCR , 터치다운 PCR, 핫 스타트 PCR , 네스티드 PCR , 부스터 PCR, 실시간 PCR, 분별 디스플레이 PCR , cDNA 말단의 신속 증폭， 인버스 PCR , 백토레트 PCR , TAIL-PCR, 리가아제 연쇄 반웅， 복구 연쇄 반웅， 전사—중재 증폭， 자가 유지 염기서열 복제， 타깃 염기서열의 선택적 증폭 반웅을 이용할 수 있으나， 본 발명의 범위가 이에 제한되지는 않는다.
상기 단계 (c)에서， 반응물의 증폭 산물의 양을 정상 대조군 시료의 증폭산물과 비교하는 단계를 추가로 수행할 수 있으며， 피시험자 시료의 증폭 산물이 정상 대조군 시료의 증폭산물과 비교하여 유의적으로 증가되거나 감소되었다고 판단될 경우， 해당 피시험자는 대사증후군 또는 대사증후군 관련 질환의 위험성이 예측되거나 대사증후군이 있는 것으로 판단할 수 있다.
바람직하게는， 피시험자 시료의 네이세리아 속 균주 및 그란눌리카텔라 속 균주로 이루어진 군에서 선택된 1이상의 미생물에 대한 증폭산물이 정상 대조군 시료보다 높은 경우， 대사증후군 또는 대사증후군 관련 질환의 위험성이 있는 것으로 예측하거나 대사증후군이 있는 것으로 진단할 수 있다.
상기 네이세리아 속 균주， 예를 들어 네이세리아 일통가타 균주 및 /또는 그란눌리카텔라 속 균주로서， 예를 들어 그란눌리카텔라 아디아센스 균주의 게놈 DNA 증폭 단계가 SYBR 실시간 검출에 의해 이루어지는 경우, 이상치 (out l i er , 평균 ± 1.5 * 표준편차)를 제외한 정상 대조군 시료의 네이세리아 속 균주 및 /또는 그란눌리카텔라 속 균주의 증폭 산물의 절대 정량값에 대한 피시험자의 검출 시료의 증폭 산물의 절대 정량값 (P)이 1.01 내지 5.00， 바람직하게는 1.01 내지 2.00 또는 2.00 내지 3.50인 경우 대사증후군 또는 대사증후군 관련 질환의 위험성이 있는 것으로 예측하거나 대사증후군 또는 대사증후군 관련 질환이 있는 것으로 진단할 수 있다. 예를 들어 상기 P 값이 2.00 내지 3.50인 경우 고혈압의 위험성이 있는 것을 예측하거나 고혈압이 있는 것으로 진단할 수 있다.
[수학식 1]
P = (검출 시료 내 균주의 게놈 DNA증폭 산물의 절대 정량값 )/ (정상 시료 내 균주의 게놈 DNA 증폭 산물의 절대 정량값)산출된 네이세리아 속 균주의 P값이 1. 1 이상， 바람직하게는 1. 1인 경우 및 /또는 그란눌리카텔라 속 균주의 P값이 1.4 이상， 바람직하게는 1.4인 경우 대사증후군 또는 대사증후군 관련 질환의 위험성이 있는 것으로 예측하거나 진단 ¾ 수 있다. 또한 피시험자 시료의 펩토코커스 속 균주에 대한 증폭산물의 양이 정상 대초군 시료보다 낮은 경우， 대사증후군 또는 대사증후군 관련 질환의 위험성이 있는 것으로 예측하거나 대사증후군 또는 대사증후군 관련 질환이 있는 것으로 진단할 수 있다. ᅳ
상기 펩토코커스 속 균주의 게놈 DNA증폭 단계가 SYBR실시간 검출에 의해 이루어지는 경우， 이상치 (out l i er , 평균 ± 1.5 * 표준편차)를 제외한 정상 대조군 시료의 펩토코커스 속 균주의 증폭 산물의 절대 정량값에 대한 피시험자의 검출 시료의 증폭 산물의 절대 정량값 (P)이 0.01 내지 0.99， 바람직하게는 0.05 내지 0.90인 경우 대사증후군 또는 대사증후군 관련 질환의 위험성이 있는 것으로 예측하거나 대사증후군 또는 대사증후군 관련 질환이 있는 것으로 진단할 수 있다. 예를 들어 상기 P 값이 0.05 내지 0.90인 경우 고혈압의 위험성이 있는 것을 예측하거나 고혈압이 있는 것으로 진단할 수 있다.
[수학식 1]
P = (검출 시료 내 균주의 게놈 DNA증폭 산물의 절대 정량값 )/ (정상 시료 내 균주의 게놈 DNA 증폭 산물의 절대 정량값)
예를 들어， 펩토코커스 속 균주의 P값이 0.6미만， 이상， 바람직하게는 0.6인 경우 대사증후군의 위험성이 있는 것으로 예측하거나 진단할 수 있다. 바람직하게는 피시험자 시료의 펩토코커스 속 균주 및 그란눌리카텔라 속 균주의 증폭 산물의 비율 (시료 내 펩토코커스 속 균주 증폭 산물의 절대 정량값 ： 시료 내 그란눌리카텔라 속 균주 증폭 산물의 절대 정량값)이 정상 대조군 시료보다 낮은 경우 대사증후군 또는 대사증후군 관련 질환의 위험성이 있는 것으로 예측하거나 대사증후군 또는 대사증후군 관련 질환이 있는 것으로 진단할 수 있다. 예를 들어 게놈 DNA 증폭 단계는 SYBR 실시간 검출에 의한 펩토코커스 속 균주 및 그란눌리카텔라 속 균주 각각의 증폭 산물의 비율이 0.01 , 0.03， 0.05 및 0.22로 이루어질 군에서 선택된 하한 값 및 0.23， 0.6， 0.62 , 1.4 및 1.5로 이루어진 군에섯 선택된 상한값으로 이루어진 범위인 경우 대사증후군 또는 대사증후군 관련 질환의 위험성이 있는 것으로 예측하거나 대사증후군 또는 대사증후군 관련 질환이 있는 것으로 진단할 수 있다. 또한 대용량 염기서열 분석에 의해 게놈 DNA 시뭔싱이 이루어지는 경우， 상기 펩토코커스 속 균주 및 그란눌리카텔라 속 균주의 게놈 빈도량 비가 0.0001 내지 0.05인 경우 대사증후군 또는 대사증후군 관련 질환의 위험성이 있는 것으로 예측하거나 대사증후군 또는 대사증후군 관련 질환이 있는 것으로 진단할 수 있다.
또한， 본 발명은 대사증후군 또는 대사증후군 관련 질환 환자에서 네이세리아 속 균주， 그란눌리카텔라 속 균주 및 /또는 펩토코커스 속 균주 군집이 특이적으로 증가하거나 감소한다는 것을 처음 규명하였으므로， 네이세리아 속 균주， 그란눌리카텔라 속 균주 및 /또는 템토코커스 속 균주 군집의 변화와 질병 상태의 관련성을 이용하여， 대사증후군 또는 대사증후군 - -관련 질ᅳ환 처료—를 위한—신약ᅳ -게발에도 활용돨수 있다 . 一 ᅳ - 바람직한 일구현예로， 본 발명은 대사증후군 예방 또는 치료제 후보물질을 처리한 후 네이세리아 속 균주， 그란눌리카텔라 속 균주 및 펩토코커스 속 균주로 이루어진 군에서 선택되는 1 이상의 미생물 군집의 변화를 검출하는 단계를 포함하는， 대사증후군 또는 대사증후군 관련 질환 예방 또는 치료제의 스크리닝 방법을 제공한다. 구체적으로， 본 발명에서는 대사증후군 또는 대사증후군 관련 질환 예방 또는 치료 후보물질의 존재 및 부재 하에서 시료 내 네이세리아 속 균주， 그란눌리카텔라 속 균주 및 /또는 펩토코커스 속 균주의 변화를 비교하는 방법으로， 대사증후군 예방또는 치료제를 스크리닝 하는데 적용될 수 있다. 다시 말해， 대사증후군 예방 또는 치료 후보물질의 존재 및 부재 하에서 시료 내 네이세리아 속 균주， 그란눌리카텔라 속 균주 및 /또는 펩토코커스 속 균주의 군집 형성 정도를 각각 측정하여 양자를 비교한 후， 후보물질이 존재 할 때 군집 형성이 더 감소하는 경우 해당 후보물질을 대사증후군 예방또는 치료제로 개발할 수 있다.
상기 후보물질이란 대사증후군 또는 대사증후군 관련 질환 예방 또는 치료제가 될 수 있는 각종 저분자량 화합물， 고분자량 화합물， 핵산분자 (예컨대， DNA , RNA , PNA등)， 단백질， 당 및 지질 등을 포함하나 이에 한정되지 않는다. 【유리한효과】
본 발명의 조성물은 대사증후군 또는 대사증후군 관련 질환의 위험성 예측 또는 진단을 위하여 네이세리아 속 균주， 그란눌리카텔라 속 균주 및 /또는 펩토코커스 속 균주를 신규 바이오마커로서 제공하며, 이를 이용하여 종래 사용되는 방법 대비 예방 또는 진단의 정확성을 높일. 수 있을 뿐 아니라 비침습적으로 시료를 채취할 수 있고 시료 채취 전 공복 조건을 요구하지 않아 유용하다. 또한 이를 이용하여 대사증후군 또는 대사증후군 관련 질환 예방 또는 치료용 신약 개발 및 제어의 타겟으로 활용할수 있다. 【도면의 간단한 설명】
도 1은 대사 증후군 여부에 따른 구강 균총 다양성을 Chao , observed speci es , shannon index로 분석한 결과이다.
도 2는 대사증후군 여부에 따른 구강 균총의 군집구조를 분석한 결과이다. 도 3은 네트워크 분석을 통한 구강 균총의 군집 특징을 분석한 결과이다.
도 4는 네트워크 분석을 통한 구강 균총의 군집과 대사증후군 관련 변수의 관계를 분석한 결과이다. .
도 5는 단변량 분석 도구인 LEfSE소프트웨어를 이용하여 대사증후군 그룹과 정상 대조군에서 증가하는 구강 세균을 나타낸 결과이다.
도 6은 쌍등이 관계와 성별, 나이를 보정한 다변량 분석 도구인 MaAsLin을 이용하여 대사증후군과 특정 구강 세균의 연관성을 나타낸 것이다.
도 7은 절대정량 분석 방법인 SYBR real-t ime PCR을 이용하여 네이세리아 일통가타， 그란눌리카텔라 아디아센스 (Granul i catel l a adi acens) , 펩토코커스를 정량한 결과이다.
도 8은 대사증후군을 정의할 수 있는 각각의 임상지표에 따른 그란눌리카텔라 박테리아의 절대량 변화 결과이다.
도 9는 구강 세균의 절대 정량 분석 결과로 나온 펩토코커스와 그란눌리카텔라 비율을 측정한 결과이다.
도 10은 구강 마이크로비음 분석 결과로 나온 펩토코커스와 그란눌리카텔라 상대정량값의 비율을 측정한 결과이다. 【발명의 실시를 위한 형태】
이하， 본 발명을 실시예에 의해 상세히 설명한다. 단， 하기 실시예는 본 발명을 예시하는 것일 뿐， 본 발명이 하기 실시예에 의해 한정되는 것은 아니다. 실시예 1. 연구대상및 시료수집
본 연구는 한국의 쌍등이 연구 (Heal thy Twin Study)에 참여한 일란성 쌍등이를 대상으로 수행되었다. 쌍등이의 일란성 여부는 AmpFlSTR Indent i f ier Ki t ( 15개의 상염색체 short tandem repeat마커와 1개의 성 -결정 마커)와 90% 이상의 정확도를 보이는 설문지 조사를 통하여 확인하였으며， 본 쌍둥이 코호트에 대한 자세한 방법론은 이전의 논문에 기술되어 있다
(Sung, J., et al . , Twin Research and Human Genetics, 2006. 9(6): p. 844-848.).
대사증후군 기준에 해당하는 환자와 건강한 대상자를 선정하여 구강 내 첫번째 어금니의 치석을 채취하였다. 멸균된 이쑤시개로 채취 된 치석 시료는 0.9%의 NaCl이 포함된 염분용액에 담겨 -80 에 냉동보관 하였다. 상기 대사증후군 환자 선정을 위해 적용한 기준은 아래 5가지 기준 중 3가지 이상을 만족하는 경우 대사증후군 환자로 선정하였다.
<대사증후군 환자 선정 기준 >
1) 허리둘레: 남성 90cm이상， 여성 85cm이상;
2) 혈중 중성지방 함량: 150mg/dL이상;
3) 혈중 HDL콜레스테를 함량: 남성 40mg/dL미만， 여성 50mg/dL미만;
4) 혈압: 130/85隱 Hg이상; 및
5) 공복혈당 100 mg/dL 이상. 실시예 2. 구강미생물의 DNA추출
실시예 1의 넁동 보관된 시료를 실험실로 옮겨 bead-beating extraction방법으로 genomicDNA를 추출하였다. 치석이 묻어있는 이쑤시개는 zirconia-si 1 ica bead와 섞여 균질화 된 후， isopropanol 침전법으로 추출되었다. 실시예 3. 차세대서열분석을 이용한 구강박테리아 16S rRNA 유전자 시퀀싱
실시예 2에서 추출된 DNA는 박테리아의 V4 영역을 타겟으로 하는 515F/806R 프라이머 (마크로젠， 출처논문: Ultra-high- throughput microbial community analysis on the 11 lumina HiSeq and MiSeq platforms)를 이용하여 PCR 증폭하였다. 상기 프라이머는 하기 표 2의 서열번호 4로 이루어진 정방향 프라이머 및 서열번호 5로 이루어진 역방향 프라이머를 포함하며， 이를 사용하여 PCR증폭을 하였다. 【표 2】
Figure imgf000018_0001
상기 정방향 프라이머 서열은 왼쪽부터 오른쪽으로 어댑터 서열 (5'ᅳ AATGATACGGCGACCACCGAGATCTACAC -3 ' )， 패드 서열 (5 ' -TATGGTAATT - 3'), 링커 서열 (5'-GT- 3'), 및 보존된 박테리아 프라이머 515F (5'- GTGCCAGCMGCCGCGGTAA-3')로 이루어진 것이며， 상기 역방향 프라이머 서열은 왼쪽부터 오른쪽으로 Illumina MiSeq 호환의 어댑터 서열 (5'- CAAGCAGAAGACGGCATACGAGAT -3'), 12—바코드 서열， 패드 서열 (5 '— AGTCAGTCAG - 3'), 링커 서열 (5'- CC - 3')， 및 보존된 박테리아 프라이머 806R (5'- GGACTACHVGGGTWTCTAAT -3' )로 이루어진 것이다. PCR mixture는 총 50ul로 10 X 반웅버퍼， 2.5mM의 dNTP, 12.5pmole의 프라이머， 2.5U의 G-Taq polymerase
(Cosmo, Seoul , Korea)로 구성되었으며 PCR 반웅은 94에서 3분간 변성 , 94에서 45초， 50에서 60초 및 72에서 90초 35회 반복， 72에서 10분간의 최종 연장 단계로 이루어졌다. 상기 증폭 산물을 Illumina사의 MiSeq 기기를 이용하여 시퀀싱 하였다. 실시예 4. 16S rRNA를 이용한구강박테리아균총분석
시퀀싱을 통해 생성된 대용량 염기서열 데이터는 QIIME pipeline사용하여 구강 박테리아 균총의 다양성과 구조를 분석하였다 (Caporaso, J.G. , et al . , QIIME al lows analysis of high-throughput community sequencing data. Nat. Methods . , 2010. 7(5)： p. 335-336. ) 한국인 쌍등이 코호트 대상자 228명의 구강시료를 채취하여 박테리아의 16S rRNA를 대상으로 구강 미생물 균총 분석을 실시하였다. 분석 결과 대사증후군 ¾단의 구강 균총 다양성이 정상그룹에 비해 유의하게 증가하는 것으로 나타났다 (도 1). 대사증후군과 정상 대조군의 균총 구조 분석 결과， phylum 레벨에서 3개의 phyla가 70¾> 이상의 군집을 구성하는 것으로 나타났다. 퍼미큐츠 (Firmicutes)가 약 34%, 프로테오박테리아 (Proteobacteria)가 약 32%, 액티오박테리아 (Act inobacteria)가 약 17%를 이루었으며 대사증후군 그룹에서 퍼미큐츠가 38% 증가하였고， 프로테오박테리아가 30%감소하였음을 확인하였다 (도 2). 실시예 5. 구강균총의 네트워크 분석
구강 균총의 대사증후군 그룹과 정상 그룹에 따른 발생패턴을 파악하기 위해 Sparse Correlations for Compositional data (SparCC) 소프트웨어를 이용해 네트워크 분석을 실시하였다. 구강 박테리아 균총의 네트워크 분석을 통해 대사증후군 환자군과 정상군에 상대적으로 많이 존재하는 박테리아들의 유사 군집을 형성하는 것으로 규명되었다 (도 3). 또한， 구강 박테리아 균총과 대사증후군 관련 변수의 네트워크 분석을 한 결과， 스트렙토코커스， 그란눌리카텔라， 네이세리아， 헤모필러스， 액티노바실러스, 로시아가 유의한 네트워크를 형성하는 것을 확인하였다 (도 4). 실시예 6. 대사증후군진단을위한구강박테리아바이오마커 분석 대사증후군 진단을 위한 구강 박테리아 바이오마커를 규명하기 위해 LEfSe를 이용하여 단변량 분석을 실시하였다. LEfSe는 Kruskal-Wi 11 is 분석을 통해 미생물 바이오마커를 규명한 후 Wilcoxon rank-sum사후 분석을 통해 초기분석 결과를 검증하는 분석도구이다. 바이오마커 검증 후 LEfSe 소프트웨어의 Linear Discriminant Analysis (LDA)분석을 통해 바이오마커의 영향력을 파악하였다 (Segata, N. , et al . , Metagenomic biomarker discovery and explanation. Genome Biol. , 2011. 12(6)： p. R60.). 단변량 분석을 통한 구강 박테리아 바이오마커 분석 결과 네이세리아 속 균주 (LDA 점수: 4.05)， 그란눌리카텔라 속 균주 (LDA 점수: 3.49)가 환자군에서， 펩토코커스 속 균주가 (LDA점수: 3. 1)정상군에서 영향력이 더 큰 것을 확인하였다 (도 5) . 실시예 7. 구강균총과 대사증후군의 상관관계 분석
흔란변수를 제어할 수 있는 MaAsLin 소프트웨어를 이용해 다변량 분석을 통한 대사증후군을 특정할 수 있는 구강박테리아를 규명하였다. 대사증후군 여부를 독립변수로， 구강 균총을 종속변수로 지정 후 대상자의 나이， 성별를 제어하여 다변량 분석을 실시하였다. 대상자의 나이와 성별을 보정요인으로 넣고 실시한 다변량 분석결과， 네이세리아 속 균주로서， 네이세리아 일통가타 (r 계수 = 0.024 , q값 (위양성이 보정된 p값) = 0. 136)， 그란눌리카텔라 속 균주로서 , 그란눌리카텔라 아디아센스 (r 계수 = 0.019， q 값 (위양성이 보정된 p값) = 0.222)가 대사증후군과 유의한 상관관계가 있는 것으로 분석되었다 (도 6) . 실시예 8. 절대 정량분석에 따른 대사증후군 탐지
실시예 6 및 실시예 7에서 대사증후군에서 유의한 연관성이 있는 것으로 분석된 3종의 구강박테리아 총의 검출로 대사증후군 탐지의 가능성을 확인하기 위해 정량적 PCR의 방법 중 하나인 SYBR real-t ime PCR을 사용하여 각각의 대상자가 실제로 보유하는 네이세리아 속 균주, 그란눌리카텔라 속 균주 및 펩토코커스 속 균주의 절대 양을 측정하였다. 절대정량을 위한 standard curve를 제작하기 위해 펩토코커스와 네이세리아， 그란눌리카텔라의 기준균주 (type strain)을 배양하여 DNA를 추출 후 PCR로 증폭하여 나은 산물과 클로닝을 통해 나온 산물을 10배 연속희석법으로 희석하여 사용하였다. 제작된 standard curve와 함께 실시예 2에서 추출된 박테리아의 DNA를 대상으로 Real-t ime PCR이 진행되었다. Realᅳ t ime PCR mixture는 종 25ul로 SYBR master mix (Appl i ed Biosystems , Foster Ci ty, CA) , 50pmole의 프라이머로 구성되었으며 PCR 반웅은 95에서 15분간 변성， 95에서 30초， 60에서 1분 및 72에서 30초간 40 회 반복으로 이루어졌다.
절대 정량 결과를 도 7 및 도 8에 나타내었으며, 그란눌리카텔라 속 균주가 대사증후군 그룹에서 평균 2514 copy number /ng (DNA) , 정상 대조군에서 평균 2358 copy number /ng (DNA)로 증폭되어 (아래 수학식 1에 의한 P=1.07) 대사증후군 환자군에서 유의하게 증가하는 것으로 나타났으며 대사증후군을 진단하는 임상 기준 중 혈압이 높은 그룹에서 4963 copy number /ng (DNA) , 혈압이 낮은 그룹에서 1675 copy number /ng (DNA)로 증폭되어 (아래 수학식 1에 의한
Figure imgf000021_0001
96) 특히 혈압과 유의한 연관성이 있는 것으로 나타났다. 따라서， 상기와 같이 구강 박테리아 균주 검출용 프라이머 및 PCR을 이용하여 박테리아 균주를 탐지하여 대사증후군 위험도 예측 또는 진단에 사용할 수 있음을 확인하였다.
[수학식 1]
P = (검출 시료 내 균주의 게놈 DNA증폭 산물의 절대 정량값 )/ (정상 시료 내 균주의 게놈 DNA 증폭 산물의 절대 정량값)
Real-t ime PCR분석으로 산정된 박테리아의 genome copy수를 이용하여 정상군과 대사증후군 그룹의 펩토코커스와 그란눌리카텔라의 비율을 계산하였다. 펩토코서스의 genome copy 수를 그란눌리카텔라의 genome copy수로 나누어 비율이 산정되었다. 또한， 대용량 염기서열 분석으로 산정된 구강 균와상대빈도량을 기반으로 동일한 분석이 이루어졌다.
정상군과 대사증후군의 펩토코커스 속 균주와 그란눌리카텔라 속 균주의 비율을 산정한 결과를 도 9에 나타내었으며， 그 비율이 정상군 0.62， 환자군에서 0.22로 정상군에서 유의하게 높은 것을 확인하였다. 동일한 분석방법을 구강균총 분석결과로 산정된 균총의 빈도량에 적용하였을 때 역시 정상군에서 펩토코커스 속 균주와 그란눌리카텔라 속 균주의 비율이 1.4, 환자군에서 비율이 0.05로 정상군에서 유의하게 높은 것으로 확인되었다 (도 10) .

Claims

【청구의 범위】
【청구항 1】
네이세리아 (Nei sser i a)속 균주， 그란눌리카텔라 (Granul i catel l a)속 균주 및 펩토코커스 (Peptococcus)속 균주로 이루어진 군에서 선택된 1종 이상의 구강 내 미생물을 검출할 수 있는 제제를 포함하는， 구강 미생물을 이용한 대사증후군 또는 대사증후군 관련 질환 위험도 예측 또는 진단용 조성물.
【청구항 2】
제 1항에 있어서， 상기 조성물은 구강 내에서 채취된 시료에 적용되는 것을 특징으로 하는， 조성물.
【청구항 3]
거 U항에 있어서， 상기 네이세리아 속 균주는 네이세리아 일통가타 (Nei sser i a elongata)이고， 상기 그란눌리카텔라 속 균주는 그란눌리카텔라 아디아센스 (Granul i catel l a adi acens)인 , 조성물.
【청구항 4】
제 1항에 있어서, 상기 미생물을 검출할 수 있는 제제는 미생물에 특이적인 프라이머， 프로브， 안티센스 올리고뉴클레오티드， 압타머 또는 항체인， 조성물.
【청구항 5】
제 1항에 있어서， 상기 대사증후군 관련 질환은 비만， 고혈압， 당뇨， 인슐린 내성 증후군, 고지혈증， 암， 심혈관질환， 염증성 장질환， 아토피 및 알러지 질환으로 이루어진 군에서 선택된 1종 이상인 조성물.
【청구항 6】
제 1항 내지 제 5항 중 어느 한 항의 조성물을 포함하는， 구강 미생물을 이용한 대사증후군 또는 대사증후군 관련 질환의 위험도 예측 또는 진단용 키트.
【청구항 7】
제 6항에 있어서， 상기 키트는 구강 내에서 채취된 시료에 적용되는 것을 특징으로 하는， 키트.
【청구항 8】
게 7항에 있어서， 상기 키트는 피시험자의 구강 내 시료의 채취를 위한 구강 시료 채취용 포집 기구를 포함하며， 상기 포집 기구는 흡수성 패드， 면봉， 스포이드， 스푼， 스왑 및 이쑤시개로 이루어진 군에서 선택된 1 이상의 구강 시료 채취용 포집 기구를 추가로 포함하는 것인， 키트.
【청구항 9】
네이세리아 (Nei sser i a) 속 균주, 그란눌리카텔라 (Granul i catel la) 속 균주 및 펩토코커스 (Peptococcus) 속 균주로 이루어진 군에서 선택된 1 이상의 구강 내 미생물을 검출하는 단계를 포함하는, 대사증후군 또는 대사증후군 관련 질환의 위험도 예측 또는 진단에 필요한 정보를 제공하는 방법.
【청구항 10】
제 9항에 있어서， 상기 네이세리아 속 균주는 네이세리아 일통가타 (Nei sser i a elongata)이고， 상기 그란눌리카텔라 속 균주는 그란눌리카텔라 아디아센스 (Granul i catel l a adi acens)인， 방법.
【청구항 11】
거 19항에 있어서，
피시험자의 구강 시료에서 얻은미생물의 게놈 DNA 에 검출 대상 미생물에 특이적인 프라이머를 반웅시키는 단계; 및
상기 반웅물을 증폭시키는 단계를 포함하는, 대사증후군 또는 대사증후군 관련 질환의 위험도 예측 또는 진단에 필요한 정보를 제공하는 방법.
【청구항 12】
제 11항에 있어서， 상기 시료는 피 시험자의 구강 내 상피세포, 구강 내 혈액 구강 내 타액， 구강 내 치석， 구강 내 혈장， 및 이를 포함하는 용액으로 이루어진 군에서 선택된 1종 이상인 것인， 대사증후군 또는 대사증후군 관련 질환의 위험도 예측 또는 진단에 필요한 정보를 제공하는 방법.
【청구항 13】 제 11항에 있어서，상기 시료의 게놈 DNA증폭산물의 양을 정상 대조군 시료의 증폭산물과 비교하여 대사증후군 또는 대사증후군 관련 질환을 예측 또는 진단하는 단계를 추가로 포함하는， 대사증후군 또는ᅮ대사증후군 관련 질환의 위험도 예측 또는 진단에 필요한 정보를 제공하는 방법 .
【청구항 14】
제 13항에 있어서，상기 시료의 게놈 DNA증폭산물의 양을 정상 대조군 시료의 증폭산물과 비교하여 상기 시료의 네이세리아 속 균주 및 그란눌리카텔라 속 균주로 이루어진 군에서 선택된 1이상의 미생물에 대한 증폭산물이 정상 대조군 시료보다 높은 경우 대사증후군 또는 대사증후군 관련 질환의 위험성이 있는 것으로 예측하거나 대사증후군 또는 대사증후군 관련 질환이 있는 것으로 결정하는 단계를 추가로 포함하는， 대사증후군 또는 대사증후군 관련 질환의 위험도 예측 또는 진단에 필요한 정보를 제공하는 방법 .
【청구항 15】
제 14항에 있어서， 아래 수학식 1에 의해 산출되는 네이세리아 속 균주의 P 값이 0.01 내지 5.00인 경우， 대사증후군 또는 대사증후군 관련 질환의 위험성이 있는 것으로 예측하거나 대사증후군 또는 대사증후군 관련 질환이 있는 것으로 진단하는 것인， 방법:
[수학식 1]
P = (검출 시료 내 균주의 게놈 DNA증폭 산물의 절대 정량값 )/ (정상 시료 내 균주의 게놈 DNA 증폭 산물의 절대 정량값)
【청구항 16]
제 14항에 있어서， 아래 수학식 1에 의해 산출되는 그란눌리카텔라 속 균주의 Pᅳ값어 -Ο ΓΘ-I- 내자 5 θ0인 ᅵ경 -우， 대사증후군 또는 -대사증후군 관련— - 질환의 위험성이 있는 것으로 예측하거나 대사증후군 또는 대사증후군 관련 질환이 있는 것으로 진단하는 것인, 방법:
[수학식 1]
Ρ = (검출 시료 내 균주의 게놈 DNA증폭 산물의 절대 정량값 )/ (정상 시료 내 균주의 게놈 DNA 증폭 산물의 절대 정량값)
【청구항 17]
제 13항에 있어서，상기 시료의 게놈 DNA증폭산물의 양을 정상 대조군 시료의 증폭산물과 비교하여 상기 시료의 펩토코커스 속 균주에 대한 증폭산물의 양이 정상 대조군 시료보다 낮은 경우 대사증후군 또는 대사증후군 관련 질환의 위험성이 있는 것으로 예측하거나 대사증후군 또는 대사증후군 관련 질환이 있는 것으로 결정하는 단계를 추가로 포함하는, 대사증후군.또는 대사증후군 관련 질환의 위험도 예측 또는 진단에 필요한 정보를 제공하는방법 .
【청구항 18]
제 17항에 있어서， 아래 수학식 1에 의해 산출되는 펩토코커스 속 균주의 P 값이 0.01 내지 0.99인. 경우， 대사증후군 또는 대사증후군 관련 질환의 위험성이 있는 것으로 예측하거나 대사증후군 또는 대사증후군 관련 질환아 있는 것으로 진단하는 것인， 방법:
[수학식 1]
P = (검출 시료 내 균주의 게놈 DNA증폭 산물의 절대 정량값 )/ (정상 시료 내 균주의 게놈 DNA 증폭 산물의 절대 정량값)
【청구항 19]
대사증후군 또는 대사증후군 관련 질환 예방 또는 치료제 후 물질을 처리하는 단계 ;
상기 후보물질 처리 전 및 처리 후 구강 내 시료에서 네이세리아 속 균주， 그란눌리카텔라 속 균주 및 템토코커스 속 균주로 이루어진 군에서 선택되는 1 이상의 미생물의 변화를 검출하는 단계; 및
상기 후보물질 처리 후 상기 네이세리아 속 균주 및 그란눌리카텔라 속 균주로 이루어진 군에서 선택된 1 이상의 미생물 검출량이 감소하거나， 상기 펩토코커스 속 균주의 검출량이 증가한 경우 상기 후보 물질을 대사증후군 또는 대사증후군 관련 질환 예방 또는 치료제인 것으로 판단하는 단계를 포함하는， 대사증후군 또는 대사증후군 관련 질환 예방 또는 치료제 스크리닝 방법 .
PCT/KR2017/007841 2016-07-25 2017-07-20 구강 세균의 군집을 이용한 대사증후군 또는 대사증후군 관련 질환 위험 예측 또는 진단용 조성물 WO2018021761A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US16/316,662 US11365452B2 (en) 2016-07-25 2017-07-20 Composition for diagnosing or predicting risk of metabolic syndrome or metabolic syndrome-related diseases using human oral microbiome
EP17834703.5A EP3489365A4 (en) 2016-07-25 2017-07-20 COMPOSITION FOR PREDICTING THE RISK OR DIAGNOSING A METABOLIC SYNDROME OR DISORDERS ASSOCIATED WITH METABOLIC SYNDROME USING AN ORAL BACTERIAL COMMUNITY

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2016-0094299 2016-07-25
KR1020160094299A KR101815692B1 (ko) 2016-07-25 2016-07-25 구강 세균의 군집을 이용한 대사성 질환 진단용 바이오 마커

Publications (1)

Publication Number Publication Date
WO2018021761A1 true WO2018021761A1 (ko) 2018-02-01

Family

ID=61016110

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/007841 WO2018021761A1 (ko) 2016-07-25 2017-07-20 구강 세균의 군집을 이용한 대사증후군 또는 대사증후군 관련 질환 위험 예측 또는 진단용 조성물

Country Status (4)

Country Link
US (1) US11365452B2 (ko)
EP (1) EP3489365A4 (ko)
KR (1) KR101815692B1 (ko)
WO (1) WO2018021761A1 (ko)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2021010343A (ja) * 2019-07-08 2021-02-04 三菱ケミカル株式会社 口腔内細菌による健康状態の予測方法
KR102547445B1 (ko) * 2020-08-24 2023-06-27 동국대학교 와이즈캠퍼스 산학협력단 구강 미생물군을 이용한 불면증 치료 효과 예측 방법
KR102184398B1 (ko) * 2020-10-06 2020-11-30 주식회사 에스씨엘헬스케어 대사증후군 또는 혈중 세라마이드 고발현 위험군 진단 또는 예측용 조성물
KR102291727B1 (ko) * 2021-01-13 2021-08-20 주식회사 에스씨엘헬스케어 대사증후군 진단 또는 예측용 조성물
CN115326958B (zh) * 2022-08-11 2023-11-24 北京大学第三医院（北京大学第三临床医学院） 一种辅助预测或诊断肥胖合并高脂血症儿童的标志物组合物

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120196764A1 (en) * 2009-06-25 2012-08-02 The Regents Of The University Of California Salivary transcriptomic and microbial biomarkers for pancreatic cancer
KR101445243B1 (ko) * 2014-03-28 2014-09-29 서울대학교산학협력단 장내 세균의 군집과 기능의 변화를 이용한 대사성 및 염증성 질환의 조기진단
WO2014179959A1 (en) * 2013-05-09 2014-11-13 The Procter & Gamble Company Method and system for assessing health condition

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2102350A4 (en) 2006-12-18 2012-08-08 Univ St Louis INTESTINAL MICROBIOMA AS A BIOMARKER AND THERAPEUTIC TARGET FOR TREATING OBESITY OR OBESITY-RELATED DISORDER
US9939442B2 (en) 2011-09-08 2018-04-10 The Regents Of The University Of California Salivary biomarkers for gastric cancer detection
KR102222273B1 (ko) * 2013-02-04 2021-03-08 세레스 테라퓨틱스, 인코포레이티드 조성물 및 방법
AU2014232370B2 (en) 2013-03-15 2018-11-01 Seres Therapeutics, Inc. Network-based microbial compositions and methods
EP2927327A1 (en) 2014-04-02 2015-10-07 EntreChem, S.L. Non-invasive in vitro method for diagnosis and prognosis of colorectal cancer

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120196764A1 (en) * 2009-06-25 2012-08-02 The Regents Of The University Of California Salivary transcriptomic and microbial biomarkers for pancreatic cancer
WO2014179959A1 (en) * 2013-05-09 2014-11-13 The Procter & Gamble Company Method and system for assessing health condition
KR101445243B1 (ko) * 2014-03-28 2014-09-29 서울대학교산학협력단 장내 세균의 군집과 기능의 변화를 이용한 대사성 및 염증성 질환의 조기진단

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
CAPORASO, JG ET AL.: "QIIME allows analysis of high-throughput community sequencing data", NAT., vol. 7, no. 5, pages 335 - 336, XP055154026, DOI: doi:10.1038/nmeth.f.303
FARRELL, J. ET AL.: "Variants of oral microbiota associated with pancreatic diseases including pancreatic cancer", GUT, vol. 61, 2012, pages 582 - 588
FARRELL, J. ET AL.: "Variations of oral microbiota are associated with pancreatic diseases including pancreatic cancer", GUT, vol. 61, 2012, pages 582 - 588
HE, JINZHI ET AL.: "The Oral Microbiome Diversity and Its Relation to Human Diseases", FOLIA MICROBIOLOGICA, vol. 60, 2015, pages 69 - 80, XP035411930, DOI: doi:10.1007/s12223-014-0342-2 *
JORTH, PETER ET AL.: "Metatranscriptomics of the Human Oral Microbiome during Health and Disease", MBIO, vol. 5, no. 2, 2014, pages 1 - 10, XP055574945 *
REKHA, R. ET AL.: "Designing and validation of genus-specific primers for human gut flora study", ELECTRON J BIOTECHNOL, vol. 9, no. 5, 2005, pages 0 - 0
See also references of EP3489365A4
SEGATA, N. ET AL., GENOME BIOL., vol. 12, no. 6, 2011
SUNG, J. ET AL., TWIN RESEARCH AND HUMAN GENETICS, vol. 9, no. 6, 2006, pages 844 - 848

Also Published As

Publication number Publication date
EP3489365A1 (en) 2019-05-29
US11365452B2 (en) 2022-06-21
EP3489365A4 (en) 2020-07-29
KR101815692B1 (ko) 2018-01-16
US20190264262A1 (en) 2019-08-29

Similar Documents

Publication Publication Date Title
US11365452B2 (en) Composition for diagnosing or predicting risk of metabolic syndrome or metabolic syndrome-related diseases using human oral microbiome
KR101445243B1 (ko) 장내 세균의 군집과 기능의 변화를 이용한 대사성 및 염증성 질환의 조기진단
CN108064272A (zh) 用于类风湿性关节炎的生物标记物及其用途
CN107779505A (zh) 结肠直肠癌的粪便细菌标志物
KR101848037B1 (ko) 질 내 미생물을 포함하는 조성물
EP2909335B1 (en) Prognostic of diet impact on obesity-related co-morbidities
KR102134534B1 (ko) 장내 미생물 군집의 변화를 이용한 유아의 아토피피부염 조기 진단용 조성물
EP3359682B1 (en) Method for diagnosing hepatic fibrosis based on bacterial profile and diversity
CN108064273A (zh) 结直肠癌相关疾病的生物标志物
US20200277655A1 (en) New tools for assessing fimh blockers therapeutic efficiency
KR102484695B1 (ko) 장내 미생물 군집 수준 평가를 통한 비만 예측용 조성물 및 이의 용도
KR102363098B1 (ko) 장내 미생물을 이용한 신질환 위험도 예측 또는 진단용 조성물, 그를 이용한 진단키트, 정보제공방법 및 신질환 예방 또는 치료제 스크리닝 방법
KR102406599B1 (ko) 장내 미생물 군집 수준 평가를 통한 비만 예측용 조성물 및 이의 용도
KR102363094B1 (ko) 장내 미생물을 이용한 간질환 위험도 예측 또는 진단용 조성물, 그를 이용한 진단키트, 정보제공방법 및 간질환 예방 또는 치료제 스크리닝 방법
KR102533533B1 (ko) 베일로넬라 디스파 균주를 활용한 알코올성 간경변증 진단을 위한 정보제공 방법
KR102363088B1 (ko) 장내 미생물을 이용한 당뇨병 위험도 예측 또는 진단용 조성물, 그를 이용한 진단키트, 정보제공방법 및 당뇨병 예방 또는 치료제 스크리닝 방법
CN114107487B (zh) 一种可用于诊断脑卒中的产品
KR102363092B1 (ko) 장내 미생물을 이용한 비만 위험도 예측 또는 진단용 조성물, 그를 이용한 진단키트, 정보제공방법 및 비만 예방 또는 치료제 스크리닝 방법
KR20230116237A (ko) 고혈압과 관련된 장내 미생물 마커의 선별 방법 및 이를 이용한 고혈압 위험도 측정 방법
WO2015008884A1 (ko) 메트포르민에 대한 환자의 치료 반응성 평가 또는 예측용 조성물
CN116261599A (zh) 使用肠道微生物预测或诊断疾病风险的组合物、使用肠道微生物的诊断试剂盒、提供信息的方法以及筛选用于预防或治疗糖尿病的试剂的方法
EP4350008A1 (en) Biomarker composition for early diagnosis of colorectal cancer and application
CN115786552A (zh) 肠道菌群标志物在颅缝早闭辅助诊断中的应用
CN116926187A (zh) 一种肠道微生物标志物的应用
JP2019176754A (ja) 排卵障害の検査方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17834703

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017834703

Country of ref document: EP

Effective date: 20190225