WO2017209396A1 - 간암의 진단 및 예후 예측용 바이오 마커 및 그의 용도 - Google Patents

간암의 진단 및 예후 예측용 바이오 마커 및 그의 용도 Download PDF

Info

Publication number
WO2017209396A1
WO2017209396A1 PCT/KR2017/004482 KR2017004482W WO2017209396A1 WO 2017209396 A1 WO2017209396 A1 WO 2017209396A1 KR 2017004482 W KR2017004482 W KR 2017004482W WO 2017209396 A1 WO2017209396 A1 WO 2017209396A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
liver cancer
mrna
seq
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2017/004482
Other languages
English (en)
French (fr)
Inventor
이은경
탁효선
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of Catholic University of Korea
Original Assignee
Industry Academic Cooperation Foundation of Catholic University of Korea
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Academic Cooperation Foundation of Catholic University of Korea filed Critical Industry Academic Cooperation Foundation of Catholic University of Korea
Priority to US16/305,809 priority Critical patent/US11180814B2/en
Publication of WO2017209396A1 publication Critical patent/WO2017209396A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57525Immunoassay; Biospecific binding assay; Materials therefor for cancer of the liver or pancreas
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00Nucleic acid detection characterised by assay method
    • C12Q2561/113Real time assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/50Determining the risk of developing a disease
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/60Complex ways of combining multiple protein biomarkers for diagnosis

Definitions

  • the present invention relates to a biomarker for diagnosing and prognosticing liver cancer, and more particularly, to a composition or kit for diagnosing or predicting liver cancer using the biomarker, a kit, a method for providing information for diagnosing or predicting liver cancer, a biomarker detecting method, It relates to a method for screening a liver cancer treatment agent and a composition for treating liver cancer.
  • liver cancer is one of the most common and deadly human tumors in the world, and can be classified into primary liver cancer (hepatocellular carcinoma (HCC)) and other metastatic liver cancers in which other tissues have been transmitted to the liver.
  • HCC hepatocellular carcinoma
  • liver cancer refers to primary liver cancer, which occurs frequently after the cancer has advanced significantly, and often misses the time for proper treatment. It is known that cancer can be effectively treated only when appropriate treatment is applied according to its prognosis, but liver cancer, which has already advanced, is known to have a high mortality rate due to its poor prognosis. Therefore, even though a diagnostic method for accurately predicting the prognosis of liver cancer patients is urgently needed, there are limitations in accurately predicting it. In particular, an accurate method of predicting prognosis requires an analysis method for classifying patients by risk group. However, the prognosis is judged only by pathological clinical stage of liver cancer and primary surgical treatment.
  • Korean Patent Publication No. 10-2010-0115283 discloses genes such as CBS, NNMT, and TKT as biomarkers for liver cancer diagnosis or prognostic analysis
  • Korean Patent Application Publication No. 10-2014-0115490 discloses ACADVL, ANLN, and BASP1.
  • a liver cancer biomarker for diagnosing or prognosticting one or more liver cancers selected from the group consisting of MTHFD1, CAPN1, C4A, FLNB and PABPC1 is disclosed.
  • An object of the present invention is to provide a composition and kit for liver cancer diagnosis and prognosis prediction using biomarkers with improved specificity and sensitivity.
  • Another object of the present invention is to provide an information providing method and a biomarker detection method for diagnosing and predicting liver cancer using the biomarker.
  • Another object of the present invention is to provide a method for screening a liver cancer therapeutic agent using the biomarker.
  • Still another object of the present invention is to provide a composition for treating liver cancer using the inhibitor of the biomarker.
  • the present invention provides HELZ, IMP-1, NONO, RALY and RBM42 gene biomarkers as biomarkers for liver cancer diagnosis and prognosis prediction.
  • HELZ Helicase With Zinc Finger, SEQ ID NO: 1 (amino acid sequence) and SEQ ID NO: 2 (base sequence) are superfamily I class members of RNA helicases.
  • RNA helicases are known to alter the biological activity of RNA molecules and regulate access to other proteins by unwinding the double-stranded region of RNA (Wagner et al., 1999 [PubMed 10471385]). ]).
  • IMP-1 insulin like growth factor 2 mRNA binding protein 1
  • SEQ ID NO: 3 amino acid sequence
  • SEQ ID NO: 4 base sequence
  • genes are insulin-like growth factor 2 mRNA-binding protein family encodes a member of the factor 2 mRNA-binding protein family.
  • This protein contains four K homology domains and two RNA recognition motifs and functions by binding to mRNA of specific genes such as insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein. And control their translation. For this gene, transcriptional variants encoding two different isoforms have been found.
  • NONO non-POU domain containing, octamer-binding, SEQ ID NO: 5 (amino acid sequence) and SEQ ID NO: 6 (base sequence)
  • genes are RNA-binding proteins that perform several functions in the nucleus, including transcriptional regulation and RNA splicing Encrypt
  • RALY RALY heterogeneous nuclear ribonucleoprotein, SEQ ID NO: 7 (amino acid sequence) and SEQ ID NO: 8 (base sequence)
  • hnRNP heterogeneous nuclear ribonucleoprotein
  • the RBM42 (RNA binding motif protein 42, SEQ ID NO: 9 (amino acid sequence) and SEQ ID NO: 10 (base sequence)) genes are a 3-ratio of hnRNP K (Heterogeneous nuclear ribonucleoprotein K) -binding protein and p21 mRNA, one of its target mRNAs. It is known to bind to a translation site (UTR).
  • hnRNP K is a conservative RNA-binding protein involved in several gene expression processes including chromatin remodeling, transcription, RNA splicing, mRNA stability and translation (Fukuda T1, Naiki T, Saito M, Irie K. Genes Cells. 2009 Feb; 14 (2): 113-28.doi: 10.1111 / j.1365-2443.2008.01256.x.Epub 2008 Jan 6.).
  • the present invention is for liver cancer diagnosis and prognostic prediction comprising a substance for measuring the expression level of any one or more biomarker genes selected from the group consisting of HELZ, IMP-1, NONO, RALY and RBM42 To provide a composition.
  • the substance for measuring the expression level of the gene detects any one or more of the presence of mRNA, the protein encoding the gene, or both, the presence amount and the presence pattern of the gene Characterized in that the material.
  • the substance measuring the expression level of the gene specifically binds to at least one selected from the group consisting of a nucleotide sequence of the gene, a sequence complementary thereto, a fragment of the nucleotide, and a sequence complementary thereto.
  • a nucleotide sequence of the gene specifically binds to at least one selected from the group consisting of a nucleotide sequence of the gene, a sequence complementary thereto, a fragment of the nucleotide, and a sequence complementary thereto.
  • the substance for measuring the expression level of the gene is any one or more of a polypeptide encoded by the nucleotide sequence, a polypeptide encoded by the complementary sequence, a polypeptide encoded by a fragment of the nucleotide sequence Oligopeptides, Monoclonal Antibodies, Polyclonal Antibodies, Chimeric Antibodies, Antibody Fragments, Ligands, PNA (Peptide Nucleic Acid), Aptamers, Aviders And peptidomimetics (peptidomimetics) is characterized in that any one or more selected.
  • the substance for measuring the expression level of the gene is to detect any one or more of the presence, abundance and presence pattern of the protein encoded by the biomarker gene and mRNA that the gene is transcribed. Characterized in that the material.
  • the material for measuring the expression level of the gene is reverse transcription polymerase chain reaction, competitive polymerase chain reaction, real-time polymerase chain reaction, Nuclease protection assay (RNase, S1 nuclease assay), in situ hybridization method DNA microarray, Northern blot, Western blot, Enzyme Linked Immuno Sorbent Assay (ELISA), Radioimmunoassay, Immunodiffusion, Immunoelectrophoresis, Tissue immunostaining, Immunoprecipitation assay, Complement fixation assay, FACS, Mass spectrometry spectrometry) and protein microarrays may be used as a detection reagent for measuring gene expression by any one or more methods, but are not limited thereto.
  • the present invention provides a kit for diagnosing and predicting liver cancer comprising a substance for detecting any one or more biomarker genes selected from the group consisting of HELZ, IMP-1, NONO, RALY, and RBM42. do.
  • the substance for detecting the gene may include an antibody that specifically recognizes a nucleic acid sequence of the gene, a complementary nucleic acid sequence thereof, a fragment of the nucleic acid sequences, or a protein encoded by the nucleic acid sequence, Antibody fragments, aptamers, aviders, or peptidomimetics.
  • the kit may be selected from a microarray, a gene amplification kit, an immunoassay kit, a luminex assay kit, a protein microarray kit, and an ELISA kit, but is not limited thereto.
  • the invention comprises the steps of measuring the expression level of any one or more biomarker genes selected from the group consisting of HELZ, IMP-1, NONO, RALY and RBM42 from a sample obtained from a subject; And it provides a method for providing information for diagnosing and predicting liver cancer comprising comparing the expression level of the gene with a reference value obtained from a normal control sample.
  • the method is characterized in that it is highly likely that the onset of liver cancer or the prognosis is high when the expression level of the gene is higher than the reference value.
  • the expression level of the gene is measured by reverse transcription polymerase chain reaction, competitive polymerase chain reaction, real time polymerase chain reaction, Nuclease protection assay (RNase, S1 nuclease assay), in situ hybridization, DNA micro Array Method, Northern Blot, Western Blot, Enzyme Linked Immuno Sorbent Assay (ELISA), Radioimmunoassay, Immune Diffusion, Immunoelectrophoresis, Tissue Immunostaining, Immunoprecipitation Assay, Complementary Assay, FACS, Mass Spectrometry or Protein microarray may be used, but is not limited thereto.
  • the present invention provides a primer set that can be used to detect the biomarker genes of the present invention.
  • the HELZ gene is a forward primer of SEQ ID NO: 11 and a reverse primer of SEQ ID NO: 12
  • the IMP-1 gene is a forward primer of SEQ ID NO: 13
  • a reverse primer of SEQ ID NO: 14 wherein the NONO gene is a forward primer of SEQ ID NO: 15 and a reverse primer of SEQ ID NO: 16, and the RALY gene is a forward primer of SEQ ID NO: 17 (forward primer) and reverse primer of SEQ ID NO: 18, the RBM42 gene can be amplified using a forward primer of SEQ ID NO: 19 and a reverse primer of SEQ ID NO: 20, respectively.
  • the primer set may be used as a primer set for diagnosing liver cancer and predicting prognosis.
  • the invention comprises measuring the expression level of any one or more biomarker genes selected from the group consisting of HELZ, IMP-1, NONO, RALY and RBM42 present in a human biological sample.
  • a method for detecting a biomarker for diagnosing liver cancer or predicting prognosis is provided.
  • the expression level of the gene may be measured using the above-described measuring method.
  • the present invention comprises the steps of treating a subject material to a cell or an experimental animal in which any one or more genes selected from the group consisting of HELZ, IMP-1, NONO, RALY and RBM42 are expressed; And it provides a method for screening a liver cancer therapeutic agent comprising the step of confirming the expression level of the gene.
  • the screening method further comprises the step of determining the target material as a candidate for treating liver cancer when the expression of the gene is inhibited by the treatment of the target material.
  • the expression level of the gene may be measured using the above-described measuring method.
  • the present invention provides a composition for preventing or treating liver cancer comprising any one or more gene inhibitors selected from the group consisting of HELZ, IMP-1, NONO, RALY and RBM42.
  • the inhibitor may be siRNA or an antibody, but is not limited thereto.
  • the siRNA may be selected from the group consisting of siRNA represented by SEQ ID NO: 21 to SEQ ID NO: 25, the siRNA represented by SEQ ID NO: 21 to SEQ ID NO: 25 are each HELZ, IMP-1 , NONO, RALY and RBM42 genes.
  • the antibody may be a monoclonal antibody, polyclonal antibody, and / or recombinant antibody that specifically binds to the HELZ, IMP-1, NONO, RALY and RBM42 proteins, and the like, It can be prepared directly by known methods (Benny KC Loed., Antibody Engineering: Methods and Protocols, Methods in Molecular Biology, Vol. 248, Humana Press (2004)).
  • the HELZ, IMP-1, NONO, RALY and RBM42 genes of the present invention were found to increase in expression as liver cancer progresses. Therefore, the genes can be used as markers for diagnosing and prognostic liver cancer with improved specificity and sensitivity depending on the combination, and thus can not only diagnose liver cancer with high accuracy and reliability or predict the prognosis, but also effectively screen for the treatment of liver cancer. Can be used.
  • Figure 2 is a result of confirming the expression patterns of NONO mRNA, RALY mRNA, RBM42 mRNA in human normal tissue and cancer tissue.
  • 3 is a result of confirming the expression patterns of NONO protein and RALY protein in human normal tissue and cancer tissue.
  • FIG. 4 is a result of comparing and analyzing the survival rate of the cancer patient group according to the expression difference of HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA using a computer program.
  • FIG. 6 is a result showing the reduced cell activity in the experimental group treated with each of HELZ, IMP-1, NONO, RALY, RBM42 siRNA compared to the control group.
  • Figure 7 shows the results of reduced cell growth compared to the control group in the HELZ, IMP-1, NONO, RALY, RBM42 siRNA treatment group respectively.
  • biomarkers are markers for early diagnosis of cancer and for prognosis.
  • liver cancer generally refers to a cancer that originates in hepatocytes.
  • Liver cancer includes primary liver cancer in the liver from the beginning and metastatic liver cancer in which cancer from other tissues has spread to the liver.
  • the cause is unclear in most cases, cirrhosis is frequently found, and liver cancer is found to occur in patients with cirrhosis and carriers of chronic active hepatitis B or hepatitis B.
  • the present inventors confirmed that using the marker of the present invention, a highly sensitive and reliable result can be obtained for the development of liver cancer from an individual.
  • diagnosis refers to determining the susceptibility of an object to a particular disease or condition, determining whether an object currently has a particular disease or condition, an object suffering from a particular disease or condition Determining prognosis (eg, identifying pre-metastatic or metastatic cancer states, determining stage of cancer or determining the responsiveness of cancer to treatment), or therametrics (eg, information on treatment efficacy) Monitoring the state of an object to provide
  • prognosis eg, identifying pre-metastatic or metastatic cancer states, determining stage of cancer or determining the responsiveness of cancer to treatment
  • therametrics eg, information on treatment efficacy
  • the term "marker” refers to a substance that can be determined by distinguishing a cell or tissue from which liver cancer develops from a normal cell or tissue, and a polypeptide or nucleic acid (eg, mRNA) showing an increased pattern in cells with liver cancer compared to normal cells. Etc.), lipids, glycolipids, glycoproteins, organic biomolecules such as sugars (monosaccharides, disaccharides, oligosaccharides, etc.) and the like.
  • the liver cancer diagnostic (bio) marker of the present invention is a nucleotide of HELZ, IMP-1, NONO, RALY, and RBM42 genes (including fragments thereof) or proteins encoded therein, including fragments thereof, in liver cancer cells It is a gene with increased expression.
  • markers may use mRNA for any one gene or any protein encoded by the gene, and may be a complex marker including two or more of these markers.
  • a 'polypeptide' is understood to include an amino acid sequence that exhibits substantial identity to that amino acid sequence. This substantial identity is at least 60% homology when the amino acid sequence of the present invention is aligned with the maximal correspondence of any other sequence and the aligned sequence is analyzed using algorithms commonly used in the art. , More preferably, but not limited to, an amino acid sequence that exhibits at least 80% homology, most preferably at least 90% homology, and in general, higher percent identity is more preferred.
  • Polypeptides having said identity also include polypeptides associated with the beta-adipate pathway, including amino acid sequences in which one or more amino acid residues have been lost, substituted, inserted, and / or added in a polypeptide of the particular amino acid sequence described. do. In general, the smaller the number of losses, substitutions, insertions, and / or additions, the more preferable.
  • nucleotide as used herein has the meaning of encompassing DNA (gDNA and cDNA) and RNA molecules inclusively, and the nucleotides that are the basic building blocks of nucleic acid molecules are naturally occurring nucleotides as well as sugars. Or analogs with modified base sites.
  • polypeptides of the present invention are not limited to nucleic acid molecules encoding specific amino acid sequences (polypeptides) described above, and as described above, polynucleotides having an amino acid sequence or a function corresponding thereto that exhibit substantial identity to a specific amino acid sequence. It is interpreted to include nucleic acid molecules encoding peptides.
  • This substantial identity is at least 60% homology when the amino acid sequence of the present invention is aligned with the maximal correspondence of any other sequence and the aligned sequence is analyzed using algorithms commonly used in the art. More preferably at least 80% homology, most preferably at least 90% homology, but is not limited thereto.
  • polypeptides having corresponding functions include, for example, polypeptides of amino acid sequence in which one or more amino acids are lost, substituted, inserted, and / or added.
  • polypeptides comprise a polypeptide consisting of an amino acid sequence in which one or more amino acid residues have been lost, substituted, inserted, and / or added as described above and involved 3-hydroxypropionic acid synthesis, and the loss or substitution of amino acid residues. It is preferred that the number of inserts, and / or additions is small.
  • polypeptide includes a polypeptide having an amino acid sequence having about 60% or more identity with a specific amino acid sequence as described above and serving as a biomarker for diagnosing or prognostic liver cancer, and the higher the identity, the more preferable.
  • the term “complementary” or “complementary” refers to the ability of purine and pyrimidine nucleotides to bind through hydrogen bonds to form double stranded polynucleotides, including partially complementary cases.
  • the following base pairs are associated with complementarity: guanine and cytosine; Adenine and thymine; And adenine and uracil.
  • “Complementary” applies substantially to all base pairs in which the above-mentioned relationship comprises two single-stranded polynucleotides throughout the molecule of full length.
  • Partially complementary refers to the relationship that a portion of one of the molecules remains a single strand because the length of one of the two single-stranded polynucleotides is short.
  • the present invention provides a composition for diagnosing or predicting liver cancer comprising a substance measuring the expression level of HELZ, IMP-1, NONO, RALY and RBM42 genes.
  • Liver cancer diagnostic or prognostic composition according to the present invention may include a substance for measuring the expression of each gene, or may be a substance for simultaneously measuring the expression of the two genes.
  • Expression measurement (or detection) in the present invention includes quantitative and / or qualitative analysis, including the detection of the presence, absence, and detection of the amount of expression, such methods are known in the art, and those skilled in the art To choose the appropriate method.
  • the substance for measuring the expression level of the gene may be a substance for detecting any one or more of the presence of mRNA, the protein encoding the gene, or both, the presence amount and the pattern of transcription of the gene.
  • the present invention can be used for the diagnosis or prognosis of hepatocellular carcinoma through quantitative and / or qualitative detection of such genes at the nucleic acid level, particularly at the mRNA and protein levels.
  • a substance for measuring the expression level of the gene is a nucleotide sequence of the gene, a sequence complementary thereto, a fragment of the nucleotide and a primer specifically binding to any one or more selected from the group consisting of the sequence, probe , At least one of aptamer and antisense.
  • probe and / or primer pairs specific for mRNA of the gene are included.
  • primer or probe is meant a nucleic acid sequence having a free 3 'hydroxyl group capable of binding complementarily to the template and allowing reverse transcriptase or DNA polymerase to initiate replication of the template.
  • the gene expression measuring material may be labeled as a color, luminescent or fluorescent material for signal detection.
  • Northern blot or reverse transcriptase PCR polymerase chain reaction
  • RNA of a sample is specifically isolated from mRNA, and then cDNA is synthesized therefrom, and then a specific gene or a combination of primers and probes is used to detect a specific gene in the sample. Or it is a method which can determine the expression amount.
  • the substance measuring the expression level of the gene in the present invention detects any one or more of the presence, abundance and presence pattern of the protein encoded by the gene of the present invention and the messenger RNA (mRNA) that the gene is transcribed. It may be a substance.
  • mRNA messenger RNA
  • the material for measuring the expression level of the gene may include a material used in various gene (biomarker) detection methods known in the art, for example, reverse transcription polymerase chain reaction, competitive polymerase chain Reaction, real-time polymerase chain reaction, Nuclease protection assay (RNase, S1 nuclease assay), in situ hybridization, DNA microarray method, Northern blot, Western blot, Enzyme Linked Immuno Sorbent Assay (ELISA), radioimmunoassay, immunodiffusion method , Immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, mass spectrometry and protein microarray can be used as a detection reagent for measuring gene expression, but is not limited thereto. It is not.
  • the present invention measures the expression of a gene of interest using methods of quantitative and / or qualitative analysis of various nucleic acids and / or proteins known in the art.
  • RT-PCR reverse transcription polymerase chain reaction
  • NPA Nuclease protection assays
  • methods using RNase, S1 nuclease analysis, in situ hybridization, DNA microarrays or chips or Northern blots, etc. may be used, such assays are known and can also be carried out using commercially available kits.
  • Ramen can be selected as appropriate for the practice of the present application.
  • the present invention provides a kit (or system) for diagnosing or predicting liver cancer comprising a substance capable of detecting the genes of the present invention.
  • the kit according to the present invention may use a variety of kits known in the art, for example, any one selected from a microarray, a gene amplification kit, an immunoassay kit, a luminex assay kit, a protein microarray kit, and an ELISA kit. It may be one or more, but is not limited thereto.
  • the present invention comprises the steps of treating the liver cancer diagnostic or prognostic composition for a target biological sample; Measuring the expression level of a gene selected from the group consisting of HELZ, IMP-1, NONO, RALY and RBM42 genes from the biological sample of interest; And it provides a liver cancer diagnosis or prognostic method comprising the step of comparing the gene expression level measurement result with a reference value.
  • the biological sample refers to a substance or a mixture of substances including one or more components capable of detecting a biomarker, and includes a living body, particularly a cell, tissue or body fluid derived from a human, such as whole blood, urine, plasma, and serum. It is not limited to this. It also includes cells or tissues derived directly from an organism as well as cultured in vitro. Various samples may be used for the detection of liver cancer biomarkers according to the present disclosure, but are not limited thereto. In one embodiment, urine, whole blood, serum and / or plasma may be used. In other embodiments, liver tissue / cells or in vitro cell cultures obtained from living or suspected or probable liver cancers may be used, but are not limited thereto. It also includes fractions or derivatives of the blood, cells or tissues. When using a cell or tissue, the cell itself or a fusion of the cell or tissue may be used.
  • the expression level of the gene in the method for diagnosing or predicting liver cancer according to the present invention may use a quantitative and / or qualitative measurement method for various known nucleic acids and / or proteins as described above.
  • liver gene is diagnosed and the prognosis is predicted by comparing the result of the gene expression level measurement with that of the control group.
  • the control group or the reference group was a negative control group, or a sample from a patient treated with hepatocellular carcinoma; , A sample of a patient derived from hepatitis.
  • a sample derived from a normal person, a normal tissue sample taken from a liver cancer determination patient, or a sample derived from a patient treated after being determined as a hepatocellular carcinoma is used as a control group or a reference group and used for comparison of the obtained profile.
  • the liver cancer biomarker gene according to the present invention has increased expression in liver cancer cells and tissues compared to normal cells and tissues.
  • Various methods known in the art can be used to compare marker profiles between control groups and test groups using samples. For example, reference may be made to digital image comparison of expression profiles and comparison using DB for expression data. Profiles obtained through marker detection according to the present application can be processed using known data analysis methods. For example, the nearest neighbor classifier, partial-least squares, SVM, AdaBoost, and clustering-based classification methods can be used. In addition, various statistical processing methods may be used to confirm the significance of the method for diagnosing and predicting liver cancer according to the present invention. As a statistical processing method, in one embodiment, a logic regression method may be used. In addition, statistical processing can determine the level of confidence in the significant difference between the test substance and the control to diagnose HCC. The raw data used for statistical processing are the values analyzed in duplicate, triple or multiple for each marker. This statistical method is very useful for making clinically meaningful judgments through statistical processing of biomarkers as well as clinical and genetic data.
  • Liver cancer diagnosis and prognostic method can be used to determine the severity of liver cancer. For example, it can be assessed as mild, moderate or severe, compared to the profiles of the positive and negative controls. Furthermore, marker profile analysis for a certain liver cancer population may be performed and classified according to a predetermined criterion based on the profile result.
  • the method for diagnosing and prognostic liver cancer according to the present invention can be performed several times for a specific period of time, for example, over a year, and can be used for monitoring the change in expression pattern.
  • an increase or decrease in expression may be associated with the state of liver cancer. It can be used to determine HCC incidence, progression, exacerbation, etc., in comparison with previous test values or the value of the control group for the same subject. Based on changes in biomarkers over time, preventive measures can be taken to prevent the progression of liver cancer. Further, in order to confirm liver cancer, it may be used with conventional liver cancer diagnosis methods such as AFP test, ultrasound, computerized axial tomography (CT scan) or magnetic resonance imaging (MRI) test.
  • CT scan computerized axial tomography
  • MRI magnetic resonance imaging
  • the present invention provides a method for detecting a biomarker for liver cancer diagnosis or prognosis by measuring the expression level of the genes of the present invention in a biological sample of human in order to provide information necessary for diagnosis or prognosis of liver cancer. to provide.
  • the expression level of the gene in the method for detecting the biomarker for diagnosing or predicting liver cancer according to the present invention may be quantitative and qualitative measurement methods for various nucleic acids and proteins known in the art.
  • the present invention provides a method for screening a liver cancer therapeutic agent comprising the step of confirming whether to promote or inhibit the expression of the biomarker gene of the present invention in a compound to be tested. Confirmation of whether the gene is promoted or suppressed in the screening method of the liver cancer therapeutic agent according to the present invention may use a quantitative and / or qualitative measurement method for various known nucleic acids and / or proteins as described above.
  • the compound to be tested is a substance expected to regulate the expression of the marker gene according to the present application.
  • the compound may have a low molecular weight therapeutic effect.
  • a compound having a weight of about 1000 Da, such as 400 Da, 600 Da or 800 Da may be used, but is not limited thereto.
  • such compounds may form part of a compound library, and the number of compounds constituting the library may vary from tens to millions.
  • Such compound libraries include peptides, peptoids and other cyclic or linear oligomeric compounds, and small molecule compounds based on templates such as benzodiazepines, hydantoin, biaryls, carbocycles and polycycle compounds (such as naphthalene, phenoty) Azine, acridine, steroids, and the like), carbohydrate and amino acid derivatives, dihydropyridine, benzhydryl and heterocycles (such as triazine, indole, thiazolidine, etc.), but these are merely illustrative. It is not limited to this.
  • the present invention provides a composition for the prevention or treatment of liver cancer comprising any one or more gene inhibitors selected from the group consisting of HELZ, IMP-1, NONO, RALY and RBM42.
  • the inhibitor is preferably siRNA, but is not limited thereto.
  • siRNA When siRNA is used as the gene inhibitor, an appropriate drug delivery system known for delivery of siRNA can be used.
  • an appropriate drug delivery system known for delivery of siRNA can be used.
  • viral vectors retroviral vectors, adenovirus vectors, vaccinia virus vectors, etc.
  • non-viral vectors liposomes, cationic polymers, micelles, emulsions, Nucleic acid carriers such as solid lipid nanoparticles
  • Nucleic acid carriers such as solid lipid nanoparticles
  • compositions of the invention may be in the form of sterile injectable preparations of sterile injectable aqueous or oily suspensions. Such suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents.
  • compositions of the present invention may be used in a pharmaceutically acceptable carrier such as ion exchange resins, lecithin, serum proteins, various phosphates, glycine, sorbic acid, potassium sorbate, water, salts or electrolytes, colloidal silica, magnesium tri Silicates, polyvinylpyrrolidone, cellulose based substrates, polyethylene glycols, sodium carboxymethylcellulose, polyarylates, waxes, and the like, but are not limited thereto.
  • Patients to be administered the siRNA or pharmaceutical compositions of the invention may be mammals, preferably humans, monkeys, rodents.
  • the therapeutically effective amount of the pharmaceutical composition of the present invention may include the type of disease, the degree of symptoms, the type of siRNA administered, the type of formulation, the age, weight, general health, sex and diet, time of administration, route of administration and treatment of the patient. It may be appropriately adjusted according to various factors including a drug, such as duration, concomitant medication.
  • the tissue used in this experiment was purchased from the Catholic Research Tissue Bank and used for the experiment. Normal liver tissue cells and liver cancer cells were purchased from 24 pairs of patients and used for the experiment. All regulations on the use of human tissues were conducted in compliance with the regulations of the Catholic University Institutional Ethics Committee.
  • DMEM culture containing 10% bovine serum was used for the culture of all cell lines used in the experiment.
  • Cell lines were cultured in an environment maintained at a 5% CO 2 concentration in an incubator maintained at 37 °C.
  • Intracellular dielectric injection was carried out using a 35-mm2 culture dish, and experiments related to mitochondrial function analysis were performed using a 96 well culture dish. In all other cases, cell lines were cultured and maintained using 100-mm2 plates.
  • siRNA sequence for each target gene is as follows.
  • HELZ GCAGUUGAUCCUCGAAUUA (SEQ ID NO: 21)
  • IMP-1 CCGGGAGCAGACCAGGCAA (dTdT) (SEQ ID NO: 22)
  • RALY UAACGUACCUGUCAAGCUC (SEQ ID NO. 24)
  • RBM42 GCAAUGAGGUGAACGAUGAUU (SEQ ID NO: 25)
  • Invitrogen's trizol solution was used for analysis of the gene expression and changes in the tissues used in the purchased tissues and experiments. After tissue crushing and cell capture, trizol solution was treated to obtain mRNA, and then cDNA was synthesized using Toyobo's cDNA synthesis kit. Using the synthesized cDNA, the expression and changes of gene expression in the experimental and control groups were quantified by real-time quantitative PCR.
  • Sampled cells were obtained by intracellular protein using RIPA solution, and then the same amount of total protein was isolated according to size by electrophoresis in SDS-PAGE gel.
  • the specific size of the isolated protein was transferred to the PVDF membrane and the antibody of the protein was attached to the PVDF membrane.
  • the change in expression of the protein to be observed was quantitatively analyzed by recording the light irradiated from the specific protein on the X-ray film.
  • control and experimental groups were measured by MTT assay.
  • the control and experimental cells were quantified by measuring the cell activity in the same amount in 96-well culture dish after incubation for 2 days and after incubation for 3 days, respectively.
  • control and experimental groups were measured by measuring the total cell counts over time.
  • the control and experimental cells were quantified by measuring the total number of cells after inoculation in a 6-well culture dish in the same amount, followed by 2 days of culture and 3 days of culture, respectively.
  • Colony forming ability analysis to measure the initial cancer developmental capacity of the cancer cell line was confirmed whether HELZ, IMP-1, NONO, RALY, RBM42 can affect the initial cancer developmental capacity of the cell line.
  • the control and experimental groups were inoculated with 100 cells in 6-well culture dishes, respectively, and cultured for 3 weeks. After confirming colony formation in the culture dish, the number of colonies was quantified through crystal violet staining.
  • TMM Tumor-Node-Metastasis
  • Serum used in this experiment was distributed through the Human Resource Bank of Korea Human Resource Bank Network, Chonbuk National University Hospital and Human Resource Bank of Gyeongsang National University Hospital. Serum and normal serum of liver cancer patients were obtained from a total of 100 patients and 20 controls and used for the experiment. All regulations on the use of human tissues were conducted in compliance with the regulations of the clergy University Institutional Ethics Committee.
  • Dot-blotting was used to analyze protein expression and changes in the serum. Using 45 ⁇ l of pre-serial serum, it is immobilized on the PVDF (poly-vinyl difluoride) membrane of Merk Millipore, and the expression is detected by the antibody of a specific protein. Through this, the expression and change pattern of the related proteins of the experimental group and the control group were quantified.
  • PVDF poly-vinyl difluoride
  • HELZ mRNA, IMP-1 mRNA, NONO mRNA, IMP-1 mRNA, NOMP mRNA, RALY mRNA, RBM42 mRNA expression in human cancer RALY mRNA, RBM42 mRNA expression was confirmed by RNA sequencing.
  • HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA in cancer tissue is increased (Fig. 1A)
  • HELZ mRNA, IMP-1 mRNA, NONO mRNA in normal contrast cancer tissue is increased (Fig. 1B).
  • Fig. 1B HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA increases.
  • NONO mRNA, RALY mRNA, and RBM42 mRNA As cancer develops in the body, NONO mRNA, RALY mRNA, and RBM42 mRNA expression patterns in normal tissues and cancer tissues of humans were confirmed (FIG. 2). ). As a result, it was confirmed that the expression of NONO mRNA, RALY mRNA, RBM42 mRNA was increased in cancer tissues compared to normal tissues.
  • NONO protein and RALY protein shows as the cancer develops in the body
  • NONO protein and RALY protein expression patterns in normal human tissues and cancer tissues are confirmed (FIG. 3).
  • NONO protein and RALY protein expression patterns in normal human tissues and cancer tissues are confirmed (FIG. 3).
  • FIG. 3 it was confirmed that the expression of NONO protein and RALY protein was increased in cancer tissues compared to normal tissues.
  • HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, and RBM42 mRNA according to the survival rate in cancer patients was expressed by computer program through HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA expression.
  • the result of comparing and analyzing the survival rate of the cancer patient group according to the difference (Fig. 4). As a result, it was confirmed that the survival rate of patients with decreased expression of NONO mRNA, RALY mRNA, and RBM42 mRNA was increased.
  • the present inventors were able to predict in advance whether the onset and severity of liver cancer through analysis of the expression level of HELZ, IMP-1, NONO, RALY, RBM42.
  • RBM42, NONO and RALY antibodies were used to target RBM42, NONO and RALY proteins, respectively.
  • the serum used in this experiment was used 45 ⁇ l per person and the antibodies are as follows.
  • RBM42 used 1 mg / ml antibody of BETHYL
  • NONO antibody and RALY antibody used Abcam's antibody, and the concentration was 1: 1000.
  • RBM42 protein was not detected in 20 normal serum but was detected in 32 of 100 liver cancer serum.
  • NONO protein was detected in 2 of 20 normal serum, 54 in 100 liver cancer patient serum, and RALY protein was detected in 2 of 16 normal serum and 24 of 80 liver cancer patient serum ( 8).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 간암 진단 또는 예후 예측용 바이오 마커 및 이의 용도에 관한 것으로, 본 발명의 바이오 마커는 특이성과 민감도가 향상된 간암 진단 및 예후 측정용 마커로 이용될 수 있으며, 이를 통해 높은 정확성과 신뢰도로 간암을 진단하거나 그 예후를 예측할 수 있을 뿐만 아니라 간암 치료제를 효과적으로 스크리닝하는데 이용될 수 있다.

Description

간암의 진단 및 예후 예측용 바이오 마커 및 그의 용도
본 발명은 간암의 진단 및 예후 예측용 바이오 마커에 관한 것으로, 보다 구체적으로 상기 바이오 마커를 이용한 간암 진단 또는 예후 예측용 조성물, 키트, 간암 진단 또는 예후 예측을 위한 정보제공방법, 바이오 마커 검출 방법, 간암 치료제의 스크리닝 방법 및 간암 치료용 조성물에 관한 것이다.
간암은 전세계적으로 흔하면서도 치명적인 인간 종양의 하나로, 간세포 자체로부터 발생한 원발성 간암(간세포암; hepatocellular carcinoma, HCC)과 다른 조직의 암이 간으로 전이되어 온 전이성 간암으로 크게 구분될 수 있다. 흔히 간암이라 함은 원발성 간암을 지칭하는데, 원발성 간암은 암이 상당히 진행된 이후에 그 증상이 나타나므로 적절한 치료시기를 놓치는 경우가 빈번히 발생한다. 암은 그 예후에 따라 적절한 치료방법이 적용되어야만 효율적인 치료가 가능하나, 이미 진행되어 버린 간암은 그 예후가 극히 불량하여 높은 치사율을 나타내는 것으로 알려져 있다. 따라서 간암 환자의 예후를 정확히 예측할 수 있는 진단방법이 절실히 요구됨에도 아직까지 이를 정확히 예측하는 것에는 한계가 있다. 특히 예후의 정확한 예측을 위해서는 환자들을 위험군별로 분류하는 분석방법이 필요한데, 아직까지는 병리임상학적인 간암의 단계와 1차적 외과 치료에만 의존하여 예후를 판단하고 있는 실정이다.
이에 따라 최근 암 진단의 정확성을 높이고 효과적인 치료방법을 적용하기 위해 유전자 분석을 활용하려는 시도가 증가하고 있다. 즉 환자로부터 얻은 혈액 등의 시료로부터 특정 암 관련 유전자를 검출하거나 그 발현정도를 측정하여 암의 진단이나 치료에 활용하는 방법이다. 예컨대 대한민국 공개특허 제10-2010-0115283호는 CBS, NNMT, TKT 등의 유전자를 간암 진단 또는 예후 분석용 바이오 마커로 개시하고 있으며, 대한민국 공개특허 제10-2014-0115490호는 ACADVL, ANLN, BASP1, MTHFD1, CAPN1, C4A, FLNB 및 PABPC1로 구성되는 군으로부터 선택되는 하나 이상의 간암 진단 또는 예후 측정용 간암 바이오마커를 개시하고 있다. 그러나 암 세포의 복잡성과 다양성 등으로 인해 일부 진단용 바이오 마커만으로 간암의 예후를 정확히 예측하는 것에는 한계가 있다. 따라서 특이성과 민감도가 향상된 바이오 마커의 지속적인 개발과 함께 여러 마커를 조합하여 진단의 정확성을 향상시킴으로써 개별검사의 한계를 극복할 필요가 있다.
본 발명의 목적은 특이성과 민감도가 향상된 바이오마커를 이용한 간암 진단 및 예후 예측용 조성물 및 키트를 제공하는 것이다.
본 발명의 다른 목적은 상기 바이오마커를 이용하여 간암 진단 및 예후 예측을 위한 정보제공방법 및 바이오 마커 검출방법을 제공하는 것이다.
본 발명의 다른 목적은 상기 바이오마커를 이용한 간암 치료제의 스크리닝 방법을 제공하는 것이다.
본 발명의 또다른 목적은 상기 바이오마커의 억제제를 이용한 간암 치료용 조성물을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 간암 진단 및 예후 예측용 바이오 마커로서 HELZ, IMP-1, NONO, RALY 및 RBM42 유전자 바이오 마커를 제공한다.
HELZ (Helicase With Zinc Finger, 서열번호 1(아미노산 서열) 및 서열번호 2(염기서열))는 RNA 헬리카아제(helicases)의 슈퍼패밀리 I 클래스 멤버이다. RNA 헬리카아제는 RNA의 이중가닥 영역을 풀어 구조(conformation) 변화를 일으킴으로써, RNA 분자의 생물학적 활성을 변화시키고 다른 단백질에의 접근을 조절하는 것으로 알려져 있다(Wagner et al., 1999 [PubMed 10471385]).
IMP-1 (IGF2BP1; insulin like growth factor 2 mRNA binding protein 1, 서열번호 3(아미노산 서열) 및 서열번호 4(염기서열)) 유전자는 인슐린-유사 성장인자 2 mRNA-결합 단백질 패밀리(insulin-like growth factor 2 mRNA-binding protein family)의 멤버를 암호화한다. 이 단백질은 4개의 K 상동(homology) 도메인과 2개의 RNA 인식 모티프를 포함하며, 인슐린-유사 성장인자 2, 베타-액틴 및 베타-트랜스듀신 반복-포함 단백질과 같은 특정 유전자의 mRNA에 결합하여 기능하고, 이들의 번역을 조절한다. 이 유전자에 대해서는 두 개의 서로 다른 동형단백질(isoform)을 암호화하는 전사 변이체가 발견되었다.
NONO (non-POU domain containing, octamer-binding, 서열번호 5(아미노산 서열) 및 서열번호 6(염기서열)) 유전자는 핵에서 전사조절과 RNA 스플라이싱을 포함한 여러 기능을 수행하는 RNA-결합 단백질을 암호화한다.
RALY (RALY heterogeneous nuclear ribonucleoprotein, 서열번호 7(아미노산 서열) 및 서열번호 8(염기서열)) 유전자는 hnRNP (heterogeneous nuclear ribonucleoprotein) 유전자 패밀리의 멤버를 암호화한다. 이 단백질은 pre-mRNA 스플라이싱과 배 발달(embryonic development)에 관여하는 것으로 알려져 있다.
RBM42 (RNA binding motif protein 42, 서열번호 9(아미노산 서열) 및 서열번호 10(염기서열)) 유전자는 hnRNP K (Heterogeneous nuclear ribonucleoprotein K)-결합 단백질과 이의 표적 mRNA 중 하나인 p21 mRNA의 3-비번역부위(UTR)에 결합하는 것으로 알려져 있다. hnRNP K는 크로마틴 리모델링, 전사, RNA 스플라이싱, mRNA 안정성 및 번역을 포함한 여러 유전자 발현 프로세스에 관여하는 보존적인 RNA-결합 단백질이다(Fukuda T1, Naiki T, Saito M, Irie K. Genes Cells. 2009 Feb;14(2):113-28. doi: 10.1111/j.1365-2443.2008.01256.x. Epub 2008 Jan 6.).
본 발명의 일 양태로서, 본 발명은 상기 HELZ, IMP-1, NONO, RALY 및 RBM42 로 이루어진 군으로부터 선택되는 어느 하나 이상의 바이오마커 유전자의 발현 수준을 측정하는 물질을 포함하는 간암 진단 및 예후 예측용 조성물을 제공한다.
본 발명의 일례에 따르면, 상기 유전자의 발현 수준을 측정하는 물질은 상기 유전자가 전사하는 mRNA, 상기 유전자가 암호화하는 단백질, 또는 양자 모두의 존재 여부, 존재량 및 존재 패턴 중에서 어느 하나 이상을 검출하는 물질인 것을 특징으로 한다.
본 발명의 일례에 따르면, 상기 유전자의 발현 수준을 측정하는 물질은 상기 유전자의 뉴클레오타이드 서열, 그에 상보적인 서열, 상기 뉴클레오타이드의 단편 및 그에 상보적인 서열로 이루어진 군에서 선택된 어느 하나 이상에 특이적으로 결합하는 프라이머, 프로브, 앱타머 및 안티센스 중 어느 하나 이상인 것을 특징으로 한다.
본 발명의 일례에 따르면, 상기 유전자의 발현 수준을 측정하는 물질은 상기 뉴클레오타이드 서열에 코딩되는 폴리펩타이드, 상기 상보적인 서열에 코딩되는 폴리펩타이드, 상기 뉴클레오타이드 서열의 단편에 코딩되는 폴리펩타이드 중 어느 하나 이상에 특이적으로 결합하는 올리고펩타이드, 모노클로날 항체, 폴리클로날 항체, 키메릭(chimeric) 항체, 항체단편, 리간드, PNA(Peptide nucleic acid), 앱타머(aptamer), 아비머(avidity multimer) 및 펩티도모방체(peptidomimetics) 중에서 선택된 어느 하나 이상인 것을 특징으로 한다.
본 발명의 일례에 따르면, 상기 유전자의 발현 수준을 측정하는 물질은 상기 바이오마커 유전자가 암호화하는 단백질 및 상기 유전자가 전사하는 mRNA의 결합체의 존재 여부, 존재량 및 존재 패턴 중에서 어느 하나 이상을 검출하는 물질인 것을 특징으로 한다.
본 발명의 일례에 따르면, 상기 유전자의 발현 수준을 측정하는 물질은 역전사 중합효소연쇄반응, 경쟁적 중합효소 연쇄반응, 실시간 중합효소 연쇄반응, Nuclease 보호 분석(RNase, S1 nuclease assay), in situ 교잡법, DNA 마이크로어레이 이용법, 노던 블랏, 웨스턴 블랏, ELISA(Enzyme Linked Immuno Sorbent Assay), 방사선 면역분석법, 면역 확산법, 면역 전기영동, 조직 면역염색, 면역침전 분석법, 보체 고정 분석법, FACS, 질량분석법(Mass spectrometry) 및 단백질 마이크로어레이 이용법 중에서 어느 하나 이상의 방법으로 유전자 발현을 측정하는 검출시약일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 양태로서, 본 발명은 상기 HELZ, IMP-1, NONO, RALY 및 RBM42 로 이루어진 군으로부터 선택되는 어느 하나 이상의 바이오마커 유전자를 검출하는 물질을 포함하는 간암 진단 및 예후 예측용 키트를 제공한다.
본 발명의 일례에 따르면, 상기 유전자를 검출하는 물질은, 상기 유전자의 핵산서열, 이의 상보적인 핵산서열, 상기 핵산서열들의 단편, 또는 상기 핵산서열에 의해 코딩되는 단백질을 특이적으로 인식하는 항체, 항체 단편, 앱타머(aptamer), 아비머(avidity multimer) 또는 펩티도모방체(peptidomimetics)를 포함할 수 있다.
본 발명의 일례에 따르면, 상기 키트는 마이크로 어레이, 유전자 증폭 키트, 면역분석(immunoassay)용 키트, 루미넥스 분석 키트, 단백질 마이크로어레이 키트 및 ELISA 키트 중에서 선택될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 양태로서, 본 발명은 대상체로부터 얻은 시료로부터, HELZ, IMP-1, NONO, RALY 및 RBM42 로 이루어진 군으로부터 선택되는 어느 하나 이상의 바이오마커 유전자의 발현 수준을 측정하는 단계; 및 상기 유전자의 발현 수준을 정상 대조군 시료로부터 얻은 기준치와 비교하는 단계를 포함하는 간암 진단 및 예후 예측을 위한 정보제공방법을 제공한다.
본 발명의 일례에 따르면, 상기 방법은 상기 유전자의 발현 수준이 기준치 보다 높은 경우 간암의 발병가능성이 높거나 또는 예후가 좋지 않을 가능성이 높은 것으로 판단하는 것을 특징으로 한다.
본 발명의 일례에 따르면, 상기 유전자의 발현 수준 측정은 역전사 중합효소연쇄반응, 경쟁적 중합효소 연쇄반응, 실시간 중합효소 연쇄반응, Nuclease 보호 분석(RNase, S1 nuclease assay), in situ 교잡법, DNA 마이크로어레이 이용법, 노던 블랏, 웨스턴 블랏, ELISA(Enzyme Linked Immuno Sorbent Assay), 방사선 면역분석법, 면역 확산법, 면역 전기영동, 조직 면역염색, 면역침전 분석법, 보체 고정 분석법, FACS, 질량분석법(Mass spectrometry) 또는 단백질 마이크로어레이 이용법 등으로 수행할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 양태로서, 본 발명은 상기 본 발명의 바이오마커 유전자들을 검출하는데 사용될 수 있는 프라이머 세트를 제공한다. 본 발명의 일례에 따르면, 상기 HELZ 유전자는 서열번호 11의 정방향 프라이머(forward primer)와 서열번호 12의 역방향 프라이머(reverse primer)를, 상기 IMP-1 유전자는 서열번호 13의 정방향 프라이머(forward primer)와 서열번호 14의 역방향 프라이머(reverse primer)를, 상기 NONO 유전자는 서열번호 15의 정방향 프라이머(forward primer)와 서열번호 16의 역방향 프라이머(reverse primer)를, 상기 RALY 유전자는 서열번호 17의 정방향 프라이머(forward primer)와 서열번호 18의 역방향 프라이머(reverse primer)를, 상기 RBM42 유전자는 서열번호 19의 정방향 프라이머(forward primer)와 서열번호 20의 역방향 프라이머(reverse primer)를 각각 사용하여 증폭시킬 수 있다. 따라서 상기 프라이머 세트는 간암 진단 및 예후 예측용 프라이머 세트로 사용될 수 있다.
본 발명의 다른 양태로서, 본 발명은 인간의 생물학적 시료에 존재하는 HELZ, IMP-1, NONO, RALY 및 RBM42 로 이루어진 군으로부터 선택되는 어느 하나 이상의 바이오마커 유전자의 발현 수준을 측정하는 단계를 포함하는, 간암 진단 또는 예후 예측용 바이오 마커를 검출하는 방법을 제공한다. 본 발명의 일례에 따르면, 상기 유전자의 발현 수준 측정은 상술한 측정 방법을 사용하여 수행할 수 있다.
본 발명의 또다른 양태로서, 본 발명은 HELZ, IMP-1, NONO, RALY 및 RBM42 로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자가 발현되는 세포 또는 실험동물에 대상물질을 처리하는 단계; 및 상기 유전자의 발현수준을 확인하는 단계를 포함하는 간암 치료제의 스크리닝 방법을 제공한다.
본 발명의 일례에 따르면, 상기 스크리닝 방법은 대상물질 처리에 의해 상기 유전자의 발현이 억제되는 경우 대상물질을 간암 치료제 후보군으로 판정하는 단계를 더 포함한다.
본 발명의 일례에 따르면, 상기 유전자의 발현 수준 측정은 상술한 측정 방법을 사용하여 수행할 수 있다.
본 발명의 또다른 양태로서, 본 발명은 상기 HELZ, IMP-1, NONO, RALY 및 RBM42로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자 억제제를 포함하는 간암 예방 또는 치료용 조성물을 제공한다.
본 발명의 일례에 따르면, 상기 억제제는 siRNA 또는 항체일 수 있으나, 이에 제한되는 것은 아니다. 본 발명의 일례에 따르면, 상기 siRNA는 서열번호 21 내지 서열번호 25로 표시되는 siRNA들로 이루어진 군으로부터 선택될 수 있으며, 상기 서열번호 21 내지 서열번호 25으로 표시되는 siRNA들은 각각 HELZ, IMP-1, NONO, RALY 및 RBM42 유전자를 표적으로 한다. 본 발명의 일례에 따르면, 상기 항체는 상기 HELZ, IMP-1, NONO, RALY 및 RBM42 단백질에 특이적으로 결합하는 단클론 항체, 다클론 항체, 및/또는 재조합 항체 등일 수 있으며, 시판되는 것을 구입하거나 공지의 방법(Benny K. C. Lo ed., Antibody Engineering: Methods and Protocols, Methods in Molecular Biology, Vol. 248, Humana Press (2004))에 의해 직접 제조할 수 있다.
본 발명의 HELZ, IMP-1, NONO, RALY 및 RBM42 유전자는 간암이 진행됨에 따라 그 발현이 증가하는 것으로 확인되었다. 따라서 상기 유전자들은 조합에 따라 특이성과 민감도가 향상된 간암 진단 및 예후 측정용 마커로 이용될 수 있으며, 이를 통해 높은 정확성과 신뢰도로 간암을 진단하거나 그 예후를 예측할 수 있을 뿐만 아니라 간암 치료제를 효과적으로 스크리닝하는데 이용될 수 있다.
도 1은 RNA 염기서열 결정법을 이용하여 인간 암 조직과 정상조직에 대해 HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA 발현을 확인한 결과이다.
도 2는 인간의 정상조직과 암 조직에서의 NONO mRNA, RALY mRNA, RBM42 mRNA의 발현양상을 확인한 결과이다.
도 3은 인간의 정상조직과 암 조직에서 NONO 단백질과 RALY 단백질의 발현양상을 확인한 결과이다.
도 4는 HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA의 발현차이에 따른 암 환자 군의 생존율을 컴퓨터 프로그램을 이용하여 비교 분석한 결과이다.
도 5는 초기 암발생 능력과 밀접한 관련이 있는 콜로니 형성실험을 통하여 HELZ, IMP-1, NONO, RALY, RBM42 가 세포에 미치는 영향을 나타낸 결과이다.
도 6은 HELZ, IMP-1, NONO, RALY, RBM42 siRNA 각각을 처리한 실험군에서 대조군에 비하여 저하된 세포 활성도를 나타낸 결과이다.
도 7은 HELZ, IMP-1, NONO, RALY, RBM42 siRNA 각각을 처리한 실험군에서 대조군에 비하여 저하된 세포 성장을 나타낸 결과이다.
도 8은 간암 환자의 혈청에서 RBM42, NONO, RALY의 단백질 발현의 증가를 나타낸 결과이다.
본 발명자들은 바이오마커들이 간암을 조기 진단하고 예후를 판정할 수 있는 마커임을 규명함으로써 본 발명을 완성하였다.
본 발명에서 용어 "간암 (liver cancer)"이란 일반적으로 간세포에서 기원하는 암을 의미한다. 간암에는 처음부터 간에서 생기는 원발성 간암과 다른 조직에서 발생한 암이 간에 전이되어 발병하는 전이성 간암이 있다. 원인은 대부분 불분명하나, 간경변이 있는 경우가 많으며, 간경변이 있는 환자와 만성 활동성 B형 간염, 또는 B형 간염 보균자에서 간암이 잘 발생하는 것으로 밝혀지고 있다. 본 발명자들은 본 발명의 마커를 사용하면, 개체로 부터 간암의 발병여부에 대해 민감도 및 신뢰도가 높은 결과를 얻을 수 있음을 확인하였다.
본 명세서에서 용어 진단은 특정 질병 또는 질환에 대한 한 객체의 감수성(susceptibility)을 판정하는 것, 한 객체가 특정 질병 또는 질환을 현재 가지고 있는 지 여부를 판정하는 것, 특정 질병 또는 질환에 걸린 한 객체의 예후(prognosis)(예컨대, 전-전이성 또는 전이성 암 상태의 동정, 암의 단계 결정 또는 치료에 대한 암의 반응성 결정)를 판정하는 것, 또는 테라메트릭스(therametrics)(예컨대, 치료 효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링 하는 것)을 포함한다. 간암의 "예후"는 다양한 관점에서 추정될 수 있지만, 대표적으로 재발가능성, 생존가능성, 무병생존가능성의 관점에서 판단된다.
본 발명에서 용어 "마커"란 간암이 발생한 세포 또는 조직을 정상 세포 또는 조직과 구분하여 판정할 수 있는 물질로, 정상 세포에 비하여 간암을 가진 세포에서 증가 양상을 보이는 폴리펩타이드 또는 핵산(예: mRNA 등), 지질 , 당지질, 당단백질, 당(단당류, 이당류, 올리고당류 등) 등과 같은 유기 생체 분자 등을 포함한다. 본 발명의 목적상, 본 발명의 간암 진단 (바이오)마커는 HELZ, IMP-1, NONO, RALY 및 RBM42 유전자의 뉴클레오타이드(그의 단편 포함) 또는 그에 코딩되는 단백질(그의 단편 포함)로서, 간암 세포에서 발현이 증가하는 유전자이다. 이러한 마커들은 어느 하나의 유전자에 대한 mRNA 또는 상기 유전자에 의해 코딩되는 어느 하나의 단백질을 사용할 수 있으며, 이들 마커들이 둘 이상 포함된 복합 마커일 수도 있다.
본 명세서에서 사용되는 '폴리펩타이드'(또는 단백질)는 해당 아미노산 서열에 대하여 실질적인 동일성을 나타내는 아미노산 서열을 포함하는 것으로 해석된다. 상기의 실질적인 동일성은 본 발명의 아미노산 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인하고, 당업계에서 통상적으로 사용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에, 최소 60%의 상동성, 보다 바람직하게는 최소 80%의 상동성, 가장 바람직하게는 최소 90%의 상동성을 나타내는 아미노산 서열을 의미하나 이에 제한되는 것은 아니며, 일반적으로, 동일성 % 는 높을수록 더욱 바람직하다. 또한 상기 동일성을 가지는 폴리펩타이드는 기재된 특정 아미노산 서열의 폴리펩타이드에서 1개 이상 아미노산 잔기가 소실, 치환, 삽입, 및/또는 첨가된 아미노산 서열을 포함하면서 베타-아디페이트 경로와 관련되는 폴리펩타이드를 포함한다. 일반적으로, 소실, 치환, 삽입, 및/또는 첨가의 수는 적을수록 더욱 바람직하다.
본 명세서에 사용되는 '폴리뉴클레오타이드' (또는 뉴클레오타이드, 핵산)는 DNA(gDNA 및 cDNA) 그리고 RNA 분자를 포괄적으로 포함하는 의미를 가지며, 핵산 분자에서 기본 구성 단위인 뉴클레오타이드는 자연의 뉴클레오타이드 뿐만 아니라, 당 또는 염기 부위가 변형된 유사체(analogues)도 포함한다.
본 발명의 폴리뉴클레오타이드는 상기 기재된 특정의 아미노산 서열(폴리펩타이드)을 암호화하는 핵산 분자에 제한되지 않고, 상기에서 서술한 것처럼 특정 아미노산 서열에 대하여 실질적인 동일성을 나타내는 아미노산 서열 또는 그에 상응하는 기능을 갖는 폴리펩타이드를 암호화하는 핵산 분자를 포함하는 것으로 해석된다. 상기의 실질적인 동일성은 본 발명의 아미노산 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인하고, 당업계에서 통상적으로 사용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에, 최소 60%의 상동성, 보다 바람직하게는 최소 80%의 상동성, 가장 바람직하게는 최소 90%의 상동성을 나타내는 아미노산 서열을 의미하나 이에 제한되는 것은 아니다.
상기 상응하는 기능을 가진 폴리펩타이드는 예를 들어, 하나 이상의 아미노산이 소실, 치환, 삽입, 및/또는 첨가되는 아미노산 서열의 폴리펩타이드를 포함한다. 그러한 폴리펩타이드는 상기 상술한 것처럼 1 개 이상의 아미노산 잔기가 소실, 치환, 삽입, 및/또는 첨가된 아미노산 서열로 이루어지며 3-하이드록시프로피온산 합성 관련되는 폴리펩타이드를 포함하며, 아미노산 잔기의 소실, 치환, 삽입, 및/또는 첨가의 수가 적은 것이 바람직하다. 또한, 상기 폴리펩타이드는 상기 상술한 것처럼 기재된 특정의 아미노산 서열과 약 60% 이상의 동일성을 갖는 아미노산 서열을 가지며 간암 진단 또는 예후 추정의 바이오 마커 기능을 하는 폴리펩타이드를 포함하며, 동일성이 높을 수록 바람직하다.
본 명세서에서 사용되는 용어 "상보적" 또는 "상보성"은 퓨린 및 피리미딘 뉴클레오티드가 수소 결합을 통해 결합하여 더블 스트랜드 폴리뉴클레오타이드를 형성하는 능력을 의미하며, 부분적으로 상보적인 경우도 포함한다. 하기 염기쌍이 상보성과 관련된다: 구아닌 및 시토신; 아데닌 및 티민; 및 아데닌 및 우라실. "상보적"은 상기 언급된 관계가 전장의 상기 분자에 걸쳐 2개의 싱글-스트랜드 폴리뉴클레오타이드를 포함하는 모든 염기쌍에 실질적으로 적용된다. "부분적으로 상보적"은 2개의 싱글-스트랜드 폴리뉴클레오타이드 중 하나의 길이가 짧기 때문에 그 분자들 중 하나의 일부가 싱글 스트랜드로 남아있는 것 관계를 의미한다.
본 발명은 HELZ, IMP-1, NONO, RALY 및 RBM42 유전자의 발현 수준을 측정하는 물질을 포함하는 간암 진단 또는 예후 예측용 조성물을 제공한다.
본 발명에 따른 간암 진단 또는 예후 측정용 조성물은 상기 각 유전자의 발현을 측정하는 물질을 각각 포함하거나, 또는 상기 두 유전자의 발현을 동시에 측정하는 물질일 수 있다.
본 발명에서 발현 측정(또는 검출)이란 정량 및/또는 정성 분석을 포함하는 것으로, 존재, 부존재의 검출 및 발현량 검출을 포함하는 것으로 이러한 방법은 당업계에 공지되어 있으며, 당업자라면 본원의 실시를 위해 적절한 방법을 선택할 수 있을 것이다.
본 발명에서 상기 유전자의 발현 수준을 측정하는 물질은 상기 유전자가 전사하는 mRNA, 상기 유전자가 암호화하는 단백질, 또는 양자 모두의 존재 여부, 존재량 및 존재 패턴 중에서 어느 하나 이상을 검출하는 물질일 수 있다. 본 발명은 상기 유전자를 핵산 수준 특히 mRNA 및 단백질 수준에서 정량적 및/또는 정성적 검출을 통해 간세포암의 진단 또는 예후 측정에 사용될 수 있다.
본 발명에서 상기 유전자의 발현 수준을 측정하는 물질은 상기 유전자의 뉴클레오타이드 서열, 그에 상보적인 서열, 상기 뉴클레오타이드의 단편 및 그에 상보적인 서열로 이루어진 군에서 선택된 어느 하나 이상에 특이적으로 결합하는 프라이머, 프로브, 앱타머 및 안티센스 중 어느 하나 이상일 수 있다.
일례로, 상기 유전자의 mRNA의 존재 여부와 그 양 또는 패턴을 RT-PCR로 측정하기 위하여, 상기 유전자의 mRNA에 특이적인 프로브 및/또는 프라이머쌍를 포함한다. 프라이머 또는 프로브는 주형과 상보적으로 결합할 수 있고 역전사효소 또는 DNA 중합효소가 주형의 복제를 개시할 수 있도록 하는 자유 3말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열을 의미한다. 본원에 사용되는 상기 유전자 발현 측정 물질은 신호검출을 위해 발색, 발광 또는 형광물질과 같은 것으로 표지될 수 있다. 일례로, mRNA 검출을 위해 노던블랏 또는 역전사 PCR (중합효소연쇄반응)이 사용된다. 후자의 경우 검체의 RNA를 특히 mRNA를 분리한 후, 이로부터 cDNA를 합성한 후, 특정 프라이머, 또는 프라이머 및 프로브의 조합을 사용하여, 검체 중의 특정 유전자를 검출하는 것으로, 특정 유전자의 존재/부존재 또는 발현량을 결정할 수 있는 방법이다.
본 발명에서 상기 유전자의 발현 수준을 측정하는 물질은 상기 본 발명의 유전자가 암호화하는 단백질 및 상기 유전자가 전사하는 전령 RNA(mRNA)의 결합체의 존재 여부, 존재량 및 존재 패턴 중에서 어느 하나 이상을 검출하는 물질일 수 있다.
본 발명에서 상기 유전자의 발현 수준을 측정하는 물질은 당해 분야에서 공지된 다양한 유전자(바이오 마커) 검출 방법에 사용되는 물질을 포함할 수 있으며, 예를 들어, 역전사 중합효소연쇄반응, 경쟁적 중합효소 연쇄반응, 실시간 중합효소 연쇄반응, Nuclease 보호 분석(RNase, S1 nuclease assay), in situ 교잡법, DNA 마이크로어레이 이용법, 노던 블랏, 웨스턴 블랏, ELISA(Enzyme Linked Immuno Sorbent Assay), 방사선 면역분석법, 면역 확산법, 면역 전기영동, 조직 면역염색, 면역침전 분석법, 보체 고정 분석법, FACS, 질량분석법(Mass spectrometry) 및 단백질 마이크로어레이 이용법 중에서 어느 하나 이상의 방법으로 유전자 발현을 측정하는 검출시약일 수 있으나, 이에 제한되는 것은 아니다.
본 발명은 당해 분야에서 공지된 다양한 핵산 및/또는 단백질에 대한 정량 및/또는 정성 분석 방법을 사용하여 해당 유전자의 발현을 측정한다. 일례로, RNA 수준에서의 검출, 발현량 또는 패턴의 검출을 위해 역전사 중합효소연쇄반응(RT-PCR)/중합효소연쇄반응, 경쟁적 RT-PCR, 실시간 RT-PCR, Nuclease 보호 분석(NPA) 예를 들면 RNase, S1 nuclease 분석, in situ 교잡법, DNA 마이크로 어레이 또는 칩 또는 노던블랏 등을 이용한 방식이 사용될 수 있으며, 이러한 분석법은 공지된 것이며, 또한 시중의 키트를 사용하여 수행될 수 있으며, 당업자라면 본원의 실시를 위해 적절한 것을 선택할 수 있다.
본 발명은 상기 본 발명의 유전자들을 검출할 수 있는 물질을 포함하는 간암 진단 또는 예후 예측용 키트(또는 시스템)를 제공한다. 본 발명에 따른 키트는 당해 분야에서 공지된 다양한 키트를 사용할 수 있는데, 일례로 마이크로 어레이, 유전자 증폭 키트, 면역분석(immunoassay)용 키트, 루미넥스 분석 키트, 단백질 마이크로어레이 키트 및 ELISA 키트 중에서 선택된 어느 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.
본 발명은 상기 간암 진단 또는 예후 예측용 조성물을 대상 생물학적 시료에 처리하는 단계; 상기 대상 생물학적 시료로부터 HELZ, IMP-1, NONO, RALY 및 RBM42 유전자로 이루어진 군으로부터 선택되는 유전자의 발현 수준을 측정하는 단계; 및 상기 유전자 발현 수준 측정 결과를 기준치와 대비하는 단계를 포함하는 간암 진단 또는 예후 예측 방법을 제공한다.
상기 생물학적 시료란 바이오마커 검출이 가능한 하나 이상의 성분을 포함하는 물질 또는 물질의 혼합물을 일컫는 것으로, 생물체, 특히 인간 유래의 세포, 조직 또는 체액, 예를 들면 전혈, 뇨, 혈장, 및 혈청을 포함하나 이로 제한하는 것은 아니다. 또한 생물체에서 직접적으로 유래된 것은 물론 인비트로(in vitro)에서 배양된 세포 또는 조직을 포함한다. 본원에 따른 간암 바이오마커의 검출을 위해 다양한 시료가 사용될 수 있으나, 이로 제한하는 것은 아니다. 일 구현예에서는 뇨, 전혈, 혈청 및/또는 혈장이 사용될 수 있다. 다른 구현예에서는 간암이 발생한 또는 발생이 의심되는 또는 발생가능성이 있는 생물체에서 수득한 간조직/세포 또는 인비트로 세포 배양물이 사용될 수 있으나, 이에 제한하는 것은 아니다. 또한 상기 혈액, 세포 또는 조직의 분획 또는 유도물을 포함하는 것이다. 세포 또는 조직을 이용하는 경우, 세포 자체 또는 세포 또는 조직의 융해물이 사용될 수 있다.
본 발명에 따른 상기 간암 진단 또는 예후 예측 방법에서의 유전자의 발현 수준 측정은 상술한 바와 같은 공지된 다양한 핵산 및/또는 단백질에 대한 정량 및/또는 정성 측정 방법을 사용할 수 있다.
본 발명에 따른 상기 간암 진단 또는 예후 예측 방법에서 상기 유전자 발현 수준 측정 결과를 대조군에 대한 측정 결과와 대비하여 간암을 진단하고 예후를 예측한다. 대조군 또는 참조군으로는 음성 대조군으로 정상 시료, 또는 간세포암에 걸린 후 치료된 환자 유래의 시료, 양성대조군으로 본원에 따른 마커 이외에 방법으로 간세포암으로 판정된 환자 유래의 시료, 간경화 환자 유래의 시료, 간염 유래 환자의 시료일 수 있다. 일례로, 정상인 유래의 시료, 간암 판정 환자에서 채취한 정상 조직 시료, 간세포암으로 판정후 치료를 받은 환자 유래의 시료가 대조군 또는 참조군으로 사용되어, 수득된 프로파일의 비교에 사용된다. 일례로, 본 발명에 따른 간암 바이오 마커 유전자는 정상 세포 및 조직에 비하여 간암 세포 및 조직에서 발현이 증가하였다.
대조군과 시료를 이용한 시험군 사이의 마커 프로파일의 비교에는 당해 분야에서 공지된 다양한 방법이 사용될 수 있다. 예를 들면 발현 프로파일의 디지털 영상 비교, 발현 데이터에 대한 DB를 이용한 비교를 참조할 수 있다. 본원에 따른 마커 검출을 통하여 수득된 프로파일은 공지의 데이터 분석방법을 이용하여 처리될 수 있다. 일례로 nearest neighbor classifier, partial-least squares, SVM, AdaBoost 및 clustering-based classification 방법이 사용될 수 있다. 또한 본 발명에 따른 간암 진단 및 예후 추정 방법의 유의성을 확인하기 위하여, 다양한 통계처리 방법이 사용될 수 있다. 통계적 처리 방법으로 일 구현예에서는 logic regression 방법이 사용될 수 있다. 또한, 통계처리를 통해 HCC로 진단하기 위해 시험물질과 대조군간의 유의한 차이에 관한 신뢰수준을 결정할 수 있다. 통계 처리에 사용되는 원 데이터는 각 마커에 대하여 이중, 삼중 또는 다중으로 분석된 값이다. 이러한 통계적 분석 방법은 바이오마커는 물론, 임상 및 유전적 데이터의 통계적 처리를 통하여 임상 적으로 유의한 판단을 하는데 매우 유용하다.
본 발명에 따른 간암 진단 및 예후 추정 방법은 간암의 심각성 정도를 판단하는데 사용될 수 있다. 예를 들면 양성대조군 및 음성대조군의 프로파일과 비교하여, 경증 , 중간정도 또는 중증으로 평가될 수 있다. 나아가 일정한 간암 집단에 대한 마커 프로파일 분석을 수행하여, 프로파일 결과를 근거로 일정 기준에 따라 분류할 수 있다.
본 발명에 따른 간암 진단 및 예후 추정 방법은 특정 기간 동안 예를 들어 1년에 걸쳐 수차례 수행될 수 있으며, 발현 패턴의 변화 추이 모니터링에 사용될 수 있다. 마커의 종류에 따라 발현의 증가 또는 감소를 간암의 상태와 연관지을 수 있다. 동일 대상체에 대한 종전의 검사수치 또는 대조군의 수치와 비교하여, HCC 발병, 진행, 악화 등의 판단에 사용될 수 있다. 시간의 경과에 따른 바이오 마커의 변화를 근거로 간암 진행을 막기 위한 예방적 조치를 취할 수 있다. 나아가 간암 확진을 위해, 기존의 간암 진단 방법인 AFP 테스트, 초음파, 컴퓨터단층촬영 (computerized axial tomography(CT scan)) 또는 자기공명영상(magnetic resonance imaging (MRI)) 검사 등과 함께 사용될 수 있다.
본 발명은 간암의 진단 또는 예후 예측에 필요한 정보를 제공하기 위하여, 인간의 생물학적 시료에 있는 상기 본 발명의 유전자들의 발현 수준을 측정하는 단계를 통해 간암 진단 또는 예후 예측용 바이오 마커를 검출하는 방법을 제공한다. 본 발명에 따른 상기 간암 진단 또는 예후 예측용 바이오 마커를 검출하는 방법에서의 유전자의 발현 수준 측정은 당해 분야에서 공지된 다양한 핵산 및 단백질에 대한 정량 및 정성 측정 방법을 사용할 수 있다.
또한, 본 발명은 시험 대상 화합물에서 본 발명의 바이오마커 유전자의 발현 촉진 또는 억제 여부를 확인하는 단계를 포함하는 간암 치료제의 스크리닝 방법을 제공한다. 본 발명에 따른 상기 간암 치료제의 스크리닝 방법에서의 유전자의 발현 촉진 또는 억제 여부 확인은 상술한 바와 같은 공지된 다양한 핵산 및/또는 단백질에 대한 정량 및/또는 정성 측정 방법을 사용할 수 있다.
상기 시험 대상 화합물은 본원에 따른 마커 유전자의 발현을 조절할 것으로 기대되는 물질로, 예를 들면 약물의 스크리닝 목적을 위해서는 화합물은 저분자량의 치료효과를 갖는 것이 사용될 수 있다. 예를 들면 중량이 400 Da, 600 Da 또는 800 Da과 같은 약 1000 Da 내외의 화합물이 사용될 수 있으나, 이에 제한되는 것은 아니다. 목적에 따라 이러한 화합물은 화합물 라이브러리의 일부를 구성할 수 있으며, 라이브러리를 구성하는 화합물의 숫자도 수십개부터 수백만개까지 다양하다. 이러한 화합물 라이브러리는 펩타이드, 펩토이드 및 기타 환형 또는 선형의 올리고머성 화합물, 및 주형을 기본으로 하는 저분자 화합물, 예컨대 벤조디아제핀, 하이단토인, 바이아릴, 카보사이클 및 폴리사이클 화합물 (예컨대 나프탈렌, 페노티아진, 아크리딘, 스테로이드 등), 카보하이드레이트 및 아미노산 유도체, 디하이드로피리딘, 벤즈하이드릴 및 헤테로사이클 (예컨대 트리아진, 인돌, 티아졸리딘 등)을 포함하는 것일 수 있으나, 이는 단지 예시적인 것으로 이로 한정되는 것은 아니다.
한편, 본 발명은 다른 양태로서, HELZ, IMP-1, NONO, RALY 및 RBM42로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자 억제제를 포함하는 간암 예방 또는 치료용 조성물을 제공한다. 본 발명의 일례에 따르면, 상기 억제제는 siRNA인 것이 바람직하나, 이에 제한되는 것은 아니다.
siRNA를 상기 유전자 억제제로 사용할 경우 siRNA의 전달을 위해 공지되어 있는 적절한 약물전달시스템을 사용할 수 있다. 예컨대, siRNA의 세포 내 전달 효율을 높이기 위해서는, 바이러스성 벡터(레트로바이러스 벡터, 아데노바이러스 벡터, 백시니아바이러스 벡터 등), 비-바이러스성 벡터, 리포좀, 양이온성 고분자, 마이셀(micelle), 에멀젼, 지질 나노입자(solid lipid nanoparticles) 등과 같은 핵산 전달체를 사용할 수 있다.
본 발명의 간암 예방 또는 치료용 조성물에 사용되는 제형은 당업계에 공지되어 있는 것을 적절히 선택할 수 있다. 본 발명의 일례에 따르면, 본 발명의 약학적 조성물은 멸균 주사용 수성 또는 유성 현탁액의 멸균 주사용 제제의 형태일 수 있다. 이러한 현탁액은 적합한 분산제 또는 습윤제 및 현탁화제를 사용하여 본 분야에 공지된 기술에 따라 제형화할 수 있다. 또한, 본 발명의 약학적 조성물은 약제학적으로 허용가능한 담체, 예컨대 이온 교환 수지, 레시틴, 혈청 단백질, 각종 인산염, 글리신, 소르브산, 칼륨 소르베이트, 물, 염 또는 전해질, 교질성 실리카, 마그네슘 트리실리케이트, 폴리비닐피롤리돈, 셀룰로즈계 기질, 폴리에틸렌 글리콜, 나트륨 카르복시메틸셀룰로즈, 폴리아릴레이트, 왁스 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 본 발명의 siRNA 또는 약학적 조성물의 투여 대상 환자는 포유 동물, 바람직하게는 사람, 원숭이, 설치류일 수 있다. 본 발명의 약학적 조성물의 치료적 유효량은 질환의 종류, 증상의 정도, 투여되는 siRNA의 종류, 제형의 종류, 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 치료 기간, 병용투여제 등의 약물을 비롯한 다양한 인자에 따라 적절하게 조절될 수 있다.
이하에서는 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 다만, 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다 할 것이다.
실험방법
1. 조직 준비
본 실험에 이용된 조직은 가톨릭 연구조직은행에서 구입하여 실험에 이용하였다. 총 24쌍의 환자로부터 정상 간 조직 세포와 간암세포를 구입하여 실험에 이용하였다. 인체조직 사용의 모든 규정은 가톨릭대학교 기관윤리 위원회의 규정을 준수하여 실험을 진행하였다.
2. 세포 배양
실험에 이용된 모든 세포주의 배양에는 10%의 소혈청이 포함된 DMEM 배양액을 사용하였다. 37℃ 가 유지되는 향온배양기 내에서 5% CO2 농도를 유지시킨 환경에서 세포주를 배양하였다. 외부유전체의 세포 내 주입 시에는 35-mm2 배양접시를 이용하여 실시하였으며 미토콘드리아 기능 분석관련 실험은 96 well 배양접시를 이용하여 실시하였다. 그 외의 모든 상황에서는 100-mm2 배양접시를 이용하여 세포주를 배양 및 유지 하였다.
3. 외부 유전체 전달자 제작
총 6가지 siRNA 형태의 외부유전체가 세포 내 주입법을 통하여 실험에 이용되었다. 6가지 siRNA의 경우 Genolution사의 제품을 구입하여 이용하였다. 각각의 표적 유전자에 대한 siRNA 서열은 다음과 같다.
- HELZ : GCAGUUGAUCCUCGAAUUA (서열번호 21)
- IMP-1 : CCGGGAGCAGACCAGGCAA(dTdT) (서열번호 22)
- NONO : GGUGCAUUCCUGAAGUCUCUAAUGU (서열번호 23)
- RALY : UAACGUACCUGUCAAGCUC (서열번호 24)
- RBM42 : GCAAUGAGGUGAACGAUGAUU (서열번호 25)
4. 외부 유전체의 세포 내 주입
실험에 이용된 모든 외부 유전체의 주입에는 Invitrogen 사에서 나온 리포펙타민 2000을 이용하여 진행하였다. 각각의 외부유전체를 실험에 따라 일정량을 제조사의 매뉴얼대로 리포펙타민2000으로 처리한 후 세포배양액에 혼합하는 방법을 통하여 외부 유전체를 세포 내로 주입하였다.
5. 세포 및 조직 내 유전자 발현 변화 분석
구입한 조직 및 실험에 이용된 세포의 유전자 발현 및 변화양상의 분석을 위하여 Invitrogen 사의 트라이졸 용액을 이용하였다. 조직분쇄 및 세포포집 후 트라이졸 용액을 처리하여 mRNA를 수득한 후 Toyobo사의 cDNA 합성 Kit를 이용하여 cDNA를 합성하였다. 합성된 cDNA를 이용하여 real-time quantitative PCR 방법을 통해 실험군 및 대조군의 유전자 발현 및 변화양상을 정량화 하였다.
유전자 발현 검증을 위해 사용한 프라이머 서열은 아래 표 1과 같다.
유전자명 프라이머 서열
HELZ F AGAGCTGAAAAGTCATGTGAACA (서열번호 11)
R ACTCTCGATTTTGATGCGTTCT (서열번호 12)
IMP-1 F GCGGCCAGTTCTTGGTCAA (서열번호 13)
R TTGGGCACCGAATGTTCAATC (서열번호 14)
NONO F CTAGCGGAGATTGCCAAAGTG (서열번호 15)
R GTTCGTTGGACACATACTGAGG (서열번호 16)
RALY F GTCCGGCGTGTCAAAACTAAC (서열번호 17)
R TTTGCTCCGCAGCGATCTG (서열번호 18)
RBM42 F CCTGTGATCCGCCCAATTATC (서열번호 19)
R CATGGGAGGAACTACTGTGGC (서열번호 20)
6. 세포 내 단백질 발현 변화 분석
표집된 세포를 RIPA용액을 이용하여 세포내의 단백질을 수득한 후 동일한 양의 전체 단백질을 SDS-PAGE 젤 내에서 전기영동을 통하여 크기에 따라 분리하였다. 분리된 단백질 중 확인하고자 하는 특정사이즈 부분을 PVDF 막으로 옮긴 후 해당 단백질의 항체를 PVDF 막에 붙였다. 특정단백질을 발현 정도를 정량화 할 수 있는 2차 항체를 처리한 후 X-ray 필름에 특정 단백질에서 조사되는 빛을 기록하여 관찰하고자 하는 단백질의 발현 변화를 정량적으로 분석하였다.
7. 세포 활성도 분석
후보 단백질로 선정된 HELZ, IMP-1, NONO, RALY, RBM42가 암세포주에 미치는 영향을 알아보기 위해 MTT assay를 통하여 대조군과 실험군의 세포활성도를 측정하였다. 대조군과 실험군 세포를 동일한 양으로 96-well 배양접시에 접종 후 각각 2일간 배양 후와 3일간 배양 후 세포 활성도를 측정하여 정량화 하였다.
8. 세포 성장능 분석
HELZ, IMP-1, NONO, RALY, RBM42가 암세포주에 미치는 영향을 알아보기 위해 시간별 세포 총계를 측정하는 방법을 통하여 대조군과 실험군의 세포 성장능을 측정하였다. 대조군과 실험군 세포를 동일한 양으로 6-well 배양접시에 접종 후 각각 2일간 배양 후와 3일간 배양 후 세포 총계를 측정하여 정량화 하였다.
9. 세포의 콜로니 형성능 분석
암세포주의 초기 암발생 능력 정도를 측정할 수 있는 콜로니 형성능 분석을 통하여 HELZ, IMP-1, NONO, RALY, RBM42 가 세포주의 초기 암발생 능력에 영향을 줄 수 있는지를 확인하였다. 대조군과 실험군을 각각 6-well 배양접시에 세포를 100개씩 접종한 후 3주간 배양을 하였다. 배양접시에 콜로니 형성을 확인 후 크리스탈 바이올렛 염색을 통하여 콜로니 개수를 정량화 하였다.
10. 인간 간암 병변에 따른 유전자 발현 변화 분석
TNM(Tumor-Node-Metastasis)분류법을 통해 병변에 따라 분류된 인간 간암 조직을 RNA 염기서열 결정법을 이용하여 유전자 발현 및 변화양상을 분석한 자료를 통해 인간 간암의 병기별 유전자 발현 변화를 분석하였다. 자료에서 측정된 병기별 유전자 발현 정도를 수치화 한 값을 통계처리 하여 유전자 발현 및 변화양상을 분석하였다.
11. 유전자 발현 변화에 따른 생존율 변화 분석
다양한 인간 암 환자 군에서 유전자 발현 및 변화양상의 차이를 분석한 자료를 통해 유전자 발현 및 변화에 따른 다양한 인간 암 환자 군의 생존율 변화를 분석하였다. 자료에서 측정된 유전자 발현 정도에 따른 생존일을 통계처리 하여 유전자 발현의 차이에 따른 생존율 변화를 분석하였다.
12. 혈청 준비 및 혈청 내 단백질 발현 변화 분석
본 실험에 이용된 혈청은 한국인체자원은행네트워크 전북대학교병원 인체자원은행과 경상대학교병원 인체자원은행을 통하여 분양받아 실험에 이용하였다. 총 100명의 환자와 20명의 대조군으로부터 간암 환자의 혈청과 정상 혈청을 분양받아 실험에 이용하였다. 인체조직 사용의 모든 규정은 가톨릭대학교 기관윤리 위원회의 규정을 준수하여 실험을 진행하였다.
분양받은 혈청에서의 단백질 발현 및 변화양상의 분석을 위하여 점블럿법(Dot-blotting)을 이용하였다. 분양받은 혈청 45μl를 이용하여 Merk Millipore사의 PVDF(poly-vinyl difluoride) 막에 고정시켜 특정 단백질의 항체로 발현을 검출하는 방법이다. 이를 통해 실험군 및 대조군의 관련 단백질의 발현 및 변화양상을 정량화 하였다.
실험결과
1. 암 조직에서 HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA 발현의 증가확인
암 발병에 있어서 HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA의 발현양상이 어떠한 차이를 보이는지 확인하기 위하여 인간 암 조직과 정상조직을 이용해 HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA 발현을 RNA 염기서열 결정법을 통해 확인하였다.
그 결과, 암 조직에서의 HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA 발현이 증가됨을 확인한 그래프이며(도 1A), 정상대비 암 조직에서 HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA 발현이 증가됨을 확인한 그래프이다(도 1B). 이를 통해 암이 진행됨에 따라 HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA의 발현이 증가하는 것을 알 수 있다.
2. 암에서의 NONO mRNA, RALY mRNA, RBM42 mRNA 발현의 증가확인
NONO mRNA, RALY mRNA, RBM42 mRNA가 체내에서 암이 발병됨에 따라 어떠한 발현 차이를 보이는지 확인하기 위하여 인간의 정상조직과 암 조직에서의 NONO mRNA, RALY mRNA, RBM42 mRNA 발현양상을 확인한 결과이다(도 2). 그 결과 정상조직 대비 암 조직에서 NONO mRNA, RALY mRNA, RBM42 mRNA 발현이 증가됨을 확인할 수 있었다.
3. 암에서의 NONO 단백질과 RALY 단백질 발현의 증가확인
NONO 단백질과 RALY 단백질이 체내에서 암이 발병됨에 따라 어떠한 발현 차이를 보이는지 확인하기 위하여 인간의 정상조직과 암 조직에서의 NONO 단백질과 RALY 단백질 발현양상을 확인한 결과이다(도 3). 그 결과 정상조직 대비 암 조직에서 NONO 단백질과 RALY 단백질 발현이 증가됨을 확인할 수 있었다.
4. HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA 발현 차이에 따른 생존율의 증가 확인
암 환자 군에서 생존율에 따른 HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA 발현차이를 확인하기 위하여 컴퓨터 프로그램을 통해 HELZ mRNA, IMP-1 mRNA, NONO mRNA, RALY mRNA, RBM42 mRNA 발현차이에 따른 암 환자 군의 생존율을 비교 분석한 결과이다(도 4). 그 결과 NONO mRNA, RALY mRNA, RBM42 mRNA의 발현이 저하되어 있는 환자의 생존율이 더 증가 되어 있음을 확인할 수 있었다.
5. HELZ, IMP-1, NONO, RALY, RBM42 의 발현 저하에 따른 콜로니 형성능 변화
초기 암발생 능력과 밀접한 관련이 있는 콜로니 형성실험을 통하여 HELZ, IMP-1, NONO, RALY, RBM42 가 세포에 미치는 영향을 관찰한 결과이다(도 5). 그 결과 각각의 HELZ, IMP-1, NONO, RALY, RBM42 siRNA를 처리한 실험군에서 콜로니 형성이 저하되는 것을 확인하였다.
6. HELZ, IMP-1, NONO, RALY, RBM42 의 발현 저하에 따른 세포활성도 변화
각각의 HELZ, IMP-1, NONO, RALY, RBM42 siRNA를 처리한 실험군에서 대조군에 비하여 저하된 세포 활성도를 나타낸 것이다(도 6). 이를 통해 HELZ, IMP-1, NONO, RALY, RBM42 가 세포의 활성도를 증가시키는 것을 확인하였다.
7. HELZ, IMP-1, NONO, RALY, RBM42 의 발현 저하에 따른 세포성장능 변화
각각의 HELZ, IMP-1, NONO, RALY, RBM42 siRNA를 처리한 실험군에서 대조군에 비하여 저하된 세포 성장을 나타낸 것이다(도 7). 이를 통해 HELZ, IMP-1, NONO, RALY, RBM42 가 세포의 성장능을 증가시키는 것을 확인하였다.
따라서 이러한 결과를 토대로, 본 발명자들은 HELZ, IMP-1, NONO, RALY, RBM42의 발현정도 분석을 통해 간암의 발병여부 및 중증도 등을 사전에 예측할 수 있음을 알 수 있었다.
8. 간암 환자의 혈청에서 RBM42, NONO, RALY 단백질 발현의 분석
간암 환자의 혈청에서 RBM42, NONO, RALY 단백질의 발현양상이 어떠한 차이를 보이는지 확인하기 위하여 점블럿법을 통해 분석한 결과이다. RBM42, NONO, RALY 단백질들을 표적으로 하는 각각 RBM42, NONO, RALY 항체를 이용하였다. 이때 실험에 이용된 혈청은 한 사람당 45μl가 사용 되었으며 항체는 다음과 같다. RBM42는 BETHYL 사의 1mg/ml 농도의 항체를, NONO 항체와 RALY 항체는 모두 Abcam 사의 항체를 사용하였고 사용시 농도는 1:1000 비율로 사용하였다. 이를 통해 간암 환자의 혈청에서 RBM42, NONO, RALY 단백질들의 발현이 증가하였음을 확인하였다. 구체적으로 총 100명의 간암환자 및 20명의 정상인 혈청을 위와 같은 조건으로 분석한 결과, RBM42 단백질은 20개의 정상인 혈청에서는 검출되지 않았으나 간암 환자 혈청의 경우 100개 중 32개에서 검출되었다. 또한, NONO 단백질은 20개의 정상인 혈청 중 2개에서, 100개의 간암 환자 혈청 중 54개에서 검출되었고, RALY 단백질은 16개의 정상인 혈청 중 2개에서, 80개의 간암 환자 혈청 중 24개에서 검출되었다(도 8).
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항 들과 그것들의 등가물에 의하여 정의된다고 할 것이다.

Claims (11)

  1. HELZ (Helicase With Zinc Finger), IMP-1 (Insulin like growth factor 2 mRNA binding protein 1), NONO (Non-POU Domain Containing), RALY (RALY heterogeneous nuclear ribonucleoprotein) 및 RBM42 (RNA binding motif protein 42) 단백질 또는 그의 유전자의 mRNA(messenger RNA)의 수준을 측정하는 제제를 포함하는 간암 진단 및 예후 예측용 조성물.
  2. 제1항에 있어서, 상기 유전자의 mRNA 수준을 측정하는 제제는 상기 유전자에 특이적으로 결합하는 프라이머 쌍, 프로브 또는 안티센스 올리고뉴클레오티드인 것인 간암 진단 및 예후 예측용 조성물.
  3. 제1항에 있어서, 상기 단백질 수준을 측정하는 제제는 상기 단백질에 특이적으로 결합하는 항체를 포함하는 것인 간암 진단 및 예후 예측용 조성물.
  4. 제1항의 조성물을 포함하는 간암 진단 및 예후 예측용 키트.
  5. 제4항에 있어서, 상기 키트는 RT-PCR(Reverse transcription polymerase chain reaction) 키트, DNA 칩 키트, ELISA(Enzyme-linked immunosorbent assay) 키트, 단백질 칩 키트, 래피드(rapid) 키트 또는 MRM(Multiple reaction monitoring) 키트인 것인 간암 진단 및 예후 예측용 키트.
  6. 서열번호 11의 정방향 프라이머(forward primer)와 서열번호 12의 역방향 프라이머(reverse primer)로 이루어진 HELZ 유전자 증폭용 프라이머 세트;
    서열번호 13의 정방향 프라이머(forward primer)와 서열번호 14의 역방향 프라이머(reverse primer)로 이루어진 IMP-1 유전자 증폭용 프라이머 세트;
    서열번호 15의 정방향 프라이머(forward primer)와 서열번호 16의 역방향 프라이머(reverse primer)로 이루어진 NONO 유전자 증폭용 프라이머 세트;
    서열번호 17의 정방향 프라이머(forward primer)와 서열번호 18의 역방향 프라이머(reverse primer)로 이루어진 RALY 유전자 증폭용 프라이머 세트; 및
    서열번호 19의 정방향 프라이머(forward primer)와 서열번호 20의 역방향 프라이머(reverse primer)로 이루어진 RBM42 유전자 증폭용 프라이머 세트로 이루어진 군으로부터 선택되는 간암 진단 및 예후 예측용 프라이머 세트.
  7. 분리된 생물학적 시료로부터 HELZ, IMP-1, NONO, RALY 및 RBM42로 이루어진 군으로부터 선택되는 어느 하나 이상의 단백질 또는 그의 유전자의 발현 수준을 측정하는 단계; 및
    상기 측정된 단백질의 발현 수준 또는 유전자의 발현 수준을 정상 대조군 시료와 비교하는 단계를 포함하는, 간암 진단 및 예후 예측을 위한 정보제공방법.
  8. 제7항에 있어서,
    상기 단백질 또는 유전자의 발현 수준이 기준치 보다 높은 경우 간암의 발병가능성이 높거나 또는 예후가 좋지 않을 가능성이 높은 것으로 판단하는 것인 정보제공방법.
  9. 제7항에 있어서, 상기 유전자의 발현 수준은 상기 유전자의 mRNA 발현 수준인 것인 정보제공방법.
  10. 제9항에 있어서, 상기 mRNA 수준 측정은 역전사 중합효소반응, 경쟁적 역전사 중합효소반응, 실시간 역전사 중합효소반응, RNase 보호 분석법, 노던 블랏팅 또는 DNA 칩에 의한 것인 정보제공방법.
  11. 제7항에 있어서, 상기 단백질의 발현 수준 측정은 백질 칩 분석, 면역측정법, 리간드 바인딩 어세이, MALDI-TOF(Matrix Desorption/Ionization Time of Flight Mass Spectrometry)분석, SELDI-TOF(Sulface Enhanced Laser Desorption/Ionization Time of Flight Mass Spectrometry)분석, 방사선 면역분석, 방사 면역 확산법, 오우크테로니 면역 확산법, 로케트 면역전기영동, 조직면역 염색, 보체 고정 분석법, 2차원 전기영동 분석, 액상 크로마토그래피-질량분석(liquid chromatography-Mass Spectrometry, LC-MS), LC-MS/MS(liquid chromatography-Mass Spectrometry/ Mass Spectrometry), 웨스턴 블랏, ELISA(enzyme linked immunosorbentassay) 또는 그의 조합으로 수행하는 것인 정보제공방법.
PCT/KR2017/004482 2016-05-30 2017-04-27 간암의 진단 및 예후 예측용 바이오 마커 및 그의 용도 Ceased WO2017209396A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/305,809 US11180814B2 (en) 2016-05-30 2017-04-27 Biomarker for diagnosis and prognosis prediction of liver cancer, and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20160066377 2016-05-30
KR10-2016-0066377 2016-05-30

Publications (1)

Publication Number Publication Date
WO2017209396A1 true WO2017209396A1 (ko) 2017-12-07

Family

ID=60478717

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/004482 Ceased WO2017209396A1 (ko) 2016-05-30 2017-04-27 간암의 진단 및 예후 예측용 바이오 마커 및 그의 용도

Country Status (3)

Country Link
US (1) US11180814B2 (ko)
KR (1) KR101936502B1 (ko)
WO (1) WO2017209396A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024196792A2 (en) * 2023-03-17 2024-09-26 The Regents Of The University Of California Identification of selective regulators of oncogene translation

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110096292A (ko) * 2010-02-22 2011-08-30 가톨릭대학교 산학협력단 간암 진단용 마커로서의 socs6의 용도
KR20110100718A (ko) * 2010-03-05 2011-09-15 가톨릭대학교 산학협력단 간암 진단용 마커로서 Gankyrin의 용도
CN105111297A (zh) * 2015-08-17 2015-12-02 孙世龙 一种检测肝癌标志物imp1抗原表位氨基酸序列及应用

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008020652A1 (en) * 2006-08-18 2008-02-21 Oncotherapy Science, Inc. Imp-1 oncogene as a therapeutic target and prognostic indicator for lung cancer
JP5378687B2 (ja) * 2007-03-02 2013-12-25 エフ.ホフマン−ラ ロシュ アーゲー Basp1遺伝子および/またはsrd5a2遺伝子中のメチル化シトシンを利用する、肝臓癌、肝臓癌発症リスク、肝臓癌再発リスク、肝臓癌悪性度および肝臓癌の経時的進展の検出方法

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110096292A (ko) * 2010-02-22 2011-08-30 가톨릭대학교 산학협력단 간암 진단용 마커로서의 socs6의 용도
KR20110100718A (ko) * 2010-03-05 2011-09-15 가톨릭대학교 산학협력단 간암 진단용 마커로서 Gankyrin의 용도
CN105111297A (zh) * 2015-08-17 2015-12-02 孙世龙 一种检测肝癌标志物imp1抗原表位氨基酸序列及应用

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KOZIOL ET AL.: "Recursive Partitioning as an Approach to Selection of Immune Markers for Tumor Diagnosis", CLINICAL CANCER RESEARCH, vol. 9, 1 November 2003 (2003-11-01), pages 5120 - 5126, XP002457503 *
PARADIS ET AL.: "In the New Area of Noninvasive Markers of Hepatocellular Carcinoma", J OURNAL OF HEPATOLOGY, vol. 46, 2007, pages 9 - 11, XP022008909 *

Also Published As

Publication number Publication date
US20200325540A1 (en) 2020-10-15
KR20170135671A (ko) 2017-12-08
KR101936502B1 (ko) 2019-01-09
US11180814B2 (en) 2021-11-23

Similar Documents

Publication Publication Date Title
WO2009113814A2 (ko) 간암 진단용 단백질성 마커
JP2010124828A (ja) 癌のための新規の組成物および方法
WO2010120143A2 (ko) 간암 예후 마커
WO2006036175A2 (en) Wnt proteins and detection and treatment of cancer
WO2022250465A1 (ko) 전립선암의 엔잘루타미드 저항성 예측용 신규 바이오마커 및 이의 용도
WO2023177206A1 (ko) 췌장암의 진단용 조성물
WO2011081421A9 (en) Complement c9 as markers for the diagnosis of cancer
WO2020166992A1 (ko) 암의 진단용 조성물
WO2014014157A1 (ko) 위암 진단 및 치료를 위한 adcy3의 용도
AU2010200731A1 (en) Novel compositions and methods in cancer associated with altered expression of PRLR
WO2022114887A1 (ko) 통합전사체분석 기반 만성 간질환 진단용 복합마커 및 이의 용도
WO2010085124A2 (ko) 간암진단과 재발 및 생존 예측용 마커, 이를 포함한 키트 및 상기 마커를 이용한 간암환자 예후 예측
US11180814B2 (en) Biomarker for diagnosis and prognosis prediction of liver cancer, and use thereof
WO2024117803A1 (ko) 췌장암의 예후 예측을 위한 새로운 바이오 마커
WO2022231386A1 (ko) 위암의 예후 예측 방법
WO2022215991A1 (ko) 암 예후 예측용 바이오마커
JP5939994B2 (ja) 疼痛に関係する化合物を識別することに関する方法及び使用並びに痛覚過敏を診断する方法
WO2021025412A1 (ko) 보체 성분 c8 감마를 이용한 알츠하이머병의 진단방법
US20150354006A1 (en) Markers for acute lymphoblastic leukemia
WO2022039470A1 (ko) 비흡연성 비소세포 폐암 환자의 면역상태 판단용 바이오마커 및 이를 이용한 비흡연성 비소세포 폐암 환자의 면역 상태에 대한 정보를 제공하는 방법
WO2023149608A1 (ko) 흑색종 치료 내성 예측용 trim51 바이오마커 및 이의 용도
WO2010140824A9 (ko) 간세포암의 진단 및 예후결정용 조성물
WO2024151138A1 (ko) 엑소좀을 이용한 편평상피세포 폐암 진단 또는 예후 예측용 바이오마커 및 이의 용도
WO2018169333A1 (ko) 표현형 다면발현을 나타내는 pold1 및 그를 이용한 질병 진단 방법
WO2022019626A1 (ko) 대장암 전이 억제제 스크리닝 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17806889

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17806889

Country of ref document: EP

Kind code of ref document: A1