WO2017209351A1 - 항 -cᅳ Met/항 -Nrp1 이중 특이 항체 - Google Patents

항 -cᅳ Met/항 -Nrp1 이중 특이 항체 Download PDF

Info

Publication number
WO2017209351A1
WO2017209351A1 PCT/KR2016/010376 KR2016010376W WO2017209351A1 WO 2017209351 A1 WO2017209351 A1 WO 2017209351A1 KR 2016010376 W KR2016010376 W KR 2016010376W WO 2017209351 A1 WO2017209351 A1 WO 2017209351A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
antibody
amino acid
cdr
met
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2016/010376
Other languages
English (en)
French (fr)
Inventor
이승현
남도현
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Samsung Electronics Co Ltd
Samsung Life Public Welfare Foundation
Original Assignee
Samsung Electronics Co Ltd
Samsung Life Public Welfare Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Samsung Electronics Co Ltd, Samsung Life Public Welfare Foundation filed Critical Samsung Electronics Co Ltd
Publication of WO2017209351A1 publication Critical patent/WO2017209351A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/46Hybrid immunoglobulins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/46Hybrid immunoglobulins
    • C07K16/468Immunoglobulins having two or more different antigen binding sites, e.g. multifunctional antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]

Definitions

  • An anti-c-Met / anti-Nrpl bispecific antibody comprising an anti-c-Met antibody or antigen-binding fragment thereof and an anti-Nrpl antibody or antigen-binding fragment thereof, and a pharmaceutical composition comprising the same are provided. [Background technology]
  • Nrp Neuropilin
  • ⁇ ⁇ ⁇ 1 is composed of about 923 amino acids
  • Nrp2 is composed of about 926 amino acids. It has a similar domain structure in common. It is known to have amino acid homology of 44 as a whole.
  • Nrpl is a receptor that binds to a semaphorin 3A ligand, which initially interacts with the flexin co-receptor to regulate axon induction.
  • Nrpl binds to vascular endothelial growth factor (VEGF) and mediates angiogenesis.
  • VEGF vascular endothelial growth factor
  • Nrpl is expressed in various types of human tumor cell lines and human tumors (glioblastoma, astrocytoma, glioma, neuroblastoma, testicular cancer, colorectal cancer, melanoma, pancreatic cancer, lung cancer, breast cancer, esophageal cancer and prostate cancer, etc.). It is involved in the effects of VEGF and semaphorin on the proliferation, survival and migration of cancer cells. In addition, depending on the degree of Nrpl expression, the degree of cancer progression increases. The prognosis for cancer patients is known to be poor.
  • c-Met is a representative RTK (Receptor Tyrosine Kinase) on the cell surface.
  • RTK Receptor Tyrosine Kinase
  • HGF / SF Hepatocyte Growth Factor / Scattering Factor
  • C-Met signaling through HGF / SF is a representative early stage of cancer metastasis that weakens the cell-cell contact of almost all types of epithelial tumors and causes scattering. Protein.
  • Nrpl and C-Met Targeting both Nrpl and C-Met will be able to more effectively inhibit the growth and metastasis of cancer cells, which is why the development of drugs targeting both Nrpl and c-Met is required.
  • One example provides an anti-c-Met / anti-Nrpl bispecific antibody comprising an anti-c-Met antibody or antigen binding fragment thereof and an anti-Nrpl antibody or antigen binding fragment thereof.
  • the anti-c-Met antibody or antigen-binding fragment thereof is an antibody or antigen-binding fragment thereof that specifically binds to an epitope consisting of five or more contiguous amino acids including “EEPSQ '′ in the SEMA domain of the c-Met protein. .
  • Another example provides a pharmaceutical composition comprising the anti-c-Met / anti-Nrpl dual specific antibody as an active ingredient.
  • Another example includes administering to a patient a pharmaceutically effective amount of an anti-c-Met / anti-Nrpl bispecific antibody.
  • compositions are a disease associated with overproduction (eg. Overexpression) and / or abnormal activation of c-Met and / or Nrpl.
  • overproduction e. Overexpression
  • c-Met and / or Nrpl e.g., a malignant neoplasm originating from a malignant neoplasm originating from a malignant neoplasm originating from a malignant neoplasm originating from a tumor necrosis.
  • Nrpl a disease associated with overproduction (eg. Overexpression) and / or abnormal activation of c-Met and / or Nrpl.
  • the cancer may be cancer having resistance to anticancer agents.
  • Another example provides a pharmaceutical composition for overcoming anticancer drug resistance comprising the anti-c—Met / anti-Nrpl bispecific antibody as an active ingredient.
  • Another example includes administering to a patient a pharmaceutically effective amount of an anti-c-Met / anti-Nrpl bispecific antibody. Provides a method for overcoming anticancer drug resistance. Another example provides the use of the anti-c-Met / anti-Nrpl bispecific antibody to overcome anticancer drug resistance. [Measures of problem]
  • c-Met is a representative RTK (Receptor Tyrosine Kinase) present on the cell surface and is known to be involved in cell growth, cancer development, cancer metastasis and neovascularization. Nrpl is also known to play a role in cell growth, cancer metastasis, and neovascularization.
  • RTK Receptor Tyrosine Kinase
  • the present specification proposes to simultaneously target C—Met and Nrpl, thereby enhancing anticancer and / or anticancer effect of cancer.
  • one example provides an anti-c-Met / anti-Nrpl dual specific antibody comprising an anti-c-Met antibody or antigen binding fragment thereof and an anti-Nrpl antibody or antigen binding fragment thereof.
  • the bispecific antibody may exert an anticancer effect and / or a cancer metastasis inhibiting effect by simultaneously recognizing and binding c-Met and Nrpl to inhibit function.
  • the term "antibody” means a substance produced by stimulation of an antigen in the immune system, and is produced in vivo. Recombinantly generated. Or it may be artificially synthesized, the kind is not particularly limited.
  • the antibody is an animal antibody. Chimeric antibodies, humanized antibodies, or human antibodies.
  • the antibody also includes an antigen-binding fragment of an antibody having antigen-binding ability.
  • “Complementarity determining regions (Complementarity-determining regions. CDR) the term is a portion which from the variable regions of the antibodies giving the binding specificity of the antigen means ⁇ .
  • Antigen binding fragment is one or more of the complementarity determining regions Antibody fragments, including, for example, scFv, (scFv) 2, scFv-Fc.Fab.Fab 'and F (ab') 2 can be selected from the group consisting of.
  • all of the subtypes except for the heavy chain and light chain CDR regions, or the heavy chain variable region and the light chain variable region are all subtypes.
  • immunoglobulins eg, IgA, IgD, IgE, IgG (IgGl, IgG2, IgG3. IgG4), Ig, etc.
  • it may be derived from the light chain constant region and / or heavy chain constant region of the immunoglobulin of all the above subtypes.
  • c-Met refers to receptor tyrosine kinases that bind to hepatocyte growth factor.
  • the c-Met protein may be from any species, for example from a primate such as human c-Met (eg NP_000236.2), monkey c-Met (eg Macaca mulatta, NP—001162100) and the like. Or mouse c-Met (eg, NP-032617.2). Rodents such as rat C -Met (eg NP-113705.1) and the like.
  • the protein is, for example, a polypeptide encoded by the nucleotide sequence provided in GenBank Aceession Number NM_000245.2, or a protein having an amino acid sequence provided in GenBank Aceession Number NM_000236.2. Or its extracellular domain.
  • Receptor tyrosine kinase c-Met for example, cancer development, cancer metastasis. Cancer cell migration, cancer cell infiltration. It is involved in various mechanisms such as angiogenesis process.
  • Nepl vascular endothelial growth factor
  • VEGF vascular endothelial growth factor
  • astrocytoma glioma
  • neuroblastoma neuroblastoma
  • testicular cancer colon cancer
  • melanoma pancreatic cancer
  • lung cancer breast cancer
  • esophageal cancer and prostate cancer etc.
  • semaphorin Is involved in the proliferation, survival and migration of cancer cells.
  • Nrpl may be derived from a mammal, including humans, primates such as monkeys, rodents such as rats, mice, and the like, for example, human-derived human Nrpl (amino acid sequence: NCBI Accession # NP— 001019799.1: coding polynucleotide sequence: NCBI Accession) # NM_001024628.2; etc.), Mouse Nrpl from mouse (amino acid sequence: Accession # NP-032763.2; coding polynucleotide sequence: NCBI Accession # NM_008737.2; etc.), and the like.
  • Anti-Nrpl antibodies or antigen-binding fragments thereof included in the bispecific antibodies provided herein have the property of internalizing after binding to Nrpl expressed on the surface of a cell (eg, a cancer cell).
  • the anti- The Nrpl antibody was bound to Nrpl expressed on the surface of cancer cells and then internalized into cells.
  • the antibodies provided herein bind to Nrpl on the cell surface and enter the cell, thereby reducing the absolute amount of Ni-pl present on the cell surface. It can block all signaling related to Nrpl. More therapeutic effects can be expected than conventional antibodies.
  • the anti-Nrpl antibody or antigen-binding fragment thereof is the anti-Nrpl antibody or antigen-binding fragment thereof.
  • a polypeptide comprising the amino acid sequence of SEQ ID NO: 139 (CDR-H1), a polypeptide comprising the amino acid sequence of SEQ ID NO: 140 (CDR-H2). And a polypeptide comprising the amino acid sequence of SEQ ID 141.
  • a polypeptide comprising the amino acid sequence of SEQ ID 142 (CDR-L1).
  • Light chain complementarity comprising at least one selected from the group consisting of a polypeptide comprising the amino acid sequence of SEQ ID NO: 143 (CDR-L2) and a polypeptide comprising the amino acid sequence of SEQ ID NO: 144 (CDR-L3)
  • a light chain variable region including a crystal region or the light chain complementarity crystal region;
  • Xaa3 lie Ser Pro Gly Ser Xaa4 Xaa5 Xaa6 Tyr Tyr Ala Asp Ser Val Xaa7 Gly (Xaa3 is Ala or Gly.Xaa4 is Gly or Ser, Xaa5 is Ser or Asn, Xaa6 is Thr or Lys.
  • XaalO Gly Xaall Ser Ser Asn lie Gly Asn Asn Xaal2 Val Xaal3 (XaalO is Ser or Thr, Xaall is Pro or Ser, Xaal2 is Ser or Asp, Xaal3 is Ser or Tyr)
  • Xaal4 is Ser or Ala
  • Xaal5 is Asp or Asn
  • Xaal6 is Asn or Ser
  • Xaal7 is Asn or Lys
  • Xaal9 is Ala or Ser
  • Xaa20 is Asp or Val
  • Xaa21 is Ser or Ala
  • the anti—Nrpl antibody or antigen-binding fragment thereof is a polypeptide (CDR-HI) comprising the amino acid sequence of SEQ ID NO: 110 or 121.
  • CDR-HI polypeptide comprising the amino acid sequence of SEQ ID NO: 110 or 121.
  • Polypeptide (CDR-L1) comprising the amino acid sequence of SEQ ID NO: 113. 118, or 124, polypeptide (CDR-L2) comprising the amino acid sequence of SEQ ID NO: 114, 119, or 125, and SEQ ID NOs: 115, 120
  • a light chain complementarity determining region comprising one or more selected from the group consisting of a polypeptide comprising the amino acid sequence of 126 (CDR— L3).
  • a light chain variable region comprising the light chain complementarity determining region
  • the complementarity determining site of the anti-Nrpl antibody or antigen-binding fragment thereof may be, for example, having the amino acid sequence of Table 1 below. Table 1
  • the anti-Nrpl antibody or antigen-binding fragment thereof is provided. In one example.
  • the anti-Nrpl antibody or antigen-binding fragment thereof is provided.
  • variable region comprising the amino acid sequence of SEQ ID 127, 129, or 131;
  • a light chain variable region comprising the amino acid sequence of SEQ ID 128. 130, or 132; or
  • the anti-Nrpl antibody or antigen-binding fragment thereof is SEQ ID NO: 110 (CDR-H1), 111 (CDR-H2), 112 (CDR-H3). 113 (CDR-L1),
  • the anti-Nrpl antibody or antigen-binding fragment thereof comprises a heavy chain variable region of SEQ ID NO: 127 and a light chain variable region of SEQ ID NO: 128 ,
  • the heavy chain variable region of SEQ ID NO: 131 and the light chain variable region of SEQ ID NO: 132 may be included.
  • the anti-c-Met antibody may be in a specific site of c-Met, such as in the SEMA domain. It may be, for recognizing a specific epitope region, and can be acted on c-Met cell naeyidong (internalization) and decomposing any antibody or antigen-binding fragment thereof to induce (degradat ion).
  • C-Met a receptor for HGFCHepatocyte growth factor
  • HGFCHepatocyte growth factor a receptor for HGFCHepatocyte growth factor
  • ⁇ - and ⁇ -subunits are linked by disulfide bonds to form the HGF binding domain, the SEMA domain, the PSI domain (plexin-semaphorins-integrin homology domain), and the IPT dormant 1 (inimunoglobulir like fold shared by p 1 e ⁇ ns and transcriptional factors domain).
  • the SEMA domain of the c-Met protein may be one comprising the amino acid sequence of SEQ ID NO: 79.
  • the region comprising the amino acid sequence of the sequence number group corresponding to a specific site in the SEMA domain may comprise a loop between propeller domains 2 and 3 of the epitopes in the SEMA domain of the c—Met protein. loop) site, and may act as an epitope of an anti-c-Met antibody proposed in the present invention.
  • the term “epitope” is interpreted to mean a portion of the antigen recognized by the antibody as an antigenic determinant. According to one embodiment, the epitope is the SEMA domain of the c-Met protein.
  • the epitope may be composed of 5 to 19 amino acids consecutively including SEQ ID NO: 73 (EEPSQ) in the amino acid sequence of SEQ ID NO. It may be a polypeptide comprising the amino acid sequence of SEQ ID 71, SEQ ID 72 or SEQ ID 73.
  • the epitope comprising the amino acid sequence of SEQ ID NO: 72 corresponds to the site of the most extensively located loop site between the domains of propeller structures 2 and 3 in the SEMA domain of c-Met protein.
  • the epitope comprising the amino acid sequence of SEQ ID NO: 73 is the site to which the antibody or antigen-binding fragment according to one embodiment most specifically binds.
  • the anti-c-Met antibody may be one that specifically binds to an epitope comprising 5 to 19 consecutive amino acids comprising SEQ ID NO: 73 (EEPSQ) in the amino acid sequence of SEQ ID NO. It may be an antibody or antigen binding fragment that specifically binds to an epitope comprising the amino acid sequence of SEQ ID 71, SEQ ID 72, or SEQ ID 73.
  • the anti-c-Met antibody is.
  • CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4.
  • CDR-H2 comprising an amino acid sequence of SEQ ID NO: 5, an amino acid sequence of SEQ ID NO: 2, or an amino acid sequence consisting of consecutive 8 to 19 amino acids comprising the third to tenth amino acids within the amino acid sequence of SEQ ID NO: 2
  • a CDR comprising an amino acid sequence of SEQ ID NO: 6, an amino acid sequence of SEQ ID NO: 85, or an amino acid sequence consisting of six to thirteen consecutive amino acids comprising the first to sixth amino acids within the amino acid sequence of SEQ ID NO: 85
  • CDR-L1 comprising the amino acid sequence of SEQ ID NO: 7, CDR-L2 comprising the amino acid sequence of SEQ ID NO: 8, and the amino acid sequence of SEQ ID NO: 9, the amino acid sequence of SEQ ID NO: 15.
  • One or more light chain complementarities selected from the group consisting of the amino acid sequence of SEQ ID NO: 86, or CDR-L3 comprising an amino acid sequence consisting of 9 to 17 amino acids comprising the amino acids 1-9 in the amino acid sequence of SEQ ID NO: 89; Decision area.
  • a light chain variable region comprising the one or more light chain complementarity determining regions;
  • SEQ ID NO: 4 to SEQ ID NO: 9 may each be an antibody or antigen binding fragment which is an amino acid sequence represented by the following general formula (I) to (VI):
  • Trp-Xaan-Ser-Xaai2-Arg-Val-Xaai3 (SEQ ID NO: 8)
  • Xaa 3 is Asn or Lys and Xaa 4 is Ala or Val.
  • Xaa 5 is Asn or Thr,
  • Xaa 6 is Ser or Thr
  • Xaa 7 is His, Arg, Gin or Lys and Xaa 8 is Ser or Trp.
  • Xaa 9 is His or Gin and Xaa 10 is Lys or Asn.
  • Xaa n is Ala or Gly, and Xaa ir & Thr or Lys. 33 13 is Ser or Pro,
  • 33 14 is Gly. Ala or Gin, 33 15 is Arg, His, Ser, Ala, Gly or Lys, and Xaai 6 is Leu, Tyr, Phe or Met.
  • the CDR-H1 may comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24.
  • the CDR—H2 may include an amino acid sequence selected from the group consisting of SEQ ID NO: 2.
  • SEQ ID NO: 25 and SEQ ID NO: 26.
  • the CDR-H3 may include an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 85.
  • the CDR-L1 is selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 106 It may include an amino acid sequence.
  • the CDR-L2 may include an amino acid sequence selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36.
  • the CDR-L3 may include an amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15. SEQ ID NO: 16, SEQ ID NO: 37. SEQ ID NO: 86., and SEQ ID NO: 89 .
  • the antibody or antigen-binding fragment is a polypeptide (CDR-H1), SEQ ID NO: 2, sequence comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24
  • a polypeptide (CDR-H2) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 25, and SEQ ID NO: 26, and an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 85
  • a recoding variable region comprising a polypeptide comprising (CDR-H3);
  • a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 29, SEQ ID NO: 30.
  • Polypeptide (CDR-L2) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36, and SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14.
  • SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 37, SEQ ID NO: 86, and SEQ ID NO: 89 may include a light chain variable region comprising a polypeptide (CDR-L3) comprising an amino acid sequence selected from the group.
  • Said anti-c-Met antibody or antigen-binding fragment is deleted at least one amino acid.
  • the addition or substitution may include a hinge region in which the amino acid sequence is modified.
  • the antibody may include a hinge region including the amino acid sequence of SEQ ID NO: 100.
  • the hinge region may include an amino acid sequence of SEQ ID NO: 100 or SEQ ID NO: 1. According to one embodiment.
  • the anti-c-Met antibody or antigen binding fragment is SEQ ID NO: 17, SEQ ID NO: 74, SEQ ID NO: 87, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, Said repetitive variable region comprising the amino acid sequence of SEQ ID NO: 93 or SEQ ID NO: 94: SEQ ID NO: 109.
  • a combination of the heavy chain variable region and the light chain variable region is SEQ ID NO: 17, SEQ ID NO: 74, SEQ ID NO: 87, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, Said repetitive variable
  • the anti-c-Met antibody may be a monoclonal antibody that specifically binds to an extracellular region of the c-Met protein, produced in hybridoma cells with accession number KCLRF-BP-00220. See patent 2011-0047698, which is incorporated herein by reference).
  • the anti-c-Met antibody may include all of the antibodies defined in Korean Patent Publication Nos. 2011-0047698 and 2013-0037189.
  • the light chain constant region and heavy chain constant region can be from all subtypes of immunoglobulins (eg, IgA, IgD, IgE, IgG (IgGl, IgG2, IgG3, IgG4), I M., etc.).
  • the anti-c-Met antibody the anti-c-Met antibody
  • the amino acid sequence of SEQ ID NO: 62 (in this case, the amino acid sequences 1-17 are signal peptides).
  • the amino acid sequence of the 18th to 462th SEQ ID NO: 62, the amino acid sequence of SEQ ID NO: 64 (the first to 17th amino acid sequences in this test is a signal peptide), or the 18th to 461th of SEQ ID NO: 64 An amino acid sequence selected from the group consisting of an amino acid sequence, an amino acid sequence of SEQ ID NO: 66 (wherein the first to seventeenth amino acid sequences are signal peptides), and the amino acid sequence of the eighteenth to 460th amino acid sequences of SEQ ID NO: 66; Heavy chain; And
  • the amino acid sequence of SEQ ID NO: 68 (the amino acid sequence of 1st to 20th among them is a signal peptide), the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 68, and the amino acid sequence of SEQ ID NO: 70 (the first in this case) To 20th amino acid sequence is a signal peptide), the amino acid sequence from 21st to 240th of SEQ ID NO: 70, and the amino acid sequence of SEQ ID NO: 108
  • Light chain comprising an amino acid sequence selected from the group consisting of:
  • the anti-c-Met antibody for example, the anti-c-Met antibody,
  • a heavy chain comprising the amino acid sequence of SEQ ID NO: 62 or the amino acid sequence of Nos. 18 to 462 of SEQ ID NO: 62 and a light chain comprising the amino acid sequence of SEQ ID NO: 68 or the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 68;
  • a heavy chain comprising the amino acid sequence of SEQ ID NO: 64 or the amino acid sequence of the 18th to 461th sequences of SEQ ID NO: 64 and a light chain comprising the amino acid sequence of SEQ ID NO: 68 or the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 68;
  • Antibody comprising;
  • An antibody comprising a heavy chain comprising the amino acid sequence of the 460th amino acid sequence and a light chain comprising the amino acid sequence of SEQ ID NO: 68 or the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 68;
  • An antibody comprising a heavy chain comprising an amino acid sequence up to 462 and a light chain comprising an amino acid sequence of SEQ ID NO: 70 or an amino acid sequence of SEQ ID NO: 70 from 21 to 240;
  • An antibody comprising a heavy chain comprising an amino acid sequence up to 461 and a light chain comprising an amino acid sequence of SEQ ID NO: 70 or an amino acid sequence of SEQ ID NO: 70 from 21st to 240; or
  • An antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 66 or the amino acid sequence of the 18th to 460th sequence of SEQ ID NO: 66 and a light chain comprising the amino acid sequence of the 21st to 240th amino acid sequence of SEQ ID NO: 70 or SEQ ID NO: 70;
  • An antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 66 or the amino acid sequence of the 18th to 460th sequence of SEQ ID NO: 66 and a light chain comprising the amino acid sequence of SEQ ID NO: 108
  • the polypeptide comprising the amino acid sequence of SEQ ID NO: 70 is a light chain consisting of a human kappa constant region
  • the polypeptide comprising the amino acid sequence of SEQ ID NO: 68 is a polypeptide comprising the amino acid sequence of SEQ ID NO: 70 36 (according to kabat numbering, 62nd amino acid position in SEQ ID NO: 68)
  • a histidine is a polypeptide substituted with tyrosine. Due to the substitution. In one embodiment, the yield of the antibody may be increased.
  • polypeptide comprising the amino acid sequence of SEQ ID NO: 108 is kabat numbering in the polypeptide comprising the amino acid sequence of the 21st to 240th except for the first to 20th signal peptide of the amino acid sequence of SEQ ID NO: 68 Serine (Ser) at the 27e position (depending on kabat number i rig, position 32 in SEQ ID NO: 108; inside CDR-L1) was substituted with tryptophan (Trp), and according to one embodiment, The activity of the antibody (eg, binding affinity for c-Met, c-Met degrading activity and Akt phosphorylation inhibitory activity, etc.) may be further enhanced.
  • Animal-derived antibodies produced by immunizing a desired antigen with an immunized animal can generally cause immunorejection when administered to humans for therapeutic purposes, and chimeric antibodies have been developed to suppress such rejection.
  • Chimeric antibodies are those obtained by replacing the constant regions of animal-derived antibodies that cause anti-isotype reactions with the constant regions of human antibodies using genetic engineering methods.
  • Chimeric antibodies have significantly improved anti-isotype responses compared to animal-derived antibodies, but animal-derived amino acids are still present in the variable region, making them a potential anti-idiotype.
  • idiotypic has side effects of reaction.
  • Humanized antibodies have been developed to ameliorate these side effects. It is made by implanting a region of the complementarity determining regions (CDRs) that play an important role in the binding of the variable region proliferative antigen of the chimeric antibody into the human antibody framework.
  • CDRs complementarity determining regions
  • CDR grafting technology for the production of humanized antibodies is to select an optimized human antibody that can best accept the CDR region of an animal-derived antibody.
  • structure analysis and molecular modeling techniques Even when the CDR region of an animal-derived antibody is implanted into an optimized human antibody skeleton, there are many amino acids that are located in the skeleton of an animal-derived antibody and affect antigen binding. As such, the application of additional antibody engineering techniques to restore antigen binding capacity is essential.
  • the antibody may be a mouse derived antibody, mouse-human chimeric antibody, humanized antibody or human antibody.
  • a complete antibody is a structure having two full length light chains and two full length light chains, each of which is linked by heavy and disulfide bonds.
  • the constant region of the antibody is divided into a heavy chain constant region and a light chain constant region, and the heavy chain constant 'regions are gamma), mu ( ⁇ ) and alpha ( ⁇ ).
  • the constant regions of the light chains have kappa ( ⁇ ) and lambda ( ⁇ ) types.
  • a “heavy chain” refers to a variable region domain V H comprising an amino acid sequence comprising enough variable region sequences to confer specificity to an antigen and to three constant region domains C H1 , C H2 and C H3 Is interpreted to include both full-length heavy chains and fragments thereof.
  • the term "light chain” includes both a variable region domain comprising an amino acid sequence comprising a sufficient variable region sequence for conferring specificity to an antigen and a full length light chain comprising a constant region domain C L and fragments thereof. It is interpreted to mean.
  • CDR complementarity determining region
  • the heavy and light chains may each comprise three CDRs (CDRH1, CDRH2, CDRH3 and CDRL1. CDRL2, CDRL3).
  • the CDRs can provide key contact residues for the antibody to bind antigen or epitope.
  • specifically binds or “specifically recognized” is the same as that commonly known to those skilled in the art and means that the antigen and antibody specifically interact to make an immunological reaction.
  • Antigen binding fragment is a fragment thereof for the entire structure of an immunoglobulin and refers to a portion of a polypeptide comprising a portion to which an antigen can bind, eg scFv, (scFv) 2 , scFv-Fc. Fab, Fab 'or F (ab') 2 , but is not limited thereto.
  • Fab of the antigen-binding fragment has one antigen-binding site in a structure having a variable region of the light and heavy chains, a constant region of the light chain, and a first constant region (() of the heavy chain.
  • F (ab ') 2' antibody ' is a cysteine residue of the hinge region of the disulfide bonds, Fab is generated yirumyeonseo. Recombinant techniques for generating Fv fragments with minimal antibody fragments in which Fv has only heavy chain variable regions and light chain variable regions are well known in the art.
  • Double-chain Fv is non-covalently linked to the heavy chain variable region and the light chain variable region, and the single-chain Fv is generally shared by the variable region of the heavy chain and the short-chain variable region through a peptide linker. It may be linked by a bond or directly at the C-terminus to lead to a dimer-like structure, such as a double chain Fv.
  • scFv-Fc is a structure in which a single chain Fv and a constant region are linked with or without a peptide linker.
  • the peptide linker may be composed of 1 to 100 or 2 to 50 arbitrary amino acids, and those skilled in the art may appropriately select the amino acid length and type.
  • the antigen-binding fragment can be obtained using proteolytic enzymes (Eg, restriction digestion of the entire antibody with papain can yield Fab and cleavage with pepsin yields F (ab ') 2 fragments) and can be produced via genetic recombination techniques.
  • proteolytic enzymes Eg, restriction digestion of the entire antibody with papain can yield Fab and cleavage with pepsin yields F (ab ') 2 fragments
  • hanginge region refers to a region included in the heavy chain of an antibody, which exists between the CH1 and CH2 regions, and which functions to provide flexibility of the antigen binding site in the antibody.
  • Animal-derived IgGl hinges are substituted with human IgGl hinges.
  • Animal-derived IgGl hinges are shorter in length than human IgGl hinges, and the disulfide bonds between the two heavy chains are reduced from three to two, resulting in different rigidity of the hinges.
  • modification of the hinge region can increase the antigen binding efficiency of the humanized antibody. Deletion of an amino acid for modifying the amino acid sequence of said hinge region. Addition or substitution methods are well known to those skilled in the art.
  • the antibody may be a monoclonal antibody.
  • Monoclonal antibodies can be prepared according to methods well known in the art. For example, it may be manufactured using a phage display technique.
  • the antibody may be a disulfide-binding Fvs (sdFV) or anti-idiotype (antivison Id) antibody.
  • Antibodies or antibody fragments described herein can include not only the sequences of the antibodies described herein, but also biological equivalents thereof.
  • Further changes in the amino acid sequence of the antibody can be made to further improve the binding affinity and / or other biological properties of the antibody.
  • Such modifications include, for example, deletion of amino acid sequence residues of an antibody. Insertions and / or substitutions.
  • These amino acid variations are relative similarities of amino acid chain substituents. for example. Hydrophobic, hydrophilic, charge. It may be made based on the size and the like. Size of amino acid chain substituents. Example arginine by analysis of shape and type.
  • Lysine and histidine are both positively charged residues; Alanine, glycine and serine have similar sizes; Phenylalanine. It can be seen that tryptophan and tyrosine have a similar shape. Therefore, based on these considerations, arginine, Lysine and histidine; Alanine, glycine and serine; Phenylalanine, tryptophan and tyrosine are biologically equivalent functions.
  • Hydropathic indexes of amino acids can be considered. Each amino acid is endowed with hydrophobic inex according to hydrophobicity and charge: isoleucine (+4.5): valine (+4.2): leucine (+3.8); Phenylalanine (+2.8); Cysteine / cysteine (+2.5): methionine (+ 1.9); Alanine (+1.8); Glycine (-0.4); Threonine (VII); Serine (-0.8); Tryptophan (-0.9): tyrosine (-1.3); prine (-1.6): histidine (-3.2); Glutamate (-3.5); Glutamine (-3.5); Aspartate (-3.5); Asparagine (-3.5); lysine (-3.9); And arginine (-4.5).
  • Hydrophobic amino acid indexes are very important in conferring the interactive biological function of proteins. It is known that substitution with amino acids having similar hydrophobicity indexes can retain similar biological activity. When introducing mutations with reference to the hydrophobicity index, it is preferably within ⁇ 2. More preferably, amino acid substitutions are performed that show hydrophobic index differences within X 1 and even more preferably within X 0.5.
  • each amino acid residue is assigned the following hydrophilicity values: arginine (+3.0); Lysine (+3.0): asphaltate (+3.0 sul 1); Glutamate (+ 3.0 ⁇ 1); serine (+0.3); Asparagine (+0.2); Glutamine (+0.2); Glycine (0); Threonine (-0.4): plinin (-0.5 ⁇ 1); alanine (X0.5); histidine (-0.5); cysteine (-1.0); Methionine (-1.3); Valine (-1.5); Leucine (-1.8); Isoleucine (-1.8); tyrosine (-2.3); Phenylalanine (-2.5); Tryptophan (-3.4).
  • Amino acid substitutions in proteins that do not alter the activity of the molecule as a whole are well known in the art.
  • the most commonly occurring substitutions are amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser. Ala / Gly. Ala / Thr, Ser / Asn. Ala / Val, Ser / Gly. Thr / Phe, Ala / Pro. Lys / Arg. Asp / Asn.
  • the described antibodies or nucleic acid molecules encoding them are also construed to include sequences that exhibit substantial identity to the sequences set forth in the Sequence Listing. Substantial identity of the above.
  • sequence of the present invention and any other sequence is aligned to the maximum as possible, and the aligned sequence is analyzed using algorithms commonly used in the art. At least 61% homology, at least 70% homology, at least 80% homology. A sequence that exhibits at least 9, at least 95%, or at least 99% homology. Alignment methods for sequence comparison are known in the art. for example.
  • NCBI Basic Local Alignment Search Tool is accessible from NBCI and the like, and can be used in conjunction with sequencing programs such as blastp, blasm, blastx, tblastn and tblastx on the Internet.
  • BLSAT is www. Accessible at ncbi.nlni.nih.gov/BLAST/. Sequence homology comparisons using this program are available at www.ncbi.nlm.nih.gov/BLAST/blast_help. You can check it in html.
  • the anti-c-Met / anti-Nrpl bispecific antibody is an anti-c-Met antibody or antigen binding fragment thereof, and the C-terminal or N-terminal end of the anti-c-Met antibody or antigen-binding fragment thereof, For example, an anti-Nrpl antibody linked to the C terminus or an antigen binding fragment thereof.
  • the anti-c-Met / anti—Nrpl bispecific antibody mediate the movement and degradation of c-Met proteins into cells. It may be advantageous to have a complete antibody structure (eg, IgG type antibody) in order to secretly play this role.
  • Anti-Nrpl antibodies are important for specific recognition and binding to Nrpl. Since it does not have a complete antibody structure and is capable of internalization even in the form of an antigen binding fragment such as, for example, scFv. It may be included in the form of an antigen-binding fragment that recognizes Nrpl.
  • the anti—c-Met / anti-Nrpl bispecific antibody is a complete form of an anti- C -Met antibody (such as an IgG type antibody) against c-Met and an anti-c-Met antibody. It may include, but is not limited to, antigen binding fragments of anti-Nrpl antibodies (eg, scFv or scFv—Fc) that are linked to the C terminus (eg, the C terminus of the reinforcement of an anti-c-Met antibody).
  • antigen binding fragments of anti-Nrpl antibodies eg, scFv or scFv—Fc
  • the anti-c-Met antibody or Antigen-binding fragments thereof and anti-Nrpl antibodies or antigen-binding fragments thereof are linkers, such as. Connections can be made with or without the peptide linker.
  • heavy and light chain portions in antigen binding fragments such as heavy and light chain variable regions in scFv fragments, can also be linked with or without a peptide linker.
  • the peptide linker connecting the anti-c-Met antibody or antigen-binding fragment thereof and the anti-Nrpl antibody or antigen-binding fragment thereof and the peptide linker connecting the heavy and light chain portions in the antigen-binding fragment may be the same or different.
  • the peptide linker may be a polypeptide consisting of 1 to 100, 2 to 50, 2 to 30, 2 to 20, or 2 to 15 any amino acid.
  • the amino acid type contained is not limited.
  • the peptide linker is. for example. Gly, Asn and / or Ser residues may be included, and neutral amino acids such as Thr and / or Ala may also be included. Suitable amino acid sequences for peptide linkers are known in the art. Meanwhile, the linker does not affect the function of the bispecific antibody. The length can be determined in various ways. for example.
  • the linker may be made of one or more selected from the group consisting of Gly, Asn, Ser, Thr and Ala, including 1 to 100, 2 to 50, or 5 to 25. In one example.
  • the peptide ⁇ linker is (G 4 S) n (n is a repeating number of (G 4 S)), and may be represented by an integer of 1 to 10, for example, an integer of 2 to 5).
  • the anti-c-Met / anti-Nrpl bispecific antibody is an anti-c-Met antibody
  • the chain of anti- C- Met / anti-Nrpl bispecific antibody comprises the heavy chain of the anti-c-Met antibody described above on the N-terminal side.
  • ScFv, (scFv) 2 , scFv-Fc. Fab. Fab 'or F (ab') 2 may be included, with or without a linker, for example, may comprise an amino acid sequence selected from SEQ ID NOs: 145 to 147.
  • the light chain of the anti-Met / anti-Nrpl-specific antibody may be the same as the light chain of the anti-c-Met antibody described above.
  • the amino acid sequence of SEQ ID 68 1st to 20th amino acid sequence is a signal peptide), the 21st to 240th amino acid sequence of SEQ ID NO: 68.
  • An amino acid sequence of SEQ ID NO: 70 (wherein the amino acid sequences of 1st to 20th are signal peptides), the 21st to 240th amino acid sequence of SEQ ID NO: 70, and the amino acid sequence of SEQ ID NO: 108 It may include an amino acid sequence.
  • Said anti-c-Met / anti-Nrpl dual specific antibodies can maintain similar binding affinity for c-Met or Nrpl as for the monoclonal antibody, respectively.
  • affinity (Kd) of the anti-c-Met / anti-Nrpl bispecific antibody to c-Met is about 0.001 to 50 nM, 0.001 to 30 nM , 0.001 to ⁇ , 0.001 to InM.
  • Nrpl (1 (d) is about 0.001 to ⁇ , 0.001 to 70nM, 0.001 to 50nM, 0.001 to 40nM, 0.001 to 30nM. 0.001 to ⁇ , or 0.001 to InM days) Can be.
  • Said anti-c-Met / anti-Nrpl bispecific antibody is cell internalization of anti-c-Met antibody
  • the anti-C-Met / anti-Nrpl bispecific antibodies may be anticancer agents (such as. Gemcitabine and the like) and / or c-Met targeted therapeutics (such as anti-c-Met antibodies) and / or Nrpl targeted therapeutics (such as , Anti-Nrpl antibody) can also be effective when applied to patients with resistance.
  • the anti-c-Met / anti-Nrpl bispecific antibody is, therefore, the anti-c-Met / anti-Nrpl bispecific antibody may be administered in combination as well as during administration of a c—Met inhibitor and an Nrpl inhibitor alone. Compared with, it has a significantly elevated anti-cancer and / or cancer metastasis inhibiting effect. Due to this synergistic effect, the anti-c-Met / anti-Nrpl bispecific antibody can exert an excellent effect even at low doses, as compared to the single or combined administration of c-Met and Nrpl inhibitors. . Side effects with high dosages can be reduced.
  • another example of the present invention is directed to an anti-c-Met / anti-Nrpl It provides a pharmaceutical composition for the prevention and / or treatment of diseases associated with overproduction (eg overexpression) and / or abnormal activation of c-Met and / or Nrpl comprising as an active ingredient.
  • the pharmaceutical composition may further include a pharmaceutically acceptable carrier in addition to the bispecific antibody.
  • Another example is the prevention and / or treatment of diseases associated with overproduction (eg. Overexpression) and / or abnormal activation of c-Met and / or Nrpl with a pharmaceutically effective amount of the anti-c-Met / anti-Nrpl bispecific antibody.
  • the method of preventing and / or treating a disease associated with overproduction (eg. Overexpression) and / or abnormal activation of c-Met and / or Nrpl may include overproduction (eg, c—Met and / or Nrpl prior to the administration). , And / or identifying patients in need of prevention and / or treatment of diseases associated with abnormal activation.
  • prevention means any action that inhibits or delays the occurrence of a disease by administration of a composition of the present invention.
  • Treatment is the suppression of the development of the disease. Relief of symptoms. Improvement and / or removal of etiology (eg, removal of tumor cells or tumor tissue in the case of tumors). 'Diseases associated with overproduction (eg, overexpression) and / or abnormal activation of c-Met and / or Nrpl are, for example. Cancer or cancer metastasis.
  • compositions for preventing and / or treating cancer or cancer metastases comprising the anti-c-Met / anti-Nrpl bispecific antibody as an active ingredient.
  • a method for preventing and / or treating cancer comprising administering a pharmaceutically effective amount of the anti-c-Met / anti-Nrpl bispecific antibody to a patient in need of preventing and / or treating cancer or cancer metastasis.
  • the method of preventing and / or treating cancer or cancer metastasis may further comprise identifying a patient in need of prevention and / or treatment of cancer or cancer metastasis prior to said administering.
  • the cancer may be associated with overexpression and / or abnormal activation of Nrpl and / or c-Met.
  • the cancer may be solid cancer or hematologic cancer.
  • Lung cancer eg, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, Lung adenocarcinoma, squamous cell carcinoma of the lung, etc.
  • peritoneal cancer skin cancer, melanoma (eg, skin or intraocular myeloma, etc.).
  • Rectal cancer Anal anal cancer.
  • Stomach cancer Small bowel cancer. Endocrine adenocarcinoma, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer. Chronic or acute leukemia.
  • Lymphocyte Lymphoma Hepatocellular Carcinoma, Gastrointestinal Cancer, Pancreatic Cancer. Glioblastoma (or glioblastoma). Astrocytoma, glioma, neuroblastoma, testicular cancer Cervical cancer. Ovarian Cancer. Liver cancer. Bladder cancer, breast cancer, colon cancer. Colorectal cancer: Endometrial or uterine cancer, acupuncture cancer, kidney cancer. Prostate cancer, vulvar cancer, thyroid cancer, head and neck cancer, brain cancer, osteosarcoma, etc. may be one or more selected from the group consisting of. The cancer may be primary or metastatic cancer.
  • An anti-c ⁇ Met / anti-Nrpl dual specific antibody is an anticancer agent by simultaneously inhibiting c-Met and Nrpl. for example.
  • the cancer is a conventional anticancer agent.
  • anticancer agents selected from the group consisting of gemcitabine and / or c-Met targeted therapeutics (eg anti-c-Met antibodies) and / or Nrpl targeted therapeutics (eg anti-Nrpl antibodies).
  • the cancer may have innate resistance or acquired resistance.
  • another example provides a pharmaceutical composition for overcoming anticancer drug resistance comprising the anti-c-Met / anti-Nrpl bispecific antibody.
  • Another example provides a method of overcoming anticancer resistance, comprising administering a pharmaceutically effective amount of the anti-C-Met / anti-Nrpl bispecific antibody to a patient in need of overcoming anticancer resistance.
  • the anticancer agent resistance may include one or more anticancer agents selected from the group consisting of gemcitabine and / or c-Met targeted therapeutics (eg anti-c-Met antibodies) and / or Nrpl targeted therapeutics (eg , Anti-Nrpl antibodies) may be innate or acquired resistance.
  • the anti- C- Met / anti-Nrpl bispecific antibody is a pharmaceutically acceptable carrier. Diluents, excipients, etc. It may be provided with one or more additives selected from the group.
  • the pharmaceutically acceptable carrier is commonly used in the preparation of antibodies, lactose, dextrose, sucrose, sorbbi, manny, starch, acacia rubber, phosphate. Alginate, gelatin, calcium silicate, microcrystalline cellulose. Polyvinylpyrrolidone, cellulose, water. syrup. Methyl Sallos. It may be one or more selected from the group consisting of methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, mineral oil and the like, but is not limited thereto.
  • the pharmaceutical composition is a diluent, excipient commonly used in the manufacture of pharmaceutical compositions in addition to the components. slush. Wetting agents, sweeteners 1, flavoring agents, emulsifiers, suspending agents. It may further include one or more selected from the group consisting of a preservative.
  • the pharmaceutical composition can be administered orally or parenterally.
  • parenteral administration intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection. Endothelial administration. Topical administration. It can be administered by intranasal administration, pulmonary administration or rectal administration.
  • oral compositions Upon oral administration. Since proteins or peptides are digested, oral compositions must be formulated to coat the active agent or to protect it from degradation in the stomach. In addition, the composition may be administered by any device in which the active substance may migrate to the target cell.
  • the pharmaceutical composition Said anti-Nrpl antibody or antigen binding fragment thereof. Or a suitable dosage of the anti-Met / anti-Nrpl bispecific antibody is disclosed in the Formulation Methods. Mode of administration, patient's age, weight. Sex, morbidity, food, time of administration. It may be prescribed in various ways by factors such as route of administration, rate of excretion and reaction responsiveness. Preferred dosages of the compositions range from 0.001 to 100 nig / kg on an adult basis. Can be. The daily dosage may be formulated into one formulation in unit dosage form, or may be formulated in appropriate quantities. It can be prepared by incorporation into a multi-dose container.
  • the term "pharmaceutically effective amount” means an amount in which the active ingredient (ie, the anti-C-Met / anti-Nrpl bispecific antibody) may exhibit the desired effect, i.e., the effect of preventing and / or treating cancer.
  • Formulation method mode of administration, age, weight, sex of the patient. morbidity. Food, dosing time. It may be prescribed in various ways by factors such as the route of administration, rate of excretion and response.
  • the pharmaceutical composition can be prepared in unit dose form or formulated into a multi-dose container by formulating with a pharmaceutically acceptable carrier and / or excipient, according to methods readily available to those skilled in the art. . Wherein the formulation is a solution, suspension in an oil or aqueous medium. Syrup or emulsion form or essence. Powder. Powder. Granules. It may be in the form of a tablet or capsule, and may further include a dispersant or a stabilizer.
  • compositions may be administered as individual therapeutic agents or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents.
  • the subject of administration of said pharmaceutical composition or subject of administration of said prophylactic and / or therapeutic method is a human.
  • Mammals including primates such as monkeys or rodents such as rats and mice, or cells or tissues or cultures thereof isolated from the mammals, but are not limited thereto. Cancer patients may have developed resistance to existing anticancer drugs.
  • Anti -c-Met / anti -Nrpl antibody provided by the present invention has the following benefits: i with:
  • 1 is a schematic diagram showing an example of the structure of an anti-c-Met / anti-Nrpl bispecific antibody.
  • FIG. 2 shows one of the phagemid vectors for the production of anti-Nrpl scFv antibody fragments. • A schematic diagram showing an example.
  • FIG. 5 is a graph showing binding to Nrpl according to the concentration of three anti-Nrpl scFv antibody fragments.
  • FIG. 6 is a graph showing the effect of inhibiting cell proliferation against gastric cancer cell line MKN45 of anti-c-Met / anti-Nrpl bispecific antibody.
  • FIG. 7 is a fluorescence image showing the effect of cell migration inhibition on kidney cancer cell line 786-0 of anti-c-Met / anti-Nrpl bispecific antibody.
  • FIG. 8 is a graph showing quantitative fluorescence intensity of FIG. 7.
  • FIG. 9 is a fluorescence image showing the invas ion inhibition effect of the anti-c-Met / anti—Nrpl bispecific antibody on kidney cancer cell line 786-0.
  • FIG. 10 is a graph showing quantitative fluorescence intensity of FIG. 9.
  • FIG. 11 is a graph showing the effect of inhibiting cell proliferation of c-Met antibody resistant kidney cancer cell line 786-0 of anti-c-Met / anti-Nrpl bispecific antibody.
  • FIG. 13 is a graph showing the effect of inhibiting cell proliferation on MKN45 cell line (left) and gemcitabine resistant MKN45 cell line (right) of anti-c-Met / anti-Nrpl bispecific antibodies.
  • FIG. 14 shows immunoblotting results showing changes in c—Met and Nrpl levels in gemcitabine resistant MKN45 cell lines following anti-c-Met / anti-Nrpl bispecific antibody treatment.
  • mice Five mice were mixed with 100 / _zg human c-Met / Fc fusion protein (R & D Systems) and the same amount of Freund's adjuvant per mouse to produce 6-6 week old BALB / c mice ( Japan SLC, Inc.). Two weeks later, 50 / g of the previous injection of the human c-Met / Fc fusion protein used as the antigen in the same manner as above was common with the same amount of incomplete Freund's adjuvant. Combined and injected intraperitoneally of mice.
  • mice obtained with sufficient amounts of antibodies were selected, and the following cell fusion process was performed.
  • human c-Met / Fc fusion protein mixture was injected into 50 / g PBS intraperitoneally of BALB / c mice (Japan SLC, Inc.). Immunized mice were anesthetized and spleens located on the left side of the trunk were removed. The harvested spleens were ground with a mesh to separate cells and mixed with culture medium (DMEM, GIBC0. Invitrogen) to make a splenocyte suspension. The suspension was centrifuged to recover the cell layer. The obtained splenocytes 1 ⁇ 10 8 and myeloma cells (Sp2 / 0) 1 ⁇ 10 8 were combined and centrifuged to precipitate the cells.
  • DMEM culture medium
  • the centrifuged precipitate was slowly dispersed and treated with 45% polyethylene glycol (PEG) (1 nie) contained in culture medium (DMEM). After holding at 37 ° C. for 1 minute, culture medium (DMEM) 1 111 was added. Then, culture medium (DMEM) 10 ⁇ was added for 1 minute, left for 5 minutes in water at 37 ° C and then centrifuged again at 50 inC. Resuspend the cell precipitate in l ⁇ 2xl0 5 / m ( i) in separation medium (HAT medium) and dispense 0.1 ⁇ aliquots into well-well plates and then 37 ° C Hybridoma cell groups were prepared by culturing in a carbon dioxide incubator.
  • PEG polyethylene glycol
  • Human c-Met / Fc fusion protein was added to the microtiter plate at 50 (2) per well each to adhere to the plate surface, and unreacted antigens were washed out to remove antibodies bound to Fc but not to c-Met. Human Fc protein was attached to the plate surface in the same manner as above for selection and exclusion.
  • Hybridoma cell lines that secrete antibodies that do not bind to human Fc but specifically have high binding capacity to human C—Met protein are repeatedly selected.
  • One clone of the hybridoma cell line producing monoclonal antibody was finally obtained by limiting dilution (l im iti ng dil ut i on) of the hybridoma cell line obtained through repeated selection.
  • the final screened monoclonal antibody-producing hybridomas were deposited on October 6, 2009 with the Korea Cell Line Research Foundation, located in Yeongun-dong, Jongno-gu, Seoul, under the Treaty of Budapest, and received accession number KCLRF-BP-00220 (Korea See Publication 2011-0047698). 1.1.4. Production and Purification of Monoclonal Antibodies
  • the hybridoma cells obtained in Reference Example 1.1.3 were cultured in serum-free medium, and monoclonal antibodies were produced and purified from the culture.
  • the hybridoma cells cultured in 50 ml of culture medium (DMEM) medium containing 10% (v / v) FBS were centrifuged to wash the cell precipitate at least twice with 20 ⁇ ('PBS to remove FBS.
  • the cell precipitate was resuspended in culture medium (DMEM) medium 50 nie and then incubated in a 37 ° C. carbon dioxide incubator for 3 days, after which centrifugation, cells producing the antibody were removed and the antibodies secreted.
  • the cultures were separated and stored at 4 ° C. or collected immediately for separation and purification of the antibody using an AKTA purification instrument (GE Healthcare) equipped with an affinity column (Protein G agarose co 1 iimn; Pharmacia, USA).
  • Purified antibody was purified from 50 ⁇ (! To 300 nie) of the prepared culture solution, and the purified antibody was stored by replacing the supernatant with PBS using a protein filter (Am icon), and used in the following example. .
  • mouse antibody is likely to show an inii inogenicity when injected into humans for therapeutic purposes, and in order to solve this, from the mouse antibody AbF46 produced in Reference Example 1.1.4.
  • a chimeric antibody chAbF46 was constructed in which the constant region, except for the variable region related to antigen binding, was replaced with the sequence of the human IgGl antibody.
  • the nucleotide sequence corresponding to the heavy chain is' EcoRI-signal sequence 'VH-NheI_CH-TGA-XhoI' (SEQ ID NO: 38).
  • the nucleotide sequences corresponding to the light chains were designed to be composed of 'EcoRI -signal sequence-VL-BsiWI-CL-TGA—XhoI' (SEQ ID NO: 39), respectively, to synthesize genes.
  • the DNA fragment (SEQ ID NO: 38) comprising the nucleotide sequence corresponding to the heavy chain was added to the pOpt iVEC TM -T0P0 TA Cloning Kit included in the OptiCHO TM Antibody Express Kit (Cat no.
  • the constructed vector was amplified using Qiagen Max i prep kit (Cat no. 12662), respectively, and the temporary expression was performed using the Freestyle TM MAX 293 Expression System (invitrogen).
  • the cell line used is 293 F cell.
  • FreeStyle TM 293 Expression Medium was used to culture the cells in suspension culture. One day before the temporary expression cells were prepared at a concentration of 5xl0 5 cells / ml, and after 24 hours, the cells were temporarily expressed when the number of cells reached lxl0 6 cells / nil.
  • A mix
  • B Freestyle TM MAX reagent 100 / and OptiPro TM SFM 2ml in another 15ml tube, mix (A) and (B) and incubate for 15 minutes. After the transduction, the mixture was incubated at 37 ° C. 80% humidity, 8% CO 2 , and 130 rpni incubator for 5 days.
  • the cultured cells were centrifuged to obtain 100 ml of supernatant, respectively, and purified using AKTA Prime (GE healthcare). After installing the Protein A column (GE healthcare, 17-0405-03) on the AKTA Prime and pouring the culture medium at a flow rate of 5 ml / niin. Eluted with IgG el ut ion buffer (Thermo Scientific. 21004). The obtained eluate was exchanged with PBS buffer to finally purify the chimeric antibody AbF46 (hereinafter referred to as chAbF46).
  • chAbF46 chimeric antibody AbF46
  • VH of the mouse antibody AbF46 purified in Reference Example 1.2 above was obtained through Ig Blast (http://www.ncbi.nlm.nih.gov/igblast/). Human germline genes with the most homology with the genes were analyzed. As a result, it was confirmed that VH3-71 has 83% homology at the amino acid level, CDR-H1, CDR-H2.
  • CDR—H3 was defined as Kabat numbering and designed to introduce the CDR portion of the mouse antibody AbF46 into the framework of the VH3-group.
  • amino acids 30 (S ⁇ T), 48 (V ⁇ L), 73 (D ⁇ N) and 78 (T ⁇ L) were back-mutated with the amino acid sequence of the original mouse AbF46 antibody.
  • HI further mutated 83 (R ⁇ K) and 84 (A ⁇ T) amino acids to finally construct Hl-heavy (SEQ ID NO: 40) and H3-heavy (SEQ ID NO: 41).
  • the framework sequence of the human antibody for the design of H4-heavy was found to be very similar to the mouse skeleton sequence of the AbF46 antibody. Using the most stable known VH3 subtype, CDR-HI, CDR-H2 and CDR-H3 of the mouse antibody AbF46 defined by Kabat numbering were introduced. This established H4-heavy (SEQ ID NO: 42).
  • VK2-40 in addition to VK4-1 was selected. It was confirmed that the mouse antibodies AbF46 VL and VK2-40 had 61% homology at the amino acid level, CDR-L1, CDR-L2, CDR-L3 of mouse antibody AbF46 was defined by Kabat numbering, and the CDR of mouse antibody AbF46 was determined. The part was designed to be introduced into the backbone of VK4-1. At this time, H3- light back-mutation of 3 amino acids 36 (Y ⁇ H), 46 ⁇ 3 ⁇ 4, 49 (Y ⁇ I) was constructed.
  • H4-light SEQ ID NO: 46
  • CDR-L1 of mouse antibody AbF46 defined by Kabat numbering
  • CDR-L2 CDR—L3
  • H4 light was constructed by further back-mutation of three amino acids 36 (Y ⁇ H), 46 ⁇ 3 ⁇ 41), and 49 ( ⁇ — ⁇ ).
  • a DNA fragment (Hl-heavy; sequence containing the nucleotide sequence corresponding to the repetition in the P 0ptiVEC TM -T0P0 TA Cloning Kit included in the OptiCHO TM Ant i body Express Kit (Cat no. 12762-019) of Invitrogen) SEQ ID NO: 47, H3-heavy: SEQ ID NO: 48. H4_heavy; SEQ ID NO: 49), a DNA fragment comprising the nucleotide sequence corresponding to the light chain in the pcDNA TM 3.3-T0P0 TA Cloning Kit (H1-light; SEQ ID NO: 50.
  • the constructed vector was amplified using Qiagen Max i prep kit (Cat no. 12662), respectively, and the temporary expression was performed using the Freestyle TM MAX 293 Expression System (invitrogen).
  • the cell line used was 293 F cells, and was cultured by suspension culture using FreeStyle TM 293 Expression Mediimi as a medium.
  • One day before the temporary expression cells were prepared at a concentration of 5xl0 5 cells / ml, and after 24 hours, the cells were temporarily expressed when the number of cells reached lxl0 6 cells / ml.
  • huAbF46 humanized antibody AbF46
  • the gene for constructing the scFv 'of the huAbF46 antibody was designed using the heavy and light chain variable regions of the huAbF46 antibody. Each heavy and light chain variable region was designed to be in the form of 'VH-linker-VL' and the linker was designed to have an amino acid sequence of 'GLGGLGGGGSGGGGSGGSSGVGS' (SEQ ID NO: 54).
  • the polynucleotide encoding the scFv of the huAbF46 antibody thus designed was synthesized by Bioneer. A vector for expressing this is shown in SEQ ID NO: 56.
  • CDRs Six complementary determining regions (CDRs) were defined by 'Kabat r inibering' from the mouse antibody AbF46, prepared for the affinity niaturat ion of the huAbF46 antibody, and each CDR is shown in Table 2 below. Same as
  • Primers were prepared as follows to introduce random sequences of antibody CDRs.
  • N codons were used to introduce the same ratio of bases (253 ⁇ 4 A. 25% G, 25% C. 25% T) to the site to be mutated, but in this example, the huAbF46 antibody was used.
  • To introduce random bases into the CDRs 85% of the first and second nucleotides encoding the amino acids of each CDR are preserved and 5% of the remaining three bases are introduced. The way was taken.
  • primers were designed such that the third nucleotide was introduced equally (33% G. 33% C, 33% T).
  • Construction of the antibody library gene by introducing a random sequence of CDRs was performed using primers prepared in the same manner as in Reference Example 1.5.1. Using the polynucleotide containing the scFv of the huAbF46 antibody as a template, two PCR fragments were prepared as shown in FIG. 1. This can be achieved by using an overl ap ext ens i on PCR method. Six genes were constructed by obtaining the scFv library genes of the mutated huAbF46 antibodies, each of which only the desired CDRs were.
  • each library showed a tendency to lower the binding capacity for c-Met than the wild type, but the binding capacity for some c-Met Remaining mutations were identified.
  • the polynucleotides encoding the chains of the four selected antibodies consist of 'EcoRI- sigonal sequence-VH-Nhel-CH-XhoI' (SEQ ID NO: 38) .
  • the amino acid of the antibody is changed after affinity maturation. Since it was not, the heavy chain of huAbF46 antibody was used as it is. However, the hinge region was replaced with the U6-HC7 hinge (SEQ ID NO: 57), not the hinge of human IgGl.
  • Light chain is' EcoRI-signal
  • the genes were synthesized by designing the sequence-VL-BsiWI-CL-XhoI '.
  • Polynucleotides encoding the light chain variable regions of the four antibodies selected after affinity maturation (SEQ ID NO: 58 to SEQ ID NO: 61) were synthesized by applying to Bioneer. Subsequently, the DNA fragment (SEQ ID NO: 38) comprising the nucleotide sequence corresponding to the heavy chain was added to the pOpt iVEC TM -T0P0 TA Cloning Kit included in the OptiCHO TM Antibody Express Kit (Cat no. 12762-019) of Invitrogen, pcDNA. DNA fragment comprising L3-1-derived CDR-L3 (SEQ ID NO: 58.
  • the constructed vectors were each amplified using a Qiagen Maxiprep kit (Cat no. 12662).
  • Ad hoc expression was performed using the Freestyle TM MAX 293 Expression System (invitrogen).
  • the cell line used was 293 F cells, and was cultured by suspension culture using FreeStyle TM 293 Expression Medium as a medium.
  • the cells were prepared at a concentration of 5xl0 5 cells / ml one day before the temporary expression, and after 24 hours, the cells were temporarily expressed when the number of cells reached lxl0 6 cells / ml.
  • the cultured cells were centrifuged to take 100 ml of each supernatant, and purified using AKTA Prime (GE heal thcare). After installing a Protein A column (GE healthcare. 17-0405—03) on the AKTA Prime and pouring the culture medium at a flow rate of 5 nil / min. Eluted with IgG el Lit ion buffer (Thermo Scientific, 21004).
  • An antibody consisting of a heavy chain consisting of a heavy chain variable region of huAbF46-H4-Al, a U6-HC7 hinge and a human IgGl constant region, and a light chain consisting of a light chain variable region of huAbF46-H4—A1 and a human kappa constant region were selected from huAbF46 ⁇ with H4-Al (U6-HC7); huAbF46-H4— heavy chain variable region of A1.
  • An antibody consisting of a heavy chain consisting of a heavy chain variable region of huAbF46-H4-Al, a human IgG2 hinge and a human IgG2 constant region, and a light chain consisting of a light chain variable region of huAbF46-H4-Al and a human kappa constant region was selected from huAbF46 ⁇ H4- Each named Al (IgG2 Fc).
  • the three antibodies were replaced with tyrosine (tyros ine) all the histidine (hi st i dine) of the light chain consisting of the human kappa constant region 36 to
  • the DNA fragment containing the nucleotide sequence corresponding to the heavy chain was added to the pOpt iVEC TM -T0P0 TA Cloning Kit included in the OptiCHO TM Antibody Express Kit (Cat no. 12762-019) of Invitrogen, pcDNA TM 3.3-T0P0 TA
  • a DNA fragment containing a nucleotide sequence corresponding to the light chain was inserted into a cloning kit (Cat no. 8300-01) to construct a vector for expression of the antibody.
  • the constructed vector was amplified using Qiagen Max i prep kit (Cat no. 12662), respectively, and the temporary expression was performed using the Freestyle TM MAX 293 Expression System (invitrogen).
  • the cell line used was 293 F cells, and cultured by suspension culture using FreeStyle TM 293 Expression Medium as a medium.
  • One day before the temporary expression cells were prepared at a concentration of 5xl0 5 cells / i, and after 24 hours, the cells were temporarily expressed when the number of cells reached lxl0 6 cel ls / ml.
  • Transfect ion was introduced into lipos using Freestyle TM MAX reagent (invi trogen) by lal reagent method.
  • AKTA Prime AKTA Prime
  • Protein A column (GE healthcare, 17-0405-03) was installed in AKTA Prime, and the culture solution was eluted with IgG elution buffer (Thermo Scientific, 21004) after the culture solution was poured at a flow rate of 5 nil / min. This was exchanged with PBS buffer for the final three antibodies 0111/1 4641 ⁇ 4- / 1 6-7).
  • huAbF46-H4-Al IgG2 hinge
  • huAbF46-H4-Al IgG2 Fc
  • huAbF46-H4-Al (IgG2 Fc) was selected for the anti-c-Met antibody according to the present invention and used in the following examples, and for convenience, the antibody was named as anti-c-Met antibody SAIT301.
  • Reference Example 2 Preparation of Anti-Nrpl Antibody
  • scFv antibody fragments that bind to human Nrpl were identified through phage display screening.
  • 4 sub-library samples were collected in 400m (! B) (SB / Ampicillin / Glucose). After incubation at 600 ° C., the absorbance at 0.5-0.7 was centrifuged at 5000 g for 20 minutes to remove supernatant and then suspended in 400 ⁇ (secondary culture medium (SB / Ampicillin).
  • helper phage 12 pfu (plaque forming unit) of helper phage (VCSM13; Stratagene) was added and incubated for 1 hour, followed by 30 ° C after addition of 70 // g / nie of kanamycin antibiotic (antibiotic gene introduced into helper phage). Phage library was secreted outside the host cell by overnight incubation in C. The culture obtained by centrifugation was then precipitated only by phage form using polyethylene glycol (PEG) solution to obtain a phage library. The.
  • PEG polyethylene glycol
  • 131 cells and phages were placed in a T flask using NBA 5 nie, previously placed in an incubator at 37 ° C, incubated for 30 minutes at 37 ° C, and the phage particles adhered to the cell surface were internalized. It was induced to enter the cell.
  • the cell debris was separated by centrifugation at 12,000 rpm for 5 minutes and the supernatant containing the phage particles in the cells was collected in 1 in.
  • the cells were placed in a culture medium (SB) of 8.5 m (SB) containing pre-grown ER2537, and cultured at 120 rpm at 37 ° C to infect the E. coli host ER2537.
  • SB culture medium
  • the submerged ER2537 was mixed with culture medium (SB) 500 ⁇ , and then plated in 15 cm culture medium and 5 SB culture medium (50% glycerol) was added to recover colonies. And storage (-80 ° C).
  • Phage particles recovered in the third round of cell panning were used to infect host cells (ER2537). Through colonies in the culture medium was confirmed. These colonies were taken and inoculated in 96-well plates containing 200 ⁇ SB / ampicillin culture medium and incubated at 37 ° C. for 2-3 hours.
  • each well was treated with IPTGdsopropyl ⁇ -D-1-thiogalactopyranoside at a final concentration of 1 niM and incubated overnight at 30 ° C.
  • the cultured plate was centrifuged at 3.000 rpm for 15 minutes to remove supernatant, and then 40 ⁇ TES solution (20% w / v sucrose, 50 mM) per well to recover phage particles in cultured periplasm.
  • Tris. 1 niM EDTA. PH 8.0 was added and the cells were lysed by standing at 4C for 30 minutes. Thereafter, the cells were treated with 60 / 0.2X TES solution for 30 minutes at 4 ° C. to decompose cells by osmotic pressure, and the plate was centrifuged for 15 minutes at 3,000 rpm to obtain supernatant scFv-pm protein.
  • the total number of clones analyzed was 384, and 41 of these clones (binding capacity> 2) showed high binding capacity to human Nrpl. BSA solution was used as a control. Of these 41 clones, 10 clones with high binding capacity were selected by reconfirmation ELISA. Thereafter, phagemids were recovered from 10 clones, followed by DNA sequencing, and clones having a total of six different sequences were selected. Clones with different sequences were selected, except 3H10ol, which was the same sequence as 1C08. Finally 3H10, 1A03 and 4F12 clones were selected as anti-Nrpl scFv candidates. CDR amino acid sequence of the selected 3H10, 1A03 and 4F12 clones. Variable region amino acid sequences and DNA sequences encoding the same are shown in Tables 5 and 6.
  • the basic composition of phagemid can be confirmed in FIG. 2, and in the case of the host cell ER2537 used in the above example, scFv expression alone is not possible because it inhibits the transcriptional inhibition codon (amber codon (UAG)) located in front of the phage ⁇ .
  • the expression strain TOP10F '; non-suppressor strain
  • Thermo Thermo sher Phagemid was transduced into the expression strain. after. Through DNA sequencing, each phagemid was identified as an expression strain introduced without mutation, and the expression strain was taken as colonies, and then cultured at 37 ° C overnight after inoculation into LB / ampicillin culture medium 3.
  • 3 niC of cultured at night 3 ⁇ 4 were transferred to 400 mi culture medium (SB / Ampicillin) and cultured at 0.D 600 until 0.5-0.7, and cultured overnight at 30 ° C. with a final concentration of 1 mM IPTG. It was. After centrifugation, the culture host was dissolved using 40 m of TES solution (i, and 0.2X TES 60 ⁇ was added to recover phage particles in the periplasm. The recovered supernatant was filtered through a 0.45 iM filter.
  • the scFv protein present in the filtered solution was combined with Ni-NTA bead (Qiagen) l nit 'for 1 hour at room temperature for His-tag purification, and then packed in a gravity column (Bio-rad). Recovery was carried out through a 200 ⁇ imidazole solution, and after expression and purification of each clone, SDS-PAGE and coomassie blue staining confirmed scFv equivalent size of about 28 kDa (FIG. 3).
  • ELISA was performed using the purified scFv to determine whether binding ability to the target Nrpl is present.
  • (Repeated ELISM 3 times) was bound to 96 wells coated with 200 ng Nrpl protein and 96 wells coated with 200 ng BSA control group at a level of 5 ⁇ g / mC per clone for 1 hour at room temperature. Thereafter, washing with 0.1% TBST three times, followed by treatment with HRP-bound HA antibody for 1 hour, washing again, and then standing for 5 minutes with TMB solution. Then, 0D value was measured after stopping the color reaction with 2M sulfuric acid solution. The obtained result is shown in FIG. As shown in FIG. 4.
  • Specific antibodies were prepared.
  • the production process is as follows. First, the heavy chain portion of the SAIT301 antibody used for the bispecific antibody cloning was prepared as follows. The heavy chain coding sequence of the anti-c-Met antibody was synthesized by deleting the C-terminal sequence from position 1396 of SEQ ID NO: 67 and injecting ggcggtggtggttccggaggcggcggatcc instead (Bionia).
  • the DNA 3 ⁇ 4 fragment was ligated to pOpt i VEC TM -T0P0 TA Cloning vectoi ⁇ included in the OptiCHOTM Antibody Express Kit (Cat no. 12762-019) manufactured by Iiwitrogen.
  • Three anti-Nrpl scFv heavy- and light-chain variable regions of the anti-Nrpl scFv were prepared by linking with a peptide linker (G 4 S) 2 (synthesis by bionics; N-terminal BamHI restriction enzyme recognition site and C -terniinal Xhol restriction enzyme recognition site).
  • the anti-Nrpl scFv prepared above was cloned into a vector containing a previously prepared SAIT301 portion to construct an expression bag comprising the heavy chain of the bispecific antibody.
  • the heavy chain of the constructed bispecific antibody (the C terminus of the heavy chain of the anti-c-Met antibody and the N terminus of the anti-Nrpl scFv (3H10, 1A03 or 4F12) are connected by (G 4 S) 2 linker)
  • the amino acid sequences are shown in SEQ ID NOs: 142 to 144, respectively,
  • DNA sequences are shown in SEQ ID NOs: 145-147, respectively.
  • the light chain coding nucleotide sequence of the anti-c-Met antibody was synthesized to have the nucleotide sequence of SEQ ID NO: 69 (Bionia).
  • PcDNA TM 3.3-T0P included in Invitrogen's OptiCHO TM Antibody Express Kit (Cat no. 12762-019)
  • a DNA fragment containing the nucleotide sequence corresponding to the light chain was inserted into a TA cloning vector (Cat no. 8300-01) to construct a vector expressing the light chain (SEQ ID NO: 68) of the bispecific antibody.
  • the constructed heavy chain expression vector and light chain expression vector were amplified using Qiagen Max i prep kit (Cat no. 12662), respectively, and the temporary expression was FreestyleTM MAX.
  • 293 Expression System (invi trogen) was used.
  • the cell line used is 293F cell.
  • FreeStyle TM 293 Expression Medium was used to culture the cells in suspension culture. Cells one day before the temporary expression
  • anti-c-Met / anti-Nrpl bispecific antibodies in which three anti-Nrpl scFvs were fused to the c ′ terminal of the anti-c-Met antibody SAIT3 () 1 prepared above are summarized in Table 7 below.
  • the affinity for c-Met of the three anti-c-Met / anti-Nrpl bispecific antibodies prepared in Example 1 was confirmed using Biacore TIOO (GE), respectively.
  • Human Fab binder (# 28-9583-25. GE Healthcare) was immobilized on the surface of the CM5 chip (# BR-1005-30, GE) according to the manufacturer's instructions.
  • About 90 120 RU of bispecific antibody MA01 was captured and various concentrations of C- Met-Fc (# 358-MT / CF. R & D Systems) were injected into the captured antibody.
  • the surface was regenerated by injecting a 100 mM solution of Glycine-HCKpH 1.5).
  • the data obtained in the above experiments were fitted using a BIAevaluation softvvare (GE Healthcare, Biacore T100 evaluation software).
  • Nrpl of the three anti-c-Met / anti-Nrpl bispecific antibodies prepared in Example 1 was confirmed using Biacore T100 (GE), respectively.
  • Anti-histidine antibody R & D Systems
  • C-terminal hi st idine-tagged human Nrpl R & D Systems
  • the surface was regenerated by injecting a lOniM Glycine-HCl (pH 1.5) solution.
  • affinity The data obtained in this experiment were fitted using a BIAevaluation soft ware (GE Healthcare. Biacore T100 evaluation software).
  • KD against c-Met ' is the binding affinity for c-Met of the double antibody.
  • KD against Nrpl is the binding affinity for Nrpl of the double antibody.
  • KD against Nrpl, scFv,' ' Denotes the binding affinity for Nrpl of anti-Nrpl scFv, respectively.
  • Example 3 Effect of Anti-c-Met / Anti-Nrpl Bispecific Antibody on Cancer Cell Growth Inhibition of cancer cell killing effect of the anti-c-Met / anti-Nrpl bispecific antibody prepared in Example 1 of gastric cancer cell line MKN45 was tested.
  • MKN45 cells JCRB0254
  • a medium GIBCO RPMI 1640, lOOul / well
  • the three bispecific antibodies prepared in Example 1 were each 60 nM (l). treatment for 5 days).
  • Cell number change was measured by CellTiter Glo (CTG) assay.
  • CTG CellTiter Glo
  • 100 microliters of CTG solution iega to Pr
  • the antibody control group control
  • the anti-c-Met antibody SAIT301 alone treatment group 60nM
  • the anti-Nrpl antibody alone treatment group (1A: 1A03 clone of Reference Example 2.2
  • 4F IgG antibody comprising 6 CDRs of 4F12 clone of Reference Example 2.2; 60 nM each
  • the combination of anti-_c- Met antibody SAIT301 and anti-Nrpl antibodies (1A, 3H, 4F) (60 nM, respectively) produced in Reference Example 1 were also performed.
  • anti-c-Met / anti-Nrpl-specific antibodies have better anti-cancer cell growth inhibitory effects than anti-c-Met antibody alone and anti-Nrpl antibody alone as well as combination thereof. You can see that.
  • Example 4 Inhibition of Cancer Cell Metastasis by Anti-c-Met / Anti-Nrpl Bispecific Antibodies Observed the effect of anti-c-Met / anti-Nrpl bispecific antibodies on cancer cell motility It was. The inhibitory effect on cancer cell migration by VEGF + HGF treatment of the bispecific antibody was tested.
  • a renal cancer cell line 786-0 (ATCC) having anti- C- Met antibody SAIT30H1 resistance prepared in Reference Example 1 was used (no anticancer effect when treated with SAIT301 alone).
  • a niigrat ion assay was performed using Oris Migration System (Platypus Thechnologies).
  • kidney cancer cell line 786-0 (ATCC) was inoculated in a 96-well plate equipped with a stopper in an amount of 5 000 per well. After incubation for 24 hours. The stopper was removed and each bispecific antibody prepared in Example 1 above (60 nM each) in RPMI medium (containing 10% FBS: GIBC0) with 0.1 ug (microgram) / ml HGF and 0.1 ug / ml VEGF added Treated for 24 hours. The cells were then visualized by treatment with Hoechst 33.342 (bisbenzimide; Life Technologies). Cell niigrat ions were measured by counting cells with nuclei stained with Hoechst 33342. Cell number measurement was performed using InCell Analyzer 6000 (GE Healthcares), and the results obtained were converted to relative values for the group treated with VEGF + HGF only (100 «).
  • the antibody-free group (vehicle only. HGF only, VEGF only. And VEGF + HGF only), the anti-c-Met antibody SAIT301 alone treatment group (60nM) prepared in Reference Example 1 above, The same test was also performed on the single treatment group (60 nM) of each of the anti-Nrpl antibodies comprising the six CDR3s of the clones prepared in Reference Example 2.2.
  • FIG. 7 The obtained visualization result (fluorescence image) is shown in FIG. 7, and a graph quantifying the fluorescence intensity of FIG. 7 is shown in FIG. 8.
  • Figs. 7 and 8 wherein -c-Met / anti - Nrpl bispecific antibodies is by the SAIT301 and wherein -Nrpl antibody ⁇ comparison with each single treatment, the cell migration by HGF + VEGF (migration ) It showed an excellent synergistic effect on inhibition.
  • BioCoat Growth Factor Reduced MATRIGEL Invasion Chamber (BD science. Cat #. 354483) was used. The burr is divided into an upper chamber and a lower chamber. The upper chamber was used coated with collagen according to the manufacturer's manual.
  • Kidney cancer cell line 786-0 (ATCC: 10 5 cells / well) was inoculated into the upper chamber.
  • the lower chamber was treated with each bispecific antibody (60 nM each) prepared in Example 1 and then incubated at 37 ° C.
  • the lower burrs were added with VEGF or HGF in an amount of 0.1 ug / ml, respectively.
  • Cells penetrated through the collagen layer of the upper chamber and transferred to the lower burrs were stained with calcein AM (BD) and observed with a fluorescence microscope (ZEISS), and the fluorescence intensity was quantified with an Envision 2104 Multi-label Reader (Perkin Elmer).
  • the antibody-free group (treated only with VEGF + HGF), the anti-c-Met antibody SAIT301 alone treated group (60 nM) prepared in Reference Example 1 above, and the six CDR3s of the clones prepared in Reference Example 2.2 above
  • the same test was performed for the single treatment group (60 nM) of each of the anti-Nrpl antibodies comprising.
  • Kidney cancer cell line 786-0 resistant to the anti-c-Met antibody SAIT3 () 1 prepared in Reference Example 1 was used (SAIT301 alone). No anticancer effect upon treatment).
  • the bispecific antibody prepared in Example 1 to 5000 cells were each treated at a concentration of 60 nM, and after 3 days, cell number change was measured by CellTiter Glo assay.
  • Example 5 Anticancer Resistance Overcoming Test with Anti-c-Met / Anti-Nrpl Bispecific Antibody
  • Gemcitabine-resistant MKN45 (labeled 'MIiN45-Gem Re') was prepared by repeatedly administering gemcitabine to gastric cancer cell line MKN45.
  • the MKN45-Gem Re cells were prepared by the following procedure. MICN45 cells (ATCC) were exposed to jamcytabine (Eli Lilly) for 3 months. At this time, gemcitabine was treated with increasing concentration in the concentration range of 10 to 100 ⁇ M (i vitro). In order to confirm whether the treated cells have a continuous resistance to gemcitabine, by measuring the cell viability in the group incubated for 2 weeks without treatment with the group treated with gemcitabine for 2 weeks, It was confirmed that the cells showed an equivalent degree of cell survival regardless of gemcitabine treatment.
  • MKN45 cells ATCC; no resistance; labeled 'parental'.
  • the prepared gemcitabine resistant cell line MKN45-Gem Re at 60 ⁇ l plates at a concentration of 2xl0 5 cells / niL, respectively, and cell proteins were extracted through lysis buffer (Roche) after 24 hours. 20ug of extracted cell protein was loaded onto Western blot gel After Western Blot. Each protein was detected using anti-c-Met antibody (abeam), anti-Nrpl antibody (Cell signaling), anti-p-Akt antibody (Cell signaling), and anti-GAPDH antibody (Cell signaling), respectively.
  • Example 3 5000 MKN45 and MKN45-Gem Re cells were prepared, respectively, and the bispecific antibodies prepared in Example 1 were respectively 0.2. Cell number change was measured by CellTiter Glo assay after 3 days of treatment at 1, or 5 ug / niL concentration.
  • anti-c—Met / anti-Nrpl bispecific antibody showed better cell proliferation inhibitory effect in both MKN45 and M1 (N45-Gem Re cells) than SAIT301 alone.
  • -c-Met / anti- Nrpl bispecific antibody showed an excellent effect of overcoming the anticancer drug resistance.
  • each anti-Nrpl antibody comprising six CDRs of the group treated with PBS, the SAIT301 antibody prepared in Reference Example 1 and the clone made in Reference Example 2.2
  • the same test was performed for the group treated with.
  • the obtained Western blot results are shown in FIG. 14.
  • the anti-c-Met / anti-Nrpl bispecific antibody treatment was applied to MKN45-Gem Re cells, the total amount of c-Met and Nprl was significantly reduced compared with the anti-c-Met antibody and anti-Nrpl antibody treatment. This shows that the double antibody has the internalization and degradation effect of the antigen.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

항-c-Met 항체 또는 이의 항원 결합 단편 및 항-Nrp1 항체 또 항원 결합 단편을 포함하는 항-c-Met/항-Nrp1 이중 특이 항체, 및 이를 포함하는 약학적 조성물이 제공된다.

Description

【명세서】
【발명의 명칭】
항 -c-Met/항 -Nrpl 이중 특이 항체 【기술분야】
항 -c-Met 항체 또는 이의 항원 결합 단편 및 항 -Nrpl 항체 또는 이의 항원 결합 단편을 포함하는 항 -c-Met/항 -Nrpl 이중 특이 항체, 및 이를 포함하는 약학적 조성물이 제공된다. 【배경 기술】
뉴로필린 (Neuropilin; Nrp)은 뉴런에서 활성을 띠는 단백질 수용체로서. Nrpl과 Nrp2의 두 가지 종류가 있다. Νι·ρ1은 약 923개의 아미노산으로 구성되며, Nrp2는 약 926개의 아미노산으로 구성되고. 공통적으로 유사한 도메인 구조를 갖고 있으며 . 전체적으로 44 의 아미노산 상동성을 갖는다고 알려져 있다.
이 중에서 Nrpl은 처음에 축삭 유도를 조절하기 위해 플렉신 보조- 수용체와 작용하는, 세마포린 3A 리간드에 결합하는 수용체이다. Nrpl은 혈관 내피 성장인자 (VEGF)에 결합하여 혈관 발생을 매개한다. Nrpl은 다양한 종류의 인간 종양 세포주 및 인간 종양 (교모세포종, 성상세포종. 신경교종, 신경아세포종. 고환암. 대장암, 혹색종, 췌장암. 폐암. 유방암. 식도암 및 전립선암 등)에서 발현되며. VEGF 및 세마포린의 암세포의 증식, 생존 및 이동에 미치는 영향에 관여한다. 또한, Nrpl 발현 정도에 따라 암 진행 정도가 증가하거나. 암환자의 예후가 좋지 않은 것으로 알려져 있다.
한편. c-Met 은 세포 표면에 존재하는 대표적인 RTK (Receptor Tyrosine Kinase)로써 . 그 리간드인 HGF/SF (Hepatocyte Growth Factor/Scattering Factor)와 결합하여 세포 내 신호전달을 촉진시켜 세포의 성장을 촉진할 뿐 아니라 많은 종류의 암세포에 과 발현되어 암 발생. 암 전이 암세포 이동, 암세포 침투. 신생 혈관 형성에도 광범위하게 관여한다. 또한. HGF/SF를 통한 c-Met signaling은 거의 모든 종류의 epithelial tumor의 cell- cell contact를 약화시켜 scattering을 야기하는 대표적인 암 전이 초기단계의 단백질이다.
따라서 . Nrpl와 C— Met을 동시에 표적한다면, 암세포의 성장과 전이를 보다 효과적으로 억제할 수 있을 것이며 , 이러한 이유로 Nrpl와 c-Met을 동시에 표적하는 약물의 개발이 요구된다.
【발명의 내용】
【해결하려는 과제】
일 예는 항 -c-Met 항체 또는 이의 항원 결합 단편 및 항 -Nrpl 항체 또는 이의 항원 결합 단편을 포함하는 항 -c-Met/항 -Nrpl 이중 특이 항체를 제공한다.
상기 항 -c-Met 항체 또는 이의 항원 결합 단편은 c-Met 단백질의 SEMA 도메인 내의 "EEPSQ' '를 포함하는 연속하는 5개 이상의 아미노산으로 이루어진 에피토프에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편이다.
다른 예는 상기 항 -c-Met/항 -Nrpl 이증 특이 항체를 유효성분으로 포함하는 약학적 조성물을 제공한다.
다른 예는 항 -c-Met/항 -Nrpl 이중 특이 항체의 약학적 유효량을 환자에게 투여하는 단계를 포함하는. c-Met 및 /또는 Nrpl의 과생산 (예컨대, 과발현) 및 /또는 비정상적 활성화와 관련된 질병의 예방 및 /또는 치료 방법을 제공한다.
상기 항 -c-Met/항 -Nrpl 이중 특이 항체. 약학적 조성물. 또는 방법은 c-Met 및 /또는 Nrpl의 과생산 (예컨대. 과발현) 및 /또는 비정상적 활성화와 관련된 질병 . 예컨대 암 또는 암 전이의 예방 및 /또는 치료에 사용될 수 있다. 상기 암은 항암제에 대하여 저항성을 갖는 암일 수 있다.
다른 예는 상기 항 -c— Met/항 -Nrpl 이중 특이 항체를 유효성분으로 포함하는 항암제 저항성 극복을 위한 약학적 조성물을 제공한다.
다른 예는 항 -c-Met/항 -Nrpl 이중 특이 항체의 약학적 유효량을 환자에게 투여하는 단계를 포함하는. 항암제 저항성 극복 방법을 제공한다. 다른 예는 상기 항 -c-Met/항 -Nrpl 이중 특이 항체의 항암제 저항성 극복을 위한 용도를 에공한다. 【과제의 해결 수단】
c-Met은 세포 표면에 존재하는 대표적인 RTK (Receptor Tyrosine Kinase)로서, 세포 성장, 암 발 , 암 전이 그리고 신생 혈관 형성 등에 관여하는 것으로 알려져 있다. Nrpl역시 세포성장, 암 전이 , 신생 혈관 형성 등에 역할을 하는 것으로 알려져 있다.
따라서, 본 명세서에서는 C— Met 과 Nrpl을 동시에 표적 하여, 항암 및 /또는 암의 항전이 효과가 증진됨을 제안한다.
또한. 암 세포 성장에 관여하는 c-Met과 Nrpl을 동시에 타겟함으로서. 기존의 항암제에 대하여 선척적 저항성 (innate resistance) 및 /또는 획득 저항성 (acquired resistance)를 보이는 암에서 저항성을 극복할 수 있음을 제안한다.
우선, 일 예는 항 -c-Met 항체 또는 이의 항원 결합 단편 및 항 -Nrpl 항체 또는 이의 항원 결합 단편을 포함하는 항 -c-Met/항 -Nrpl 이증 특이 항체를 제공한다. 상기 이중 특이 항체는 c-Met과 Nrpl을 동시에 인지하고 결합하여 기능을 저해함으로써 상승된 항암 효과 및 /또는 암 전이 저해 효과를 발휘할 수 있다.
본 발명에서 "항체 "라 함은, 면역계 내에서 항원의 자극에 의하여 만들어지는 물질을 의미하는 것으로서, 생체 내에서 생성된 것. 재조합적으로 생성된 것. 또는 인공적으로 합성된 것일 수 있으며 , 그 종류는 특별히 제한되지 않는다. 본 발명에서 항체는 동물 항체. 키메릭 항체, 인간화 항체, 또는 인간 항체를 모두 포함한다. 또한 본 발명에서 항체란 항원 결합능을 보유한 항체의 항원 결합 단편도 포함한다. 한편. "상보성 결정 영역 (Complementarity-determining regions. CDR)' '라 함은, 항체의 가변 영역 중에서 항원과의 결합 특이성을 부여하는 부위를 의미한다. "항원 결합 단편"은 상기 상보성 결정 영역을 하나 이상 포함하는 항체 단편. 예컨대, scFv, (scFv)2, scFv-Fc . Fab. Fab' 및 F(ab')2로 이루어진 군에서 선택되는 것일 수 있다.
하기하는 항 -c-Met 항체 또는 이의 항원 결합 단편과 항 -Nrpl 항체 또는 이의 항원 결합 단편의 설명에서, 중쇄 CDR 및 경쇄 CDR 부위, 또는 중쇄 가변 영역 및 경쇄 가변 영역을 제외한 나머지 부위는 모든 서브타입의 면역글로불린 (예컨대, IgA, IgD, IgE, IgG (IgGl, IgG2, IgG3. IgG4), Ig , 등)으로부터 유래한 것일 수 있고. 예컨대, 상기 모든 서브타입의 면역글로불린의 경쇄 불변 영역 및 /또는 중쇄 불변 영역으로부터 유래한 것일 수 있다.
본 발명에서 제공되는 이중 특이 항체의 하나의 표적인 "c-Met"은 간세포 성장 인자와 결합하는 수용체 티로신 키나제를 의미한다. 상기 c-Met 단백질은 모든 종에서 유래하는 것일 수 있으며, 예컨대, 인간 c-Met (예컨대, NP_000236.2), 원숭이 c-Met (예컨대, Macaca mulatta, NP— 001162100) 등과 같은 영장류 유래의 것. 또는 마우스 c-Met (예컨대, NP— 032617.2). 래트 C- Met (예컨대, NP— 113705.1) 등과 같은 설치류 유래의 것 등일 수 있다. 상기 단백질은 예를 돌면, GenBank Aceession Number NM_000245.2에 제공된 뉴클레오타이드 서열에 의해 암호화된 폴리펩타이드, 또는 GenBank Aceession Number NM_000236.2에 제공된 아미노산 서열을 갖는 단백질. 또는 그의 세포외 도메인을 포함한다. 수용체 티로신키나제 c-Met은 예를 들면, 암발생, 암전이. 암세포 이동, 암세포 침투. 신생혈관 생성 과정 등의 여러 가지 기작에 판여한다.
본 발명에서 제공되는 이중 특이 항체의 또 다른 표적인 "Nrpl"은 혈관 내피 성장인자 (VEGF)에 결합하여 혈관 발생을 매개하며. 다양한 종류의 인간 종양 세포주 및 인간 종양 (교모세포종. 성상세포종, 신경교종, 신경아세포종, 고환암, 대장암, 혹색종, 췌장암, 폐암, 유방암. 식도암 및 전립선암 등)에서 발현되며 , VEGF 및 세마포린의 암세포의 증식 , 생존 및 이동에 미치는 영향에 관여한다. Nrpl은 인간, 원숭이 등의 영장류, 래트, 마우스 등의 설치류를 포함하는 포유류 유래의 것일 수 있으며, 예컨대, 인간 유래의 Human Nrpl (아미노산 서열: NCBI Accession # NP— 001019799.1: 코딩 폴리뉴클레오타이드 서열: NCBI Accession # NM_001024628.2; 등), 마우스 유래의 Mouse Nrpl (아미노산 서열: Accession # NP— 032763.2; 코딩 폴리뉴클레오타이드 서열: NCBI Accession # NM_008737.2; 등) 등일 수 있다.
본 명세서에서 제공되는 이중 특이 항체에 포함된 항 -Nrpl 항체 또는 이의 항원 결합 단편은 세포 (예컨대, 암세포) 표면에 발현된 Nrpl에 결합 후 내재화 (internalizing)되는 특성을 갖는다. 하기 실시예에서는 본 발명의 항- Nrpl 항체가 암세포 표면에 발현된 Nrpl에 결합된 후, 세포 안으로 내재화됨을 확인하였다. 세포 표면의 Nrpl에 결합하여 해당 부위의 하위 신호전달을 차단하는 기존의 항체와 달리. 본 명세서에서 제공되는 항체는 세포 표면의 Nrpl에 결합하여 세포 내로 들어가기 때문에, 세포 표면에 존재하는 Ni-pl의 절대적인 양을 감소시킬 수 있고. Nrpl과 관련된 모든 신호전달을 차단할 수 있어 . 기존의 항체보다 더 큰 치료효과를 기대할 수 있다.
상기 항 -Nrpl 항체 또는 이의 항원 결합 단편은,
서열번호 139의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-H1), 서열번호 140의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-H2). 및 서열번호 141의 아미노산 서열을 포함하는 폴리펩타이드. (CDR-H3)로 이루어진 군에서 선택된 하나 이상을 포함하는 중쇄 (Heavy chain) 상보성 결정 부위 (complementarity determining region, CDR) , 또는 상기 중쇄 상보성 결정부위를 포함하는 중쇄 가변 영역 :
서열번호 142의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-L1). 서열번호 143의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-L2), 및 서열번호 144의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-L3)로 이루어진 군에서 선택된 하나 이상을 포함하는 경쇄 (Light chain) 상보성 결정부위, 또는 상기 경쇄 상보성 결정부위를 포함하는 경쇄 가변 영역;
상기 하나 이상의 중쇄 상보성 결정부위 및 하나 이상의 경쇄 상보성 결정부위의 조합 ; 또는
상기 증쇄 가변 영역 및 경쇄 가변 영역의 조합
을 포함하는 것일 수 있다:
[서열번호 139]
Xaal Tyr Xaa2 Met Ser (Xaal은 Ser 또는 Gly, Xaa2는 Tyr 또는 Ala) [서열번호 140]
Xaa3 lie Ser Pro Gly Ser Xaa4 Xaa5 Xaa6 Tyr Tyr Ala Asp Ser Val Xaa7 Gly (Xaa3은 Ala 또는 Gly. Xaa4는 Gly 또는 Ser, Xaa5는 Ser 또는 Asn, Xaa6은 Thr 또는 Lys. Xaa7은 Gin 또는 Lys)
[서열번호 141]
Arg Lys Xaa8 Xaa9 Phe Asp Tyr (Xaa8은 Thr, Lys. 또는 Tyr. Xaa9는 Arg. Ser , 또는 Met)
[서열번호 142]
XaalO Gly Xaall Ser Ser Asn lie Gly Asn Asn Xaal2 Val Xaal3 (XaalO은 Ser 또는 Thr, Xaall은 Pro 또는 Ser, Xaal2는 Ser 또는 Asp, Xaal3은 Ser 또는 Tyr)
[서열번호 143]
Xaal4 Xaal5 Xaal6 Xaal7 Arg Pro Ser (Xaal4는 Ser 또는 Ala, Xaal5는 Asp 또는 Asn, Xaal6은 Asn 또는 Ser, Xaal7은 Asn 또는 Lys)
[서열변호 144]
XaalS Xaal9 Trp Xaa20 Xaa21 Ser Leu Xaa22 Xaa23 Tyr Val (Xaal8은
Ala 또는 Gly, Xaal9는 Ala 또는 Ser, Xaa20은 Asp 또는 Val, Xaa21은 Ser 또는 Ala, Xaa22는 Asn 또는 Ser Xaa23은 Gly 또는 Ala).
보다 구체적으로, 상기 항— Nrpl 항체 또는 이의 항원 결합 단편은 서열번호 110 또는 121의 아미노산 서열을 포함하는 플리펩타이드 (CDR- HI). 서열번호 111, 116, 또는 122의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-H2), 및 서열번호 112. 117 또는 123의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-H3)로 이루어진 군에서 선택된 1종' 이상을 포함하는 중쇄 상보성 결정 부위, 또는 상기 중쇄 상보성 결정부위를 포함하는 중쇄 가변부위; 및 /또는
서열번호 113. 118, 또는 124의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-L1), 서열번호 114, 119, 또는 125의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-L2), 및 서열번호 115, 120, 또는 126의 아미노산 서열을 포함하는 폴리펩타이드 (CDR— L3)로 이루어진 군에서 선택된 1종 이상을 포함하는 경쇄 상보성 결정부위 . 또는 상기 경쇄 상보성 결정부위를 포함하는 경쇄 가변부위
를 포함하는 것일 수 있다.
구체적으로, 항 -Nrpl 항체 또는 이의 항원 결합 단편의 상보성 결정 부위는 예컨대 다음의 표 1의 아미노산 서열을 갖는 것일 수 있다. 【표 1】
Figure imgf000008_0001
일 예에서. 상기 항 -Nrpl 항체 또는 이의 항원 결합 단편은
서열번호 127, 129, 또는 131의 아미노산 서열을 포함하는 가변영역 ;
서열번호 128. 130, 또는 132의 아미노산 서열을 포함하는 경쇄 가변영역; 또는
이들의 조합
을 포함하는 것일 수 있다.
일 구체예에서. 상기 항 -Nrpl 항체 또는 이의 항원 결합 단편은, 서열번호 110 (CDR-H1), 111 (CDR-H2), 112 (CDR-H3). 113 (CDR-L1),
114 (CDR-L2), 및 115 (CDR-L3)의 아미노산 서열을 포함하거나,
서열번호 110 (CDR-H1), 116 (CDR-H2), 117 (CDR-H3), 118 (CDR-L1),
119 (CDR-L2), 및 120 (CDR-L3)의 아미노산 서열을 포함하거나,
서열번호 121 (CDR-H1). 122 (CDR-H2), 123 (CDR-H3). 124 (CDR-L1),
125 (CDR-L2), 및 126 (CDR— L3)의 아미노산 서열을 포함하는 것일 수 있다. 다른 예에서, 상기 항 -Nrpl 항체 또는 이의 항원 결합 단편은, 서열번호 127의 중쇄 가변영역 및 서열번호 128의 경쇄 가변영역을 포함하거나,
서열번호 129의 증쇄 가변영역 및 서열번호 130의 경쇄 가변영역을 포함하거나.
서열번호 131의 중쇄 가변영역 및 서열번호 132의 경쇄 가변영역을 포함하는 것일 수 있다.
상기 항 -c-Met 항체는 c-Met의 특정 부위, 예컨대 SEMA 도메인 내의 특정 부위를 에피토프로 인식하는 것일 '수 있으며, c-Met에 작용하여 세포내이동 (internalization) 및 분해 (degradat ion)를 유도하는 모든 항체 또는 그의 항원 결합 단편일 수 있다.
HGFCHepatocyte growth factor)의 수용체인 c-Met은 세포외 부위, 막투과 부위. 세포내 부위의 세 부분으로 구분되며, 세포외 부위의 경우. 이황화 결합에 의해 α-소단위체와 β-소단위체가 연결된 형태로 HGF 결합 도메인인 SEMA 도메인, PSI 도메인 (plexin-semaphorins-integrin homology domain) 및 IPT 도머 1인 ( inimunoglobulir like fold shared by p 1 e ί ns and transcriptional factors domain)으로 이루어진다. c-Met 단백질의 SEMA 도메인은 서열번호 79의 아미노산 서열을 포함하는 것일 수 있으며 . C— Met의 세포외 부위에 존재하는 도메인으로서. HGF가 결합하는 부위에 해당한다. SEMA 도메인 증에서 특정 부위, 예컨대, 106번째부터 124번째까지에 해당하는 서열번호 기의 아미노산 서열을 포함하는 영역은 c— Met 단백질의 SEMA 도메인 내의 에피토프 중 2번과 3번 프로펠러 도메인 사이의 루프 (loop) 부위에 해당하며 , 본 발명에서 제안되는 항 -c-Met 항체의 에피토프로 작용할 수 있다. 용어, "에피토프 (epitope)' '는 항원 결정 부위 (antigenic determinant )로서. 항체에 의해 인지되는 항원의 일부분을 의미하는 것으로 해석된다. 일 구체예에 따르면, 상기 에피토프는 c-Met 단백질의 SEMA 도메인 (서열번호 79) 내의 연속하는 5개 이상의 아미노산을 포함하는 부위. 예컨대, c-Met 단백질의 SEMA 도메인 (서열번호 79) 내의 106번째부 '터 124번째까지에 해당하는 서열번호 71 내에 위치하는 연속하는 5개 내지 19개의 아미노산을 포함하는 것일 수 있다. 예컨대, 상기 에피토프는 서열번호 기의 아미노산 서열 중 서열번호 73(EEPSQ)을 포함하여 연속하는 5 내지 19개의 아미노산으로 이루어진 것일 수 있으며. 예컨대, 서열번호 71, 서열번호 72 또는 서열번호 73의 아미노산 서열을 포함하는 폴리펩타이드일 수 있다.
상기 서열번호 72의 아미노산 서열을 포함하는 에피토프는 c-Met 단백질의 SEMA 도메인 내의 2번과 3번 프로펠러 구조의 도메인 사이의 루프 부위 증 가장 바칼으로 위치한 부위에 해당하며 . 상기 서열번호 73의 아미노산 서열을 포함하는 에피토프는 일 구체예에 따른 항체 또는 항원 결합 단편이 가장 특이적으로 결합하는 부위이다. 따라서, 항 -c-Met 항체는 서열번호 서열번호 기의 아미노산 서열 중 서열번호 73( EEPSQ)을 포함하는 연속하는 5 내지 19개의 아미노산을 포함하는 에피토프에 특이적으로 결합하는 것일 수 있으며 , 예컨대, 서열번호 71 , 서열번호 72 , 또는 서열번호 73의 아미노산 서열을 포함하는 에피토프에 특이적으로 결합하는 항체 또는 항원 결합 단편일 수 있다.
일 구체예에 따르면, 상기 항 -c-Met 항체는.
서열번호 4의 아미노산 서열을 포함하는 CDR-H1 . 서열번호 5의 아미노산 서열, 서열번호 2의 아미노산 서열, 또는 서열번호 2의 아미노산 서열 내의 3번째부터 10번째까지의 아미노산을 포함하는 연속하는 8 내지 19개의 아미노산으로 이루어진 아미노산 서열을 포함하는 CDR-H2 , 및 서열번호 6의 아미노산 서열, 서열번호 85의 아미노산 서열, 또는 서열번호 85의 아미노산 서열 내의 1번째부터 6번째까지의 아미노산을 포함하는 연속하는 6 내지 13개의 아미노산으로 이루어진 아미노산 서열을 포함하는 CDR-H3으로 이루어진 군에서 선택된 하나 이상의 중쇄 상보성 결정 영역 (CDR ) , 또는 상기 하나 이상의 중쇄 상보성 결정 영역을 포함하는 중쇄 가변 영역;
서열번호 7의 아미노산 서열을 포함하는 CDR-L1 , 서열번호 8의 아미노산 서열을 포함하는 CDR-L2 , 및 서열번호 9의 아미노산 서열, 서열번호 15의 아미노산 서열. 서열번호 86의 아미노산 서열, 또는 서열번호 89의 아미노산 서열 내의 1번째부터 9번째까지의 아미노산을 포함하는 9 내지 17개의 아미노산으로 이루어진 아미노산 서열을 포함하는 CDR-L3으로 이루어진 군에서 선택된 하나 이상의 경쇄 상보성 결정 영역. 또는 상기 하나 이상의 경쇄 상보성 결정 영역을 포함하는 경쇄 가변 영역;
상기 하나 이상의 중쇄 상보성 결정 영역 및 상기 하나 이상의 경쇄 상보성 결정 영역의 조합; 또는
상기 중쇄 가변 영역 및 상기 경쇄 가변 영역의 조합
을 포함하고,
상기 서열번호 4 내지 서열번호 9는 각각 하기 일반식 I 내지 일반식 VI으로 표시되는 아미노산 서열인 항체 또는 항원 결합 단편일 수 있다:
일반식 I
Xaa厂 Xaa2-Tyr— Tyr-Met-Ser (서열번호 4 ) . 일반식 Π
Arg-Asn-Xaa3-Xaa4-Asn-Gly-Xaa5-Thr (서열번호 5),
일반식 m
Asp-Asn-Trp-Leu-Xaa6-Tyr (서열번호 6),
일반식 IV
Lys-Ser-Ser-Xaa7-Ser-Leu-Leu-Ala-Xaa8_Gly-Asn-Xaa9-Xaaio-Asn-Tyr- Leu-Ala (서열번호 7)
일반식 V
Trp-Xaan-Ser-Xaai2-Arg-Val-Xaai3 (서열번호 8)
일반식 VI
Xaai4-Gln-Ser-Tyr-Ser-Xaa15-Pro-Xaa16-Thr (서열번호 9)
상기 일반식 I에서 . 331은 존재하지 않거나 Pro 또는 Ser이고, Xaa2는 Glu 또는 Asp이며,
상기 일반식 Π에서 , Xaa3은 Asn 또는 Lys이며 , Xaa4는 Ala 또는 Val이고. Xaa5는 Asn 또는 Thr이며,
상기 일반식 m에서. Xaa6은 Ser 또는 Thr이고,
상기 일반식 IV에서. Xaa7은 His, Arg, Gin 또는 Lys이고, Xaa8은 Ser 또는 Trp이고. Xaa9은 His 또는 Gin이며, Xaa10는 Lys 또는 Asn이고.
상기 일반식 V에서, Xaan은 Ala 또는 Gly이며, Xaair& Thr 또는 Lys이고. 3313는 Ser 또는 Pro이며,
상기 일반식 VI에서 , 3314은 Gly. Ala 또는 Gin이고, 3315는 Arg, His, Ser, Ala, Gly 또는 Lys이며 , Xaai6는 Leu, Tyr , Phe 또는 Met이다.
일 구체예에서, 상기 CDR-H1은 서열번호 1, 서열번호 22, 서열번호 23 및 서열번호 24로 이루어진 군에서 선택된 아미노산 서열을 포함하는 것일 수 있다. 상기 CDR— H2는 서열번호 2. 서열번호 25, 및 서열번호 26으로 이루어진 군에서 선택된 아미노산 서열을 포함하는 것일 수 있다. 상기 CDR-H3는 서열번호 3, 서열번호 27, 서열번호 28, 및 서열번호 85로 이루어진 군에서 선택된 아미노산 서열을 포함하는 것일 수 있다.
상기 CDR-L1은 서열번호 10, 서열번호 29, 서열번호 30, 서열번호 31, 서열번호 32, 서열번호 33 및 서열번호 106으로 이루어진 군에서 선택된 아미노산 서열을 포함하는 것일 수 있다. 상기 CDR-L2는 서열번호 11, 서열번호 34, 서열번호 35. 및 서열번호 36으로 이루어진 군에서 선택된 아미노산 서열을 포함하는 것일 수 있다. 상기 CDR-L3은 서열번호 12, 서열번호 13, 서열번호 14, 서열번호 15. 서열번호 16, 서열번호 37. 서열번호 86. 및 서열번호 89로 이루어진 군에서 선택된 아미노산 서열을 포함하는 것일 수 있다.
일 구체예에서, 상기 항체 또는 항원 결합 단편은 서열번호 1, 서열번호 22, 서열번호 23 및 서열번호 24로 이루어진 군에서 선택된 아미노산 서열을 포함하는 폴리펩타이드 (CDR-H1), 서열번호 2, 서열번호 25, 및 서열번호 26으로 이루어진 군에서 선택된 아미노산 서열을 포함하는 폴리펩타이드 (CDR-H2), 및 서열번호 3, 서열번호 27, 서열번호 28, 및 서열번호 85으로 이루어진 군에서 선택된 아미노산 서열을 포함하는 폴리펩타이드 (CDR-H3)를 포함하는 증쇄 가변 영역; 및 서열번호 10, 서열번호 29, 서열번호 30. 서열번호 31. 서열번호 32. 서열번호 33 및 서열번호 106으로 이루어진 군에서 선택된 아미노산 서열을 포함하는 폴리펩타이드 (CDR- L1). 서열번호 11, 서열번호 34, 서열번호 35, 및 서열번호 36으로 이루어진 군에서 선택된 아마노산 서열을 포함하는 폴리펩타이드 (CDR-L2), 및 서열번호 12, 서열번호 13, 서열번호 14. 서열번호 15, 서열번호 16, 서열번호 37, 서열번호 86, 및 서열번호 89로 이루어진 군에서 선택된 아미노산 서열을 포함하는 폴리펩타이드 (CDR-L3)를 포함하는 경쇄 가변 영역을 포함하는 것일 수 있다.
이에. 본 발명의 일 구체예에서, 항원 결합 효율성을 증진시키기 위하여. 상기 항 -c-Met 항체 또는 항원 결합 단편은 하나 이상의 아미노산이 결실. 부가 또는 치환되어 아미노산 서열이 변형된 힌지 영역을 포함하는 것일 수 있다. 예를 들어 , 상기 항체는 서열번호 100. 서열번호 101, 서열번호 102, 서열번호 103, 서열번호 104, 또는 서열번호 105의 아미노산 서열을 포함하는 힌지 영역을 포함하는 것일 수 있다. 보다 구체적으로, 상기 힌지 영역은 서열번호 100 또는 서열번호 1이의 아미노산 서열을 포함하는 것일 수 있다. 일 구체예에 따르면. 항 -c-Met 항체 또는 항원 결합 단편은 서열번호 17, 서열번호 74, 서열번호 87, 서열번호 90, 서열번호 91, 서열번호 92, 서열번호 93 또는 서열번호 94의 아미노산 서열을 포함하는 상기 증쇄 가변 영역: 서열번호 109. 서열번호 18, 서열번호 19, 서열번호 20, 서열번호 21. 서열번호 75, 서열번호 88, 서열번호 95, 서열번호 96, 서열번호 97, 서열번호 98, 서열번호 99 또는 서열번호 107의 아미노산 서열을 포함하는 상기 경쇄 가변 영역. 또는 상기 중쇄 가변 영역 및 상기 경쇄 가변 영역의 조합을 포함하는 것일 수 있다.
일 구체예에서. 항 -c-Met 항체는 수탁번호 KCLRF-BP-00220인 하이브리도마 세포에서 생산되는, c-Met 단백질의 세포외 부위 (extracellular region)에 특이적으로 결합하는 단일클론 항체일 수 있다 (대한민국 공개특허 제 2011-0047698호 참조; 상기 문헌은 본 명세서에 참조로서 포함됨).
상기의 항 -c-Met 항체는 대한민국 공개특허 제 2011-0047698호 및 제 2013-0037189호에 정의된 항체를 모두 포함할 수 있다.
상기 항 -c-Met 항체의 앞서 정의된 CDR 부위 또는 경쇄 가변 영역과 증쇄 가변 영역을 제외한 부위. 예컨대 경쇄 불변 영역과 중쇄 불변 영역은 모든 서브타입의 면역글로불린 (예컨대, IgA, IgD, IgE, IgG (IgGl, IgG2, IgG3, IgG4), I M. 등)으로부터 유래하는 것일 수 있다.
일 구체예에 따르면, 상기 항 -c-Met 항체는,
. 서;열번호 62의 아미노산 서열 (이 증에서 1번째부터 17번째까지의 아미노산 서열은 시그널 펩타이드임). 서열번호 62의 18번째부터 462번째까지의 아미노산 서열, 서열번호 64의 아미노산 서열 (이 증에서 1번째부터 17번째까지의 아미노산 서열은 시그널 펩타이드임) 또는 서열번호 64의 18번째부터 461번째까지의 아미노산 서열, 서열번호 66의 아미노산 서열 (이 중에서 1번째부터 17번째까지의 아미노산 서열은 시그널 펩타이드임), 및 서열번호 66의 18번째부터 460번째까지의 아미노산 서열로 이루어진 군에서 선택된 아미노산 서열을 포함하는 중쇄; 및
서열번호 68의 아미노산 서열 (이 중에서 1번째부터 20번째까지의 아미노산 서열은 시그널 펩타이드임), 서열번호 68의 21번째부터 240번째까지의 아미노산 서열, 서열번호 70의 아미노산 서열 (이 증에서 1번째부터 20번째까지의 아미노산 서열은 시그널 펩타이드임), 서열번호 70의 21번째부터 240번째까지의 아미노산 서열 , 및 서열번호 108의 아미노산 서열로 이루어진 군에서 선택된 아미노산 서열을 포함하는 경쇄
를 포함하는 것일 수 있다.
예컨대, 상기 항 -c-Met 항체는,
서열번호 62의 아미노산 서열 또는 서열번호 62의 18번케부터 462번째까지의 아미노산 서열을 포함하는 중쇄 및 서열번호 68의 아미노산 서열 또는 서열번호 68의 21번째부터 240번째까지의 아미노산 서열을 포함하는 경쇄를 포함하는 항체:
서열번호 64의 아미노산 서열 또는 서열번호 64의 18번째부터 461번째까지의 아미노산 서열을 포함하는 중쇄 및 서열번호 68의 아미노산 서열 또는 서열번호 68의 21번째부터 240번째까지의 아미노산 서열을 포함하는 경쇄를 포함하는 항체;
서열번호 66의 아미노산 서열 또는 서열번호 66의 18번째부터
460번째까지의 아미노산 서열을 포함하는 중쇄 및 서열번호 68의 아미노산 서열 또는 서열번호 68의 21번째부터 240번째까지의 아미노산 서열을 포함하는 경쇄를 포함하는 항체;
서열번호 62의 아미노산 서열 또는 서열번호 62의 18번째부터
462번째까지의 아미노산 서열을 포함하는 중쇄 및 서열번호 70의 아미노산 서열 또는 서열번호 70의 21번째부터 240번째까지의 아미노산 서열을 포함하는 경쇄를 포함하는 항체;
서열번호 64의 아미노산 서열 또는 서열번호 64의 18번째부터
461번째까지의 아미노산 서열을 포함하는 중쇄 및 서열번호 70의 아미노산 서열 또는 서열번호 70의 21번째부터 240번째까지의 아미노산 서열을 포함하는 경쇄를 포함하는 항체; 또는
서열번호 66의 아미노산 서열 또는 서열번호 66의 18번째부터 460번째까지의 아미노산 서열을 포함하는 중쇄 및 서열번호 70 또는 서열번호 70의 21번째부터 240번째까지의 아미노산 서열을 포함하는 경쇄를 포함하는 항체
서열번호 62의 아미노산 서열 또는 서열번호 62의 18번째부터 462번째까지의 아미노산 서열을 포함하는 중쇄 및 서열번호 108의 아미노산 서열을 포함하는 경쇄를 포함하는 항체; 서열번호 64의 아미노산 서열 또는 서열번호 64의 18번째부터 461번째까지의 아미노산 서열을 포함하는 중쇄 및 서열번호 108의 아미노산 서열을 포함하는 경쇄를 포함하는 항체; 및
서열번호 66의 아미노산 서열 또는 서열번호 66의 18번째부터 460번째까지의 아미노산 서열을 포함하는 중쇄 및 서열번호 108의 아미노산 서열을 포함하는 경쇄를 포함하는 항체
로 이루어진 군에서 선택된 것일 수 있다.
한편, 상기 서열번호 70의 아미노산 서열을 포함하는 폴리펩타이드는 인간의 카파 불변영역으로 이루어진 경쇄이며 , 서열번호 68의 아미노산 서열을 포함하는 폴리펩타이드는 상기 서열번호 70의 아미노산 서열을 포함하는 폴리펩타이드에서 36번 (kabat numbering에 따름. 서열번호 68 내의 62번째 아미노산 위치) 히스티던 (histkline)이 티로신 (tyrosine)으로 치환된 형태의 폴리펩타이드다. 상기 치환으로 인하여. 일 구체예에 따른 항체의 생산량이 증가될 수 있다. 또한 상기 서열번호 108의 아미노산 서열을 포함하는 폴리펩타이드는 상기 서열번호 68의 아미노산 서열 증 1번째부터 20번째까지의 시그널 펩타이드를 제외한 21번째부터 240번째까지의 아미노산 서열을 포함하는 폴리펩타이드에서 kabat numbering에 의한 27e 위치 (kabat number i rig에 따름, 서열번호 108 내 32번째 위치; CDR-L1 내부)의 세린 (Ser)이 트립토판 (Trp)으로 치환된 것으로, 상기 치환으로 인하여 , 일 구체예에 따른 항체의 활성 (예컨대, c-Met에 대한 결합친화도, c-Met 분해 활성 및 Akt 인산화 억제 활성 등)이 보다 증진될 수 있다.
이하, 상기 항 -c-Met 항체와 항 -Nrpl 항체에 공통된 설명을 기재한다. 원하는 항원을 피면역 동물에게 면역시켜 생산하는 동물 유래 항체는 일반적으로 치료 목적으로 인간에 투여 시 면역거부반웅이 일어날 수 있으며, 이러한 면역거부반웅을 억제하고자 키메릭 항체 (chimeric antibody)가 개발되었다. 키메릭 항체는 유전공학적 방법을 이용하여 항 -아이소타입 (anti- isotype) 반웅의 원인이 되는 동물 유래 항체의 불변 영역을 인간 항체의 불변 영역으로 치환한 것이다. 키메릭 항체는 동물 유래 항체에 비하여 항- 아이소타입 반응에 있어서 상당 부분 개선되었으나, 여전히 동물 유래 아미노산들이 가변 영역에 존재하고 있어 잠재적인 항 -이디오타입 (anti- idiotypic) 반웅에 대한 부작용을 내포하고 있다. 이러한 부작용을 개선하고자 개발된 것이 인간화 항체 (humanized ant i body)이다. 이는 키메릭 항체의 가변 영역 증 항원의 결합에 중요한 역할을 하는 CDR(complementaritiy determining regions) 부위를 인간 항체 골격 ( framework)에 이식하여 제작된다.
인간화 항체를 제작하기 위한 CDR 이식 (grafting) 기술에 있어서 가장 중요한 것은 동물 유래 항체의 CDR 부위를 가장 잘 받아들일 수 있는 최적화된 인간 항체를 선정하는 것이며, 이를 위하여 항체 데이터베이스의 활용, 결정구조 (crystal structure)의 분석, 분자모델링 기술 등이 활용된다. 그러나, 최적화된 인간 항체 골격에 동물 유래 항체의 CDR 부위를 이식할지라도 동물 유래 항체의 골격에 위치하면서 항원 결합에 영향을 미치는 아미노산이 존재하는 경우가 있기 때문에 , 항원 결합력이 보존되지 못하는 경우가 상당수 존재하므로, 항원 결합력을 복원하기 위한 추가적인 항체 공학 기술의 적용은 필수적이라고 할 수 있다.
일 구체예에 따르면, 상기 항체는 마우스 유래 항체, 마우스 -인간 키메릭 항체, 인간화 항체 또는 인간 항체일 수 있다ᅳ.
완전한 항체는 2개의 전장 (ful l length) 경쇄 및 2개의 전장 증쇄를 가지는 구조이며 각각의 경쇄는 중쇄와 이황화 결합으로 연결되어 있다. 항체의 불변 영역은 중쇄 불변 영역과 경쇄 불변 영역으로 나뉘어지며, 중쇄 불변' 영역은 감마 ), 뮤 ( μ ), 알파 ( α ). 델타 ( δ ) 및 엡실론 ( ε ) 타입을 가지고, 서브클래스로 감마 1( γ 1), 감마 2( γ2). 감마 3 3), 감마 4( γ4). 알파 1( α 1) 및 알파 2( α2)를 가진다. 경쇄의 불변 영역은 카파 ( κ ) 및 람다 ( λ ) 타입을 가진다.
용어. "증쇄 (heavy chain)"는 항원에 특이성을 부여하기 위해 충분한 가변 영역 서열을 포함하는 아미노산 서열을 포함하는 가변 영역 도메인 VH 및 3개의 불변 영역 도메인 CH1, CH2 및 CH3과 힌지 (hinge)를 포함하는 전장 중쇄 및 이의 단편을 모두 포함하는 의미로 해석된다. 또한, 용어 "경쇄 (light chain)"는 항원에 특이성을 부여하기 위한 충분한 가변영역 서열을 포함하는 아미노산 서열을 포함하는 가변 영역 도메인 및 불변 영역 도메인 CL을 포함하는 전장 경쇄 및 이의 단편을 모두 포함하는 의미로 해석된다.
용어. "CDR(complementarity determining region)' '은 면역글로불린의 중쇄 및 경쇄의 고가변 영역 (hypervariable region)의 아미노산 서열을 의미한다. 중쇄 및 경쇄는 각각 3개의 CDR을 포함할 수 있다 (CDRH1, CDRH2, CDRH3 및 CDRL1. CDRL2, CDRL3). 상기 CDR은 항체가 항원 또는 에피토프에 결합하는 데 있어서 주요한 접촉 잔기를 제공할 수 있다. 한편, 본 명세서에 있어서. 용어 , "특이적으로 결합" 또는 "특이적으로 인식"은 당업자에게 통상적으로 공지되어 있는 의미와 동일한 것으로서, 항원 및 항체가 특이적으로 상호작용하여 면역학적 반웅을 하는 것을 의미한다.
용어. "항원 결합 단편' '은 면역글로불린 전체 구조에 대한 그의 단편으로, 항원이 결합할 수 있는 부분을 포함하는 폴리펩타이드의 일부를 의미한다. 예를 들어, scFv, (scFv)2, scFv-Fc . Fab, Fab' 또는 F(ab')2일 수 있으나, 이에 한정되지 않는다.
상기 항원 결합 단편 중 Fab는 경쇄 및 중쇄의 가변영역과 경쇄의 불변 영역 및 중쇄의 첫 번째 불변 영역 (( )을 가지는 구조로 1개의 항원 결합 부위를 가진다.
Fab'는 증쇄 CH1 도메인의 C-말단에 하나 이상의 시스테인 잔기를 포함하는 힌지 영역 (hinge region)을 가진다는 점에서 Fab와 차이가 있다.
F(ab')2 '항체는 Fab'의 힌지 영역의 시스테인 잔기가 디설파이드 결합을 '이루면서 생성된다. Fv는 중쇄 가변부위 및 경쇄 가변부위만을 가지고 있는 최소의 항체조각으로 Fv 단편을 생성하는 재조합 기술은 당업계에 널리 공지되어 있다.
이중쇄 Fv( two-chain Fv)는 비공유 결합으로 중쇄 가변부위와 경쇄 가변부위가 연결되어 있고 단쇄 Fv( single— chain Fv)는 일반적으로 펩타이드 링커를 통하여 증쇄의 가변 영역과 단쇄의 가변 영역이 공유 결합으로 연결되거나 또는 C-말단에서 바로 연결되어 있어서 이중쇄 Fv와 같이 다이머와 같은 구조를 이를 수 있다. scFv-Fc는 단쇄 Fv와 불변 영역이 펩타이드 링커를 통하거나 통하지 않고 연결되어 있는 구조이다. 상기 펩타이드 링커는 1 내지 100개 또는 2 내지 50개의 임의의 아미노산으로 이루어진 것일 수 있으며, 이 발명이 속하는 기술 분야의 통상의 지식을 가진 자라면 아미노산 길이와 종류를 적껄하게 선택할 수 있다.
상기 항원 결합 단편은 단백질 가수분해 효소를 이용해서 얻을 수 있고 (예를 들어, 전체 항체를 파파인으로 제한 절단하면 Fab를 얻을 수 있고 펩신으로 절단하면 F(ab')2 단편을 얻을 수 있다), 유전자 재조합 기술을 통하여 제작할 수 있다.
용어 "힌지 영역 (hunge region)"은 항체의 중쇄에 포함되어 있는 영역으로서, CH1 및 CH2 영역 사이쎄 존재하며 , 항체 내 항원 결합 부위의 유연성 (flexibility)를 제공하는 기능을 하는 영역을 의미한다.
동물 유래 항체가 키메릭화 (chiiner izat ion) 과정을 거치게 되면. 동물 유래의 IgGl 힌지는 인간 IgGl 힌지로 치환되지만. 동물 유래 IgGl 힌지는 인간 IgGl 힌지에 비하여 그 길이가 짧고, 두 개의 중쇄 사이의 이황화결합 (disulfide bond)이 3개에서 2개로 감소하여 힌지의 경직성 (rigidity)이 서로 상이한 효과를 보이게 된다. 따라서 , 힌지 영역의 변형 (modification)은 인간화 항체의 항원 결합 효율성을 증가시 ¾ 수 있다. 상기 힌지 영역의 아미노산 서열을 변형시키기 위한 아미노산의 결실. 부가 또는 치환 방법은 당업자에게 잘 알려져 있다.
상기 항체는 단클론항체일 수 있다. 단클론항체는 당 업계에 널리 알려진 방법대로 제조될 수 있다. 예컨대, phage display 기법을 이용해서 제조될 수 있다. 또한, 상기 항체는 다이설파이드 -결합 Fvs(sdFV) 또는 항- 이디오타입 (항ᅳ Id) 항체일 수 있다.
본 명세서에 기재된 항체 또는 항체 단편은. 각각의 항원, 즉 Nrpl 또는 c-Met을 특이적으로 인식할 수 있는 범위 내에서 , 본 명세서에 기재된 항체의 서열뿐만 아니라, 이의 생물학적 균등물도 포함할 수 있다. 예를 들면. 항체의 결합 친화도 및 /또는 기타 생물학적 특성을 보다 더 개선시키기 위하여 항체의 아미노산 서열에 추가적인 변화를 줄 수 있다. 이러한 변형은, 예를 들어 항체의 아미노산 서열 잔기의 결실. 삽입 및 /또는 치환을 포함한다. 이러한 아미노산 변이는 아미노산 결사슬 치환체의 상대적 유사성 . 예컨대. 소수성, 친수성 , 전하 . 크기 등에 기초하여 이루어질 수 있다. 아미노산 결사슬 치환체의 크기 . 모양 및 종류에 대한 분석에 의하예 아르기닌. 라이신과 히스티딘은 모두 양전하를 띤 잔기이고; 알라닌 , 글라이신과 세린은 유사한 크기를 갖으며 ; 페닐알라닌. 트립토판과 타이로신은 유사한 모양을 갖는다는 것을 알 수 있다. 따라서, 이러한 고려 사항에 기초하여 , 아르기닌, 라이신과 히스티딘; 알라닌, 글라이신과 세린; 그리고 페닐알라닌, 트립토판과 타이로신은 생물학적으로 기능 균등물이라 할 수 있다.
변이를 도입하는 데 있어서. 아미노산의 소수성 인텍스 (hydropathic index)가 고려될 수 있다. 각각의 아미노산은 소수성과 전하에 따라 소수성 인엑스가 부여되어 있다: 아이소루이신 (+4.5): 발린 (+4.2): 루이신 (+3.8); 페닐알라닌 (+2.8); 시스테인 /시스타인 (+2.5): 메티오닌 ( + 1.9); 알라닌 ( + 1.8); 글라이신 (-0.4); 쓰레오닌 (ᅳ 0.7); 세린 (-0.8); 트립토판 (-0.9): 타이로신 (- 1.3); 프를린 (-1.6): 히스티딘 (-3.2); 글루타메이트 (-3.5); 글루타민 (-3.5); 아스파르테이트 (-3.5); 아스파라긴 (-3.5); 라이신 (-3.9); 및 아르기닌 (-4.5).
단백질의 상호적인 생물학적 기능 (interactive biological function)을 부여하는 데 있어서 소수성 아미노산 인덱스는 매우 중요하다. 유사한 소수성 인덱스를 가지는 아미노산으로 치환하여야 유사한 생물학적 활성을 보유할 수 있다는 것은 공지된 사실이다. 소수성 인덱스를 참조하여 변이를 도입시키는 경우, 바람직하게는 ± 2 이내. 보다 바람직하게는 土 1 이내, 보다 더 바람직하게는 土 0.5 이내의 소수성 인텍스 차이를 나타내는 아미노산 간 치환을 수행한다.
한편. 유사한 친수성 값 (hydrophilidty value)을 가지는 아미노산 사이의 치환이 균등한 생물학적 활성을 갖는 단백질을 초래한다는 것도 잘 알려져 있다. 예컨대. 각각의 아미노산 잔기에 다음과 같은 친수성 값이 부여되어 있다: 아르기닌 (+3.0); 라이신 (+3.0): 아스팔테이트 (+3.0士 1); 글루타메이트 (+3.0±1); 세린 (+0.3); 아스파라긴 (+0.2); 글루타민 (+0.2); 글라이신 (0); 쓰레오닌 (-0.4): 프를린 (-0.5±1); 알라닌 (ᅳ0.5); 히스티딘 (- 0.5); 시스테인 (-1.0); 메티오닌 (-1.3); 발린 (-1.5); 루이신 (-1.8); 아이소루이신 (-1.8); 타이로신 (-2.3); 페닐알라닌 (-2.5); 트립토판 (-3.4).
분자의 활성을 전체적으로 변경시키지 않는 단백질에서의 아미노산 치환은 당해 분야에 잘 알려져 있다. 예컨대, 가장 통상적으로 일어나는 치환은 아미노산 잔기 Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser. Ala/Gly. Ala/Thr, Ser/Asn. Ala/Val , Ser/Gly. Thr/Phe, Ala/Pro. Lys/Arg. Asp/Asn. Leu/I le, Leu/Val, Ala/Glu 및 /또는 Asp/Gly 간의 치환을 포함할 수 있다.
상술한 생물학적 균등 활성을 갖는 변이를 고려한다면. 본 명세서에 기재된 항체 또는 이를 코딩하는 핵산 분자는 서열목록에 기재된 서열과 실질적인 동일성 (substantial identity)을 나타내는 서열도 포함하는 것으로 해석된다. 상기의 실질적인 동일성은. 상기한 본 발명의 서열과 임의의 다른 서열을 최대한 대웅되도록 정렬하고, 당업계에서 통상적으로 이용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에 . 61% 이상의 상동성, 70% 이상의 상동성, 80% 이상의 상동성 . 9 이상, 95% 이상, 또는 99% 이상의 상동성을 나타내는 서열을 의미할 수 있다. 서열비교를 위한 정렬 (alignment) 방법은 당업계에 공지되어 있다. 예컨대. NCBI Basic Local Alignment Search Tool(BLAST)은 NBCI 등에서 접근 가능하며 , 인터넷 상에서 blastp, blasm, blastx, tblastn 및 tblastx와 같은 서열 분석 프로그램과 연동되어 이용할 수 있다. BLSAT는 www. ncbi.nlni.nih.gov/BLAST/에서 접속 가능하다. 이 프로그램을 이용한 서열 상동성 비교 방법은 www.ncbi.nlm.nih.gov/BLAST/blast_ help. html에서 확인할 수 있다.
일 예에서 , 상기 항 -c-Met/항 -Nrpl 이중 특이 항체는 항 -c-Met 항체 또는 이의 항원 결합 단편, 및 상기 항 -c-Met 항체 또는 이의 항원 결합 단편의 C 말단 또는 N 말단, 예컨대 C 말단에 연결된 항 -Nrpl 항체 또는 이의 항원 결합 단편을 포함하는 것일 수 있다.
이 때, 상기 항 -c-Met/항— Nrpl 이중 특이 항체에 있어서. 항— c— Met 항체는 c-Met 단백질이 세포 내로 이동하고 분해되는 것을 매개하는 역할을 하므로. 이러한 역할을 은전히 수행하기 위하여 완전한 항체 구조 (예컨대, IgG 형 항체)를 갖는 것이 유리할 수 있다. 항 -Nrpl 항체는 Nrpl에 대한 특이적 인식 및 결합이 중요하고. 완전한 항체 구조를 갖지 않고 예컨대 scFv와 같은 항원 결합 단편 형태로도 internalization 기능이 가능므로. Nrpl를 인식하는 항원 결합 단편의 형태로 포함되어도 무방할 수 있다. 따라서, 일 구체예에서 , 상기 항— c-Met/항 -Nrpl 이중 특이 항체는 c-Met에 대한 완전한 형태의 항 -C-Met 항체 (예컨대 IgG형 항체) 및 상기 항 -c-Met 항체의 C 말단 (예컨대, 항 -c-Met 항체의 증쇄의 C 말단)에 연결된 항 -Nrpl 항체의 항원 결합 단편 (예컨대, scFv 또는 scFv— Fc)을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 항 -c-Met/항 -Nrpl 이중 특이 항체에 있어서, 항 -c-Met 항체 또는 이의 항원 결합 단편과 항 -Nrpl 항체 또는 이의 항원 결합 단편은 링커, 예컨대. 펩타이드 링커를 통하거나 통하지 않고 연결될 수 있다. 또한 항원 결합 단편 내의 중쇄 부분과 경쇄 부분, 예컨대 scFv 단편 내의 중쇄 가변 영역과 경쇄 가변 영역도 펩타이드 링커를 통하거나 통하지 않고 연결될 수 있다. 상기 항 -c-Met 항체 또는 이의 항원 결합 단편과 항 -Nrpl 항체 또는 이의 항원 결합 단편을 연결하는 펩타이드 링커와 항원 결합 단편 내의 중쇄 부분과 경쇄 부분을 연결하는 펩타이드 링커는 동일하거나 상이할 수 있다. 상기 펩타이드 링커는 1 내지 100개, 2 내지 50개, 2 내지 30개, 2 내지 20개, 또는 2 내지 15개의 임의의 아미노산으로 이루어진 폴리펩타이드일 수 있으며. 그 포함된 아미노산 종류는 제한이 없다. 상기 펩타이드 링커는. 예컨대. Gly, Asn 및 /또는 Ser 잔기를 포함할 수 있으며, Thr 및 /또는 Ala과 같은 중성 아미노산들도 포함될 수 있다. 펩타이드 링커에 적합한 아미노산 서열은 당 업계에 공지되어 있다. 한편, 상기 링커는 상기 이중 특이 항체의 기능에 영향을 미치지 않는 한도 내에서. 그 길이를 다양하게 결정할 수 있다. 예컨대. 상기 펩타이드.링커는 Gly, Asn, Ser, Thr 및 Ala로 이루어진 군에서 선택된 1종 이상을 총 1 내지 100개 , 2 내지 50개 , 또는 5 내지 25개를 포함하여 이루어진 것일 수 있다. 일 예에서. 상기 펩타이드ᅳ 링커는 (G4S)n (n은 (G4S)의 반복수)로서, 1 내지 10의 정수, 예컨대 2 내지 5의 정수)로 표현되는 것일 수 있다.
구체예에서. 상기 항 -c-Met/항 -Nrpl 이중 특이 항체는 항 -c-Met항체
(예컨대, IgG 형태의 항체). 및 상기 항 -c-Met 항체의 C 말단에 연결된 항- Nrpl 항체의 scFv, (scFv)2, scFv-Fc , Fab. Fab* 또는 F(ab')2, 예컨대 scFv를 포함하는 것일 수 있다.
일 구체예에서, 상기 항 C-Met/항 -Nrpl 이중 특이 항체의 증쇄는 N 말단 쪽에 앞서 설명한 항 -c-Met 항체의 중쇄를. C 말단 쪽에 항 -Nrpl 항체의 scFv, (scFv)2, scFv-Fc. Fab. Fab' 또는 F(ab')2를, 링커를 통하거나 통하지 않고 포함하는 것일 수 있으며, 예컨대, 서열번호 145 내지 147 증에서 선택된 아미노산 서열을 포함하는 것일 수 있다.
상기 항 Met/항 -Nrpl 이증 특이 항체의 경쇄는 앞서 설명한 항 -c-Met 항체의 경쇄와 같을 수 있으며, 예컨대. 서열번호 68의 아미노산 서열 (이 중에서 1번째부터 20번째까지의 아미노산 서열은 시그널 펩타이드임), 서열번호 68의 21번째부터 240번째까지의 아미노산 서열. 서열번호 70의 아미노산 서열 (이 중에서 1번째부터 20번째까지의 아미노산 서열은 시그널 펩타이드임), 서열번호 70의 21번째부터 240번째까지의 아미노산 서열, 및 서열번호 108의 아미노산 서열로 이루어진 군에서 선택된 아미노산 서열을 포함하는 것일 수 있다.
상기 항 -c-Met/항 -Nrpl 이증 특이 항체는 각각 단일항체인 경우와 유사한 c-Met 또는 Nrpl에 대한 결합 친화도를 유지할 수 있다. 예컨대, 표면플라즈몬공명 (SPR; 예컨대, Biacore)으로 측정시 , 상기 상기 항 -c- Met/항 -Nrpl 이중 특이 항체의 c-Met에 대한 친화도 (Kd)는 약 0.001 내지 50nM, 0.001 내지 30nM, 0.001 내지 ΙΟηΜ, 0.001 내지 InM. 또는 0.001 내지 0.5 nM일 수 있고, Nrpl에 대한 친화도 (1(d)는 약 0.001 내지 ΙΟΟηΜ, 0.001 내지 70nM, 0.001 내지 50nM, 0.001 내지 40nM, 0.001 내지 30nM. 0.001 내지 ΙΟπΜ, 또는 0.001 내지 InM일 수 있다.
상기 항 -c-Met/항 -Nrpl 이중 특이 항체는 항 -c-Met 항체의 세포 내재화
(internalization.) 및 분해 (degradation) 활성에 의하여 , c— Met 및 Nrpl의 활성 저해뿐 아니라 c-Met 및 Nrpl를 분해시켜 총량 (total level)을 감소시킴으로써 보다 근본적인 차단을 가능하게 한다. 따라서 , 상기 항 -C- Met/항 -Nrpl 이중 특이 항체는 항암제 (예컨대 . 젬시타빈 등) 및 /또는 c-Met 표적 치료제 (예컨대, 항 -c-Met 항체) 및 /또는 Nrpl 표적 치료제 (예컨대, 항- Nrpl 항체)에 대하여 저항성이 생긴 환자에 적용시에도 유효한 효과를 얻을 수 있다.
또한, 상기 항 -c-Met/항 -Nrpl 이중 특이 항체는 따라서 , 상기 항 -c- Met/항 -Nrpl 이중 특이 항체는, c— Met 저해제와 Nrpl 저해제의 단독 투여시는 물론이고 병용투여시와 비교하여도, 현저하게 상승된 항암 및 /또는 암 전이 저해 효과를 갖는다. 이와 같은 상승된 효과에 의하여, 상기 항 -c-Met/항 -Nrpl 이중 특이 항체는, c-Met 저해제와 Nrpl 저해제의 단독 투여 또는 병용 투여와 비교하여 , 낮은 투여량에서도 우수한 효과를 발휘할 수 있어서. 높은 투여량에 따른 부작용을 감소시킬 수 있다.
따라서 , 본 발명의 다른 예는 상기 항 -c-Met/항 -Nrpl 이증 특이 항체를 유효성분으로 포함하는 c-Met 및 /또는 Nrpl의 과생산 (예컨대, 과발현) 및 /또는 비정상적 활성화와 관련된 질병의 예방 및 /또는 치료용 약학적 조성물을 제공한다. 상기 약학적 조성물은 상기 이중 특이 항체 이외에 약학적으로 허용 가능한 담체를 추가로 포함할 수 있다.
다른 예는 상기 항 -c-Met /항 -Nrpl 이중 특이 항체의 약학적 유효량을 c-Met 및 /또는 Nrpl의 과생산 (예컨대 . 과발현) 및 /또는 비정상적 활성화와 관련된 질병의 예방 및 /또는 치료를 필요로 하는 환자에게 투여하는 단계를 포함하는 c-Met 및 /또는 Nrpl의 과생산 (예컨대 , 과발현) 및 /또는 비정상적 활성화와 관련된 질병의 예방 및 /또는 치료 방법을 제공한다. 상기 c-Met 및 /또는 Nrpl의 과생산 (예컨대 . 과발현) 및 /또는 비정상적 활성화와 관련된 질병의 예방 및 /또는 치료 방법은 상기 투여하는 단계 이전에 c— Met 및 /또는 Nrpl의 과생산 (예컨대, 과발현) 및 /또는 비정상적 활성화와 관련된 질병의 예방 및 /또는 치료를 필요로 하는 환자를 확인하는 단계를 추가로 포함할 수 있다.
본 명세서에서 사용되는 용어. "예방 "은 본 발명의 조성물의 투여에 의하여 질병의 발생을 억제시키거나 지연시키는 모든 행위를 의미하며 . "치료 "는 질병의 발전의 억제. 증상의 경감. 개선, 및 /또는 병인의 제거 (예컨대 . 종양의 경우 종양세포 또는 종양조직의 제거 )를 의미할 수 있다. ' 상기 c-Met 및 /또는 Nrpl의 과생산 (예컨대 , 과발현) 및 /또는 비정상적 활성화와 관련된 질병은, 예컨대. 암 또는 암전이일 수 있다.
따라서. 상기 항— c-Met /항ᅳ Nrpl 이중 특이 항체를 유효성분으로 포함하는 암 또는 암전이의 예방 및 /또는 치료용 약학적 조성물이 제공한다. 또한. 상기 항ᅳ c-Met /항 -Nrpl 이중 특이 항체의 약학적 유효량을 암 또는 암전이의 예방 및 /또는 치료를 필요로 하는 환자에게 투여하는 단계를 포함하는 암의 예방 및 /또는 치료 방법을 제공한다. 상기 암 또는 암전이의 예방 및 /또는 치료 방법은 상기 투여하는 단계 이전에 암 또는 암전이의 예방 및 /또는 치료를 필요로 하는 환자를 확인하는 단계를 추가로 포함할 수 있다. 상기 암은 Nrpl 및 /또는 c-Met의 과발현 및 /또는 비정상적인 활성화와 관련된 것일 수 있다. 상기 암은 고형암 또는 혈액암일 수 있고. 예컨대. 이에 제한되지 않지만, 폐암 (예컨대 , 편평상피세포암, 소세포폐암, 비소세포폐암, 폐의 선암, 폐의 편평상피암 등), 복막암, 피부암, 흑색종 (예컨대, 피부 또는 안구내 혹색종 등). 직장암. 항문부근암. 식도암. 위암. 소장암. 내분비선암, 부갑상선암, 부신암, 연조직 육종, 요도암. 만성 또는 급성 백혈병. 림프구 림프종, 간세포암, 위장암, 췌장암. 교아종 (또는 교모세포종). 성상세포종, 신경교종 , 신경아세포종 , 고환암 . 경부암 . 난소암 . 간암 . 방광암 , 유방암 , 결장암. 대장암ᅳ 자궁내막 또는 자궁암, 침¾암, 신장암. 전립선암, 음문암, 갑상선암, 두경부암, 뇌암, 골육종 등으로 이루어진 군에서 선택된 1종 이상일 수 있다. 상기 암은 원발성 암 또는 전이성 암일 수 있다.
본 명세서에서 제공되는 항 -cᅳ Met/항 -Nrpl 이증 특이 항체는 c-Met과 Nrpl를 동시에 저해함으로써, 항암제. 예컨대. ¾시타빈 (gemc abine) 등으로 이루어진 군에서 선택된 1종 이상의 항암제 및 /또는 c-Met 표적 치료제 (예컨대. 항 -c-Met 항체) 및 /또는 Nrpl 표적 치료제 (예컨대. 항 -Nrpl 항체)에 대하여 저항성이 있거나 저항성이 생긴 암에 대해서도 항암 효과를 발휘할 수 있다.
따라서, 상기 암은 기존의 항암제. 예컨대, 젬시타빈 (gemcitabine) 등으로 이루어진 군에서 선택된 1종 이상의 항암제 및 /또는 c-Met 표적 치료제 (예컨대. 항 -c-Met 항체) 및 /또는 Nrpl 표적 치료제 (예컨대. 항 -Nrpl 항체)에 대하여 선천적 저항성 (innate resistance) 또는 획득 저항성 (acquired resistance)이 생긴 암일 수 있다.
또한, 다른 예는 상기 항 -c-Met/항 -Nrpl 이중 특이 항체를 포함하는 항암제 저항성 극복을 위한 약학 조성물을 제공한다. 다른 예는 상기 항 -C- Met/항 -Nrpl 이중 특이 항체의 약학적 유효량을 항암제 저항성 극복이 필요한 환자에게 투여하는 단계를 포함하는, 항암제 저항성 극복 방법을 제공한다. 앞서 설명한 바와 같이 , 상기 항암제 저항성은 젬시타빈 (gemcitabine) 등으로 이루어진 군에서 선택된 1종 이상의 항암제 및 /또는 c-Met 표적 치료제 (예컨대. 항 -c-Met 항체) 및 /또는 Nrpl 표적 치료제 (예컨대, 항 -Nrpl 항체)에 대하여 선천적 저항성 (innate resistance) 또는 획득 저항성 (acquired resistance)일 수 있다.
상기 약학적 조성물 또는 방법에 있어서, 상기 항 -C-Met/항ᅳ Nrpl 이중 특이 항체는 약학적으로 허용되는 담체. 희석제, 및 부형제 등으로 이루어진 군에서 선택된 1종 이상의 첨가제와 함께 제공될 수 있다.
상기 약학적으로 허용되는 담체는, 항체의 제제화에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비를, 만니를, 전분, 아카시아 고무, 인산 칼슴. 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀를로스. 폴리비닐피롤리돈, 셀롤로스, 물. 시럽. 메틸 샐를로스. 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘, 미네랄 오일 등으로 이루어진 군에서 선택된 1종 이상일 수 있으나, 이에 한정되는 것은 아니다. 상기 약학적 조성물은 상기 성분들 이외에 약학적 조성물 제조에 통상적으로 사용되는 희석제, 부형제. 윤활제. 습윤제, 감미저 1 , 향미제, 유화제, 현탁제. 보존제 등으로 이루어진 군에서 선택된 1종 이상을 추가로 포함할 수 있다.
상기 약학적 조성물, 상기 항 -C-Met /항 -Nrpl 이증 특이 항체는 경구 또는 비경구로 투여될 수 있다. 비경구 투여인 경우에는 정맥내 주입 , 피하 주입 , 근육 주입 , 복강 주입. 내피 투여 . 국소 투여. 비내 투여 , 폐내 투여 및 직장내 투여 등으로 투여할 수 있다. 경구 투여시. 단백질 또는 펩타이드는 소화가 되기 때문에 경구용 조성물은 활성 약제를 코팅하거나 위에서의 분해로부터 보호되도록 제형화 되어야 한다. 또한, 상기 조성물은 활성 물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.
상기 약학적 조성물. 상기 항 -Nrpl 항체 또는 이의 항원 결합 단편. 또는 상기 항 Met /항 -Nrpl 이중 특이 항체의 적절한 투여량은 제제화 방법 . 투여 방식 , 환자의 연령, 체중. 성, 병적 상태, 음식, 투여 시간. 투여 경로, 배설 속도 및 반웅 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 상기 조성물의 바람직한 투여량은 성인 기준으로 0 .0001 내지 100 nig/kg 범위 내일 . 수 있다. 상기 1일 투여량은 단위 용량 형태로 하나의 제제로 제제화되거나, 적절하게 분량하여 제제화되거나. 다용량 용기 내에 내입시켜 제조될 수 있다. 용어 "약학적 유효량 "은 상기 유효성분 (즉, 상기 항 -C- Met /항 -Nrpl 이중 특이 항체)이 소망하는 효과, 즉 암을 예방 및 /또는 치료하는 효과를 나타낼 수 있는 양을 의미하며, 제제화 방법, 투여 방식 , 환자의 연령, 체중, 성. 병적 상태. 음식 , 투여 시간. 투여 경로, 배설 속도 및 반웅 감웅성과 같은 요인들에 의해 다양하게 처방될 수 있다. 상기 약학적 조성물은 당해 당업자가 용이하게 실시할 수 있는 방법에 따라, 약학적으로 허용되는 담체 및 /또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액. 시럽제 또는 유화액 형태이거나 액스제. 산제. 분말제. 과립제. 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
또한. 상기 약학적 조성물은 개별 치료제로 투여되거나 다른 치료제와 병용하여 투여될 수 있고, 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다.
상기 약학적 조성물의 투여 대상 또는 상기 예방 및 /또는 치료 방법의 투여 대상 환자는 인간. 원숭이 등의 영장류 또는 래트, 마우스 등의 설치류 등을 포함하는 포유류, 또는 상기 포유류로부터 분리된 세포 또는 조직 또는 이의 배양물일 수 있으나 이에 제한되는 것은 아니며 . 기존의 항암제에 대하여 저항성이 생긴 암환자일 수 있다.
【발명의 효과】
' 본 발명에서 제공되는 항 -c-Met/항 -Nrpl 항체는 다음과 같은 이점을 갖는다:
1 . c-Met 저해제와 Nrpl 저해제 단독 투여 및 병용 투여 시보다 효능 증진 및 투여 농도 감소.
2. 암 성장 억제뿐 아니라 암 전이 억제에도 효능을 가짐.
3. 기존의 항암제에 대하여 저항성을 가지는 암에도 항암 효과를 발휘함.
4. 암 이외의 Nrpl 및 /또는 c-Met의 과발현 또는 비정상적 활성화가 관여하는 다른 질병에의 웅용 가능함.
【도면의 간단한 설명】
도 1은 항 -c-Met /항 -Nrpl 이중 특이 항체의 구조의 일 예를 보여주는 모식도이다.
도 2는 항 -Nrpl scFv 항체 단편의 생산을 위한 파지미드 백터의 일 예를 보여주는 구성도이다.
도 3은 정제된 각 항 -Nrpl scFv 항체 단편의 쿠마시 염색 결과를 보여준다.
도 4은 3종의 항 -Nrpl scFv 항체 단편들의 Nrpl에 대한 결합력을 보여주는 ELISA 결과이다.
도 5는 3종의 항 -Nrpl scFv 항체 단편들의 농도에 따른 Nrpl에 대한 결합력을 보여주는 그래프이다.
도 6은 항 -c-Met /항 -Nrpl 이중 특이 항체의 위암 세포주 MKN45에 대한 세포 증식 저해 효과를 보여주는 그래프이다.
도 7은 항 _c-Met /항 -Nrpl 이중 특이 항체의 신장암 세포주 786-0에 대한 세포 이동 저해 효과를 보여주는 형광 이미지이다.
도 8은 도 7의 형광 세기를 정량화하여 보여주는 그래프이다.
도 9는 항 -c-Met /항— Nrpl 이중 특이 항체의 신장암 세포주 786— 0에 대한 invas ion 저해 효과를 보여주는 형광 이미지이다.
도 10은 도 9의 형광 세기를 정량화하여 보여주는 그래프이다.
도 11은 항 -c-Met /항 -Nrpl 이중 특이 항체의 c-Met 항체 저항성 신장암 세포주 786-0에 대한 세포 증식 저해 효과를 보여주는 그래프이다.
도 12는 잼시타빈 저항성 MKN45 세포주에서의 Nrpl 발현량을 보여주는 면역블라팅 결과이다.
도 13은 항 -c-Met /항 -Nrpl 이중 특이 항체의 MKN45 세포주 (왼쪽) 및 젬시타빈 저항성 MKN45 세포주 (오른쪽)에 대한 세포 증식 저해 효과를 보여주는 그래프이다.
도 14는 항 -c-Met /항 -Nrpl 이중 특이 항체 처리에 따른 젬시타빈 저항성 MKN45 세포주에서의 c— Met 및 Nrpl 수준 변화를 보여주는 면역블라팅 결과이다.
【발명을 실시하기 위한 구체적인 내용】
이하 하기의 실시예를 본 발명을 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 하나 이상의 구체예를 예시적으로 설명하기 위한 것일 뿐이며 , 발명의 범위가 이들 실시예에 한정되는 것은 아니다. 참고예 1: 항 -c-Met 항체의 제작
1.1. c-Met에 대한마우스 항체 'AbF46'의 생산
1.1.1. 마우스의 면역화
하이브리도마 세포주의 개발에 필요한 면역화 된 마우스를 얻기 위하여 ,
5마리의 마우스에 한 마리당 100 /_zg의 인간의 c-Met /Fc 융합 단백질 (R&D Systems)과 동량의 완전 프로인드 어주번트 (Freund ' s adjuvant)를 혼합하여 4- 6 주된 BALB/c 마우스 (Japan SLC, Inc.)의 복강 내에 주사하였다. 2주 후에 상기와 동일한 방법으로 상기 항원으로 사용된 인간의 c-Met/Fc 융합 단백질을 앞서 주사한 양의 절반인 50 /g을 동량의 불완전 프로인드 어주번트 (incomplete Freund' s adjuvant)과 흔합하여 마우스의 복강 내에 주사하였다. 일주일 후 마지막 부스팅 (boosting)이 수행되고 3일 후에 상기 마우스의 꼬리에서 채혈하여 혈청을 얻은 뒤 1/1000로 PBS에 희석하여 ELISA로 c-Met을 인지하는 항체의 역가가 증가됨을 확인하였다. 상기의 결과로 항체의 양이 충분하게 얻어지는 마우스를 선별하여 하기의 세포융합과정을 수행하였다.
1.1.2. 세포 융합 및 하이브리도마의 제조
세포융합 실험 3일 전에 50 /g의 PBS에 인간의 c-Met/Fc 융합 단백질 흔합물을 BALB/c 마우스 (Japan SLC, Inc.)의 복강 내에 주사하고. 면역화 된 마우스를 마취한 후 몸통의 좌측에 위치한 비장 (spleen)을 적출하였다. 적출한 비장을 메쉬로 갈아서 세포를 분리하고, 배양 배지 (DMEM, GIBC0. Invitrogen)와 흔합하여 비장세포 현탁액을 만들었다. 상기 현탁액을 원심분리하여 세포층을 회수하였다. 상기 얻어진 비장세포 1 X 108 개와 골수종세포 (Sp2/0) 1 X 108 개를 흔합한 다음, 원심분리하여 세포를 침전시켰다. 상기 원심분리된 침전물을 천천히 분산시키고, 배양 배지 (DMEM)에 들어있는 45% 폴리에틸렌글리콜 (PEG) (1 nie )을 처리하고. 37 °C에서 1분 동안 유지시킨 후, 배양 배지 (DMEM) 1 111 을 첨가하였다. 이후 배양배지 (DMEM) 10 ^을 1분 동안 첨가하고, 37°C의 물에서 5분 동안 방치한 후 50 inC로 맞추어 다시 원심분리하였다. 세포 침전물을 분리 배지 (HAT 배지 )에 l~2xl05/m(i 정도로 재현탁시키고. -웰 (well) 플레이트에 0.1 ^씩 분주한 후 37°C 이산화탄소 배양기에서 배양하여 하이브리도마 세포군을 제작하였다.
1. 1.3. c-Met 단백질에 대한 단일클론 항체를 생산하는 하이브리도마 세포의 선별
상기 참고예 1 . 1 .2에서 제조된 하이브리도마 세포군 중에서 c-Met 단백질에만 특이적으로 반웅하는 하이브리도마 세포를 선별하기 위하여 인간의 c-Met /Fc 융합 단백질과 인간의 Fc 단백질을 항원으로 이용한 ELISA 분석 방법을 통하여 스크리닝하였다.
마이크로타이터 플레이트에 인간의 c-Met /Fc 융합 단백질을 한 웰당 각각 50 ( 2 씩 가하여 플레이트 표면에 부착시키고, 반웅하지 않은 항원은 세척하여 제거하였다. c-Met이 아닌 Fc에 결합되는 항체를 선별하여 제외시키기 위하여 인간의 Fc 단백질을 위와 동일한 방법으로 플레이트 표면에 부착시켰다.
상기 참고예 1. 1 . 2에서 얻어진 하이브리도마 세포의 배양액을 상기 준비된 각각 웰에 50 씩을 가하여 1 시간 동안 반웅시킨 후 인산 완층용액- 트원 20(TBST) 용액으로 충분히 세척하여 반웅하지 않은 배양액을 제거하였다. 여기에 염소 항-마우스 IgG—호스래디쉬 퍼옥시다제 (goat ant i -mouse IgG- HRP)를 가하여 1 시간 동안 실온에서 반웅시킨 다음, TBST 용액으로 충분히 세척하였다. 이어서 퍼옥시다제의 기질용액 (opD)을 가하여 반응시키고, 그 반응 정도는 ELISA Reader로 450 nm에서 흡광도를 측정하여 확인하였다.
위와 같은 반응 정도 확인에 의하여 . 인간의 Fc에는 결합되지 않고, 인간의 C— Met 단백질에만 특이적으로 높은 결합력을 갖는 항체를 분비하는 하이브리도마 세포주들을 반복하여 선별하였다. 반복 선별을 통해 얻은 하이브리도마 세포주를 제한 희석 ( l im i t i ng d i l ut i on)하여 단일클론 항체를 생성하는 하이브리도마 세포주 1개의 클론을 최종적으로 얻었다. 최종 선별된 단일클론 항체 생산 하이브리도마를 2009년 10월 6일자로 부다페스트 조약 하의 국제기탁기관인 대한민국 서울 종로구 연건동에 소재하는 한국 세포주연구재단에 기탁하여 수탁번호 KCLRF-BP-00220를 부여받았다 (한국 공개특허 제 2011-0047698 참조) . 1.1.4. 단일클론 항체의 생산 및 정제
상기 참고예 1.1.3에서 얻은 하이브리도마 세포를 무혈청 배지에서 배양하고 배양액으로부터 단일클론 항체를 생산 정제하였다.
먼저 10%(v/v) FBS가 포함된 배양 배지 (DMEM) 배지 50 m l서 배양된 상기 하이브리도마 세포를 원심분리하여 세포 침전물을 20 ιιι(' PBS로 2회 이상 세척하여 FBS가 제거된 상태에서 . 상기 세포 침전물을 배양 배지 (DMEM) 배지 50 nie에 재현탁시킨 후, 3일 동안 37°C 이산화탄소 배양기에서 배양하였다. 이후. 원심분리하여 , 항체를 생산하는 세포를 제거하고 항체들이 분비된 배양액을 분리하여 . 4°C에 보관하거나 바로 모아서 항체의 분리 정제에 사용하였다. 친화성 칼럼 (Protein G agarose co 1 iimn; Pharmacia, USA)을 장착한 AKTA 정제 기기 (GE Healthcare)를 이용하여 상기 준비된 배양액 50 ιιι(! 내지 300 nie로부터 항체를 순수 정제한 후, 단백질 웅집용 필터 (Am icon)를 사용하여 PBS로 상층액을 치환하여 정제된 항체를 보관하고, 이후의 실시예에 사용하였다.
1.2. c-Met에 대한 키메릭 항체 chAbF46의 제작
일반적으로 마우스 항체는 치료 목적으로 인간에게 주입되었을 때 면역거부반응 (inii inogenicity)을 보일 가능성이 높으므로, 이를 해결하기 위하여 , 상기 참고예 1.1.4에서 제작된 마우스 항체 AbF46으로부터. 항원 결합에 관련된 변이 영역 (variable region)을 제외한 불변 영역 (constant region)을 인간 IgGl 항체의 서열로 치환하는 키메릭 항체 chAbF46을 제작하였다.
중쇄에 해당하는 뉴클레오타이드 서열은 'EcoRI-signal sequenceᅳ VH- NheI_CH-TGA-XhoI' (서열번호 38)로. 경쇄에 해당하는 뉴클레오타이드 서열은 'EcoRI -signal sequence-VL- BsiWI-CL-TGA—XhoI' (서열번호 39)로 구성되도록 각각 디자인하여 유전자를 합성하였다. 이후, Invitrogen 사의 OptiCHO™ Antibody Express Kit (Cat no. 12762-019)에 포함되어 있는 pOpt iVEC™-T0P0 TA Cloning Kit에 상기 중쇄에 해당하는 뉴클레오타이드 서열을 포함하는 DNA 절편 (서열번호 38)을, pcDNA™3.3-T0P0 TA Cloning Kit (Cat no. 8300-01)에 상기 경쇄에 해당하는 뉴클레오타이드 서열을 포함하는 DNA 절편 (서열번호 39)을 각각 EcoRKNEB, R0101S)과 XhoKNEB, R0146S) 제한 효소를 사용하여 클로닝함으로써. 키메릭 항체의 발현을 위한 중쇄를 포함하는 백터 및 경쇄를 포함하는 백터를 각각 구축하였다.
상기 구축된 백터는 각각 Qiagen Max i prep kit (Cat no. 12662)을 이용하여 증폭되었으며, 임시발현은 Freestyle™ MAX 293 Expression System (invitrogen)을 이용하여 진행 되었다. 사용된 세포주는 293 F cell 이며. FreeStyle™ 293 Expression Medium를 배지로 사용하여 부유배양방식으로 배양되었다. 임시발현 하루 전 세포를 5xl05cells/ml의 농도로 준비한 후, 24시간이 지난 뒤 cell수가 lxl06cells/nil이 되었을 때 임시발현을 진행하였다. Freestyle™ MAX reagent (invitrogen^ 사용한 liposomal reagent법으로 형질도입 (transfection)을 진행 하였으며 , 15ml tube에 중쇄 DNA: 경쇄 DNA=l:l 의 비율로 DNA를 준비하여 OptiPro™ SFM (invtrogen) 2ml과 mix하고 (A), 또 다른 15ml tube에 Freestyle™ MAX reagent 100/ 와 OptiPro™ SFM 2ml을 mix(B)한 후, (A)와 (B)을 mix하여 15분간 incubation 한 후. 하루 전에 준비한 세포에 혼합액을 천천히 섞어주었다. 형질도입 완료 후, 37 °C. 80% humidity, 8% C02, 130 rpni incubator에서 5일간 배양하였다.
상기 배양된 세포를 원심분리하여 상등액을 각각 100 ml 취하고, AKTA Prime (GE healthcare)를 이용하여 정제하였다. AKTA Prime에 Protein A 컬럼 (GE healthcare, 17-0405-03)을 설치하고 배양액을 5 ml/niin의 유속으로 홀려준 후. IgG el ut ion buffer (Thermo Scientific. 21004)로 용출시켰다. 얻어진 용출물을 PBS 버퍼로 교환하여 최종적으로 키메릭 항체 AbF46(이하. chAbF46로 명명함)을 정제하였다.
1.3. 키메릭 항체 chAbF46으로부터 인간화항체 huAbF46의 제작
1.3.1. 중쇄의 인간화 (Heavy chain humanizat ion)
Hl-heavy 및 H3-heavy 2종의 디자인을 위하여, 우선 Ig Blast (http://醫 w.ncbi .nlm.nih.gov/igblast/)를 통하여 상기 참고예 1.2에서 정제된 마우스 항체 AbF46의 VH 유전자와 가장 상동성이 높은 인간의 생식선 (germline) 유전자를 분석하였다. 그 결과, VH3-71이 아미노산 레벨에서 83%의 상동성을 가짐을 확인하였으며, 마우스 항체 AbF46의 CDR-H1, CDR-H2. CDR— H3를 Kabat numbering으로 정의하고, 마우스 항체 AbF46의 CDR 부분이 VH3-기의 골격 (framework)에 도입되도톡 디자인하였다. 이때, 30번 (S→T), 48번 (V→L), 73번 (D→N), 78번 (Tᅳ L) 아미노산은 원래 마우스 AbF46 항체의 아미노산 서열로 back-mutation 하였다. 이후, HI은 추가로 83번 (R→K)과 84번 (A→T) 아미노산에 돌연변이를 주어 최종적으로 Hl-heavy (서열번호 40)와 H3-heavy (서열번호 41)를 구축하였다.
H4-heavy의 디자인을 위하여 인간항체의 골격 ( framework) 서열을 찾아 본 결과, AbF46 항체의 마우스 골격 서열과 서열이 매우 유사함과 동시에. 기존의 가장 안정하다고 알려진 VH3 subtype을 사용하여 Kabat numbering으로 정의된 마우스 항체 AbF46의 CDR— HI, CDR-H2, CDR-H3를 도입하였다. 이를 통하여 H4-heavy (서열번호 42)를 구축하였다.
1.3.2. 경쇄의 인간화 (Light chain humanization)
HI一 light (서열번호 43) 및 H2-light (서열번호 44) 2종의 디자인을 위하여 . Ig Blast (http://www.ncbi .nlm.nih.gov/igblast/)를 통하여 , 마우스 항체 AbF46의 VL 유전자와 가장 상동성이 높은 인간 생식선 유전자를 분석하였다. 그 결과, VK4-1이 아미노산 레벨에서 75%의 상동성을 가짐을 확인하였으며, 마우스 항체 AbF46의 CDR-L1, CDR-L2, CDR-L3를 Kabat numbering으로 정의하고, 마우스 항체 AbF46의 CDR부분이 VK4-1의 골격에 도입되도록 디자인하였다. 이때, Hl-light는 36번 (Y→H), 46번 (L→M), 49번 (Y→I) 3개의 아미노산을 back- utation 하였으며. H2— light는 49번 아미노산 (Y→I) 1개만을 back-mutation 하여 구축하였다.
H3-light (서열번호 45)의 디자인을 위하여, Blast
(http://而 w.ncbi .nlm.nih.gov/igblast/)를 통하여 마우스 항체 AbF46의 VL 유전자와 가장 상동성이 높은 인간 생식선 유전자를 분석한 결과 중, 상기 VK4-1 이외에 VK2-40을 선정하였다. 마우스 항체 AbF46 VL과 VK2— 40은 아미노산 레벨에서 61%의 상동성을 가짐을 확인하였으며, 마우스 항체 AbF46의 CDR-L1, CDR-L2, CDR-L3를 Kabat numbering으로 정의하고, 마우스 항체 AbF46의 CDR부분이 VK4-1의 골격에 도입되도록 디자인하였다. 이때, H3- light는 36번 (Y→H), 46번 →¾ , 49번 (Y→I) 3개의 아미노산을 back-mutation 하여 구축하였다.
H4-light (서열번호 46)의 디자인을 위하여, 인간항체의 골격 (framework) 서열을 찾아 본 결과, 기존의 가장 안정하다고 알려진 Vkl subtype을 사용하여 Kabat numbering으로 정의된 마우스 항체 AbF46의 CDR-L1, CDR-L2, CDR— L3를 도입하였다. 이때, H4— light는 36번 (Y→H), 46번 →¾1), 49번 (Υ—Γ) 3개의 아미노산을 추가로 back-mutation 하여 구축하였다.
이후, Invitrogen 사의 OptiCHO™ Ant i body Express Kit (Cat no. 12762-019)에 포함되어 있는 P0ptiVEC™-T0P0 TA Cloning Kit에 상기 증쇄에 해당하는 뉴클레오타이드 서열을 포함하는 DNA 절편 (Hl-heavy; 서열번호 47, H3-heavy: 서열번호 48. H4_heavy; 서열번호 49)을 pcDNA™3.3-T0P0 TA Cloning Kit 에 상기 경쇄에 해당하는 뉴클레오타이드 서열을 포함하는 DNA 절편 (H1- light; 서열번호 50. H2-light; 서열번호 51, H3-light; 서열번호 52, H4- light; 서열번호 53)을 각각 EcoRKNEB, R0101S)과 XhoKNEB, R0146S) 제한 효소를 사용하여, 클로닝함으로써, 인간화 항체의 발현을 위한 백터를 구축하였다.
상기 구축된 백터는 각각 Qiagen Max i prep kit (Cat no. 12662)을 이용하여 증폭되었으며 , 임시발현은 Freestyle™ MAX 293 Expression System (invitrogen)을 이용하여 진행 되었다. 사용된 세포주는 293 F cell 이며, FreeStyle™ 293 Expression Mediimi를 배지로 사용하여 부유배양방식으로 배양되었다. 임시발현 하루 전 세포를 5xl05cells/ml의 농도로 준비한 후, 24시간이 지난 뒤 cell수가 lxl06cells/ml이 되었을 때 임시발현을 진행하였다. Freestyle™ MAX reagent (invitrogen^ 사용한 liposomal ιᅳ eagent법으로 형질도입 (transfection)을 진행 하였으며 , 15ml tube에 중쇄 DNA: 경쇄 DNA=l:l 의 비율로 DNA를 준비하여 Opt i Pro™ SFM (invtrogen) 2nil과 mix하고 (A), 또 다른 15ml tube에 Freestyle™ MAX reagent 100/ 와 OptiPro™ SFM 2ml을 mix(B)한 후, (A)와 (B)을 mix하여 15분간 incubation 한 후, 하루 전에 준비한 세포에 흔합액을 천천히 섞어주었다. 형질도입 완료 후, 37 °C, 80% humidity, 8% C02. 130 rpm incubator에서 5일간 배양하였다.
상기 배양된 세포를 원심분리하여 상등액 각 100 ml을 취하고. AKTA Prime (GE healthcare)를 이용하여 정제하였다. AKTA Prime에 Protein A 컬럼 (GE healthcare. 17-0405-03)을 설치하고 배양액을 5 nil/min의 유속으로 홀려준 후, IgG el Lit ion buffer (Thermo Scientific, 21004)로 용출하였다. 이를 PBS buffer로 교환하여 최종적으로 인간화 항체 AbF46(이하, huAbF46로 명명함)을 정제하였다. 한편 . 이후 실시예에서 사용한 인간화 항체 huAbF46의 중쇄, 경쇄 조합은 H4-heavy (서열번호 42) 및 H4-light (서열번호 46)이다.
1.4. huAbF46항체의 scFv라이브러리 제작
huAbF46 항체의 중쇄 가변영역 및 경쇄 가변영역을 이용하여 huAbF46 항체의 scFv'를 제작하기 위한 유전자를 디자인하였다. 각각의 중쇄 가변영역 및 경쇄 가변영역을 'VH-링커 -VL'의 형태가 되도록 하고, 상기 링커는 'GLGGLGGGGSGGGGSGGSSGVGS' (서열번호 54)의 아미노산 서열을 가지도록 디자인하였다. 이렇게 디자인된 huAbF46 항체의 scFv를 코딩하는 폴리뉴클레오타이드 (서열번호 55)를 바이오니아에 의뢰하여 합성하였으며 . 이를 발현시키기 위한 백터를 서열번호 56에 나타내었다.
이후, 상기 백터로부터 발현된 결과물을 분석하여 , c-Met에 특이적인 결합력을 보임을 확인하였다.
1.5. 친화도 성숙 (affinity maturation)을 위한 라이브러리 유전자의 제작
1.5.1. 표적 CDR의 선정 및 프라이머 제작
huAbF46 항체의 친화도 성숙 (affinity niaturat ion)을 위하여 6개의 상보성 결정 부위 (complementary determining region, CDR)를 상기 제작된 마우스 항체 AbF46으로부터 'Kabat r inibering'에 의하여 정의하였으며, 각각의 CDR은 하기 표 2와 같다.
【표 2】
Figure imgf000034_0001
CDR-L2 WASTRVS(서열번호 11 )
CDR-L3 QQSYSAPU (서열번호 12)
항체 CDR의 무작위 서열 도입을 위하여 다음과 같이 프라이머를 제작하였다. 기존의 무작위 서열 도입 방식은 돌연변이를 주고자 하는 부위에 동일한 비율의 염기 ( 25¾ A . 25% G , 25% C . 25% T)가 도입되도록 N 코돈을 이용하였으나, 본 실시예에서는 huAbF46 항체의 CDR에 무작위 염기를 도입하기 위하여 , 각 CDR의 아미노산을 코딩하는 3개의 야생형 (wi l d-type) 뉴클레오타이드 중 첫번째와 두번째 뉴클레오타이드의 85%는 그대로 보존하고, 나머지 3개의 염기를 각각 5%씩 도입하는 방식을 취하였다. 또한, 세 번째 뉴클레오타이드는 동일하게 (33% G . 33% C , 33% T)가 도입되도록 프라이머를 디자인하였다.
1.5.2. huAbF46항체의 라이브러리 제작 및 c-Met에 대한 결합력 확인
CDR의 무작위 서열 도입을 통한 항체 라이브러리 유전자의 구축은 상기 참고예 1. 5. 1과 같은 방법으로 제작된 프라이머를 이용하여 수행하였다. 주형으로 huAbF46 항체의 scFv를 포함하는 폴리뉴클레오타이드를 이용하여 , 도 1에 나타낸 방법과 같이 2개의 PCR 절편을 제작하고. 이를 증복 확장 중합효소연쇄반응 (over l ap ext ens i on PCR) 방법을 통하여 . 원하는 CDR만 각각 돌연변이된 huAbF46 항체의 scFv 라이브러리 유전자를 확보하여 제작된 6개의
CDR을 각각 표적으로 하는 라이브러리들을 구축하였다.
이렇게 제작된 라이브러리는 야생형과 각 라이브러리의 c-Met에 대한 결합력을 확인하였으며, 각각의 라이브러리는 야생형에 비하여 c-Met에 대한 결합력이 대부분 낮아지는 경향을 보였으나, 일부 c-Met에 대한 결합력이 유지되는 돌연변이들을 확인하였다.
1.6. 제작된 라이브러리로부터 친화도가 개선된 항체의 선별
상기 구축된 라이브러리로부터 c-Met에 대한 라이브러리의 결합력을 향상시킨 후, 각각의 개별 클론으로부터 scFv의 유전자 서열을 분석하였다. 확보된 유전자 서열은 각각 하기 표 7과 같으며 . 이를 IgG 형태로 변환하였다. 하기 클론 증에서. L3-1 . L3-2. L3-3. L3-5으로부터 생산된 4종의 항체를 선별하여 후속 실험을 수행하였다.
【표 3】
Figure imgf000036_0001
1.7. 선별된 항체의 IgG로의 변환
선별된 4종의 항체의 증쇄를 코딩하는 폴리뉴클레오타이드는 'EcoRI- si gnal sequence-VH-Nhel-CH-XhoI' (서열번호 38)로 구성되며 , 중쇄의 경우 친화도 성숙 후에 항체의 아미노산이 변경되지 않았으므로, huAbF46 항체의 중쇄를 그대로 사용하였다. 다만, 힌지 영역 (hinge region)은 인간 IgGl의 힌지가 아닌 U6-HC7 힌지 (서열번호 57) 로 치환하였다. 경쇄는 'EcoRI-signal sequence-VL-BsiWI-CL-XhoI'로 구성되도톡 각각 디자인하여 유전자를 합성하였으며 . 친화도 성숙 후에 선별된 상기 4종 항체의 경쇄 가변영역을 포함하여 코딩하는 폴리뉴클레오타이드 (서열번호 58 내지 서열번호 61)를 바이오니아에 의뢰하여 합성하였다. 이후, Invitrogen 사의 OptiCHO™ Antibody Express Kit (Cat no. 12762-019)에 포함되어 있는 pOpt iVEC™-T0P0 TA Cloning Kit에 상기 중쇄에 해당하는 뉴클레오타이드 서열을 포함하는 DNA 절편 (서열번호 38)을, pcDNA™3.3-T0P0 TA Cloning Kit (Cat no. 8300-01)에 상기 경쇄에 해당하는 뉴클레오타이드 서열을 포함하는 DNA 껄편 (L3-1 유래 CDR-L3를 포함하는 DNA 절편: 서열번호 58. L3-2 유래 CDR-L3를 포함하는 DNA 껄편 : 서열번호 59, L3-3 유래 CDR-L3를 포함하는 DNA 절편 : 서열번호 60, L3- 5 유래 CDR-L3를 포함하는 DNA 절편: 서열번호 61)을 각각 EcoRKNEB. R0101S)과 XhoKNEB. R0146S) 제한 효소를 사용하여 클로닝함으로써, 친화력 성숙된 항체의 발현을 위한 백터를 구축하였다ᅳ
상기 구축된 백터는 각각 Qiagen Maxiprep kit (Cat no. 12662)을 이용하여 증폭되었으며. 임시발현은 Freestyle™ MAX 293 Expression System (invitrogen)을 이용하여 진행 되었다. 사용된 세포주는 293 F cell 이며 , FreeStyle™ 293 Expression Medium를 배지로 사용하여 부유배양방식으로 배양되었다. 임시발현 하루 전 세포를 5xl05cells/ml의 농도로 준비한 후, 24시간이 지난 뒤 cell수가 lxl06cells/ml이 되었을 때 임시발현을 진행하였다. Freestyle™ MAX reagent ( invi ti'ogen)을 사용한 liposomal reagent법으로 형질도입 (transfection)을 진행 하였으며 , 15ml ibe에 중쇄 DNA: 경쇄 DNA=l:l 의 비율로 DNA를 준비하여 OptiPro™ SFM (invtrogen) 2ml과 mix하고 (A), 또 다른 15ml tube에 Freestyle™ MAX reagent 와 OptiPro™
SFM 2ml을 mix(B)한 후. (A)와 (B)을 mix하여 15분간 incubation 한 후, 하루 전에 준비한 세포에 흔합액을 천천히 섞어주었다. 형질도입 완료 후, 37 °C, 80% humidity. 8% C02. 130 rpm incubator에서 5일간 배양하였다.
상기 배양된 세포를 원심분리하여 상등액 각 100 ml 을 취하고, AKTA Prime (GE heal thcare)를 이용하여 정제하였다. AKTA Prime 에 Protein A 컬럼 (GE healthcare. 17-0405— 03)을 설치하고 배양액을 5 nil/min 의 유속으로 홀려준 후. IgG el Lit ion buffer (Thermo Scientific, 21004)로 용출하였다. 이를 PBS buf fer 로 교환하여 최종적으로 친화력 성숙된 4종의 항체 (이하. huAbF46-H4-Al( L3-l 유래) . huAbF46-H4-A2 (L3-2 유래) , huAbF46-H4-A3 (L3-3 유래) , 및 huAbF46-H4-A5(L3-5 유래)로 명명함)를 정제하였다. 1.8. 불변영역 및 /또는 힌지영역이 치환된 huAbF46-H4-Al의 제조 상기 참고예 1.7에서 선별된 4종의 항체 중에서. c-Met 과의 결합친화도가 가장 높고. Akt 인산화 및 c-Met 분화 정도가 가장 낮은 것으로 측정된 huAbF46-H4-Al을 대상으로. 힌지영역 또는 불변영역 및 힌지영역이 치환된 항체를 제작하였다.
huAbF46-H4-Al의 중쇄 가변영역 , U6-HC7 힌지 및 인간의 IgGl 불변영역으로 이루어진 중쇄 및 huAbF46-H4— A1의 경쇄 가변영역 및 인간의 카파 (kappa) 불변영역으로 이루어진 경쇄로 이루어진 항체를 huAbF46ᅳ H4- A1(U6-HC7 )으로; huAbF46-H4— A1의 중쇄 가변영역. 인간의 IgG2 힌지 및 인간의 IgGl 불변영역으로 이루어진 중쇄 및 huAbF46_H4-Al의 경쇄 가변영역 및 인간의 카파 불변영역으로 이루어진 경쇄로 이루어진 항체를 hiiAbF46-H4- Al( IgG2 hinge)로; huAbF46-H4-Al의 중쇄 가변영역 , 인간의 IgG2 힌지 및 인간의 IgG2 불변영역으로 이루어진 중쇄 및 huAbF46-H4-Al의 경쇄 가변영역 및 인간의 카파 불변영역으로 이루어진 경쇄로 이루어진 항체를 huAbF46ᅳ H4- Al( IgG2 Fc )로 각각 명명하였다. 또한, 한편, 상기 3종의 항체는 생산량 증대를 위하여 인간의 카파 불변영역으로 이루어진 경쇄의 36번 히스티딘 (hi st i dine )을 모두 티로신 ( tyros ine)으로 치환하였다.
상기 3종 항체를 제작하기 위해. huAbF46-H4-Al의 중쇄 가변영역 , U6- HC7힌지 및 인간의 IgGl 불변영역으로 이루어진 폴리펩타이드 (서열번호 62)를 코딩하는 폴리뉴클레오타이드 (서열번호 63) . huAbF46-H4-Al의 중쇄 가변영역 인간의 IgG2 힌지 및 인간의 IgGl 불변영역으로 이루어진 폴리펩타이드 (서열번호 64)를 코딩하는 폴리뉴클레오타이드 (서열번호 65) , huAbF46-H4-Al의 중쇄 가변영역, 인간의 IgG2 힌지 및 인간의 IgG2 불변영역으로 이루어진 폴리펩타이드 (서열번호 66)를 코딩하는 폴리뉴클레오타이드 (서열번호 67) , 36번 히스티틴이 티로신으로 치환된 huAbF46-H4-Al의 경쇄 가변영역 및 인간의 카파 불변영역으로 이루어진 폴리펩타이드 (서열번호 68)를 코딩하는 폴리뉴클레오타이드 (서열번호 69)를 바이오니아에 의뢰하여 합성하였다. 이후, Invitrogen 사의 OptiCHO™ Antibody Express Kit (Cat no. 12762-019)에 포함되어 있는 pOpt iVEC™-T0P0 TA Cloning Kit 에 상기 중쇄에 해당하는 염기서열을 포함하는 DNA 절편을, pcDNA™3.3-T0P0 TA Cloning Kit(Cat no. 8300-01)에 상기 경쇄에 해당하는 염기서열을 포함하는 DNA 절편을 삽입하여 , 상기 항체의 발현을 위한 백터를 구축하였다.
상기 구축된 백터는 각각 Qiagen Max i prep kit (Cat no. 12662)을 이용하여 증폭되었으며, 임시발현은 Freestyle™ MAX 293 Expression System (invitrogen)을 이용하여 진행 되었다. 사용된 세포주는 293 F cell 이며 , FreeStyle™ 293 Expression Medium 를 배지로 사용하여 부유배양방식으로 배양되었다. 임시발현 하루 전 세포를 5xl05cells/i 의 농도로 준비한 후, 24시간이 지난 뒤 cell 수가 lxl06cel ls/ml 이 되었을 때 임시발현을 진행하였다. Freestyle™ MAX reagent ( invi trogen)을 사용한 lipos에 lal reagent 법으로 형질도입 ( transfect ion)을 진행 하였으며 , 15ml tube 에 증쇄 DNA: 경쇄 DNA=l:l 의 비율로 DNA 를 준비하여 Opt i Pro™ SFM (invtrogen) 2ml 과 mix 하고 (A), 또 다른 15ml tube 에 Freestyle™ MAX reagent' 100/ 와 Opt i Pro™ SFM 2ml 을 mix(B)한 후, (A)와 (B)을 mix 하여 15분간 incubation 한 후, 하루 전에 준비한 세포에 흔합액을 천천히 섞어주었다. 형질도입 완료 후, 37 °C, 80% humidity, 8% C02, 130 rpm incubator에서 5일간 배양하였다. 상기 배양된 세포를 원심분리하여 상등액 각 100 ml을 취하고, AKTA Prime (GE healthcare)를 이용하여 정제하였다. AKTA Prime에 Protein A 컬럼 (GE healthcare, 17— 0405-03)을 설치하고 배양액을 5 nil/min의 유속으로 홀려준 후, IgG elution buffer (Thermo Scientific, 21004)로 용출하였다. 이를 PBS buffer로 교환하여 최종적으로 3종의 항체0111/1 464¼-/1 6- 7). huAbF46-H4-Al(IgG2 hinge), huAbF46-H4-Al( IgG2 Fc))를 정제하였다. 이 중에서 본 발명에 따른 항 -c-Met 항체를 대표하여 huAbF46-H4-Al(IgG2 Fc)을 선택하여 하기의 실시예에 사용하였으며, 편의상 상기 항체를 항 -c-Met 항체 SAIT301로 명명하였다. 참고예 2. 항 -Nrpl항체 제조
2.1. 환자 유래 세포를 이용한 내재화 (internalizing) 항체 동정 항 -Nrpl 항체 단편 동정 위한 세포 패닝 (cell panning l 필요한 세포를 선별하기 위해 사업단 (삼성서울병원 난치암연구사업단)에서 보유하고 있는 환자 유래 세포들 중. Nrpl의 발현수준이 높은 세포들을 FACS( Fluorescence Activated Cell Sorting) 방법으로 선별하였다. 이들 중 가장 많이 표면에 Nrpl을 발현하는 131 세포 (Nat ionar Cancer Institute (NCI) 기관에서 얻은 환자 유래 세포)를 세포 패닝에 이용하였다.
기존에 제작된 합성 scFv 항체 단편 파지 라이브러리 (Yang et al . , Mol . Cells, 27:225- 235, 2009)를 이용하여 인간 Nrpl에 결합하는 scFv 항체 단편을 파지 디스플레이 스크리닝을 통해 동정하였다. 대장균 숙주 ER2537 (New England Biolab) 내에 도입되어 있는 파지미드 (phagemid) 백터를 파지 (phage) 형태로 회수하기 위해 4개의 하위 라이브러리 샘플을 각 400m (!의 배양배지 (SB/암피실린 / 글루코오스)에서 2시간 동안 배양하였다. 0.D 600에서 흡광도가 0.5-0.7 정도되면 5000 g에서 20분동안 원심분리하여 상층액을 제거한 후 400 ηι(의 2차 배양배지 (SB/암피실린) 내에 부유시킨 다음. 1012 pfu(plaque forming unit)의 헬퍼 파지 (VCSM13; Stratagene)를 첨가하여 1시간 동안 배양하였다. 그 다음, 카나마이신 항생제 (헬퍼 파지 내 도입된 항생제 유전자)를 70 //g/nie 첨가한 후 30°C에서 밤샘 배양을 하여 파지 라이브러리가 숙주 세포 외로 분비될 수 있도록 하였다. 이어 원심분리를 통해 얻은 배양물을 PEG(polyethylene glycol) 용액을 이용해 파지 형태만 침전시켜 파지 라이브러리를 얻었다.
이렇게 얻어진 파지 라이브러리와 Nrpl 발현이 높은 환자 유래 세포 인 131 세포 (4 X 106개)를 섞어 총 5 lii NBA(neurobasal medium)에 넣고, 4°C의 회전기에 고정시킨 후 1-2시간 동안 360도로 회전시켰다. 그 다음 131 세포에 결합하지 않은 파지입자들을 제거하기 위해 300 g에서 5분간 원심분리하여 세포를 분리시킨 후 다시 5 me NBA를 넣는 세척 과정을 진행하였다. 이 과정을 4차례 반복하였고. 마지막 과정에서는 미리 37°C의 인큐베이터에 둔 NBA 5 nie를 사용하여 131 세포와 파지들을 T 플라스크에 넣어 37°C에서 30분간 배양시켜 세포 표면에 붙은 파지입자들이 내재화 (internalization)을 통해 세포 안으로 들어가게 유도하였다.
다음 15 m 튜브 (conical tube)에 옮긴 후 300 g에서 5분간 원심분리시켜 세포를 분리시킨 후, 이 과정을 차가운 PBS( Phosphate buffered saline) 5 πι 을 넣는 세척 과정을 6번 반복하여 수행하고, 세포 패닝 회차가 거듭될수록 이 과정의 횟수를 증가시켰다. 이후, 0.1 Μ 글리신 (ρΗ 2.2) 5 me를 넣고, 상온에서 5분간 두어 세포 표면에 있는 파지입자들을 세포 표면으로부터 분리시켰다. 이후. 300 g에서 5분간 원심분리시켜 세포만 분리시켜 0.5 m 100 mM TEA를 넣고, 이를 e-튜브에 옮겨 상온에서 15분간 두었다. 다음으로, 12,000 rpm에서 5분간 원심분리시켜 세포 찌꺼기를 분리하여 세포 안에 있는 파지 입자들이 있는 상층액을 따서 1 in. 2M TrisCpH 8)와 섞어 중화시킨 후, 미리 키워놓은 ER2537이 들어있는 8.5 m(의 배양 배지 (SB)에 넣고, 37°C에서 120 rpm으로 배양시켜 파지입자들을 대장균 숙주인 ER2537에 감염시켰다. 이후, 3.000 rpm으로 15분간 원심분리시켜 가라앉은 ER2537을 배양배지 (SB) 500 ^로 섞은 후. 15 cm 배양배지에 도말하여 배양 후 5 의 SB 배양배지 (50% 글리세를)를 첨가하여 콜로니들을 회수 및 보관 (- 80°C)하였다. 이어 반복되는 세포 패닝 회차를 진행하기 위해 보관된 전 회차 파지 용액 중 1 m ('를 취해 파지 입자 증폭 작업을 수행하였다. 숙주세포인 ER2537에 배양 후 헬퍼 파지를 넣어 희수된 파지입자들은 PEG 침전을 통해 분리하였고, 이를 다음 회차 패닝 때도 동일하게 사용하였다. 3회차 패닝을 수행하였다. 회차가 거듭될수록 패닝 전 대비 후의 파지입자의 비율이 증가됨을 확인하였고, 이는 세포 패닝을 거쳐 내재화된 파지입자들이 증폭됨을 의미하며 , 이의 결과를 표 4에 나타내었다.
【표 4】
Figure imgf000041_0001
2.2. 항 -Nrpl scFv후보 선별을 위한 ELISA 및 서열 분석
3회차 세포 패닝에서 회수된 파지 입자들을 숙주세포 (ER2537) 감염을 통해 배양배지에서 콜로니로 확인하였다. 이 콜로니들을 취하여 200 ιΛ SB/암피실린 배양배지가 담긴 96-웰 플레이트에 접종 후 37°C 2-3시간 동안 배양하였다.
그 다음. scFv-pm 단백질 발현 유도를 위해 각 웰에 최종농도 1 niM의 IPTGdsopropyl β -D-1-thiogalactopyranoside)를 처리하고 30°C에서 밤샘 배양하였다. 배양한 플레이트는 3.000 rpm에서 15분간 원심분리하여 상층액을 제거한 후 배양세포 주변세포질 (periplasm) 내에 있는 파지입자를 회수하기 위해 각 웰 당 40 ^의 TES 용액 (20% w/v 수크로오스, 50 mM Tris. 1 niM EDTA. pH 8.0)을 넣고, 4C에서 30분 동안 정치함으로써 세포를 용해시켰다. 이후 60 / 의 0.2X TES 용액을 처리하여 4°C에서 30분 동안 두어 삼투압으로 세포를 분해시킨 다음, 플레이트를 3,000 rpm 15분간 원심분리시켜 상층액의 scFv-pm 단백질을 얻었다.
미리 준비한 인간 Nrpl 단백질이 코팅된 96—웰 플레이트에 얻은 상층액 중 25 '를 각 해당 웰에 첨가한 후 1시간 동안 실온에서 결합시킨 다음, TBST와 증류수를 이용해 6번 세척하였다. 이후. scFv-pm 의 HA tag에 결합할 수 있는 HRP가 결합된 항 -HA 항체를 이용해 1시간 동안 실은에서 결합시킨 후, 다시 TBST(0.1¾ Tween20)와 증류수를 이용해 6번 세척하였다. TMB 용액을 이용한 발색반웅을 유도한 후 H2S04 용액으로 발색반응을 멈추고, 0.D 450 體에서 그 값을 측정하였다.
총 분석된 클론 수는 384개였고, 이 증 41개의 클론 (결합능배수 > 2)이 인간 Nrpl에 대한 높은 결합능을 보였다. 대조군으로는 BSA 용액이 사용되었으며 . 이 41개 클론 중 재확인 ELISA를 통해서 결합능이 높은 10개의 클론들을 선택하였다. 이후, 10개의 클론들로부터 파지미드를 회수한 다음 DNA 서열분석을 진행하였고, 총 6개의 다른 서열을 지닌 클론들을 선별하였다. 1C08과 동일한 서열인 3H10올 제외하고는 각 다른 서열을 지닌 클론들이 선별되었고. 최종적으로 3H10, 1A03 및 4F12 클론을 항 -Nrpl scFv 후보로 선택하였다. 상기 선택된 3H10, 1A03 및 4F12 클론의 CDR 아미노산 서열. 가변영역 아미노산 서열 및 이를 코딩하는 DNA 서열을 표 5 및 표 6에 나타내었다.
【표 5】 항 -Nrpl scFv의 CDR 아미노산 서
Figure imgf000043_0001
【표 6】
항 -Nrpl scFv의 중쇄 가변영역 및 경쇄 가변영
Figure imgf000043_0002
2.3. 항 -Nrpl scFv생산 및 Nrpl 결합능 확인
파지미드의 기본 구성은 도 2에서 확인할 수 있으며 , 위의 실시예에서 사용된 숙주세포 ER2537의 경우 phage ρΙΠ 앞에 위치한 전사억제 코돈 ( amber codon(UAG) )을 억제하기 때문에 scFv 단독 발현이 불가능하다. 따라서 비억제 숙주 (non-suppressor strain)인 발현균주 (TOP10F '; Thermo Fi sher Scientific)를 이용하여 파지미드를 발현균주 내로 형질도입 하였다. 이후. DNA 서열분석을 통해 각 파지미드가 돌연변이 없이 도입된 발현균주를 확인하였고, 이 발현균주를 콜로니로 취한 다음 LB/암피실린 배양배지 3 에 접종 후 37°C에서 밤^ 배양하였다. 이후, 밤¾ 배양시킨 배양액 3 niC은 400 mi 배양배지 (SB/암피실린)로 옮겨 0.D 600에서 0.5-0.7이 될 때까지 배양하였고, 최종 농도 1 mM IPTG를 첨가하여 30°C에서 밤샘 배양하였다. 배양액은 원심분리 후 TES 용액 40 m(i을 이용하여 발현숙주를 용해시킨 후, 0.2X TES 60 ιιιί을 투입해 세포주변질 내 파지입자를 회수하였고. 회수한 상층액은 0.45 iM 필터를 통해 여과하였다. 여과된 용액 내에 존재하는 scFv 단백질은 His-tag 정제를 위해 Ni-NTA bead(Qiagen)l nit'이 첨가되어 상온에서 1시간 결합되었고, 이후 중력 컬럼 (gravity column, Bio-rad)에 패킹되어 200 ηιΜ 이미다졸 용액을 통해 회수하였다. 각 클론의 발현 및 정제 후 SDS-PAGE 및 쿠마시 염색 (coomassie blue staining)을 통해 scFv 해당 크기인 약 28 kDa을 확인하였다 (도 3).
정제된 scFv를 이용해 ELISA를 진행하여 표적 Nrpl에 대한 결합능이 존재하는지 확인하였다. ELISM3번 반복)로 200 ng Nrpl 단백질을 코팅한 96웰과 대조군인 BSA 200 ng을 코팅한 96웰에 각 클론 당 5 ^g/mC 수준으로 상온에서 1시간 동안 결합시켰다. 이후, 0.1% TBST를 이용해 3회 세척한 다음 HRP가 결합된 HA 항체를 1시간 동안 처리하고, 다시 한 번 세척한 후 TMB 용액으로 5분간 정치시켰다. 그리고, 2M 황산용액으로 발색반응을 정지시킨 후 0D 값을 측정하였다. 상기 얻어진 결과를 도 4에 나타내었다. 도 4에 나타난 바와 같이 . Nrpl에 결합하지 않는 12B scFv (비교항체: 아미노산 서열: 서열번호 151; 코딩 DNA 서열: 서열번호 152)에 비해 1A03, 3H10 및 4F12 scFv는 Ni'pl에 대한 특이적인 결합능을 보였다.
다음으로, 인간 Nrpl에 대한 각 항체 단편의 농도에 따른 결합능을 측정하기 위하여. 각각 200 ng의 Nrpl 또는 BSA가 코팅된 96웰에 각 scFv를 2.000 ng/me, 1,000 ng/mt, 500 ng/ni . 250 ng/nif, 125 ng/mt. 62.5 ng/mi, 31.25 ng/me, 또는 15.62 ng/mi 농도로 처리하여 0D 값 (460nm) 변화를 분석하였다. 상기 얻어진 결과를 도 5에 나타내었다. 도 5에서 나타난 바와 같이 , Nrpl에 대한 결합능에 있어 , 12B scFv의 경우에는 농도 변화에 따른 0D 값의 변화가 없는 반면, 3H10 및 4F12 scFv의 경우에는 고농도로 갈수록 BSA 대비 Nrpl에 결합한 scFv가 증가함을 0D 값 변화를 통해 확인할 수 있었다.
3종의 scFv 항체 단편의 Nrpl 단백질에 대한 결합능의 세기를 수치 화를 통해 정확하게 알아보고자 표면 플라스몬 공명 (SPR, surface plasmon resonance) 장비인 biacore T100을 이용해 ka와 kd 값을 통한 최종적인 KD 값을 얻었다. KD 값은 kd 값을 ka 값으로 나눈 값으로 낮을수록 해당 물질에 대한 결합능이 크다. 분석 결과. 4F12 scFv의 경우 KD(M) 값이 73.60 X 10" 9로 가장 낮았고. 이어 1A03 scFv는 89.40 X 10— 9의 KD(M) 값을 나타냈으며. 3H10 scFv는 295.4 X 1(Γ9의 D(M) 값을 나타내었다. 실시예 1: 항 -c-Met/항 -Nrpl 이중 특이 항체의 제작
상기 참고예 1에서 제작된 항 -c— Met 항체 SAIT3()1의 Fc의 c-말단에 상기 참고예 2.2에서 준비된 3종의 항 -Nrpl 항체의 scFv (3H10, 1A03 또는 4F12)를 융합한 이중 특이 항체를 제작하였다. 그 제작 과정은 아래와 같다. 우선, 상기 이중 특이 항체 클로닝에 이용된 SAIT301 항체의 중쇄 부분은 다음과 같이 제작하였다. 항— c-Met 항체의 중쇄 코딩 염기서열은 서열번호 67의 position 1396부터의 C-terminal 쪽 서열을 삭제하고, 그 대신 ggcggtggtggttccggaggcggcggatcc을 압입하여 합성하였다 (바이오니아).
이후, Iiwitrogen 사의 OptiCHOTM Antibody Express Kit (Cat no. 12762-019)에 포함되어 있는 pOpt i VEC™-T0P0 TA Cloning vectoiᅳ에 상기 DNA ¾편을 ligate하였다.
한편. 3종의 항— Nrpl scFv의 중쇄 가변영역 및 경쇄 가변영역이 펩타이드 링커 (G4S)2로 연결된 항 -Nrpl scFv를 제작하였다 (바이오니아에 의뢰하여 합성; N-terminal BamHI 제한 효소 인식부위 및 C-terniinal Xhol 제한 효소 인식 부위 포함 형태) .
그 후, BamHI 제한 효소와 Xhol 제한 효소를 사용하여 상기 제작된 항- Nrpl scFv을 앞서 준비된 SAIT301 부분이 포함되어 있는 백터에 클로닝하여 , 상기 이중 특이 항체의 중쇄를 포함하는 발현 백텅를 구축하였다.
상기 구축된 이중 특이 항체의 중쇄 (항 -c-Met 항체의 중쇄의 C 말단과 항 -Nrpl scFv (3H10, 1A03 또는 4F12)의 N 말단이 (G4S)2 링커로 연결됨)의 아미노산 서열을 서열번호 142 내지 144에 각각 나타내고, 이들을 코딩하는
DNA 서열을 서열번호 145 내지 147에 각각 나타내었다.
또한. 항 -c-Met 항체의 경쇄 코딩 염기서열은 서열번호 69의 염기서열을 갖도록 합성하였다 (바이오니아). Invitrogen 사의 OptiCHO™ Antibody Express Kit (Cat no. 12762-019)에 포함되어 있는 pcDNA™3.3-T0P()
TA Cloning vector (Cat no. 8300-01)에 상기 경쇄에 해당하는 염기서열을 포함하는 DNA 절편을 삽입하여, 상기 이중 특이 항체의 경쇄 (서열번호 68)를 발현하는 백터를 구축하였다.
상기 구축된 중쇄 발현 백터와 경쇄 발현 백터는 각각 Qiagen Max i prep kit (Cat no. 12662)을 이용하여 증폭되었으며 , 임시발현은 FreestyleTM MAX
293 Expression System ( invi trogen)을 이용하여 진행 되었다. 사용된 세포주는 293F cell 이며. FreeStyle™ 293 Expression Medium를 배지로 사용하여 부유배양방식으로 배양되었다. 임시발현 하루 전 세포를
5xl05cells/ml의 농도로 준비한 후, 24시간이 지난 뒤 cell수가 lxl06cells/ml이 되었을 때 임시발현을 진행하였다. FreestyleTM MAX reagent
( invitrogen)을 용한 liposomal reagent법으로 형질도입 (transfect ion)을 ; 진행 하였으며. 15ml tube에 중쇄 DM: 경쇄 DNA=1:1 의 비율로 DNA를 준비하여 OptiPro™ SFM ( invtrogen) 2ml과 mix하고 (A) . 또 다른 15ml tube에
FreestyleTM MAX reagent 100// ('와 OptiPro™ SFM 2ml을 mix(B)한 후, (A)와 (B)을 mix하여 15분간 incubation 한 후. 하루 전에 준비한 세포에 혼합액을 천천히 섞어주었다. 형질도입 완료 후, 37 °C, 80% humidity, 8% C02, 130 rpm incLibator에서 4일간 배양하였다.
상기 배양된 세포를 원심분리하여 상등액을 각각 100 ml 취하고, AKTA
Prime (GE healthcare)를 이용하여 정제하였다. AKTA Prime에 HiTrap MabSelect SuRe 컬럼 (GE healthcare. 11-0034-95)을 설치하고 배양액을 5 ml/min의 유속으로 홀려준 후, IgG e hit ion buffer (Thermo Scientific,
21004)로 용출시킨 다음, 얻어진 용출물을 PBS 버퍼로 교환하였다.
상기 제작된 항 -c-Met 항체 SAIT3()1의 cᅳ말단에 3종의 항 -Nrpl scFv가 각각 융합된 항 -c-Met/항 -Nrpl 이중 특이 항체를 아래의 표 7에 정리하였다.
【표 7】 이증항체 항 -c-Met 항체 항" "Nrpl scFv 증쇄 경쇄
MN02 1A03 서열번호 145
麵: 서열번호 148)
03 3H10 서열번호 146
SAIT301 서열번호 68
(DNA: 서열번호 149)
N04 4F12 서열번호 147
(DNA: 서열번호 150) 실시예 2: 항 -c-Met/항 -Nrpl 이중 특이 항체의 c-Met 및 Nrpl에 대한 결합 친화도
상기 실시예 1 에서 제작된 3종의 항 -c-Met/항 -Nrpl 이중 특이 항체의 c-Met에 대한 친화도를 Biacore TIOO(GE)을 사용하여 각각 확인하였다. 인간 Fab 결합제 (#28-9583-25. GE Healthcare)를 CM5 칩 (#BR- 1005-30, GE)의 표면에 제조사 설명서에 따라서 고정화시켰다. 약 90 120 RU의 이중 특이 항체 MA01를 포획하고, 다양한 농도의 C-Met -Fc(#358-MT/CF. R&D Systems)를 상기 포획된 항체에 주입하였다. 여기에 lOmM Glycine-HCKpH 1.5) 용액을 주입하여 상기 표면을 재생시켰다 (regenerated). 친화도를 측정하기 위하여 , 상기 실험에서 얻어진 데이터를 BIAevaluation softvvare(GE Healthcare, Biacore T100 evaluation software)를 사용하여 fitting하였다.
또한, 상기 실시예 1에서 제작된 3종의 항 -c-Met/항 -Nrpl 이중 특이 항체의 Nrpl에 대한 친화도를 Biacore T100(GE)을 사용하여 각각 확인하였다. Anti-histidine antibody (R&D Systems)를 CM5 칩 (#BR- 1005-30, GE)의 표면에 제조사 설명서에 따라서 고정화시켰다. C-terminal hi st idine-tagged human Nrpl (R&D Systems)를 포획하고, 다양한 농도의 이중 특이 항체를 상기 포획된 항원 (Nrpl)에 주입하였다. 여기에 lOniM Glycine-HCl (pH 1.5) 용액을 주입하여 상기 표면을 재생시켰다 (regenerated). 친화도를 측정하기 위하여 . 상기 실험에서 얻어진 데이터를 BIAevaluation soft war e(GE Healthcare. Biacore T100 evaluation software)를 사용하여 fitting하였다.
상기 얻어진 결과를 아래의 표 8에 나타내었다:
【표 8】
이중항체 KD against c-Met KD against Nrpl KD against Nrpl ,
(nM) (nM) scFv. ( iiM )
MN02 0.08 22.31 138.5 MN03 0.09 11.43 67.21
MN04 0.05 0.38 0.62
표 8에서, "KD against c-Met' '은 이중항체의 c-Met에 대한 결합 친화도. "KD against Nrpl"는 이중항체의 Nrpl에 대한 결합친화도. " KD against Nrpl, scFv,' '는 항 -Nrpl scFv의 Nrpl에 대한 결합친화도를 각각 나타낸다.
상기 표 8에서 확인되는 바와 같이 , 항 -c-Met/항 -Ni-pl 이중 특이 항체는 단일 항체에서와 유사한 수준으로 c-Met 및 Nrpl에 대한 결합력을 유지하는 것을 확인할 수 있다. 실시예 3: 항 -c-Met/항 -Nrpl 이중 특이 항체의 암세포 성장 저해 효과 상기 실시예 1에서 제작된 항 -c-Met/항 -Nrpl 이중 특이 항체의 암세포 사멸 효과를 위암 세포주 MKN45를 대상으로 시험하였다.
구체적으로, MKN45 세포 (JCRB0254) 5000개를 배지 (GIBCO RPMI 1640, lOOul/well)를 포함하는 각 웰에 분주하고, 여기에 상기 실시예 1에서 제작된 3종의 이중 특이 항체를 각각 60nM(l treatment for 5 days)의 양으로 5일동안 처리하였다. 세포수 변화는 CellTiter Glo (CTG) assay 를 통해 측정하였다. 구체적으로, 5일동안 인큐베이팅 후 CTG 용액 (Pr에 iega) 100 마이크로리터를 각 웰에 첨가한 후. 실온에서 30분간 인큐베이팅하였다. 상기 얻어진 발광 신호를 Envision 2104 Multi-label Reader (Perkin Elmer , Walt ham, Massachusetts, USA)를 사용하여 기록하였다.
비교를 위하여, 항체 무처리군 (control), 상기 참고예 1에서 제작된 항 -c-Met 항체 SAIT301 단독 처리군 (60nM), 항 -Nrpl 항체 단독 처리군 (1A: 참고예 2.2의 1A03 클론의 6개 CDR 을 포함하는 IgG 항체: 3H: 참고예 2.2의 3H10 클론의 6개 CDR 을 포함하는 IgG 항체; 4F: 참고예 2.2의 4F12 클론의 6개 CDR 을 포함하는 IgG 항체; 각각 60nM)). 및 참고예 1에서 제작된 항 _c- Met 항체 SAIT301와 항 -Nrpl 항체 (1A, 3H, 4F)의 병용 처리군 (각각 60nM))에 대해서도 상기와 동일한 시험을 수행하였다.
상기 얻어진 결과를 도 6에 나타내었다. 도 6에 나타난 바와 같이 , 항- c-Met/항 -Nrpl 이증 특이 항체들은 항 -c-Met 항체 단독 투여 및 항 -Nrpl 항체 단독 투여시는 물론 이들의 병용 투여시보다 우수한 항암 세포 성장 저해 효과를 보이는 것을 확인할 수 있다. 실시예 4: 항 -c-Met/항 -Nrpl 이중 특이 항체에 의한 암세포 전이 억제 실시예 1에서 제작된 항 -c-Met/항 -Nrpl 이중 특이 항체가 암세포 움직임 (motility)에 주는 영향을 관찰하였다. 상기 이중특이항체의 VEGF+HGF 처리에 의한 암세포 이동 (migration)에 대한 억제 효과를 시험하였다. 시험을 위하여 참고예 1에서 제작된 항 -C-Met 항체 SAIT30H1 저항성을 가지는 신장암 세포주 786-0 (ATCC)를 사용하였다 (SAIT301 단독 처리시 항암효과 없음). 항 -c-Met/항 -Nrpl 이중 특이 항체에 의해 VEGF 및 HGF에 의해 유도된 세포 이동이 억제되는지 여부를 확인하기 위해. Oris Migration System(Platypus Thechnologies)을 이용한 세포 이동 어세이 (niigrat ion assay)를 수행하였다.
구체적으로, 신장암 세포주 786—0 (ATCC)를 각 웰당 5으000개의 양으로 stopper가 장착된 96-well plate에 접종하였다. 24시간 동안 배양 후. 상기 stopper를 제거하고, HGF 0.1 ug( microgram) /ml 및 VEGF 0.1 ug/ml가 첨가된 RPMI 배지 (10% FBS 포함: GIBC0)에서 상기 실시예 1에서 제작된 각각의 이중 특이 항체 (각각 60nM)로 24시간 동안 처리하였다. 그 후, 상기 세포들을 Hoechst 33.342 (bisbenzimide; Life Technologies)로 처리하여 가시화시켰다. 세포 이동 (cell niigrat ion)은 Hoechst 33342로 염색된 핵을 갖는 세포 수를 세어서 측정하였다. 세포 수 측정은 InCell Analyzer 6000 (GE Healthcares)를 사용하여 수행하고, 얻어진 결과는 VEGF+HGF만 처리한 군 (100«에 대한 상대값으로 변환시켰다.
비교를 위하여 , 항체 무처리군 (vehicle만 처리. HGF만 처리, VEGF만 처리 . 및 VEGF+HGF만 처리), 상기 참고예 1에서 제작된 항 -c-Met 항체 SAIT301 단독 처리군 (60nM), 및 상기 참고예 2.2에서 제작된 클론의 6개 CDR3을 포함하는 항 -Nrpl 항체 각각의 단독 처리군 (60nM)에 대해서도 동일한 시험을 수행하였다.
상기 얻어진 가시화 결과 (형광 이미지)를 도 7에 나타내고, 도 7의 형광 세기를 정량화한 그래프를 도 8에 나타내었다. 도 7 및 도 8에 나타난 바와 같이, 항 -c-Met/항— Nrpl 이중 특이 항체는 SAIT301와 항 -Nrpl 항체를 각각 단독으로 처리한 경우와 비교하여, VEGF+HGF에 의한 세포 이동 (migration) 억제에 있어서 우수한 상승 효과를 보였다.
또한, 이중 항체의 암전이 저해 효과를 시험하기 위하여 , 신장암 세포주 786-0에 대한 항체의 Invasion 저해 정도를 시험하였다.
항체 처리에 의한 invasion 저해 효과를 확인하기 위하여. BioCoat Growth Factor Reduced MATRIGEL Invasion Chamber (BD science. Cat#. 354483)를 사용하였다. 상기 버는 상부 챔버와 하부 챔버로 나뉘어져 있으며. 상부 챔버는 제조자 설명서 (manufacturer's manual)에 따라서 콜라겐으로 코팅하여 사용하였다.
신장암 세포주 786-0 (ATCC: 105 cells/well)를 상부 챔버에 접종하고. 하부 챔버는 실시예 1에서 제작된 각각의 이중 특이 항체 (각각 60nM)로 처리한 후, 37°C에서 배양하였다. 이 때 하부 버에는 VEGF 또는 HGF를 각각 0.1 ug/ml의 양으로 첨가하였다. 24시간 후. 상부 챔버의 콜라겐 층을 뚫고 하부 버로 이동한 세포를 calcein AM (BD)로 염색한 후 형광 현미경 (ZEISS)으로 관찰하고, 형광 세기를 Envision 2104 Multi-label Reader (Perkin Elmer)로 정량화하였다.
비교를 위하여, 항체 무처리군 (VEGF+HGF만 처리), 상기 참고예 1에서 제작된 항 -c-Met 항체 SAIT301 단독 처리군 (60nM), 및 상기 참고예 2.2에서 제작된 클론의 6개 CDR3을 포함하는 항 -Nrpl 항체 각각의 단독 처리군 (60nM)에 대해서도 동일한 시험을 수행하였다.
상기 얻어진 형광 이미지를 도 9에 나타내고, 형광 세기를 정량화한 그래프를 도 10에 나타내었다. 도 9 및 도 10에 나타난 바와 같이, 항 -C- Met/항 -Nrpl 이중 특이 항체들은 항 -c-Met 항체 단독 투여 및 항 -Nrpl 항체 단독 투여시는 물론 이들의 병용 투여시보다 우수한 암세포 invasion 저해 효과를 보이는 것을 확인할 수 있다. 실시예 5: 항 -c-Met/항 -Nrpl 이중 특이 항체에 의한 항 -c-Met 항체 저항성 극복 시험
항 -c-Met/항 -Nrpl 이중 특이 항체의 c-Met 표적 치료제에 대한 저항성 극복 가능성을 확인하기 위하여. 참고예 1에서 제작된 항 -c-Met 항체 SAIT3()1에 저항성을 가지는 신장암 세포주 786-0를 사용하였다 (SAIT301 단독 처리시 항암효과 없음). 실시예 3을 참조하여, 상기 세포 5000개에 실시예 1에서 제작된 이중 특이 항체를 각각 60nM의 농도로 처리하고 3일 이후에 CellTiter Glo assay를 통해 세포수 변화를 측정하였다.
비교를 위하여, 항체 무처리군 (Cont 로 표시), 상기 참고예 1 에서 제작된 항 -c-Met 항체 SAIT301 단독 처리군 (60nM: S301 로 표시), 상기 참고예 2.2 에서 얻어진 4F12 클론의 6 개 CDR 을 포함하는 항 -Nrpl 항체 단독 처리군 (60nM; 4F 로 표시), 및 SAIT301 와 항 -Nrpl 항체의 병용 투여군 (각각 60nM; S+4F로 표시 )에 대해서도 동일한 시험을 수행하였다.
상기 얻어진 결과를 도 11에 나타내었다. 도 11에서 보여지는 바와 같이, 항 -c-Met/항 -Nrpl 이증 특이 항체는 SAIT301와 4F12를 각각 단독으로 처리한 경우 및 이를 병용 투여한 경우와 비교하여. 신장암 세포에서의 c-Met 치료제에 대한 저항성 극복 효과가 우수함을 확인할 수 있다. 실시예 5: 항 -c-Met/항 -Nrpl 이중 특이 항체에 의한 항암제 저항성 극복 시험
항 -c-Met/항 -Nrpl 이증 특이 항체의 항암제 (젬시타빈)에 대한 저항성 극복 가능성을 확인하기 위하여 . 위암 세포주 MKN45에 젬시타빈을 반복 투여하여 젬시타빈 저항성 MKN45 ('MIiN45-Gem Re'로 표시)를 준비하였다.
구체적으로. 상기 MKN45-Gem Re 세포는 다음의 과정으로 준비하였다. MICN45 세포 (ATCC)를 잼시타빈 (Eli Lilly)에 3개월 동안 노출시켰다. 이 때, 젬시타빈은 10 내지 lOOuM 농도 범위에서 농도를 증가시키면서 처리하였다 ( i vitro) . 상기 처리된 세포들이 젬시타빈에 대하여 지속적인 저항성을 갖는지 여부를 확인하기 위하여 , 상기 세포에 젬시타빈을 2주간 처리하여 배양한 군과 처리하지 않고 2주간 배양한 군에서의 세포 생존률을 측정하여 , 상기 세포들이 젬시타빈 처리 여부와 무관한 동등한 정도의 세포 생존률을 보이는 것을 확인하였다.
MKN45 세포 (ATCC; 저항성 없음; 'parental'로 표시). 및 상기 준비된 젬시타빈 저항성 세포주 MKN45-Gem Re를 각각 2xl05 cells/niL의 농도로 60隱 plates 에서 배양하고, 24시간 이후에 lysis buffer (Roche)를 통하여 세포 단백질을 추출하였다. 추출한 세포 단백질 20ug을 웨스턴블랏 젤에 로딩하여 웨스턴블랏을 진행한 뒤 . 항 -c-Met 항체 (abeam), 항 -Nrpl 항체 (Cell signaling), 항 -p-Akt 항체 (Cell signaling), 및 항 -GAPDH 항체 (Cell signaling)를 각각 사용하여 각각의 단백질을 검출하였다.
상기 얻어진 결과를 도 12에 나타내었다.
도 12에 나타난 바와 같이, 젬시타빈 저항성이 유도된 경우, Nrpl 발현 수준이 증가한 것을 확인할 수 있다.
실시예 3을 참조하여. MKN45와 MKN45-Gem Re 세포를 각각 5000개씩 준비하고, 여기에 실시예 1에서 제작된 이중 특이 항체를 각각 0.2. 1, 또는 5 ug/niL의 농도로 처리하고 3일 이후에 CellTiter Glo assay를 통해 세포수 변화를 측정하였다.
비교를 위하여 , 상기 참고예 1에서 제작된 항 -c_Met 항체 SAIT301 단독 처리군에 대해서도 동일한 시험을 수행하였다.
상기 얻어진 결과를 도 13에 나타내었다. 도 13에서 보여지는 바와 같이 , 항 -c— Met/항 -Nrpl 이중 특이 항체는 SAIT301 단독 처리시보다 MKN45와 M1(N45-Gem Re 세포 모두에서 세포 증식 저해 효과가 우수하게 나타났으며 , 이는 항 -c-Met/항— Nrpl 이중 특이 항체가 항암제 저항성 극복 효과가 우수함을 보여주는 것이라고 할 수 았다.
' 잼시타빈 저항성 MKN45 세포주에 항 -c-Met/항 -Nrpl 이중 특이 항체 처리시 c-Met 및 Nrpl 총량 변화를 시험하였다.
상기 준비된 MKN45-Gem Re 세포를 2xl05 cells/mL의 농도로 60隱 plates 에서 배양하고. 24시간 이후에 상기 실시예 1에서 제작된 이중 특이 항체를 각각 5ug/mL의 농도로 24시간 동안 처리한 후, 상기 세포에 lysis buffer (Roche)를 처리하여 세포 단백질을 추출하였다. 추출한 단백질 20ug을 웨스턴블랏 젤에 로딩하여 웨스턴블랏을 진행한 뒤, 항 -c-Met 항체 (abeam), 항 -Nrpl 항체 (Cell signaling), 및 항 -GAPDH 항체 (Cell signaling)를 사용하여 각각의 단백질을 검출하였다.
비교를 위하여, 상기 이중 특이 항체 대신에, PBS를 처리한 군, 참고예 1에서 제작된 SAIT301 항체를 처리한 군 및 참고예 2.2에서 제작된 클론의 6개의 CDR을 포함하는 각각의 항 -Nrpl 항체를 처리한 군에 대해서도 동일한 시험을 수행하였다. 상기 얻어진 웨스턴블랏 결과를 도 14에 나타내었다. 도 14에 나타난 바와 같이 . MKN45-Gem Re 세포에 항— c-Met/항 -Nrpl 이중 특이 항체 처리시, 항 c-Met 항체 및 항 Nrpl 항체를 처리한 경우와 비교하여, c-Met 과 Nprl의 총량이 현저히 감소한 것을 확인할 수 있으며, 이는 상기 이중항체가 항원의 internalization 및 degradation 효과를 가짐을 보여주는 것이다.

Claims

【청구범위】
【청구항 1】
항 -c-Met 항체 또는 이의 항원 결합 단편 및 항 -Nrpl 항체 또는 이의 항원 결합 단편을 포함하고,
상기 항 -c-Met 항체 또는 이의 항원 결합 단편은 서열번호 기의 아미노산 서열 내의 서열번호 73의 아미노산 서열을 포함하는 연속하는 5 내지 19개 아미노산으로 이루어진 에피토프에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편이고,
상기 항 -Nrpl 항체 또는 이의 항원 결합 단편은 서열번호 139의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-H1) , 서열번호 140의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-H2) . 서열번호 141의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-H3) , 서열번호 142의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-L1 ) , 서열번호 143의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-L2) , 및 서열번호 144의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-L3)을 포함하는 항체 또는 이의 항원 결합 단편인,
항 -c-Met/항 -Nrpl 이중 특이 항체.
【청구항 2】
제 1항에 있어서. 상기 항 -Nrpl 항체 또는 이,의 항원 결합 단편은 서열번호 110 또는 121의 아미노산 서열을 포함하는 폴리펩타이드 (CDR- HI ) ,
서열번호 111. 116. 또는 122의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-H2) ,
서열번호 112, 117 또는 123의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-H3) ,
서열번호 113 , 118. 또는 124의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-L1) ,
서열번호 114 , 119 , 또는 125의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-L2) . 및
서열번호 115, 120 , 또는 126의 아미노산 서열을 포함하는 폴리펩타이드 (CDR-L3) 을 포함하는 것인, 항 -c-Met/항 -Nrpl 이중 특이 항체.
【청구항 3】
제 2항에 있어서. 상기 항 -Nrpl 항체 또는 이의 항원 결합 단편은, 서열번호 127, 129, 또는 131의 아미노산 서열을 포함하는 중쇄 가변영역 및
서열번호 '128, 130, 또는 132의 아미노산 서열을 포함하는 경쇄 가변영역
을 포함하는 것인. 항 -c-Met/항 -Nrpl 이증 특이 항체.
【청구항 4]
제 1항에 있어서, 상기 항 -Nrpl 항체 또는 이의 항원 결합 단편은, 서열번호 110 (CDR-H1), 111 (CDR-H2). 112 (CDR-H3), 113 (CDR-L1). 114 (CDR-L2). 및 115 (CDR-L3)의 아미노산 서열을 포함하거나.
서열번호 110 (CDR-H1). 116 (CDR-H2). 117 (CDR-H3), 118 (CDR-L1). 119 (CDR-L2), 및 120 (CDR-L3)의 아미노산 서열을 포함하거나,
서열번호 121 (CDR-H1). 122 (CDR-H2), 123 (CDR-H3), 124 (CDR-L1),
125 (CDR-L2), 및 126 (CDR-L3)의 아미노산 서열을 포함하는 것인,
항 -c-Met/항 -Nrpl 이중 특이 항체.
【청구항 5】
제 4항에 있어서 . 상기 항 -Nrpl 항체 또는 이의 항원 결합 단편은, 서열번호 127의 중쇄 가변영역 및 서열번호 128의 경쇄 가변영역을 포함하거나.
서열번호 129의 중쇄 가변영역 및 서열번호 130의 경쇄 가변영역을 포함하거나,
서열번호 131의 중쇄 가변영역 및 서열번호 132의 경쇄 가변영역을 포함하는 것인,
항 -c-Met/항 -Nrpl 이중 특이 항체.
【청구항 6】
제 1항에 있어서 . 상가 항 -c-Met 항체 또는 이의 항원 결합 단편은, 서열번호 4의 아미노산 서열을 포함하는 CDR-H1.
서열번호 5의 아미노산 서열. 서열번호 2의 아미노산 서열, 또는 서열번호 2의 아미노산 서열 내의 3번째부터 10번째까지의 아미노산을 포함하는 연속하는 8 내지 19개의 아미노산으로 이루어진 아미노산 서열을 포함하는 CDRᅳ H2.
서열번호 6의 아미노산 서열, 서열번호 85의 아미노산 서열. 또는 서열번호 85의 아미노산 서열 내의 1번째부터 6번째까지의 아미노산을 포함하는 연속하는 6 내지 13개의 아미노산으로 이루어진 아미노산 서열을 포함하는 CDR-H3,
서열번호 7의 아미노산 서열을 포함하는 CDR-L1,
서열번호 8의 아미노산 서열을 포함하는 CDR-L2. 및
서열번호 9의 아미노산 서열, 서열번호 15의 아미노산 서열, 서열번호
86의 아미노산 서열 , 또는 서열번호 89의 아미노산 서열 내의 1번째부터 9번째까지의 아미노산을 포함하는 9 내지 17개의 아미노산으로 이루어진 아미노산 서열을 포함하는 CDR-L3
을 포함하는 것인, 항 -c-Met/항 -Nrpl 이증 특이 항체:
【청구항 7】
제 6항에 있어서, 상기 항 -c-Met 항체 또는 이의 항원 결합 단편은. 서열번호 1, 서멸번호 22, 서열번호 23 및 서열번호 24로 이루어진 군에서 선택된 CDR-H1,
서열번호 2, 서열번호 25, 및 서열번호 26으로 이루어진 군에서 선텍된 CDR-H2,
서열번호 3. 서열번호 27, 서열번호 28, 및 서열번호 85로 이루어진 군에서 선택된 CDR-H3,
서열번호 10, 서열번호 29, 서열번호 30, 서열번호 31. 서열번호 32, 서열번호 33. 및 서열번호 106으로 이루어진 군에서 선택된 CDR-L1,
서열번호 11, 서열번호 34. 서열번호 35. 및 서열번호 36으로 이루어진 군에서 선택된 CDR-L2, 및
서열번호 12, 서열번호 13, 서열번호 14, 서열번호 15, 서열번호 16, 서열번호 37, 서열번호 86, 및 서열번호 89로 이루어진 군에서 선택된 CDR-L3 을 포함하는 것인, 항 -c-Met/항ᅳ Nrpl 이중 특이 항체.
【청구항 8】 제 7항에 있어서, 상기 항 -c-Met 항체 또는 이의 항원 결합 단편은. 서열번호 17, 서열번호 74, 서열번호 87, 서열번호 90, 서열번호 91, 서열번호 92, 서열번호 93 또는 서열번호 94의 아미노산 서열을 포함하는 중쇄 가변 영역. 및
서열번호 109, 서열번호 18. 서열번호 19, 서열번호 20, 서열번호 21, 서열번호 75, 서열번호 88. 서열번호 95, 서열번호 96, 서열번호 97, 서열번호 98, 서열번호 99 또는 서열번호 107의 아미노산 서열을 포함하는 경쇄 가변 ᄋ 3 OJ
0 ᄀ
을 포함하는 것인, 항 -c-Met/항 -Nrpl 이중 특이 항체.
【청구항 9】
제 1항 내지 제 8항 증 어느 한 항에 있어서.
상기 항원 결합 단편은 scFv. (scFv)2, scFv-Fc , Fab. Fab' 및 F(ab')2로 이루어진 군에서 선택되는 것인,
항 -c-Met/항— Nrpl 이중 특이 항체.
【청구항 10】
제 1항 내지 제 8항 중 어느 한 항에 있어서,
상기 항 -c-Met 항체 및 항 -Nrpl 항체는 각각 마우스 유래 항체, 마우스 -인간 키메릭 항체, 인간화 항체, 또는 인간 항체인,
항 -c_Met/항 -Nrpl 이중 특이 항체.
【청구항 11】
제 1항 내지 제 8항 중 어느 한 항에 있어서 .
IgG 형태의 항 -c-Met 항체 및 상기 항 -c-Met 항체의 Fc의 C 말단에 연결된 항 -Nrpl 항체의 항원 결합 단편을 포함하는,
항 -c-Met/항 -Nrpl 이중 특이 항체.
【청구항 12】
제 1항 내지 제 8항 중 어느 한 항의 항 -c-Met/항 -Nrpl 이중 특이 항체를 유효성분으로 포함하는, 암 또는 암 전이의 예방 또는 치료용 약학적 조성물.
【청구항 13】
제 12항에 있어서, 상기 암은 항암제 저항성 암인, 약학적 조성물.
【청구항 14】
5 T 제 1항의 항 -c-Met /항- Nrpl 이중 특이 항체를 암 또는 암 전이의 예방 또는 치료를 필요로 하는 환자에게 투여하는 단계를 포함하는. 암 또는 암 전이의 예방 또는 치료 방법 .
【청구항 15]
제 14항에 있어서. 상기 암은 항암제 저항성 암인. 방법 .
【청구항 16]
제 1항의 항 -c-Met /항 -Nrpl 이중 특이 항체를 항암제 저항성 극복을 필요로 하는 환자에게 투여하는 단계를 포함하는, 항암제 저항성 극복 방법.
【청구항 17】
암 또는 암 전이의 예방 또는 치료에 사용하기 위한 제 1항 내지 제 11항 중 어느 한 항의 항 -c-Met/항 -Nrpl 이중 특이 항체.
【청구항 18]
제 17항에 있어서. 상기 암은 항암제 저항성 암인, 항 -c-Met /항 -Nrpl 이증 특이 항체.
【청구항 19】
항암제 저항성 극복에 사용하기 위한 게 1항 내지 제 n항 중 어느 한 항의 항 -C-Met /항 -Nrpl 이중 특이 항체.
PCT/KR2016/010376 2016-06-03 2016-09-13 항 -cᅳ Met/항 -Nrp1 이중 특이 항체 Ceased WO2017209351A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020160069648A KR101985299B1 (ko) 2016-06-03 2016-06-03 항-c-Met/항-Nrp1 이중 특이 항체
KR10-2016-0069648 2016-06-03

Publications (1)

Publication Number Publication Date
WO2017209351A1 true WO2017209351A1 (ko) 2017-12-07

Family

ID=60478818

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/010376 Ceased WO2017209351A1 (ko) 2016-06-03 2016-09-13 항 -cᅳ Met/항 -Nrp1 이중 특이 항체

Country Status (2)

Country Link
KR (1) KR101985299B1 (ko)
WO (1) WO2017209351A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024102187A1 (en) * 2022-11-07 2024-05-16 Pinetree Therapeutics, Inc. Combination therapy comprising bispecific antibodies comprising an nrp1 binding domain
WO2025029618A1 (en) * 2023-07-28 2025-02-06 Pinetree Therapeutics, Inc. Non-receptor tyrosine kinase compositions for targeted lysosomal degradaton and methods of use thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013007667A1 (en) * 2011-07-11 2013-01-17 Roche Diagnostics Gmbh An antibody specifically binding to neuropilin-1
KR20130120439A (ko) * 2010-07-09 2013-11-04 제넨테크, 인크. 항-뉴로필린 항체 및 사용 방법
KR20140119317A (ko) * 2013-03-28 2014-10-10 삼성전자주식회사 c-Met 항체 및 VEGF 결합 단편이 연결된 융합 단백질
WO2015103072A1 (en) * 2013-12-30 2015-07-09 Epimab Biotherapeutics Fabs-in-tandem immunoglobulin and uses thereof
KR20150087365A (ko) * 2012-11-21 2015-07-29 얀센 바이오테크 인코포레이티드 이중특이성 EGFR/c-Met 항체

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
UA96139C2 (uk) 2005-11-08 2011-10-10 Дженентек, Інк. Антитіло до нейропіліну-1 (nrp1)
KR20150000794A (ko) * 2013-06-25 2015-01-05 삼성전자주식회사 단백질 복합체, 이를 포함하는 c-Met과 Her-3에 대한 이중특이 항체, 및 그 제조 방법
WO2016089126A1 (ko) 2014-12-03 2016-06-09 사회복지법인 삼성생명공익재단 뉴로필린 1(Neuropilin 1)에 대한 항체 및 이의 용도

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130120439A (ko) * 2010-07-09 2013-11-04 제넨테크, 인크. 항-뉴로필린 항체 및 사용 방법
WO2013007667A1 (en) * 2011-07-11 2013-01-17 Roche Diagnostics Gmbh An antibody specifically binding to neuropilin-1
KR20150087365A (ko) * 2012-11-21 2015-07-29 얀센 바이오테크 인코포레이티드 이중특이성 EGFR/c-Met 항체
KR20140119317A (ko) * 2013-03-28 2014-10-10 삼성전자주식회사 c-Met 항체 및 VEGF 결합 단편이 연결된 융합 단백질
WO2015103072A1 (en) * 2013-12-30 2015-07-09 Epimab Biotherapeutics Fabs-in-tandem immunoglobulin and uses thereof

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024102187A1 (en) * 2022-11-07 2024-05-16 Pinetree Therapeutics, Inc. Combination therapy comprising bispecific antibodies comprising an nrp1 binding domain
WO2025029618A1 (en) * 2023-07-28 2025-02-06 Pinetree Therapeutics, Inc. Non-receptor tyrosine kinase compositions for targeted lysosomal degradaton and methods of use thereof

Also Published As

Publication number Publication date
KR101985299B1 (ko) 2019-09-03
KR20170137470A (ko) 2017-12-13

Similar Documents

Publication Publication Date Title
JP6359372B2 (ja) DARPinを含む二重特異キメラ蛋白質
AU2012319299B2 (en) Anti c-Met antibody and uses thereof
US9808507B2 (en) Anti-c-Met/anti-Ang2 bispecific antibody
TWI402078B (zh) 抗csf-1r抗體
US9505843B2 (en) Anti-Her3 scFV fragment and bispecific anti-c-Met/anti-Her3 antibodies comprising the same
CN113227135A (zh) 用于治疗癌症和其他疾病的对紧密连接蛋白18.2具有特异性的结合分子、其组合物和方法
WO2020143836A1 (zh) Cd73抗体及其制备方法和应用
WO2020011275A1 (zh) 一种sema4d抗体及其制备方法和应用
KR102349370B1 (ko) 인간화 또는 친화도 성숙된 항 앤지오포이에틴-2 항체 및 그의 용도
JP6636684B2 (ja) c−Met抗体およびVEGF結合断片が連結された融合タンパク質
JP2017520575A (ja) 二重特異的ヘテロ二量体ダイアボディおよびその使用
US10246507B2 (en) Polypeptide, anti-VEGF antibody, and anti-c-Met/anti-VEGF bispecific antibodies comprising the same
JP6689847B2 (ja) がんの治療における使用のための抗−ck8抗体
KR20230132544A (ko) 신규한 항-그렘린1 항체
TW202208438A (zh) 抗lilrb1抗體或其抗原結合片段、製備其的方法、藥物組成物、核酸分子、重組載體以及重組細胞
US10000569B2 (en) Anti-cMet/anti-EGFR/anti-HER3 multispecific antibodies and use thereof
KR102486507B1 (ko) 플렉틴-1 결합 항체 및 그의 용도
CN114746451A (zh) TGFβ/PD-L1双特异性结合蛋白
JP2022528007A (ja) PDL1及びTGFβに対する二機能性融合タンパク質並びにその使用
CN118047871A (zh) 一种靶向FRα的抗体或其抗原结合片段及其应用
WO2017209351A1 (ko) 항 -cᅳ Met/항 -Nrp1 이중 특이 항체
KR101854529B1 (ko) 인간 및 마우스 Sema3A에 교차결합하는 항체 및 그의 용도
JP2017501723A (ja) 新規な抗adam17抗体および癌の治療におけるその使用
US20180057601A1 (en) Novel humanized adam17 antibody
CN112500491A (zh) 一种特异性中和辅助性T细胞TGF-β信号的双特异性抗体、其药物组合及其用途

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16904150

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16904150

Country of ref document: EP

Kind code of ref document: A1