WO2017209351A1

WO2017209351A1 - Bispecific anti-c-met/anti-nrp1 antibody

Info

Publication number: WO2017209351A1
Application number: PCT/KR2016/010376
Authority: WO
Inventors: 이승현; 남도현
Original assignee: 삼성전자 주식회사; 사회복지법인 삼성생명공익재단
Priority date: 2016-06-03
Filing date: 2016-09-13
Publication date: 2017-12-07
Also published as: KR20170137470A; KR101985299B1

Abstract

Provided are: a bispecific anti-c-Met/anti-Nrp1 antibody comprising an anti-c-Met antibody or an antigen binding fragment thereof, and an anti-Nrp1 antibody or an antigen binding fragment thereof; and a pharmaceutical composition containing the same.

Description

【Specification】

[Name of invention]

Anti-c-Met / Anti-Nrpl Bispecific Antibodies

An anti-c-Met / anti-Nrpl bispecific antibody comprising an anti-c-Met antibody or antigen-binding fragment thereof and an anti-Nrpl antibody or antigen-binding fragment thereof, and a pharmaceutical composition comprising the same are provided. [Background technology]

Neuropilin (Nrp) is a protein receptor that is active in neurons. There are two types, Nrpl and Nrp2. Νι · ρ1 is composed of about 923 amino acids, Nrp2 is composed of about 926 amino acids. It has a similar domain structure in common. It is known to have amino acid homology of 44 as a whole.

Among these, Nrpl is a receptor that binds to a semaphorin 3A ligand, which initially interacts with the flexin co-receptor to regulate axon induction. Nrpl binds to vascular endothelial growth factor (VEGF) and mediates angiogenesis. Nrpl is expressed in various types of human tumor cell lines and human tumors (glioblastoma, astrocytoma, glioma, neuroblastoma, testicular cancer, colorectal cancer, melanoma, pancreatic cancer, lung cancer, breast cancer, esophageal cancer and prostate cancer, etc.). It is involved in the effects of VEGF and semaphorin on the proliferation, survival and migration of cancer cells. In addition, depending on the degree of Nrpl expression, the degree of cancer progression increases. The prognosis for cancer patients is known to be poor.

Meanwhile. c-Met is a representative RTK (Receptor Tyrosine Kinase) on the cell surface. In combination with its ligand, HGF / SF (Hepatocyte Growth Factor / Scattering Factor), it promotes intracellular signaling and promotes cell growth and overexpresses many types of cancer cells, resulting in cancer. Cancer metastasis cancer cell migration, cancer cell infiltration. It is also widely involved in neovascularization. Also. C-Met signaling through HGF / SF is a representative early stage of cancer metastasis that weakens the cell-cell contact of almost all types of epithelial tumors and causes scattering. Protein.

therefore . Targeting both Nrpl and C-Met will be able to more effectively inhibit the growth and metastasis of cancer cells, which is why the development of drugs targeting both Nrpl and c-Met is required.

[Content of invention]

[Problem to solve]

One example provides an anti-c-Met / anti-Nrpl bispecific antibody comprising an anti-c-Met antibody or antigen binding fragment thereof and an anti-Nrpl antibody or antigen binding fragment thereof.

The anti-c-Met antibody or antigen-binding fragment thereof is an antibody or antigen-binding fragment thereof that specifically binds to an epitope consisting of five or more contiguous amino acids including “EEPSQ '′ in the SEMA domain of the c-Met protein. .

Another example provides a pharmaceutical composition comprising the anti-c-Met / anti-Nrpl dual specific antibody as an active ingredient.

Another example includes administering to a patient a pharmaceutically effective amount of an anti-c-Met / anti-Nrpl bispecific antibody. Provided are methods for the prevention and / or treatment of diseases associated with overproduction (eg overexpression) and / or abnormal activation of c-Met and / or Nrpl.

Said anti-c-Met / anti-Nrpl bispecific antibody. Pharmaceutical compositions. Or the method is a disease associated with overproduction (eg. Overexpression) and / or abnormal activation of c-Met and / or Nrpl. For example, it can be used for the prevention and / or treatment of cancer or cancer metastasis. The cancer may be cancer having resistance to anticancer agents.

Another example provides a pharmaceutical composition for overcoming anticancer drug resistance comprising the anti-c—Met / anti-Nrpl bispecific antibody as an active ingredient.

Another example includes administering to a patient a pharmaceutically effective amount of an anti-c-Met / anti-Nrpl bispecific antibody. Provides a method for overcoming anticancer drug resistance. Another example provides the use of the anti-c-Met / anti-Nrpl bispecific antibody to overcome anticancer drug resistance. [Measures of problem]

c-Met is a representative RTK (Receptor Tyrosine Kinase) present on the cell surface and is known to be involved in cell growth, cancer development, cancer metastasis and neovascularization. Nrpl is also known to play a role in cell growth, cancer metastasis, and neovascularization.

Therefore, the present specification proposes to simultaneously target C—Met and Nrpl, thereby enhancing anticancer and / or anticancer effect of cancer.

Also. By simultaneously targeting c-Met and Nrpl involved in cancer cell growth. It is proposed that resistance can be overcome in cancers showing innate resistance and / or acquired resistance to existing anticancer agents.

First, one example provides an anti-c-Met / anti-Nrpl dual specific antibody comprising an anti-c-Met antibody or antigen binding fragment thereof and an anti-Nrpl antibody or antigen binding fragment thereof. The bispecific antibody may exert an anticancer effect and / or a cancer metastasis inhibiting effect by simultaneously recognizing and binding c-Met and Nrpl to inhibit function.

In the present invention, the term "antibody" means a substance produced by stimulation of an antigen in the immune system, and is produced in vivo. Recombinantly generated. Or it may be artificially synthesized, the kind is not particularly limited. In the present invention, the antibody is an animal antibody. Chimeric antibodies, humanized antibodies, or human antibodies. In the present invention, the antibody also includes an antigen-binding fragment of an antibody having antigen-binding ability. Meanwhile. "Complementarity determining regions (Complementarity-determining regions. CDR), the term" is a portion which from the variable regions of the antibodies giving the binding specificity of the antigen means ^■. "Antigen binding fragment" is one or more of the complementarity determining regions Antibody fragments, including, for example, scFv, (scFv) 2, scFv-Fc.Fab.Fab 'and F (ab') 2 can be selected from the group consisting of.

In the following description of the anti-c-Met antibody or antigen-binding fragment thereof and the anti-Nrpl antibody or antigen-binding fragment thereof, all of the subtypes except for the heavy chain and light chain CDR regions, or the heavy chain variable region and the light chain variable region are all subtypes. of And immunoglobulins (eg, IgA, IgD, IgE, IgG (IgGl, IgG2, IgG3. IgG4), Ig, etc.). For example, it may be derived from the light chain constant region and / or heavy chain constant region of the immunoglobulin of all the above subtypes.

One target of the bispecific antibodies provided herein "c-Met" refers to receptor tyrosine kinases that bind to hepatocyte growth factor. The c-Met protein may be from any species, for example from a primate such as human c-Met (eg NP_000236.2), monkey c-Met (eg Macaca mulatta, NP—001162100) and the like. Or mouse c-Met (eg, NP-032617.2). Rodents such as rat _C -Met (eg NP-113705.1) and the like. The protein is, for example, a polypeptide encoded by the nucleotide sequence provided in GenBank Aceession Number NM_000245.2, or a protein having an amino acid sequence provided in GenBank Aceession Number NM_000236.2. Or its extracellular domain. Receptor tyrosine kinase c-Met, for example, cancer development, cancer metastasis. Cancer cell migration, cancer cell infiltration. It is involved in various mechanisms such as angiogenesis process.

Another target of the bispecific antibodies provided herein is "Nrpl", which binds to vascular endothelial growth factor (VEGF) and mediates angiogenesis. It is expressed in various types of human tumor cell lines and human tumors (glioblastoma, astrocytoma, glioma, neuroblastoma, testicular cancer, colon cancer, melanoma, pancreatic cancer, lung cancer, breast cancer, esophageal cancer and prostate cancer, etc.), VEGF and semaphorin Is involved in the proliferation, survival and migration of cancer cells. Nrpl may be derived from a mammal, including humans, primates such as monkeys, rodents such as rats, mice, and the like, for example, human-derived human Nrpl (amino acid sequence: NCBI Accession # NP— 001019799.1: coding polynucleotide sequence: NCBI Accession) # NM_001024628.2; etc.), Mouse Nrpl from mouse (amino acid sequence: Accession # NP-032763.2; coding polynucleotide sequence: NCBI Accession # NM_008737.2; etc.), and the like.

Anti-Nrpl antibodies or antigen-binding fragments thereof included in the bispecific antibodies provided herein have the property of internalizing after binding to Nrpl expressed on the surface of a cell (eg, a cancer cell). In the following examples, the anti- The Nrpl antibody was bound to Nrpl expressed on the surface of cancer cells and then internalized into cells. Unlike conventional antibodies that bind to Nrpl on the cell surface and block subsignal signaling at that site. The antibodies provided herein bind to Nrpl on the cell surface and enter the cell, thereby reducing the absolute amount of Ni-pl present on the cell surface. It can block all signaling related to Nrpl. More therapeutic effects can be expected than conventional antibodies.

The anti-Nrpl antibody or antigen-binding fragment thereof,

A polypeptide comprising the amino acid sequence of SEQ ID NO: 139 (CDR-H1), a polypeptide comprising the amino acid sequence of SEQ ID NO: 140 (CDR-H2). And a polypeptide comprising the amino acid sequence of SEQ ID 141. A heavy chain complementarity determining region (CDR) comprising at least one selected from the group consisting of (CDR-H3), or a heavy chain variable region comprising the heavy chain complementarity determining region:

A polypeptide comprising the amino acid sequence of SEQ ID 142 (CDR-L1). Light chain complementarity comprising at least one selected from the group consisting of a polypeptide comprising the amino acid sequence of SEQ ID NO: 143 (CDR-L2) and a polypeptide comprising the amino acid sequence of SEQ ID NO: 144 (CDR-L3) A light chain variable region including a crystal region or the light chain complementarity crystal region;

A combination of the at least one heavy chain complementarity determining site and the at least one light chain complementarity determining site; or

Combination of the repetitive variable region and the light chain variable region

It may be to include:

[SEQ ID NO: 139]

Xaal Tyr Xaa2 Met Ser (Xaal is Ser or Gly, Xaa2 is Tyr or Ala) [SEQ ID NO: 140]

Xaa3 lie Ser Pro Gly Ser Xaa4 Xaa5 Xaa6 Tyr Tyr Ala Asp Ser Val Xaa7 Gly (Xaa3 is Ala or Gly.Xaa4 is Gly or Ser, Xaa5 is Ser or Asn, Xaa6 is Thr or Lys.

[SEQ ID NO: 141]

Arg Lys Xaa8 Xaa9 Phe Asp Tyr (Xaa8 is Thr, Lys. Or Tyr. Arg. Ser, or Met)

[SEQ ID NO: 142]

XaalO Gly Xaall Ser Ser Asn lie Gly Asn Asn Xaal2 Val Xaal3 (XaalO is Ser or Thr, Xaall is Pro or Ser, Xaal2 is Ser or Asp, Xaal3 is Ser or Tyr)

[SEQ ID NO: 143]

Xaal4 Xaal5 Xaal6 Xaal7 Arg Pro Ser (Xaal4 is Ser or Ala, Xaal5 is Asp or Asn, Xaal6 is Asn or Ser, Xaal7 is Asn or Lys)

[SEQ ID NO: 144]

XaalS Xaal9 Trp Xaa20 Xaa21 Ser Leu Xaa22 Xaa23 Tyr Val (Xaal8 is

Ala or Gly, Xaal9 is Ala or Ser, Xaa20 is Asp or Val, Xaa21 is Ser or Ala, Xaa22 is Asn or Ser Xaa23 is Gly or Ala).

More specifically, the anti—Nrpl antibody or antigen-binding fragment thereof is a polypeptide (CDR-HI) comprising the amino acid sequence of SEQ ID NO: 110 or 121. One selected from the group consisting of a polypeptide comprising the amino acid sequence of SEQ ID NO: 111, 116, or 122 (CDR-H2), and a polypeptide comprising the amino acid sequence of SEQ ID NO: 112. 117 or 123 (CDR-H3) ^'heavy chain complementarity determining region comprising at least, or the heavy chain variable region comprising the heavy chain complementarity determining region; And / or

Polypeptide (CDR-L1) comprising the amino acid sequence of SEQ ID NO: 113. 118, or 124, polypeptide (CDR-L2) comprising the amino acid sequence of SEQ ID NO: 114, 119, or 125, and SEQ ID NOs: 115, 120 Or a light chain complementarity determining region comprising one or more selected from the group consisting of a polypeptide comprising the amino acid sequence of 126 (CDR— L3). Or a light chain variable region comprising the light chain complementarity determining region

It may be to include.

Specifically, the complementarity determining site of the anti-Nrpl antibody or antigen-binding fragment thereof may be, for example, having the amino acid sequence of Table 1 below. Table 1

In one example. The anti-Nrpl antibody or antigen-binding fragment thereof

A variable region comprising the amino acid sequence of SEQ ID 127, 129, or 131;

A light chain variable region comprising the amino acid sequence of SEQ ID 128. 130, or 132; or

Combination of these

It may be to include.

In one embodiment. The anti-Nrpl antibody or antigen-binding fragment thereof is SEQ ID NO: 110 (CDR-H1), 111 (CDR-H2), 112 (CDR-H3). 113 (CDR-L1),

Or comprise the amino acid sequence of 114 (CDR-L2), and 115 (CDR-L3),

SEQ ID NOs: 110 (CDR-H1), 116 (CDR-H2), 117 (CDR-H3), 118 (CDR-L1),

Amino acid sequences of 119 (CDR-L2), and 120 (CDR-L3), or

SEQ ID NO: 121 (CDR-H1). 122 (CDR-H2), 123 (CDR-H3). 124 (CDR-L1),

And may comprise the amino acid sequence of 125 (CDR-L2), and 126 (CDR—L3). In another embodiment, the anti-Nrpl antibody or antigen-binding fragment thereof comprises a heavy chain variable region of SEQ ID NO: 127 and a light chain variable region of SEQ ID NO: 128 _,

Or a light chain variable region of SEQ ID NO: 129 and a light chain variable region of SEQ ID NO: 130;

The heavy chain variable region of SEQ ID NO: 131 and the light chain variable region of SEQ ID NO: 132 may be included.

The anti-c-Met antibody may be in a specific site of c-Met, such as in the SEMA domain. It may ^be, for recognizing a specific epitope region, and can be acted on c-Met cell naeyidong (internalization) and decomposing any antibody or antigen-binding fragment thereof to induce (degradat ion).

C-Met, a receptor for HGFCHepatocyte growth factor, is an extracellular site and a transmembrane site. It is divided into three parts of the intracellular site, and for the extracellular site. Α- and β-subunits are linked by disulfide bonds to form the HGF binding domain, the SEMA domain, the PSI domain (plexin-semaphorins-integrin homology domain), and the IPT dormant 1 (inimunoglobulir like fold shared by p 1 e ί ns and transcriptional factors domain). The SEMA domain of the c-Met protein may be one comprising the amino acid sequence of SEQ ID NO: 79. C—as a domain present at the extracellular site of Met. Corresponds to the site where HGF binds. The region comprising the amino acid sequence of the sequence number group corresponding to a specific site in the SEMA domain, eg, 106-124, may comprise a loop between propeller domains 2 and 3 of the epitopes in the SEMA domain of the c—Met protein. loop) site, and may act as an epitope of an anti-c-Met antibody proposed in the present invention. The term “epitope” is interpreted to mean a portion of the antigen recognized by the antibody as an antigenic determinant. According to one embodiment, the epitope is the SEMA domain of the c-Met protein. A site comprising five or more contiguous amino acids in (SEQ ID NO: 79), eg, a sequence located within SEQ ID NO: 71 corresponding to from 106 to ^' 124 in the SEMA domain (SEQ ID NO: 79) of the c-Met protein For example, the epitope may be composed of 5 to 19 amino acids consecutively including SEQ ID NO: 73 (EEPSQ) in the amino acid sequence of SEQ ID NO. It may be a polypeptide comprising the amino acid sequence of SEQ ID 71, SEQ ID 72 or SEQ ID 73.

The epitope comprising the amino acid sequence of SEQ ID NO: 72 corresponds to the site of the most extensively located loop site between the domains of propeller structures 2 and 3 in the SEMA domain of c-Met protein. The epitope comprising the amino acid sequence of SEQ ID NO: 73 is the site to which the antibody or antigen-binding fragment according to one embodiment most specifically binds. Thus, the anti-c-Met antibody may be one that specifically binds to an epitope comprising 5 to 19 consecutive amino acids comprising SEQ ID NO: 73 (EEPSQ) in the amino acid sequence of SEQ ID NO. It may be an antibody or antigen binding fragment that specifically binds to an epitope comprising the amino acid sequence of SEQ ID 71, SEQ ID 72, or SEQ ID 73.

According to one embodiment, the anti-c-Met antibody is.

CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4. CDR-H2 comprising an amino acid sequence of SEQ ID NO: 5, an amino acid sequence of SEQ ID NO: 2, or an amino acid sequence consisting of consecutive 8 to 19 amino acids comprising the third to tenth amino acids within the amino acid sequence of SEQ ID NO: 2 And a CDR comprising an amino acid sequence of SEQ ID NO: 6, an amino acid sequence of SEQ ID NO: 85, or an amino acid sequence consisting of six to thirteen consecutive amino acids comprising the first to sixth amino acids within the amino acid sequence of SEQ ID NO: 85 At least one heavy chain complementarity determining region (CDR) selected from the group consisting of -H3, or a heavy chain variable region comprising said at least one heavy chain complementarity determining region;

CDR-L1 comprising the amino acid sequence of SEQ ID NO: 7, CDR-L2 comprising the amino acid sequence of SEQ ID NO: 8, and the amino acid sequence of SEQ ID NO: 9, the amino acid sequence of SEQ ID NO: 15. One or more light chain complementarities selected from the group consisting of the amino acid sequence of SEQ ID NO: 86, or CDR-L3 comprising an amino acid sequence consisting of 9 to 17 amino acids comprising the amino acids 1-9 in the amino acid sequence of SEQ ID NO: 89; Decision area. Or a light chain variable region comprising the one or more light chain complementarity determining regions;

A combination of the one or more heavy chain complementarity determining regions and the one or more light chain complementarity determining regions; or

Combination of the heavy chain variable region and the light chain variable region

Including,

SEQ ID NO: 4 to SEQ ID NO: 9 may each be an antibody or antigen binding fragment which is an amino acid sequence represented by the following general formula (I) to (VI):

Formula I

Xaa 厂 Xaa ₂ -Tyr— Tyr-Met-Ser (SEQ ID NO: 4). Formula Π

Arg-Asn-Xaa ₃ -Xaa ₄ -Asn-Gly-Xaa ₅ -Thr (SEQ ID NO: 5),

General formula m

Asp-Asn-Trp-Leu-Xaa ₆ -Tyr (SEQ ID NO: 6),

Formula IV

Lys-Ser-Ser-Xaa7-Ser-Leu-Leu-Ala-Xaa8 ^_ Gly-Asn-Xaa9-Xaaio-Asn-Tyr- Leu-Ala (SEQ ID NO: 7)

Formula V

Trp-Xaan-Ser-Xaai2-Arg-Val-Xaai3 (SEQ ID NO: 8)

Formula VI

Xaai ₄ -Gln-Ser-Tyr-Ser-Xaa ₁₅ -Pro-Xaa ₁₆ -Thr (SEQ ID NO: 9)

In formula I above. 33 ₁ is absent or Pro or Ser, Xaa ₂ is Glu or Asp,

In Formula II, Xaa ₃ is Asn or Lys and Xaa ₄ is Ala or Val. Xaa ₅ is Asn or Thr,

In formula m above. Xaa ₆ is Ser or Thr,

In Formula IV above. Xaa ₇ is His, Arg, Gin or Lys and Xaa ₈ is Ser or Trp. Xaa ₉ is His or Gin and Xaa ₁₀ is Lys or Asn.

In Formula V, Xaa _n is Ala or Gly, and Xaa _ir & Thr or Lys. 33 ₁₃ is Ser or Pro,

In Formula VI, 33 ₁₄ is Gly. Ala or Gin, 33 ₁₅ is Arg, His, Ser, Ala, Gly or Lys, and Xaai ₆ is Leu, Tyr, Phe or Met.

In one embodiment, the CDR-H1 may comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24. The CDR—H2 may include an amino acid sequence selected from the group consisting of SEQ ID NO: 2. SEQ ID NO: 25, and SEQ ID NO: 26. The CDR-H3 may include an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 85.

The CDR-L1 is selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 106 It may include an amino acid sequence. The CDR-L2 may include an amino acid sequence selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36. The CDR-L3 may include an amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15. SEQ ID NO: 16, SEQ ID NO: 37. SEQ ID NO: 86., and SEQ ID NO: 89 .

In one embodiment, the antibody or antigen-binding fragment is a polypeptide (CDR-H1), SEQ ID NO: 2, sequence comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24 A polypeptide (CDR-H2) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 25, and SEQ ID NO: 26, and an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 85 A recoding variable region comprising a polypeptide comprising (CDR-H3); And a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 29, SEQ ID NO: 30. SEQ ID NO: 31. SEQ ID NO: 32. SEQ ID NO: 33 and SEQ ID NO: 106 (CDR-L1). Polypeptide (CDR-L2) comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36, and SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14. SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 37, SEQ ID NO: 86, and SEQ ID NO: 89 may include a light chain variable region comprising a polypeptide (CDR-L3) comprising an amino acid sequence selected from the group.

Therefore. In one embodiment of the present invention, to enhance antigen binding efficiency. Said anti-c-Met antibody or antigen-binding fragment is deleted at least one amino acid. The addition or substitution may include a hinge region in which the amino acid sequence is modified. For example, the antibody may include a hinge region including the amino acid sequence of SEQ ID NO: 100. SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, or SEQ ID NO: 105. More specifically, the hinge region may include an amino acid sequence of SEQ ID NO: 100 or SEQ ID NO: 1. According to one embodiment. The anti-c-Met antibody or antigen binding fragment is SEQ ID NO: 17, SEQ ID NO: 74, SEQ ID NO: 87, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, Said repetitive variable region comprising the amino acid sequence of SEQ ID NO: 93 or SEQ ID NO: 94: SEQ ID NO: 109. SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21. SEQ ID NO: 75, SEQ ID NO: 88, SEQ ID NO: 95, Said light chain variable region comprising the amino acid sequence of SEQ ID 96, SEQ ID 97, SEQ ID 98, SEQ ID 99 or SEQ ID NO: 107. Or a combination of the heavy chain variable region and the light chain variable region.

In one embodiment. The anti-c-Met antibody may be a monoclonal antibody that specifically binds to an extracellular region of the c-Met protein, produced in hybridoma cells with accession number KCLRF-BP-00220. See patent 2011-0047698, which is incorporated herein by reference).

The anti-c-Met antibody may include all of the antibodies defined in Korean Patent Publication Nos. 2011-0047698 and 2013-0037189.

A region excluding a previously defined CDR region or light and variable chain regions of the anti-c-Met antibody. For example, the light chain constant region and heavy chain constant region can be from all subtypes of immunoglobulins (eg, IgA, IgD, IgE, IgG (IgGl, IgG2, IgG3, IgG4), I M., etc.).

According to one embodiment, the anti-c-Met antibody,

. The amino acid sequence of SEQ ID NO: 62 (in this case, the amino acid sequences 1-17 are signal peptides). The amino acid sequence of the 18th to 462th SEQ ID NO: 62, the amino acid sequence of SEQ ID NO: 64 (the first to 17th amino acid sequences in this test is a signal peptide), or the 18th to 461th of SEQ ID NO: 64 An amino acid sequence selected from the group consisting of an amino acid sequence, an amino acid sequence of SEQ ID NO: 66 (wherein the first to seventeenth amino acid sequences are signal peptides), and the amino acid sequence of the eighteenth to 460th amino acid sequences of SEQ ID NO: 66; Heavy chain; And

The amino acid sequence of SEQ ID NO: 68 (the amino acid sequence of 1st to 20th among them is a signal peptide), the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 68, and the amino acid sequence of SEQ ID NO: 70 (the first in this case) To 20th amino acid sequence is a signal peptide), the amino acid sequence from 21st to 240th of SEQ ID NO: 70, and the amino acid sequence of SEQ ID NO: 108 Light chain comprising an amino acid sequence selected from the group consisting of:

It may be to include.

For example, the anti-c-Met antibody,

A heavy chain comprising the amino acid sequence of SEQ ID NO: 62 or the amino acid sequence of Nos. 18 to 462 of SEQ ID NO: 62 and a light chain comprising the amino acid sequence of SEQ ID NO: 68 or the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 68; Antibodies Containing:

A heavy chain comprising the amino acid sequence of SEQ ID NO: 64 or the amino acid sequence of the 18th to 461th sequences of SEQ ID NO: 64 and a light chain comprising the amino acid sequence of SEQ ID NO: 68 or the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 68; Antibody comprising;

From amino acid sequence of SEQ ID NO: 66 or 18th of SEQ ID NO: 66

An antibody comprising a heavy chain comprising the amino acid sequence of the 460th amino acid sequence and a light chain comprising the amino acid sequence of SEQ ID NO: 68 or the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 68;

From amino acid sequence of SEQ ID NO: 62 or 18th of SEQ ID NO: 62

An antibody comprising a heavy chain comprising an amino acid sequence up to 462 and a light chain comprising an amino acid sequence of SEQ ID NO: 70 or an amino acid sequence of SEQ ID NO: 70 from 21 to 240;

From amino acid sequence of SEQ ID NO: 64 or 18th of SEQ ID NO: 64

An antibody comprising a heavy chain comprising an amino acid sequence up to 461 and a light chain comprising an amino acid sequence of SEQ ID NO: 70 or an amino acid sequence of SEQ ID NO: 70 from 21st to 240; or

An antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 66 or the amino acid sequence of the 18th to 460th sequence of SEQ ID NO: 66 and a light chain comprising the amino acid sequence of the 21st to 240th amino acid sequence of SEQ ID NO: 70 or SEQ ID NO: 70;

An antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 62 or the amino acid sequence of the 18th to 462th sequence of SEQ ID NO: 62 and a light chain comprising the amino acid sequence of SEQ ID NO: 108; An antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 64 or the amino acid sequence of the 18th to 461th sequences of SEQ ID NO: 64 and a light chain comprising the amino acid sequence of SEQ ID NO: 108; And

An antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 66 or the amino acid sequence of the 18th to 460th sequence of SEQ ID NO: 66 and a light chain comprising the amino acid sequence of SEQ ID NO: 108

It may be selected from the group consisting of.

On the other hand, the polypeptide comprising the amino acid sequence of SEQ ID NO: 70 is a light chain consisting of a human kappa constant region, the polypeptide comprising the amino acid sequence of SEQ ID NO: 68 is a polypeptide comprising the amino acid sequence of SEQ ID NO: 70 36 (according to kabat numbering, 62nd amino acid position in SEQ ID NO: 68) A histidine is a polypeptide substituted with tyrosine. Due to the substitution. In one embodiment, the yield of the antibody may be increased. In addition, the polypeptide comprising the amino acid sequence of SEQ ID NO: 108 is kabat numbering in the polypeptide comprising the amino acid sequence of the 21st to 240th except for the first to 20th signal peptide of the amino acid sequence of SEQ ID NO: 68 Serine (Ser) at the 27e position (depending on kabat number i rig, position 32 in SEQ ID NO: 108; inside CDR-L1) was substituted with tryptophan (Trp), and according to one embodiment, The activity of the antibody (eg, binding affinity for c-Met, c-Met degrading activity and Akt phosphorylation inhibitory activity, etc.) may be further enhanced.

Hereinafter, description common to the anti-c-Met antibody and anti-Nrpl antibody will be described. Animal-derived antibodies produced by immunizing a desired antigen with an immunized animal can generally cause immunorejection when administered to humans for therapeutic purposes, and chimeric antibodies have been developed to suppress such rejection. Chimeric antibodies are those obtained by replacing the constant regions of animal-derived antibodies that cause anti-isotype reactions with the constant regions of human antibodies using genetic engineering methods. Chimeric antibodies have significantly improved anti-isotype responses compared to animal-derived antibodies, but animal-derived amino acids are still present in the variable region, making them a potential anti-idiotype. idiotypic) has side effects of reaction. Humanized antibodies have been developed to ameliorate these side effects. It is made by implanting a region of the complementarity determining regions (CDRs) that play an important role in the binding of the variable region proliferative antigen of the chimeric antibody into the human antibody framework.

The most important aspect of CDR grafting technology for the production of humanized antibodies is to select an optimized human antibody that can best accept the CDR region of an animal-derived antibody. structure analysis and molecular modeling techniques. However, even when the CDR region of an animal-derived antibody is implanted into an optimized human antibody skeleton, there are many amino acids that are located in the skeleton of an animal-derived antibody and affect antigen binding. As such, the application of additional antibody engineering techniques to restore antigen binding capacity is essential.

According to one embodiment, the antibody may be a mouse derived antibody, mouse-human chimeric antibody, humanized antibody or human antibody.

A complete antibody is a structure having two full length light chains and two full length light chains, each of which is linked by heavy and disulfide bonds. The constant region of the antibody is divided into a heavy chain constant region and a light chain constant region, and the heavy chain constant 'regions are gamma), mu (μ) and alpha (α). Gamma 1 (γ 1) and gamma 2 (γ 2) subtypes, having delta (δ) and epsilon (ε) types. Gamma 3 3), gamma 4 (γ4). Alpha 1 (α 1) and alpha 2 (α2). The constant regions of the light chains have kappa (κ) and lambda (λ) types.

Terms. A "heavy chain" refers to a variable region domain V _H comprising an amino acid sequence comprising enough variable region sequences to confer specificity to an antigen and to three constant region domains C _H1 , C _H2 and C _H3 Is interpreted to include both full-length heavy chains and fragments thereof. In addition, the term "light chain" includes both a variable region domain comprising an amino acid sequence comprising a sufficient variable region sequence for conferring specificity to an antigen and a full length light chain comprising a constant region domain C _L and fragments thereof. It is interpreted to mean.

Terms. "Complementarity determining region" (CDR) is an immunoglobulin An amino acid sequence of the hypervariable region of the heavy and light chains. The heavy and light chains may each comprise three CDRs (CDRH1, CDRH2, CDRH3 and CDRL1. CDRL2, CDRL3). The CDRs can provide key contact residues for the antibody to bind antigen or epitope. In addition, in this specification. The term “specifically binds” or “specifically recognized” is the same as that commonly known to those skilled in the art and means that the antigen and antibody specifically interact to make an immunological reaction.

Terms. "Antigen binding fragment"'is a fragment thereof for the entire structure of an immunoglobulin and refers to a portion of a polypeptide comprising a portion to which an antigen can bind, eg scFv, (scFv) ₂ , scFv-Fc. Fab, Fab 'or F (ab') ₂ , but is not limited thereto.

Fab of the antigen-binding fragment has one antigen-binding site in a structure having a variable region of the light and heavy chains, a constant region of the light chain, and a first constant region (() of the heavy chain.

Fab 'differs from Fab in that it has a hinge region comprising one or more cysteine residues at the C-terminus of the chain C _H1 domain.

F (ab ^') _2' antibody 'is a cysteine residue of the hinge region of the disulfide ^bonds, Fab is generated yirumyeonseo. Recombinant techniques for generating Fv fragments with minimal antibody fragments in which Fv has only heavy chain variable regions and light chain variable regions are well known in the art.

Double-chain Fv is non-covalently linked to the heavy chain variable region and the light chain variable region, and the single-chain Fv is generally shared by the variable region of the heavy chain and the short-chain variable region through a peptide linker. It may be linked by a bond or directly at the C-terminus to lead to a dimer-like structure, such as a double chain Fv. scFv-Fc is a structure in which a single chain Fv and a constant region are linked with or without a peptide linker. The peptide linker may be composed of 1 to 100 or 2 to 50 arbitrary amino acids, and those skilled in the art may appropriately select the amino acid length and type.

The antigen-binding fragment can be obtained using proteolytic enzymes (Eg, restriction digestion of the entire antibody with papain can yield Fab and cleavage with pepsin yields F (ab ') ₂ fragments) and can be produced via genetic recombination techniques.

The term “hunge region” refers to a region included in the heavy chain of an antibody, which exists between the CH1 and CH2 regions, and which functions to provide flexibility of the antigen binding site in the antibody.

When an animal-derived antibody undergoes a chiiner izat ion process. Animal-derived IgGl hinges are substituted with human IgGl hinges. Animal-derived IgGl hinges are shorter in length than human IgGl hinges, and the disulfide bonds between the two heavy chains are reduced from three to two, resulting in different rigidity of the hinges. Thus, modification of the hinge region can increase the antigen binding efficiency of the humanized antibody. Deletion of an amino acid for modifying the amino acid sequence of said hinge region. Addition or substitution methods are well known to those skilled in the art.

The antibody may be a monoclonal antibody. Monoclonal antibodies can be prepared according to methods well known in the art. For example, it may be manufactured using a phage display technique. In addition, the antibody may be a disulfide-binding Fvs (sdFV) or anti-idiotype (antivison Id) antibody.

Antibodies or antibody fragments described herein. As long as it can specifically recognize each antigen, ie, Nrpl or c-Met, it can include not only the sequences of the antibodies described herein, but also biological equivalents thereof. For example. Further changes in the amino acid sequence of the antibody can be made to further improve the binding affinity and / or other biological properties of the antibody. Such modifications include, for example, deletion of amino acid sequence residues of an antibody. Insertions and / or substitutions. These amino acid variations are relative similarities of amino acid chain substituents. for example. Hydrophobic, hydrophilic, charge. It may be made based on the size and the like. Size of amino acid chain substituents. Example arginine by analysis of shape and type. Lysine and histidine are both positively charged residues; Alanine, glycine and serine have similar sizes; Phenylalanine. It can be seen that tryptophan and tyrosine have a similar shape. Therefore, based on these considerations, arginine, Lysine and histidine; Alanine, glycine and serine; Phenylalanine, tryptophan and tyrosine are biologically equivalent functions.

In introducing mutations. Hydropathic indexes of amino acids can be considered. Each amino acid is endowed with hydrophobic inex according to hydrophobicity and charge: isoleucine (+4.5): valine (+4.2): leucine (+3.8); Phenylalanine (+2.8); Cysteine / cysteine (+2.5): methionine (+ 1.9); Alanine (+1.8); Glycine (-0.4); Threonine (VII); Serine (-0.8); Tryptophan (-0.9): tyrosine (-1.3); prine (-1.6): histidine (-3.2); Glutamate (-3.5); Glutamine (-3.5); Aspartate (-3.5); Asparagine (-3.5); lysine (-3.9); And arginine (-4.5).

Hydrophobic amino acid indexes are very important in conferring the interactive biological function of proteins. It is known that substitution with amino acids having similar hydrophobicity indexes can retain similar biological activity. When introducing mutations with reference to the hydrophobicity index, it is preferably within _± 2. More preferably, amino acid substitutions are performed that show hydrophobic index differences within X 1 and even more preferably within X 0.5.

Meanwhile. It is also well known that substitutions between amino acids having similar hydrophilidty values result in proteins with equivalent biological activity. for example. Each amino acid residue is assigned the following hydrophilicity values: arginine (+3.0); Lysine (+3.0): asphaltate (+3.0 sul 1); Glutamate (+ 3.0 ± 1); serine (+0.3); Asparagine (+0.2); Glutamine (+0.2); Glycine (0); Threonine (-0.4): plinin (-0.5 ± 1); alanine (X0.5); histidine (-0.5); cysteine (-1.0); Methionine (-1.3); Valine (-1.5); Leucine (-1.8); Isoleucine (-1.8); tyrosine (-2.3); Phenylalanine (-2.5); Tryptophan (-3.4).

Amino acid substitutions in proteins that do not alter the activity of the molecule as a whole are well known in the art. For example, the most commonly occurring substitutions are amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser. Ala / Gly. Ala / Thr, Ser / Asn. Ala / Val, Ser / Gly. Thr / Phe, Ala / Pro. Lys / Arg. Asp / Asn. Substitutions between Leu / I le, Leu / Val, Ala / Glu, and / or Asp / Gly.

Considering the variation with the biologically equivalent activity described above. In this specification The described antibodies or nucleic acid molecules encoding them are also construed to include sequences that exhibit substantial identity to the sequences set forth in the Sequence Listing. Substantial identity of the above. When the sequence of the present invention and any other sequence is aligned to the maximum as possible, and the aligned sequence is analyzed using algorithms commonly used in the art. At least 61% homology, at least 70% homology, at least 80% homology. A sequence that exhibits at least 9, at least 95%, or at least 99% homology. Alignment methods for sequence comparison are known in the art. for example. NCBI Basic Local Alignment Search Tool (BLAST) is accessible from NBCI and the like, and can be used in conjunction with sequencing programs such as blastp, blasm, blastx, tblastn and tblastx on the Internet. BLSAT is www. Accessible at ncbi.nlni.nih.gov/BLAST/. Sequence homology comparisons using this program are available at www.ncbi.nlm.nih.gov/BLAST/blast_help. You can check it in html.

In one embodiment, the anti-c-Met / anti-Nrpl bispecific antibody is an anti-c-Met antibody or antigen binding fragment thereof, and the C-terminal or N-terminal end of the anti-c-Met antibody or antigen-binding fragment thereof, For example, an anti-Nrpl antibody linked to the C terminus or an antigen binding fragment thereof.

In this case, the anti-c-Met / anti—Nrpl bispecific antibody. Anti-c—Met antibodies mediate the movement and degradation of c-Met proteins into cells. It may be advantageous to have a complete antibody structure (eg, IgG type antibody) in order to secretly play this role. Anti-Nrpl antibodies are important for specific recognition and binding to Nrpl. Since it does not have a complete antibody structure and is capable of internalization even in the form of an antigen binding fragment such as, for example, scFv. It may be included in the form of an antigen-binding fragment that recognizes Nrpl. Thus, in one embodiment, the anti—c-Met / anti-Nrpl bispecific antibody is a complete form of an anti- _C -Met antibody (such as an IgG type antibody) against c-Met and an anti-c-Met antibody. It may include, but is not limited to, antigen binding fragments of anti-Nrpl antibodies (eg, scFv or scFv—Fc) that are linked to the C terminus (eg, the C terminus of the reinforcement of an anti-c-Met antibody).

In the above anti-c-Met / anti-Nrpl bispecific antibody, the anti-c-Met antibody or Antigen-binding fragments thereof and anti-Nrpl antibodies or antigen-binding fragments thereof are linkers, such as. Connections can be made with or without the peptide linker. In addition, heavy and light chain portions in antigen binding fragments, such as heavy and light chain variable regions in scFv fragments, can also be linked with or without a peptide linker. The peptide linker connecting the anti-c-Met antibody or antigen-binding fragment thereof and the anti-Nrpl antibody or antigen-binding fragment thereof and the peptide linker connecting the heavy and light chain portions in the antigen-binding fragment may be the same or different. The peptide linker may be a polypeptide consisting of 1 to 100, 2 to 50, 2 to 30, 2 to 20, or 2 to 15 any amino acid. The amino acid type contained is not limited. The peptide linker is. for example. Gly, Asn and / or Ser residues may be included, and neutral amino acids such as Thr and / or Ala may also be included. Suitable amino acid sequences for peptide linkers are known in the art. Meanwhile, the linker does not affect the function of the bispecific antibody. The length can be determined in various ways. for example. The peptide. The linker may be made of one or more selected from the group consisting of Gly, Asn, Ser, Thr and Ala, including 1 to 100, 2 to 50, or 5 to 25. In one example. The peptide ᅳ linker is (G 4 S) n (n is a repeating number of (G 4 S)), and may be represented by an integer of 1 to 10, for example, an integer of 2 to 5).

In an embodiment. The anti-c-Met / anti-Nrpl bispecific antibody is an anti-c-Met antibody

(Eg, antibodies in IgG form). And scFv, (scFv) ₂ , scFv-Fc, Fab. Of an anti-Nrpl antibody linked to the C terminus of the anti-c-Met antibody. Fab ^* or F (ab ') ₂ , such as scFv.

In one embodiment, the chain of anti- _C- Met / anti-Nrpl bispecific antibody comprises the heavy chain of the anti-c-Met antibody described above on the N-terminal side. ScFv, (scFv) ₂ , scFv-Fc. Fab. Fab 'or F (ab') ₂ may be included, with or without a linker, for example, may comprise an amino acid sequence selected from SEQ ID NOs: 145 to 147.

The light chain of the anti-Met / anti-Nrpl-specific antibody may be the same as the light chain of the anti-c-Met antibody described above. The amino acid sequence of SEQ ID 68 1st to 20th amino acid sequence is a signal peptide), the 21st to 240th amino acid sequence of SEQ ID NO: 68. An amino acid sequence of SEQ ID NO: 70 (wherein the amino acid sequences of 1st to 20th are signal peptides), the 21st to 240th amino acid sequence of SEQ ID NO: 70, and the amino acid sequence of SEQ ID NO: 108 It may include an amino acid sequence.

Said anti-c-Met / anti-Nrpl dual specific antibodies can maintain similar binding affinity for c-Met or Nrpl as for the monoclonal antibody, respectively. For example, as measured by surface plasmon resonance (SPR; eg, Biacore), the affinity (Kd) of the anti-c-Met / anti-Nrpl bispecific antibody to c-Met is about 0.001 to 50 nM, 0.001 to 30 nM , 0.001 to ΙΟηΜ, 0.001 to InM. Or 0.001 to 0.5 nM, and the affinity for Nrpl (1 (d) is about 0.001 to ΙΟΟηΜ, 0.001 to 70nM, 0.001 to 50nM, 0.001 to 40nM, 0.001 to 30nM. 0.001 to ΙΟπΜ, or 0.001 to InM days) Can be.

Said anti-c-Met / anti-Nrpl bispecific antibody is cell internalization of anti-c-Met antibody

By internalization and degradation activity, c-Met and Nrpl can be degraded to reduce the total level as well as inhibition of c-Met and Nrpl activity, thereby enabling more fundamental blocking. Thus, the anti-C-Met / anti-Nrpl bispecific antibodies may be anticancer agents (such as. Gemcitabine and the like) and / or c-Met targeted therapeutics (such as anti-c-Met antibodies) and / or Nrpl targeted therapeutics (such as , Anti-Nrpl antibody) can also be effective when applied to patients with resistance.

In addition, the anti-c-Met / anti-Nrpl bispecific antibody is, therefore, the anti-c-Met / anti-Nrpl bispecific antibody may be administered in combination as well as during administration of a c—Met inhibitor and an Nrpl inhibitor alone. Compared with, it has a significantly elevated anti-cancer and / or cancer metastasis inhibiting effect. Due to this synergistic effect, the anti-c-Met / anti-Nrpl bispecific antibody can exert an excellent effect even at low doses, as compared to the single or combined administration of c-Met and Nrpl inhibitors. . Side effects with high dosages can be reduced.

Thus, another example of the present invention is directed to an anti-c-Met / anti-Nrpl It provides a pharmaceutical composition for the prevention and / or treatment of diseases associated with overproduction (eg overexpression) and / or abnormal activation of c-Met and / or Nrpl comprising as an active ingredient. The pharmaceutical composition may further include a pharmaceutically acceptable carrier in addition to the bispecific antibody.

Another example is the prevention and / or treatment of diseases associated with overproduction (eg. Overexpression) and / or abnormal activation of c-Met and / or Nrpl with a pharmaceutically effective amount of the anti-c-Met / anti-Nrpl bispecific antibody. A method of preventing and / or treating a disease associated with overproduction (eg, overexpression) and / or abnormal activation of c-Met and / or Nrpl, comprising administering to a patient in need thereof. The method of preventing and / or treating a disease associated with overproduction (eg. Overexpression) and / or abnormal activation of c-Met and / or Nrpl may include overproduction (eg, c—Met and / or Nrpl prior to the administration). , And / or identifying patients in need of prevention and / or treatment of diseases associated with abnormal activation.

Terminology used herein. "Prevention" means any action that inhibits or delays the occurrence of a disease by administration of a composition of the present invention. "Treatment" is the suppression of the development of the disease. Relief of symptoms. Improvement and / or removal of etiology (eg, removal of tumor cells or tumor tissue in the case of tumors). 'Diseases associated with overproduction (eg, overexpression) and / or abnormal activation of c-Met and / or Nrpl are, for example. Cancer or cancer metastasis.

therefore. Provided herein are pharmaceutical compositions for preventing and / or treating cancer or cancer metastases comprising the anti-c-Met / anti-Nrpl bispecific antibody as an active ingredient. Also. A method for preventing and / or treating cancer, comprising administering a pharmaceutically effective amount of the anti-c-Met / anti-Nrpl bispecific antibody to a patient in need of preventing and / or treating cancer or cancer metastasis. do. The method of preventing and / or treating cancer or cancer metastasis may further comprise identifying a patient in need of prevention and / or treatment of cancer or cancer metastasis prior to said administering. The cancer may be associated with overexpression and / or abnormal activation of Nrpl and / or c-Met. The cancer may be solid cancer or hematologic cancer. for example. Lung cancer (eg, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, Lung adenocarcinoma, squamous cell carcinoma of the lung, etc.), peritoneal cancer, skin cancer, melanoma (eg, skin or intraocular myeloma, etc.). Rectal cancer. Anal anal cancer. Esophageal cancer. Stomach cancer. Small bowel cancer. Endocrine adenocarcinoma, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer. Chronic or acute leukemia. Lymphocyte Lymphoma, Hepatocellular Carcinoma, Gastrointestinal Cancer, Pancreatic Cancer. Glioblastoma (or glioblastoma). Astrocytoma, glioma, neuroblastoma, testicular cancer Cervical cancer. Ovarian Cancer. Liver cancer. Bladder cancer, breast cancer, colon cancer. Colorectal cancer: Endometrial or uterine cancer, acupuncture cancer, kidney cancer. Prostate cancer, vulvar cancer, thyroid cancer, head and neck cancer, brain cancer, osteosarcoma, etc. may be one or more selected from the group consisting of. The cancer may be primary or metastatic cancer.

An anti-c ᅳ Met / anti-Nrpl dual specific antibody provided herein is an anticancer agent by simultaneously inhibiting c-Met and Nrpl. for example. At least one anticancer agent and / or c-Met targeted therapeutic agent (eg anti-c-Met antibody) and / or Nrpl targeted therapeutic agent (eg anti-Nrpl antibody) selected from the group consisting of ¾cytabine and the like. It can also exert anticancer effects against cancers that have become resistant or resistant to it.

Thus, the cancer is a conventional anticancer agent. For example, to one or more anticancer agents selected from the group consisting of gemcitabine and / or c-Met targeted therapeutics (eg anti-c-Met antibodies) and / or Nrpl targeted therapeutics (eg anti-Nrpl antibodies). The cancer may have innate resistance or acquired resistance.

In addition, another example provides a pharmaceutical composition for overcoming anticancer drug resistance comprising the anti-c-Met / anti-Nrpl bispecific antibody. Another example provides a method of overcoming anticancer resistance, comprising administering a pharmaceutically effective amount of the anti-C-Met / anti-Nrpl bispecific antibody to a patient in need of overcoming anticancer resistance. As described above, the anticancer agent resistance may include one or more anticancer agents selected from the group consisting of gemcitabine and / or c-Met targeted therapeutics (eg anti-c-Met antibodies) and / or Nrpl targeted therapeutics (eg , Anti-Nrpl antibodies) may be innate or acquired resistance.

In the pharmaceutical composition or method, the anti- _C- Met / anti-Nrpl bispecific antibody is a pharmaceutically acceptable carrier. Diluents, excipients, etc. It may be provided with one or more additives selected from the group.

The pharmaceutically acceptable carrier is commonly used in the preparation of antibodies, lactose, dextrose, sucrose, sorbbi, manny, starch, acacia rubber, phosphate. Alginate, gelatin, calcium silicate, microcrystalline cellulose. Polyvinylpyrrolidone, cellulose, water. syrup. Methyl Sallos. It may be one or more selected from the group consisting of methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, mineral oil and the like, but is not limited thereto. The pharmaceutical composition is a diluent, excipient commonly used in the manufacture of pharmaceutical compositions in addition to the components. slush. Wetting agents, sweeteners 1, flavoring agents, emulsifiers, suspending agents. It may further include one or more selected from the group consisting of a preservative.

The pharmaceutical composition, the anti- _C- Met / anti-Nrpl dual specific antibody, can be administered orally or parenterally. For parenteral administration, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection. Endothelial administration. Topical administration. It can be administered by intranasal administration, pulmonary administration or rectal administration. Upon oral administration. Since proteins or peptides are digested, oral compositions must be formulated to coat the active agent or to protect it from degradation in the stomach. In addition, the composition may be administered by any device in which the active substance may migrate to the target cell.

The pharmaceutical composition. Said anti-Nrpl antibody or antigen binding fragment thereof. Or a suitable dosage of the anti-Met / anti-Nrpl bispecific antibody is disclosed in the Formulation Methods. Mode of administration, patient's age, weight. Sex, morbidity, food, time of administration. It may be prescribed in various ways by factors such as route of administration, rate of excretion and reaction responsiveness. Preferred dosages of the compositions range from 0.001 to 100 nig / kg on an adult basis. Can be. The daily dosage may be formulated into one formulation in unit dosage form, or may be formulated in appropriate quantities. It can be prepared by incorporation into a multi-dose container. The term "pharmaceutically effective amount" means an amount in which the active ingredient (ie, the anti-C-Met / anti-Nrpl bispecific antibody) may exhibit the desired effect, i.e., the effect of preventing and / or treating cancer. ， Formulation method, mode of administration, age, weight, sex of the patient. morbidity. Food, dosing time. It may be prescribed in various ways by factors such as the route of administration, rate of excretion and response. The pharmaceutical composition can be prepared in unit dose form or formulated into a multi-dose container by formulating with a pharmaceutically acceptable carrier and / or excipient, according to methods readily available to those skilled in the art. . Wherein the formulation is a solution, suspension in an oil or aqueous medium. Syrup or emulsion form or essence. Powder. Powder. Granules. It may be in the form of a tablet or capsule, and may further include a dispersant or a stabilizer.

Also. The pharmaceutical compositions may be administered as individual therapeutic agents or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents.

The subject of administration of said pharmaceutical composition or subject of administration of said prophylactic and / or therapeutic method is a human. Mammals, including primates such as monkeys or rodents such as rats and mice, or cells or tissues or cultures thereof isolated from the mammals, but are not limited thereto. Cancer patients may have developed resistance to existing anticancer drugs.

【Effects of the Invention】

^"Anti -c-Met / anti -Nrpl antibody provided by the present invention has the following benefits: ⁱ with:

One . Increased potency and reduced dose compared to c-Met and Nrpl inhibitors alone or in combination.

2. Efficacy in inhibiting cancer growth as well as cancer metastasis.

3. It also shows anticancer effect even against cancer that has resistance to existing anticancer drugs.

4. Can be used for other diseases involving overexpression or abnormal activation of Nrpl and / or c-Met other than cancer.

[Brief Description of Drawings]

1 is a schematic diagram showing an example of the structure of an anti-c-Met / anti-Nrpl bispecific antibody.

2 shows one of the phagemid vectors for the production of anti-Nrpl scFv antibody fragments. ^• A schematic diagram showing an example.

3 shows Coomassie staining results of each purified anti-Nrpl scFv antibody fragment.

4 is an ELISA result showing binding of three anti-Nrpl scFv antibody fragments to Nrpl.

FIG. 5 is a graph showing binding to Nrpl according to the concentration of three anti-Nrpl scFv antibody fragments.

6 is a graph showing the effect of inhibiting cell proliferation against gastric cancer cell line MKN45 of anti-c-Met / anti-Nrpl bispecific antibody.

FIG. 7 is a fluorescence image showing the effect of cell migration inhibition on kidney cancer cell line 786-0 of anti-c-Met / anti-Nrpl bispecific antibody.

FIG. 8 is a graph showing quantitative fluorescence intensity of FIG. 7.

9 is a fluorescence image showing the invas ion inhibition effect of the anti-c-Met / anti—Nrpl bispecific antibody on kidney cancer cell line 786-0.

FIG. 10 is a graph showing quantitative fluorescence intensity of FIG. 9.

FIG. 11 is a graph showing the effect of inhibiting cell proliferation of c-Met antibody resistant kidney cancer cell line 786-0 of anti-c-Met / anti-Nrpl bispecific antibody.

12 is an immunoblotting result showing Nrpl expression level in jamcitabine resistant MKN45 cell line.

FIG. 13 is a graph showing the effect of inhibiting cell proliferation on MKN45 cell line (left) and gemcitabine resistant MKN45 cell line (right) of anti-c-Met / anti-Nrpl bispecific antibodies.

FIG. 14 shows immunoblotting results showing changes in c—Met and Nrpl levels in gemcitabine resistant MKN45 cell lines following anti-c-Met / anti-Nrpl bispecific antibody treatment.

[Specific contents to carry out invention]

Hereinafter, the following examples will be described in more detail with reference to the present invention. However, these examples are merely illustrative of one or more embodiments, and the scope of the invention is not limited to these examples. Reference Example 1 Construction of Anti-c-Met Antibody

1.1. Production of mouse antibody 'AbF46' against c-Met

1.1.1. Immunization of Mice

In order to obtain immunized mice necessary for the development of hybridoma cell lines,

Five mice were mixed with 100 / _zg human c-Met / Fc fusion protein (R & D Systems) and the same amount of Freund's adjuvant per mouse to produce 6-6 week old BALB / c mice ( Japan SLC, Inc.). Two weeks later, 50 / g of the previous injection of the human c-Met / Fc fusion protein used as the antigen in the same manner as above was common with the same amount of incomplete Freund's adjuvant. Combined and injected intraperitoneally of mice. One week later, the last boosting (boosting) was performed 3 days after the blood was collected from the tail of the mouse to obtain a serum and diluted to 1/1000 PBS to confirm that the titer of the antibody that recognizes c-Met by ELISA. As a result, mice obtained with sufficient amounts of antibodies were selected, and the following cell fusion process was performed.

1.1.2. Cell Fusion and Preparation of Hybridomas

Three days before the cell fusion experiment, human c-Met / Fc fusion protein mixture was injected into 50 / g PBS intraperitoneally of BALB / c mice (Japan SLC, Inc.). Immunized mice were anesthetized and spleens located on the left side of the trunk were removed. The harvested spleens were ground with a mesh to separate cells and mixed with culture medium (DMEM, GIBC0. Invitrogen) to make a splenocyte suspension. The suspension was centrifuged to recover the cell layer. The obtained splenocytes 1 × 10 ⁸ and myeloma cells (Sp2 / 0) 1 × 10 ⁸ were combined and centrifuged to precipitate the cells. The centrifuged precipitate was slowly dispersed and treated with 45% polyethylene glycol (PEG) (1 nie) contained in culture medium (DMEM). After holding at 37 ° C. for 1 minute, culture medium (DMEM) 1 111 was added. Then, culture medium (DMEM) 10 ^ was added for 1 minute, left for 5 minutes in water at 37 ^° C and then centrifuged again at 50 inC. Resuspend the cell precipitate in l ~ 2xl0 ⁵ / m ⁽ i) in separation medium (HAT medium) and dispense 0.1 ^ aliquots into well-well plates and then 37 ° C Hybridoma cell groups were prepared by culturing in a carbon dioxide incubator.

1.3. Screening for Hybridoma Cells Producing Monoclonal Antibodies to c-Met Protein

Reference Example 1 above. ELISA assay method using human c-Met / Fc fusion protein and human Fc protein as antigen to select hybridoma cells that specifically react only c-Met protein among hybridoma cell population prepared in 1.2 Screened through.

Human c-Met / Fc fusion protein was added to the microtiter plate at 50 (2) per well each to adhere to the plate surface, and unreacted antigens were washed out to remove antibodies bound to Fc but not to c-Met. Human Fc protein was attached to the plate surface in the same manner as above for selection and exclusion.

Reference Example 1 above. The culture medium of the hybridoma cells obtained in step 2 was added to each of the wells prepared above, and then reacted for 1 hour, followed by washing with a phosphate complete solution-twen 20 (TBST) solution sufficiently to remove the unreacted culture solution. To this was added goat anti-mouse IgG—horseradish peroxidase (goat ant i-mouse IgG-HRP) and reacted at room temperature for 1 hour, followed by thorough washing with TBST solution. Subsequently, a substrate solution of peroxidase (opD) was added to the reaction _, and the reaction degree was confirmed by measuring absorbance at 450 nm with an ELISA Reader.

By checking the reaction degree as above. Hybridoma cell lines that secrete antibodies that do not bind to human Fc but specifically have high binding capacity to human C—Met protein are repeatedly selected. One clone of the hybridoma cell line producing monoclonal antibody was finally obtained by limiting dilution (l im iti ng dil ut i on) of the hybridoma cell line obtained through repeated selection. The final screened monoclonal antibody-producing hybridomas were deposited on October 6, 2009 with the Korea Cell Line Research Foundation, located in Yeongun-dong, Jongno-gu, Seoul, under the Treaty of Budapest, and received accession number KCLRF-BP-00220 (Korea See Publication 2011-0047698). 1.1.4. Production and Purification of Monoclonal Antibodies

The hybridoma cells obtained in Reference Example 1.1.3 were cultured in serum-free medium, and monoclonal antibodies were produced and purified from the culture.

First, the hybridoma cells cultured in 50 ml of culture medium (DMEM) medium containing 10% (v / v) FBS were centrifuged to wash the cell precipitate at least twice with 20 ιι ('PBS to remove FBS. The cell precipitate was resuspended in culture medium (DMEM) medium 50 nie and then incubated in a 37 ^° C. carbon dioxide incubator for 3 days, after which centrifugation, cells producing the antibody were removed and the antibodies secreted. The cultures were separated and stored ^at 4 ^° C. or collected immediately for separation and purification of the antibody using an AKTA purification instrument (GE Healthcare) equipped with an affinity column (Protein G agarose co 1 iimn; Pharmacia, USA). Purified antibody was purified from 50 ιιι (! To 300 nie) of the prepared culture solution, and the purified antibody was stored by replacing the supernatant with PBS using a protein filter (Am icon), and used in the following example. .

1.2. Construction of the chimeric antibody chAbF46 against c-Met

In general, the mouse antibody is likely to show an inii inogenicity when injected into humans for therapeutic purposes, and in order to solve this, from the mouse antibody AbF46 produced in Reference Example 1.1.4. A chimeric antibody chAbF46 was constructed in which the constant region, except for the variable region related to antigen binding, was replaced with the sequence of the human IgGl antibody.

The nucleotide sequence corresponding to the heavy chain is' EcoRI-signal sequence 'VH-NheI_CH-TGA-XhoI' (SEQ ID NO: 38). The nucleotide sequences corresponding to the light chains were designed to be composed of 'EcoRI -signal sequence-VL-BsiWI-CL-TGA—XhoI' (SEQ ID NO: 39), respectively, to synthesize genes. Subsequently, the DNA fragment (SEQ ID NO: 38) comprising the nucleotide sequence corresponding to the heavy chain was added to the pOpt iVEC ™ -T0P0 TA Cloning Kit included in the OptiCHO ™ Antibody Express Kit (Cat no. 12762-019) of Invitrogen, pcDNA. DNA fragments comprising the nucleotide sequence corresponding to the light chain in a ™ 3.3-T0P0 TA Cloning Kit (Cat no. 8300-01) (SEQ ID NO: 39) by cloning using EcoRKNEB, R0101S) and XhoKNEB, R0146S) restriction enzymes, respectively. A vector comprising a heavy chain and a vector comprising a light chain for the expression of chimeric antibodies were constructed, respectively.

The constructed vector was amplified using Qiagen Max i prep kit (Cat no. 12662), respectively, and the temporary expression was performed using the Freestyle ™ MAX 293 Expression System (invitrogen). The cell line used is 293 F cell. FreeStyle ™ 293 Expression Medium was used to culture the cells in suspension culture. One day before the temporary expression cells were prepared at a concentration of 5xl0 ⁵ cells / ml, and after 24 hours, the cells were temporarily expressed when the number of cells reached lxl0 ⁶ cells / nil. Transfection was performed using a freestyle ™ MAX reagent (liposomal reagent using invitrogen ^), and DNA was prepared in a 15 ml tube at a ratio of heavy chain DNA: light chain DNA = l: l and mixed with 2ml OptiPro ™ SFM (invtrogen). (A), mix (B) Freestyle ™ MAX reagent 100 / and OptiPro ™ SFM 2ml in another 15ml tube, mix (A) and (B) and incubate for 15 minutes. After the transduction, the mixture was incubated at 37 ^° C. 80% humidity, 8% CO ₂ , and 130 rpni incubator for 5 days.

The cultured cells were centrifuged to obtain 100 ml of supernatant, respectively, and purified using AKTA Prime (GE healthcare). After installing the Protein A column (GE healthcare, 17-0405-03) on the AKTA Prime and pouring the culture medium at a flow rate of 5 ml / niin. Eluted with IgG el ut ion buffer (Thermo Scientific. 21004). The obtained eluate was exchanged with PBS buffer to finally purify the chimeric antibody AbF46 (hereinafter referred to as chAbF46).

1.3. Construction of Humanized Antibody huAbF46 from Chimeric Antibody chAbF46

1.3.1. Heavy chain humanizat ion

For the design of both Hl-heavy and H3-heavy, first, VH of the mouse antibody AbF46 purified in Reference Example 1.2 above was obtained through Ig Blast (http://www.ncbi.nlm.nih.gov/igblast/). Human germline genes with the most homology with the genes were analyzed. As a result, it was confirmed that VH3-71 has 83% homology at the amino acid level, CDR-H1, CDR-H2. CDR—H3 was defined as Kabat numbering and designed to introduce the CDR portion of the mouse antibody AbF46 into the framework of the VH3-group. At this time, amino acids 30 (S → T), 48 (V → L), 73 (D → N) and 78 (T ᅳ L) were back-mutated with the amino acid sequence of the original mouse AbF46 antibody. HI further mutated 83 (R → K) and 84 (A → T) amino acids to finally construct Hl-heavy (SEQ ID NO: 40) and H3-heavy (SEQ ID NO: 41).

The framework sequence of the human antibody for the design of H4-heavy was found to be very similar to the mouse skeleton sequence of the AbF46 antibody. Using the most stable known VH3 subtype, CDR-HI, CDR-H2 and CDR-H3 of the mouse antibody AbF46 defined by Kabat numbering were introduced. This established H4-heavy (SEQ ID NO: 42).

1.3.2. Light chain humanization

For the design of two types of HI 一 light (SEQ ID NO: 43) and H2-light (SEQ ID NO: 44). Human germline genes most homologous to the VL gene of the mouse antibody AbF46 were analyzed through Ig Blast (http://www.ncbi.nlm.nih.gov/igblast/). As a result, it was confirmed that VK4-1 had 75% homology at the amino acid level, CDR-L1, CDR-L2, CDR-L3 of mouse antibody AbF46 were defined as Kabat numbering, and the CDR portion of mouse antibody AbF46 was defined as It was designed to be introduced into the backbone of VK4-1. At this time, Hl-light back-tation 3 amino acids 36 (Y → H), 46 (L → M), 49 (Y → I). H2—light was constructed by back-mutating only one amino acid number 49 (Y → I).

For the design of H3-light (SEQ ID NO: 45), Blast

Among the results of analyzing the human germline gene having the highest homology with the VL gene of the mouse antibody AbF46 through (http://www.ncbi.nlm.nih.gov/igblast/), VK2-40 in addition to VK4-1 Was selected. It was confirmed that the mouse antibodies AbF46 VL and VK2-40 had 61% homology at the amino acid level, CDR-L1, CDR-L2, CDR-L3 of mouse antibody AbF46 was defined by Kabat numbering, and the CDR of mouse antibody AbF46 was determined. The part was designed to be introduced into the backbone of VK4-1. At this time, H3- light back-mutation of 3 amino acids 36 (Y → H), 46 → ¾, 49 (Y → I) Was constructed.

For the design of H4-light (SEQ ID NO: 46), we found the framework sequences of human antibodies and found that CDR-L1 of mouse antibody AbF46, defined by Kabat numbering, using the most known Vkl subtype, CDR-L2, CDR—L3 were introduced. At this time, H4 light was constructed by further back-mutation of three amino acids 36 (Y → H), 46 → ¾1), and 49 (Υ—Γ).

Subsequently, a DNA fragment (Hl-heavy; sequence containing the nucleotide sequence corresponding to the repetition in the _P 0ptiVEC ™ -T0P0 TA Cloning Kit included in the OptiCHO ™ Ant i body Express Kit (Cat no. 12762-019) of Invitrogen) SEQ ID NO: 47, H3-heavy: SEQ ID NO: 48. H4_heavy; SEQ ID NO: 49), a DNA fragment comprising the nucleotide sequence corresponding to the light chain in the pcDNA ™ 3.3-T0P0 TA Cloning Kit (H1-light; SEQ ID NO: 50. H2- light; SEQ ID NO: 51, H3-light; SEQ ID NO: 52, H4- light; SEQ ID NO: 53), respectively, using EcoRKNEB, R0101S) and XhoKNEB, R0146S) restriction enzymes to clone the vector for expression of humanized antibodies. Built.

The constructed vector was amplified using Qiagen Max i prep kit (Cat no. 12662), respectively, and the temporary expression was performed using the Freestyle ™ MAX 293 Expression System (invitrogen). The cell line used was 293 F cells, and was cultured by suspension culture using FreeStyle ™ 293 Expression Mediimi as a medium. One day before the temporary expression cells were prepared at a concentration of 5xl0 ⁵ cells / ml, and after 24 hours, the cells were temporarily expressed when the number of cells reached lxl0 ⁶ cells / ml. Transfection was performed by Freestyle ™ MAX reagent (liposomal γ ᅳ eagent using invitrogen ^), and DNA was prepared in a 15 ml tube at a ratio of heavy DNA: light chain DNA = l: l to Opt i Pro ™ SFM (invtrogen). Mix with 2nil (A), mix (B) Freestyle ™ MAX reagent 100 / with OptiPro ™ SFM 2ml in another 15ml tube, mix (A) and (B), incubate for 15 minutes, and then The mixture was slowly mixed with the prepared cells After completion of transduction, the cells were incubated in 37 ^° C., 80% humidity, 8% C ₂ .130 rpm incubator for 5 days.

Centrifuge the cultured cells and take 100 ml of each supernatant. Purification was performed using AKTA Prime (GE healthcare). Protein A on AKTA Prime A column (GE healthcare. 17-0405-03) was set up and the culture was poured at a flow rate of 5 nil / min, then eluted with IgG el Lit ion buffer (Thermo Scientific, 21004). This was exchanged with PBS buffer to finally purify the humanized antibody AbF46 (hereinafter referred to as huAbF46). Meanwhile . The heavy and light chain combinations of the humanized antibody huAbF46 used in the Examples below are H4-heavy (SEQ ID NO: 42) and H4-light (SEQ ID NO: 46).

1.4. scFv Library Construction of huAbF46 Antibody

The gene for constructing the scFv 'of the huAbF46 antibody was designed using the heavy and light chain variable regions of the huAbF46 antibody. Each heavy and light chain variable region was designed to be in the form of 'VH-linker-VL' and the linker was designed to have an amino acid sequence of 'GLGGLGGGGSGGGGSGGSSGVGS' (SEQ ID NO: 54). The polynucleotide encoding the scFv of the huAbF46 antibody thus designed (SEQ ID NO: 55) was synthesized by Bioneer. A vector for expressing this is shown in SEQ ID NO: 56.

Then, by analyzing the results expressed from the vector, it was confirmed that showing a specific binding force to c-Met.

1.5. Fabrication of Library Genes for Affinity Maturation

1.5.1. Target CDR Selection and Primer Construction

Six complementary determining regions (CDRs) were defined by 'Kabat r inibering' from the mouse antibody AbF46, prepared for the affinity niaturat ion of the huAbF46 antibody, and each CDR is shown in Table 2 below. Same as

Table 2

CDR-L2 WASTRVS (SEQ ID NO: 11 ⁾

CDR-L3 QQSYSAPU (SEQ ID NO: 12)

Primers were prepared as follows to introduce random sequences of antibody CDRs. In the conventional random sequence introduction method, N codons were used to introduce the same ratio of bases (25¾ A. 25% G, 25% C. 25% T) to the site to be mutated, but in this example, the huAbF46 antibody was used. To introduce random bases into the CDRs, 85% of the first and second nucleotides encoding the amino acids of each CDR are preserved and 5% of the remaining three bases are introduced. The way was taken. In addition, primers were designed such that the third nucleotide was introduced equally (33% G. 33% C, 33% T).

1.5.2. Library Construction of huAbF46 Antibody and Confirmation of Avidity for c-Met

Construction of the antibody library gene by introducing a random sequence of CDRs was performed using primers prepared in the same manner as in Reference Example 1.5.1. Using the polynucleotide containing the scFv of the huAbF46 antibody as a template, two PCR fragments were prepared as shown in FIG. 1. This can be achieved by using an overl ap ext ens i on PCR method. Six genes were constructed by obtaining the scFv library genes of the mutated huAbF46 antibodies, each of which only the desired CDRs were.

Libraries that target each CDR were constructed.

The prepared libraries were found to bind the wild type and c-Met of each library, each library showed a tendency to lower the binding capacity for c-Met than the wild type, but the binding capacity for some c-Met Remaining mutations were identified.

1.6. Screening for Improved Affinity Antibodies

After enhancing the binding capacity of the library to c-Met from the constructed library, the gene sequence of scFv was analyzed from each individual clone. The obtained gene sequences are shown in Table 7 below, respectively. It was converted to IgG form. In the following clones. L3-1. L3-2. L3-3. Four antibodies produced from L3-5 Selection and subsequent experiments were performed.

Table 3

1.7. Conversion of Selected Antibodies to IgG

The polynucleotides encoding the chains of the four selected antibodies consist of 'EcoRI- sigonal sequence-VH-Nhel-CH-XhoI' (SEQ ID NO: 38) .In the heavy chain, the amino acid of the antibody is changed after affinity maturation. Since it was not, the heavy chain of huAbF46 antibody was used as it is. However, the hinge region was replaced with the U6-HC7 hinge (SEQ ID NO: 57), not the hinge of human IgGl. Light chain is' EcoRI-signal The genes were synthesized by designing the sequence-VL-BsiWI-CL-XhoI '. Polynucleotides encoding the light chain variable regions of the four antibodies selected after affinity maturation (SEQ ID NO: 58 to SEQ ID NO: 61) were synthesized by applying to Bioneer. Subsequently, the DNA fragment (SEQ ID NO: 38) comprising the nucleotide sequence corresponding to the heavy chain was added to the pOpt iVEC ™ -T0P0 TA Cloning Kit included in the OptiCHO ™ Antibody Express Kit (Cat no. 12762-019) of Invitrogen, pcDNA. DNA fragment comprising L3-1-derived CDR-L3 (SEQ ID NO: 58. L3-2 derived from DNA fragment comprising nucleotide sequence corresponding to the light chain) in the 3.3-T0P0 TA Cloning Kit (Cat no. 8300-01) DNA fragments comprising CDR-L3: SEQ ID NO: 59, DNA fragments comprising L3-3 derived CDR-L3: SEQ ID NO: 60, DNA fragments containing L3- 5 derived CDR-L3: SEQ ID NO: 61), respectively, EcoRKNEB . R0101S) and XhoKNEB. R0146S) Cloning with restriction enzymes constructed a vector for the expression of affinity matured antibodies.

The constructed vectors were each amplified using a Qiagen Maxiprep kit (Cat no. 12662). Ad hoc expression was performed using the Freestyle ™ MAX 293 Expression System (invitrogen). The cell line used was 293 F cells, and was cultured by suspension culture using FreeStyle ™ 293 Expression Medium as a medium. The cells were prepared at a concentration of 5xl0 ⁵ cells / ml one day before the temporary expression, and after 24 hours, the cells were temporarily expressed when the number of cells reached lxl0 ⁶ cells / ml. Transfection was performed using a liposomal reagent method using Freestyle ™ MAX reagent (invi ti'ogen), and the DNA was prepared in a ratio of heavy chain DNA: light chain DNA = l: l in 15ml ibe and OptiPro ™ SFM (invtrogen). Mix with 2ml (A) and place another 15ml tube with Freestyle ™ MAX reagent and OptiPro ™

After mix (B) 2 ml of SFM. After incubation for 15 minutes by mixing (A) and (B), the mixture was slowly mixed with the cells prepared one day before. After completion of transduction, 37 ^° C., 80% humidity. 8% C0 ₂ . Incubated for 5 days at 130 rpm incubator.

The cultured cells were centrifuged to take 100 ml of each supernatant, and purified using AKTA Prime (GE heal thcare). After installing a Protein A column (GE healthcare. 17-0405—03) on the AKTA Prime and pouring the culture medium at a flow rate of 5 nil / min. Eluted with IgG el Lit ion buffer (Thermo Scientific, 21004). This was exchanged for PBS buf fer to finally four affinity-matured antibodies (hereinafter huAbF46-H4-Al (from L3-l) .huAbF46-H4-A2 (from L3-2), huAbF46-H4-A3 (L3) -3), and huAbF46-H4-A5 (named from L3-5)). 1.8. Preparation of huAbF46-H4-Al Substituted with Constant and / or Hinge Regions Among the four antibodies selected in Reference Example 1.7 above. The highest binding affinity with c-Met. Targeting huAbF46-H4-Al with the lowest levels of Akt phosphorylation and c-Met differentiation. Antibodies in which the hinge region or the constant region and the hinge region were substituted were prepared.

An antibody consisting of a heavy chain consisting of a heavy chain variable region of huAbF46-H4-Al, a U6-HC7 hinge and a human IgGl constant region, and a light chain consisting of a light chain variable region of huAbF46-H4—A1 and a human kappa constant region were selected from huAbF46 ᅳ with H4-Al (U6-HC7); huAbF46-H4— heavy chain variable region of A1. An antibody consisting of a heavy chain consisting of a human IgG2 hinge and a human IgGl constant region and a light chain consisting of a light chain variable region of huAbF46_H4-Al and a human kappa constant region with hiiAbF46-H4-Al (IgG2 hinge); An antibody consisting of a heavy chain consisting of a heavy chain variable region of huAbF46-H4-Al, a human IgG2 hinge and a human IgG2 constant region, and a light chain consisting of a light chain variable region of huAbF46-H4-Al and a human kappa constant region was selected from huAbF46 ᅳ H4- Each named Al (IgG2 Fc). On the other hand, the three antibodies were replaced with tyrosine (tyros ine) all the histidine (hi st i dine) of the light chain consisting of the human kappa constant region 36 to increase production.

To prepare the three antibodies. Polynucleotide encoding the polypeptide consisting of the heavy chain variable region of the huAbF46-H4-Al, the U6-HC7 hinge and the IgGl constant region of human (SEQ ID NO: 62) (SEQ ID NO: 63). heavy chain variable region of huAbF46-H4-Al polynucleotide encoding the polypeptide consisting of the human IgG2 hinge and the human IgGl constant region (SEQ ID NO: 64) (SEQ ID NO: 65), heavy chain variable region of huAbF46-H4-Al, human Polynucleotide encoding the polypeptide consisting of the IgG2 hinge of human and an IgG2 constant region of human (SEQ ID NO: 66) (SEQ ID NO: 67), light chain variable region of huAbF46-H4-Al where histidine 36 is substituted with tyrosine Kappa constant region Polynucleotides encoding the polypeptide (SEQ ID NO: 68) (SEQ ID NO: 69) were synthesized by applying to Bioneer. Subsequently, the DNA fragment containing the nucleotide sequence corresponding to the heavy chain was added to the pOpt iVEC ™ -T0P0 TA Cloning Kit included in the OptiCHO ™ Antibody Express Kit (Cat no. 12762-019) of Invitrogen, pcDNA ™ 3.3-T0P0 TA A DNA fragment containing a nucleotide sequence corresponding to the light chain was inserted into a cloning kit (Cat no. 8300-01) to construct a vector for expression of the antibody.

The constructed vector was amplified using Qiagen Max i prep kit (Cat no. 12662), respectively, and the temporary expression was performed using the Freestyle ™ MAX 293 Expression System (invitrogen). The cell line used was 293 F cells, and cultured by suspension culture using FreeStyle ™ 293 Expression Medium as a medium. One day before the temporary expression cells were prepared at a concentration of 5xl0 ⁵ cells / i, and after 24 hours, the cells were temporarily expressed when the number of cells reached lxl0 ⁶ cel ls / ml. Transfect ion was introduced into lipos using Freestyle ™ MAX reagent (invi trogen) by lal reagent method. Opt i Pro ™ SFM was prepared by preparing DNA at the ratio of DNA: light chain DNA = l: l in 15ml tube. (invtrogen) mix with 2ml (A), mix (B) Freestyle ™ MAX reagent ^' 100 / and Opti Pro ™ SFM 2ml in another 15ml tube, mix (A) and (B) for 15 minutes After incubation, the mixture was slowly mixed with the cells prepared one day before. After the transduction was completed, incubated for 5 days at 37 ^° C, 80% humidity, 8% C0 ₂ , 130 rpm incubator. The cultured cells were centrifuged to take 100 ml of each supernatant, and purified using AKTA Prime (GE healthcare). Protein A column (GE healthcare, 17-0405-03) was installed in AKTA Prime, and the culture solution was eluted with IgG elution buffer (Thermo Scientific, 21004) after the culture solution was poured at a flow rate of 5 nil / min. This was exchanged with PBS buffer for the final three antibodies 0111/1 464¼- / 1 6-7). huAbF46-H4-Al (IgG2 hinge), huAbF46-H4-Al (IgG2 Fc)) was purified. Among them, huAbF46-H4-Al (IgG2 Fc) was selected for the anti-c-Met antibody according to the present invention and used in the following examples, and for convenience, the antibody was named as anti-c-Met antibody SAIT301. Reference Example 2. Preparation of Anti-Nrpl Antibody

2.1. Identification of Internalizing Antibodies Using Patient-Derived Cells Cell panning for identification of anti-Nrpl antibody fragments. Among the patient-derived cells held by the Samsung Medical Center, Seoul, Korea. Cells with high expression levels of Nrpl were selected by FACS (Fluorescence Activated Cell Sorting) method, among which 131 cells (the patient-derived cells obtained from the Nat ionar Cancer Institute (NCI) institution), which express the most Nrpl on the surface, were cell panned. It was used for.

Using a synthetic scFv antibody fragment phage library (Yang et al., Mol. Cells, 27: 225-235, 2009) prepared previously, scFv antibody fragments that bind to human Nrpl were identified through phage display screening. In order to recover phagemid vectors introduced into E. coli host ER2537 (New England Biolab) in phage form, 4 sub-library samples were collected in 400m (! B) (SB / Ampicillin / Glucose). After incubation at 600 ° C., the absorbance at 0.5-0.7 was centrifuged at 5000 g for 20 minutes to remove supernatant and then suspended in 400 ηι (secondary culture medium (SB / Ampicillin). ¹² pfu (plaque forming unit) of helper phage (VCSM13; Stratagene) was added and incubated for 1 hour, followed by 30 ^{° C} after addition of 70 // g / nie of kanamycin antibiotic (antibiotic gene introduced into helper phage). Phage library was secreted outside the host cell by overnight incubation in C. The culture obtained by centrifugation was then precipitated only by phage form using polyethylene glycol (PEG) solution to obtain a phage library. The.

The phage library thus obtained and 131 cells (4 X 10 ⁶ cells), which are patient-derived cells with high Nrpl expression, are mixed and placed in a total of 5 lii NBA (neurobasal medium), fixed on a 4 ^° C. rotator, and then 360 for 1-2 hours. Rotated back. Then, the cells were separated by centrifugation at 300 g for 5 minutes to remove phage particles that did not bind to 131 cells, followed by washing with 5 me NBA. This process was repeated four times. In the final process, 131 cells and phages were placed in a T flask using NBA 5 nie, previously placed in an incubator at 37 ^° C, incubated for 30 minutes at 37 ^° C, and the phage particles adhered to the cell surface were internalized. It was induced to enter the cell.

After transferring to a 15 m conical tube, centrifuged at 300 g for 5 minutes to separate the cells, and this process was repeated 6 times by adding cold PBS (Phosphate buffered saline) 5 πι, and As the panning cycle repeated, the frequency of this process increased. Then, 0.1 Μ glycine (ρΗ 2.2) was added 5 me, and allowed to stand at room temperature for 5 minutes to separate the phage particles on the cell surface from the cell surface. after. Centrifugation at 300 g for 5 minutes to separate the cells were added 0.5 m 100 mM TEA, which was transferred to the e-tube and placed for 15 minutes at room temperature. Next, the cell debris was separated by centrifugation at 12,000 rpm for 5 minutes and the supernatant containing the phage particles in the cells was collected in 1 in. After neutralization by mixing with 2M TrisCpH 8), the cells were placed in a culture medium (SB) of 8.5 m (SB) containing pre-grown ER2537, and cultured at 120 rpm at 37 ^° C to infect the E. coli host ER2537. After centrifugation at 3.000 rpm for 15 minutes, the submerged ER2537 was mixed with culture medium (SB) 500 ^, and then plated in 15 cm culture medium and 5 SB culture medium (50% glycerol) was added to recover colonies. And storage (-80 ^° C). Then, to proceed with repeated cell panning, 1 m ⁽ 'of the previous round of phage solution was taken and phage particle amplification was performed. After incubating in host cell ER2537, helper phage Phosphated particles were separated by PEG precipitation, and the same was used for the next round of panning: The third round of panning was performed. It was, which means that the phage particles were amplified internalized via cell panning, and showed its results are shown in Table 4.

Table 4

2.2. ELISA and Sequence Analysis for Anti-Nrpl scFv Candidate Selection

Phage particles recovered in the third round of cell panning were used to infect host cells (ER2537). Through colonies in the culture medium was confirmed. These colonies were taken and inoculated in 96-well plates containing 200 ιΛ SB / ampicillin culture medium and incubated at 37 ^° C. for 2-3 hours.

next. To induce scFv-pm protein expression, each well was treated with IPTGdsopropyl β-D-1-thiogalactopyranoside at a final concentration of 1 niM and incubated overnight at 30 ^° C. The cultured plate was centrifuged at 3.000 rpm for 15 minutes to remove supernatant, and then 40 ^ TES solution (20% w / v sucrose, 50 mM) per well to recover phage particles in cultured periplasm. Tris. 1 niM EDTA. PH 8.0) was added and the cells were lysed by standing at 4C for 30 minutes. Thereafter, the cells were treated with 60 / 0.2X TES solution for 30 minutes at 4 ^° C. to decompose cells by osmotic pressure, and the plate was centrifuged for 15 minutes at 3,000 rpm to obtain supernatant scFv-pm protein.

25 'of the supernatant obtained in a 96-well plate coated with human Nrpl protein prepared in advance was added to each well, and then bound at room temperature for 1 hour, and then washed six times using TBST and distilled water. after. After HRP-binding anti-HA antibody that can bind to the HA tag of scFv-pm was bound for 1 hour in real, and then washed six times with TBST (0.1¾ Tween20) and distilled water again. After inducing color reaction using TMB solution, the color reaction was stopped with H ₂ SO ₄ solution, and the value was measured at 0.D 450.

The total number of clones analyzed was 384, and 41 of these clones (binding capacity> 2) showed high binding capacity to human Nrpl. BSA solution was used as a control. Of these 41 clones, 10 clones with high binding capacity were selected by reconfirmation ELISA. Thereafter, phagemids were recovered from 10 clones, followed by DNA sequencing, and clones having a total of six different sequences were selected. Clones with different sequences were selected, except 3H10ol, which was the same sequence as 1C08. Finally 3H10, 1A03 and 4F12 clones were selected as anti-Nrpl scFv candidates. CDR amino acid sequence of the selected 3H10, 1A03 and 4F12 clones. Variable region amino acid sequences and DNA sequences encoding the same are shown in Tables 5 and 6.

Table 5 CDR Amino Acid Standing of Anti-Nrpl scFv

Table 6

Heavy and light chain variable regions of anti-Nrpl scFv

2.3. Anti-Nrpl scFv production and Nrpl binding capacity

The basic composition of phagemid can be confirmed in FIG. 2, and in the case of the host cell ER2537 used in the above example, scFv expression alone is not possible because it inhibits the transcriptional inhibition codon (amber codon (UAG)) located in front of the phage ρΙΠ. Thus, the expression strain (TOP10F '; non-suppressor strain) Thermo Thermo sher Phagemid was transduced into the expression strain. after. Through DNA sequencing, each phagemid was identified as an expression strain introduced without mutation, and the expression strain was taken as colonies, and then cultured at 37 ° C overnight after inoculation into LB / ampicillin culture medium 3. Afterwards, 3 niC of cultured at night ¾ were transferred to 400 mi culture medium (SB / Ampicillin) and cultured at 0.D 600 until 0.5-0.7, and cultured overnight at 30 ° C. with a final concentration of 1 mM IPTG. It was. After centrifugation, the culture host was dissolved using 40 m of TES solution (i, and 0.2X TES 60 ιιιί was added to recover phage particles in the periplasm. The recovered supernatant was filtered through a 0.45 iM filter. The scFv protein present in the filtered solution was combined with Ni-NTA bead (Qiagen) l nit 'for 1 hour at room temperature for His-tag purification, and then packed in a gravity column (Bio-rad). Recovery was carried out through a 200 ηιΜ imidazole solution, and after expression and purification of each clone, SDS-PAGE and coomassie blue staining confirmed scFv equivalent size of about 28 kDa (FIG. 3).

ELISA was performed using the purified scFv to determine whether binding ability to the target Nrpl is present. (Repeated ELISM 3 times) was bound to 96 wells coated with 200 ng Nrpl protein and 96 wells coated with 200 ng BSA control group at a level of 5 ^ g / mC per clone for 1 hour at room temperature. Thereafter, washing with 0.1% TBST three times, followed by treatment with HRP-bound HA antibody for 1 hour, washing again, and then standing for 5 minutes with TMB solution. Then, 0D value was measured after stopping the color reaction with 2M sulfuric acid solution. The obtained result is shown in FIG. As shown in FIG. 4. It does not bind to the scFv Nrpl 12B (comparing antibody amino acid sequences: SEQ ID NO: 151; coding DNA sequence: SEQ ID NO: 152) as compared to 1A03, 3H10 and 4F12 scFv showed a specific binding capacity for the Ni ^'pl.

Next, to measure the binding ability according to the concentration of each antibody fragment to human Nrpl. Each scFv in 96 wells coated with 200 ng Nrpl or BSA, respectively, 2.000 ng / me, 1,000 ng / mt, 500 ng / ni. 250 ng / nif, 125 ng / mt. Changes in 0D values (460 nm) were analyzed by treatment at 62.5 ng / mi, 31.25 ng / me, or 15.62 ng / mi concentrations. The obtained result is shown in FIG. As shown in Figure 5, in the binding capacity for Nrpl, in the case of 12B scFv 0D according to the change in concentration On the other hand, in the case of 3H10 and 4F12 scFv, there was no change in the value, and it was confirmed that the scFv bound to Nrpl compared to BSA increased with increasing 0D value.

To quantify the strength of the three scFv antibody fragments by Nrpl protein, the final KD values through ka and kd values were determined using biacore T100, a surface plasmon resonance (SPR) instrument. Got it. The KD value is obtained by dividing the kd value by the ka value. Analysis. The 4F12 scFv had the lowest KD (M) of 73.60 X 10 ^" ^{9. The} 1A03 scFv showed a KD (M) of 89.40 X 10— ^9. The 3H10 scFv showed a D5.4 of 295.4 X 1 (Γ ⁹⁾ . M) values are shown Example 1: Construction of anti-c-Met / anti-Nrpl bispecific antibodies

A double fusion of scFv (3H10, 1A03 or 4F12) of three anti-Nrpl antibodies prepared in Reference Example 2.2 to the c-terminus of the Fc of the anti-c—Met antibody SAIT3 () 1 prepared in Reference Example 1 above. Specific antibodies were prepared. The production process is as follows. First, the heavy chain portion of the SAIT301 antibody used for the bispecific antibody cloning was prepared as follows. The heavy chain coding sequence of the anti-c-Met antibody was synthesized by deleting the C-terminal sequence from position 1396 of SEQ ID NO: 67 and injecting ggcggtggtggttccggaggcggcggatcc instead (Bionia).

Subsequently, the DNA ¾ fragment was ligated to pOpt i VEC ™ -T0P0 TA Cloning vectoi ᅳ included in the OptiCHOTM Antibody Express Kit (Cat no. 12762-019) manufactured by Iiwitrogen.

Meanwhile. Three anti-Nrpl scFv heavy- and light-chain variable regions of the anti-Nrpl scFv were prepared by linking with a peptide linker (G ₄ S) ₂ (synthesis by bionics; N-terminal BamHI restriction enzyme recognition site and C -terniinal Xhol restriction enzyme recognition site).

Then, using the BamHI restriction enzyme and Xhol restriction enzyme, the anti-Nrpl scFv prepared above was cloned into a vector containing a previously prepared SAIT301 portion to construct an expression bag comprising the heavy chain of the bispecific antibody.

The heavy chain of the constructed bispecific antibody (the C terminus of the heavy chain of the anti-c-Met antibody and the N terminus of the anti-Nrpl scFv (3H10, 1A03 or 4F12) are connected by (G ₄ S) ₂ linker) The amino acid sequences are shown in SEQ ID NOs: 142 to 144, respectively,

DNA sequences are shown in SEQ ID NOs: 145-147, respectively.

Also. The light chain coding nucleotide sequence of the anti-c-Met antibody was synthesized to have the nucleotide sequence of SEQ ID NO: 69 (Bionia). PcDNA ™ 3.3-T0P () included in Invitrogen's OptiCHO ™ Antibody Express Kit (Cat no. 12762-019)

A DNA fragment containing the nucleotide sequence corresponding to the light chain was inserted into a TA cloning vector (Cat no. 8300-01) to construct a vector expressing the light chain (SEQ ID NO: 68) of the bispecific antibody.

The constructed heavy chain expression vector and light chain expression vector were amplified using Qiagen Max i prep kit (Cat no. 12662), respectively, and the temporary expression was FreestyleTM MAX.

293 Expression System (invi trogen) was used. The cell line used is 293F cell. FreeStyle ™ 293 Expression Medium was used to culture the cells in suspension culture. Cells one day before the temporary expression

After preparation at a concentration of 5xl0 ⁵ cells / ml, after 24 hours, when the number of cells reached lxl0 ⁶ cells / ml, the temporary expression was performed. FreestyleTM MAX reagent

transduction (transfect ion) by a liposomal reagent method using invitrogen ^; Proceeded. Prepare DNA in a ratio of heavy chain DM: light chain DNA = 1: 1 in a 15 ml tube, mix with 2 ml of OptiPro ™ SFM (invtrogen) (A). In another 15ml tube

After mixing (B) FreestyleTM MAX reagent 100 // ('and OptiPro ™ SFM 2ml, mix (A) and (B) and incubate for 15 minutes.The mixed solution was slowly mixed into the cells prepared one day before. After completion, incubated for 4 days at 37 ^° C, 80% humidity, 8% C0 ₂ , 130 rpm incLibator.

Centrifuge the cultured cells to take 100 ml of each supernatant, and AKTA

Purification was carried out using Prime (GE healthcare). A HiTrap MabSelect SuRe column (GE healthcare. 11-0034-95) was installed in AKTA Prime, and the culture solution was poured at a flow rate of 5 ml / min, followed by IgG e hit ion buffer (Thermo Scientific,

21004), and the resulting eluate was exchanged with PBS buffer.

The anti-c-Met / anti-Nrpl bispecific antibodies in which three anti-Nrpl scFvs were fused to the c ′ terminal of the anti-c-Met antibody SAIT3 () 1 prepared above are summarized in Table 7 below.

Table 7 Binary Antibody -c-Met Antibody "" Nrpl scFv Reinforced Light Chain

MN02 1A03 SEQ ID NO: 145

VII: SEQ ID NO: 148)

03 3H10 SEQ ID NO: 146

SAIT301 SEQ ID NO: 68

(DNA: SEQ ID NO: 149)

N04 4F12 SEQ ID NO: 147

(DNA: SEQ ID NO: 150) Example 2: Binding Affinity of Anti-c-Met / Anti-Nrpl Bispecific Antibodies to c-Met and Nrpl

The affinity for c-Met of the three anti-c-Met / anti-Nrpl bispecific antibodies prepared in Example 1 was confirmed using Biacore TIOO (GE), respectively. Human Fab binder (# 28-9583-25. GE Healthcare) was immobilized on the surface of the CM5 chip (# BR-1005-30, GE) according to the manufacturer's instructions. About 90 120 RU of bispecific antibody MA01 was captured and various concentrations of _C- Met-Fc (# 358-MT / CF. R & D Systems) were injected into the captured antibody. The surface was regenerated by injecting a 100 mM solution of Glycine-HCKpH 1.5). In order to measure the affinity, the data obtained in the above experiments were fitted using a BIAevaluation softvvare (GE Healthcare, Biacore T100 evaluation software).

In addition, the affinity for Nrpl of the three anti-c-Met / anti-Nrpl bispecific antibodies prepared in Example 1 was confirmed using Biacore T100 (GE), respectively. Anti-histidine antibody (R & D Systems) was immobilized on the surface of the CM5 chip (# BR-1005-30, GE) according to the manufacturer's instructions. C-terminal hi st idine-tagged human Nrpl (R & D Systems) was captured and various concentrations of bispecific antibodies were injected into the captured antigen (Nrpl). The surface was regenerated by injecting a lOniM Glycine-HCl (pH 1.5) solution. To measure affinity. The data obtained in this experiment were fitted using a BIAevaluation soft ware (GE Healthcare. Biacore T100 evaluation software).

The results obtained are shown in Table 8 below:

Table 8

Double antibody KD against c-Met KD against Nrpl KD against Nrpl,

(nM) (nM) scFv. (iiM)

MN02 0.08 22.31 138.5 MN03 0.09 11.43 67.21

MN04 0.05 0.38 0.62

In Table 8, "KD against c-Met '" is the binding affinity for c-Met of the double antibody. "KD against Nrpl" is the binding affinity for Nrpl of the double antibody. "KD against Nrpl, scFv,' ' Denotes the binding affinity for Nrpl of anti-Nrpl scFv, respectively.

As confirmed in Table 8 above, it can be seen that the anti-c-Met / anti-Ni-pl bispecific antibody maintains avidity for c-Met and Nrpl at a similar level as in a single antibody. Example 3 Effect of Anti-c-Met / Anti-Nrpl Bispecific Antibody on Cancer Cell Growth Inhibition of cancer cell killing effect of the anti-c-Met / anti-Nrpl bispecific antibody prepared in Example 1 of gastric cancer cell line MKN45 Was tested.

Specifically, 5000 MKN45 cells (JCRB0254) were dispensed into each well containing a medium (GIBCO RPMI 1640, lOOul / well), and the three bispecific antibodies prepared in Example 1 were each 60 nM (l). treatment for 5 days). Cell number change was measured by CellTiter Glo (CTG) assay. Specifically, after incubation for 5 days, 100 microliters of CTG solution (iega to Pr) were added to each well. Incubate at room temperature for 30 minutes. The luminescence signal obtained was recorded using an Envision 2104 Multi-label Reader (Perkin Elmer, Walt ham, Massachusetts, USA).

For comparison, the antibody control group (control), the anti-c-Met antibody SAIT301 alone treatment group (60nM) prepared in Reference Example 1, the anti-Nrpl antibody alone treatment group (1A: 1A03 clone of Reference Example 2.2 IgG antibody comprising 6 CDRs: 3H: IgG antibody comprising 6 CDRs of 3H10 clone of Reference Example 2.2; 4F: IgG antibody comprising 6 CDRs of 4F12 clone of Reference Example 2.2; 60 nM each). And the combination of anti-_c- Met antibody SAIT301 and anti-Nrpl antibodies (1A, 3H, 4F) (60 nM, respectively) produced in Reference Example 1 were also performed.

The obtained result is shown in FIG. As shown in FIG. 6, anti-c-Met / anti-Nrpl-specific antibodies have better anti-cancer cell growth inhibitory effects than anti-c-Met antibody alone and anti-Nrpl antibody alone as well as combination thereof. You can see that. Example 4 Inhibition of Cancer Cell Metastasis by Anti-c-Met / Anti-Nrpl Bispecific Antibodies Observed the effect of anti-c-Met / anti-Nrpl bispecific antibodies on cancer cell motility It was. The inhibitory effect on cancer cell migration by VEGF + HGF treatment of the bispecific antibody was tested. For testing, a renal cancer cell line 786-0 (ATCC) having anti- _C- Met antibody SAIT30H1 resistance prepared in Reference Example 1 was used (no anticancer effect when treated with SAIT301 alone). To determine whether cell migration induced by VEGF and HGF is inhibited by anti-c-Met / anti-Nrpl bispecific antibodies. A niigrat ion assay was performed using Oris Migration System (Platypus Thechnologies).

Specifically, kidney cancer cell line 786-0 (ATCC) was inoculated in a 96-well plate equipped with a stopper in an amount of 5 000 per well. After incubation for 24 hours. The stopper was removed and each bispecific antibody prepared in Example 1 above (60 nM each) in RPMI medium (containing 10% FBS: GIBC0) with 0.1 ug (microgram) / ml HGF and 0.1 ug / ml VEGF added Treated for 24 hours. The cells were then visualized by treatment with Hoechst 33.342 (bisbenzimide; Life Technologies). Cell niigrat ions were measured by counting cells with nuclei stained with Hoechst 33342. Cell number measurement was performed using InCell Analyzer 6000 (GE Healthcares), and the results obtained were converted to relative values for the group treated with VEGF + HGF only (100 «).

For comparison, the antibody-free group (vehicle only. HGF only, VEGF only. And VEGF + HGF only), the anti-c-Met antibody SAIT301 alone treatment group (60nM) prepared in Reference Example 1 above, The same test was also performed on the single treatment group (60 nM) of each of the anti-Nrpl antibodies comprising the six CDR3s of the clones prepared in Reference Example 2.2.

The obtained visualization result (fluorescence image) is shown in FIG. 7, and a graph quantifying the fluorescence intensity of FIG. 7 is shown in FIG. 8. As shown in Figs. 7 and 8, wherein -c-Met / anti - Nrpl bispecific antibodies is by the SAIT301 and wherein -Nrpl antibody ^■ comparison with each single treatment, the cell migration by HGF + VEGF (migration ) It showed an excellent synergistic effect on inhibition.

In addition, in order to test the cancer metastasis inhibitory effect of the double antibody, the degree of Invasion inhibition of the antibody against kidney cancer cell line 786-0 was tested.

To confirm the invasion inhibition effect by antibody treatment. BioCoat Growth Factor Reduced MATRIGEL Invasion Chamber (BD science. Cat #. 354483) was used. The burr is divided into an upper chamber and a lower chamber. The upper chamber was used coated with collagen according to the manufacturer's manual.

Kidney cancer cell line 786-0 (ATCC: 10 ⁵ cells / well) was inoculated into the upper chamber. The lower chamber was treated with each bispecific antibody (60 nM each) prepared in Example 1 and then incubated at 37 ^° C. At this time, the lower burrs were added with VEGF or HGF in an amount of 0.1 ug / ml, respectively. After 24 hours. Cells penetrated through the collagen layer of the upper chamber and transferred to the lower burrs were stained with calcein AM (BD) and observed with a fluorescence microscope (ZEISS), and the fluorescence intensity was quantified with an Envision 2104 Multi-label Reader (Perkin Elmer).

For comparison, the antibody-free group (treated only with VEGF + HGF), the anti-c-Met antibody SAIT301 alone treated group (60 nM) prepared in Reference Example 1 above, and the six CDR3s of the clones prepared in Reference Example 2.2 above The same test was performed for the single treatment group (60 nM) of each of the anti-Nrpl antibodies comprising.

The obtained fluorescence image is shown in FIG. 9, and a graph quantifying fluorescence intensity is shown in FIG. 10. 9 and 10, anti-C-Met / anti-Nrpl bispecific antibodies have better cancer cell invasion than anti-c-Met antibody alone and anti-Nrpl antibody alone as well as combinations thereof. It can be seen that the inhibitory effect. Example 5 Anti-c-Met Antibody Resistance Overcoming Test by Anti-c-Met / Anti-Nrpl Bispecific Antibody

To determine the possibility of overcoming resistance of anti-c-Met / anti-Nrpl bispecific antibodies to c-Met targeted therapeutics. Kidney cancer cell line 786-0 resistant to the anti-c-Met antibody SAIT3 () 1 prepared in Reference Example 1 was used (SAIT301 alone). No anticancer effect upon treatment). Referring to Example 3, the bispecific antibody prepared in Example 1 to 5000 cells were each treated at a concentration of 60 nM, and after 3 days, cell number change was measured by CellTiter Glo assay.

For comparison, six of the 4F12 clones obtained from the antibody-free group (denoted as Cont), the anti-c-Met antibody SAIT301 alone treated group prepared in Reference Example 1 (60nM: S301) and the above Reference Example 2.2 The same test was performed for the anti-Nrpl antibody alone treatment group (60nM; represented by 4F) containing CDRs, and the co-administration group of SAIT301 and anti-Nrpl antibody (60nM; represented by S + 4F, respectively).

The obtained result is shown in FIG. As shown in FIG. 11, the anti-c-Met / anti-Nrpl-specific antibody was treated with SAIT301 and 4F12 alone and compared with the case of co-administration thereof. It can be seen that the effect of overcoming resistance to c-Met therapeutic agent in renal cancer cells. Example 5: Anticancer Resistance Overcoming Test with Anti-c-Met / Anti-Nrpl Bispecific Antibody

To identify the possibility of overcoming resistance to anticancer agents (gemcitabine) of anti-c-Met / anti-Nrpl-specific antibodies. Gemcitabine-resistant MKN45 (labeled 'MIiN45-Gem Re') was prepared by repeatedly administering gemcitabine to gastric cancer cell line MKN45.

Specifically. The MKN45-Gem Re cells were prepared by the following procedure. MICN45 cells (ATCC) were exposed to jamcytabine (Eli Lilly) for 3 months. At this time, gemcitabine was treated with increasing concentration in the concentration range of 10 to 100 μM (i vitro). In order to confirm whether the treated cells have a continuous resistance to gemcitabine, by measuring the cell viability in the group incubated for 2 weeks without treatment with the group treated with gemcitabine for 2 weeks, It was confirmed that the cells showed an equivalent degree of cell survival regardless of gemcitabine treatment.

MKN45 cells (ATCC; no resistance; labeled 'parental'). And the prepared gemcitabine resistant cell line MKN45-Gem Re at 60 μl plates at a concentration of 2xl0 ⁵ cells / niL, respectively, and cell proteins were extracted through lysis buffer (Roche) after 24 hours. 20ug of extracted cell protein was loaded onto Western blot gel After Western Blot. Each protein was detected using anti-c-Met antibody (abeam), anti-Nrpl antibody (Cell signaling), anti-p-Akt antibody (Cell signaling), and anti-GAPDH antibody (Cell signaling), respectively.

The obtained result is shown in FIG.

As shown in Figure 12, when gemcitabine resistance is induced, it can be seen that the Nrpl expression level increased.

See Example 3. 5000 MKN45 and MKN45-Gem Re cells were prepared, respectively, and the bispecific antibodies prepared in Example 1 were respectively 0.2. Cell number change was measured by CellTiter Glo assay after 3 days of treatment at 1, or 5 ug / niL concentration.

For comparison, the anti-produced in Reference Example 1 was carried out the same test about the _c _Met antibody SAIT301-only treatment group.

The obtained result is shown in FIG. As shown in FIG. 13, anti-c—Met / anti-Nrpl bispecific antibody showed better cell proliferation inhibitory effect in both MKN45 and M1 (N45-Gem Re cells) than SAIT301 alone. -c-Met / anti- Nrpl bispecific antibody showed an excellent effect of overcoming the anticancer drug resistance.

Changes in the total amount of c-Met and Nrpl were tested upon anti-c-Met / anti-Nrpl bispecific antibody treatment in jamcitabine resistant MKN45 cell line.

Incubate the prepared MKN45-Gem Re cells in 60 隱 plates at a concentration of 2xl0 ⁵ cells / mL. After 24 hours, each of the bispecific antibodies prepared in Example 1 was treated at a concentration of 5 ug / mL for 24 hours, and then the cells were treated with lysis buffer (Roche) to extract cellular proteins. 20 ug of the extracted protein was loaded onto a western blot gel, followed by Western blot, and then, anti-c-Met antibody (abeam), anti-Nrpl antibody (Cell signaling), and anti-GAPDH antibody (Cell signaling), respectively. Protein was detected.

For comparison, instead of the bispecific antibody, each anti-Nrpl antibody comprising six CDRs of the group treated with PBS, the SAIT301 antibody prepared in Reference Example 1 and the clone made in Reference Example 2.2 The same test was performed for the group treated with. The obtained Western blot results are shown in FIG. 14. As shown in FIG. When the anti-c-Met / anti-Nrpl bispecific antibody treatment was applied to MKN45-Gem Re cells, the total amount of c-Met and Nprl was significantly reduced compared with the anti-c-Met antibody and anti-Nrpl antibody treatment. This shows that the double antibody has the internalization and degradation effect of the antigen.

Claims

【Claims】

【Claim 1】

comprising an anti-c-Met antibody or antigen-binding fragment thereof and an anti-Nrpl antibody or antigen-binding fragment thereof,

The anti-c-Met antibody or antigen-binding fragment thereof is an antibody or antigen-binding antibody that specifically binds to an epitope consisting of 5 to 19 consecutive amino acids including the amino acid sequence of SEQ ID NO: 73 in the amino acid sequence of SEQ ID NO: It's a short story,

The anti-Nrpl antibody or antigen-binding fragment thereof is a polypeptide containing the amino acid sequence of SEQ ID NO: 139 (CDR-H1), a polypeptide containing the amino acid sequence of SEQ ID NO: 140 (CDR-H2). Polypeptide containing the amino acid sequence of SEQ ID NO: 141 (CDR-H3), polypeptide containing the amino acid sequence of SEQ ID NO: 142 (CDR-L1), polypeptide containing the amino acid sequence of SEQ ID NO: 143 (CDR-L2) , and an antibody or antigen-binding fragment thereof comprising a polypeptide (CDR-L3) comprising the amino acid sequence of SEQ ID NO: 144,

Anti-c-Met/anti-Nrpl bispecific antibody.

【Claim 2】

According to paragraph 1. The anti-Nrpl antibody or antigen-binding fragment thereof is a polypeptide containing the amino acid sequence of SEQ ID NO: 110 or 121 (CDR-HI),

SEQ ID NO: 111, polypeptide containing the amino acid sequence of 116. or 122 (CDR-H2),

Polypeptide containing the amino acid sequence of SEQ ID NO: 112, 117 or 123 (CDR-H3),

A polypeptide comprising the amino acid sequence of SEQ ID NO: 113, 118, or 124 (CDR-L1),

A polypeptide comprising the amino acid sequence of SEQ ID NO: 114, 119, or 125 (CDR-L2). and

A polypeptide comprising the amino acid sequence of SEQ ID NO: 115, 120, or 126 (CDR-L3) Containing, anti-c-Met/anti-Nrpl bispecific antibody.

【Claim 3】

In paragraph 2. The anti-Nrpl antibody or antigen-binding fragment thereof includes a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 127, 129, or 131, and

Light chain variable region comprising the amino acid sequence of SEQ ID NO ^: 128, 130, or 132

which includes. Anti-c-Met/anti-Nrpl bispecific antibody.

[Claim 4]

The method of claim 1, wherein the anti-Nrpl antibody or antigen-binding fragment thereof has SEQ ID NO: 110 (CDR-H1), 111 (CDR-H2). 112 (CDR-H3), 113 (CDR-L1). 114 (CDR-L2). and 115 (CDR-L3).

SEQ ID NO: 110 (CDR-H1). 116 (CDR-H2). 117 (CDR-H3), 118 (CDR-L1). It contains the amino acid sequence of 119 (CDR-L2), and 120 (CDR-L3), or

SEQ ID NO: 121 (CDR-H1). 122 (CDR-H2), 123 (CDR-H3), 124 (CDR-L1),

Comprising the amino acid sequences of 125 (CDR-L2), and 126 (CDR-L3),

Anti-c-Met/anti-Nrpl bispecific antibody.

【Claim 5】

In clause 4. The anti-Nrpl antibody or antigen-binding fragment thereof includes a heavy chain variable region of SEQ ID NO: 127 and a light chain variable region of SEQ ID NO: 128.

It includes a heavy chain variable region of SEQ ID NO: 129 and a light chain variable region of SEQ ID NO: 130, or

Comprising a heavy chain variable region of SEQ ID NO: 131 and a light chain variable region of SEQ ID NO: 132,

Anti-c-Met/anti-Nrpl bispecific antibody.

【Claim 6】

In paragraph 1. The additive anti-c-Met antibody or antigen-binding fragment thereof has CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4.

Amino acid sequence of SEQ ID NO: 5. Amino acid sequence of SEQ ID NO: 2, or CDRᅳ H2 comprising an amino acid sequence of 8 to 19 consecutive amino acids including the 3rd to 10th amino acids in the amino acid sequence of SEQ ID NO: 2.

Amino acid sequence of SEQ ID NO: 6, amino acid sequence of SEQ ID NO: 85. or CDR-H3, which contains an amino acid sequence of 6 to 13 consecutive amino acids including the 1st to 6th amino acids in the amino acid sequence of SEQ ID NO: 85,

CDR-L1 comprising the amino acid sequence of SEQ ID NO: 7,

CDR-L2 comprising the amino acid sequence of SEQ ID NO: 8. and

Amino acid sequence of SEQ ID NO: 9, amino acid sequence of SEQ ID NO: 15, SEQ ID NO:

CDR-L3 comprising an amino acid sequence of 9 to 17 amino acids, including amino acids 1 to 9 in the amino acid sequence of SEQ ID NO: 86, or amino acid sequence 89.

Anti-c-Met/anti-Nrpl bispecific antibodies comprising:

【Claim 7】

The method of claim 6, wherein the anti-c-Met antibody or antigen-binding fragment thereof. CDR-H1 selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24,

CDR-H2 selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 25, and SEQ ID NO: 26,

SEQ ID NO: 3. CDR-H3 selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 85,

CDR-L1 selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 106,

CDR-L2 selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36, and

Anti-c-, comprising a CDR-L3 selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 37, SEQ ID NO: 86, and SEQ ID NO: 89 Met/anti-Nrpl bispecific antibody.

【Claim 8】 The method of claim 7, wherein the anti-c-Met antibody or antigen-binding fragment thereof. A heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 17, SEQ ID NO: 74, SEQ ID NO: 87, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, or SEQ ID NO: 94. and

SEQ ID NO: 109, SEQ ID NO: 18. SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 75, SEQ ID NO: 88. SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99 or SEQ ID NO: Light chain variable ᄋ 3 OJ containing the amino acid sequence of 107

0

Containing, anti-c-Met/anti-Nrpl bispecific antibody.

【Claim 9】

According to any one of paragraphs 1 to 8.

The antigen-binding fragment is scFv. (scFv)2, scFv-Fc, Fab. selected from the group consisting of Fab' and F(ab')2,

Anti-c-Met/anti—Nrpl bispecific antibody.

【Claim 10】

According to any one of claims 1 to 8,

The anti-c-Met antibody and anti-Nrpl antibody are each a mouse-derived antibody, a mouse-human chimeric antibody, a humanized antibody, or a human antibody,

Anti-c_Met/anti-Nrpl bispecific antibody.

【Claim 11】

According to any one of claims 1 to 8.

Comprising an anti-c-Met antibody in the form of an IgG and an antigen-binding fragment of an anti-Nrpl antibody linked to the C terminus of the Fc of the anti-c-Met antibody,

Anti-c-Met/anti-Nrpl bispecific antibody.

【Claim 12】

A pharmaceutical composition for preventing or treating cancer or cancer metastasis, comprising the anti-c-Met/anti-Nrpl bispecific antibody of any one of claims 1 to 8 as an active ingredient.

【Claim 13】

The pharmaceutical composition according to claim 12, wherein the cancer is an anticancer drug-resistant cancer.

【Claim 14】

5T Comprising the step of administering the anti-c-Met/anti-Nrpl bispecific antibody of claim 1 to a patient in need of prevention or treatment of cancer or cancer metastasis. Methods for preventing or treating cancer or cancer metastasis.

[Claim 15]

In clause 14. The cancer is anticancer drug resistant cancer. method .

[Claim 16]

A method of overcoming anticancer drug resistance, comprising administering the anti-c-Met/anti-Nrpl bispecific antibody of claim 1 to a patient in need of overcoming anticancer drug resistance.

【Claim 17】

The anti-c-Met/anti-Nrpl bispecific antibody of any one of claims 1 to 11 for use in the prevention or treatment of cancer or cancer metastasis.

[Claim 18]

In clause 17. The cancer is anti-cancer drug resistant cancer, anti-c-Met/anti-Nrpl dual-specific antibody.

【Claim 19】

The anti- _C -Met/anti-Nrpl bispecific antibody according to any one of items 1 to 1 for use in overcoming anticancer drug resistance.