WO2017150755A1 - 가금티푸스 및 살모넬라증 예방을 위한 내독소가 감소된 살모넬라 3가 불활화 백신 조성물 - Google Patents

가금티푸스 및 살모넬라증 예방을 위한 내독소가 감소된 살모넬라 3가 불활화 백신 조성물 Download PDF

Info

Publication number
WO2017150755A1
WO2017150755A1 PCT/KR2016/002354 KR2016002354W WO2017150755A1 WO 2017150755 A1 WO2017150755 A1 WO 2017150755A1 KR 2016002354 W KR2016002354 W KR 2016002354W WO 2017150755 A1 WO2017150755 A1 WO 2017150755A1
Authority
WO
WIPO (PCT)
Prior art keywords
salmonella
vaccine composition
msbb
strain
gene
Prior art date
Application number
PCT/KR2016/002354
Other languages
English (en)
French (fr)
Inventor
한태욱
박소연
Original Assignee
(주)비손바이오로직스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)비손바이오로직스 filed Critical (주)비손바이오로직스
Publication of WO2017150755A1 publication Critical patent/WO2017150755A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/025—Enterobacteriales, e.g. Enterobacter
    • A61K39/0275—Salmonella
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55505—Inorganic adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • the present invention relates to a vaccine composition for preventing Salmonella infection, and more particularly, a trivalent inactivating vaccine for preventing Salmonella infection comprising a mixture of Salmonella gallinarum, Salmonella enteritidis, and Salmonella typhimurium strains, in which the msbB gene is deleted. It relates to a composition.
  • Salmonellosis is a foodborne infection caused by Salmonella spp., The causative bacterium.
  • the majority of Salmonella serotypes are common infectious diseases that infect not only livestock, but also humans. And diseases that are problematic in public health.
  • poultry typhoid which causes great economic damage in the poultry industry, is caused by Salmonella Gallinarum (SG), the causative chain, and it is not harmful to humans, but it infects all poultry ages and causes death. Reduce broiler productivity.
  • Salmonella Enteritidis (SE) and S. Typhimuriun (ST) cause economic losses due to diarrhea and other digestive symptoms in chickens, and lower egg production in laying hens.
  • SE Salmonella Enteritidis
  • S. Typhimuriun ST
  • SG9R Salmonella gallinarum (SG) prophylactic vaccine
  • SG Salmonella gallinarum
  • the present inventors While studying the vaccine composition for preventing Salmonella infection, the present inventors applied infection from three strains when applying a combination of Salmonella gallinarum, Salmonella enteritidis, and Salmonella typhimurium strains lacking the msbB gene related to endotoxin. At the same time, it has been found to be useful for the prevention of Salmonella infection by defending.
  • an object of the present invention is to provide a vaccine composition for preventing Salmonella infection comprising Salmonella galinarum, Salmonella enteritidis and Salmonella typhimurium strains, in which the msbB gene is deleted.
  • msbB gene is deficient Salmonella Galina room strain
  • msbB gene is deficient Salmonella enter utility discharge strain
  • msbB Salmonella infection vaccine composition for the gene comprises a deletion of Salmonella typhimurium strains do.
  • the msbB Salmonella Galina room isolates the gene defect has accession No. KCTC 12960BP may be in the msbB gene is deficient Salmonella enter utility discharge strain accession number KCTC 12798BP may be in the msbB gene is deficient Salmonella typhimurium strain May be accession number KCTC 12961BP.
  • the Salmonella infection may be infected by one or more bacteria selected from the group consisting of Salmonella gallinarum, Salmonella enteritidis and Salmonella typhimurium, and the group consisting of poultry typhoid, poultry paratyphoid and poultry typhoid. It may be any one selected from.
  • the poultry may be any one selected from the group consisting of chickens, ducks, turkeys, quails, waterfowl, pigeons, canaries, pigs and beef cattle, the Salmonella infection may be chicken salmonella.
  • the vaccine composition is a Salmonella typhimurium strain with the msbB gene is a the defect Salmonella Galina room strain, msbB gene is deficient Salmonella enter utility discharge strain and the msbB gene defect 1: CFU ratio of 1: 1 It may include.
  • the vaccine composition may further comprise a pharmaceutically acceptable carrier or adjuvant, and may further comprise an IMS1313 excipient and aluminum hydroxide gel.
  • the volume ratio of the IMS1313 excipient and aluminum hydroxide gel may be 1: 1.
  • a method for preventing Salmonella infection comprising administering the vaccine composition to an animal other than a human.
  • Trivac which is a vaccine composition for preventing Salmonella infection, including Salmonella gallinarum strain lacking endotoxin-related msbB gene, Salmonella enteritidis strain and Salmonella typhimurium strain, It has been found to be able to simultaneously protect against infections of the fungus and to compensate for the side effects of existing oily vaccine compositions.
  • the vaccine composition of the present invention can be usefully used for the prevention of Salmonella infection.
  • Figure 1 is a msbB deletion strain produced a check test results produced using the lambda Red recombination system (lamda red recombination system).
  • (a) shows the embodiment in which the strain deficient the msbB gene from Salmonella Galina room (SG) according to 1 (SG ⁇ msbB),
  • (b ) the strain was deficient the msbB gene from Salmonella enter utility disk (SE) in accordance with Example 2 (SE ⁇ msbB),
  • SE ⁇ msbB Salmonella enter utility disk
  • ST ⁇ msbB defect the msbB gene from Salmonella typhimurium
  • FIG 2 shows the safety evaluation results of the BBL-A1 vaccine composition.
  • (a) was treated with Salmonella antigen and oily vaccine composition
  • (b) was with oily vaccine composition
  • (c) was with Salmonella antigen and BBL-A1 vaccine composition
  • (d) was with BBL-A1 vaccine composition.
  • Figure 3 is a schematic diagram showing the progress of the protective effect evaluation against Salmonella infection of trivalent inactivated vaccine prepared according to an embodiment of the present invention.
  • Figure 4 is a result of measuring the long-term colony (CFU / tissue) of each of the three challenge inoculation strains in the liver and spleen of the chicken at the time of inoculation of the trivalent inactivated vaccine prepared according to an embodiment of the present invention.
  • (a) and (b) are organ colonies of Salmonella enteridis (SE) measured in liver and spleen
  • (c) and (d) are organ colonies of Salmonella typhimurium (ST) measured in liver and spleen.
  • Numbers, (e) and (f) are the results of a comparison of long-term colony counts for Salmonella gallinarum (SG) measured in liver and spleen.
  • Figure 5 is the result of measuring the antibody titer (IgG titer) produced after inoculation of the Trivac (Trivac) vaccine prepared according to an embodiment of the present invention.
  • (a) shows the results of measurement of IgG antibody against Salmonella typhimurium (ST), and
  • (b) shows the IgG antibody value against Salmonella gallinarum (SG).
  • prevention means inhibiting the occurrence of a disease or condition in an animal that has not been diagnosed as having a disease or condition but is prone to Salmonella disease or disease.
  • the term "vaccine” is a generic term for a drug that weakens an antigen, that is, a pathogen and injects it into a human body or an animal to form an antibody, thereby protecting and immunizing the disease. There are inactivated vaccines that kill them and live vaccines that attenuate pathogenicity.
  • the inactivated vaccine is a vaccine made by killing pathogenic microorganisms by purifying pathogens and heating them, or by using UV irradiation or formalin or alkylation reagents. It is important to maintain the structure of the antigen present in. Inactivated vaccines mainly induce humoral immunity, but have high safety and thus have little side effects of vaccination and have potential application as a multivalent vaccine.
  • msbB gene has a defect Salmonella Galina room (Salmonella Gallinarum) strain
  • msbB gene is a display of defect Salmonella enter utility (Salmonella enteritidis) strain and the msbB gene is deficient Salmonella typhimurium (Salmonella typhimurium) It provides a vaccine composition for preventing Salmonella infection comprising the strain.
  • the msbB Salmonella Galina room isolates the gene defect has accession No.
  • KCTC 12960BP may be in the msbB gene is deficient Salmonella enter utility discharge strain accession number KCTC 12798BP may be in the msbB gene is deficient Salmonella typhimurium strain May be accession number KCTC 12961BP.
  • the vaccine composition may be an inactivated vaccine composition.
  • the activity of the protein expressed from the gene may be very low, and a single or complex gene may be missed, or antibiotic resistance genes or other genes that are foreign genes within the base sequence. It may be a method of inserting to prevent the expression of the complete protein.
  • the method of deleting all the base sequences of the gene which exists in a chromosome can also be used (nonpatent literature 1-3). Or in combination with the variant according to the above method.
  • the method of deleting the gene group can use the one-step inactivation method (non-patent literature 4) using lambda red recombinase developed by Datsenko KA et al. have.
  • the msbB gene is a gene associated with Salmonella lipopolysaccharide (LPS) synthesis, and serves to add myristic acid to a lipid A precursor as an acyltransferase. Deficiency of this enzyme is known to affect the host's interaction with Toll-like receptors (TLRs), thereby affecting bacterial intracellular survival and pathogenicity. Thus, by deleting genes essential for the survival or pathogenicity of the bacteria can be achieved the effect of reducing the survival rate in the host cell.
  • LPS Salmonella lipopolysaccharide
  • the Salmonella infection may be infected by one or more bacteria selected from the group consisting of Salmonella gallinarum, Salmonella enteridis, Salmonella typhimurium, poultry typhoid, poultry paratyphoid and poultry typhoid It may be any one or more selected from the group consisting of.
  • the poultry may be any one selected from the group consisting of chickens, ducks, turkeys, quails, waterfowl, pigeons, canaries, pigs and beef cattle, the Salmonella infection may be chicken salmonella.
  • the vaccine composition is a msbB gene is deficient Salmonella Galina room strain, msbB gene is deficient Salmonella enter utility discharge strain and the msbB gene is a Salmonella typhimurium strain of 1 deficiency: 1: 1 It may be included in the CFU ratio, each mutant strain may be included in 1 ⁇ 10 9 (colony forming unit (CFU) / dose) in the vaccine composition.
  • CFU colony forming unit
  • the vaccine composition may further comprise a pharmaceutically acceptable carrier or adjuvant.
  • the vaccine composition may further comprise one or more pharmaceutically acceptable carriers or additives. That is, the vaccine composition of the present invention may be formulated in the form of oral dosage forms, external preparations, suppositories, and sterile injectable solutions, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, respectively, according to conventional methods. .
  • the pharmaceutically acceptable carrier is lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil and the like. Also included are diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, and the like.
  • the excipient is also called an adjuvant (adjuvant), a material that promotes the immune response to the antigen in the specific process of the initial activation of immune cells, agents that enhance immunity by increasing the activity of cells of the immune system, but not an immunogen to the host, Molecule and the like. Selection of excipients in the manufacture of inactivated vaccines is an important cause of vaccine efficacy.
  • adjuvant a material that promotes the immune response to the antigen in the specific process of the initial activation of immune cells, agents that enhance immunity by increasing the activity of cells of the immune system, but not an immunogen to the host.
  • Oral solid preparations include tablets, pills, powders, granules, capsules and the like, which solid preparations include at least one excipient such as starch, calcium carbonate, sucrose or lactose ( lactose), gelatin, and the like, and may include lubricants such as magnesium stearate, talc, and the like.
  • Oral liquid preparations include suspensions, solvents, emulsions, syrups, and the like, and may include water, diluents such as liquid paraffin, wetting agents, sweeteners, fragrances, preservatives, and the like.
  • Parenteral preparations include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, and non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, and vegetable oils such as olive oil and ethyl. Injectable esters such as oleate and the like.
  • As the base of the suppository witepsol, macrogol, tween, cacao butter, laurin butter, glycerogelatin and the like may be used.
  • the vaccine composition may additionally comprise an IMS1313 (MONTANIDE IMS1313, SEPPIC) excipient and aluminum hydroxide gel (Alum gel).
  • the volume ratio of the IMS1313 excipient and aluminum hydroxide gel may be 1: 1.
  • the volume ratio of the mutant strain and the mixed excipient may be preferably set to 80:20. If mixed excipients are used in amounts less than the above ranges, the sustainability of the effects due to the antigen may be insufficient.
  • the adjuvant refers to a compound or mixture that enhances the immune response and / or promotes the rate of absorption after inoculation and includes any absorption-promoting agent.
  • Acceptable adjuvants include Freund's complete adjuvant, Freund's incomplete adjuvant, saponins, mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, fluoron polyols, polyanions, peptides, oils or hydrocarbon emulsions, keyhole pets Hemocyanin, dinitrophenol, and the like, but are not limited thereto.
  • a method for preventing Salmonella infection comprising administering the vaccine composition to an animal other than a human.
  • the vaccine composition comprising the vaccine and the vaccine prepared above may be administered intraperitoneally, intramuscularly, subcutaneously, or intramucosally.
  • the second inoculation is performed after a certain period of time, and the Salmonella entity Humoral immunity responses to DIS, Salmonella typhimurium (ST), and Salmonella gallinarum (SG) can be induced.
  • Salmonella enteritidis strain HID1403 SE
  • Salmonella typhimurium strain HID1115 ST
  • Salmonella gallinarum strain HID1095 SG
  • the pathogenic Salmonella strains HID1403 and HID1115 were isolated from chickens diagnosed with chicken salmonella, and HID1095 from chickens diagnosed with poultice. All Salmonella strains and mutant strains were cultured in low salt Luria Bertani (LB) culture or agar medium (MSB agar) at 37 ° C., and antibiotics (ampicillin 200 ⁇ g / ml, kanamycin 70 ⁇ g / ml or tetracycline 40 ⁇ g / Screening was carried out using a ml).
  • LB low salt Luria Bertani
  • MSB agar agar medium
  • Salmonella enteritidis strain HID1403 SE
  • Salmonella typhimurium strain HID1115 ST
  • Salmonella gallinarum strain HID1095 SG
  • Plasmid Related Description source pTP 233 Lambda Red Recombinase Expression Vector, Zoplasmid, Temperature Sensitive, Tetracycline (Tet) Resistant Gene Kangwon National University Veterinary and Epidemiology Laboratory pkD4 Template plasmid for amplification of kancasses flanked by FLP recognition site (FRT), kanamycin (Km) resistant gene Datsenko & Wanner, 2000 pCP20 FLP recombinase enzyme gene, antibiotic resistance gene elimination function, growth in temperature sensitive plasmid (30 ° C), ampicillin (Amp) resistant gene Datsenko & Wanner, 2000
  • mutant strains HID2114, HID2138, and HID2129 each of which deleted the Salmonella msbB gene, were prepared, and the strains were deposited in the Korea Research Institute of Bioscience and Biotechnology.
  • the transformed strain selected in the above method was then removed using the plasmid pCP20 to remove the kanamycin resistance region, and the deletion was confirmed by PCR amplification and DNA sequencing (FIG. 1).
  • HID2114 SE ⁇ msbB
  • HID2138 ST ⁇ msbB
  • HID2129 HID2129
  • Wild-type (wildtype, WT) SE, msbB gene magnitude of ST and SG are 1,141 bp, 861 bp, 805 bp, whereas, msbB gene
  • the size of the msbB gene defect SE ⁇ msbB, ST ⁇ msbB and SG ⁇ msbB is 418 bp, 261 bp , 197 bp, so that the gene deletion strain was successfully produced.
  • Antigen Salmonella enteritidis strain HID2114 SE
  • Salmonella typhimurium strain HID2138 ST
  • Salmonella gallinarum strain HID2129SG were inoculated in 1 L of MSB liquid medium, and then incubated for 18 hours at 37 ° C.
  • the cells were centrifuged at 8000 rpm for 20 minutes, and PBS (phosphate buffered saline, pH 7.2) was added to the isolated bacterial pellet, followed by centrifugation. After the procedure was performed twice, formalin was added so that the final concentration was 0.3% (v / v), and the bacteria were inactivated by the reaction at 4 ° C. for 24 hours.
  • PBS phosphate buffered saline, pH 7.2
  • the mixed adjuvant was mixed in a 1: 1 ratio of IMS1313 excipient and aluminum hydroxide gel excipient and is referred to as 'BeesonBiologics adjuvant, BBL-A1' collectively as the excipient (adjuvant) mixed by the above method. It was.
  • the vaccine composition was prepared by mixing the trivalent mixed antigen with a volume ratio of 8: 2 (antigen: mixed adjuvant), and when the mixed adjuvant is used in a smaller amount than the above range, the antigen sustaining effect as a vaccine adjuvant may be insufficient. have.
  • the trivalent vaccine in which the inactivated mixed antigen (1: 1: 1) prepared by the above method and the mixed adjuvant BBL-A1 is combined is referred to as 'Salmonella trivalent inactivated vaccine, Trivac'. It was.
  • the inoculation site was one week after vaccination in the thigh of the 40-week-old brown laying hen.
  • the experimental group was a vaccination group mixed with an adjuvant and a Salmonella antigen, and an adjuvant single vaccination group
  • the control group was a vaccine containing a mixture of Salmonella antigen and water (W / O, ISA70, SEPPIC), which are widely used as a Salmonella vaccine composition.
  • the inoculation group, oil (ISA70, SEPPIC) single inoculation group was divided into a total of four groups were bred, and the side effects of the inoculation were compared.
  • Salmonella trivalent inactivated vaccine which is a combination of inactivated mixed antigen (1: 1: 1) and mixed adjuvant BBL-A1
  • Trivac Salmonella trivalent inactivated vaccine
  • a control group only the PBS-inoculated negative control group was used, and as the vaccine control group, commercialized MSD SG9R and Salenvac-T vaccine control groups were included.
  • the SG9R vaccine was intramuscular (IM) inoculated at 2 ⁇ 10 7 CFU / 0.5 ml, and Salenvac-T was inoculated at 0.5 ml / dose per muscle (IM) per company protocol.
  • the blood collection schedule is as shown in FIG. 3, and blood was collected from the jugular vein of the chicken at two-week intervals from before vaccination (3 weeks old) to the end of the experiment (11 weeks old).
  • tissue crushed solution was subjected to decimal step dilution, incubated after plating on LB agar medium to which 0.1% NA was added, and CFU / g was measured.
  • the Salmonella trivalent vaccine Trivac which has been developed, was able to defend against all pathogenic isolates SE, ST and SG even with a single vaccination.
  • OMP Outer membrane protein isolated from SE, ST, SG was used as a coating antigen, and was prepared at a concentration of 2.5 ⁇ g / ml by adding 0.05 M buffer (sodium bicarbonate buffer, pH 9.6).
  • 0.05 M buffer sodium bicarbonate buffer, pH 9.6
  • 100 ⁇ l / well of OMP antigen was dispensed and coated at 4 ° C. for 16 hours.
  • the wells were washed three times with 0.05% PBS-T (Phosphate Buffered Saline-Tween20) and then blocked with 2% BSA (Bovine Serum Albumin) / PBS for 2 hours.
  • PBS-T Phosphate Buffered Saline-Tween20
  • BSA Bovine Serum Albumin
  • the primary antibody (chicken serum) diluted 200-fold with 1% BSA / PBS was dispensed by 100 ⁇ l / well, followed by binary dilution for 1 hour at 37 ° C., and the secondary antibody diluted 20,000-fold (goat anti- Chicken HRP conjugated; Bethyl Laboratories, USA) was dispensed in 100 ⁇ l / well and reacted at 37 ° C. for 1 hour.
  • the IgG antibody titer of SG9R vaccination group (log 10), which is attenuated live vaccine at 14 days (2 weeks) of vaccination, was measured. ) was 1.78 times higher than the negative control group and 0.78 times higher than the Trivac inoculation group. However, as time passed, it was confirmed that at day 42, the Trivac inoculated group showed 1.35 times higher IgG antibody value and 3.11 times higher than the negative control group than the SG9R vaccination group. In addition, the results shown in FIG.
  • Trivac a vaccine composition containing a trivalent inactivating vaccine and an adjuvant deficient in the msbB gene, protects against pathogenic Salmonella as well as SG9R, an attenuated live vaccine, and Salenvac-T, a bivalent vaccine. Efficacy and it was confirmed that the sustained humoral immunity was better than the SG9R vaccination group. In addition, it was confirmed that the safety of the vaccine composition formulation, which is the most problematic, is superior to the oily vaccine composition used most in chickens (no inoculation side effects).
  • Trivac the vaccine composition of the present invention
  • a single dose of trivalent vaccine had the same effect as a single vaccine (SG9R) or a bivalent vaccine (Salenvac-T), and thus, if used in the future, It is believed that the economic burden will be reduced, and the adjuvant of the present invention may be applied as a candidate vaccine composition formulation of other bacterial vaccines as well as the trivalent vaccine.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

본 발명은 살모넬라 감염증 예방용 백신 조성물에 관한 것으로서, msbB 유전자가 결손된 살모넬라 갈리나룸 균주, msbB 유전자가 결손된 살모넬라 엔터리티디스 균주 및 msbB 유전자가 결손된 살모넬라 티피뮤리움 균주를 혼합하여 포함하는 3가 혼합 항원을 포함하는 혼합 애쥬번트(이하 'BeesonBiologics adjuvant, BBL-A1')는 살모넬라 감염증 예방용 3가 불활화 백신 조성물(이하 트리백[Trivac]')을 제공한다. 본 발명의 약학 조성물은, 상기 3가지 혈청형 균의 감염을 동시에 방어할 수 있으며 기존 오일성 백신 조성물의 부작용 또한 보완하므로, 살모넬라 감염증의 예방에 유용하게 사용될 수 있다.

Description

가금티푸스 및 살모넬라증 예방을 위한 내독소가 감소된 살모넬라 3가 불활화 백신 조성물
본 발명은 살모넬라 감염증 예방용 백신 조성물에 관한 것으로, 더욱 상세하게는 msbB　유전자가 결손된 살모넬라 갈리나룸, 살모넬라 엔터리티디스 및 살모넬라 티피뮤리움 균주를 혼합하여 포함하는 살모넬라 감염증 예방용 3가 불활화 백신 조성물에 관한 것이다.
살모넬라증은(Salmonellosis)는 원인 세균인 살모넬라 혈청형(Salmonella spp.)에 의해 발생하는 식품매개 전염병으로서, 대다수의 살모넬라 혈청형은 가축뿐만 아니라 사람에게도 감염되는 인수 공통전염병으로, 전 세계적으로 경제적·산업적 및 공중보건학적으로 문제가 되고 있는 질병이다. 그 중 양계산업에서 큰 경제적인 피해를 일으키는 가금 티푸스는 원인체인 살모넬라 갈리나룸(Salmonella Gallinarum: SG)에 의해 일어나며, 사람에게는 크게 위해가 되지 않으나, 모든 가금류 일령을 감염시킴과 동시에 폐사까지 야기하여 산란계 및 육계의 생산성을 감소킨다. 이외에 살모넬라 엔터리티디스(S. Enteritidis: SE)와 티피뮤리움(S. Typhimuriun: ST)은 닭에 설사를 비롯한 소화기증상 유발 및 산란계에서 산란율 저하 등으로 경제적 손실을 야기시키며, 이외에도 계란 및 닭고기를 통해 사람에게 살모넬라 식중독증(살모넬라증, Salmonellosis)을 유발시킴으로써, 전 세계적으로 공중보건학적 문제가 되고 있다.
따라서, 닭 살모넬라증은 경제적 손실 및 공중보건학적인 문제를 야기하기 때문에 현재까지 살모넬라를 예방하기 위한 백신 개발 및 연구가 활발히 진행되고 있다. 하지만, 살모넬라가 가지고 있는 지질다당체(lipopolysaccharide, LPS)항원과 백신을 포함하는 오일성 조성물로 인하여 백신접종 부위에 육아종 형성(염증반응) 등의 백신부작용으로 농장에서는 백신접종을 기피하고 있다.
살모넬라 갈리나룸(SG) 예방 백신인 SG9R은 지속적인 균의 계대배양으로 약독화된 생균 백신으로, 50여년 전부터 널리 사용되어 왔지만 약독화 기전이 명확하지 않은 관계로 백신의 병원성이 복원될 가능성과 숙주 내 간과 비장 등의 실질장기에 SG9R균주에 의한 병변이 보고되어, 선진국에서는 이 백신의 사용이 극히 제한적이거나 사용을 금지하고 있다.
현재 국내농장에서는 SG의 경우 2회 접종, ST+SE를 예방하기 위한 2가백신인 Salenvac-T의 경우 2회 접종으로 문제시되고 있는 주요 살모넬라 혈청형 감염예방을 위해서는 총 4회 접종을 실시해야 하는 시간적, 경제적인 부담이 있다. 또한, 상대적으로 SG감염에 의한 닭의 생산성 감소, 폐사율 증가 등 직접적으로 농장에 피해를 입히는 반면, SE와 ST감염에 의한 피해는 공중보건학적으로 가장 중요한 문제지만, 양계측면에서는 상대적으로 적기 때문에 SG백신보다 SE+ST의 백신접종을 하지 않는 실정이다.
따라서, 상기와 같은 종래의 닭 살모넬라 백신이 가지는 단점을 극복하여, 기존에 상용화된 단일백신과 같은 효능을 가지며, 백신접종의 부작용을 최소화한 내독소 감소된 살모넬라 3가 백신개발과, 성능은 뛰어나지만 육아종 형성 등의 부작용을 지닌 오일성 백신조성물(Oil adjuvant, 예 ISA70)을 대체할 수 있는 조성물에 대한 연구가 필요하다.
본 발명자들은 살모넬라 감염증 예방용 백신 조성물에 대하여 연구하던 중, 내독소와 관련된 msbB 유전자가 결손된 살모넬라 갈리나룸, 살모넬라 엔터리티디스 및 살모넬라 티피뮤리움 균주를 혼합하여 적용할 경우 세 균주로부터의 감염을 동시에 방어함으로써 살모넬라 감염증의 예방에 유용하다는 것을 발견하였다.
따라서 본 발명은 msbB 유전자가 결손된 살모넬라 갈리나룸, 살모넬라 엔터리티디스 및 살모넬라 티피뮤리움 균주를 포함하는 살모넬라 감염증 예방용 백신 조성물을 제공하는 것을 목적으로 한다.
본 발명의 일 태양에 따라, msbB　유전자가 결손된 살모넬라 갈리나룸 균주, msbB　유전자가 결손된 살모넬라 엔터리티디스 균주 및 msbB　유전자가 결손된 살모넬라 티피뮤리움 균주를 포함하는 살모넬라 감염증 예방용 백신 조성물이 제공된다. 상기 msbB　유전자가 결손된 살모넬라 갈리나룸 균주는 수탁번호 KCTC 12960BP일 수 있고, 상기 msbB　유전자가 결손된 살모넬라 엔터리티디스 균주는 수탁번호 KCTC 12798BP일 수 있고, 상기 msbB　유전자가 결손된 살모넬라 티피뮤리움 균주는 수탁번호 KCTC 12961BP일 수 있다.
일 구현예에서, 상기 살모넬라 감염증은 살모넬라 갈리나룸, 살모넬라 엔터리티디스 및 살모넬라 티피뮤리움으로 이루어진 군으로부터 선택된 1종 이상의 세균에 의해 감염되는 것일 수 있으며, 가금 티푸스, 가금 파라티푸스 및 가금 장티푸스로 이루어진 군으로부터 선택되는 어느 하나일 수 있다. 상기 가금은 닭, 오리, 칠면조, 메추리, 물새, 비둘기, 카나리아, 돼지 및 육우로 이루어진 군으로부터 선택되는 어느 하나일 수 있고, 상기 살모넬라 감염증은 닭 살모넬라증일 수 있다.
일 구현예에서, 상기 백신 조성물은 msbB　유전자가 결손된 살모넬라 갈리나룸 균주, msbB　유전자가 결손된 살모넬라 엔터리티디스 균주 및 msbB　유전자가 결손된 살모넬라 티피뮤리움 균주를 1:1:1의 CFU 비율로 포함할 수 있다.
일 구현예에서, 상기 백신 조성물은 약제학적으로 허용가능한 담체 또는 면역보조제를 추가적으로 포함할 수 있으며, 추가적으로 IMS1313 부형제 및 수산화 알루미늄 젤을 포함할 수 있다. 상기 IMS1313 부형제 및 수산화 알루미늄 젤의 부피비는 1:1일 수 있다.
본 발명의 일 태양에 따라, 상기 백신 조성물을, 인간을 제외한 동물에 투여하는 단계를 포함하는 살모넬라 감염증 예방 방법이 제공된다.
본 발명에 의해, 내독소 관련 msbB　유전자가 결손된 살모넬라 갈리나룸 균주, 살모넬라 엔터리티디스 균주 및 살모넬라 티피뮤리움 균주를 포함하는 살모넬라 감염증 예방용 백신 조성물인 트리백(Trivac)은, 상기 3가지 혈청형 균의 감염을 동시에 방어할 수 있으며 기존 오일성 백신 조성물의 부작용 또한 보완하는 것이 밝혀졌다.
따라서, 본 발명의 백신 조성물은 살모넬라 감염증의 예방에 유용하게 사용될 수 있다.
도 1은 람다 레드 재조합 시스템(lamda red recombination system)을 이용하여 제작한 msbB 결손 균주 제작 확인 시험 결과이다. (a)는 실시예 1에 따라 살모넬라 갈리나룸(SG)에서 msbB 유전자를 결손시킨 균주(SGΔmsbB), (b)는 실시예 2에 따라 살모넬라 엔터리티디스(SE)에서 msbB 유전자를 결손시킨 균주(SEΔmsbB), (c)는 실시예 3에 따라 살모넬라 티피뮤리움(ST)에서 msbB 유전자를 결손시킨 균주(STΔmsbB)이다.
도 2는 BBL-A1 백신 조성물의 안전성평가 결과이다. (a)는 살모넬라 항원 및 오일성 백신 조성물, (b)는 오일성 백신 조성물, (c)는 살모넬라 항원 및 BBL-A1 백신 조성물, (d)는 BBL-A1 백신 조성물을 처리하였다.
도 3는 본 발명의 실시예에 따라 제조된 3가 불활화백신의 살모넬라 감염에 대한 방어효능평가 진행 과정을 나타낸 모식도이다.
도 4은 본 발명의 실시예에 따라 제조된 3가 불활화백신의 접종 시 닭의 간과 비장에서 3가지 공격접종균주의 장기집락수(CFU/tissue)를 각각 측정한 결과이다. (a) 및 (b)는 간 및 비장에서 측정된 살모넬라 엔터리티디스(SE)의 장기집락수, (c) 및 (d)는 간 및 비장에서 측정된 살모넬라 티피뮤리움(ST)의 장기집락수, (e) 및 (f)는 간 및 비장에서 측정된 살모넬라 갈리나룸(SG)에 대한 장기집락수를 비교한 결과이다.
도 5는 본 발명의 실시예에 따라 제조된 트리백(Trivac)백신을 접종한 후 생성된 항체가(IgG titer)를 측정한 결과이다. (a)는 살모넬라 티피뮤리움(ST)에 대한 IgG 항체가, (b)는 살모넬라 갈리나룸(SG)에 대한 IgG 항체가의 측정 결과이다.
본 명세서에서, "예방"이라 함은 질환 또는 질병을 보유하고 있다고 진단된 적은 없으나, 살모넬라 질환 또는 질병에 걸리기 쉬운 경향이 있는 동물에서 질환 또는 질병의 발생을 억제하는 것을 의미한다.
또한 본 명세서에서, "백신"이라 함은 항원, 즉 병원체를 약하게 만들어 인체 또는 동물에 주입하여 항체를 형성하게 하여 그 질병에 방어, 면역성을 가지게 하는 의약품을 총칭하는 것으로, 백신의 종류는 완전히 병원체를 죽여 만드는 불활화 백신과 병원성을 약독화시킨 생백신이 있다.
이 중 불활화 백신은 병원체를 정제한 후 가열하거나, 자외선 조사 또는 포르말린이나, 알킬화 시약 등의 약품을 이용하여 병원성 미생물을 죽여서 만든 백신으로, 불활성화 할 때에 세균이 복제될 수 없게 만들지만 생물체 표면에 존재하는 항원의 구조를 그대로 유지시키는 것이 중요하다. 불활성화 백신은 주로 체액성 면역만을 유도하지만 안전성이 높아서 백신 접종의 부작용이 거의 없으며 다가 백신으로서 응용 가능성이 있다.
본 발명은 일 태양에 따라, msbB　유전자가 결손된 살모넬라 갈리나룸(Salmonella Gallinarum) 균주, msbB　유전자가 결손된 살모넬라 엔터리티디스(Salmonella enteritidis) 균주 및 msbB　유전자가 결손된 살모넬라 티피뮤리움(Salmonella typhimurium) 균주를 포함하는 살모넬라 감염증 예방용 백신 조성물을 제공한다. 상기 msbB　유전자가 결손된 살모넬라 갈리나룸 균주는 수탁번호 KCTC 12960BP일 수 있고, 상기 msbB　유전자가 결손된 살모넬라 엔터리티디스 균주는 수탁번호 KCTC 12798BP일 수 있고, 상기 msbB　유전자가 결손된 살모넬라 티피뮤리움 균주는 수탁번호 KCTC 12961BP일 수 있다. 상기 백신 조성물은 불활화 백신 조성물일 수 있다.
유전자의 염기 서열 중 활성 부위의 단일 또는 복합 서열을 변화하여, 유전자로부터 발현되는 단백질의 활성을 매우 낮출 수도 있고, 단일 또는 복합 유전자의 결손, 염기서열 내부에 외래 유전자인 항생제 내성 유전자나 다른 유전자를 삽입하여 완전한 단백질이 발현되지 못하게 하는 방법일 수 있다. 바람직하게는 염색체에 존재하는 유전자의 염기 서열을 모두 결손하는 방법을 사용할 수도 있다(비특허문헌 1 내지 3). 또는 상기 방법에 의한 변이체의 조합으로 불활성화 시킬 수 있다.
본 발명의 실시예에서는 병원성 유전자를 가장 확실하게 불활성화하기 위해마지막 방법인 염색체내의 염기서열을 모두 결손하는 방법을 사용하였다. 유전자군을 결손하는 방법은 대장균 유전자 결손 방법으로 널리 알려진 Datsenko KA 등이 개발한 람다레드 재조합 효소(lamda Red recombinase)를 이용한 '1 단계 불활성화방법(Onestep deletion method, 비특허문헌 4)을 이용할 수 있다.
상기 msbB 유전자는 살모넬라 지질다당류(lipopolysaccharide, LPS)합성과 관련된 유전자이며, 아실전이효소(acyltransferase)로서 지질 A(lipid A)전구체에 미리스트산(myristic acid)를 첨가하는 역할을 한다. 이 효소의 결핍시 숙주의 톨-유사수용체(Toll-like receptor, TLR)와의 상호작용에 영향을 주어, 세균의 세포 내 생존 및 병원성에 영향을 주는 것으로 알려져 있다. 따라서 상기 세균의 생존 또는 병원성에 필수적인 유전자를 결실시켜 숙주 세포내에서의 생존율을 감소시키는 효과를 달성할 수 있다.
본 발명의 일 구현예에서, 상기 살모넬라 감염증은 살모넬라 갈리나룸, 살모넬라 엔터리티디스, 살모넬라 티피뮤리움으로 이루어진 군으로부터 선택된 1종 이상의 세균에 의해 감염되는 것일 수 있으며, 가금 티푸스, 가금 파라티푸스 및 가금 장티푸스로 이루어진 군으로부터 선택되는 어느 하나 이상일 수 있다. 상기 가금은 닭, 오리, 칠면조, 메추리, 물새, 비둘기, 카나리아, 돼지 및 육우로 이루어진 군으로부터 선택되는 어느 하나일 수 있고, 상기 살모넬라 감염증은 닭 살모넬라증일 수 있다. 상기 가금 티푸스 및 가금 파라티푸스를 예방함으로써, 조류에게서는 소화계통 질병 및 질병으로 인한 폐사를 예방하고, 사람에게서는 인체 살모넬라 감염증 및 식중독을 예방할 수 있다.
본 발명의 일 구현예에서, 상기 백신 조성물은 msbB　유전자가 결손된 살모넬라 갈리나룸 균주, msbB　유전자가 결손된 살모넬라 엔터리티디스 균주 및 msbB　유전자가 결손된 살모넬라 티피뮤리움 균주를 1:1:1의 CFU 비율로 포함할 수 있으며, 각 돌연변이 균주는 백신 조성물 내에 1×109 (colony forming unit, CFU)/dose씩 포함될 수 있다.
본 발명의 일 구현예에서, 상기 백신 조성물은 약제학적으로 허용가능한 담체 또는 면역보조제를 추가적으로 포함할 수 있다. 상기 백신 조성물은 1종 이상의 약제학적으로 허용가능한 담체 또는 첨가제를 추가로 포함할 수 있다. 즉, 본 발명의 백신 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제제화될 수 있다. 상기 약제학적으로 허용가능한 담체는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유 등을 포함한다. 또한, 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 포함한다.
상기 부형제는 애쥬번트(adjuvant)라고도 불리며, 면역세포의 초기 활성화 과정에서 비특이적으로 항원에 대한 면역 반응을 촉진하는 물질로, 숙주에게 면역원은 아니지만 면역계의 세포의 활성을 증대시킴으로써 면역을 강화하는 제제, 분자 등을 의미한다. 불활화 백신의 제작시 부형제의 선발은 백신 효능의 중요한 원인이 된다.
경구용 고형 제제는 정제, 환제, 산제, 과립제, 캡슐제 등을 포함하며, 이러한 고형제제는 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 포함할 수 있으며, 마그네슘 스테아레이트, 탈크 같은 윤활제 등을 포함할 수 있다.
경구용 액상 제제는 현탁제, 내용액제, 유제, 시럽제 등을 포함하며, 물, 리퀴드 파라핀 등의 희석제, 습윤제, 감미제, 방향제, 보존제 등을 포함할 수 있다. 비경구용 제제는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제를 포함하며, 비수성 용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르류 등을 포함한다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween), 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
일 구현예에서, 상기 백신 조성물은 추가적으로 IMS1313(MONTANIDE IMS1313, SEPPIC) 부형제 및 수산화 알루미늄 젤(Alum gel)을 포함할 수 있다. 상기 IMS1313 부형제 및 수산화 알루미늄 젤의 부피비는 1:1일 수 있다. 상기 돌연변이 균주와 혼합 부형제의 부피비는 80:20으로 설정하여 바람직하게 수행될 수 있다. 혼합 부형제를 상기 범위보다 더 적은 양으로 사용할 경우 항원으로 인한 효과의 지속성이 미비할 수 있기 때문이다.
상기 어쥬번트는 면역반응의 향상 및/또는 접종 후 흡수 속도를 촉진하는 화합물 또는 혼합물을 칭하는 것으로 임의의 흡수-촉진제를 포함한다. 허용가능한 어쥬번트로는 프로인트 완전 어쥬번트, 프로인트 불완전 어쥬번트, 사포닌, 미네랄 겔, 예컨대 수산화 알루미늄, 계면활성제 예컨대 리소레시틴, 플루론 폴리올, 다중음이온, 펩타이드, 오일 또는 탄화수소 에멀젼, 키홀림펫 헤모시아닌, 디니트로페놀 등을 포함하나 이에 한정되는 것은 아니다.
본 발명의 일 태양에 따라, 상기 백신 조성물을, 인간을 제외한 동물에 투여하는 단계를 포함하는 살모넬라 감염증 예방 방법이 제공된다.
상기 제작한 백신 및 백신을 포함하는 백신 조성물은 복강 내 투여, 근육 내 투여, 피하 투여 또는 점막 내 투여할 수 있으며, 바람직하게는 1차 접종 후, 일정 기간 경과 후 2차 접종하여, 살모넬라 엔터리티디스(SE), 살모넬라 티피뮤리움(ST), 살모넬라 갈리나룸(SG)에 대한 체액성 면역(humoral immunity)반응을 유도할 수 있다.
이하, 본 발명을 실시예 및 시험예를 통하여 더욱 상세히 설명한다. 그러나, 하기 실시예 및 시험예는 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이에 제한되는 것은 아니다.
< 실시예 >
1. 시험균주 및 배양조건
본 발명에 이용된 균주로는 살모넬라 엔터리티디스 균주 HID1403(SE), 살모넬라 티피뮤리움 균주 HID1115(ST), 살모넬라 갈리나룸 균주 HID1095(SG)를 사용하였다(표 1).
병원성 살모넬라 균주 HID1403 및 HID1115는 닭 살모넬라증으로 진단된 닭에서 분리되었고, HID1095는 가금티푸스로 진단된 닭에서 분리하였다. 모든 살모넬라 균주 및 결손변이 균주는 37 ℃에서 MSB(low salt Luria Bertani, LB) 배양액 또는 한천 배지(MSB agar)에서 배양하였으며, 항생제(ampicillin 200 ㎍/㎖, kanamycin 70 ㎍/㎖ 또는 tetracycline 40 ㎍/㎖)를 사용해 선별과정을 수행하였다.
균주 관련 설명 출처
HID1095 국내 양계농장에서 분리된 병원성 균주 강원대 수의학과 전염병학 연구실
HID1115 국내 양계농장에서 분리된 병원성 균주 강원대 수의학과 전염병학 연구실
HID1403 국내 양계농장에서 분리된 병원성 균주 강원대 수의학과 전염병학 연구실
2. 살모넬라 msbB 유전자 돌연변이체 제작
상기의 언급한 살모넬라 엔터리티디스 균주 HID1403(SE), 살모넬라 티피뮤리움 균주 HID1115(ST), 살모넬라 갈리나룸 균주 HID1095(SG)는 람다 레드 재조합 시스템(Red lambda recombination system)을 기반으로 한 유전자 재조합 시스템을 이용하였으며, 사용한 플라스미드는 표 2와 같다.
플라스미드 관련 설명 출처
pTP 233 람다 레드 재조합효소 발현벡터, 조플라스미드, 온도감수성, 테트라사이클린(Tet)내성 유전자 강원대 수의학과 전염병학 연구실
pkD4 FLP인지 사이트(FRT)에 의하여 측면화된 kan카세트의 증폭을 위한 주형 플라스미드, 카나마이신(Km)내성 유전자 Datsenko & Wanner, 2000
pCP20 FLP 재조합 효소 유전자, 항생제 내성 유전자제거 기능, 온도 민감성 플라스미드(30ㅀC)에서 성장, 엠피실린(Amp)내성 유전자 Datsenko & Wanner, 2000
특이적 프라이머(specific primer)는 표 3과 같다. 하기 프라이머들을 사용하여 플라스미드 카세트 pKD4의 카나마이신 내성 유전자를 증폭하였고, 전기천공법(electrophoration)을 사용하여 각 PCR 산물(PCR product)을 수용성 세포(competent cell, CP cell) 내로 삽입하였다. 상기 세포들을 카나마이신(70 ㎍/㎖)이 포함된 LB 고체배지에 배양하여 형질전환된 균주를 선별하였다. 상기 선별된 변이 균주의 제작을 완료한 후, 확인용 프라이머로 msbB 유전자 부위를 증폭시킨 후 그 유전자 사이즈를 전기영동하여 확인하였다(표 3).
균주a 프라이머 서열 (5'→3')
SE SE_msbB-long F ATGGCGGGGATTGCATTAACACCGGCATCATTCCGTGATGTAGGCTGGAGCTGCTTCGAAGTT
SE SE_msbB-long R TTATACGGCTGAATCTCGCCTGGCTTGCGGGTTTTGAGCAGCTTCCTCCTTAGTTCCTATTCCG
SE SE_msbB com F GCAGACGTCGCTACACTATTCACA
SE SE_msbB com R CGGTTCAACCAATACCACGCGTAT
ST ST_msbB_0202-F ATGGGATAAAGATCTTTACGCTTATACGGCTGAATCTCGCCTGTGTAGGCTGGAGCTGCTTCGAAG
ST ST_msbB_0202-R CGTAGCGAAGCTGAGCGCGAAGCGATTGTCGATGAGATGTTCATATGAATATCCTCCTTAGTTCCT
ST ST MsbB-F1 ATGGGATAAAGATCTTTACGCTTATACGGC
ST ST MsbB-R2 GATCGCATTAACACCGGCATCAT
SG SG_msbB-F_1217-2 step ATGGCGGGGATTGCATTAACACCGGCATCATTCCGTGATTGTGTAGGCTGGAGCTGCTTCGAA
SG SG_msbB-R_1217-2step GTCTGGCGATAGTGTGGTCGTCAGCCGTGAGCAGATCGTCCATATGAATATCCTCCTTAGTTC
SG SG_msbB com F ATGGCGGGGATTGCATTAACACCGGCATCATT
SG SG_msbB com R CAGGATCCAGGTGTACTGTTCCAGAT
최종적으로 각각 살모넬라 msbB 유전자를 결실시킨 돌연변이 균주 HID2114, HID2138, HID2129를 제작하였으며, 한국생명공학연구원 미생물자원센터에 균주를 기탁하였다(표 4).
균주 관련 설명 수탁번호
HID2129 HID1095균주에서 msbB 유전자 결실, SGΔmsbB KCTC 12960BP
HID2138 HID1115균주에서 msbB 유전자 결실, STΔmsbB KCTC 12798BP
HID2114 HID1403균주에서 msbB 유전자 결실, SEΔmsbB KCTC 12961BP
3. 돌연변이체의 확인 및 항생제내성 제거
상기 방법에서 선별한 형질전환균주는 이후, 플라스미드 pCP20을 사용하여 카나마이신 저항성 영역을 제거하였고, 결실 여부는 PCR 증폭 및 DNA 시퀀싱(DNA sequencing)을 통해 확인하였다(도 1).
살모넬라 엔터리티디스(SE), 살모넬라 티피뮤리움(ST), 살모넬라 갈리나룸(SG)에서 각각 msbB 유전자가 결손된 균주는 HID2114(SEΔmsbB), HID2138(STΔmsbB), HID2129(SGΔmsbB)로 명명하였다.
야생형(wildtype, WT) SE, ST 및 SG의 msbB 유전자 크기는 1,141 bp, 861 bp, 805 bp인 반면, msbB 유전자가 결손된 SEΔmsbB, STΔmsbB 및 SGΔmsbB의 msbB 유전자 크기는 418 bp, 261 bp, 197 bp인 것으로 확인되어, 성공적으로 유전자 결손 균주가 제작되었다.
4. 살모넬라 균주 유래 3가지 혈청형 결손변이 균주의 혼합제조
항원인 살모넬라 엔터리티디스 균주 HID2114(SE), 살모넬라 티피뮤리움 균주 HID2138(ST), 살모넬라 갈리나룸 균주 HID2129SG)를 1 L의 MSB 액체배지에 각각 접종한 후 37 ℃에서 18시간 이상 배양하였다. 균을 세척하기 위해, 4 ℃에서 8000 rpm으로 20분간 원심분리하였고, 분리된 균 침전물(bacterial pellet)에 PBS(phosphate buffered saline, pH 7.2)를 첨가 후 원심분리를 하였다. 상기 방법을 2회 진행 후 최종농도가 0.3 %(v/v)되도록 포르말린(formalin)을 첨가하여 4 ℃에서 24시간 반응시키는 방법으로 균을 불활화하였다. 각 균의 불활화유무 및 다른 균에 의한 오염을 확인하기 위하여, SS agar (Salmonella-Shigella) 및 LB agar에 배양하였으며(37 ℃, 18 h), 불활화 유무 확인이 끝난 후 불활화된 3가지 혈청형을 1:1:1(부피비)로 혼합하였다.
5. 혼합 애쥬번트의 제조 및 이용
혼합 애쥬번트(adjuvant)는 IMS1313 부형제 및 수산화 알루미늄 젤(Alum gel) 부형제를 1:1 비율로 혼합하였으며, 상기 방법으로 혼합한 부형제(애쥬번트)를 통틀어 이하 'BeesonBiologics adjuvant, BBL-A1'이라고 지칭하였다.
상기 3가 혼합 항원과 8 : 2(항원 : 혼합 애쥬번트)의 부피비로 혼합하여 백신 조성물을 제조하였으며, 혼합 애쥬번트를 상기 범위보다 더 적은 양으로 사용할 경우 백신 보조제로서의 항원지속성 효과가 미비할 수 있다. 상기 방법으로 제작한 불활화시킨 혼합 항원(1:1:1)과 혼합 애쥬번트인 BBL-A1을 혼합한 3가 백신을 통틀어 이하 '살모넬라 3가 불활화백신, 트리백(Trivac)'이라고 지칭하였다.
6. 통계처리
모든 값은 백신대조군과 음성대조군(또는 양성대조군)을 기준으로 하여, 각각 CFU/tissue값과 IgG 항체가(log10)를 비교하였으며, 통계적인 유의성을 확인하기 위해 프리즘 소프트웨어(Prism software, Version 5.0, GraphPad Prism, USA)를 사용하였고, 통계적인 의의는 일원분산분석(One-way analysis of variance)의 Tukey's 다중비교검정(Multiple Comparison Test)을 통해 확인하였다. ELISA 기준값(cut-off)은 음성대조군의 혈청의 흡광도 값(OD450nm)을 AVR ± 3 × SDs (STDEV)로 계산하였고, ELISA 항체가 값은 ELISA 기준값보다 높은 최소 희석배수 값을 사용하였다.
<시험예>
1. 혼합 애쥬번트의 안전성 평가
실시예 5에 따라 제조된 애쥬번트인 BBL-A1의 안전성 평가를 위해, 40주령 갈색산란계의 대퇴부에 백신접종 1주 후 접종 부위를 부검하였다. 실험군은 애쥬번트와 살모넬라 항원을 혼합한 백신 접종군, 애쥬번트 단일 접종군이며, 대조군은 살모넬라 백신 조성물로 많이 쓰이는 오일(water in oil, W/O, ISA70, SEPPIC)과 살모넬라 항원을 혼합한 백신 접종군, 오일(ISA70, SEPPIC) 단일 접종군까지 총 4개의 군으로 나누어 사육하였고, 접종에 의한 부작용을 비교하였다.
실제 오일성 백신조성물을 사용하고 있는 양계, 양돈 농가에서는 백신부위 부작용으로 가축동물의 폐사 및 활동성 저하, 사료섭취 저하로 인하여 경제적인 손실을 겪고 있다. 그렇기 때문에, 본 연구에서 개발한 애쥬번트는 안전성을 확인하였다는 데에 의의가 있으며, 향후 살모넬라 백신뿐만 아니라, 오일성 백신조성물과 함께 쓰이고 있는 가축용 백신에 쓰일 수 있다.
도 2(a) 및 (b)에서 보여지듯이 오일성 백신 조성물의 부작용으로 과한 염증반응에 의한 출혈증상과 육아종 형성이 관찰되었으며, 이는 닭의 활동성을 저하시켰다. 반면에, 도 2(c) 및 (d)는 같이 백신접종 부위가 깨끗하였고, 도 2(a)와 달리 닭의 활동성이 매우 좋았다. 결과적으로, 실시예 5의 BBL-A1 애쥬번트가 오일성 백신조성물보다 백신으로서 뛰어난 안전성을 나타냄을 확인하였다.
2. 백신 접종 및 채혈
Salmonella Gallinarum(SG)음성인 3주령 갈색산란계(Lohmann Brown) 60수를 양계농장에서 구입하였고, 본 실험을 위해 실험동물을 군별로 8수씩 분배하여 2개의 실험군 및 대조군으로 구성하였고, 63일동안 Chicken isolator(Threeshine, Korea)에서 사육하였다.
msbB 유전자가 결손된 살모넬라 엔테리티디스(Salmonella Enteritidis; 이하 'SE'라고 지칭함), 살모넬라 티피뮤리움(Salmonella Typimurium; 이하 'ST'라고 지칭함), 살모넬라 갈리나룸(Salmonella Gallinarum; 이하 'SG'라고 지칭함) 불활화시킨 혼합항원(1:1:1)과 혼합 애쥬번트 BBL-A1을 혼합한 3가 백신(통틀어 이하 '살모넬라 3가 불활화백신, 트리백(Trivac)'이라고 지칭함)의 야외감염 방어효능평가를 하기 위하여 백신을 2주 간격으로 수당 각각 3×109 CFU/0.5 ml씩 2회 접종하였고, 본 개발 백신인 트리백을 상용백신과 비교하기 위하여, 하기 도 3과 같이 실험을 실시하였다. 대조군으로는 PBS만 접종 음성대조군을 두었고 백신대조군으로는 상용화된 MSD사의 SG9R과 Salenvac-T 백신대조군을 두었다. SG9R백신은 2×107 CFU/0.5 ml 씩 근육(intramuscular, IM)접종을 하였으며, Salenvac-T는 회사 프로토콜에 따라 수당 0.5 ml/dose씩 근육(IM)접종하였다.
채혈일정은 도 3과 같으며, 백신접종 전(3주령)부터 실험종료일(11주령)까지 2주 간격으로 닭의 경정맥에서 채혈을 실시했다.
3. 공격접종 후 목적장기에서 장기집락화(CFU/tissue) 측정
백신 2차접종 2주 후(9주령), 공격접종을 하기 위해 SE(HID1403), ST(HID1115), SG(HID1095)분리주를 42 μg/ml의 항생제(Nalidixic acid, NA, Duchefa Biochemie, Netherland)가 첨가된 배지(Luria Bertani, LB, Difco™, USA)에서 배양하였다. SE와 ST는 숙주 특이성이 낮아 감염성이 낮으므로, 3×105 CFU/0.1 ml씩 혈관 내 접종(intravenous, IV)하였고, SG는 5.5×109 CFU/0.5 ml씩 경구 접종(oral infection)하였다.
공격접종 2주 후 이산화탄소(CO2)가스로 일괄적으로 도태시킨 후 간과 비장을 분리하였고, 조직파쇄기(Tissue lyserⅡ, Qiagen, USA)를 사용하여 조직을 파쇄하였다. 조직파쇄액은 10진 계단희석을 하여, 0.1 % NA가 첨가된 LB 한천배지에 도말 후 배양하였고, CFU/g를 측정했다.
본 연구에서 개발한 3가 백신인 트리백(Trivac)과 백신 대조군, 양성 대조군(비백신 공격접종군)을 2주 간격으로 2회 접종한 후 닭의 간과 비장에서 장기집락수를 비교한 결과, 도 4(a)와 (b)에서 백신 대조군인 Salenvac-T와 비슷한 방어효능을 확인하였고, 닭의 비장에서 양성 대조군보다 1.9(log10)배 낮은 공격접종 균주가 검출되었다. ST를 공격접종한 도 4(c) 및 (d)의 결과에서도 백신대조군과 비슷한 방어효능을 확인할 수 있었으며, 간과 비장에서 양성 대조군보다 각각 2.5배, 2배씩 낮은 공격접종 균주가 검출되었다. 마지막으로, SG를 공격접종한 도 4(e) 및 (f)에서 3가 백신 접종군은 간과 비장에서 양성 대조군보다 2.0, 1.8배 낮은 공격접종 균주가 검출됨으로써, 트리백(Trivac)접종군이 약독화 생균백신인 SG9R 백신 접종군 보다는 못 미치지만, 닭에서 가장 높은 병원성을 가지는 SG감염으로 인한 가금티푸스에 대한 뛰어난 방어효능을 확인하였다.
결과적으로, 현재 개발한 살모넬라 3가 백신 트리백(Trivac)은 1회 백신접종으로도 병원성 분리균주인 SE, ST, SG를 모두 방어할 수 있음을 확인하였다.
4. 닭에서의 체액성 면역 비교평가
혈청 IgG 수준을 평가하기 위해 간접효소면역측정법(Indirect ELISA)을 실시하였다. SE, ST, SG에서 분리한 세포외막단백질(outer membrane protein, OMP)를 코팅항원으로 사용하였고, 0.05 M의 완충액(sodium bicarbonate buffer, pH 9.6)를 첨가하여 2.5 ㎍/ml농도로 준비하였다. 웰 플레이트(MaxiSorp 96-well plate, NUNC, Denmark)에 OMP항원을 100 ㎕/well씩 분주한 후 4 ℃에서 16시간 동안 코팅하였다. 0.05 % PBS-T(Phosphate Buffered Saline-Tween20)로 well을 3회 세척한 후 2 % BSA(Bovine Serum Albumin)/PBS 로 2시간 동안 블로킹하였다.
1 % BSA/PBS로 200배 희석한 1차 항체(닭 혈청)를 100 ㎕/well씩 분주한 후 2진 희석하여 37 ℃에서 1시간 동안 반응시켰고, 20,000배 희석한 2차 항체(goat anti-chicken HRP conjugated; Bethyl Laboratories, USA)를 100 ㎕/well씩 분주하여, 37 ℃에서 1시간 동안 반응시켰다. 각 플레이트를 3회씩 세척한 후, 3,3′, 5,5′-TMB(Tetramethylbenzidine; SurModics, USA)를 첨가하여 3분간 암반응시키고, 2N 황산(H2SO4) 첨가 후 ELISA 마이크로플레이트리더(microplate reader, Bio-Rad Laboratories, USA)로 흡광도(OD 450 nm)를 측정하였다.
우선 SG 세포외막단백질(outer membrane protein, OMP) 항원에 대한 살모넬라 특이적인 IgG 항체가를 비교 측정하였을 때, 백신접종 14일(2주)째 약독생균백신인 SG9R 백신 접종군의 IgG 항체가(log10)가 음성 대조군에 비하여 1.78배 높게 나타났으며, 트리백(Trivac) 접종군 보다 0.78배 높게 나타났다. 하지만, 시간이 지남에 따라, 42일째 트리백(Trivac) 접종군이 SG9R 백신 접종군보다 IgG 항체가가 1.35배, 음성대조군보다 3.11배 높게 나타남을 확인하였다. 도 5(b)에서 나타나는 결과 또한, 28 및 42일째 음성 대조군보다 1.4배, 1.6배 증가함을 확인하였다.
상기의 결과로, msbB 유전자가 결손된 3가 불활화 백신과 애쥬번트가 첨가된 백신 조성물인 트리백(Trivac)은 약독화 생균백신인 SG9R과 2가 백신인 Salenvac-T와 못지않은 병원성 살모넬라 방어효능을 지니고 있으며, SG9R 백신 접종군보다 오히려 체액성 면역의 지속성이 좋았음을 확인하였다. 또한, 가장 문제시 되고 있는 백신조성물 제제의 안전성에 있어서, 닭에서 가장 많이 쓰이는 오일성 백신 조성물보다 안전성이 우수함(접종 부작용 없음)을 확인하였다.
따라서, 본 발명의 백신 조성물인 트리백(Trivac)은 3가 백신 1회 접종이 단일백신(SG9R) 또는 2가 백신(Salenvac-T)과 동등한 효과를 가짐을 확인함으로써, 향후 실용화되었을 경우 농장주들의 경제적인 부담을 줄여줄 것으로 판단되며, 본 발명의 애쥬번트는 상기 3가 백신 뿐만 아니라, 다른 세균 백신의 후보 백신 조성물 제제로서 응용이 가능할 것으로 사료된다.
Figure PCTKR2016002354-appb-I000001
Figure PCTKR2016002354-appb-I000002
Figure PCTKR2016002354-appb-I000003

Claims (11)

  1. msbB　유전자가 결손된 살모넬라 갈리나룸(Salmonella Gallinarum) 균주, msbB　유전자가 결손된 살모넬라 엔터리티디스(Salmonella enteritidis) 균주 및 msbB　유전자가 결손된 살모넬라 티피뮤리움(Salmonella typhimurium) 균주를 포함하는 살모넬라 감염증 예방용 백신 조성물.
  2. 제 1 항에 있어서, 상기 msbB　유전자가 결손된 살모넬라 갈리나룸 균주가 수탁번호 KCTC 12960BP인 것을 특징으로 하고, 상기 msbB　유전자가 결손된 살모넬라 엔터리티디스 균주가 수탁번호 KCTC 12798BP인 것을 특징으로 하고, 상기 msbB　유전자가 결손된 살모넬라 티피뮤리움 균주가 수탁번호 KCTC 12961BP인 것을 특징으로 하는 백신 조성물.
  3. 제 1 항에 있어서, 상기 살모넬라 감염증이 살모넬라 갈리나룸, 살모넬라 엔터리티디스 및 살모넬라 티피뮤리움으로 이루어진 군으로부터 선택된 1종 이상의 세균에 의해 감염되는 것을 특징으로 하는 백신 조성물.
  4. 제 1 항에 있어서, 상기 살모넬라 감염증이 가금 티푸스, 가금 파라티푸스 및 가금 장티푸스로 이루어진 군으로부터 선택되는 어느 하나 이상인 것을 특징으로 하는 백신 조성물.
  5. 제 4 항에 있어서, 상기 가금이 닭, 오리, 칠면조, 메추리, 물새, 비둘기, 카나리아, 돼지 및 육우로 이루어진 군으로부터 선택되는 어느 하나인 것을 특징으로 하는 백신 조성물.
  6. 제 1 항에 있어서, 상기 살모넬라 감염증이 닭 살모넬라증인 것을 특징으로 하는 백신 조성물.
  7. 제 1 항에 있어서, 상기 백신 조성물이 msbB　유전자가 결손된 살모넬라 갈리나룸 균주, msbB　유전자가 결손된 살모넬라 엔터리티디스 균주 및 msbB　유전자가 결손된 살모넬라 티피뮤리움 균주를 1:1:1의 CFU 비율로 포함하는 것을 특징으로 하는 백신 조성물.
  8. 제 1 항에 있어서, 약제학적으로 허용가능한 담체 또는 면역보조제를 추가적으로 포함하는 것을 특징으로 하는 백신 조성물.
  9. 제 1 항에 있어서, 추가적으로 IMS1313 부형제 및 수산화 알루미늄 젤(Alum gel)을 포함하는 백신 조성물(이하 'BeesonBiologics adjuvant, BBL-A1').
  10. 제 9 항에 있어서, 상기 IMS1313 부형제 및 수산화 알루미늄 젤의 부피비가 1:1인 것을 특징으로 하는 백신 조성물.
  11. 제 1 항 내지 제 10 항 중 어느 한 항의 백신 조성물을, 인간을 제외한 동물에 투여하는 단계를 포함하는 살모넬라 감염증 예방 방법.
PCT/KR2016/002354 2016-02-29 2016-03-09 가금티푸스 및 살모넬라증 예방을 위한 내독소가 감소된 살모넬라 3가 불활화 백신 조성물 WO2017150755A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020160024133A KR101856736B1 (ko) 2016-02-29 2016-02-29 가금티푸스 및 살모넬라증 예방을 위한 내독소가 감소된 살모넬라 3가 불활화 백신 조성물
KR10-2016-0024133 2016-02-29

Publications (1)

Publication Number Publication Date
WO2017150755A1 true WO2017150755A1 (ko) 2017-09-08

Family

ID=59743329

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/002354 WO2017150755A1 (ko) 2016-02-29 2016-03-09 가금티푸스 및 살모넬라증 예방을 위한 내독소가 감소된 살모넬라 3가 불활화 백신 조성물

Country Status (2)

Country Link
KR (1) KR101856736B1 (ko)
WO (1) WO2017150755A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102360761B1 (ko) * 2020-02-10 2022-02-10 전북대학교산학협력단 신규한 살모넬라 타이피뮤리움 불활화 사균체를 포함하는 살모넬라증 예방 또는 치료용 백신 조성물

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998033923A1 (en) * 1997-01-30 1998-08-06 Imperial College Of Science, Technology & Medicine MUTANT msbB or htrB GENES
KR20100011581A (ko) * 2008-07-25 2010-02-03 한국생명공학연구원 외막소체를 생산하는 재조합 ｇ（－） 박테리아 및 이를이용한 다가항원이 실린 외막소체의 제조방법
KR20110126227A (ko) * 2010-05-17 2011-11-23 전남대학교산학협력단 ｐｐＧｐｐ―결손 변이 살모넬라 갈리나룸 균을 포함하는 가금 티프스 약제학적 백신 조성물
KR20130011809A (ko) * 2011-07-22 2013-01-30 전북대학교산학협력단 가금류의 병원성 대장균의 병원성 인자를 발현하는 살모넬라균을 포함하는 가금류의 병원성 대장균증 및 살모넬라균증의 예방 및 치료용 백신 조성물.
KR20150112859A (ko) * 2014-03-27 2015-10-07 강원대학교산학협력단 살모넬라 엔테리티디스 불활화백신에 사용되는 최적 부형제 조성물

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE60136563D1 (de) * 2000-11-16 2008-12-24 Intervet Int Bv Salmonella vakzine

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998033923A1 (en) * 1997-01-30 1998-08-06 Imperial College Of Science, Technology & Medicine MUTANT msbB or htrB GENES
KR20100011581A (ko) * 2008-07-25 2010-02-03 한국생명공학연구원 외막소체를 생산하는 재조합 ｇ（－） 박테리아 및 이를이용한 다가항원이 실린 외막소체의 제조방법
KR20110126227A (ko) * 2010-05-17 2011-11-23 전남대학교산학협력단 ｐｐＧｐｐ―결손 변이 살모넬라 갈리나룸 균을 포함하는 가금 티프스 약제학적 백신 조성물
KR20130011809A (ko) * 2011-07-22 2013-01-30 전북대학교산학협력단 가금류의 병원성 대장균의 병원성 인자를 발현하는 살모넬라균을 포함하는 가금류의 병원성 대장균증 및 살모넬라균증의 예방 및 치료용 백신 조성물.
KR20150112859A (ko) * 2014-03-27 2015-10-07 강원대학교산학협력단 살모넬라 엔테리티디스 불활화백신에 사용되는 최적 부형제 조성물

Also Published As

Publication number Publication date
KR20170102095A (ko) 2017-09-07
KR101856736B1 (ko) 2018-05-11

Similar Documents

Publication Publication Date Title
Ferguson‐Noel et al. Mycoplasmosis
US9289484B2 (en) Attenuated Streptococcus suis vaccines and methods of making and use thereof
US10098941B2 (en) Immunological compositions containing attenuated Histophilus somni
US20110052635A1 (en) Live attenuated salmonella vaccine
Arafat et al. Effect of infectious bursal disease (IBD) vaccine on Salmonella Enteritidis infected chickens
WO2012157989A2 (en) Avirulent modified salmonella gallinarum strains and pharmaceutical composition using the same
Okamura et al. Comparative evaluation of a bivalent killed Salmonella vaccine to prevent egg contamination with Salmonella enterica serovars Enteritidis, Typhimurium, and Gallinarum biovar Pullorum, using 4 different challenge models
US20210145954A1 (en) Method of reducing egg contamination
WO2018124393A1 (ko) 브루셀라 균 주요 공통 항원을 발현하는 lps의 o-항원 결실 비병원성 살모넬라 균주를 포함하는 브루셀라증 예방 또는 치료용 백신 조성물
US20190000954A1 (en) Attenuated mannheimia haemolytica strains
WO2013015586A2 (ko) 가금류의 병원성 대장균의 병원성 인자를 발현하는 살모넬라균을 포함하는 가금류의 병원성 대장균증 및 살모넬라균증의 예방 및 치료용 백신 조성물
WO2017150755A1 (ko) 가금티푸스 및 살모넬라증 예방을 위한 내독소가 감소된 살모넬라 3가 불활화 백신 조성물
EP2189164A1 (en) Salmonella marker vaccine
KR20120129777A (ko) 약독화, 면역강화 살모넬라 엔테리티디스의 변이균주를 포함하는 살모넬라증 예방용 생균 백신 조성물
KR101031376B1 (ko) 살모넬라 엔테리티디스 감염 예방용 불활화 백신
KR20200138570A (ko) 조류 대장균증 예방을 위한 내독소가 감소된 대장균 3가 불활화 백신 조성물
KR20080105099A (ko) 약독화 살모넬라 생백신
김남형 Evolutionary genetics and immunological characterization of Salmonella enterica subsp. enterica serovar Gallinarum biovar Gallinarum
JP6196677B2 (ja) 交差防御性サルモネラワクチン
WO2013147534A1 (ko) 생물형 면역증강제를 이용한 경구용 가금티푸스 백신 조성물
Nhi et al. RIEMERELLOSIS IN DUCK
CN116836900A (zh) 肠炎沙门菌ryhB-1和sopE双基因缺失株及其作为减毒疫苗候选株的应用
CN112638409A (zh) 组合疫苗
Redweik et al. SUPPLEMENTAL FILE. Live Bacterial Prophylactics in Modern Poultry

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16892768

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 16892768

Country of ref document: EP

Kind code of ref document: A1