WO2018124393A1 - 브루셀라 균 주요 공통 항원을 발현하는 lps의 o-항원 결실 비병원성 살모넬라 균주를 포함하는 브루셀라증 예방 또는 치료용 백신 조성물 - Google Patents

브루셀라 균 주요 공통 항원을 발현하는 lps의 o-항원 결실 비병원성 살모넬라 균주를 포함하는 브루셀라증 예방 또는 치료용 백신 조성물 Download PDF

Info

Publication number
WO2018124393A1
WO2018124393A1 PCT/KR2017/002866 KR2017002866W WO2018124393A1 WO 2018124393 A1 WO2018124393 A1 WO 2018124393A1 KR 2017002866 W KR2017002866 W KR 2017002866W WO 2018124393 A1 WO2018124393 A1 WO 2018124393A1
Authority
WO
WIPO (PCT)
Prior art keywords
brucella
salmonella
antigen
mixture
brucellosis
Prior art date
Application number
PCT/KR2017/002866
Other languages
English (en)
French (fr)
Inventor
이존화
넬시암다라조나탄
원가연
허진
Original Assignee
전북대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 전북대학교산학협력단 filed Critical 전북대학교산학협력단
Publication of WO2018124393A1 publication Critical patent/WO2018124393A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/025—Enterobacteriales, e.g. Enterobacter
    • A61K39/0275—Salmonella
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/098—Brucella
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a vaccine composition for the prevention or treatment of brucellosis, which comprises an O-antigen-deleting non-pathogenic Salmonella strain of LPS expressing Brucella major bacterial antigen.
  • Brucellosis causes miscarriage and infertility in mammals, especially ruminants including cattle, dogs, pigs, goats, sheep and horses, and in humans, fever (malta fever, Melitensis fever) and arthritis And acquired common infectious diseases that cause chills.
  • Brucella is the causative agent of Brucella Abotus abortus ), Brucella Melitosis melitensis , Brucella suis ) and Brucella canis canis ) has been reported to be caused by infection.
  • Brucella Abbottus is a pathogen found in cattle, which has caused great damage to livestock farmers, making it a major economic problem.
  • Brucella is a pathogen that invades and proliferates within the host macrophages. Both humoral and cell mediated immunity are necessary to prevent brucellosis, but in particular a cell mediated immune response is required to remove brucellella from the host individual. The host activates the immune response of T cell type 1 (Th1) mediated by IFN- ⁇ in response to Brucella infection.
  • Th1 T cell type 1
  • commercially available vaccines for the prevention of brucellosis are live and attenuated Brucella vaccine strains. These vaccines have a property of returning to a pathogenic strain, and interfere with Brucella diagnosis. Because of this limitation, more effective vaccine development needs to be made quickly for safe use.
  • a recombinant attenuated vaccine, molecular label strain, DNA vaccine, and subunit vaccine have been constructed by genetic engineering technology, but there is no effective vaccine yet.
  • Korean Patent No. 0263942 discloses' a new Brucella Abbotus strain that can be used for the prevention of Brussels disease and its preparation method ', and Korean Patent No. 1151004' Adhesiveness factor of bovine pathogenic E. coli is transformed.
  • a vaccine composition for the prevention and treatment of attenuated Salmonella mutant strains and bovine coliform bacterium and Salmonella bacterium comprising the same is disclosed, but includes an O-antigen-deleting non-pathogenic Salmonella strain of LPS expressing the main common antigen of Brucella strains of the present invention. No vaccine composition for preventing or treating brucellosis is described.
  • the present invention is derived from the above requirements, and the present inventors have not only enhanced the immune response due to the vaccine, but also four antigens (BLS, Omp19, PrpA and SOD) derived from Brucella abotus to simultaneously prevent brucellosis and salmonellosis. )
  • BLS, Omp19, PrpA and SOD antigens derived from Brucella abotus to simultaneously prevent brucellosis and salmonellosis.
  • the present invention expresses Brucella abortus (Brucella lumazine synthase) derived from BLS, Omp19 (outer membrane protein 19), Proline racemase subunit A (PrpA) and SOD (superoxide dismutase) antigens, respectively. , Lon , cpxR , rfaL And a mixture of attenuated Salmonella mutant strains lacking the asd gene.
  • Brucella abortus Brucella lumazine synthase
  • Omp19 outer membrane protein 19
  • PrpA Proline racemase subunit A
  • SOD superoxide dismutase
  • the present invention Brucella ( Abotus) abortus ) prevention or treatment of brucellosis and salmonella including amplifying genes encoding Brucella lumazine synthase (BLS), outer membrane protein 19 (Omp19), Proline racemase subunit A (PrpA) and superoxide dismutase (SOD) antigens, respectively Provided is a method for preparing a mixture of attenuated Salmonella mutant strains.
  • BLS Brucella lumazine synthase
  • Omp19 outer membrane protein 19
  • PrpA Proline racemase subunit A
  • SOD superoxide dismutase
  • the present invention also provides a mixture of attenuated Salmonella mutant strains for the prophylaxis or treatment of brucellosis and Salmonellosis produced by the above method.
  • the present invention also provides a vaccine composition for the prevention or treatment of brucellosis and salmonella, comprising the mixture of the attenuated Salmonella mutant strain as an active ingredient.
  • the present invention also provides a feed additive for the prevention or improvement of brucellosis and salmonella, comprising the mixture of the attenuated Salmonella mutant strain as an active ingredient.
  • the attenuated Salmonella mutant strain of the present invention has an outer shell structure and shell structure similar to that of Salmonella spp., And thus can express a Brussela abottus-derived antigen outside the cell to induce humoral and cellular immune responses against the antigen.
  • the mutant strain is expected to be useful as a vaccine to prevent and treat brucellosis and salmonella, which can be safely, economically and easily inoculated.
  • the rfaL of the present invention Salmonella mutant strains lacking genes may be used to limit the use of Salmonella probiotic vaccines that have been restricted for use due to misdiagnosis of serologic tests using antibodies with LPS antigen as well as enhanced expression of selected Brucella abottus-derived antigens. It is expected to expand.
  • Figure 1 is a schematic diagram showing an overview of the development of the vaccine vaccine Brucella using the attenuated Salmonella strain and foreign antigen secretion system of the present invention.
  • Figure 2 is the result of confirming the Brucella LPS used by purification in the present invention by silver staining.
  • Figure 3 is a result of Western blotting culture supernatant of recombinant strains expressing each of the Brucella antigens in the attenuated Salmonella strains JOL912 and O-antigen deletion strain JOL1800 derived from JOL912, A is BLS, B is PrpA, C Is Omp19, D is the result of confirming the SOD antigen.
  • VC vector control; JOL1876, JOL1880, JOL1877, JOL1881, JOL1875, JOL1879, JOL1874, JOL1878, Brucella antigen expressing recombinant strains (see Table 1).
  • Figure 4 (A) is a result of measuring the IgG and IgA levels detected in the serum and enteric wash solution of the immunoassay animal using ELISA using the sonicated Brucella strain as a coating antigen, (B) is a recombinant Brucella IgG and IgA levels detected in serum and intestinal wash of immunoassay animals using ELISA using BLS purified protein as antigen of coating.
  • Control PBS intraperitoneal administration; Oral administration of SrBL Oral, SrBL vaccine; RSrBL Oral, RSrBL vaccine oral administration; SrBL IP, SrBL vaccine intraperitoneal administration; RSrBL IP, RSrBL vaccine intraperitoneal administration; RSrB IP, RSrB vaccine intraperitoneal administration; VC IP, JOL1800 vector intraperitoneal administration; RB51 IP, RB51 live vaccine intraperitoneal administration (see Table 3 for details); Four bar bars in each group represent IgG or IgA levels at weeks 1, 2, 3 and 4, respectively.
  • Figure 5 is a result of confirming the concentration of IL-4 and IL-12 cytokines by using RT-PCR in mouse splenocytes restimulated with Brucella antigen
  • B is a Brucellella antigen or Salmonella outer membrane protein
  • the concentration of IFN- ⁇ cytokines secreted by stimulated splenocytes was confirmed by ELISPOT analysis. Statistical significance was determined in comparison to the levels of unstimulated splenocytes.
  • Figure 6 is the result of confirming the IFN- ⁇ dot by ELISPOT analysis.
  • Figure 7 is a comparison result of the number of the challenge strains (brussela S544) isolated from the spleen of the experimental animals of each group after the challenge.
  • the present invention Brucella abortus (Brucella lumazine synthase (BLS), Omp19 (outer membrane protein 19), PrpA (Proline racemase subunit A) and SOD (superoxide dismutase) antigen Respectively, lon, cpxR , rfaL And a mixture of attenuated Salmonella mutant strains lacking the asd gene.
  • BLS Brucella lumazine synthase
  • Omp19 outer membrane protein 19
  • PrpA Proline racemase subunit A
  • SOD superoxide dismutase
  • Brucella is called Brucella Abotus abortus , cattle), Brucella melitensis (sheep, goat), Brucella suisse suis , pig), Brucella canis canis , dog) and Brucella Orbis Brucella bacteria, such as ovis , sheep), are reported to be caused by infection, and all of them infect human body and cause serious diseases, and the main cause of the problem in Korea is infection by Brucella Abotus.
  • the present inventor expects a protective effect according to each pathogenesis by screening for each antigenic protein related to the pathogenesis of Brucella, and is commonly expressed in Brucella bacteria including Brucella Abbottus, Brucella Melitosis, Brucella Suis, and Brucella Canis.
  • the antigen to be selected was selected.
  • Brucella as the antigen Brussela lumazine synthase (BLS), outer membrane protein 19 (Omp19), Proline racemase subunit A (PrpA), and superoxide dismutase (SOD) derived from abortus were selected, and the antigens were selected from other Brucella bacteria (Brucella mellitosis, Brucella suis). , Brucella Canis) and 99-100% homology.
  • the BLS of the present invention is involved in the synthesis of riboflavin by catalyzing a lumazine synthase (LS) 6,7-dimethyl-8-ribityllumazine synthase (LS) enzyme.
  • BLS is essential for Brucella's intracellular survival because excessive riboflavin synthesis inhibits intracellular survival by making Brucella vulnerable to oxidative or nitrosative stress.
  • BLS binds an external antigen to the N-terminus and is widely used as a carrier for peptides or proteins, thereby efficiently presenting the antigen to the immune system, and recognized by TLR4 (Toll-Like Receptor 4). It modulates the innate acquired immune response, including the CD8 + and CD8 + immune responses, and simultaneously triggers T-helper (Th) 1 and Th2 responses.
  • Omp19 protein of the present invention is a component of the outer membrane lipid protein of Brucella bacteria and is expressed in all six species of Brucella and is known as a major immune response protein.
  • PrpA protein of the present invention is known to induce the secretion of lysing elements associated with B-cell proliferation and interact with non-muscle myosin IIA (NMMIIA) of macrophages as a major viral factor of Brucella Avotus.
  • NMIIA non-muscle myosin IIA
  • mice delayed immune response during the acute infection phase is a major factor causing chronic.
  • it promotes cellular infection by increasing the number of B-cells and specific antibody responses, and is known as a major factor in changing IFN- ⁇ , IL-10, TGF ⁇ 1 and TNF ⁇ cytokine levels during the acute infection phase.
  • SOD of the present invention serves to protect cells from externally produced superoxide (superoxide), which protects Brucella from oxidative burst upon invasion of macrophages of Brucella and is recognized as a major pathogen.
  • superoxide superoxide
  • the range of BLS, Omp19, PrpA and SOD antigens according to the present invention includes proteins having amino acid sequences represented by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, and functional equivalents thereof.
  • “Functional equivalent” means at least 60%, preferably 80%, more preferably at least 60% of the amino acid sequence represented by each of SEQ ID NOS: 1, 2, 3, and 4 as a result of the addition, substitution, or deletion of amino acids It refers to a protein having a sequence homology of 90% or more, more preferably 95% or more, and which exhibits substantially homogeneous physiological activity with the proteins represented by SEQ ID NOs: 1, 2, 3, and 4, respectively.
  • “Substantially homogeneous physiological activity” means Brucella vaccine vaccine activity.
  • the invention also encompasses fragments, derivatives and analogues of the respective BLS, Omp19, PrpA and SOD antigens.
  • Salmonella mutant used in the present invention may be an attenuated Salmonella mutant strain as deleted asd gene.
  • Salmonella mutant strains lon, cpxR and asd genes are deleted, more preferably lon, cpxR , rfaL And Salmonella mutants lacking the asd gene, but are not limited thereto.
  • Salmonella mutants in which lon, cpxR and asd genes are deleted ⁇ cpxR ⁇ asd Salmonella typhimurium mutant (JOL912) is a DAP (diaminopimellic acid) requester that lacks the asd gene and is designed to select an antigen-recombinant strain without antibiotics.
  • DAP diaminopimellic acid
  • cpxR lymphocyte penetration is increased to increase immunogenicity and increase the lon gene. Deletion can cause pathogenic attenuation. It is known that the strain has no effect on the production of extracellular polysaccharide (EPS), which can act as an antigen, and thus acts as an antigen by itself, resulting in sufficient humoral mucosal cellular immune response.
  • EPS extracellular polysaccharide
  • LPS lipopolysaccharide
  • Salmonella mutants lon, cpxR , rfaL according to an embodiment of the present invention
  • Mutant strains in which genes are deleted ⁇ lon ⁇ cpxR ⁇ rfaL ⁇ asd Salmonella typhimurium mutant (JOL1800) was additionally rfaL from the Salmonella mutant strain (JOL912) lacking the lon, cpxR and asd genes.
  • the mutant strains that have deleted the gene not only have JOL912 mutant characteristics, but also can enhance the immune response stimulated by external antigens by allowing them to be further exposed to the LPS upon extracellular membrane expression of the selected Brucella antigen gene.
  • the attenuated Salmonella mutant strain encodes a Bla ( ⁇ -lactamse) signal sequence, BLS (Brucella lumazine synthase), Omp19 (outer membrane protein 19), Proline racemase subunit A (PrpA), and a superoxide dismutase (SOD) antigen.
  • Bla ⁇ -lactamse
  • BLS Brucella lumazine synthase
  • Omp19 outer membrane protein 19
  • PrpA Proline racemase subunit A
  • SOD superoxide dismutase
  • the recombinant vector may be pJHL65 (Asd + vector, pBR ori, 6xHis) or pJHL80 (Asd + vector, p15A ori, 6xHis) having a secretion system based on the Bla signal sequence.
  • Salmonella mutants of the present invention wherein the Salmonella is Salmonella typhimurium (Salmonella typhimurium), Salmonella tie blood (Salmonella typi), Salmonella para tie blood (Salmonella paratyphi), Salmonella Sendai (Salmonella sendai), Salmonella Galina Solarium ( Salmonella gallinarium ) or Salmonella enteritidis ( Salmonella enteritidis ) and the like, preferably Salmonella typhimurium, but is not limited thereto.
  • Salmonella mutants of the present invention are lon, cpxR , rfaL And asd Salmonella expressing either the extracellular membrane or the extracellular antigen of Salmonella, which has a gene deleted from Brucella lumazine synthase (BLS), outer membrane protein 19 (Omp19), Proline racemase subunit A (PrpA), and superoxide dismutase (SOD) antigens. It is a mixture containing two or more mutants.
  • BLS Brucella lumazine synthase
  • Omp19 outer membrane protein 19
  • PrpA Proline racemase subunit A
  • SOD superoxide dismutase
  • the Salmonella mutant mixture may be a mixture including all of Salmonella mutants expressing BLS, Salmonella mutants expressing Omp19, Salmonella mutants expressing PrpA and Salmonella mutants expressing SOD, but are not limited thereto.
  • step (b) cloning the amplified gene of step (a) into a recombinant vector having an asd gene to obtain four cloned plasmids;
  • each cloned plasmid of step (b) is lon, cpxR , rfaL And asd Deleting the genes to transform each of the attenuated Salmonella strains to obtain four transformed Salmonella mutants;
  • step (d) selecting and mixing each of the transformed Salmonella mutants of step (c); and providing a method for preparing a mixture of attenuated Salmonella mutants for preventing or treating brucellosis and Salmonella mutants.
  • the asd (aspartate ⁇ -semialdehyde dehydrogenase) gene to the enzyme involved in the starting point of the synthesis (diaminopimellic acid) DAP involved in peptidoglycan cross-connection of the glycan in the cell wall synthesis, asd gene deficient in the DAP-deficient medium weeks
  • the introduction of the asd gene can be confirmed, which is a useful marker for plasmids.
  • the present invention also provides a mixture of attenuated Salmonella mutant strains for the prophylaxis or treatment of brucellosis and Salmonellosis produced by the above method.
  • the attenuated Salmonella mutants and mixtures thereof are as described above.
  • the present invention also provides a vaccine composition for the prevention or treatment of brucellosis and salmonella, comprising the mixture of the attenuated Salmonella mutant strain as an active ingredient.
  • the vaccine composition of the present invention is Brucella abotus ( Brucella ) to Salmonella attenuated by gene deletion abortus (Brucella lumazine synthase), Omp19 (outer membrane protein 19), Proline racemase subunit A (PrpA), and a mixture containing one or more Salmonella mutants expressing SOD (superoxide dismutase) antigen as an active ingredient,
  • the vaccine composition may be treated in humans or animals to simultaneously prevent or treat brucellosis and salmonellosis.
  • the Salmonella mutant strain mixture may be prepared in the form of mutant strains or dead bacteria, preferably in the form of mutant strains, but is not limited thereto.
  • the vaccine composition of the present invention may further comprise a Brucella-derived lipopolysaccharide (LPS) as an active ingredient.
  • LPS Brucella-derived lipopolysaccharide
  • the vaccine composition was administered together with Brucella LPS purified for humoral immune enhancing effect by maximizing antibody production against Brucella surface antigens.
  • composition of the present invention can be administered orally or parenterally (eg, applied intramuscularly, intravenously, subcutaneously, intraperitoneally or topically) according to the desired method, preferably orally or intraperitoneally. And, more preferably, it may be administered intraperitoneally, but is not limited thereto.
  • dosage of the composition varies depending on the weight of the person or animal, age, sex, health status, diet, administration time, administration method, excretion rate and the severity of the disease.
  • the vaccine composition may be inoculated in humans or mammals, and the mammal may be cattle, deer, goats, goats, dogs, pigs, and the like, and may be preferably inoculated in cattle, but is not limited thereto.
  • the term “vaccine” refers to a biological agent containing an antigen that immunizes a living body, and refers to an immunogen or antigenic substance that immunizes the living body by injection or oral administration to a human or animal for the prevention of infection.
  • In vivo immunization is largely divided into automatic immunity obtained automatically by the in vivo immunity after infection of a pathogen and passive immunity obtained by an externally injected vaccine. While autoimmunity is characterized by a long period of production of immune-related antibodies and continuous immunity, passive immunization with vaccines acts immediately to treat infectious diseases, but has a disadvantage of poor sustainability.
  • the vaccine composition includes stabilizers, emulsifiers, aluminum hydroxide, aluminum phosphate, pH adjusters, surfactants, liposomes, iscom adjuvants, synthetic glycopeptides, extenders, carboxypolymethylene, subviral particle adjuvants, cholera toxin , N, N-dioctadecyl-N ', N'-bis (2-hydroxyethyl) -propanediamine, monophosphoryl lipid A, dimethyldioctadecyl-ammonium bromide and mixtures thereof
  • the second adjuvant may be further contained.
  • the vaccine composition may comprise a veterinary acceptable carrier.
  • veterinary acceptable carrier includes any and all solvents, dispersion media, coatings, antigen adjuvant, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, and the like.
  • Carriers, excipients, and diluents that may be included in the composition for vaccines include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, glycerin, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil and the like.
  • the vaccine composition is an oral formulation such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and nasal formulations such as drips or sprays and sterile injectable solutions, respectively, according to a conventional method.
  • Formulated in the form of can be used.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used can be prepared.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient such as starch, calcium carbonate and sucrose in the lecithin-like emulsifier. Or lactose, gelatin, etc. can be mixed and prepared. In addition to simple excipients, lubricants such as magnesium styrate talc may also be used. As a liquid preparation for oral administration, suspending agents, liquid solutions, emulsions, syrups, etc. may be used. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be used.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations.
  • non-aqueous preparation and suspending agent propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like may be used, but are not limited thereto.
  • Suitable penetrants for formulations for intranasal administration are generally known to those skilled in the art. Such suitable formulations are formulated to be preferably sterile, isotonic and buffered for stability and compliance.
  • Formulations for intranasal administration are also formulated to stimulate mucus secretion in several aspects to maintain normal ciliary action, and suitable formulations are preferably slightly buffered formulations that maintain isotonicity, pH 5.5 to 6.5, and most preferably Antimicrobial preservatives and suitable drug stabilizers.
  • the present invention also provides a feed additive for the prevention or improvement of brucellosis and salmonella, comprising the mixture of the attenuated Salmonella mutant strain as an active ingredient.
  • the feed additive of the present invention is Brucella Abbottus ( Brucella) abortus), including mixtures of Salmonella mutants which express and secrete derived BLS (Brucella lumazine synthase), Omp19 (outer membrane protein 19), Proline racemase subunit A (PrpA) and SOD (superoxide dismutase) antigen as an active ingredient, Salmonella Mutants
  • BLS Brucella lumazine synthase
  • Omp19 outer membrane protein 19
  • PrpA Proline racemase subunit A
  • SOD superoxide dismutase
  • the feed additive of the present invention may use the Salmonella mutant mixture as it is or additionally add known carriers, stabilizers and the like, such as grains and by-products allowed for livestock, citric acid, fumaric acid, adipic acid, lactic acid, if necessary.
  • Organic acids such as malic acid, phosphates such as sodium phosphate, potassium phosphate, acid pyrophosphate and polyphosphate (polyphosphate), polyphenols, catechins, alpha-tocopherols, rosemary extracts, vitamin C, green tea extracts, licorice extracts, chitosan, Natural antioxidants such as tannic acid and phytic acid, antibiotics, antibacterial agents, and other additives may be added, and the shape may be in a suitable state such as powder, granules, pellets, suspensions, and the like. It may be supplied alone or mixed with the feed.
  • PKD46 plasmid a lambda RED plasmid
  • Salmonella typhimurium JOL912; see Table 1
  • JOL912 Salmonella typhimurium
  • the amplified PCR product was extracted and transformed into Salmonella typhimurium competent cells into which pKD46 was introduced.
  • Salmonella typhimurium competent cells into which pKD46 was introduced.
  • the gamma, beta, and exo genes in the pKD46 plasmid were expressed, and the pKD3 PCR product was compared with the rfaL gene of Salmonella typhimurium. Replaced.
  • PCR again confirmed that specific genes were deleted.
  • competent cells were made from the colonies of which the gene deletion was confirmed, and the pCP20 plasmid was transformed. Cultured at 37 ° C., bacteria without chloramphenicol resistance were selected. LPS was isolated and confirmed by SDS-PAGE for comparison with wild Salmonella typhimurium.
  • the Salmonella strain was named JOL1800 (see Table 1).
  • Brucella LPS was isolated using LPS extraction kit (iNtRON biotechnology, Korea) using phenol. 1-5 lysis buffer was used to dissolve the cell walls after centrifugation at 2-5 ml of Brucella Avotus S544 bacterial culture using centrifugation at a speed of 13,000 rpm. 200 ⁇ l of chloroform was added to the dissolved bacterial solution, and then stored at an outdoor temperature for 5 minutes, centrifuged at 13,000 rpm for 10 minutes, and only the supernatant was separated and stored in a new 1.5 ml tube. 800 ⁇ l of purification buffer was added, stored at ⁇ 20 ° C.
  • the synthesized gene was cloned into a commercially available protein expression plasmid pET28a and prepared as pET28a-Bls, pET28a-PrpA pET28a-Sodc pET28a-Omp19, and each prepared plasmid was transformed into E. coli BL21 (DE3) pLysS. Antigen proteins were purified.
  • each antigen gene was inserted into pJHL65, respectively, to prepare pJHL65-Bls pJHL65-PrpA, pJHL65-Sodc, pJHL65-Omp19, and this plasmid was transformed into rfaL gene knockout Salmonella typhimurium strain JOL1800 to prepare as a vaccine strain.
  • Primer used in the present invention primer Sequence (5 ' ⁇ 3') (SEQ ID NO: PCR product size BLS_F GAATTCaaccaaagctgtccgaacaa (7) 486 bp BLS_R AAGCTTtcagacaagcgcggcgatgc (8) PrpA EcoRI_F GAATTCgcaagacattccttcttctgcg (9) 1011 bp PrpA HindIII_R AAGCTTttatgccatgctgaacccatgagca (10) Omp19 EcoRI_F GAATTCggaatttcaaagcaagtctgctc (11) 543 bp Omp19 HindIII_R AAGCTTtcagcgcgacagcgtcacggc (12) SOD EcoRI_F CCGCGAATTCaagtccttatttattgcatcg (13) 519bp SOD HindIII
  • samples were prepared by incubating each vaccine candidate strain in 200 ml LB liquid medium overnight. The sample thus prepared was centrifuged at 4,000 rpm and the supernatant was transferred to a new flask. The separated supernatant was separated and purified by 20% TCA (trichloroacetic acid), and the remaining pellet was centrifuged at 4,000 rpm and mixed with SDS-sample buffer. After SDS-PAGE it was transferred to PVDF membrane and blocked for 3 hours with blocking buffer (3% BSA in PBST).
  • the primary mouse IgG1 anti-His antibody (Penta-His TM , LifeTechnologies, USA) was diluted 1: 5,000 and reacted overnight. The next day, after 1 hour reaction with a secondary antibody (goat anti-mouse IgG1-HRP) diluted at 15,000 (Sigma-Aldrich, USA), color development was performed to confirm the size of each antigen. The expression was confirmed by color development with WEST-one TM Western Blotting System (IntronBiotechnology, Korea).
  • the vaccine confirmed expression by West blot was inoculated in BALB / c mice to analyze the immune induction response.
  • the experiment was conducted by dividing 128 mice into 8 groups of 16 mice each.
  • the vaccine strains and the route of administration of each group are shown in Table 3.
  • Group A Control group
  • Group B a SrBL vaccine was inoculated by mixing LPS in a vaccine strain culture expressing four antigens selected from JOL912, an attenuated Salmonella strain without O antigen
  • Group C b RSrBL vaccine Inoculated with Brucella LPS in a vaccine strain culture expressing four Brucella antigens expressed in JOL1800, an attenuated Salmonella strain lacking the O antigen, intraperitoneally inoculated with a vaccine strain such as Group B: Group B, Group E Vaccine strains such as intraperitoneal
  • group F administration of Brucella four antigen expression JOL1800 strain intraperitoneally without LPS mixing.
  • mice in each group were used for the immune response test using splenocytes 21 days after vaccination, and the other experimental animals were challenged with mice infected with the pathogenic wild Brucella Avotus S544 30 days after vaccination. This was done. After 15 days of challenge, all the animals were incubated at 37 ° C. for 7 days in Brucella cultured solid medium after aseptic sacrifice. Based on the number of colonies detected in each group (x), the protection index (PI) was calculated using the following equation after the challenge infection for each group.
  • PI (y value of PBS log count)-(y value of test vaccine log count).
  • ELISA was performed to determine the specific sIgA and IgG antibodies for each antigen. Serum and intestinal wash samples were taken at weekly intervals for 4 weeks after vaccine. Serum was collected through the intraorbital vein and then centrifuged for 4,000g for 5 minutes to separate the serum from the supernatant and stored at -20 ° C. In the case of feces, the feces were weighed, suspended in PBS containing 0.1% sodium azide to 100 mg / ml, centrifuged at 13,200 rpm for 10 minutes, and the supernatant was separated and stored at -20 ° C. It was used for the experiment.
  • the method of execution is the concentration of 500 ng / well of purified antigenic protein in the sample well for determining the inoculation amount, and the goat anti-mouse IgG (goat anti-mouse IgG) in the standard protein well.
  • goat anti-mouse sIgA goat anti-mouse sIgA
  • reaction was carried out at 37 ° C. for 1 hour 30 minutes.
  • HRP-conjugated goat anti-mouse IgA for serum and HRP-conjugated goat anti-mouse IgA for vaginal wash samples were diluted at a magnification of 1: 5,000, and 100 ⁇ l was dispensed into each well, followed by reaction at 37 ° C. for 1 hour.
  • OPD ( o -phenylenediamine) -substrate reaction solution was dispensed by 100 ⁇ l per well and stopped with 3M H 2 SO 4 after color development, and then the OD value was measured at 492 nm.
  • the concentration of each antigen specific antibody was determined based on standard protein concentrations.
  • mice were sacrificed and the spleen was aseptically collected, pulverized, and the cells were taken out of the tissues to remove the remaining tissues with a cell stainer.
  • RPMI all RPMI (RPMI 1640 supplemented, Sigma)
  • FBS heat-inactivated fetal bovine serum
  • penicillin 100 IU / ml penicillin
  • 100 ug / ml streptomycin 100 ug / ml streptomycin.
  • the cells were again submerged by centrifugation, and the cells were suspended through RBC Lysis buffer to remove red blood cells (RBC).
  • spleen cells splenocyte cell
  • RPMI final cell with the antigen corresponding to each group, such as 1 ⁇ 10 6
  • the cells were cultured for 48 hours after stimulation with JOL1800 Salmonella strain grinding solution and sexually transmitted Brucellella antigen proteins.
  • splenocytes isolated from the immune animals were re-stimulated with Brucella and Salmonella antigens, and then IFN- ⁇ was increased in splenocytes after the vaccine administration using Mouse IFN- ⁇ ELISpotPLUS (Mabtech AB, Sweden). Confirmed. After culturing 2 ⁇ 10 5 cells in 96 well plates, they were stimulated with JOL1800 outer membrane protein antigen and ultrasonically crushed Brucellella strains for 30 hours for 30 hours, followed by anti-INF- ⁇ biotin conjugated antibody and secondary antibody. Streptavidin-HRP (1: 1,000) was used to detect INF- ⁇ expressing cells (INF- ⁇ spots). The total expression level was determined by counting INF- ⁇ expressing cells in each cell well.
  • CD3 + CD8 + T lymphocytes in the spleen lymphocytes of experimental animals to which the vaccine was administered fluorescein isothiocyanate (FITC) -labeled anti-CD3, biotin-labeled anti-CD4 and APE-labeled anti-CD8
  • FITC fluorescein isothiocyanate
  • the expression size of the BLS antigen was about 23 KDa
  • the expression size of the PrpA antigen was about 39 kDa
  • the expression size of the Omp19 antigen was about 20 kDa
  • the expression size of the SOD antigen was about 20 kDa (FIG. 3).
  • the ultrasonically crushed Brucella strain was used as a coating antigen of BLS purified protein in coated antigen or recombinant Brucella antigen.
  • ELISA was performed.
  • the titer of IgG and IgA of the experimental animal group administered by mixing the Salmonella strain expressing the Brucella antigen using the ultrasonically pulverized Brucella strain as a coding antigen was confirmed.
  • IgA increased up to 3 weeks in all groups except the vector control group (VC IP) and the control group (Control).
  • Group D SrBL IP
  • group H RB51 IP
  • Brucella-specific IgG concentration did not show a significant difference according to the route of administration, but on the contrary, IgA concentrations that induce mucosal immunity were increased in group B (SrBL oral) and C (RSrBL oral).
  • Antibody production targeting the entire Brucella showed higher antibody production in existing RB51 live vaccines.
  • Figure 4B it was confirmed that the production of BLS protein-specific antibodies in the Brussela antigen expression attenuated Salmonella live vaccine administration group.
  • FIG. 5A The results of measuring IL-4 and IL-12 concentration using RT-PCR in spleen cells of mice restimulated with Brucella antigen are shown in FIG. 5A.
  • Significant increases in IL-4 levels were observed in groups B (SrBL oral), D (SrBL IP), E (RSrBL IP) and H (RB51 IP).
  • Intraperitoneal vaccination increased the levels of cytokines intraperitoneally, and IL-12 cytokine levels in group B (SrBL oral), C (RSrBL oral), D (SrBL IP) and H (RB51 IP). ), A significant increase was shown (FIG. 5A).
  • IFN- ⁇ levels secreted by splenocytes stimulated with Brucella antigen or Salmonella envelope protein were measured to be highest in splenocytes (stimulated with Salmonella envelope protein) detected in experimental animals of group D (SrBL IP). - ⁇ levels appeared (FIG. 5B). Significantly increased IFN- ⁇ levels were observed in Brucella antigen-stimulated splenocytes of group C (RSrBL oral), E (RSrBL IP) and H (RB51 IP).
  • the protective effect of the vaccine was evaluated through the number of strains of challenge infection detected in splenocytes 15 days after challenge challenge. As shown in Figures 7 and 8, the highest protective efficiency was seen in the group RSrBL IP (Brussela antigen expressing JOL1800 strain + LPS, intraperitoneal inoculation). In addition, the protective effect of group SrBL IP (Brussela antigen expression JOL912 strain + LPS, intraperitoneal) and group RSrBL IP showed a significant increase compared to the existing vaccine, RB51 immunized group (RB51 IP) ( P ⁇ 0.05).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Physiology (AREA)
  • Animal Husbandry (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Food Science & Technology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

본 발명은 브루셀라 균 주요 공통 항원을 발현하는 LPS의 O-항원 결실 비병원성 살모넬라 균주을 이용한 브루셀라증 예방용 백신 조성물에 관한 것이다. 본 발명은 브루셀라 아보투스(Brucella abortus) 유래 BLS, Omp19, PrpA 및 SOD 항원의 분비를 증가시키도록 개발된 벡터로 LPS의 O-항원이 결실된 약독화 살모넬라균을 형질전환시키고 상기 형질전환된 살모넬라 변이주의 혼합물을 접종시킨 마우스에서 항원에 대한 체액성 및 세포성 면역 반응 유도 및 도전 감염시 방어 효과가 우수함을 확인하였다. 따라서, 본 발명의 변이주는 안전하고 경제적이며 간편하게 접종할 수 있는 브루셀라증 및 살모넬라증 예방 또는 치료용 백신으로 유용하게 사용될 것으로 기대된다.

Description

브루셀라 균 주요 공통 항원을 발현하는 LPS의 O-항원 결실 비병원성 살모넬라 균주를 포함하는 브루셀라증 예방 또는 치료용 백신 조성물
본 발명은 브루셀라 균 주요 공통 항원을 발현하는 LPS의 O-항원 결실 비병원성 살모넬라 균주를 포함하는 브루셀라증 예방 또는 치료용 백신 조성물에 관한 것이다.
브루셀라증(Brucellosis)은 포유동물 특히 소를 포함한 반추동물, 개, 돼지, 산양, 면양, 말 등에서 유산 및 불임을 일으키고, 사람에서는 몰타열(Malta fever, Melitensis fever)을 포함한 열병(파상열), 관절염 및 오한을 유발하는 인수 공통 전염병이다. 브루셀라증은 원인균으로 브루셀라 아보투스(Brucella abortus), 브루셀라 멜리텐시스(Brucella melitensis), 브루셀라 수이스(Brucella suis) 및 브루셀라 캐니스(Brucella canis) 등의 브루셀라균이 감염되어 유발되는 것으로 보고되어 있다. 이 중 브루셀라 아보투스는 소에서 발견되는 병원균으로 양축 농가에 큰 피해를 주어 국가 경제적으로 큰 문제가 되고 있다.
우리나라는 1955년까지 브루셀라증의 비감염 지역이었으나 1956년에 미국에서 도입한 젖소군에서 처음 브루셀라증의 발병이 보고된 이후 1958년에 국립종축장의 돼지에서, 1960년에는 제주 목장에 도입된 소에서 집단 발병한 것으로 보고되었으며 이외에도 지속적인 발병 사례가 발표되고 있다.
브루셀라증을 극복하기 위하여 세계 여러 나라에서는 젖소를 대상으로 예방 백신을 접종하거나 이를 진단하여 양성을 보이는 소를 살처분하는 2가지 방식의 정책을 시행하여 왔다. 우리나라의 경우는 아직 브루셀라증의 발병율이 낮기 때문에 지금까지는 예방 백신을 접종하기보다는 이를 검진하여 양성인 소를 도태시키는 방식으로 브루셀라증을 근절하고자 하였다. 그러함에도 불구하고 그 발병 두수가 증가함은 물론 그의 집단 발병으로 낙농업을 포기하는 농가가 증가하고 있는 실정이다. 따라서 국가 방역 정책이 예방 접종으로 변경된다면 브루셀라증 진단약을 생산하고 그 검진 사업에 소용되는 예산의 일부로서도 전 젖소에 대하여 충분히 예방 접종을 수행할 수 있는 경제적인 이점도 기대할 수 있다.
브루셀라균은 숙주가 된 대식세포 안에서 세포 내로 침입을 하고 증식하는 병원균이다. 체액성과 세포매개 면역성 모두 브루셀라증을 예방하기 위해 필요하지만 특히 세포매개 면역반응이 숙주개체로부터 브루셀라를 제거하기 위해 필요하다. 숙주가 브루셀라 감염에 반응하여 IFN-γ에 의해 매개된 T 세포 타입 1(Th1)의 면역 반응을 활성화시킨다. 현재까지 브루셀라증을 예방하기 위해 상업적으로 사용할 수 있는 백신들은 생백신과 약독화된 브루셀라 백신 균주이다. 이러한 백신들은 병원성 균주로 되돌아가는 성질이 있고, 브루셀라 진단에 방해가 되는 등의 문제점이 있다. 이러한 제한 때문에 안전하게 사용하기 위해서는 더욱 효과적인 백신 개발이 신속하게 이루어질 필요가 있다. 현재 유전공학 기술로 재조합된 약독화 백신, 분자 표지 균주, DNA 백신 및 서브유닛 백신 등을 구축하고 있으나, 아직까지 효과적인 백신은 없는 실정이다.
한편, 한국등록특허 제0263942호에는 '브루셀라병의 예방에 사용될 수 있는 새로운 브루셀라 어보투스 균주 및 그의 제조방법'이 개시되어 있고, 한국등록특허 제1151004호에는 '소의 병원성 대장균의 부착인자가 형질전환된 약독화된 살모넬라 변이주 및 이를 포함하는 소의 대장균증 및 살모넬라균증의 예방 및 치료용 백신조성물'이 개시되어 있으나, 본 발명의 브루셀라 균 주요 공통 항원을 발현하는 LPS의 O-항원 결실 비병원성 살모넬라 균주를 포함하는 브루셀라증 예방 또는 치료용 백신 조성물에 대해서는 기재된 바가 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자는 백신으로 인한 면역 반응의 증강뿐만 아니라 브루셀라증과 살모넬라증을 동시에 예방하기 위해 브루셀라 아보투스 유래의 4종의 항원(BLS, Omp19, PrpA 및 SOD)을 각각 Bla 신호 서열을 포함하는 생균 백신용 재조합 벡터에 클로닝하여 LPS의 O-항원이 결실된 살모넬라 균주에 형질전환시키고 상기 형질전환된 살모넬라 혼합물을 접종시킨 마우스에서 항원에 대한 체액성 및 세포성 면역 반응 유도 및 도전 감염시 방어 효과가 우수함을 확인함으로써, 본 발명을 완성하였다.
상기 과제를 해결하기 위해, 본 발명은 브루셀라 아보투스(Brucella abortus) 유래 BLS(Brucella lumazine synthase), Omp19(outer membrane protein 19), PrpA(Proline racemase subunit A) 및 SOD(superoxide dismutase) 항원을 각각 발현하고, lon, cpxR , rfaL 및 asd 유전자가 결실된 약독화 살모넬라 변이주의 혼합물을 제공한다.
또한, 본 발명은 브루셀라 아보투스(Brucella abortus) 유래 BLS(Brucella lumazine synthase), Omp19(outer membrane protein 19), PrpA(Proline racemase subunit A) 및 SOD(superoxide dismutase) 항원을 코딩하는 유전자를 각각 증폭시키는 단계를 포함하는 브루셀라증 및 살모넬라증 예방 또는 치료용 약독화 살모넬라 변이주의 혼합물의 제조방법을 제공한다.
또한, 본 발명은 상기 방법에 의해 제조된 브루셀라증 및 살모넬라증 예방 또는 치료용 약독화 살모넬라 변이주의 혼합물을 제공한다.
또한, 본 발명은 상기 약독화 살모넬라 변이주의 혼합물을 유효성분으로 포함하는 브루셀라증 및 살모넬라증 예방 또는 치료용 백신 조성물을 제공한다.
또한, 본 발명은 상기 약독화 살모넬라 변이주의 혼합물을 유효성분으로 포함하는 브루셀라증 및 살모넬라증 예방 또는 개선용 사료 첨가제를 제공한다.
본 발명의 약독화 살모넬라 변이주는 살모넬라 야외균주와 유사한 외각성분 및 외각구조를 가지면서 브루셀라 아보투스 유래 항원들을 세포 외부에 발현시켜 상기 항원에 대하여 체액성 및 세포성 면역 반응을 유도할 수 있으므로 본 발명의 변이주는 안전하고 경제적이며 간편하게 접종할 수 있는 브루셀라증과 살모넬라증을 동시에 예방 및 치료할 수 있는 백신으로 유용하게 사용될 것으로 기대된다. 또한, 본 발명의 rfaL 유전자가 결실된 살모넬라 변이주는 선별된 브루셀라 아보투스 유래 항원의 세포 외부로의 발현 증진뿐만 아니라, LPS를 항원으로 하는 항체를 이용하는 혈청학적 검사의 오진단으로 인해 사용이 제한되던 살모넬라 생균 백신의 이용 가능성을 확대할 것으로 기대된다.
도 1은 본 발명의 약독화된 살모넬라 균주와 외래항원 분비시스템을 이용한 브루셀라 예방 백신 개발 개요를 나타내는 모식도이다.
도 2는 본 발명에서 정제하여 사용된 브루셀라 LPS를 실버 염색으로 확인한 결과이다.
도 3은 약독화 살모넬라 균주 JOL912와 JOL912에서 유래한 O-항원 결실 균주 JOL1800에 각각의 브루셀라 항원을 발현시킨 재조합 균주들의 배양 상층액을 웨스턴 블롯팅한 결과로, A는 BLS, B는 PrpA, C는 Omp19, D는 SOD 항원을 확인한 결과이다. VC, 벡터 대조군; JOL1876, JOL1880, JOL1877, JOL1881, JOL1875, JOL1879, JOL1874, JOL1878, 브루셀라 항원 발현 재조합 균주(표 1 참고).
도 4의 (A)는 초음파 분쇄된(sonicated) 브루셀라 균주를 코팅 항원으로 사용한 ELISA를 통한 면역 실험동물의 혈청과 장세척액에서 검출된 IgG와 IgA 수준을 측정한 결과이며, (B)는 재조합 브루셀라 항원 중 BLS 정제 단백질을 코팅 항원으로 사용한 ELISA를 통한 면역 실험동물의 혈청과 장세척액에서 검출된 IgG와 IgA 수준을 측정한 결과이다. Control, PBS 복강 투여; SrBL Oral, SrBL 백신 경구 투여; RSrBL Oral, RSrBL 백신 경구 투여; SrBL IP, SrBL 백신 복강 투여; RSrBL IP, RSrBL 백신 복강 투여; RSrB IP, RSrB 백신 복강 투여; VC IP, JOL1800 벡터 복강 투여; RB51 IP, RB51 생균 백신 복강 투여(상세 설명은 표 3 참고); 각 그룹의 4개 막대바는 각각 1, 2, 3 및 4주차의 IgG 또는 IgA 수준을 의미한다.
도 5의 (A)는 브루셀라 항원으로 재자극한 마우스 비장세포에서 RT-PCR을 이용하여 IL-4와 IL-12 사이토카인의 농도를 확인한 결과이며, (B)는 브루셀라 항원 또는 살모넬라 외막 단백질로 자극한 비장세포에서 분비하는 IFN-γ 사이토카인의 농도를 ELISPOT 분석으로 확인한 결과이다. 자극하지 않은 비장세포의 수치와 비교하여 통계학적 유의함이 결정되었다.
도 6은 ELISPOT 분석으로 IFN-γ 점(dot)을 확인한 결과이다.
도 7은 도전감염 후의 각 그룹별 실험동물의 비장에서 분리된 도전감염 균주(브루셀라 S544) 수의 비교 결과이다.
도 8은 도전감염 후 비장에서 검출된 도전감염 균주의 수에 따른 방어율 지표(protective index) 분석 결과이다.
본 발명의 목적을 달성하기 위하여, 본 발명은 브루셀라 아보투스(Brucella abortus) 유래 BLS(Brucella lumazine synthase), Omp19(outer membrane protein 19), PrpA(Proline racemase subunit A) 및 SOD(superoxide dismutase) 항원을 각각 발현하고, lon, cpxR , rfaL 및 asd 유전자가 결실된 약독화 살모넬라 변이주의 혼합물을 제공한다.
브루셀라증은 브루셀라 아보투스(Brucella abortus, 소), 브루셀라 멜리텐시스(Brucella melitensis, 양, 염소), 브루셀라 수이스(Brucella suis, 돼지), 브루셀라 캐니스(Brucella canis, 개) 및 브루셀라 오비스(Brucella ovis, 양) 등의 브루셀라균이 감염되어 유발되는 것으로 보고되어 있고, 모두 인체에 감염하여 심각한 질병을 초래하며, 국내에서 문제가 되고 있는 원인체는 브루셀라 아보투스에 의한 감염이 주를 이루고 있다.
본 발명자는 브루셀라의 병인기전과 관련된 각 항원단백질의 선별로 각 병인기전에 따른 방어효과를 기대하며 브루셀라 아보투스, 브루셀라 멜리텐시스, 브루셀라 수이스, 브루셀라 캐니스를 포함하는 브루셀라균에서 공통으로 발현되는 항원을 선정하였다.
본 발명자는 상기 항원으로 브루셀라 아보투스(Brucella abortus) 유래 BLS(Brucella lumazine synthase), Omp19(outer membrane protein 19), PrpA(Proline racemase subunit A) 및 SOD(superoxide dismutase)을 선정하였으며, 상기 항원들은 다른 브루셀라균(브루셀라 멜리텐시스, 브루셀라 수이스, 브루셀라 캐니스)과 99~100% 상동성을 가지고 있다.
본 발명의 BLS는 루마진 신타아제(lumazine synthase, LS; 6,7-dimethyl-8-ribityllumazine synthase) 효소를 촉매화시켜 리보플라빈(riboflavin)의 합성에 관여한다. 과도한 리보플라빈의 합성은 세포내에서 브루셀라균이 산화(oxidative) 혹은 질산화(nitrosative) 스트레스에 취약하게 만들어 세포내 생존을 저해하므로 BLS는 브루셀라균의 세포내 생존에 필수적인 요소이다. 또한 BLS는 N 말단에 외부 항원을 결합하여 펩타이드 혹은 단백질의 운반체로 광범위하게 이용되는 특성으로 인하여 면역시스템에 효율적으로 항원을 제시할 뿐만 아니라 TLR4(Toll-Like Receptor 4)에 인식되어 수지상 세포의 성숙과 CD8+ 연관 면역 반응을 포함하고 있는 선천성 후천성 면역반응을 조절하며 T-helper(Th)1 과 Th2 반응을 동시에 일으킨다.
본 발명의 Omp19 단백질은 브루셀라 균의 외막 지질 단백질의 한 구성 성분으로써 브루셀라 주요 6개 종에서 모두 발현되며 주요 면역 반응 단백질로 알려져 있다.
본 발명의 PrpA 단백질은 브루셀라 아보투스의 주요 병인 인자(virulence factor)로써 대식세포의 NMMⅡA(non-muscle myosin ⅡA)와 상호작용하며 B-세포 증식과 연관이 있는 용해 요소의 분비를 유도한다고 알려져 있으며 마우스에서 급성 감염기에 면역 반응을 지연시켜 만성화를 일으키는 주요 요소이다. 또한 B-세포 수의 증가와 특이 항체 반응을 유도하여 세포 감염을 증진시키고 있으며 급성 감염기 동안 IFN-γ, IL-10, TGFβ1 및 TNFα 사이토카인 레벨을 변화시키는 주요 요소로 알려져 있다.
본 발명의 SOD는 외부에서 생산된 수퍼옥사이드(superoxide)에서 세포를 보호하는 역할을 하며 이는 브루셀라의 대식세포내 침입시 oxidative burst로부터 브루셀라를 보호해 주요 병인 인자로써 주요 면역항원으로 인식되고 있다.
본 발명에 따른 BLS, Omp19, PrpA 및 SOD 항원의 범위는 각각 서열번호 1, 서열번호 2, 서열번호 3 및 서열번호 4로 표시되는 아미노산 서열을 갖는 단백질 및 이의 기능적 동등물을 포함한다. "기능적 동등물"이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 각각의 서열번호 1, 2, 3 및 4로 표시되는 아미노산 서열과 적어도 60% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 더 더욱 바람직하게는 95% 이상의 서열 상동성을 갖는 것으로, 각각의 서열번호 1, 2, 3 및 4로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. "실질적으로 동질의 생리활성"이란 브루셀라증 백신 활성을 의미한다. 본 발명은 또한 각각의 BLS, Omp19, PrpA 및 SOD 항원의 단편, 유도체 및 유사체(analogues)를 포함한다.
본 발명에 사용되는 살모넬라 변이주는 약독화 살모넬라 변이주로서 asd 유전자가 결실된 것일 수 있다. 바람직하게는 lon, cpxR 및 asd 유전자가 결실된 살모넬라 변이주, 더 바람직하게는 lon, cpxR , rfaL 및 asd 유전자가 결실된 살모넬라 변이주일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 살모넬라 변이주에 있어서, lon, cpxR 및 asd 유전자가 결실된 살모넬라 변이주(Δlon ΔcpxR Δasd Salmonella typhimurium mutant, JOL912)는 asd 유전자가 결실된 DAP(diaminopimellic acid) 요구주로서 항생제 없이 항원 재조합 균주를 선택할 수 있도록 제작되었을 뿐만 아니라, cpxR을 결실시킴으로써 림프조직 침투력이 증가되어 면역원성을 높이고, lon 유전자를 결실하여 병원성이 약독화될 수 있다. 상기 균주는 항원으로 작용할 수 있는 EPS(extracellular polysaccharide)의 생산에는 아무 영향을 주지 않아 그 자체로 항원의 역할을 하여 안정성을 지니면서 충분한 체액성 점막성 세포성 면역 반응을 일으킨다고 알려져 있다.
본 발명의 일 구현 예에서, 기존의 약독화 살모넬라 균주에서 외부 항원의 발현을 증가시키기 위하여 살모넬라의 지질다당류(Lipopolysaccharide, LPS)의 발현과 관련된 유전자의 결실을 진행하였다. LPS는 그람 음성균에서 바깥막을 형성하는 부분으로 LPS의 O 항원 다당류 중합효소(O antigen polysaccharide(O-PS) polymerase)의 합성에 관여하는 rfaL 유전자를 제거하여 바깥막에 합성되는 LPS의 길이를 짧게 만들었다.
본 발명의 일 구현 예에 따른 살모넬라 변이주인 lon, cpxR , rfaL 및 asd 유전자가 결실된 변이주(Δlon ΔcpxR ΔrfaL Δasd Salmonella typhimurium mutant, JOL1800)는 상기 lon, cpxR 및 asd 유전자가 결실된 살모넬라 변이주(JOL912)로부터 추가로 rfaL 유전자를 결실시킨 변이주로써, JOL912 변이주 특성을 가질 뿐 아니라, 선별된 브루셀라 항원 유전자의 세포 외막 발현시 LPS에 가려지지 않고 더 노출되게 함으로써 외부항원에 의해 자극되는 면역 반응을 증강시킬 수 있다.
상기 약독화 살모넬라 변이주는 Bla(β-lactamse) 신호 서열, 이에 연결된 BLS(Brucella lumazine synthase), Omp19(outer membrane protein 19), PrpA(Proline racemase subunit A) 및 SOD(superoxide dismutase) 항원을 코딩하는 유전자로 이루어진 군에서 선택된 어느 하나의 유전자; 및 asd 유전자;를 포함하는 재조합 벡터로 형질전환된 것일 수 있으나, 이에 제한되지 않는다. 본 발명의 일 구현 예에서, 상기 재조합 벡터는 Bla 신호 서열을 기초로 한 분비 시스템을 지닌 pJHL65(Asd+ vector, pBR ori, 6xHis) 또는 pJHL80(Asd+ vector, p15A ori, 6xHis)일 수 있다.
또한, 본 발명의 살모넬라 변이주에 있어서, 상기 살모넬라균은 살모넬라 티피무리움(Salmonella typhimurium), 살모넬라 타이피(Salmonella typi), 살모넬라 파라타이피(Salmonella paratyphi), 살모넬라 센다이(Salmonella sendai), 살모넬라 갈리나리움(Salmonella gallinarium) 또는 살모넬라 엔테리티디스(Salmonella enteritidis) 등일 수 있고, 바람직하게는 살모넬라 티피무리움일 수 있으나, 이에 제한되지 않는다.
본 발명의 상기 살모넬라 변이주의 혼합물은 lon, cpxR , rfaL 및 asd 유전자가 결실된 살모넬라균으로부터 BLS(Brucella lumazine synthase), Omp19(outer membrane protein 19), PrpA(Proline racemase subunit A) 및 SOD(superoxide dismutase) 항원 중 어느 하나의 항원을 세포외막 또는 세포 밖에 발현하는 살모넬라 변이주를 2 이상 포함하고 있는 혼합물이다.
바람직하게는, 상기 살모넬라 변이주 혼합물은 BLS를 발현하는 살모넬라 변이주, Omp19를 발현하는 살모넬라 변이주, PrpA를 발현하는 살모넬라 변이주 및 SOD를 발현하는 살모넬라 변이주를 모두 포함하는 혼합물일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은
(a) 브루셀라 아보투스(Brucella abortus) 유래 BLS(Brucella lumazine synthase), Omp19(outer membrane protein 19), PrpA(Proline racemase subunit A) 및 SOD(superoxide dismutase) 항원을 코딩하는 유전자를 각각 증폭시키는 단계;
(b) 상기 (a) 단계의 증폭된 유전자를 asd 유전자를 가진 재조합 벡터에 각각 클로닝하여 4개의 클로닝된 플라스미드를 수득하는 단계;
(c) 상기 (b) 단계의 클로닝된 각각의 플라스미드를 lon, cpxR , rfaL 및 asd 유전자를 결실시켜 약독화된 살모넬라 균주에 각각 형질전환시켜 4개의 형질전환된 살모넬라 변이주를 수득하는 단계; 및
(d) 상기 (c) 단계의 각각의 형질전환된 살모넬라 변이주를 선별하여 혼합하는 단계;를 포함하는 브루셀라증 및 살모넬라증 예방 또는 치료용 약독화 살모넬라 변이주의 혼합물 제조방법을 제공한다.
상기 asd(aspartate β-semialdehyde dehydrogenase) 유전자는 세포벽 합성에 있어서 펩티도글리칸의 크로스 연결에 관여하는 DAP(diaminopimellic acid) 합성의 개시지점에 관련된 효소로, DAP가 결핍된 배지에서 asd 유전자 결핍주에 asd 유전자의 도입 여부를 확인할 수 있어, 이는 유용한 플라스미드의 선택표지이다.
또한, 본 발명은 상기 방법에 의해 제조된 브루셀라증 및 살모넬라증 예방 또는 치료용 약독화 살모넬라 변이주의 혼합물을 제공한다.
상기 약독화 살모넬라 변이주 및 이의 혼합물은 전술한 바와 같다.
또한, 본 발명은 상기 약독화 살모넬라 변이주의 혼합물을 유효성분으로 포함하는 브루셀라증 및 살모넬라증 예방 또는 치료용 백신 조성물을 제공한다.
본 발명의 백신 조성물은 유전자 결실에 의해 약독화된 살모넬라균에 브루셀라 아보투스(Brucella abortus) 유래 BLS(Brucella lumazine synthase), Omp19(outer membrane protein 19), PrpA(Proline racemase subunit A) 및 SOD(superoxide dismutase) 항원을 발현하는 살모넬라 변이주를 하나 이상 포함하는 혼합물을 유효성분으로 포함하여, 상기 백신 조성물을 사람 또는 동물에 처리하여 브루셀라증 및 살모넬라증을 동시에 예방 또는 치료할 수 있다.
본 발명의 일 구현 예에 따른 백신 조성물에 있어서, 상기 살모넬라 변이주 혼합물은 변이주 생균 또는 사균의 형태로 준비될 수 있고, 바람직하게는 변이주 생균의 형태일 수 있으나, 이에 제한되지 않는다.
본 발명의 백신 조성물은 유효성분으로서 브루셀라 유래 LPS(lipopolysaccharide)를 추가로 포함할 수 있다.
본 발명의 일 구현예에 따르면, 상기 백신 조성물은 브루셀라 표면 항원에 대한 항체 생성을 극대화시켜 체액성 면역 증강 효과를 위하여 정제되어진 브루셀라 LPS를 함께 투여하였다.
본 발명의 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여(예를 들어, 근육 내, 정맥 내, 피하, 복강 내 또는 국소에 적용)할 수 있으며, 바람직하게는 경구 또는 복강 내 투여할 수 있으며, 더욱 바람직하게는 복강 내 투여할 수 있으나, 이에 제한되지 않는다. 또한 상기 조성물의 투여량은 사람이나 동물의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가 다양하다.
상기 백신 조성물은 사람이나 포유동물에 접종할 수 있으며, 포유동물은 소, 사슴, 산양, 염소, 개, 돼지 등일 수 있으며, 바람직하게는 소에 접종할 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어 "백신"은 생체에 면역을 주는 항원을 함유한 생물학적인 제제로서, 감염증의 예방을 위하여 사람이나 동물에 주사하거나 경구 투여함으로써 생체에 면역이 생기게 하는 면역원 또는 항원성 물질을 말한다. 생체 내 면역은 병원균의 감염 후에 생체 내 면역력이 자동으로 얻어지는 자동 면역과 외부에서 주입한 백신에 의하여 얻어지는 수동 면역으로 크게 나누어진다. 자동 면역은 면역에 관계하는 항체의 생성기간이 길고 지속적인 면역력의 특징이 있는 반면, 백신에 의한 수동 면역은 감염증 치료에 즉시 작용하나 지속력이 떨어지는 단점이 있다.
상기 백신 조성물은 안정제, 유화제, 수산화알루미늄, 인산알루미늄, pH 조정제, 계면활성제, 리포솜, 이스콤(iscom) 보조제, 합성 글리코펩티드, 증량제, 카복시폴리메틸렌, 서브바이랄(subviral) 입자 보조제, 콜레라 독소, N,N-디옥타데실-N',N'-비스(2-하이드록시에틸)-프로판디아민, 모노포스포릴 지질 A, 디메틸디옥타데실-암모늄 브로마이드 및 이의 혼합물로 구성된 군에서 선택된 어느 하나 이상의 제 2 보조제를 추가로 함유할 수 있다.
또한, 상기 백신 조성물은 수의학적으로 허용 가능한 담체를 포함할 수 있다. 본 발명에서 용어 "수의학적으로 허용 가능한 담체"란 임의의 및 모든 용매, 분산 매질, 코팅제, 항원 보강제, 안정제, 희석제, 보존제, 항균제 및 항진균제, 등장성 작용제, 흡착 지연제 등을 포함한다. 백신용 조성물에 포함될 수 있는 담체, 부형제, 희석제로는 락토즈, 덱스트로스, 슈크로스, 솔비톨, 만니톨, 자일리톨, 말티톨, 전분, 글리세린, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘포스페이트, 칼슘실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유 등을 들 수 있다.
또한, 상기 백신용 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형 및 드립(drip) 또는 스프레이 등의 비강용 제형 그리고 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 제제화할 경우에는 보통 사용되는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제할 수 있다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 레시틴 유사 유화제에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제할 수 있다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용할 수 있다. 경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등을 사용할 수 있으며, 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수용성제, 현탁제, 유제, 동결건조제제가 포함된다. 비수용성제제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리 에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있으나, 이에 제한되지 않는다. 비강내 투여를 위한 제제에 적합한 침투제는 일반적으로 당업자에게 공지되어 있다. 그러한 적합한 제형물은 안정성과 순응도를 위해 바람직하게 무균, 등장 및 완충되도록 제형화된다. 비강내 투여를 위한 제제는 또한 정상적인 섬모 작용을 유지시키기 위해 점액 분비를 여러 측면에서 자극하도록 제조되며, 적합한 제형이 바람직하게 등장성의, pH 5.5 내지 6.5를 유지하는 약간 완충된 제형이며, 가장 바람직하게 항미생물 방부제 및 적합한 약물 안정화제를 포함한다.
또한, 본 발명은 상기 약독화 살모넬라 변이주의 혼합물을 유효성분으로 포함하는 브루셀라증 및 살모넬라증 예방 또는 개선용 사료 첨가제를 제공한다.
본 발명의 상기 사료 첨가제는 브루셀라 아보투스(Brucella abortus) 유래 BLS(Brucella lumazine synthase), Omp19(outer membrane protein 19), PrpA(Proline racemase subunit A) 및 SOD(superoxide dismutase) 항원을 발현 및 분비하는 살모넬라 변이주의 혼합물을 유효성분으로 포함하여, 살모넬라 변이주의 혼합물이 브루셀라 및 살모넬라에 대한 보호 효과뿐만 아니라, 동물의 세포성 및 체액성 면역반응을 효과적으로 유도하므로 이를 사료 첨가제로 사용할 경우 가축의 브루셀라증 및 살모넬라증 동시 예방 및 면역증강에 기여할 수 있다.
본 발명의 상기 사료 첨가제는 살모넬라 변이주 혼합물을 원형 그대로 사용하거나 또는 추가적으로 가축에 허용되는 곡류 및 그 부산물 등의 공지된 담체, 안정제 등을 가할 수 있으며, 필요에 따라 구연산, 후말산, 아디픽산, 젖산, 사과산 등의 유기산이나 인산나트륨, 인산칼륨, 산성 피로인산염, 폴리인산염(중합인산염) 등의 인산염이나, 폴리페놀, 카테킨, 알파-토코페롤, 로즈마리 추출물, 비타민 C, 녹차 추출물, 감초 추출물, 키토산, 탄닌산, 피틴산 등의 천연 항산화제, 항생물질, 항균제 및 기타의 첨가제 등을 가할 수도 있으며, 그 형상으로서는 분체, 과립, 펠릿, 현탁액 등의 적당한 상태일 수 있으며, 상기 사료첨가제를 공급하는 경우는 가축 등에 대하여 단독으로 또는 사료에 혼합하여 공급할 수 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
재료 및 방법
1. rfaL 유전자 녹아웃(knockout) 살모넬라 티피무리움 균주의 제작
람다 레드(lambda RED) 플라스미드인 pKD46 플라스미드를 분리하여 살모넬라 티피무리움(JOL912; 표 1 참고)에 형질전환 후 32℃ 이하(28~30℃)에서 배양 후 PCR을 통해 성공적으로 플라스미드가 도입되었는지 확인하였다. pKD3 플라스미드를 주형으로 하여 rfaL 유전자와 pKD3 플라스미드의 일부분을 포함하는 프라이머 세트(waa.rfaP1, tgtctcatcccaaacctattgtggagaaaagatgctaaccgtgtaggctagagctgcttc, 서열번호 5; waa.rfaP2, atgatggaaaacgcgctgataccgtaataagtatcagcgcatgggaattagccatggtcc, 서열번호 6)를 이용하여 PCR로 증폭하였다. 증폭된 PCR 산물을 추출하여 pKD46이 도입된 살모넬라 티피무리움 컴피턴트 세포(competent cell)에 형질전환시켰다. 아라비노스(Arabinose)를 첨가한 배지에 도말하여 37℃에서 배양하면 pKD46 플라스미드 내의 감마(gama), 베타(beta), 엑소(exo) 유전자가 발현되어 pKD3 PCR 산물이 살모넬라 티피무리움의 rfaL 유전자와 치환되었다. PCR로 다시 특정 유전자가 결실(deletion)되었는지 확인하였다. 항생제 저항 유전자를 제거하기 위해 유전자 결실이 확인된 콜로니의 균으로 컴피턴트 세포를 만들어 pCP20 플라스미드를 형질전환하였다. 37℃에서 배양해 클로람페니콜(chloramphenicol) 저항성이 없는 균을 선택하였다. LPS를 분리하여 야생 살모넬라 티피무리움과 비교를 위한 SDS-PAGE를 진행하여 확인하였다. 상기 살모넬라 균주를 JOL1800로 명명하였다(표 1 참고).
Figure PCTKR2017002866-appb-T000001
2. 브루셀라 LPS의 정제
브루셀라 LPS는 페놀을 이용한 LPS 추출 키트(iNtRON biotechnology, 한국)를 이용하여 분리되었다. 2-5㎖의 브루셀라 아보투스 S544 세균 배양액을 13,000rpm 의 속도의 원심분리를 이용하여 세균 펠렛(pellet)을 분리 후 세포벽을 용해하기 위하여 1㎖의 용균 버퍼(lysis buffer)를 이용하였다. 용해된 세균 용액에 200㎕의 클로로폼을 더한 후 5분간 실외온도에 보관 후 13,000 rpm으로 10분간 원심분리 후 상층액만 분리하여 새로운 1.5㎖ 튜브에 보관하였다. 800㎕의 정제 버퍼(purification buffer)를 더하여 -20℃에 10분간 보관후 13,000rpm으로 15분간 원심분리하여 상층액을 제거하고 LPS 펠렛을 확인하였다. 정제된 LPS는 실버 스테이닝 키트(Silver Stain Plus, Bio-Rad, US)를 이용하여 분리 여부를 확인하였고 단백질과 핵산의 오염을 방지하기 위하여 프로테이나아제 K(proteinase K)를 더하여 추출을 진행하였다(도 2).
3. 재조합 플라스미드의 제작
선별되어진 PrpA, Omp19, SODc 3개의 항원 유전자는 NCBI(http://www.ncbi.nlm.nih.gov/genome/1101)의 Bab S544 게놈 유전자 지도에서 각각 CP000887(1737003-1738001), CP000887(1878467..1878997), KF362132.1(1-522)의 시퀀스를 바탕으로 5'부분에 EcoRI 제한효소 시퀀스와 3'부분에 HindⅢ 제한 효소 시퀀스를 더한 프라이머를 이용하여 브루셀라 아보투스 S544 균주에서 PCR에 의해 증폭되었다(표 2). BLS 유전자는 제한효소자리가 시퀀스 안에 존재하여 제한 효소 자리 시퀀스를 더하여 합성되었다(표 2). 합성된 유전자는 시판되는 단백질 발현용 플라스미드인 pET28a에 클로닝되어 각각 pET28a-Bls, pET28a-PrpA pET28a-Sodc pET28a-Omp19으로 제조되었고 각각의 제조된 플라스미드는 대장균 BL21(DE3)pLysS로 형질전환 후 각각의 항원 단백질을 정제하였다. 또한 각각의 항원 유전자는 각각 pJHL65에 삽입되어 pJHL65-Bls pJHL65-PrpA, pJHL65-Sodc, pJHL65-Omp19가 제조되었고 이 플라스미드는 rfaL 유전자 녹아웃 살모넬라 티피무리움 균주 JOL1800에 형질전환시켜 백신 균주로 준비되었다.
본 발명에 사용된 프라이머
프라이머 서열(5'→3') (서열번호) PCR 산물 크기
BLS_F GAATTCaaccaaagctgtccgaacaa (7) 486bp
BLS_R AAGCTTtcagacaagcgcggcgatgc (8)
PrpA EcoRI_F GAATTCgcaagacattccttcttctgcg (9) 1011bp
PrpA HindIII_R AAGCTTttatgccatgctgaacccatgagca (10)
Omp19 EcoRI_F GAATTCggaatttcaaaagcaagtctgctc (11) 543bp
Omp19 HindIII_R AAGCTTtcagcgcgacagcgtcacggc (12)
SOD EcoRI_F CCGCGAATTCaagtccttatttattgcatcg (13) 519bp
SOD HindIII_R CCGCAAGCTTttattcgatcacgccgcagg (14)
4. 웨스턴 블롯을 이용한 후보 항원의 백신 세포에서의 발현 확인
제작된 백신 균주가 해당 Bls, Omp19, PrpA, Sodc 항원을 발현하는지 확인하기 위하여 각 백신 후보 균주를 200㎖ LB 액체 배지에 하룻밤 배양하여 샘플을 준비하였다. 이렇게 준비된 샘플은 4,000rpm으로 원심분리 후 상층액은 새 플라스크로 옮겨주었다. 분리된 상층액은 20% TCA(trichloroacetic acid)를 이용하여 분비된 단백질을 분리정제하였고 4,000rpm에서 원심분리하여 남은 펠렛은 SDS-샘플 완충액과 혼합한 후 15분간 끊인 뒤 사용하였다. SDS-PAGE 후 PVDF 멤브레인으로 옮겨 블로킹 완충액(3% BSA in PBST)로 3시간 블로킹하였다. 1차 마우스 IgG1 항-His 항체(Penta-HisTM, LifeTechnologies, 미국)를 1:5,000으로 희석하여 하룻밤 반응을 하였다. 다음날 1:5,000으로 희석된 2차 항체(goat anti-mouse IgG1-HRP)(Sigma-Aldrich, 미국)로 1시간 반응 후 발색하여 각 항원의 크기를 확인하여 발현을 확인하였다. WEST-oneTM Western Blotting System(IntronBiotechnology, 한국)으로 발색하여 발현을 확인하였다.
5. 후보 균주의 백신 균주로의 가능성 및 실험동물에서의 면역원성 확인
웨스트 블롯으로 발현 확인이 완료된 백신을 BALB/c 마우스에 접종하여 면역유도 반응을 분석하였다. 128마리의 마우스를 각각 16마리씩 8그룹으로 나누어 실험을 진행하였다. 각 그룹의 백신균주와 투여 경로는 표 3에 나타내었다. A 그룹: 대조군, B 그룹: aSrBL 백신은 O 항원이 결실되지 않은 약독화 살모넬라 균주인 JOL912에 각각 선별된 네 개의 항원이 발현되는 백신 균주 배양액에 LPS를 혼합하여 접종, C 그룹: bRSrBL 백신은 O 항원이 결실된 약독화 살모넬라 균주인 JOL1800에서 발현되는 네 개의 브루셀라 항원이 발현되는 백신 균주 배양액에 브루셀라 LPS 혼합 접종, D 그룹: B 그룹과 같은 백신 균주를 복강으로 접종, E 그룹: C 그룹과 같은 백신 균주를 복강으로 접종, F그룹: LPS 혼합 없이 브루셀라 네가지 항원 발현 JOL1800 균주를 복강으로 투여.
각 그룹에서 6마리의 마우스는 백신 접종 21일 후 비장세포를 이용한 면역반응 시험에 이용되었고, 나머지 실험동물은 백신 접종 후 30일에 병원성 야생 브루셀라 아보투스 S544로 감염시킨 마우스를 이용하여 도전감염 시험이 이루어졌다. 도전감염 15일 후 모든 실험동물은 무균적 희생 후 비장을 균질화하여 브루셀라 배양 고체 배지에 7일동안 37℃에서 배양하였다. 각 그룹별로 검출된 집락의 수(x) 를 기본으로 각 그룹별 도전감염 후 아래의 계산식을 이용하여 보호 인텍스(Protection Index, PI)가 계산되었다.
y = log(x/log x)
PI = (PBS 로그 수의 y 값) - (테스트 백신 로그 수의 y 값).
Figure PCTKR2017002866-appb-T000002
6. 면역화된 마우스의 체액성 면역 반응
각 항원에 대해 특이한 sIgA 항체와 IgG 항체를 측정하기 위해 ELISA를 시행하였다. 혈청 샘플과 장세척 샘플은 백신 후 4주동안 1주 간격으로 채취되었다. 혈청은 안와후 정맥을 통해 채취한 후 4,000g, 5분 동안 원심 분리하여 상등액의 혈청을 분리한 후 -20℃에 보관한 후 실험에 사용하였다. 분변의 경우 분변은 무게를 잰 후 소듐 아자이드(sodium azide)가 0.1% 함유된 PBS로 100mg/㎖가 되도록 부유시킨 후 13,200rpm에서 10분간 원심분리 후 상층액을 분리, -20℃에 보관하며 실험에 사용하였다. 수행 방법은 접종량을 결정짓기 위한 시료 웰(sample well)에는 정제된 항원 단백질을 500ng/웰(well)의 농도로, 표준 단백질 웰(standard well)에는 염소 항-마우스 IgG(goat anti-mouse IgG) 또는 염소 항-마우스 sIgA(goat anti-mouse sIgA)를 각각 200ng/웰의 농도로 분주한 후 4℃에서 하룻밤 동안 코팅(coating)하고, 코팅된 플레이트는 0.05% Tween 20이 함유된 PBS(PBST)로 3번 세척한 후 블로킹 완충액(3% skim milk in PBS)으로 블로킹한 다음 혈청(serum)은 PBST로 1:100으로 질세척 샘플은 1:3로 각각 희석한 다음 100㎕씩 웰에 분주한 후, 37℃에서 1시간 30분 동안 반응하였다. 혈청의 경우 HRP-콘주게이트된 염소 항-마우스 IgG(peroxidase-conjugated goat anti-mouse IgG) 그리고 질세척 샘플의 경우에는 HRP-콘주게이트된 염소 항-마우스 IgA(peroxidase-conjugated goat anti-mouse IgA)를 1:5,000의 배율로 희석하여 각 웰에 100㎕씩 분주한 후 37℃에서 1시간 동안 반응하였다. OPD(o-phenylenediamine)-기질 반응액을 웰 당 100㎕씩 분주하여 발색 후 3M H2SO4로 정지시킨 후 492nm에서 OD값을 측정하였다. 각 항원 특이적 항체의 농도는 표준 단백질 농도에 기초하여 측정하였다.
7. 비장세포의 사이토카인 분석
접종 후 6주차인 마우스를 희생시켜 무균적으로 비장(spleen)을 채취한 후 분쇄하고 조직 내 세포를 꺼내 세포 스트레이너(cell stainer)로 남은 조직을 제거하였다. 원심분리하여 세포를 가라앉힌 뒤 RPMI(모든 RPMI(RPMI 1640 supplemented, Sigma)는 10% 열-불활성화 FBS(heat-inactivated fetal bovine serum), 100 IU/㎖ 페니실린 및 100ug/㎖ 스트렙토마이신이 포함되어 있다)로 부유시켜 재차 세포를 원심분리로 가라앉힌 뒤 적혈구 용해 버퍼(RBC Lysis buffer)를 통해 세포를 부유시켜 적혈구(red blood cell, RBC)를 제거하였다. 이후 원심분리한 세포 침전물을 멸균 PBS로 세척하고 이와 같은 과정을 두 차례 더 거친 뒤 RPMI에 부유된 비장세포(splenocyte cell) 수를 측정하여 각 그룹에 해당하는 항원과 함께 최종 세포 수가 1×106이 되도록 96 웰 배양 플레이트에 분주 후 JOL1800 살모넬라 균주 분쇄액과 각각 성병된 브루셀라 항원 단백질로 자극 후 48시간동안 배양하였다.
배양 후 인터루킨-4(interleukin-4, IL-4)와 인터루킨-12(interleukin-12, IL-12) 사이토카인의 분비를 관찰하기 위하여 RNeasy plus mono kit(Qiagen사)를 사용하여 각 항원으로 반응시킨 비장세포로부터 총 RNA를 추출하였다. 추출된 총 RNA는 NanoDrop을 이용하여 적절한 농도값을 확인한 뒤 High capacity cDNA Reverse transcription kit을 이용하여 cDNA로 합성하여 냉동보관하고 Step One plus Real Time PCR system 기기를 사용하여 IL-4, IL-12 및 β-액틴의 증폭을 mRNA 레벨에서 관찰하였다.
8. ELISPOT (Enzyme-Linked ImmunoSpot ) 분석을 이용한 인터페론-γ( IFN -γ) 검출
백신 후 21일 차에 면역 실험동물에서 분리한 비장세포를 브루셀라와 살모넬라 항원으로 재자극한 후 Mouse IFN-γ ELISpotPLUS(Mabtech AB, 스웨덴)을 이용하여 백신 투여 후 비장세포에서 IFN-γ의 증가율을 확인하였다. 96 웰 플레이트에 2×105세포를 배양 후 각각 JOL1800 외막 단백질 항원과 초음파 분쇄한 브루셀라 균주 500ng으로 30시간동안 자극한 후 1차 항체로 항-INF-γ 비오틴 콘주게이트된 항체와 2차 항체로 스트렙타비딘-HRP(1:1,000) 사용하여 INF-γ 발현 세포(INF-γ spots)를 검출하였다. 각각의 세포 웰에서 INF-γ 발현 세포 수를 세어 전체 발현량을 결정하였다.
9. 유세포 분석을 이용한 CD3+CD4+, CD3+CD8+ T 림프구 분석
백신을 투여한 실험동물의 비장 림프구에서 CD3+CD4+, CD3+CD8+ T 림프구의 증식 여부를 확인하기 위하여 FITC(fluorescein isothiocyanate)-표지 항-CD3, 비오틴-표지 항-CD4 및 APE-표지 항-CD8 항체(SouthernBiotech, 미국)와 함께 비장세포를 배양 후 MACSQuant Analyzer(Miltenyi Biotech, 독일)를 이용, 각각의 표면 항체의 발현의 차이를 기준으로 림프구 증식을 분석하였다.
실시예 1. 브루셀라 항원을 발현하는 백신의 백신 세포에서의 발현 확인
제작된 백신 균주가 해당 BLS, PrpA, Omp19, SOD 항원을 발현하는지 확인하기 위하여 웨스트 블롯을 실시하였다. BLS 항원의 발현 크기는 약 23KDa이고, PrpA 항원의 발현 크기는 약 39kDa, Omp19 항원의 발현 크기는 약 20kDa, SOD 항원의 발현 크기는 약 20kDa임을 확인하였다(도 3).
실시예 2. 체액성 면역 반응 분석 - 백신 투여 후 IgG 및 sIgA 분석
본 발명의 각 브루셀라 항원을 발현하는 살모넬라 균주의 혼합물을 투여한 실험동물군에서 IgG와 IgA의 역가를 측정하기 위해 초음파 분쇄된 브루셀라 균주를 코팅 항원 또는 재조합 브루셀라 항원 중 BLS 정제 단백질을 코팅 항원으로 사용하여 ELISA를 시행하였다. 도 4A에 개시된 바와 같이, 초음파 분쇄된 브루셀라 균주를 코딩 항원으로 사용하여 브루셀라 항원을 발현하는 살모넬라 균주를 혼합하여 투여한 실험동물군의 IgG와 IgA의 역가를 확인한 결과, 전체 브루셀라 균 특이 항체 IgG와 IgA는 벡터 대조군(VC IP)과 대조군 그룹(Control)을 제외한 모든 그룹에서 3주차까지 증가하는 추세를 보였다. 그룹 D(SrBL IP)는 4주차까지 증가세를 보였으며 브루셀라 생백신 RB51을 접종한 그룹 H(RB51 IP)에서는 IgG가 유의하게 증가하였다. 브루셀라 특이 IgG 농도는 투여경로에 따라 큰 차이를 보이지 않았지만 반대로 경구투여를 한 그룹 B(SrBL oral)와 C(RSrBL oral)에서 점막면역을 유도하는 IgA 농도는 유의한 증가세를 보였다. 브루셀라 전체를 타겟으로 한 항체 생성에서는 기존의 RB51 생백신에서 더 높은 항체 생성을 보였다. 하지만 도 4B에서 나타나듯이 브루셀라 항원 발현 약독화 살모넬라 생백신 투여 그룹들에서 BLS 단백질 특이 항체의 생성이 증가되었음을 확인하였다.
실시예 3. 면역 사이토카인 분석
브루셀라 항원으로 재자극한 마우스의 비장세포에서 IL-4 및 IL-12 농도를 RT-PCR를 이용하여 측정한 결과는 도 5A에 개시되었다. IL-4 수치의 유의한 증가가 그룹 B(SrBL oral), D(SrBL IP), E(RSrBL IP) 및 H(RB51 IP)에서 관찰되었다. 같은 백신 균주 접종시 경구 접종보다 복강으로 접종시 사이토카인의 수치가 증가하였고, IL-12 사이토카인 수치는 그룹 B(SrBL oral), C(RSrBL oral), D(SrBL IP) 및 H(RB51 IP)에서 유의한 증가가 나타남을 확인하였다(도 5A). 한편, 브루셀라 항원 또는 살모넬라 외막 단백질로 자극한 비장세포에서 분비되는 IFN-γ 농도를 측정한 결과, 그룹 D(SrBL IP)의 실험동물에서 검출된 비장세포(살모넬라 외막 단백질로 자극)에서 가장 높은 IFN-γ 수치가 나타났다(도 5B). 그룹 C(RSrBL oral), E(RSrBL IP), H(RB51 IP)의 브루셀라 항원 자극 비장세포에서도 유의하게 증가한 IFN-γ 수치가 관찰되었다.
실시예 4. 백신 면역 실험동물에서 T 세포 림프구의 변화
자극하지 않은 비장세포(US)에서의 CD3+CD4+, CD3+CD8+ T 세포의 비율과 비교시 살모넬라 자극(SS) 혹은 브루셀라 자극(BS) 비장세포에서 전반적인 증가가 확인되었다(표 4). 그룹 D(브루셀라 항원 발현 JOL912 균주 + LPS 접종 그룹, 경구투여)에서 가장 높은 CD4+ T 세포의 증가세를 보였고 CD8+ T 림프구에서는 비자극 비장세포와 비교시 확연한 증가세가 나타나지 않았다.
Figure PCTKR2017002866-appb-T000003
실시예 5. 도전감염시 백신 방어 효과
도전감염 15일 후 비장세포에서 검출된 도전 감염 균주의 수를 통하여 백신으로 인한 방어효과가 평가되었다. 도 7 및 도 8에 개시된 바와 같이, 그룹 RSrBL IP(브루셀라 항원 발현 JOL1800 균주 + LPS, 복강 접종)에서 가장 높은 방어 효율이 나타났다. 또한 그룹 SrBL IP(브루셀라 항원발현 JOL912 균주 + LPS, 복강 접종)에서와 그룹 RSrBL IP에서 보여준 방어 효과는 기존의 백신인 RB51 면역화된 그룹(RB51 IP)에 비해서도 확연한 증가를 보였다(P < 0.05).

Claims (9)

  1. 브루셀라 아보투스(Brucella abortus) 유래 BLS(Brucella lumazine synthase), Omp19(outer membrane protein 19), PrpA(Proline racemase subunit A) 및 SOD(superoxide dismutase) 항원을 각각 발현하고, lon, cpxR , rfaL 및 asd 유전자가 결실된 약독화 살모넬라 변이주의 혼합물.
  2. 제1항에 있어서, 상기 BLS(Brucella lumazine synthase), Omp19(outer membrane protein 19), PrpA(Proline racemase subunit A) 및 SOD(superoxide dismutase) 항원은 각각 서열번호 1, 서열번호 2, 서열번호 3 및 서열번호 4의 아미노산 서열로 이루어진 것을 특징으로 하는 약독화 살모넬라 변이주의 혼합물.
  3. 제1항에 있어서, 상기 약독화 살모넬라 변이주는 Bla(β-lactamse) 신호 서열, 이에 연결된 BLS(Brucella lumazine synthase), Omp19(outer membrane protein 19), PrpA(Proline racemase subunit A) 및 SOD(superoxide dismutase) 항원을 코딩하는 유전자로 이루어진 군에서 선택된 어느 하나의 유전자; 및 asd 유전자;를 포함하는 재조합 벡터로 형질전환된 것을 특징으로 하는 약독화 살모넬라 변이주의 혼합물.
  4. (a) 브루셀라 아보투스(Brucella abortus) 유래 BLS(Brucella lumazine synthase), Omp19(outer membrane protein 19), PrpA(Proline racemase subunit A) 및 SOD(superoxide dismutase) 항원을 코딩하는 유전자를 각각 증폭시키는 단계;
    (b) 상기 (a) 단계의 증폭된 유전자를 asd 유전자를 가진 재조합 벡터에 각각 클로닝하여 4개의 클로닝된 플라스미드를 수득하는 단계;
    (c) 상기 (b) 단계의 클로닝된 각각의 플라스미드를 lon, cpxR , rfaL 및 asd 유전자를 결실시켜 약독화된 살모넬라 균주에 각각 형질전환시켜 4개의 형질전환된 살모넬라 변이주를 수득하는 단계; 및
    (d) 상기 (c) 단계의 각각의 형질전환된 살모넬라 변이주를 선별하여 혼합하는 단계;를 포함하는 브루셀라증 및 살모넬라증 예방 또는 치료용 약독화 살모넬라 변이주의 혼합물의 제조방법.
  5. 제4항의 방법에 의해 제조된 브루셀라증 및 살모넬라증 예방 또는 치료용 약독화 살모넬라 변이주의 혼합물.
  6. 제1항 또는 제5항의 약독화 살모넬라 변이주의 혼합물을 유효성분으로 포함하는 브루셀라증 및 살모넬라증 예방 또는 치료용 백신 조성물.
  7. 제6항에 있어서, 상기 백신 조성물은 브루셀라 유래 LPS(lipopolysaccharide)를 추가로 포함하는 것을 특징으로 하는 브루셀라증 및 살모넬라증 예방 또는 치료용 백신 조성물.
  8. 제6항에 있어서, 상기 백신 조성물은 복강 내 투여용인 것을 특징으로 하는 브루셀라증 및 살모넬라증 예방 또는 치료용 백신 조성물.
  9. 제1항 또는 제5항의 약독화 살모넬라 변이주의 혼합물을 유효성분으로 포함하는 브루셀라증 및 살모넬라증 예방 또는 개선용 사료 첨가제.
PCT/KR2017/002866 2016-12-26 2017-03-17 브루셀라 균 주요 공통 항원을 발현하는 lps의 o-항원 결실 비병원성 살모넬라 균주를 포함하는 브루셀라증 예방 또는 치료용 백신 조성물 WO2018124393A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2016-0178943 2016-12-26
KR1020160178943A KR101840360B1 (ko) 2016-12-26 2016-12-26 브루셀라 균 주요 공통 항원을 발현하는 lps의 o-항원 결실 비병원성 살모넬라 균주를 포함하는 브루셀라증 예방 또는 치료용 백신 조성물

Publications (1)

Publication Number Publication Date
WO2018124393A1 true WO2018124393A1 (ko) 2018-07-05

Family

ID=61910596

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/002866 WO2018124393A1 (ko) 2016-12-26 2017-03-17 브루셀라 균 주요 공통 항원을 발현하는 lps의 o-항원 결실 비병원성 살모넬라 균주를 포함하는 브루셀라증 예방 또는 치료용 백신 조성물

Country Status (2)

Country Link
KR (1) KR101840360B1 (ko)
WO (1) WO2018124393A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020051381A1 (en) * 2018-09-05 2020-03-12 University Of Florida Research Foundation, Inc. Protective immunity enhanced salmonella vaccine (piesv) against brucella spp.
CN112852698A (zh) * 2021-01-30 2021-05-28 军事科学院军事医学研究院军事兽医研究所 牛种布鲁氏菌A19株asd基因缺失株的构建方法和应用
CN114097707A (zh) * 2021-11-15 2022-03-01 韩勇 一种规模场牛羊布鲁氏菌病防控方法

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102107519B1 (ko) * 2018-06-25 2020-05-07 경상대학교산학협력단 브루셀라 어보투스 균주 유래의 InpB, Dps, AspC 및 Ndk 단백질을 유효성분으로 포함하는 브루셀라 감염증 예방 또는 치료용 백신 조성물
KR102092041B1 (ko) * 2018-10-30 2020-03-23 경상대학교산학협력단 브루셀라 어보투스 균주 유래의 SodC, RibH, Ndk, L7/L12 및 MDH 단백질을 유효성분으로 포함하는 브루셀라 감염증 예방 또는 치료용 백신 조성물

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130052230A1 (en) * 2010-01-28 2013-02-28 Universiteit Gent Salmonella vaccine

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130052230A1 (en) * 2010-01-28 2013-02-28 Universiteit Gent Salmonella vaccine

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DORNELES, E. MS: "Recent advances in Brucella abortus vaccines", VETERINARY RESEARCH, vol. 76, 2015, pages 1 - 10, XP055612937 *
KIM, W. K.: "Comparison between immunization routes of live attenuated Salmonella typhimurium strains expressing BCSP31, Omp3b, and SOD of Brucella abortus in murine mode", FRONTIERS IN MICROBIOLOGY, vol. 550, 20 April 2016 (2016-04-20), pages 1 - 8, XP055612919 *
KONG, Q.: "Effect of deletion of genes involved in lipopolysaccharide core and 0-antigen synthesis on virulence and immunogenicity of Salmonella enterica serovar Typhimurium", INFECTION AND IMMUNITY, vol. 79, no. 10, 2011, pages 4227 - 4239, XP009155080 *
ZENK, S. F.: "Role of Salmonella enterica lipopolysaccharide in activation of dendritic cell functions and bacterial containment", THE JOURNAL OF IMMUNOLOGY, vol. 183, no. 4, 2009, pages 2697 - 2707, XP055612936 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020051381A1 (en) * 2018-09-05 2020-03-12 University Of Florida Research Foundation, Inc. Protective immunity enhanced salmonella vaccine (piesv) against brucella spp.
US11975061B2 (en) 2018-09-05 2024-05-07 University Of Florida Research Foundation, Incorporated Protective immunity enhanced Salmonella vaccine (PIESV) against Brucella spp
CN112852698A (zh) * 2021-01-30 2021-05-28 军事科学院军事医学研究院军事兽医研究所 牛种布鲁氏菌A19株asd基因缺失株的构建方法和应用
CN112852698B (zh) * 2021-01-30 2022-11-29 军事科学院军事医学研究院军事兽医研究所 牛种布鲁氏菌A19株asd基因缺失株的构建方法和应用
CN114097707A (zh) * 2021-11-15 2022-03-01 韩勇 一种规模场牛羊布鲁氏菌病防控方法

Also Published As

Publication number Publication date
KR101840360B1 (ko) 2018-03-20

Similar Documents

Publication Publication Date Title
WO2018124393A1 (ko) 브루셀라 균 주요 공통 항원을 발현하는 lps의 o-항원 결실 비병원성 살모넬라 균주를 포함하는 브루셀라증 예방 또는 치료용 백신 조성물
JP3935180B2 (ja) 弱毒生ネオスポラワクチン
US11103569B2 (en) Vaccine for protection against Streptococcus suis
Lalsiamthara et al. Brucella lipopolysaccharide reinforced Salmonella delivering Brucella immunogens protects mice against virulent challenge
JP2018513877A (ja) 連鎖球菌ワクチン
WO2018124407A1 (ko) 약독화된 살모넬라 변이주를 유효성분으로 포함하는 돼지 증식성 회장염 및 살모넬라증 동시 예방 또는 치료용 백신 조성물
US20190000954A1 (en) Attenuated mannheimia haemolytica strains
US11696944B2 (en) Vaccine for protection against Streptococcus suis
EP2597151A2 (en) Recombinant microorganisms, methods for preparing vaccine strains, antigens, and vector vaccine compositions of same, uses thereof, and related antibodies, diagnostic kit, and treatment and/or prophylactic methods
KR20220167577A (ko) FliC-FimA-CD40L 융합 항원을 발현하는 살모넬라 갈리나룸 변이주를 유효성분으로 포함하는 가금티푸스 및 살모넬라증 동시 예방 또는 치료용 백신 조성물
Kong et al. Mucosal delivery of a self-destructing Salmonella-based vaccine inducing immunity against Eimeria
WO2013015586A2 (ko) 가금류의 병원성 대장균의 병원성 인자를 발현하는 살모넬라균을 포함하는 가금류의 병원성 대장균증 및 살모넬라균증의 예방 및 치료용 백신 조성물
CN106574235B (zh) 用于针对布鲁氏菌病的改进疫苗的改性细菌
KR101873362B1 (ko) 브루셀라 균 주요 공통 항원을 발현하는 비병원성 약독화 살모넬라 균주를 포함하는 브루셀라증 예방 또는 치료용 백신 조성물
EP2962696A1 (en) Novel veterinary vaccine compositions for use in the treatment of infectious diseases caused by or associated with Pasteurellaceae family bacteria
WO2021141384A1 (ko) 항원성이 증진된 항원을 발현하는 약독화된 살모넬라 변이주를 유효성분으로 포함하는 돼지 증식성 회장염 및 살모넬라증 동시 예방 또는 치료용 백신 조성물
WO2016013873A1 (ko) Ｒｖ３１１２, ＭＴＢＫ ２０６２０ 또는 ＭＴＢＫ ２４８２０ 단백질을 포함하는 결핵 예방용 백신 조성물
KR101705098B1 (ko) 약독화된 살모넬라 변이주를 포함하는 돼지 흉막폐렴의 예방 또는 치료용 백신 조성물
KR101712012B1 (ko) 개선된 고스트 살모넬라 변이주를 유효성분으로 포함하는 돼지 대장균증의 예방 또는 치료용 백신 조성물
Bello et al. Mucosal immunization of BALB/c mice with DNA vaccines encoding the SEN1002 and SEN1395 open reading frames of Salmonella enterica serovar Enteritidis induces protective immunity
CN113755421A (zh) 一种用于covid-19的口服性疫苗及抗体加强剂
Balzano The Role of MFS Family Transporters in the Lifecycle of Type A Francisella tularensis and Their Viability as Vaccine Targets
Baloglu Applicability of vaccinia virus as cloning and expression vector for bacterial genes: mice immune responses to vaccinia virus expressing Brucella abortus and Listeria monocytogenes antigens
WO2018170547A1 (en) Live vaccine strains
Wang QiuYue et al. A novel recombinant BCG vaccine encoding Eimeria tenella rhomboid and chicken IL-2 induces protective immunity against coccidiosis.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17887804

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17887804

Country of ref document: EP

Kind code of ref document: A1