WO2017147600A1 - Whole-cell cancer vaccines and methods for selection thereof - Google Patents

Whole-cell cancer vaccines and methods for selection thereof Download PDF

Info

Publication number
WO2017147600A1
WO2017147600A1 PCT/US2017/019757 US2017019757W WO2017147600A1 WO 2017147600 A1 WO2017147600 A1 WO 2017147600A1 US 2017019757 W US2017019757 W US 2017019757W WO 2017147600 A1 WO2017147600 A1 WO 2017147600A1
Authority
WO
WIPO (PCT)
Prior art keywords
hla
gene
cell
allele
cancer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/019757
Other languages
English (en)
French (fr)
Inventor
Markus Daniel Lacher
Joseph Paul WAGNER
Charles Louis WISEMAN
William Valentine WILLIAMS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Briacell Therapeutics Corp USA
Original Assignee
Briacell Therapeutics Corp USA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AU2017224232A priority Critical patent/AU2017224232B2/en
Application filed by Briacell Therapeutics Corp USA filed Critical Briacell Therapeutics Corp USA
Priority to JP2018563769A priority patent/JP6901505B2/ja
Priority to NZ745327A priority patent/NZ745327A/en
Priority to EP17757429.0A priority patent/EP3419657A4/en
Priority to CN201780023982.8A priority patent/CN109069603A/zh
Priority to CA3015080A priority patent/CA3015080A1/en
Publication of WO2017147600A1 publication Critical patent/WO2017147600A1/en
Priority to IL261354A priority patent/IL261354A/en
Priority to US16/110,317 priority patent/US11559574B2/en
Anticipated expiration legal-status Critical
Priority to AU2022259857A priority patent/AU2022259857B2/en
Priority to US18/078,351 priority patent/US20230277640A1/en
Priority to AU2025205094A priority patent/AU2025205094A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70539MHC-molecules, e.g. HLA-molecules
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/001102Receptors, cell surface antigens or cell surface determinants
    • A61K39/001116Receptors for cytokines
    • A61K39/00112Receptors for interferons [IFN]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/001102Receptors, cell surface antigens or cell surface determinants
    • A61K39/001129Molecules with a "CD" designation not provided for elsewhere
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/001136Cytokines
    • A61K39/001139Colony stimulating factors [CSF]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/001136Cytokines
    • A61K39/00114Interleukins [IL]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57515Immunoassay; Biospecific binding assay; Materials therefor for cancer of the breast
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5152Tumor cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5156Animal cells expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55522Cytokines; Lymphokines; Interferons

Definitions

  • Cancer immunotherapy with allogeneic whole-cell vaccines is a relatively simple and in many cases effective approach to reduce tumor burden. It is generally assumed that to be effective, the vaccine needs to express immunogenic antigens co-expressed in patient tumor cells; and antigen-presenting cells (APCs) such as dendritic cells (DCs) need to cross- present such antigens following uptake of vaccine cell fragments.
  • APCs antigen-presenting cells
  • DCs dendritic cells
  • the present invention provides a modified human cancer cell comprising a recombinant polynucleotide encoding an allele of a human leukocyte antigen (ULA) class I gene.
  • the modified human cancer cell further comprises a recombinant polynucleotide encoding an allele of an ULA class II gene.
  • the present invention provides a modified human cancer cell comprising a recombinant polynucleotide encoding an allele of an ULA class II gene.
  • the modified human cancer cell further comprises a recombinant polynucleotide encoding an allele of an ULA class I gene.
  • the recombinant polynucleotide is present on a vector in the cell. In other embodiments, the recombinant polynucleotide is integrated into the genome of the cell.
  • the HLA class I gene is selected from the group consisting of an HLA-A gene, an HLA-B gene, an HLA-C gene, an HLA-E gene, an HLA-F gene, an HLA-G gene, a beta-2-microglobulin ⁇ B2M) gene, and a combination thereof.
  • the allele of the HLA-A gene is an allele selected from the group consisting of HLA-A* 11 :01, HLA-A*01 :01, HLA-A*02:01, HLA-A*03 :01, HLA-A*26:01, HLA-A*29:02, HLA- A*32:01, HLA-A*24:02, HLA-A*33 :03, HLA-A*68:01, HLA-A*31 :01, HLA-A*02:06, and a combination thereof.
  • the allele of the HLA-B gene is an allele selected from the group consisting of HLA-B* 13 :02, HLA-B*41 :01, HLA-B* 18:03, HLA-B*44:02, HLA-B*07:02, HLA-B*35:01, HLA-B*40:01, HLA-B*35:08, HLA-B*55:01, HLA- B*51 :01, HLA-B*44:03, HLA-B*58:01, HLA-B*08:01, HLA-B* 18:01, HLA-B* 15:01, HLA-B*52:01, and a combination thereof.
  • the allele of the HLA-C gene is an allele selected from the group consisting of HLA-C*04:01, HLA-C*07:02, HLA-C*07:01, HLA-C*06:02, HLA-C*03 :04, HLA-C*01 :02, HLA-C*02:02, HLA-C*08:02, HLA- C* 15:02, HLA-C*03 :03, HLA-C*05:01, HLA-C*08:01, HLA-C* 16:01, HLA-C* 12:03, HLA-C* 14:02, and a combination thereof.
  • the HLA class II gene is selected from the group consisting of an HLA class II alpha subunit gene, an HLA class II beta subunit gene, and a combination thereof.
  • the HLA class II gene is selected from the group consisting of an HLA-DP gene, an HLA-DM gene, an HLA-DOA gene, an HLA-DOB gene, an HLA- DQ gene, an HLA-DR gene, and a combination thereof.
  • HLA-DM gene is selected from the group consisting of an HLA-DMA gene, an HLA-DMB gene, and a combination thereof.
  • the HLA-DR gene is selected from the group consisting of an HLA-DRA gene, an HLA-DRB 1 gene, an HLA-DRB3 gene, an HLA-DRB4 gene, an HLA-DRB5 gene, and a combination thereof.
  • the allele of the HLA-DRB 3 gene is an allele selected from the group consisting of HLA-DRB 3* 02: 02, HLA- DRB3*01 :01, HLA-DRB3*03 :01, and a combination thereof.
  • the modified human cancer cell further comprises a recombinant polynucleotide encoding granulocyte-macrophage colony-stimulating factor (GM-CSF). In other embodiments, the modified human cancer cell further comprises a recombinant polynucleotide encoding interferon alpha (IFNa).
  • GM-CSF granulocyte-macrophage colony-stimulating factor
  • IFNa interferon alpha
  • the modified human cancer cell further comprises a recombinant polynucleotide encoding adenosine deaminase (ADA), adhesion G protein- coupled receptor E5 (ADGRE5), caveolin 1 (CAV1), CD58 molecule (CD58), CD74 molecule (CD74), CD83 molecule (CD83), C-X-C motif chemokine ligand 8 (CXCL8), C-X-C motif chemokine ligand 16 (CXCL16), intracellular adhesion molecule 3 (ICAM3), interleukin 6 (IL6), interleukin 10 (IL10), interleukin 15 (IL15), interleukin 18 (IL18), KIT ligand (KITLG), tumor necrosis factor superfamily member 14 (TNFSF14), preferentially expressed antigen in melanoma (FRAME), PDZ binding kinase (PBK), centrosomal protein 55 (CEP55), kinesin family
  • ADA adeno
  • the human cancer cell is a human cancer cell line.
  • the human cancer cell line is an SV-BR-1 breast cancer cell line.
  • the present invention provides a method for selecting a whole-cell cancer vaccine for a subject having cancer, the method comprising:
  • HLA human leukocyte antigen
  • the one or more HLA genes comprise an HLA class I gene, an HLA class II gene, or a combination thereof.
  • the HLA class I gene is selected from the group consisting of an HLA-A gene, an HLA-B gene, an HLA-C gene, an HLA-E gene, an HLA-F gene, an HLA-G gene, a beta-2-microglobulin (B2M) gene, and a combination thereof.
  • the allele of the HLA-A gene is an allele selected from the group consisting of HLA-A* 11 :01, HLA-A*01 :01, HLA-A*02:01, HLA-A*03 :01, HLA-A*26:01, HLA-A*29:02, HLA-A*32:01, HLA-A*24:02, HLA-A*33 :03, HLA- A*68:01, HLA-A*31 :01, HLA-A*02:06, and a combination thereof.
  • the allele of the HLA-B gene is an allele selected from the group consisting of HLA-B* 13 :02, HLA-B*41 :01, HLA-B* 18:03, HLA-B*44:02, HLA-B*07:02, HLA-B*35:01, HLA- B*40:01, HLA-B*35:08, HLA-B*55:01, HLA-B*51 :01, HLA-B*44:03, HLA-B*58:01, HLA-B*08:01, HLA-B* 18:01, HLA-B* 15:01, HLA-B*52:01, and a combination thereof.
  • the allele of the HLA-C gene is an allele selected from the group consisting of HLA-C*04:01, HLA-C*07:02, HLA-C*07:01, HLA-C*06:02, HLA-C*03 :04, HLA- C*01 :02, HLA-C*02:02, HLA-C*08:02, HLA-C* 15:02, HLA-C*03 :03, HLA-C*05:01, HLA-C*08:01, HLA-C* 16:01, HLA-C* 12:03, HLA-C* 14:02, and a combination thereof.
  • the HLA class II gene is selected from the group consisting of an HLA class II alpha subunit gene, an HLA class II beta subunit gene, and a combination thereof.
  • the HLA class II gene is selected from the group consisting of an HLA-DP gene, an HLA-DM gene, an HLA-DOA gene, an HLA-DOB gene, an HLA- DQ gene, an HLA-DR gene, and a combination thereof.
  • the HLA- DM gene is selected from the group consisting of an HLA-DMA gene, an HLA-DMB gene, and a combination thereof.
  • the HLA-DR gene is selected from the group consisting of an HLA-DRA gene, an HLA-DRB l gene, an HLA-DRB3 gene, an HLA- DRB4 gene, an HLA-DRB5 gene, and a combination thereof.
  • the allele of the HLA-DRB3 gene is an allele selected from the group consisting of HLA-DRB3*02:02, HLA-DRB3*01 :01, HLA-DRB3*03 :01, and a combination thereof.
  • the allele of the HLA class I gene is HLA-A* 11 :01 or HLA-A*24:02 and the allele of the HLA class II gene is HLA-DRB3*02:02 or HLA-DRB3*01 :01.
  • the whole-cell cancer vaccine is selected for the subject when one or more alleles in the HLA allele profile of the subject match the HLA allele profile of the whole-cell cancer vaccine. In some instances, the whole-cell cancer vaccine is selected for the subject when two or more alleles in the HLA allele profile of the subject match the HLA allele profile of the whole-cell cancer vaccine.
  • the present invention provides a method for selecting a whole- cell cancer vaccine for a subject having cancer, the method comprising: (a)(i) detecting the presence or level of one or more biomarkers in a sample obtained from the subject; and/or
  • step (b) comparing the presence or level of the one or more biomarkers detected in step (a)(i) and/or the level of activity and/or number of the one or more immune cells measured in step (a)(ii) to the presence or level of the one or more biomarkers and/or the level of activity and/or number of one or more immune cells in a control sample;
  • step (c) selecting the whole-cell cancer vaccine for the subject based on the comparison in step (b), wherein the whole-cell cancer vaccine is derived from a breast cancer cell line or a breast cancer cell.
  • the breast cancer cell line is an SV-BR-1 breast cancer cell line.
  • the one or more biomarkers is selected from the group consisting of preferentially expressed antigen in melanoma (FRAME), PDZ binding kinase (PBK), centrosomal protein 55 (CEP 55), kinesin family member 2C (KIF2C), placenta-specific protein 1 (PLAC1), Opa interacting protein 5 (OIP5), calcium binding tyrosine phosphorylation regulated (CABYR), sperm-associated antigen 1 (SPAG1), alpha-1,3- glucosyltransferase (ALG8), actin-related protein 2/3 complex, subunit 5-like (ARPC5L), chromobox homolog 2 (CBX2), collagen type VIII alpha 1 chain (COL8A1), DDB 1 and CUL4 associated factor 10, (DCAFIO), eukaryotic translation initiation factor 3 subunit H (EIF3H
  • FRAME preferentially expressed antigen
  • the one or more biomarkers is selected from the group consisting of PRAME, PBK, CEP55, KIF2C, ERBB2, MIEN1, PGAP3, and a combination thereof.
  • the one or more biomarkers is PRAME.
  • the one or more biomarkers is selected from the group consisting of ERBB2, MIEN1, PGAP3, and a combination thereof.
  • the vaccine is selected for the subject when the level of at least one of the one or more biomarkers is overexpressed in the sample obtained from the subject compared to the control sample, wherein the control sample comprises a normal cell or tissue obtained from the subject, from a different subject, or from a population of subjects. In some instances, the vaccine is selected for the subject when the level of at least one of the one or more biomarkers is overexpressed at least about 1.5-fold compared to the control sample.
  • the vaccine is selected for the subject when the level of activity and/or number of the one or more immune cells obtained from the subject is higher compared to the control sample, wherein the control sample comprises one or more immune cells obtained from a different subject or population of subjects who do not have cancer.
  • the level of activity and/or number of the one or more immune cells obtained from the subject is at least about 1.5-fold higher compared to the control sample.
  • the one or more immune cells in which the level of activity and/or number is measured is selected from the group consisting of a peripheral blood mononuclear cell (PBMC), a lymphocyte, a monocyte, a natural killer (NK) cell, a dendritic cell, a macrophage, a myeloid-derived suppressor cell (MDSC), and a combination thereof.
  • PBMC peripheral blood mononuclear cell
  • NK natural killer
  • MDSC myeloid-derived suppressor cell
  • the one or more immune cells in which the level of activity and/or number is measured is selected from the group consisting of a PBMC, a lymphocyte, a dendritic cell, and a combination thereof.
  • the presence or level of the one or more biomarkers is detected using a method selected from the group consisting of an ELISA, a multiplex assay, measuring the RNA transcript level of a gene encoding an antigen, immunohistochemistry, a Western blot, a bead-based method, and a combination thereof.
  • the level of activity and/or number of the one or more immune cells is measured using a method selected from the group consisting of an ELISA, an ELISPOT assay, a Western blot, a cytotoxic T lymphocyte (CTL) activity assay, a cytotoxicity assay, a proliferation assay, a cytokine production assay, an MHC multimer assay, a flow cytometry assay, and a combination thereof.
  • the level of activity and/or number of the one or more immune cells is measured following stimulation with an antigen.
  • the one or more biomarkers comprise one or more alleles of one or more human leukocyte antigen (HLA) genes.
  • the one or more HLA genes comprise an HLA class I gene, an HLA class II gene, or a combination thereof.
  • the HLA class I gene is selected from the group consisting of an HLA-A gene, an HLA-B gene, an HLA-C gene, an HLA-E gene, an HLA-F gene, an HLA-G gene, a beta-2-microglobulin (B2M) gene, and a combination thereof.
  • the allele of the HLA-A gene is an allele selected from the group consisting of HLA-A* 11 :01, HLA-A*01 :01, HLA-A*02:01, HLA-A*03 :01, HLA-A*26:01, HLA-A*29:02, HLA- A*32:01, HLA-A*24:02, HLA-A*33 :03, HLA-A*68:01, HLA-A*31 :01, HLA-A*02:06, and a combination thereof.
  • the allele of the HLA-B gene is an allele selected from the group consisting of HLA-B* 13 :02, HLA-B*41 :01, HLA-B* 18:03, HLA-B*44:02, HLA-B*07:02, HLA-B*35:01, HLA-B*40:01, HLA-B*35:08, HLA-B*55:01, HLA- B*51 :01, HLA-B*44:03, HLA-B*58:01, HLA-B*08:01, HLA-B* 18:01, HLA-B* 15:01, HLA-B *52:01, and a combination thereof.
  • the allele of the HLA-C gene is an allele selected from the group consisting of HLA-C*04:01, HLA-C*07:02, HLA- C*07:01, HLA-C*06:02, HLA-C*03 :04, HLA-C*01 :02, HLA-C*02:02, HLA-C*08:02, HLA-C* 15:02, HLA-C*03 :03, HLA-C*05:01, HLA-C*08:01, HLA-C* 16:01, HLA- C* 12:03, HLA-C* 14:02, and a combination thereof.
  • the HLA class II gene is selected from the group consisting of an HLA class II alpha subunit gene, an HLA class II beta subunit gene, and a combination thereof.
  • the HLA class II gene is selected from the group consisting of an HLA-DP gene, an HLA-DM gene, an HLA-DOA gene, an HLA-DOB gene, an HLA- DQ gene, an HLA-DR gene, and a combination thereof.
  • the HLA- DM gene is selected from the group consisting of an HLA-DMA gene, an HLA-DMB gene, and a combination thereof.
  • the HLA-DR gene is selected from the group consisting of an HLA-DRA gene, an HLA-DRB l gene, an HLA-DRB3 gene, an HLA- DRB4 gene, an HLA-DRB5 gene, and a combination thereof.
  • the allele of the HLA-DRB3 gene is an allele selected from the group consisting of HLA-DRB3*02:02, HLA-DRB3*01 :01, HLA-DRB3*03 :01, and a combination thereof.
  • the allele of the HLA class I gene is HLA-A* 11 :01 or HLA-A*24:02 and the allele of the HLA class II gene is HLA-DRB3*02:02 or HLA-DRB3*01 :01.
  • the vaccine is selected for the subject when one or more alleles of one or more human leukocyte antigen (HLA) genes in the sample obtained from the subject match one or more alleles of one or more human leukocyte antigen (HLA) genes in the vaccine.
  • HLA human leukocyte antigen
  • the sample obtained from the subject is a whole blood sample, a plasma sample, a serum sample, a buccal swab sample, a tumor tissue sample, a biofluid sample, a pleural effusion sample, a urine sample, a hair sample, a skin sample, or a combination thereof.
  • the sample is obtained from a biopsy, from a surgical resection, as a fine needle aspirate (FNA), or a combination thereof.
  • the sample comprises tumor tissue, a tumor cell, a circulating tumor cell (CTC), or a combination thereof.
  • the present invention provides a composition comprising a modified human cancer cell comprising a recombinant polynucleotide encoding an allele of a human leukocyte antigen (HLA) class I gene.
  • the modified human cancer cell further comprises a recombinant polynucleotide encoding an allele of an HLA class II gene.
  • the present invention provides a composition comprising a modified human cancer cell comprising a recombinant polynucleotide encoding an allele of an HLA class II gene.
  • the modified human cancer cell further comprises a recombinant polynucleotide encoding an allele of an HLA class I gene.
  • the recombinant polynucleotide is present on a vector in the cell.
  • the recombinant polynucleotide is integrated into the genome of the cell.
  • the HLA class I gene is selected from the group consisting of an HLA-A gene, an HLA-B gene, an HLA-C gene, an HLA-E gene, an HLA-F gene, an HLA-G gene, a beta-2-microglobulin (B2M) gene, and a combination thereof.
  • the allele of the HLA-B gene is an allele selected from the group consisting of HLA-B* 13 :02, HLA-B*41 :01, HLA-B* 18:03, HLA-B*44:02, HLA-B*07:02, HLA-B*35:01, HLA- B*40:01, HLA-B*35:08, HLA-B*55:01, HLA-B*51 :01, HLA-B*44:03, HLA-B*58:01, HLA-B*08:01, HLA-B* 18:01, HLA-B* 15:01, HLA-B*52:01, and a combination thereof.
  • the allele of the HLA-C gene is an allele selected from the group consisting of HLA-C*04:01, HLA-C*07:02, HLA-C*07:01, HLA-C*06:02, HLA-C*03 :04, HLA- C*01 :02, HLA-C*02:02, HLA-C*08:02, HLA-C* 15:02, HLA-C*03 :03, HLA-C*05:01, HLA-C*08:01, HLA-C* 16:01, HLA-C* 12:03, HLA-C* 14:02, and a combination thereof.
  • the HLA class II gene is selected from the group consisting of an HLA class II alpha subunit gene, an HLA class II beta subunit gene, and a combination thereof.
  • the HLA class II gene is selected from the group consisting of an HLA-DP gene, an HLA-DM gene, an HLA-DOA gene, an HLA-DOB gene, an HLA- DQ gene, an HLA-DR gene, and a combination thereof.
  • the HLA- DM gene is selected from the group consisting of an HLA-DMA gene, an HLA-DMB gene, and a combination thereof.
  • the HLA-DR gene is selected from the group consisting of an HLA-DRA gene, an HLA-DRB l gene, an HLA-DRB3 gene, an HLA- DRB4 gene, an HLA-DRB5 gene, and a combination thereof.
  • the allele of the HLA-DRB3 gene is an allele selected from the group consisting of HLA-DRB3*02:02, HLA-DRB3*01 :01, HLA-DRB3*03 :01, and a combination thereof.
  • the allele of the HLA class I gene is HLA-A* 11 :01 or HLA-A*24:02 and the allele of the HLA class II gene is HLA-DRB3*02:02 or HLA-DRB3*01 :01.
  • the modified human cancer cell further comprises a recombinant polynucleotide encoding adenosine deaminase (ADA), adhesion G protein- coupled receptor E5 (ADGRE5), caveolin 1 (CAV1), CD58 molecule (CD58), CD74 molecule (CD74), CD83 molecule (CD83), C-X-C motif chemokine ligand 8 (CXCL8), C-X- C motif chemokine ligand 16 (CXCL16), intracellular adhesion molecule 3 (ICAM3), interleukin 6 (IL6), interleukin 10 (IL10), interleukin 15 (IL15), interleukin 18 (IL18), KIT ligand (KITLG), tumor necrosis factor superfamily member 14 (T FSF14), or a combination thereof.
  • ADA adenosine deaminase
  • ADGRE5 adhesion G protein- coupled receptor E5
  • CAV1 caveolin 1
  • CD58 CD58
  • the composition further comprises granulocyte-macrophage colony-stimulating factor (GM-CSF).
  • GM-CSF granulocyte-macrophage colony-stimulating factor
  • the GM-CSF is encoded by a recombinant polynucleotide and expressed by a modified cell.
  • the GM- CSF is expressed by the same modified cell that comprises the recombinant polynucleotide encoding an allele of a human leukocyte antigen (HLA) class I and/or class II gene.
  • HLA human leukocyte antigen
  • the GM-CSF is not expressed by the same modified cell that comprises the recombinant polynucleotide encoding an allele of a human leukocyte antigen (HLA) class I and/or class II gene. In other embodiments, the GM-CSF is present in a soluble form.
  • the composition further comprises interferon alpha (IFNa).
  • IFNa interferon alpha
  • the IFNa is expressed by the same modified cell that comprises the recombinant polynucleotide encoding an allele of a human leukocyte antigen (ULA) class I and/or class II gene. In other embodiments, the IFNa is present in a soluble form.
  • the human cancer cell is a human cancer cell line.
  • the human cancer cell line is an SV-BR-1 breast cancer cell line.
  • the invention provides a pharmaceutical composition comprising a composition of the present invention and a pharmaceutically acceptable carrier.
  • the invention provides a method for treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of the pharmaceutical composition of the present invention.
  • the method further comprises treating the subject with a therapy selected from the group consisting of chemotherapy, immunotherapy, radiotherapy, hormone therapy, a differentiating agent, a small-molecule drug, and a combination thereof.
  • the immunotherapy comprises an agent selected from the group consisting of an immune checkpoint inhibitor, a monoclonal antibody, a small-molecule drug, and a combination thereof.
  • the chemotherapy comprises an agent selected from the group consisting of an alkylating agent, an antimetabolite, an anti-tumor antibiotic, a topoisomerase inhibitor, a mitotic inhibitor, a corticosteroid, and a combination thereof.
  • the method further comprises selecting a whole-cell cancer vaccine for the subject according to a method of the present invention.
  • the subject has stage I, stage II, stage III, or stage IV cancer.
  • the cancer is selected from the group consisting of breast cancer, ovarian cancer, cervical cancer, prostate cancer, pancreatic cancer, colorectal cancer, gastric cancer, lung cancer, skin cancer, liver cancer, brain cancer, eye cancer, soft tissue cancer, renal cancer, bladder cancer, head and neck cancer, mesothelioma, acute leukemia, chronic leukemia, medulloblastoma, multiple myeloma, sarcoma, and a combination thereof.
  • the pharmaceutical composition is administered by injection.
  • the injection is an intradermal and/or intralymphatic injection.
  • treating the subject produces a decrease in tumor volume.
  • treating the subject ameliorates or eliminates one or more signs or symptoms of cancer.
  • treating the subject results in an increase in the activity and/or number of one or more immune cells.
  • the one or more immune cells in which the level of activity and/or number is increased are selected from the group consisting of a peripheral blood mononuclear cell (PBMC), a lymphocyte, a monocyte, a natural killer (NK) cell, a dendritic cell, a macrophage, a myeloid-derived suppressor cell (MDSC), and a combination thereof.
  • PBMC peripheral blood mononuclear cell
  • NK natural killer
  • MDSC myeloid-derived suppressor cell
  • the one or more immune cells in which the level of activity and/or number is increased are selected from the group consisting of a PBMC, a lymphocyte, a dendritic cell, and a combination thereof.
  • the level of activity and/or number of the one or more immune cells is measured using a method selected from the group consisting of an ELISA, an ELISPOT assay, a Western blot, a cytotoxic T lymphocyte (CTL) activity assay, a cytotoxicity assay, a proliferation assay, a cytokine production assay, an MHC multimer assay, a flow cytometry assay, and a combination thereof.
  • CTL cytotoxic T lymphocyte
  • the level of activity and/or number of the one or more immune cells is measured following stimulation with an antigen.
  • an increase in immune cell activity and/or number indicates that the subject should be administered one or more additional doses of the pharmaceutical composition. In other embodiments, treating the subject results in an increased survival time.
  • the present invention provides a kit for treating a subject with cancer comprising a pharmaceutical composition of the present invention.
  • the kit further comprises instructions for use.
  • the kit further comprises one or more reagents.
  • the one or more reagents are for isolating a sample from the subject having cancer, detecting the presence or absence of one or more alleles of one or more human leukocyte antigen (HLA) genes, detecting the presence or level of one or more biomarkers, and/or measuring the activity and/or number of one or more immune cells.
  • HLA human leukocyte antigen
  • the invention provides a method for determining the HER2 status of a cell, the method comprising:
  • step (b) comparing the presence or level of the one or more biomarkers detected in step (a) to the presence or level of the one or more biomarkers in a reference cell;
  • step (c) determining the HER2 status of the sample cell based upon the comparison performed in step (b).
  • the sample cell is a cancer cell or is a cell obtained from a subject who has cancer. In other embodiments, the sample cell is determined to be HER2 positive when the one or more biomarkers is expressed at a higher level in the sample cell compared to the reference cell. In some instances, the reference cell is a non-cancer cell obtained from the same subject as the sample cell or is a non-cancer cell obtained from a different subject or population of subjects.
  • the level of the one or more biomarkers is higher in a HER2 3+ cell than in a HER2 2+ cell. In other embodiments, the level of the one or more biomarkers is higher in a HER2 2+ cell than in a HER2 1+ or a HER2 0 cell. In some other embodiments, detecting the presence or level of the one or more biomarkers comprises measuring mRNA expression, protein abundance, or a combination thereof.
  • the determination is made with a sensitivity of at least about 60%. In some instances, the determination is made with a sensitivity of at least about 87%. In other instances, the determination is made with a sensitivity of at least about 100%. In other embodiments, the steps of (a), (b), and/or (c) are automated.
  • FIGS. 1A-1D show the development of SV-BR-l-GM.
  • FIG. 1A shows a schematic depicting development of the SV-BR-l-GM (BriaVax) cell line.
  • the SV-BR-l-GM cell line was derived from SV-BR-1 breast cancer cells following stable transfection with CSF2 (which encodes human GM-CSF).
  • CSF2 which encodes human GM-CSF
  • the SV-BR-1 cell line itself was established from a chest lesion of a metastatic breast cancer patient (16,17).
  • An SV-BR-l-GM master cell bank (MCB) was previously generated, and several "clinical product" (CP) lots were manufactured therefrom for actual or potential clinical use. Additionally, MCB -independent research (RES) banks were generated.
  • CP "clinical product"
  • RES MCB -independent research
  • FIG. IB shows morphologies of SV- BR-l-GM cells after serum starvation, as exemplified by 40X and 100X magnifications of cultured SV-BR-l-GM Lot 11 cells.
  • SV-BR-l-GM cells grow in monolayers but can also loosely attach or form aggregates following low-density seeding.
  • FIGS. 1C and ID depict quality control (QC) measures.
  • FIG. 1C shows hierarchical clustering of SV-BR-l- GM samples based on their microarray expression profiles. Normalized gene expression levels of samples belonging to the same sample type were averaged (i.e., the arithmetic mean was computed) prior to clustering.
  • FIG. ID shows that only samples with a RIN e value of at least 7.5 were used for this study. Notably, the CP Lot V cryo sample clustered separately. Additionally, the CP Lot V cryo sample did not pass the minimal variability QC metric (see, section titled "Methods" of Example 1) and was thus excluded from additional analyses.
  • FIGS. 2A-2C show hierarchical clustering.
  • MCF7, MDA-MB-231, and MDA-MB- 468 are human breast cancer cell lines.
  • MCF10A is a "normal" human epithelial cell line.
  • HMEC denotes human mammary epithelial cells.
  • Data sets other than of SV-BR-l-GM were obtained from GEO (NCBI) and are as follows: noncultured breast cells from GSE35399 (Shehata et al, Breast Cancer Res. 2012; 14(5):R134), HMECs from GSE56718 (Lowe et al, Genome Biol.
  • FIG. 2A shows hierarchical clustering of both samples and genes (i.e., probes) with minimum expression values among all samples greater than 1.5 times the background cutoff value.
  • the SV-BR-l-GM samples clustered separately from the MDA- MB-231, MDA-MB-468, MCF7, and MCF10A samples.
  • 2B shows hierarchical clustering of both samples and genes (i.e., probes) with maximum expression values among the different sample groups (i.e., SV-BR-l-GM, MDA-MB-231, MDA-MB-468, MCF7, MCF10A , ALDH NEG, ALDH POS, ERBB3 NEG, NCL, BASAL, STROMAL, HMEC early proliferating, HMEC deep senescence) greater than 1.5 times the background cutoff value.
  • Sample groups i.e., SV-BR-l-GM, MDA-MB-231, MDA-MB-468, MCF7, MCF10A , ALDH NEG, ALDH POS, ERBB3 NEG, NCL, BASAL, STROMAL, HMEC early proliferating, HMEC deep senescence
  • FIG. 2C shows the ERBB2 cluster.
  • FIG. 3 depicts the expression of immune stimulators in SV-BR-l-GM cells.
  • I l l genes with known immune-stimulatory roles were identified in published reports (29-70) (Table 2) and their microarray-based mRNA expression levels were determined.
  • the 22 genes shown in this plot presented with transcript levels greater than 1.5 times the background cutoff value in each of the SV-BR-l-GM samples.
  • the term "Relative Expression Values" refers to quantile-normalized mRNA levels.
  • FIGS. 4A-4C depict HLA class II components in SV-BR-l-GM cells.
  • SV-BR-l- GM cells expressed components that were predictive for functional HLA-DR complex formation.
  • the term "Relative Expression Values" refers to quantile-normalized mRNA levels obtained via microarray hybridization.
  • FIG. 4A depicts the expression of HLA-DRA, which encodes an HLA-DR alpha chain.
  • FIG. 4B depicts the expression of HLA-DMA and HLA-DMB, which encode components of HLA-DM, a non-classical MHC II which chaperones peptide-free MHC II against inactivation and catalysis of the exchange of the CLIP peptide with peptides from endocytosed or endogenous antigens (71).
  • FIG. 4C depicts the expression of CD74, which encodes the invariant chain and CLIP.
  • FIGS. 5A-5C depict validation of HLA class II gene expression by quantitative RT- PCR.
  • a confirmatory experiment was conducted on a subset of the SV-BR-l-GM samples (Table 4) used for Illumina ® microarray analysis and with RNA from MCF7 cells (i.e., breast cancer cell line carrying the HLA-DRB3*0202 allele (72)) as a calibrator sample.
  • MCF7 cells i.e., breast cancer cell line carrying the HLA-DRB3*0202 allele (72)
  • the MHC II- related transcripts analyzed were not expressed only in SV-BR-l-GM cells, but were expressed at substantially higher levels than in MCF7 cells.
  • FIG. 5A depicts the expression of HLA-DRA and HLA-DRB.
  • FIG. 5B depicts the expression of HLA-DMA and HLA-DMB.
  • FIG. 5C depicts the expression of CD74.
  • FIGS. 6A-6G show that SV-BR-l-GM expressed both "classical” HLA-Ia and “nonclassical” ULA-Ib components.
  • “Relative Expression Levels” refers to quantile- normalized mRNA levels obtained via microarray hybridization.
  • FIG. 6A shows expression of B2M, encoding b2-microglobulin.
  • FIG. 6B shows expression of HLA-A.
  • FIG. 6C shows expression of HLA-B.
  • FIG. 6D shows expression of HLA-E.
  • FIG. 6E shows expression of HLA-F.
  • FIG. 6F shows expression of HLA-G.
  • FIG. 6G shows expression of HLA-H.
  • FIGS. 7A and 7B depict GM-CSF secretion by SV-BR-l-GM cells.
  • FIG. 7A shows data for CP Lot IV 4p.
  • FIG. 7B shows data for CP Lot VIII.
  • FIG. 8 shows HLA-DRB3 expression in a tumor specimen of a strong clinical responder.
  • subject A002 in Example 1 presented with tumor expression of HLA-DRB 3
  • paraffin-embedded A002 tumor material was stained with a rabbit polyclonal antibody raised against an N- terminal region of human HLA-DRB3.
  • HLA-DRB 3 immunoreactivity was apparent.
  • FIGS. 9A-9E depict cancer/testis antigen (CTA) expression in SV-BR-l-GM cells.
  • FIG. 9A depicts RNA expression levels of 279 confirmed or putative CTAs (Table 7) in SV- BR-l-GM cells, several other established breast cancer cell lines, and several normal human breast cell types.
  • FIG. 9B depicts transcript levels of PRAME.
  • FIG. 9C depicts transcript levels of KIF2C.
  • FIG. 9D depicts transcript levels of CEP55.
  • FIG. 9E depicts transcript levels ⁇ .
  • FIGS. 1 OA- IOC depict in silico screening results for immunogen candidates.
  • SV- BR-l-GM RNA samples were hybridized onto Illumina ® HumanHT-12 v4 Expression BeadChip arrays.
  • SV-BR-l-GM expression data were compared to those of normal human breast cells provided in the Gene Expression Omnibus (GEO, NCBI) database as datasets GSE35399 (81), GSE56718 (80) and GSE48398 (MCF10A only).
  • GSE35399 81
  • GSE56718 80
  • GSE48398 MCF10A only
  • Such genes represented candidate immunogens for mediating SV-BR-l-GM's anti-cancer effect.
  • first (i.e., low-stringency) filter was applied, 455 different genes were retained, of which 352 remained after the second (i.e., medium-stringency) filter was applied.
  • the latter genes were in silico validated on GEO datasets GSE29431 (i.e., breast cancer tissues) and GSE7307 (i.e., nonmalignant tissues representing various organs; see, Table 11).
  • GSE29431 i.e., breast cancer tissues
  • GSE7307 i.e., nonmalignant tissues representing various organs; see, Table 11.
  • FIG. 10A depicts expression of ERBB2 (HER2lneu, Illumina ® probe 216836_s_at).
  • FIG. 10B depicts expression ⁇ (Illumina ® probe 224447_s_at).
  • FIG. IOC depicts expression ⁇ 3 (Illumina ® probe 55616_at).
  • FIGS. 11 A-l 1C depicts mechanisms of action for SV-BR-l-GM.
  • FIG. 11 A depicts immune modulators expressed in BriaVax (SV-BR-l-GM). Shown are a subset of the factors having immune modulating roles expressed in SV-BR-l-GM. Additional factors are listed in Table 5.
  • FIG. 11B depicts cross-dressing (trogocytosis) of DCs with SV-BR-l-GM peptide- MHCs. In this mechanism, allogeneic SV-BR-l-GM cell surface MHCs loaded with SV-BR- l-GM antigens are directly transferred onto the cell surface of patient DCs by trogocytosis.
  • FIG. l lC depicts cross-presentation.
  • SV-BR-l-GM cells are degraded (i.e., by apoptosis and other mechanisms), then fragments of degraded cells are taken up by dendritic cells (DCs) from the patient.
  • DCs dendritic cells
  • SV-BR-l-GM antigens are proteolytically degraded and presented on cell surface MHCs to patient T cells.
  • FIG. 12 depicts a mechanism of action of the BriaVax (SV-BR-l-GM) cancer vaccine.
  • Factors expressed in SV-BR-l-GM cells (FIG. 11 A) and some of their known roles as immune modulators are shown.
  • Expression of HLA class I and II genes is consistent with a model in which the SV-BR-l-GM vaccine directly stimulates cytotoxic T lymphocytes (CD8+) and T helper cells (CD4+), and thereby induces both cytotoxic and humoral responses. Since SV-BR-l-GM cells do not express CD80 or CD86 mRNA, they unlikely act directly as antigen-presenting cells activating naive T cells.
  • DCs displaying SV- BR-l-GM TAA peptides on MHCs obtained from SV-BR-l-GM cells ⁇ i.e., via cross-dressing (FIG. 11B) and/or on some of their own MHCs via cross-presentation (FIG. HC)), may activate such naive T cells.
  • SV-BR-l-GM TAA-specific T cells recognize and kill tumor cells that co-express and present the corresponding TAAs. Additionally, tumor destruction can occur via antibodies.
  • CTL denotes cytotoxic T lymphocyte; T H denotes T helper cell.
  • FIG. 13 depicts an overview of the filtration strategy to identify candidate TAAs.
  • Gene expression profiles of SV-BR-l-GM cells were compared to those of normal breast cells (i.e., a subset of samples represented by GSE35399, GSE56718, GSE48398). 455 genes (NCBI Gene Symbols) were retained after applying a low-stringency filter; 352 of them were also retained after applying a medium-stringency filter. These 352 genes were then subjected to an in silico validation step aimed at identifying genes that are overexpressed both in SV- BR-l-GM cells and breast cancer tissue but lack expression in non-malignant tissues of various organs.
  • FIG. 14 depicts low- and medium-stringency filtration.
  • SV-BR-l-GM referred to as BriaVax.
  • the present invention is based, in part, on the discovery that SV-BR-l-GM cells not only express tumor-associated antigens (TAAs), but also a set of biomarkers including HLA class I and II alleles known for their immune-stimulatory roles in antigen- presenting cells (APCs).
  • TAAs tumor-associated antigens
  • APCs immune-stimulatory roles in antigen- presenting cells
  • the present invention is also based, in part, on the discovery that human leukocyte antigen (HLA) allele matches between SV-BR-l-GM and the special clinical responder enabled patient T lymphocytes to directly recognize TAAs as presented by the vaccine's MHC system. Furthermore, the present invention is based, in part, on the discovery of biomarkers than enable superior identification and discrimination of HER2 positive cells.
  • HLA human leukocyte antigen
  • the terms "about” and “approximately” shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Typical, exemplary degrees of error are within 20 percent (%), preferably within 10%, and more preferably within 5% of a given value or range of values. Alternatively, and particularly in biological systems, the terms “about” and “approximately” may mean values that are within an order of magnitude, preferably within 5-fold and more preferably within 2- fold of a given value. Numerical quantities given herein are approximate unless stated otherwise, meaning that the term “about” or “approximately” can be inferred when not expressly stated.
  • subject means a vertebrate, preferably a mammal, more preferably a human.
  • Mammals include, but are not limited to, murines, rats, simians, humans, farm animals, sport animals, and pets.
  • Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
  • administering includes oral administration, topical contact, administration as a suppository, intravenous, intraperitoneal, intramuscular, intralesional, intratumoral, intradermal, intralymphatic, intrathecal, intranasal, or subcutaneous administration to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, e.g., intravenous, intramuscular, intra- arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc.
  • treating refers to an approach for obtaining beneficial or desired results including, but not limited to, a therapeutic benefit and/or a prophylactic benefit.
  • therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment.
  • Therapeutic benefit can also mean to effect a cure of one or more diseases, conditions, or symptoms under treatment.
  • the term "effective amount” or “sufficient amount” refers to the amount of a modified cancer cell or other composition that is sufficient to effect beneficial or desired results.
  • the therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art.
  • the specific amount may vary depending on one or more of: the particular agent chosen, the target cell type, the location of the target cell in the subject, the dosing regimen to be followed, whether it is administered in combination with other compounds, timing of administration, and the physical delivery system in which it is carried.
  • an effective amount is determined by such considerations as may be known in the art.
  • the amount must be effective to achieve the desired therapeutic effect in a subject suffering from cancer.
  • the desired therapeutic effect may include, for example, amelioration of undesired symptoms associated with cancer, prevention of the manifestation of such symptoms before they occur, slowing down the progression of symptoms associated with cancer, slowing down or limiting any irreversible damage caused by cancer, lessening the severity of or curing a cancer, or improving the survival rate or providing more rapid recovery from a cancer.
  • the effective amount depends, inter alia, on the type and severity of the disease to be treated and the treatment regime.
  • the effective amount is typically determined in appropriately designed clinical trials (dose range studies) and the person versed in the art will know how to properly conduct such trials in order to determine the effective amount.
  • an effective amount depends on a variety of factors including the distribution profile of a therapeutic agent (e.g., a whole-cell cancer vaccine) or composition within the body, the relationship between a variety of pharmacological parameters (e.g., half- life in the body) and undesired side effects, and other factors such as age and gender, etc.
  • pharmaceutically acceptable carrier refers to a substance that aids the administration of an active agent to a cell, an organism, or a subject.
  • “Pharmaceutically acceptable carrier” refers to a carrier or excipient that can be included in the compositions of the invention and that causes no significant adverse toxicological effect on the subject.
  • Non- limiting examples of pharmaceutically acceptable carriers include water, NaCl, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors and colors, liposomes, dispersion media, microcapsules, cationic lipid carriers, isotonic and absorption delaying agents, and the like.
  • the carrier may also be substances for providing the formulation with stability, sterility and isotonicity (e.g. antimicrobial preservatives, antioxidants, chelating agents and buffers), for preventing the action of microorganisms (e.g. antimicrobial and antifungal agents, such as parabens, chlorobutanol, sorbic acid and the like) or for providing the formulation with an edible flavor etc.
  • the carrier is an agent that facilitates the delivery of a modified cancer cell to a target cell or tissue.
  • pharmaceutical carriers are useful in the present invention.
  • nucleic acid refers to a polymer containing at least two deoxyribonucleotides or ribonucleotides in either single- or double- stranded form and includes DNA, RNA, and hybrids thereof.
  • DNA may be in the form of, e.g., antisense molecules, plasmid DNA, DNA-DNA duplexes, pre-condensed DNA, PCR products, vectors (PI, PAC, BAC, YAC, artificial chromosomes), expression cassettes, chimeric sequences, chromosomal DNA, or derivatives and combinations of these groups.
  • RNA may be in the form of small interfering RNA (siRNA), Dicer-substrate dsRNA, small hairpin RNA (shRNA), asymmetrical interfering RNA (aiRNA), microRNA (miRNA), mRNA, tRNA, rRNA, tRNA, viral RNA (vRNA), and combinations thereof.
  • Nucleic acids include nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, and which have similar binding properties as the reference nucleic acid.
  • analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2'-0-methyl ribonucleotides, and peptide-nucleic acids (PNAs).
  • PNAs peptide-nucleic acids
  • the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid.
  • a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, S Ps, and complementary sequences as well as the sequence explicitly indicated.
  • degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed- base and/or deoxyinosine residues (Batzer et al, Nucleic Acid Res., 19:5081 (1991); Ohtsuka et al, J. Biol. Chem., 260:2605-2608 (1985); Rossolini et al, Mol. Cell. Probes, 8:91-98 (1994)).
  • "Nucleotides” contain a sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked together through the phosphate groups.
  • Bases include purines and pyrimidines, which further include natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs, and synthetic derivatives of purines and pyrimidines, which include, but are not limited to, modifications which place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates, and alkylhalides.
  • the term "gene” means the segment of DNA involved in producing a polypeptide chain.
  • the DNA segment may include regions preceding and following the coding region (leader and trailer) involved in the transcription/translation of the gene product and the regulation of the transcription/translation, as well as intervening sequences (introns) between individual coding segments (exons).
  • vector and "expression vector” refer to a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular polynucleotide sequence in a host cell.
  • An expression vector may be part of a plasmid, viral genome, or nucleic acid fragment.
  • an expression vector includes a polynucleotide to be transcribed, operably linked to a promoter.
  • promoter is used herein to refer to an array of nucleic acid control sequences that direct transcription of a nucleic acid.
  • a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element.
  • a promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription.
  • Other elements that may be present in an expression vector include those that enhance transcription (e.g., enhancers) and terminate transcription (e.g., terminators).
  • Recombinant refers to a genetically modified polynucleotide, polypeptide, cell, tissue, or organism.
  • a recombinant polynucleotide or a copy or complement of a recombinant polynucleotide is one that has been manipulated using well known methods.
  • a recombinant expression cassette comprising a promoter operably linked to a second polynucleotide can include a promoter that is heterologous to the second polynucleotide as the result of human manipulation (e.g., by methods described in Sambrook et al, Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, (1989) or Current Protocols in Molecular Biology Volumes 1-3, John Wiley & Sons, Inc. (1994-1998)).
  • a recombinant expression cassette (or expression vector) typically comprises polynucleotides in combinations that are not found in nature.
  • human manipulated restriction sites or plasmid vector sequences can flank or separate the promoter from other sequences.
  • a recombinant protein is one that is expressed from a recombinant polynucleotide, and recombinant cells, tissues, and organisms are those that comprise recombinant sequences (polynucleotide and/or polypeptide).
  • a recombinant cell is one that has been modified (e.g., transfected or transformed), with a recombinant nucleotide, expression vector or cassette, or the like.
  • cancer is intended to include any member of a class of diseases characterized by the uncontrolled growth of aberrant cel ls.
  • the term includes all known cancers and neoplastic conditions, whether characterized as malignant, benign, recurrent, soft tissue, or solid, and cancers of all stages and grades including advanced, pre- and post- metastatic cancers.
  • cancers examples include, but are not limited to, gynecological cancers (e.g., ovarian, cervical, uterine, vaginal, and vulvar cancers); lung cancers (e.g., non-small cell lung cancer, small cell lung cancer, mesothelioma, carcinoid tumors, lung adenocarcinoma); breast cancers (e.g., triple-negative breast cancer, ductal carcinoma, in situ, invasive ductal carcinoma, tubular carcinoma, medullary carcinoma, mucinous carcinoma, papillary carcinoma, cribriform carcinoma, invasive lobular carcinoma, inflammatory breast cancer, lobular carcinoma in situ, Paget' s disease, Phyliodes tumors); digestive and gastrointestinal cancers such as gastric cancer (e.g., stomach cancer), colorectal cancer, gastrointestinal stromal tumors (GIST), gastrointestinal carcinoid tumors, colon cancer, rectal cancer, anal cancer, bile duct cancer, small alan
  • stage refers to a classification of the extent of cancer. Factors that are considered when staging a cancer include but are not limited to tumor size, tumor invasion of nearby tissues, and whether the tumor has metastasized to other sites. The specific criteria and parameters for differentiating one stage from another can vary depending on the type of cancer. Cancer staging is used, for example, to assist in determining a prognosis and/or identifying the most appropriate treatment option(s).
  • T M cancer staging system
  • T refers to the size and extent of the main tumor
  • N refers to the number of nearby lymph nodes to which the cancer has spread
  • M refers to whether the cancer has metastasized.
  • TX denotes that the main tumor cannot be measured
  • TO denotes that the main tumor cannot be found
  • Tl denotes that the main tumor cannot be found
  • Tl denotes the size and/or extent of the main tumor, wherein a larger number corresponds to a larger tumor and/or a tumor that has grown into nearby tissues.
  • NX denotes that cancer in nearby lymph nodes cannot be measured
  • NO denotes that there is no cancer in nearby lymph nodes
  • Nl denotes the number and location of lymph nodes to which the cancer has spread, wherein a larger number corresponds to a greater number of lymph nodes containing the cancer.
  • MX denotes that metastasis cannot be measured
  • M0 denotes that no metastasis has occurred
  • Ml denotes that the cancer has metastasized to other parts of the body.
  • cancers are classified or graded as having one of five stages: "Stage 0," “Stage I,” “Stage II,” “Stage III,” and “Stage IV.”
  • Stage 0 denotes that abnormal cells are present, but have not spread to nearby tissue. This is also commonly called carcinoma in situ (CIS).
  • CIS carcinoma in situ
  • Stages I, II, and III denote that cancer is present. Higher numbers correspond to larger tumor sizes and/or tumors that have spread to nearby tissues.
  • Stage IV denotes that the cancer has metastasized.
  • biopsy refers to the process of removing a tissue sample for diagnostic or prognostic evaluation, and to the tissue specimen itself. Any biopsy technique known in the art can be applied to the methods and compositions of the present invention. The biopsy technique applied will generally depend on the tissue type to be evaluated and the size and type of the tumor ⁇ i.e., solid or suspended ⁇ i.e., blood, thoracentesis aspirate, or ascites)), among other factors. Representative biopsy techniques include excisional biopsy, incisional biopsy, needle biopsy ⁇ e.g., core needle biopsy, fine-needle aspiration biopsy, etc.), surgical biopsy, and bone marrow biopsy.
  • Biopsy techniques are discussed, for example, in Harrison 's Principles of Internal Medicine, Kasper, et al., eds., 16th ed., 2005, Chapter 70, and throughout Part V.
  • biopsy techniques can be performed to identify cancerous and/or precancerous cells in a given tissue sample.
  • allele refers to a particular form or variant of a gene, typically arising through a mutation event. Alleles can result from, for example, nucleotide substitutions, additions, or deletions, or can represent a variable number of short nucleotide repeats.
  • HLA human leukocyte antigen
  • HLA alleles are named by the World Health Organization Naming Committee for Factors of the HLA system. Under this system, an HLA gene name is followed by a series of numerical fields. At a minimum, two numerical fields are included.
  • HLA-A*02: 101 denotes a specific allele of the HLA-A gene.
  • the first field denotes an allele group.
  • the second field separated from the first field by a colon, denotes the specific HLA protein that is produced.
  • a longer name is used ⁇ e.g., HLA-A*02: 101 :01 :02N).
  • the third numerical field denotes whether a synonymous DNA substitution is present within the coding region, and the fourth numerical field denotes differences between alleles that exist in the non-coding region.
  • an HLA allele name is contains a letter at the end.
  • N denotes that the allele is a null allele ⁇ i.e., the allele produces a non-functional protein
  • L denotes that the allele results in lower than normal cell surface expression of the particular HLA protein
  • S denotes that the allele produces a soluble protein not found on the cell surface
  • Q denotes a questionable allele ⁇ i.e., an allele that nay not affect normal expression
  • C denotes that the allele produces a protein that is present in cell cytoplasm but is not present at the cell surface
  • A denotes an allele that results in aberrant expression (i.e., it is uncertain whether the particular HLA protein is expressed).
  • allele profile refers to a collection of alleles of one or more genes in a particular sample.
  • the sample may be obtained from a subject, a particular cell or cell type (e.g., a breast cell or breast cancer cell), or from an engineered cell (e.g., a cancer cell that has been engineered to express one or more proteins).
  • an allele profile describes the alleles of a single gene that are present in a sample (e.g., in a cell obtained from a subject or a cancer vaccine cell), or may describe the alleles that are present for two or more genes in a sample.
  • an allele profile may list the alleles that are present for the HLA-A gene in a particular sample. For a diploid cell, only one allele may be present (e.g., if both chromosomes contain the same allele, such as HLA-A*02:01). Alternatively, two different alleles may be present (e.g., the allele profile contains HLA- A*02:01 and HLA-A*24:02, or HLA-A*02:01 and HLA-A*03 :01). In other instances, the allele profile enumerates the alleles that are present for two or more genes. As a non-limiting example, an allele profile may describe the alleles of the HLA-A and HLA-DRB3 genes that are present in a patient sample.
  • an allele profile of a subject may indicate that the HLA-A*02:01 and HLA-A*24:02 alleles of the HLA-A gene are present, and that the HLA- DRB3*03 :01 allele of the HLA-DRB3 gene is present.
  • allele profiles can be compared.
  • a subject can have an allele profile containing the HLA-A*02:01 and HLA-A*24:02 alleles
  • a cancer vaccine cell can have a profile containing the HLA-A*02:01 and HLA-A*03 :01 alleles.
  • the two allele profiles are compared, then there is a partial match between the profiles (i.e., the HLA- A*02:01 allele is present in both profiles).
  • the vaccine cell has an allele profile containing HLA-A*02:01 and HLA-A*24:02, then the subject and vaccine cell profiles are a complete match with respect to this particular gene.
  • HLA human leukocyte antigen
  • MHC human major histocompatibility complex
  • HLA-A, HLA-B, and HLA-C genes are more polymorphic, while HLA-E, HLA-F, and HLA-G genes are less polymorphic.
  • HLA-K and HLA-L are also known to exist as pseudogenes.
  • beta-2-microglobulin is an MHC class I protein, encoded by the ⁇ B2M) gene.
  • HLA-A nucleotide sequences are set forth under GenBank reference numbers NM_001242758 and NM_002116.
  • a non-limiting example of an HLA-B nucleotide sequence is set forth under GenBank reference number NM_005514.
  • Non-limiting examples of HLA-C nucleotide sequences are set forth under GenBank reference numbers NM_001243042 and NM_002117.
  • a non- limiting example of an HLA-E nucleotide sequence is set forth under GenBank reference number NM 005516.
  • a non-limiting example of an HLA-F nucleotide sequence is set forth under GenBank reference number NM O 18950.
  • a non-limiting example of an HLA-G nucleotide sequence is set forth under GenBank reference number NM 002127.
  • a non- limiting example of a B2M nucleotide sequence is set forth under GenBank reference number NM_004048.
  • Class II MHC proteins which present antigens from the outside of the cell to T lymphocytes, are encoded by the HLA-DP, HLA-DM, HLA-DO, HLA-DQ, and HLA-DR genes.
  • HLA-DM genes include HLA-DMA and HLA-DMB.
  • HLA-DO genes include HLA- DO A and HLA-DOB.
  • HLA-DP genes include HLA-DP Al and HLA-DPB1.
  • HLA-DQ genes include HLA-DQA1, HLA-DQA2, HLA-DQB1, and HLA-DQB2.
  • HLA-DR genes include HLA-DRA, HLA-DRBl, HLA-DRB3, HLA-DRB4, and HLA-DRB5.
  • Non-limiting examples of HLA-DMA and HLA-DMB nucleotide sequences are set forth under GenBank reference numbers NM_006120 and NM_002118, respectively.
  • Non-limiting examples of HLA-DRA, HLA-DRBl, HLA-DRB3, HLA-DRB4, and HLA-DRB5 nucleotide sequences are set forth in GenBank reference numbers NM_01911, NM_002124, NM_022555, NM_021983, NM_002125, respectively.
  • vaccine refers to a biological composition that, when administered to a subject, has the ability to produce an acquired immunity to a particular pathogen or disease in the subject.
  • one or more antigens, or fragments of antigens, that are associated with the pathogen or disease of interest are administered to the subject.
  • Vaccines can comprise, for example, inactivated or attenuated organisms ⁇ e.g., bacteria or viruses), cells, proteins that are expressed from or on cells ⁇ e.g., cell surface proteins), proteins that are produced by organisms ⁇ e.g., toxins), or portions of organisms ⁇ e.g., viral envelope proteins.
  • cells are engineered to express proteins such that, when administered as a vaccine, they enhance the ability of a subject to acquire immunity to that particular cell type (e.g., enhance the ability of a subject to acquire immunity to a cancer cell).
  • vaccine or “whole-cell cancer vaccine” includes but is not limited to modified cancer cell(s) of the present invention.
  • GM-CSF granulocyte macrophage colony-stimulating factor
  • CSF2 colony stimulating factor
  • GM-CSF functions as a cytokine that affects a number of cell types, in particular macrophages and eosinophils.
  • GM- CSF stimulates stem cells to produce granulocytes (i.e., neutrophils, eosinophils, and basophils) and monocytes.
  • the monocytes subsequently mature into macrophages and dendritic cells after tissue infiltration.
  • a non-limiting example of a CSF2 nucleotide sequence (the gene that encodes GM-CSF) in humans is set forth under GenBank reference number M_000758.
  • interferon alpha refers to a group of proteins that are part of a larger class of proteins known as interferons, which are signaling proteins that are synthesized and released by host cells in response to a pathogen (e.g., viruses, bacteria, parasites, tumor cells). Interferon alpha proteins are produced by leukocytes and are mainly involved in the innate immune response. Type I interferon proteins include IFN-a, IFN- ⁇ , IFN- ⁇ , IFN-K, IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IFN-co, and IFN-v.
  • IFN-a proteins include IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNAIO, IFNA 13, IFNA 14, IFNA16, IFNA17, and IFNA21.
  • Non-limiting examples of IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA 7, IFNA8, IFNAIO, IFNA 13, IFNA 14, IFNA16, IFNA17, and IFNA21 human nucleotide sequences are set forth in Gene Bank reference numbers NM 024013, NM_000605, NM_021068, NM_002169, NM_021002, NM_021057, NM_002170, NM 002171, NM_006900, NM_002172, NM_002173, NM_021268, and NM_002175, respectively.
  • the term "survival” refers to a length of time following the diagnosis of a disease and/or beginning or completing a particular course of therapy for a disease (e.g., cancer).
  • the term “overall survival” includes the clinical endpoint describing patients who are alive for a defined period of time after being diagnosed with or treated for a disease, such as cancer.
  • the term “disease-free survival” includes the length of time after treatment for a specific disease (e.g., cancer) during which a patient survives with no sign of the disease (e.g., without known recurrence).
  • disease-free survival is a clinical parameter used to evaluate the efficacy of a particular therapy, which is usually measured in units of 1 or 5 years.
  • progression-free survival includes the length of time during and after treatment for a specific disease (e.g., cancer) in which a patient is living with the disease without additional symptoms of the disease. In some embodiments, survival is expressed as a median or mean value.
  • HER2 refers to a member of the human epidermal growth factor receptor (HER/EGFR/ERBB) family. Amplification or overexpression of this biomarker plays a significant role in the development and progression of certain aggressive types of cancer, including breast cancer. As such, HER2 has become an important biomarker and therapeutic target for at least about 30% of breast cancer patients.
  • Non-limiting examples of HER2 nucleotide sequences are set forth in GenBank reference numbers NP 001005862, NP_001289936, NP_001289937, NP_001289938, and NP_004448.
  • Non-limiting examples of HER2 peptide sequences are set forth in GenBank reference numbers NP 001005862, NP_001276865, NP_001276866, NP_001276867, and NP_004439.
  • HER2 testing methods include immunohistochemistry (IHC), fluorescence in situ hybridization (FISH), ELISAs, and RNA quantification (e.g., of HER2 expression) methods such as RT-PCR and microarray analysis.
  • IHC immunohistochemistry
  • FISH fluorescence in situ hybridization
  • ELISAs ELISAs
  • RNA quantification e.g., of HER2 expression
  • RT-PCR e.g., RT-PCR and microarray analysis.
  • HER2 positive When HER2 is amplified or overexpressed in a cell, the cell is referred to as being "HER2 positive"
  • the level of HER2 amplification or overexpression in HER2 positive cells is commonly expressed as a score ranging from 0 to 3 (i.e., HER2 0, HER2 1+, HER2 2+, or HER2 3+), with higher scores corresponding to greater degrees of expression.
  • the present invention provides a modified human cancer cell comprising a recombinant polynucleotide that encodes one more alleles of a human leukocyte antigen (HLA) gene.
  • HLA human leukocyte antigen
  • the recombinant polynucleotide encodes one or more alleles of an HLA class I gene.
  • the recombinant polynucleotide encodes one or more alleles of an HLA class II gene.
  • the recombinant polynucleotide encodes one or more alleles of an HLA class I gene and one or more alleles of an HLA class II gene.
  • the recombinant polynucleotide is integrated into the genome of the cell. In other embodiments, the recombinant polynucleotide is present on a vector in the cell. In embodiments where more than one recombinant polynucleotide is present, all of the recombinant polynucleotides can be present on the same vector, or each recombinant polynucleotide can be present on a separate vector. Any number of combinations are permitted.
  • all of the recombinant polynucleotides encoding HLA class I gene alleles can be present on one vector, and all of the recombinant polynucleotides encoding HLA class II gene alleles can be present on another vector.
  • all of the recombinant polynucleotides encoding HLA-A gene alleles can be present on one vector, and all of the recombinant polynucleotides encoding HLA-B gene alleles can be present on another vector.
  • the HLA class I gene is an HLA-A gene, an HLA-B gene, an HLA-C gene, an HLA-E gene, an HLA-F gene, an HLA-G gene, or a B2M gene.
  • the HLA class I gene is a combination of an HLA-A gene, an HLA-B gene, an HLA-C gene, an HLA-E gene, an HLA-F gene, an HLA-G gene, and/or a B2M gene.
  • the modified cancer cell comprises recombinant polynucleotide(s) encoding alleles of one or more ⁇ e.g., 1, 2, 3, 4, 5, 6, or 7) HLA class I genes.
  • Modified human cancer cells of the present invention can comprise one or more ⁇ e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) recombinant polynucleotides encoding HLA-A alleles.
  • the one or more HLA-A alleles are each present at a median frequency of at least about 2% in a population. In other embodiments, the one or more HLA-A alleles are each present at a maximum frequency of at least about 5% in a population. In still other embodiments, the one or more HLA-A alleles are each present at a median frequency of at least about 2% and a maximum frequency of at least about 5% in a population.
  • HLA-B alleles include but are not limited to HLA-B* 13 :02, HLA-B*41 :01, HLA-B* 18:03, HLA-B*44:02, HLA-B*07:02, HLA-B*35:01, HLA- B*40:01, HLA-B*35:08, HLA-B*55:01, HLA-B*51 :01, HLA-B*44:03, HLA-B*58:01, HLA-B*08:01, HLA-B* 18:01, HLA-B* 15:01, and HLA-B*52:01.
  • Modified human cancer cells of the present invention can comprise one or more ⁇ e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more) recombinant polynucleotide(s) encoding HLA-B alleles.
  • the one or more HLA-B alleles are each present at a median frequency of at least about 2% in a population.
  • the one or more HLA-B alleles are each present at a maximum frequency of at least about 5% in a population.
  • the one or more HLA-B alleles are each present at a median frequency of at least about 2% and a maximum frequency of at least about 5% in a population.
  • HLA-C*04:01 HLA-C*07:02
  • HLA-C*07:01 HLA-C*06:02
  • HLA-C*03 :04 HLA-C*01 :02
  • HLA- C*02:02 HLA-C*08:02
  • HLA-C*03 :03 HLA-C*05:01
  • HLA-C*08:01 HLA-C* 16:01
  • Modified human cancer cells of the present invention can comprise one or more ⁇ e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more) recombinant polynucleotide(s) encoding HLA-C alleles.
  • the one or more HLA-C alleles are each present at a median frequency of at least about 2% in a population.
  • the one or more HLA-C alleles are each present at a maximum frequency of at least about 5% in a population.
  • the one or more HLA-C alleles are each present at a median frequency of at least about 2% and a maximum frequency of at least about 5% in a population.
  • the HLA class II gene is an HLA class II alpha subunit gene. In other embodiments, the HLA class II gene is an HLA class II beta subunit gene. In particular embodiments, the HLA class II gene is a combination of HLA class II alpha subunit and HLA class II beta subunit genes.
  • the HLA class II gene is an HLA-DP gene, an HLA-DM gene, an HLA-DO gene, an HLA-DQ gene, and/or an HLA-DR gene.
  • the HLA-DO gene is an HLA-DOA gene.
  • the HLA-DO gene is an HLA-DOB gene.
  • the modified cancer cell comprises recombinant nucleotides encoding both HLA-DOA and HLA-DOB gene alleles.
  • the HLA-DM gene is an HLA-DMA gene.
  • the HLA-DM gene is an HLA-DMB gene.
  • the modified cancer cell comprises recombinant nucleotides encoding both HLA-DMA and HLA-DMB gene alleles.
  • the HLA-DR gene is an HLA-DRA gene, an HLA-DRB1 gene, an HLA-DRB3 gene, an HLA-DRB4 gene, and/or an HLA-DRB5 gene.
  • the modified cancer cell comprises recombinant polynucleotides encoding alleles of one or more ⁇ e.g., 1, 2, 3, 4, 5, or more) HLA-DR gene(s).
  • HLA-DRB3 alleles include but are not limited to HLA- DRB3*02:02, HLA-DRB3*01 :01, and HLA-DRB3*03 :01.
  • Modified human cancer cells of the present invention can comprise one or more ⁇ e.g., 1, 2, 3, or more) recombinant polynucleotide(s) encoding HLA-DRB3 alleles.
  • the one or more HLA- DRB3 alleles are each present at a median frequency of at least about 2% in a population.
  • the one or more HLA-DRB3 alleles are each present at a maximum frequency of at least about 5% in a population.
  • the one or more HLA-DRB3 alleles are each present at a median frequency of at least about 2% and a maximum frequency of at least about 5% in a population.
  • the modified cancer cell comprises a recombinant polynucleotide encoding the HLA-DRB3*01 :01 allele. In some embodiments, the modified cancer cell comprises a recombinant polynucleotide encoding the HLA-DRB3*02:02 allele. In some embodiments, the modified cancer cell comprises a recombinant polynucleotide encoding the HLA-DRB3*03 :01 allele. In some embodiments, the modified cancer cell comprises a recombinant polynucleotide encoding the HLA-A*01 :01 allele.
  • the modified cancer cell comprises a recombinant polynucleotide encoding the HLA-A*02:01 allele. In some embodiments, the modified cancer cell comprises a recombinant polynucleotide encoding the HLA-A*03 :01 allele. In some embodiments, the modified cancer cell comprises a recombinant polynucleotide encoding the HLA-A*26:01 allele. In some embodiments, the modified cancer cell comprises a recombinant polynucleotide encoding the HLA-A*29:02 allele. In some embodiments, the modified cancer cell comprises a recombinant polynucleotide encoding the HLA-A*32:01 allele.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*01 :01 alleles. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*01 :01 alleles. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA- A*01 :01 alleles.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*02:01 alleles. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*02:01 alleles. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA- A*02:01 alleles.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*03 :01 alleles. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*03 :01 alleles. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA- A*03 :01 alleles.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*26:01 alleles. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*26:01 alleles. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA- A*26:01 alleles.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*29:02 alleles. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*29:02 alleles. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA- A*29:02 alleles.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*32:01 alleles. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*32:01 alleles. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA- A*32:01 alleles.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 allele and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the ULA- DRB3*02:02 allele and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 allele and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*01 :01 allele and GM-CSF.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*02:01 allele and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*03 :01 allele and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*26:01 allele and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*29:02 allele and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*32:01 allele and GM-CSF.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*01 :01 alleles and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*01 :01 alleles and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA-A*01 :01 alleles and GM-CSF.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*02:01 alleles and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*02:01 alleles and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA-A*02:01 alleles and GM-CSF.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*03 :01 alleles and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*03 :01 alleles and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HL A- A* 03 :01 alleles and GM-CSF.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*26:01 alleles and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*26:01 alleles and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA-A*26:01 alleles and GM-CSF.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*29:02 alleles and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*29:02 alleles and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA-A*29:02 alleles and GM-CSF.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*32:01 alleles and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*32:01 alleles and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA-A*32:01 alleles and GM-CSF.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 allele and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the ULA- DRB3*02:02 allele and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 allele and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*01 :01 allele and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*02:01 allele and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*03 :01 allele and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*26:01 allele and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*29:02 allele and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*32:01 allele and IFNa. [0117] In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*01 :01 alleles and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*01 :01 alleles and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the ULA- DRB3*03 :01 and HLA-A*01 :01 alleles and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*02:01 alleles and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*02:01 alleles and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the ULA- DRB3*03 :01 and HLA-A*02:01 alleles and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*03 :01 alleles and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*03 :01 alleles and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the ULA- DRB3*03 :01 and HLA-A*03 :01 alleles and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*26:01 alleles and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*26:01 alleles and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the ULA- DRB3*03 :01 and HLA-A*26:01 alleles and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*29:02 alleles and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*29:02 alleles and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the ULA- DRB3*03 :01 and HLA-A*29:02 alleles and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*32:01 alleles and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*32:01 alleles and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the ULA- DRB3*03 :01 and HLA-A*32:01 alleles and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 allele ,GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 allele, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 allele, GM- CSF, and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*01 :01 allele, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*02:01 allele, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*03 :01 allele, GM-CSF, and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*26:01 allele, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*29:02 allele, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*32:01 allele, GM-CSF, and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*01 :01 alleles, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*01 :01 alleles, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA-A*01 :01 alleles, GM-CSF, and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*02:01 alleles, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*02:01 alleles, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA-A*02:01 alleles, GM-CSF, and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*03 :01 alleles, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*03 :01 alleles, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA-A*03 :01 alleles, GM-CSF, and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*26:01 alleles, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*26:01 alleles, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA-A*26:01 alleles, GM-CSF, and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*29:02 alleles, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*29:02 alleles, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA-A*29:02 alleles, GM-CSF, and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*01 :01 and HLA-A*32:01 alleles, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*02:02 and HLA-A*32:01 alleles, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-DRB3*03 :01 and HLA-A*32:01 alleles, GM-CSF, and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A* 11 :01 allele of HLA-A and the HLA-DRB3*02:02 allele of HLA-DRB3. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A* 11 :01 allele of HLA-A and the HLA-DRB3*01 :01 allele of HLA-DRB3.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*24:02 allele of HLA-A and the HLA-DRB3*02:02 allele of HLA-DRB3. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*24:02 allele of HLA-A and the HLA-DRB3*01 :01 allele of HLA-DRB3.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A* 11 :01 allele of HLA-A, the HLA-DRB3*02:02 allele of HLA-DRB3, and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A* 11 :01 allele of HLA-A, the HLA- DRB3*01 :01 allele of HLA-DRB3, and GM-CSF.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*24:02 allele of HLA-A, the HLA-DRB3*02:02 allele of HLA-DRB3, and GM-CSF. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*24:02 allele of HLA-A, the HLA-DRB3*01 :01 allele of HLA-DRB3, and GM-CSF.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A* 11 :01 allele of HLA-A, the HLA-DRB3*02:02 allele of HLA-DRB3, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A* 11 :01 allele of HLA-A, the HLA- DRB3*01 :01 allele of HLA-DRB3, and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*24:02 allele of HLA-A, the HLA-DRB3*02:02 allele of HLA-DRB3, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*24:02 allele of HLA-A, the HLA-DRB3*01 :01 allele of HLA-DRB3, and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A* 11 :01 allele of HLA-A, the HLA-DRB3*02:02 allele of HLA-DRB3, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A* 11 :01 allele of HLA-A, the HLA-DRB3*01 :01 allele of HLA-DRB3, GM-CSF, and IFNa.
  • the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*24:02 allele of HLA-A, the HLA-DRB3*02:02 allele of HLA-DRB3, GM-CSF, and IFNa. In some embodiments, the modified cancer cell comprises recombinant polynucleotides encoding the HLA-A*24:02 allele of HLA-A, the HLA-DRB3*01 :01 allele of HLA-DRB3, GM-CSF, and IFNa.
  • the modified human cancer cell further comprises a recombinant polynucleotide encoding granulocyte-macrophage colony-stimulating factor (GM-CSF).
  • GM-CSF granulocyte-macrophage colony-stimulating factor
  • the recombinant polynucleotide encoding GM-CSF is integrated into the genome of the cell.
  • the recombinant polynucleotide encoding GM-CSF is present on a vector.
  • the recombinant polynucleotide encoding GM- CSF can be present on the same vector as the recombinant polynucleotides encoding one or more ULA alleles, or can be present on a different vector.
  • the modified human cancer cell further comprises a recombinant polynucleotide encoding interferon alpha (IFNa).
  • IFNa interferon alpha
  • the recombinant polynucleotide encoding IFNa is integrated into the genome of the cell.
  • the recombinant polynucleotide encoding IFNa is present on a vector.
  • the recombinant polynucleotide encoding IFNa can be present on the same vector as the recombinant polynucleotides encoding one or more ULA alleles, or can be present on a different vector.
  • the modified human cancer cell further comprises recombinant polynucleotides encoding GM-CSF and IFNa.
  • the recombinant polynucleotides encoding GM-CSF and/or IFNa are integrated into the genome of the cell.
  • the recombinant polynucleotides encoding GM-CSF and/or IFNa are present on a vector.
  • the recombinant polynucleotides encoding GM-CSF and/or IFNa can be present on the same vector as the recombinant polynucleotides encoding one or more ULA alleles, or can be present on a different vector.
  • the modified cancer cell further comprises a recombinant polypeptide encoding one or more immune-stimulatory genes.
  • the modified cancer cell further comprises a recombinant polynucleotide encoding an immune- stimulatory gene selected from the group consisting of adenosine deaminase ⁇ ADA), adhesion G protein-coupled receptor E5 (ADGRE5), caveolin 1 (CAV1), CD58 molecule (CD58), CD74 molecule (CD74), CD83 molecule (CD83), C-X-C motif chemokine ligand 8 (CXCL8), C-X-C motif chemokine ligand 16 (CXCL16), intracellular adhesion molecule 3 (ICAM3), interleukin 6 (IL6), interleukin 10 (IL10), interleukin 15 (IL15), interleukin 18 (IL18), KIT ligand (KITLG), tumor necrosis factor superfamily member 14 (TNF
  • the modified cancer cell further comprises a recombinant polypeptide encoding one or more cancer/testis antigen (CTA) genes.
  • the modified cancer cell further comprises a recombinant polynucleotide encoding a CTA gene selected from the group consisting of preferentially expressed antigen in melanoma (FRAME), PDZ binding kinase (PBK), centrosomal protein 55 (CEP 55), kinesin family member 2C (KIF2C), placenta-specific protein 1 (PLAC1), Opa interacting protein 5 (OIP5), calcium binding tyrosine phosphorylation regulated (CABYR), sperm-associated antigen 1 (SPAG1), and a combination thereof.
  • the modified cancer cell further comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, or more) recombinant polynucleotides encoding a CTA gene.
  • the modified cancer cell further comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or more) recombinant polynucleotides encoding an immune-stimulatory and/or a CTA gene.
  • one or more e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or more
  • the modified cancer cell further comprises one or more polynucleotides encoding a gene selected from the group consisting of ADA, ADGRE5, CAV1, CD58, CD74, CD83, CXCL8, CXCL16, ICAM3, IL6, IL10, IL15, IL18, KITLG, TNFSF14, PRAME, PBK, CEP55, KIF2C, PLAC1, OIP5, CABYR, SPAG1, and a combination thereof.
  • the recombinant polynucleotides encoding the immune-stimulatory and/or CTA genes can be integrated into the genome of the modified cancer cell, or can be present on one or more vectors.
  • the modified cancer cell further comprises one or more recombinant polynucleotides encoding one or more genes set forth in Tables 1, 2, 5, 7, 8, 9, 10, 12, 13, and 14.
  • the modified cancer cell further comprises recombinant polynucleotide(s)
  • the modified cancer cell comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250,
  • the modified cancer cell further comprises polynucleotides encoding PRAME, PBK, CEP55, KIF2C, ERBB2, MIEN1, PGAP3, or a combination thereof.
  • the recombinant polynucleotides can be integrated into the genome of the modified cancer cell, or located on one or more vectors.
  • the one or more HLA alleles, one or more CTA genes, one or more immune-stimulatory genes, GM-CSF-encoding gene, IFNa-encoding gene, and/or one or more additional biomarkers described herein are encoded by the recombinant polynucleotides are expressed by the cell. Expression can be transient, or in preferred embodiments expression is permanent. In some embodiments, expression of the HLA allele, CTA gene, immune-stimulatory gene, GM-CSF, IFNa, and/or additional biomarker is inducible.
  • the human cancer cell is a human cancer cell line. Any number of human cancer cells or cancer cell lines are suitable for the present invention.
  • suitable human cancer cell lines include the SV-BR-1, SVCT, MDA- MB-231, MDA-MB-157, ZR-75-30, ZR-75-1, Hs 578T, MCF7, T47D, MTSV1-7 CE1, 1- 7HB2, VP303, VP267, and VP229 breast cancer cell lines, the UM-UC-3, T24/83, ECV304, RT4, and HT 1197 bladder cancer cell lines, the MDST8, C170, GP5d, GP2d, and LS 123 colon cancer cell lines, the SHP-77, COR-L23/R, COR-L23/5010, MOR/0.2R, NCI- H69/LX20, ChaGo-K-1, and Meta 7 lung cancer cell lines, the MFE-280 and MFE-296 endometri
  • the human cancer cell line is an SV-BR-1 breast cancer cell line.
  • the human cancer cell line is a modified SV-BR-l-GM cancer cell line.
  • the cell lines described herein and others are available, for example, from Sigma-Aldrich (www.sigmaaldrich.com).
  • the modified cancer cell is obtained from a subject who is to be treated for cancer prior to modification of the cancer cell.
  • the expression of the HLA allele(s), biomarker(s), GM-CSF, and/or IFNa are under the control of two or more different promoters. In some instances, the expression of each allele, biomarker, GM-CSF, and/or IFNa is under the control of a separate promoter. In some embodiments, the expression of the HLA allele(s), biomarker(s), GM- CSF, and/or IFNa are under the control of a single promoter. In some instances, the HLA allele(s), biomarker(s), GM-CSF, and/or IFNa are expressed as a polycistronic mRNA. In particular instances, one or more cistrons are separated by internal ribosomal entry sites.
  • the present invention provides a method for selecting a whole-cell cancer vaccine for a subject having cancer.
  • the method comprises:
  • HLA human leukocyte antigen
  • one or more alleles of one or more HLA class I genes are detected and are used to generate an allele profile.
  • one or more alleles of one or more HLA class II genes are detected and are used to generate an allele profile.
  • one or more alleles of one or more HLA class I genes and one or more alleles of one or more HLA class II genes are detected and used to generate an allele profile.
  • the HLA class I gene is an HLA-A gene, an HLA-B gene, an HLA-C gene, an HLA-E gene, an HLA-F gene, an HLA-G gene, or a B2M gene.
  • the HLA class I gene is a combination of an HLA-A gene, an HLA-B gene, an HLA-C gene, an HLA-E gene, an HLA-F gene, an HLA-G gene, and/or a B2M gene.
  • one or more ⁇ e.g., 1, 2, 3, 4, 5, 6, or 7) HLA class I genes are detected.
  • one or more ⁇ e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more) HLA-A alleles are detected.
  • the one or more HLA-A alleles selected for detection are each present at a median frequency of at least about 2% in a population. In other embodiments, the one or more HLA-A alleles selected for detection are each present at a maximum frequency of at least about 5% in a population. In still other embodiments, the one or more HLA-A alleles selected for detection are each present at a median frequency of at least about 2% and a maximum frequency of at least about 5% in a population.
  • HLA-B alleles include but are not limited to HLA-B* 13 :02, HLA-B*41 :01, HLA-B* 18:03, HLA-B*44:02, HLA-B*07:02, HLA-B*35:01, HLA- B*40:01, HLA-B*35:08, HLA-B*55:01, HLA-B*51 :01, HLA-B*44:03, HLA-B*58:01, HLA-B*08:01, HLA-B* 18:01, HLA-B* 15:01, and HLA-B*52:01.
  • one or more HLA-B alleles are detected.
  • the one or more HLA-B alleles selected for detection are each present at a median frequency of at least about 2% in a population.
  • the one or more HLA-B alleles selected for detection are each present at a maximum frequency of at least about 5% in a population.
  • the one or more HLA-B alleles selected for detection are each present at a median frequency of at least about 2% and a maximum frequency of at least about 5% in a population.
  • HLA-C*04:01 HLA-C*07:02
  • HLA-C*07:01 HLA-C*06:02
  • HLA-C*03 :04 HLA-C*01 :02
  • HLA- C*02:02 HLA-C*08:02
  • HLA-C*03 :03 HLA-C*05:01
  • HLA-C*08:01 HLA-C* 16:01
  • HLA-C* 12:03 HLA-C* 14:02.
  • one or more HLA-C alleles are detected.
  • the one or more HLA-C alleles selected for detection are each present at a median frequency of at least about 2% in a population.
  • the one or more HLA-C alleles selected for detection are each present at a maximum frequency of at least about 5% in a population.
  • the one or more HLA-C alleles selected for detection are each present at a median frequency of at least about 2% and a maximum frequency of at least about 5% in a population.
  • the HLA class II gene is an HLA class II alpha subunit gene. In other embodiments, the HLA class II gene is an HLA class II beta subunit gene. In particular embodiments, the HLA class II gene is a combination of HLA class II alpha subunit and HLA class II beta subunit genes.
  • the HLA class II gene is an HLA-DP gene, an HLA-DM gene, an HLA-DO gene, an HLA-DQ gene, and/or an HLA-DR gene.
  • the HLA-DO gene is an HLA-DOA gene.
  • the HLA-DO gene is an HLA-DOB gene.
  • both HLA-DOA and HLA-DOB gene alleles are detected.
  • the HLA-DM gene is an HLA-DMA gene.
  • the HLA-DM gene is an HLA-DMB gene. In particular instances, both HLA-DMA and HLA-DMB gene alleles are detected.
  • the HLA-DR gene is an HLA-DRA gene, an HLA-DRBl gene, an HLA-DRB3 gene, an HLA-DRB4 gene, and/or an HLA-DRB5 gene.
  • alleles of one or more ⁇ e.g., 1, 2, 3, 4, 5, or more) HLA-DR gene(s) are detected.
  • suitable HLA-DRB3 alleles include but are not limited to HLA- DRB3*02:02, HLA-DRB3*01 :01, and HLA-DRB3*03 :01.
  • one or more ⁇ e.g., 1, 2, 3, or more) recombinant polynucleotide(s) encoding HLA-DRB3 alleles are detected.
  • the one or more HLA-DRB3 alleles selected for detection are each present at a median frequency of at least about 2% in a population.
  • the one or more HLA-DRB3 alleles selected for detection are each present at a maximum frequency of at least about 5% in a population.
  • the one or more HLA-DRB3 alleles selected for detection are each present at a median frequency of at least about 2% and a maximum frequency of at least about 5% in a population.
  • the allele profile comprises HLA-A* 11 :01 or HLA-A*24:02 alleles of HLA-A and HLA-DRB3*02:02 or HLA-DRB3*01 :01 of HLA-DRB3.
  • a whole-cell cancer vaccine is selected for the subject when there is a complete match between the HLA allele profile of the subject and the HLA allele profile of the vaccine. In some instances, all of the HLA alleles present in the profile of the subject are present in the profile of the vaccine. In other instances, all of the HLA alleles present in the profile of the vaccine are present in the profile of the subject. In other embodiments, a whole-cell cancer vaccine is selected for the subject when there is a partial match between the HLA allele profile of the subject and the HLA allele profile of the vaccine.
  • a partial match is present when one or more ⁇ e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, or more) alleles present in the profile of the subject are present in the profile of the vaccine.
  • a partial match is present when one or more ⁇ e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, or more) alleles present in the profile of the vaccine are present in the profile of the subject.
  • a partial match is present when there is at least about a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), or 100%) match between the allele profile of the subject and the allele profile of the vaccine.
  • the method comprises: detecting the presence or level of one or more biomarkers in a sample obtained from the subject; comparing the presence or level of the one or more biomarkers detected in the sample obtained from the subject to the presence or level of the one or more biomarkers in a control sample; and selecting the whole-cell cancer vaccine for the subject based on the comparison, wherein the whole-cell cancer vaccine is derived from a breast cancer cell line or a breast cancer cell.
  • the breast cancer cell line is an SV-BR-1 breast cancer cell line.
  • the method comprises: measuring the level of activity and/or number of one or more immune cells obtained from the subject; comparing the activity and/or number of the one or more immune cells obtained from the subject to the activity and/or number of one or more immune cells in a control sample; and selecting the whole-cell cancer vaccine for the subject based on the comparison, wherein the whole-cell cancer vaccine is derived from a breast cancer cell line or a breast cancer cell.
  • the breast cancer cell line is an SV-BR-1 breast cancer cell line.
  • the method comprises: detecting the presence or level of one or more biomarkers in a sample obtained from the subject; and/or measuring the level of activity and/or number of one or more immune cells obtained from the subject; comparing the presence or level of the one or more biomarkers detected in the sample obtained from the subject and/or the level of activity and/or number of the one or more immune cells obtained from the subject to the presence or level of the one or more biomarkers and/or the level of activity and/or number of one or more immune cells in a control sample; and selecting the whole-cell cancer vaccine for the subject based on the comparison, wherein the whole-cell cancer vaccine is derived from a breast cancer cell line or a breast cancer cell.
  • the breast cancer cell line is an SV-BR-1 breast cancer cell line.
  • Biomarkers suitable for methods of the present invention include, but are not limited to, those set forth in Tables 1, 2, 5, 7, 8, 9, 10, 12, 13, and 14. In some embodiments, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, or biomarkers set forth in Tables 1, 2, 5, 7, 8, 9, 10, 12,
  • the presence or level of one or more immune-stimulatory genes are detected.
  • the one or more immune-stimulatory genes are selected from the group consisting of adenosine deaminase (ADA), adhesion G protein- coupled receptor E5 (ADGRE5), caveolin 1 (CAV1), CD58 molecule (CD58), CD74 molecule (CD74), CD83 molecule (CD83), C-X-C motif chemokine ligand 8 (CXCL8), C-X-C motif chemokine ligand 16 (CXCL16), intracellular adhesion molecule 3 (ICAM3), interleukin 6 (IL6), interleukin 10 (IL10), interleukin 15 (IL15), interleukin 18 (IL18), KIT ligand (KITLG), tumor necrosis factor superfamily member 14 (TNFSF14), and a combination thereof.
  • one or more e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
  • one or more cancer/testis antigen (CTA) genes are detected.
  • the one or more CTA genes are selected from the group consisting of preferentially expressed antigen in melanoma (FRAME), PDZ binding kinase (PBK), centrosomal protein 55 (CEP 55), kinesin family member 2C (KIF2C), placenta-specific protein 1 (PLAC1), Opa interacting protein 5 (OIP5), calcium binding tyrosine phosphorylation regulated (CABYR), sperm-associated antigen 1 (SPAGI), and a combination thereof.
  • one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, or more) CTA genes are detected.
  • one or more e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
  • immune-stimulatory and/or a CTA genes are detected.
  • one or more genes selected from the group consisting of ADA, ADGRE5, CAV1, CD58, CD74, CD83, CXCL8, CXCL16, ICAM3, IL6, IL10, IL15, IL18, KITLG, TNFSF14, PRAME, PBK, CEP55, KIF2C, PLACl, OIP5, CABYR, SPAGl, are detected.
  • the one or more biomarkers that are detected are selected from the group consisting of preferentially expressed antigen in melanoma ⁇ PRAME), PDZ binding kinase (PBK), centrosomal protein 55 (CEP 55), kinesin family member 2C (KIF2C), placenta-specific protein 1 (PLACl), Opa interacting protein 5 (OIP5), calcium binding tyrosine phosphorylation regulated (CABYR), sperm-associated antigen 1 (SPAGl), alpha- 1,3-glucosyltransferase (ALG8), actin-related protein 2/3 complex, subunit 5-like (ARPC5L), chromobox homolog 2 (CBX2), collagen type VIII alpha 1 chain (COL8A1), DDB 1 and CUL4 associated factor 10, (DCAFIO), eukaryotic translation initiation factor 3 subunit H (EIF3H), erb-b2 receptor tyrosine kinase 2
  • PBK centroso
  • the one or more biomarkers that are selected are selected from the group consisting of PRAME, PBK, CEP55, KLF2C, ERBB2, MIEN I, PGAP3, and a combination thereof.
  • the one or more biomarkers is PRAME.
  • the one or more biomarkers is selected from the group consisting of ERBB2, MIEN1, PGAP3, and a combination thereof.
  • serum/plasma biomarkers associated with the present invention are provided below in Table 1.
  • the levels of the analytes in fluids such as serum or plasma can be measured via Luminex multiplex assays. Recommended dilutions for polystyrene and magnetic bead assays can be obtained from www.rndsystems.com/luminex/analytes. It should be noted that while the analytes associated with the present invention are classified as "serum/plasma biomarkers" in Table 1, the levels of these biomarkers may also be assessed in other biofluids, such as urine.
  • Table 1 Semm/Plasma Biomarkers
  • CD25/IL-2 R alpha HTRA2/Omi Cardiac Myoglobin ULBP-2/5/6
  • the vaccine is selected for the subject when the level of at least one of the one or more biomarkers is overexpressed in the sample obtained from the subject compared to the control sample.
  • the control sample comprises a normal cell or tissue obtained from the subject.
  • the control sample comprises a normal cell or tissue obtained from a different subject or from a population of subjects. Populations of subjects can be used to establish reference ranges for comparisons.
  • the vaccine is selected for the subject when one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 1 10, 1 15, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, or more) biomarkers are overexpressed compared to the control sample.
  • biomarkers e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15,
  • the vaccine is selected for the subject when the level(s) of the one or more biomarkers are at least about 1.5-fold (e.g., about 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6- fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, 10-fold, 1 1-fold, 12-fold, 13- fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, 55-fold, 60-fold, 65-fold, 70-fold, 75-fold, 80-fold, 85-fold, 90- fold, 95-fold, 100-fold, or more) higher compared to the control sample.
  • the vaccine is selected for the subject when at least one of the one or more biomarkers is overexpressed at least
  • the vaccine is selected for the subject when the level of activity and/or number of the one or more immune cells obtained from the subject is higher compared to the control sample.
  • the control sample comprises one or more immune cells obtained from a different subject who does not have cancer or a population of subjects who do not have cancer. Populations of subjects can be used to establish reference ranges for use in comparisons.
  • the vaccine is selected for the subject when the level of activity and/or number of the immune cells obtained from the subject is at least about 1.5-fold (e.g., about 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5- fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9- fold, 9.5-fold, 10-fold, 1 1-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, 55-fold, 60-fold, 65- fold, 70-fold, 75-fold, 80-fold, 85-fold, 90-fold, 95-fold, 100-fold, or more) higher compared to the control sample.
  • the vaccine is selected for the subject when the level(s) of activity and/or number of the one
  • PBMCs peripheral blood mononuclear cells
  • lymphocytes e.g., T lymphocytes, B lymphocytes, natural killer (NK) cells
  • monocytes dendritic cells
  • macrophages macrophages
  • MDSCs myeloid-derived suppressor cells
  • the one or more immune cells in which the level of activity and/or number is measured is selected from the group consisting of PBMCs, lymphocytes (e.g., T lymphocytes, B lymphocytes, natural killer (NK) cells), and/or dendritic cells.
  • Detecting the presence or level of biomarkers of the present invention can comprise, for example, measuring DNA levels (e.g., genomic DNA copy number, mRNA or cDNA quantification) or protein levels (e.g., quantifying the amount of protein that is present in a sample, measuring the amount of protein activation or modification, or detecting antibodies).
  • DNA levels e.g., genomic DNA copy number, mRNA or cDNA quantification
  • protein levels e.g., quantifying the amount of protein that is present in a sample, measuring the amount of protein activation or modification, or detecting antibodies.
  • the presence or level of biomarkers are detected using a method selected from the group consisting of quantitative PCR, microarray analysis, an ELISA, a radioimmunoassay (RIA), immunoprecipitation, immunofluorescence, FACS analysis, electrochemiluminescence, a multiplex bead assay (e.g., using Luminex or fluorescent microbeads), immunohistochemistry, a Western blot, a dot blot, and a combination thereof.
  • a method selected from the group consisting of quantitative PCR, microarray analysis, an ELISA, a radioimmunoassay (RIA), immunoprecipitation, immunofluorescence, FACS analysis, electrochemiluminescence, a multiplex bead assay (e.g., using Luminex or fluorescent microbeads), immunohistochemistry, a Western blot, a dot blot, and a combination thereof.
  • Suitable methods include antibody detection (e.g., using an ELISA or Western blot), a cytotoxic T lymphocyte (CTL) activity assay (e.g., chromium release assay, IFN- ⁇ ELISpot assay, or a multifactor flow cytometry - based assay), a cytotoxicity assay, a proliferation assay (e.g., a thymidine incorporation assay, a colorimetric assay (e.g., an MTT assay, a WST1 assay, or a resazurin assay), or an ATP quantification assay (e.g., a bioluminescent-based ATP detection assay)), a cytokine production assay (e.g., an ELISpot assay or an ELISA (e.g., on culture supernatant or serum)),
  • a multimer of fluorescently-labeled peptide-MHC complexes are used to stain cells such as peptide-specific T cells.
  • the peptide can be, for example, a tumor-associated antigen (TAA) such as PRAME or other biomarker.
  • TAA tumor-associated antigen
  • the multimer is a tetramer or pentamer, although other configurations are possible.
  • the conjugation of fluorophores or beads e.g., magnetic beads
  • allows isolation and/or sorting of the T lymphocytes e.g., using flow cytometry).
  • an antibody or plurality thereof used to detect the biomarker(s), measure immune cell activity or number, or perform HLA typing can be immobilized on a solid support.
  • the solid support can be, for example, a multiwell plate, a microarray, a chip, a bead, a porous strip, or a nitrocellulose filter.
  • the bead comprises chitin.
  • the immobilization can be via covalent or non-covalent binding.
  • Labeled secondary antibodies can be used to detect binding between antibodies and biomarkers, immune cells, and/or HLA antigens.
  • Secondary antibodies bind to the constant or "C" regions of different classes or isotypes of immunoglobulins IgM, IgD, IgG, IgA, and IgE.
  • a secondary antibody against an IgG constant region is used in the present methods.
  • Secondary antibodies against the IgG subclasses, for example, IgGl , IgG2, IgG3, and IgG4 also find use in the present methods.
  • Secondary antibodies can be labeled with any directly or indirectly detectable moiety, including a fluorophore (e.g., fluorescein, phycoerythrin, quantum dot, Luminex bead, fluorescent bead), an enzyme (e.g., peroxidase,
  • a fluorophore e.g., fluorescein, phycoerythrin, quantum dot, Luminex bead, fluorescent bead
  • an enzyme e.g., peroxidase
  • alkaline phosphatase a radioisotope (e.g., H, P, I) or a chemiluminescent moiety.
  • Labeling signals can be amplified using a complex of biotin and a biotin binding moiety (e.g., avidin, streptavidin, neutravidin).
  • Biotin binding moiety e.g., avidin, streptavidin, neutravidin.
  • Fluorescently labeled anti-human IgG antibodies are commercially available, e.g., from Molecular Probes (Eugene, OR).
  • Enzyme-labeled anti- human IgG antibodies are commercially available, e.g., from Sigma-Aldrich (St. Louis, MO) and Chemicon (Temecula, CA).
  • the presence or decreased or increased presence of one or more biomarkers, immune cells, and/or HLA antigens is indicated by a detectable signal (e.g., a blot, fluorescence, chemiluminescence, color, radioactivity) in an immunoassay.
  • a detectable signal e.g., a blot, fluorescence, chemiluminescence, color, radioactivity
  • This detectable signal can be compared to the signal from a control sample or to a threshold value
  • the results of the biomarker presence or level determinations, immune cell measurements, and/or HLA typing are recorded in a tangible medium.
  • the results can be recorded, e.g., on paper or on electronic media (e.g., audio tape, a computer disk, a CD, a flash drive, etc.).
  • immune cells are stimulated (e.g., in vitro stimulation of isolated immune cells) before the activity and/or number is measured.
  • the immune cells are stimulated with an antigenic protein such as a TAA (e.g., PRAME) or other biomarker protein described herein.
  • the immune cells are stimulated by being exposed to whole cells (e.g., cancer cells or modified cancer cells).
  • the one or more biomarkers comprise one or more alleles of one or more HLA genes, as described herein.
  • the vaccine is selected for the subject when one or more alleles of one or more HLA genes in the sample obtained from the subject match one or more alleles of one or more HLA genes in the vaccine.
  • the match can be a complete match or a partial match, as described herein.
  • HLA typing methods which will be known to one of skill in the art, are generally divided into phenotyping and genotyping methods.
  • phenotyping methods involve the use of monoclonal antibodies to detect HLA antigens, although serological methods (e.g., complement-dependent cytotoxicity assays) are also known.
  • Genotyping methods typically involve PCR amplification of HLA alleles. Following amplification, high-resolution sequence-based typing methods or low-resolution methods such as sequence-specific primer typing or sequence-specific oligonucleotide probe methods can be used.
  • the sample obtained from the subject comprises whole blood, plasma, serum, cerebrospinal fluid, tissue, saliva, buccal cells, tumor tissue, a biofluid (e.g., urine, a pleural effusion sample), hair, skin, or a combination thereof.
  • a biofluid e.g., urine, a pleural effusion sample
  • the sample comprises circulating tumor cells (CTCs).
  • CTCs circulating tumor cells
  • the sample can also be made up of a combination of normal and cancer cells.
  • Samples can be obtained by biopsy, from a surgical resection, as a fine needle aspirate, or any other method that yields a sufficient number of cells or amount of tissue such that detection of biomarkers, measurement of immune cell activity and/or number, or HLA typing is enabled.
  • the present invention provides a composition comprising a modified human cancer cell of the present invention described herein.
  • the modified cancer cell can comprise one or more alleles of one or more HLA class I genes, one or more alleles of one or more HLA class II genes, or a combination thereof, as described herein.
  • the modified cancer cell further comprises one or more recombinant polynucleotides encoding one or more biomarkers described herein.
  • the one or more biomarkers comprise one or more CTA genes and/or one or more immune- stimulatory genes.
  • the HLA allele(s) and/or biomarkers are expressed by the modified human cancer cell. Expression can be transient or permanent. In some cases, expression is inducible.
  • the composition further comprises granulocyte-macrophage colony-stimulating factor (GM-CSF).
  • GM-CSF granulocyte-macrophage colony-stimulating factor
  • the GM-CSF is encoded by a recombinant polynucleotide and expressed by a modified cell.
  • the GM-CSF is expressed by the same modified cell (i.e., modified cancer cell) that comprises the recombinant polynucleotide encoding an allele of a human leukocyte antigen (HLA) class I and/or class II gene.
  • HLA human leukocyte antigen
  • the GM-CSF is not expressed by the same modified cell (e.g., modified cancer cell) that comprises the recombinant polynucleotide encoding an allele of a human leukocyte antigen (HLA) class I and/or class II gene.
  • the GM-CSF is present in the composition in a soluble form.
  • the composition further comprises interferon alpha (IFNa).
  • IFNa interferon alpha
  • the IFNa is expressed by the same modified cell (e.g., modified cancer cell) that comprises the recombinant polynucleotide encoding an allele of a human leukocyte antigen (HLA) class I and/or class II gene.
  • HLA human leukocyte antigen
  • the IFNa is expressed by different cells that have been modified to express IFNa.
  • the IFNa is present in a soluble form.
  • the human cancer cell is a human cancer cell line. Any number of human cancer cell lines are suitable for the present invention, as described herein.
  • the human cancer cell line is an SV-BR-1 breast cancer cell line.
  • the human cancer cell line is a modified SV-BR-1 -GM cancer cell line
  • the present invention provides a pharmaceutical composition.
  • the pharmaceutical composition comprises a composition described herein and a pharmaceutically acceptable carrier.
  • the formulation of pharmaceutical compositions is generally known in the art (see, e.g., REMINGTON'S PHARMACEUTICAL SCIENCES, 18TH ED., Mack Publishing Co., Easton, PA (1990)). Prevention against microorganism contamination can be achieved through the addition of one or more of various antibacterial and antifungal agents.
  • compositions suitable for administration include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • Typical carriers include a solvent or dispersion medium containing, for example, water-buffered aqueous solutions (i.e., biocompatible buffers, non-limiting examples of which include Lactated Ringer's solution and CryoStor cryopreservation media (e.g., CS2, CS5, and CSIO, containing 2%, 5%, and 10%, respectively of DMSO; available from BioLife Solutions, Bothell, WA)), ethanol, polyols such as glycerol, propylene glycol, polyethylene glycol, suitable mixtures thereof, surfactants, or vegetable oils.
  • biocompatible buffers i.e., biocompatible buffers, non-limiting examples of which include Lactated Ringer's solution and CryoStor cryopreservation media (e.g., CS2, CS
  • Sterilization can be accomplished by an art-recognized technique, including but not limited to addition of antibacterial or antifungal agents, for example, paraben, chlorobutanol, sorbic acid or thimerosal. Further, isotonic agents such as sugars or sodium chloride may be incorporated in the subject compositions.
  • antibacterial or antifungal agents for example, paraben, chlorobutanol, sorbic acid or thimerosal.
  • isotonic agents such as sugars or sodium chloride may be incorporated in the subject compositions.
  • sterile injectable solutions containing modified cancer cell(s), and/or other composition(s) of the present invention can be accomplished by incorporating the compound(s) in the required amount(s) in the appropriate solvent with various ingredients enumerated above, as required, followed by sterilization. To obtain a sterile powder, the above sterile solutions can be vacuum-dried or freeze-dried as necessary.
  • the modified cancer cell(s), and/or other composition(s) provided herein are formulated for administration, e.g., intradermal injection, intralymphatic injection, oral, nasal, topical, or parental administration in unit dosage form for ease of administration and uniformity of dosage.
  • Unit dosage forms refers to physically discrete units suited as unitary dosages for the subjects, e.g., humans or other mammals to be treated, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • more concentrated dosage forms may be prepared, from which the more dilute unit dosage forms may then be produced.
  • the more concentrated dosage forms thus will contain substantially more than, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times the amount of the modified cancer cell(s), and/or other composition(s).
  • a dose may include, for example, about 50,000 to 50,000,000 (e.g., about 50,000, 60,000, 70,000, 80,000, 90,000, 100,000, 110,000, 120,000, 130,000, 140,000, 150,000, 160,000, 170,000, 180,000, 190,000, 200,000, 250,000, 300,000, 350,000, 400,000, 450,000, 500,000, 550,000, 600,000, 650,000, 700,000, 750,000, 800,000, 850,000, 900,000, 950,000, 1,000,000, 1,500,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 5,500,000, 6,000,000, 6,500,000, 7,000,000, 7,500,000, 8,000,000, 8,500,000, 9,000,000, 9,500,000, 10,000,000, 11,000,000, 12,000,000, 13,000,000, 14,000,000, 15,000,000, 16,000,000, 17,000,000, 18,000,000, 19,000,000, 20,000,000, 25,000,000, 30,000,000, 35,000,000, 40,000,000, 45,000,000, 50,000,000, or more) modified cancer cells.
  • a dose may contain about 5,000,000 modified cancer cells.
  • a dose may also include, for example, at least about 5,000,000 to 100,000,000 (e.g., about 5,000,000, 6,000,000, 7,000,000, 8,000,000, 9,000,000, 10,000,000, 15,000,000, 20,000,000, 25,000,000, 30,000,000, 35,000,000, 40,000,000, 45,000,000, 50,000,000, 55,000,000, 60,000,000, 65,000,000, 70,000,000, 75,000,000, 80,000,000, 85,000,000, 90,000,000, 95,000,000, 100,000,000, or more) modified cancer cells.
  • at least about 5,000,000 to 100,000,000 e.g., about 5,000,000, 6,000,000, 7,000,000, 8,000,000, 9,000,000, 10,000,000, 15,000,000, 20,000,000, 25,000,000, 30,000,000, 35,000,000, 40,000,000, 45,000,000, 50,000,000, 55,000,000, 60,000,000, 65,000,000, 70,000,000, 75,000,000, 80,000,000, 85,000,000, 90,000,000, 95,000,000, 100,000,000, or more modified cancer cells.
  • a dose may alternatively include, for example, at least about 100,000,000 to 1,000,000,000 (e.g., about 100,000,000, 150,000,000, 200,000,000, 250,000,000, 300,000,000, 350,000,000, 400,000,000, 450,000,000, 500,000,000, 550,000,000, 600,000,000, 650,000,000, 700,000,000, 750,000,000, 800,000,000, 850,000,000, 900,000,000, 950,000,000, 1,000,000,000, or more) mofified cancer cells.
  • the modified cancer cells are irradiated.
  • the irradiation dose may be, for example, between about 2 and 2,000 Gy (e.g., about, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, or 2,000 Gy).
  • the modified cancer cells are irradiated with a dose of about 200 Gy.
  • the dosage forms typically include a conventional pharmaceutical carrier or excipient and may additionally include other medicinal agents, carriers, adjuvants, diluents, tissue permeation enhancers, solubilizers, and the like.
  • Appropriate excipients can be tailored to the particular dosage form and route of administration by methods well known in the art (see, e.g., REMINGTON 'S PHARMACEUTICAL SCIENCES, supra).
  • excipients include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, saline, syrup, methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, and polyacrylic acids such as Carbopols, e.g., Carbopol 941, Carbopol 980, Carbopol 981, etc.
  • Carbopols e.g., Carbopol 941, Carbopol 980, Carbopol 981, etc.
  • the dosage forms can additionally include lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying agents; suspending agents; preserving agents such as methyl-, ethyl-, and propyl-hydroxy-benzoates (i.e., the parabens); pH adjusting agents such as inorganic and organic acids and bases; sweetening agents; and flavoring agents.
  • lubricating agents such as talc, magnesium stearate, and mineral oil
  • wetting agents such as talc, magnesium stearate, and mineral oil
  • emulsifying agents such as methyl-, ethyl-, and propyl-hydroxy-benzoates (i.e., the parabens)
  • pH adjusting agents such as inorganic and organic acids and bases
  • sweetening agents and flavoring agents.
  • the dosage forms may also comprise biodegradable polymer beads, dextran, and cyclodextrin inclusion complexes.
  • the composition for administration may be an oral delivery vehicle such as a capsule, cachet or tablet, each of which contains a predetermined amount of the composition to provide the correct incremental dose to the patient.
  • Oral delivery vehicles may be useful, for example, in avoiding contact between the composition and the mouth and upper gastrointestinal tract.
  • the therapeutically effective dose can be in the form of tablets, capsules, emulsions, suspensions, solutions, syrups, sprays, lozenges, powders, and sustained-release formulations.
  • Suitable excipients for oral administration include pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, gelatin, sucrose, magnesium carbonate, and the like.
  • the therapeutically effective dose takes the form of a pill, tablet, or capsule, and thus, the dosage form can contain, along with the modified cancer cell(s), and/or other composition(s) described herein, any of the following: a diluent such as lactose, sucrose, dicalcium phosphate, and the like; a disintegrant such as starch or derivatives thereof; a lubricant such as magnesium stearate and the like; and a binder such a starch, gum acacia, polyvinylpyrrolidone, gelatin, cellulose and derivatives thereof.
  • a diluent such as lactose, sucrose, dicalcium phosphate, and the like
  • a disintegrant such as starch or derivatives thereof
  • a lubricant such as magnesium stearate and the like
  • a binder such a starch, gum acacia, polyvinylpyrrolidone, gelatin, cellulose and derivatives thereof.
  • a suitable carrier masks the composition, e.g., the modified cancer cell(s), and/or other composition(s) from the mouth and upper gastrointestinal (GI) tract and reduces or prevents local itching/swelling reactions in these regions during administration.
  • a carrier may contain one or more lipid, polysaccharide or protein constituents.
  • the carrier is a food product.
  • the therapeutically effective dose can be in the form of emulsions, lotions, gels, foams, creams, jellies, solutions, suspensions, ointments, and transdermal patches.
  • the modified cancer cell(s), and/or other composition(s) described herein can be delivered as a dry powder or in liquid form via a nebulizer. Aerosol formulations can be placed into pressurized acceptable propellants such as dichlorodifluoromethane.
  • the therapeutically effective dose can be in the form of sterile injectable solutions and sterile packaged powders.
  • injectable solutions are formulated at a pH of from about 4.5 to about 7.5.
  • the therapeutically effective dose can also be provided in a lyophilized form.
  • dosage forms may include a buffer, e.g., bicarbonate, for reconstitution prior to administration, or the buffer may be included in the lyophilized dosage form for reconstitution with, e.g., water.
  • the lyophilized dosage form may further comprise a suitable vasoconstrictor, e.g., epinephrine.
  • the lyophilized dosage form can be provided in a syringe, optionally packaged in combination with the buffer for reconstitution, such that the reconstituted dosage form can be immediately administered to an individual.
  • the therapeutically effective dose may further comprise other components, for example, anti-allergy drugs, such as antihistamines, steroids, bronchodilators, leukotriene stabilizers and mast cell stabilizers. Suitable anti-allergy drugs are well known in the art. D. Methods for Treating Cancer
  • the present invention provides a method for treating cancer in a subject.
  • the method comprises administering to the subject a therapeutically effective amount of a pharmaceutical composition of the present invention (e.g., a pharmaceutical composition comprising modified cancer cells of the present invention) described herein.
  • a pharmaceutical composition of the present invention e.g., a pharmaceutical composition comprising modified cancer cells of the present invention
  • the method further comprises administering to the subject one or more additional therapies.
  • additional types include, but are not limited to, chemotherapy, immunotherapy, radiotherapy, hormone therapy, a differentiating agent, and a small-molecule drug.
  • suitable additional types include, but are not limited to, chemotherapy, immunotherapy, radiotherapy, hormone therapy, a differentiating agent, and a small-molecule drug.
  • Chemotherapeutic agents that can be used in the present invention include but are not limited to alkylating agents (e.g., nitrogen mustards (e.g., mechlorethamine, chlorambucil, cyclophosphamide, ifosfamide, melphalan), nitrosoureas (e.g., streptozocin, carmustine (BCNU), lomustine), alkyl sulfonates (e.g., busulfan), triazines (e.g., dacarbazine (DTIC), temozlomide), ethylenimines (e.g., thiotepa, altretamine (hexamethylmelamine))), platinum drugs (e.g., cisplatin, carboplatin, oxalaplatin), antimetabolites (e.g., 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine, cytarabine
  • Topoisomerase inhibitors are compounds that inhibit the activity of topoisomerases, which are enzymes that facilitate changes in DNA structure by catalyzing the breaking and rejoining of phosphodiester bonds in the backbones of DNA strands. Such changes in DNA structure are necessary for DNA replication during the normal cell cycle. Topoisomerase inhibitors inhibit DNA ligation during the cell cycle, leading to an increased number of single- and double-stranded breaks and thus a degradation of genomic stability. Such a degradation of genomic stability leads to apoptosis and cell death. [0206] Topoisom erases are often divided into type I and type II topoisomerases. Type I topoisomerases are essential for the relaxation of DNA supercoiling during DNA replication and transcription.
  • Type I topoisomerases generate DNA single-strand breaks and also religate said breaks to re-establish an intact duplex DNA molecule.
  • inhibitors of topoisomerase type I include irinotecan, topotecan, camptothecin, and lamellarin D, which all target type IB topoisomerases.
  • Type II topoisomerase inhibitors are broadly classified as topoisomerase poisons and topoisomerase inhibitors. Topoisomerase poisons target topoisomerase-DNA complexes, while topoisomerase inhibitors disrupt enzyme catalytic turnover. Examples of type II topoisomerase inhibitors include amsacrine, etoposide, etoposide phosphate, teniposide, doxorubicin, and fluoroquinolones.
  • the chemotherapeutic agent is a topoisomerase inhibitor.
  • the topoisomerase inhibitor is a topoisomerase I inhibitor, a topoisomerase II inhibitor, or a combination thereof.
  • the topoisomerase inhibitor is selected from the group consisting of doxorubicin, etoposide, teniposide, daunorubicin, mitoxantrone, amsacrine, an ellipticine, aurintricarboxylic acid, HU-331, irinotecan, topotecan, camptothecin, lamellarin D, resveratrol, genistein, quercetin, epigallocatechin gallate (EGCG), and a combination thereof.
  • EGCG is one example of a plant-derived natural phenol that serves as a suitable topoisomerase inhibitor.
  • the topoisomerase inhibitor is doxorubicin.
  • Immunotherapy refers to any treatment that uses the subject' s immune system to fight a disease (e.g., cancer). Immunotherapy methods can be directed to either enhancing or suppressing immune function. In the context of cancer therapies, immunotherapy methods are typically directed to enhancing or activating immune function.
  • an immunotherapeutic agent comprises a monoclonal antibody that targets a particular type or part of a cancer cell. In some cases, the antibody is conjugated to a moiety such as a drug molecule or a radioactive substance.
  • Antibodies can be derived from mouse, chimeric, or humanized, as non-limiting examples.
  • Non-limiting examples of therapeutic monoclonal antibodies include alemtuzumab, bevacizumab, cetuximab, daratumumab, ipilimumab (MDX-101), nivolumab, ofatumumab, panitumumab, pembrolizumab, rituximab, tositumomab, and trastuzumab.
  • Immunotherapeutic agents can also comprise an immune checkpoint inhibitor, which modulates the ability of the immune system to distinguish between normal and "foreign" cells.
  • Programmed cell death protein 1 (PD-1) and protein death ligand 1 (PD-Ll) are common targets of immune checkpoint inhibitors, as disruption of the interaction between PDl and PD-Ll enhance the activity of immune cells against foreign cells such as cancer cells.
  • PD-1 inhibitors include pembrolizumab and nivolumab.
  • An example of a PD-Ll inhibitor is atezolizumab.
  • CTLA-4 cytotoxic T lymphocyte-associated protein 4
  • ipilimumab a monoclonal antibody that binds to and inhibits CTLA-4.
  • Radiotherapy refers to the delivery of high-energy radiation to a subject for the treatment of a disease (e.g., cancer).
  • Radiotherapy can comprise the delivery of X- rays, gamma rays, and/or charged particles.
  • Radiotherapy can be delivered locally (e.g. to the site or region of a tumor), or systemically (e.g., a radioactive substance such as radioactive iodine is administered systemically and travels to the site of the tumor).
  • hormone therapy can refer to an inhibitor of hormone synthesis, a hormone receptor antagonist, or a hormone supplement agent.
  • Inhibitors of hormone synthesis include but are not limited to aromatase inhibitors and gonadotropin releasing hormone (GnRH) analogs.
  • Hormone receptor antagonists include but are not limited to selective receptor antagonists and antiandrogen drugs.
  • Hormone supplement agents include but are not limited to progestogens, androgens, estrogens, and somatostatin analogs.
  • Aromatase inhibitors are used, for example, to treat breast cancer. Non-limiting examples include letrozole, anastrozole, and aminoglutethimide.
  • GnRH analogs can be used, for example, to induce chemical castration.
  • Selective estrogen receptor antagonists which are commonly used for the treatment of breast cancer, include tamoxifen, raloxifene, toremifene, and fulvestrant.
  • Antiandrogen drugs which bind to and inhibit the androgen receptor, are commonly used to inhibit the growth and survival effects of testosterone on prostate cancer.
  • Non-limiting examples include flutamide, apalutamide, and bicalutamide.
  • the term "differentiating agent” refers to any substance that promotes cell differentiation, which in the context of cancer can promote malignant cells to assume a less stem cell-like state.
  • a non-limiting example of an anti-cancer differentiating agent is retinoic acid.
  • Small molecule drugs generally are pharmacological agents that have a low molecular weight (i.e., less than about 900 daltons).
  • Non-limiting examples of small molecule drugs used to treat cancer include bortezomib (a proteasome inhibitor), imatinib (a tyrosine kinase inhibitor), and seliciclib (a cyclin-dependent kinase inhibitor), and epacadostat (an indoleamine 2,3-dioxygenase (IDOl) inhibitor).
  • the method of treating cancer of the present invention further comprises selecting a whole-cell cancer vaccine for the subject according to a method of the present invention described herein.
  • the subject has stage I, stage II, stage III, and/or stage IV cancer.
  • the cancer is transitioning between stages.
  • the subject has a pre-cancerous lesion.
  • the subject does not have cancer.
  • treating the subject comprises inhibiting cancer cell growth, inhibiting cancer cell proliferation, inhibiting cancer cell migration, inhibiting cancer cell invasion, ameliorating or eliminating the symptoms of cancer, reducing the size (e.g., volume) of a cancer tumor, reducing the number of cancer tumors, reducing the number of cancer cells, inducing cancer cell necrosis, pyroptosis, oncosis, apoptosis, autophagy, or other cell death, or enhancing the therapeutic effects of a composition or pharmaceutical composition.
  • treating the subject results in an increased survival time. In some instances, overall survival is increased. In other instances, disease-free survival is increased. In some instances, progression-free survival is increased. In particular embodiments, treating the subject results in a reduction in tumor volume and/or increased survival time.
  • treating the subject enhances the therapeutic effects of an anti-cancer therapy such as a chemotherapeutic agent, an immunotherapeutic agent, radiotherapy, hormone therapy, a differentiating agent, and/or a small -molecule drug.
  • an anti-cancer therapy such as a chemotherapeutic agent, an immunotherapeutic agent, radiotherapy, hormone therapy, a differentiating agent, and/or a small -molecule drug.
  • Treatment such as modified cancer cell(s), composition(s), and pharmaceutical composition(s) of the present invention can be administered using routes, dosages, and protocols that will readily be known to one of skill in the art. Administration can be conducted once per day, once every two days, once every three days, once every four days, once every five days, once every six days, or once per week. Therapy can be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, or more times per week.
  • modified cancer cell(s), composition(s), and/or pharmaceutical composition(s) of the present invention are administered as a single dose, co-administered (e.g., administered in separate doses or by different routes, but close together in time), or administered separately (e.g., administered in different doses, including the same or different route, but separated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, or more hours).
  • administration can occur, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, or more times in a day.
  • therapeutic administration can occur about once per week, about every two weeks, abpit every three weeks, or about once per month. In other cases, therapeutic administration can occur about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more times per month. Treatment can continue for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, or more weeks; about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12 or more months; or longer. At any time during treatment, the therapeutic plan can be adjusted as necessary.
  • compositions, or pharmaceutical composition(s) of the present invention may be selected, one or more additional therapeutic agents or drugs may be chosen, or any aspect of the therapeutic plan can be discontinued.
  • additional therapeutic agents or drugs may be chosen, or any aspect of the therapeutic plan can be discontinued.
  • One of skill in the art will readily be able to make such decisions, which can be informed by, for example, the results of allele profile comparison, changes in the activity and/or number of an immune cell, and/or changes in the the presence or level of one or more biomarkers.
  • the modified cancer cell(s), comosition(s), and pharmaceutical composition(s) of the present invention can be administered by any suitable route, including those described herein.
  • the administration is by intradermal or intralymphatic injection.
  • the whole-cell cancer vaccine e.g., comprising modified cancer cells of the present invention
  • IFNa interferon alpha
  • the IFNa is injected locally. IFNa can be given before and/or after the vaccine is administered. Timing of the separate injections can be any suitable interval, including those described herein.
  • a dose may include, for example, about 50,000 to 50,000,000 (e.g., about 50,000, 60,000, 70,000, 80,000, 90,000, 100,000, 1 10,000, 120,000, 130,000, 140,000, 150,000, 160,000, 170,000, 180,000, 190,000, 200,000, 250,000, 300,000, 350,000, 400,000, 450,000, 500,000, 550,000, 600,000, 650,000, 700,000, 750,000, 800,000, 850,000, 900,000, 950,000, 1,000,000, 1,500,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 5,500,000, 6,000,000, 6,500,000, 7,000,000, 7,500,000, 8,000,000, 8,500,000, 9,000,000, 9,500,000, 10,000,000, 1 1,000,000, 12,000,000, 13,000,000, 14,000,000, 15,000,000, 16,000,000, 17,000,000, 18,000,000, 19,000,000, 20,000,000, 25,000,000, 30,000,000, 35,000,000, 40,000,000, 45
  • a dose may also include, for example, at least about 5,000,000 to 100,000,000 (e.g., about 5,000,000, 6,000,000, 7,000,000, 8,000,000, 9,000,000, 10,000,000, 15,000,000, 20,000,000, 25,000,000, 30,000,000, 35,000,000, 40,000,000, 45,000,000, 50,000,000, 55,000,000, 60,000,000, 65,000,000, 70,000,000, 75,000,000, 80,000,000, 85,000,000, 90,000,000, 95,000,000, 100,000,000, or more) modified cancer cells.
  • 5,000,000 to 100,000,000 e.g., about 5,000,000, 6,000,000, 7,000,000, 8,000,000, 9,000,000, 10,000,000, 15,000,000, 20,000,000, 25,000,000, 30,000,000, 35,000,000, 40,000,000, 45,000,000, 50,000,000, 55,000,000, 60,000,000, 65,000,000, 70,000,000, 75,000,000, 80,000,000, 85,000,000, 90,000,000, 95,000,000, 100,000,000, or more modified cancer cells.
  • a dose may alternatively include, for example, at least about 100,000,000 to 1,000,000,000 (e.g., about 100,000,000, 150,000,000, 200,000,000, 250,000,000, 300,000,000, 350,000,000, 400,000,000, 450,000,000, 500,000,000, 550,000,000, 600,000,000, 650,000,000, 700,000,000, 750,000,000, 800,000,000, 850,000,000, 900,000,000, 950,000,000, 1,000,000,000, or more) mofified cancer cells.
  • the modified cancer cells are irradiated.
  • the irradiation dose may be, for example, between about 2 and 2,000 Gy ⁇ e.g., about, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1, 100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, or 2,000 Gy).
  • the modified cancer cells are irradiated with a dose of about 200 Gy.
  • treating the subject results in a decrease in the presence or level of one or more biomarkers measured or detected in a sample obtained from the subject. In some embodiments, treating the subject results in an increase in the presence or level of one or more biomarkers measured or detected in a sample obtained from the subject. In particular embodiments, treating the subject results in no change the presence or level of the one or more biomarkers.
  • treating the subject results in an increase in the activity and/or number of one or more immune cells.
  • the increase is produced in one cell type.
  • the increase is produced in multiple cell types.
  • the cell in which the level of activity and/or number is increased is selected from the group consisting of a peripheral blood mononuclear cell (PBMC), a lymphocyte (e.g. T lymphocyte, B lymphocyte, K cell), a monocyte, a dendritic cell, a macrophage, a myeloid-derived suppressor cell (MDSC), and a combination thereof.
  • PBMC peripheral blood mononuclear cell
  • lymphocyte e.g. T lymphocyte, B lymphocyte, K cell
  • monocyte e.g. T lymphocyte, B lymphocyte, K cell
  • MDSC myeloid-derived suppressor cell
  • the level of activity and/or number of immune cell(s) is measured using methods of the present invention described herein.
  • an increase in immune cell activity and/or number indicates that the subject should be administered one or more additional doses of the pharmaceutical composition (e.g., comprising modified cancer cells of the present invention).
  • a different vaccine is administered.
  • an increase in immune cell activity and/or number will occur, in some instances, after 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14,or more doses of the vaccine have been administered.
  • a sample is obtained from the subject. In other embodiments, a sample is obtained from a different subject or a population of subjects. Samples can be used for the purposes of selecting an appropriate cancer vaccine of the present invention, monitoring the response to vaccine therapy, and/or predicting how the subject will respond to vaccine therapy. Samples obtained from a different subject and/or a population of subjects can be used, for example, to establish reference ranges to facilitate comparisons that are part of the methods of the present invention. Samples can be obtained at any time, including before and/or after administration of the modified cancer cell(s), pharmaceutical composition(s), and/or other composition(s) of the present invention.
  • the sample comprises whole blood, plasma, serum, cerebrospinal fluid, tissue, saliva, buccal cells, tumor tissue, urine, fluid obtained from a pleural effusion, hair, skin, or a combination thereof.
  • the sample can comprise any biofluid.
  • any cell, tissue, or biofluid type is suitable, as long as it contains a sufficient amount of DNA or RNA to allow typing.
  • the sample comprises circulating tumor cells (CTCs).
  • CTCs circulating tumor cells
  • the sample can also be made up of a combination of normal and cancer cells.
  • the sample comprises circulating tumor cells (CTCs).
  • the sample can be obtained, for example, from a biopsy, from a surgical resection, and/or as a fine needle aspirate (FNA). Samples can be used to determine, measure, or detect HLA allele(s), immune cell activity and/or number, and/or biomarker(s), as described herein.
  • FNA fine needle aspirate
  • the results of the HLA typing e.g., the alleles present in an allele profile, the results of a comparison of allele profiles
  • immune cell activity and/or number measurement, and/or biomarker presence or level determinations are recorded in a tangible medium.
  • the results of assays e.g., the alleles present in an allele profile, the results of a comparison of allele profiles, the activity level and/or number of immune cells, the presence or level (e.g., expression) of one or more biomarkers) and/or a prognosis or diagnosis (e.g., of whether or not there is the presence of cancer, the prediction of whether the subject will respond to a vaccine, or whether the subject is responding to a vaccine) can be recorded, e.g. , on paper or on electronic media (e.g., audio tape, a computer disk, a CD, a flash drive, etc.).
  • electronic media e.g., audio tape, a computer disk, a CD, a flash drive, etc.
  • the methods further comprise the step of providing the results of assays, prognosis, and/or diagnosis to the patient (i.e., the subject) and/or the results of treatment.
  • the invention provides a kit for treating a subject with cancer.
  • the kit comprises a modified cancer cell, a composition, and/or a pharmaceutical composition of the present invention described herein.
  • the kits are useful for treating any cancer, some non-limiting examples of which include breast cancer, ovarian cancer, cervical cancer, prostate cancer, pancreatic cancer, colorectal cancer, gastric cancer, lung cancer, skin cancer, liver cancer, brain cancer, eye cancer, soft tissue cancer, renal cancer, bladder cancer, head and neck cancer, mesothelioma, acute leukemia, chronic leukemia, medulloblastoma, multiple myeloma, sarcoma, and any other cancer described herein, including a combination thereof.
  • kits Materials and reagents to carry out the various methods of the present invention can be provided in kits to facilitate execution of the methods.
  • kit includes a combination of articles that facilitates a process, assay, analysis, or manipulation.
  • kits of the present invention find utility in a wide range of applications including, for example, diagnostics, prognostics, therapy, and the like.
  • Kits can contain chemical reagents as well as other components.
  • the kits of the present invention can include, without limitation, instructions to the kit user, apparatus and reagents for sample collection and/or purification, apparatus and reagents for product collection and/or purification, apparatus and reagents for administering modified cancer cell(s) or other composition(s) of the present invention, apparatus and reagents for determining the level(s) of biomarker(s) and/or the activity and/or number of immune cells, apparatus and reagents for detecting HLA alleles, sample tubes, holders, trays, racks, dishes, plates, solutions, buffers or other chemical reagents, suitable samples to be used for standardization, normalization, and/or control samples.
  • Kits of the present invention can also be packaged for convenient storage and safe shipping, for example, in a box having a lid.
  • kits also contain negative and positive control samples for detection of HLA alleles, immune cell activity and/or number, and/or the presence or level of biomarkers.
  • the negative control samples are non-cancer cells, tissue, or biofluid obtained from the subject who is to be treated or is already undergoing treatment.
  • the negative control samples are obtained from individuals or groups of individuals who do not have cancer.
  • the positive control samples are obtained from the subject, or other individuals or groups of individuals, who have cancer.
  • kits contain samples for the preparation of a titrated curve of one or more biomarkers in a sample, to assist in the evaluation of quantified levels of the activity and/or number of one or more immune cells and/or biomarkers in a biological sample.
  • the present invention provides a method for determining the HER2 status of a sample cell.
  • the method comprises:
  • step (b) comparing the presence or level of the one or more biomarkers detected in step (a) to the presence or level of the one or more biomarkers in a reference cell;
  • step (c) determining the HER2 status of the sample cell based upon the comparison performed in step (b).
  • the sample cell is a cancer cell.
  • the sample cell is obtained from a subject who has cancer.
  • the sample cell can be obtained as a biopsy specimen, by surgical resection, or as a fine needle aspirate (FNA).
  • the sample cell is a circulating tumor cell (CTC).
  • the sample cell is determined to be HER2 positive when the one or more biomarkers is expressed at a higher level in the sample cell compared to the reference cell. In other embodiments, the cell is determined to be HER2 positive when the expression of the one or more biomarkers is overexpressed at least about 1.5-fold (e.g., about 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45- fold, 50-fold, 55-fold, 60-fold, 65-fold, 70-fold, 75-fold, 80-fold, 85-fold, 90-fold
  • the cell is determined to be overexpressing or not overexpressing HER2.
  • the cell is determined to be HER2 3+, HER2 2+, HER2 1+, or HER2 0 (i.e., HER is not overexpressed).
  • the level of the one or more biomarkers is higher in a HER2 3+ cell than in a HER2 2+ cell.
  • the level of the one or more biomarkers is higher in a HER2 2+ cell than in a HER2 1+ cell or HER2 0 cell.
  • the reference cell is a non-cancer cell obtained from the same subject as the sample cell.
  • measuring expression comprises, for example, measuring mRNA expression, protein abundance, or a combination thereof. Some examples of suitable methods for measuring expression are described herein.
  • the determination of HER2 status is made with a sensitivity of at least about 60% (e.g., about 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%).
  • the determination of HER2 status is made with a sensitivity of at least about 80% (e.g., about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%).
  • the determination of HER2 status is made with a sensitivity of at least about 90% (e.g., about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%).
  • the sensitivity is at least about 60%. In other instances, the sensitivity is at least about 87%. In some instances, the sensitivity is about 100%.
  • one or more aspects of the detection step are automated.
  • one or more aspects of the comparison step are automated.
  • one or more aspects of the determining step are automated.
  • Non-limiting examples of aspects or steps that can be automated include sample gathering, sample isolation, sample processing, one or more methods of mRNA detection, one or more methods of protein detection, quantification and/or comparison of the levels of one or more biomarkers to reference values, and processing of expression level values to determine the HER2 status of the cell.
  • Example 1 SV-BR-l-GM (BriaVax), a GM-CSF-secreting whole-cell vaccine, expresses an immune signature and matches at both HLA I and II alleles with a stage IV breast cancer patient with systemic tumor regression following SV-BR-l-GM inoculation.
  • Cancer immunotherapy with allogeneic whole-cell vaccines is an effective approach to reduce tumor burden. It is generally assumed that to be effective, the vaccine needs to express immunogenic antigens co-expressed in patient tumor cells, and that antigen- presenting cells (APC) such as dendritic cells (DCs) need to cross-present such antigens following uptake of vaccine cell fragments.
  • APC antigen- presenting cells
  • DCs dendritic cells
  • SV-BR-l-GM cells expressed sets of genes predicting the presence of both major histocompatibility complex (MHC) class I (i.e., B2M, HLA-A, HLA-B) and class II (i.e., HLA- DRA, HLA-DRB3, HLA-DMA, HLA-DMB) molecules. Additionally, the vaccine expressed several other factors with immune-modulatory functions including ADGRE5 (CD97), CD58 (LFA3), CD74 (invariant chain and CLIP), CD83, CXCL16, HLA-F, IL6, IL10, IL15, IL18, CXCL16, and TNFSF14 (LIGHT).
  • MHC major histocompatibility complex
  • SV-BR-l-GM and the study subject with the most pronounced clinical response both carried HLA-A * 11:01 and HLA-DRB3*02:02 alleles.
  • SV-BR-l-GM cells overexpressed several genes known to encode tumor-associated antigens (TAAs) such as PRAME, a cancer/testis antigen. Additionally, genes encoding potentially novel TAAs were identified.
  • TAAs tumor-associated antigens
  • SV-BR-l-GM cells Despite their breast origin, SV-BR-l-GM cells not only expressed TAAs but also a set of biomarkers including HLA class I and II alleles known for their immune-stimulatory roles in APCs. This suggests that the partial HLA allele match between SV-BR-l-GM and the special clinical responder enabled patient T lymphocytes to directly recognize TAAs as presented by the vaccine's MHC system.
  • SV-BR-l-GM cells can act directly as APCs, and/or that APCs such as DCs can cross-dress by means of trogocytosis with peptide-loaded MHCs from SV-BR-l-GM cells.
  • cancer immunotherapy In contrast to traditional chemo- or radiation therapies that kill fast-dividing cells irrespective of whether they are cancerous or normal, the goal of cancer immunotherapy is to eradicate tumors based on the malignant cells' antigenic makeup. Tumor-selectivity of the latter approach is variable and depends on the antigens targeted. For instance, while cancer/testis antigens (CTAs) such as MAGE-A and NY-ESO-1 may be specifically expressed in certain tumors but not in the corresponding normal tissues, the prototypical target for the chimeric antigen receptor (CAR)-T cell approach, CD 19 is expressed in both malignant and normal B cells. To compensate for the loss of normal B cells, B cell aplasia following CAR-T cell-based targeting of CD 19 is treated with immunoglobulin replacement
  • TAAs tumor-associated antigens
  • CARs (1, 2) and bispecific antibodies that crosslink cytotoxic T cells with cancer cells (3) rely on the presence of cell surface antigens, ectopic T cell receptor (TCR); 4), tumor- infiltrating lymphocyte (TIL; 5, 6), and vaccine-based approaches (7-18) require the display of antigenic peptides by major histocompatibility complexes (MHCs), regardless of whether the peptides represent intra- or extracellular TAAs.
  • MHCs major histocompatibility complexes
  • immune checkpoint inhibitors such as the anti-PD-1 antibodies nivolumab and pembrolizumab and the anti-CTLA-4 antibody ipilimumab are designed to prevent inhibition of effector T cells without discriminating between T cells recognizing MHC-bound peptides from intra- versus from extracellular antigens (19).
  • Whole-cell vaccines comprising live but irradiated cancer cells express a very large number of antigens, of which some may be co-expressed in the tumor. Whereas a tumor shielded by an immune-suppressive microenvironment may not elicit an immune response, whole-cell vaccines (20), if injected into immune-permissive sites, may do so. However, even though an immune response induced by the vaccine may have a tumor-directed component, the exact nature of the antigens mediating that effect may not be known.
  • Autologous vaccines derived from the tumor of the patient to be treated, are expected to express relevant antigens including patient-specific neoepitopes, but may not be effective in overcoming immunosuppression to evoke an effective immune response.
  • allogeneic vaccines that are engineered to express granulocyte-macrophage colony-stimulating factor (GM-CSF) may induce strong immune responses by promoting antigen display on dendritic cells (DCs), they may lack key antigens (15).
  • GM-CSF granulocyte-macrophage colony-stimulating factor
  • GVAX allogeneic whole-cell vaccines engineered to express GM-CSF
  • a cell line from a chest wall lesion of a metastatic breast cancer patient (17) has been previously established.
  • the cell line referred to as SV-BR-1
  • SV-BR-1 is estrogen receptor (ER)/progesterone receptor (PR) negative and very strongly HER2/neu (ERBB2) positive (17).
  • ER estrogen receptor
  • PR progesterone receptor
  • ERBB2 very strongly HER2/neu
  • SV-BR-1 cells were genetically engineered to stably overexpress GM-CSF, yielding the SV-BR-1 -GM (BriaVax) line.
  • BB-IND 2749 irradiated parental SV-BR-1
  • BB-IND 10312 SV-BR-l-GM
  • SV-BR-l-GM Described herein is a molecular fingerprint of SV-BR-l-GM established with samples representing developmental intermediates or final product, such as the master cell bank or clinical product lots, respectively.
  • APCs antigen-presenting cells
  • SV-BR-l-GM cells express a set of genes including HLA class I and II components associated with immune cells rather than with epithelial cells.
  • HLA alleles matching those of SV-BR-l-GM at both class I and II loci.
  • the polyclonal SV-BR-1 cell line was established from a chest wall lesion of a female metastatic breast cancer patient. As depicted in FIG. 1A, the SV-BR-l-GM cell line was derived from SV-BR-1 cells following stable transfection with the CSF2 gene that encodes human GM-CSF and zeocin-selection (see, e.g., U.S. Patent No. 7,674,456, U.S. Patent Application No. 10/868,094, both of which are hereby incorporated by reference in their entirety for all purposes and (16, 17)). Since it was not clonally selected, it had likely experienced substantial clonal drift during expansion.
  • GM-CSF was expected to be a major factor (15). Therefore, for clinical use of the cell line as a vaccine, GM-CSF production was assessed by ELISA using culture supernatant as assay input.
  • GM-CSF signaling involves GM-CSF binding to the a subunit of its receptor and recruitment of the receptor's a subunit (26). Whereas a restricted region in GM-CSF's first a helix was suggested to interact with the receptor's a subunit, several regions further downstream contact the a subunit (27).
  • NCBI Reference Sequence of GM- CSF see, NCBI Reference No. NP_000749.2
  • SV-BR-l-GM's ectopic GM-CSF sequence varied at positions 53 (i.e., Thr instead of Met) and 117 (i.e., Thr instead of He).
  • position 53 mapped between the first ⁇ -pleated sheet (i.e., amino acids 39-43) and the second a helix (i.e., amino acids 55-64), and was not implicated in binding of GM-CSF to the receptor's a subunit, position 117 mapped to a region associated with receptor binding (27), thus raising the question of whether receptor binding and thereby signaling could still occur with the threonine at position 117.
  • cell culture supernatant from irradiated SV-BR-l-GM cells supported the proliferation of MUTZ-3 cells, a cell line reported to depend on cytokines such as GM-CSF (28), whereas supernatant from parental SV-BR-1 cells (i.e., not engineered to express GM- CSF) had at most a minimal effect .
  • FIG. 1A depicts SV-BR-l-GM samples for which gene expression profiles were generated and their genealogy. Lots derived from the master cell bank (MCB) were designated "Clinical Product" (CP) lots. Additionally, MCB-independent research (RES) banks were generated. Morphologies of SV-BR-l-GM cells after serum starvation are shown in FIG. IB.
  • SV-BR-l-GM expresses a 24-gene signature associated with immune-stimulatory functions
  • SV-BR-l-GM cells expressed several genes with known immune system-associated roles (e.g., genes involved in MHC class II-based antigen presentation by APCs such as dendritic cells (DCs)).
  • genes involved in MHC class II-based antigen presentation by APCs such as dendritic cells (DCs)
  • DCs dendritic cells
  • H LA-DMA, HLA-DRA, and CD74 which gives rise to invariant chain (Ii) and class II-associated invariant chain peptide (CLIP).
  • a database was generated that contained 111 genes with known immune- stimulatory roles (29-70) (Table 2).
  • genes were included that encode (a) cell surface ligands for T cell co-stimulatory receptors or other cell surface-associated factors known to positively stimulate T cells (i.e., those that support T cell activation rather than inhibition), (b) cytokines and other soluble (i.e., free) factors that have positive T cell- stimulatory functions such as supporting activation, promoting survival, and/or inducing chemotaxis, (c) factors that promote the maturation, survival, chemotaxis, and/or in vitro generation of DCs, and (d) factors that promote antigen presentation.
  • HLA class I B2M, HLA-A, HLA-B, HLA-F
  • HLA-DMA HLA-DRA
  • the confirmatory experiment was conducted on a subset of the SV-BR-l-GM samples used for Illumina® microarray analysis and with RNA from MCF7 cells (i.e., a breast cancer cell line carrying the HLA-DRB3*0202 allele (72)) as a calibrator sample.
  • MCF7 cells i.e., a breast cancer cell line carrying the HLA-DRB3*0202 allele (72)
  • RNA from MCF7 cells i.e., a breast cancer cell line carrying the HLA-DRB3*0202 allele (72)
  • RNA from MCF7 cells i.e., a breast cancer cell line carrying the HLA-DRB3*0202 allele (72)
  • RNA from MCF7 cells i.e., a breast cancer cell line carrying the HLA-DRB3*0202 allele (72)
  • TaqMan® primer/probe sets were employed (Tables 3 and 4).
  • all MHC class II-related transcripts analyzed e.g.
  • HLA-DRB3 and CSF2 were also considered to be relevant immune-stimulatory factors contributing to the efficacy of the SV-BR-l-GM (BriaVax) cancer vaccine.
  • the complete 24-gene "immune signature" is shown in Table 5.
  • HLA-DRB3 HLA-DR1B, HLA-DR3B beta 3
  • CDA12 HLA-5.4, HLA-CDA12,
  • HLA-F major histocompatibility complex class I, F
  • BSF-2 BSF2, CDF, HGF, HSF,
  • IL10 interleukin 10 CSIF IL10 interleukin 10 CSIF, GVHDS, IL-10A, TGIF
  • HLA allele matches between SV-BR-l-GM and a robust clinical responder
  • HLA-DRB3 protein was identified in a paraffin-embedded tumor specimen from clinical trial subject A002. As shown in FIG. 8, HLA-DRB3 immunoreactivity was indeed apparent, thus further demonstrating the role of HLA class II in the MoA of SV-BR-l-GM (BriaVax). Table 6: HLA alleles
  • Table 6 above lists HLA alleles of SV-BR-l-GM (BriaVax) and peripheral blood cells from 4 study subjects (ClinicalTrials.gov Identifier: NCT00095862) that were identified.
  • Subject A002 with both HLA-A and HLA-DRB3 matches, responded to SV-BR-l-GM inoculation with substantial tumor regression.
  • the "Dx to Vac” column shows the time intervals from the initial cancer diagnosis to the first SV-BR-l-GM inoculation. "+” indicates allele level and "(+)" indicates allele group level identity with SV-BR-l-GM.
  • CTAs Cancer/testis antigens
  • CTAs represent a class of antigens with physiological expression predominantly restricted to testicular or placental tissue and, for a subset, brain tissue.
  • CTAs will become upregulated following malignant conversion of cells from a variety of organs.
  • immune-stimulatory roles have been established (6,73-79).
  • the mRNA expression levels of 279 confirmed or putative CTAs (Table 7) were assessed in SV-BR-l-GM cells and compared to expression in several other breast cancer cell lines and normal breast cells.
  • GEO datasets of both cultured (i.e., GSE56718 (80) and GSE48398 (MCF10A)) and noncultured (i.e., GSE35399 (81)) normal breast cells were utilized.
  • the CTA genes chosen for the analysis were selected from those described by (79) and (78), those listed in the CT database (77), and those represented by the nCounter ® Human PanCancer Immune Profiling Panel (obtained from NanoString Technologies ® , Seattle, WA).
  • CTAs fulfilling all of the following criteria: 1) representative transcript level in SV-BR-l-GM cells greater than 1.5 times the background cutoff value, 2) representative transcript level in SV-BR-l-GM cells greater than 1.5 times the maximal transcript level among the noncultured (NC) normal breast cell types (SV-BR-l- GM/Max), 3) maximal transcript level among the NC normal breast cell types less than 1.5 times the background cutoff value, whereby the maximal NC transcript level was established among the representative values of each sample type ⁇ see, section titled "Sample Representation" in "Methods” section below).
  • C denotes cultured normal cell types ⁇ i.e., MCF10A from GEO dataset GSE48398, and " early _proliferating” and "deep senescence” human mammary epithelial cells (HMECs) from GSE56718 (80)).
  • NC denotes noncultured normal cell types (i.e., ALDH EG, ALDH POS, ERBB3 EG, NCL, BASAL, STROMAL from GSE35399 (81)).
  • the background cutoff value was 141.16.
  • Tables 13 and 14 provide further evidence of the importance of the 20 in silico validated TAAs.
  • ERBB2, MIEN J, and PGAP3 (bolded entries), which are all localized to chromosome 17ql2, exhibited a trend in which they were most highly expressed in Her2 3+ tumors, less so in Her 2 2+ tumors, and the least in Her 2 0-1+ tumors.
  • Table 14 provides comparisons within Her2 2+ tumors (i.e., overall, FISH positive and negative samples), and shows that the 95% confidence intervals (CIs) of ERBB2, MIEN1, and PGAP3 were higher for the Her2 FISH+ than for the Her2 FISH- cancer group.
  • CIs 95% confidence intervals
  • Allogeneic whole-cell cancer vaccines express a wide variety of antigens, of which some may be TAAs co-expressed in patient tumors. However, whether or not an effective immune response is mounted against such TAAs depends on numerous factors. This example indicated that HLA allele identity between the vaccine and the patient was a significant factor.
  • subject A002 objective tumor regression following SV-BR-l-GM (BriaVax) inoculation was only observed in one patient (16), referred to as subject A002 in this article.
  • subject A002 carried both HLA class I (i.e., HLA-A * 11:01) and class II (i.e., HLA-DRB3*02:02) alleles that were also present in the vaccine (Table 6; FIG. 11 A).
  • HLA class I i.e., HLA-A * 11:01
  • class II i.e., HLA-DRB3*02:02
  • TAAs were displayed on vaccine cell surface MHCs where they could directly and/or indirectly (upon "cross-dressing", i.e., upon trogocytosis- based transfer onto APCs such as dendritic cells) activate T cells (FIG. 11B) (83-85).
  • cross-dressing i.e., upon trogocytosis- based transfer onto APCs such as dendritic cells
  • APCs such as dendritic cells
  • other mechanisms may have contributed to the immune-stimulatory effects of the vaccine.
  • cross-presentation whereby cellular fragments from the vaccine are endocytosed by APCs, processed, then corresponding peptide antigens loaded onto MHC molecules, may also have played a substantial role (FIG. 11C) (85, 86).
  • allele combination frequencies range from 5.4-31.0% (i.e., the probability that a randomly selected individual carries at least one of SV-BR-l-GM's HLA class I and one of its HLA class II alleles is 5.4-31.0% depending on the ethnic group).
  • combination frequencies range from 12.8-37.7%.
  • Table 15 Frequencies of HLA allele combinations
  • phenotype frequencies as percentage values. See the section titled “Methods” below for details on the calculations.
  • AAFA denotes African American
  • AFB denotes African
  • AINDI denotes South Asian Indian
  • AMIND denotes North American Indian
  • CARB denotes Caribbean black
  • CARHIS denotes Caribbean Hispanic
  • EURCAU denotes European Caucasian
  • FILII denotes Filipino
  • JAPI denotes Japanese
  • KORI denotes Korean
  • MENAFC denotes Middle Eastern or N. Coast of Africa
  • MSWHIS denotes Mexican or Chicano
  • NCHI denotes Chinese
  • SCAHIS denotes Hispanic - South or Central American
  • SCSEAI denotes Southeast Asian
  • VIET denotes Vietnamese.
  • Immunologic tolerance is a double-edged sword. Its underlying mechanisms prevent both autologous antigens from evoking an immune response (autoimmunity) and the recognition of tumors by the immune system.
  • Several methods to break tolerance have been described, including the use of immune checkpoint inhibitors or monoclonal antibodies delivering co-stimulatory signals to T cells (92).
  • immune checkpoint inhibitors or monoclonal antibodies delivering co-stimulatory signals to T cells (92).
  • GM-CSF secreted by the vaccine has been attributed a major role in overcoming immune tolerance (9).
  • GVAX whole-cell vaccines express a vast array of antigens co- expressed on healthy cells one would imagine that autoimmunity may accompany such treatments.
  • a two-tier microarray-based in silico approach was employed to examine whether TAAs responsible for the vaccine's anti -tumor effect induced an immune response due to an overexpression-mediated break of tolerance.
  • genes upregulated in SV-BR-l-GM cells relative to normal breast cells were identified. This was accomplished by comparing several different lots of SV-BR-l-GM to a variety of normal human breast cell types.
  • Second, the genes with apparently higher expression levels in SV-BR-l-GM compared with normal breast cells were subjected to a validation step for which the genes' expression levels in breast cancer were compared to those of normal tissues of various organs.
  • ERBB2 HER2lneu ⁇ MIEN1 (C170RF37), and PGAP3 (PERLDl)
  • FIG. 10 This indicated that not only was ERBB2 overexpressed in a subset of breast cancers, but so were other candidate TAAs located in the vicinity of ERBB2 (93, 94).
  • ERBB2 also known as HER2
  • IHC immunohistochemistry
  • MIEN1 and/or PGAP3 were used for the analysis (either alone, in combination with each other, or in combination with ERBB2), then sensitivity was improved. MIEN1 and PGAP3 alone (i.e., instead of ERBB2) resulted in a sensitivity of 87%. Similarly, combinations of ERBB2 and MIEN1 or ERBB2 and PGAP3 resulted in sensitivities of 87%. A combination of MIEN1 and PGAP3 or a combination of all three biomarkers resulted in a sensitivity of 100%). Clearly, these biomarkers afford superior sensitivity over current IHC or FISH assays, as well as ERBB2 alone when measuring mRNA levels.
  • CTAs Cancer/testis antigens
  • gene expression profiles of a set of 279 CTAs (Table 7) were analyzed, several CTAs, most notably PRAME, were found to be selectively expressed in SV-BR-l-GM compared to normal breast cells (FIG. 9 and Table 8).
  • PRAME did not appear in the stringent in silico screen because of the 54 breast cancer specimens analyzed, PRAME expression was restricted to only 11 (20%>) samples, of which only 2 (4%>) demonstrated appreciable expression levels. Furthermore, at least some of the CTAs had low expression levels in SV-BR-l-GM cells (FIG. 9). However, as demonstrated by Groeper et al, CTA-specific tumor-infiltrating lymphocytes (TILs) could even be expanded from tumors with undetectable CTA levels (6).
  • TILs tumor-infiltrating lymphocytes
  • the study presented here provides evidence that the tumor-directed effect observed following inoculation with the SV-BR-l-GM vaccine and reported previously (16) is mediated by the vaccine's "immune signature", which includes factors ranging from HLA class I and II components to ligands for T cell co-stimulatory receptors and chemokines known to promote attraction of immune cells, and by TAAs such as PRAME.
  • SV-BR-l-GM cells Unlike other established breast cancer cell lines, SV-BR-l-GM cells not only expressed known and putative TAAs but also a collection of factors with known roles in promoting immune responses. Most notably, in addition to HLA class I factors, class II genes such as HLA-DMA and -DMB were also expressed. Since HLA class II components are associated with bone fide antigen-presenting cells such as DCs, their expression in SV- BR-l-GM cells was surprising and points toward a unique mechanism of action.
  • SV-BR-l-GM lots were manufactured in RPMI-1640 supplemented with 10% FBS and L-glutamine or Gibco ® GlutaMAXTM (obtained from Thermo Fisher Scientific, Waltham, MA). Typically, a fraction ⁇ e.g., about 50%) of such culture medium was pre-conditioned by SV-BR-l-GM cells at the time of medium change.
  • SV-BR-l-GM cells were expanded from cryopreserved cell suspensions starting from T-25 flasks with sequential propagation in larger flasks and harvesting from about thirty T-150 flasks. Lots were expanded also starting from small tissue culture vessels and were scaled to and further expanded in T-225 flasks. The final expansion step was conducted in 10-STACK CellSTACK ® Culture Chambers (obtained from Corning Inc., Corning, NY).
  • SV-BR-l-GM cells obtained directly from cryogenic vials following recovery from liquid nitrogen or harvested from cultures, were lysed in Buffer RLT (obtained from Qiagen, Valencia, CA) with or without supplementation with ⁇ -mercaptoethanol (obtained from Bio- Rad Laboratories, Hercules, CA).
  • Buffer RLT obtained from Qiagen, Valencia, CA
  • ⁇ -mercaptoethanol obtained from Bio- Rad Laboratories, Hercules, CA
  • Total RNA was isolated from lysates via RNeasy Mini Kits (obtained from Qiagen) then subjected to microarray hybridization.
  • RNA was amplified, biotin-labeled, Cy3 -labeled, then hybridized onto HumanHT-12 v4 Expression BeadChip arrays (obtained from Illumina ® , San Diego, CA).
  • Fluorescent signal intensities were acquired on an Illumina ® iScan array scanner. Average signal intensities and detection p-values were calculated using Illumina ® GenomeStudio software. Thereafter, non- normalized data sets passing quality control (QC) criteria as defined below were analyzed with various modules of GenePattern software using the public server portal at www.broadinstitute.org/cancer/software/genepattern (99). If applicable, datasets to be compared were merged using the MergeColumns version 1 module.
  • QC quality control
  • Expression levels of all Illumina ® samples to be cross-compared were quantile-normalized using the IlluminaNormalizer software version 2 (beta) module, then further processed in Microsoft Excel and/or subjected to log transformation and hierarchical clustering via the HierarchicalClustering software version 6 module (i.e., distance correlation: Pearson correlation; clustering method: Pairwise average-linkage). Heat maps and dendrograms of clustered data were generated using the HierarchicalClustering Viewer software version 11 module.
  • a gene was defined as being expressed if at least one corresponding probe yielded a quantile-normalized expression value above the median "expression" level among all human RNA-targeting, non-control, probes (max. 47,323 for the HumanHT-12 v4 Expression BeadChip arrays, Illumina ® ).
  • This background cutoff definition coincided with the rough estimate that approximately 50% of the genes in a tissue are expressed (100).
  • this definition likely overestimates the extent of actual background. Nevertheless, consequently, it reduced the probability of calling non-expressed genes expressed.
  • RNA integrity Number equivalent (REST 6 ) value of less than 7.5 were excluded from further analysis. Additionally, for SV-BR-l-GM samples as well as samples obtained via GEO (NCBI) and processed on HumanHT-12 v.4 BeadChips, non-normalized data sets were assessed for gene expression variability. Except for the analysis shown in FIG. 1C, low- variability samples were excluded from further processing. Low-variability was defined as a ratio between the expression value at the 95 th percentile and the value at the 5 th percentile of less than 10.
  • HMECs human mammary epithelial cell samples
  • Normal breast sample types i.e., ALDH NEG, ALDH POS, ERBB3 NEG, NCL, BASAL, and STROMAL
  • FIGS. 9B-9E where arithmetic means and standard errors of the means (SEMs) are shown.
  • Validation of the genes retained after medium-stringency filtration was done via the quotients of the representative breast cancer samples in GSE2943 and those of the quantile-normalized and grouped normal tissues in GEO dataset GSE7307 (i.e., high-stringency filter). Groups of normal tissues are listed in Table 11 and the twenty genes retained after high-stringency filtration in Table 12.
  • CTAs Cancer/Testis Antigens
  • HLA-DRB3 expression on tumor specimens was assessed on paraffin-embedded tissue by immunohistochemistry using a rabbit polyclonal antibody raised against an N-terminal region of human HLA-DRB3 (Product code: ab 196601; obtained Abeam, Cambridge, MA). Frequencies of HLA allele combinations
  • alleles and allele groups are both referred to as "alleles”, and the sums of the individual SV-BR-l-GM JZL4-.4, -B, and -DRB3 allele frequencies are referred to as ⁇ faA, ⁇ faB, and ⁇ faDRB3, respectively.
  • fp 1 - (1 - ⁇ faDRB3) 2 , whereby (1 - ⁇ faDRB3) 2 is the probability that no SV-BR-l-GM HLA-DRB3 allele is present per individual, and, conversely, 1 -
  • 1 - ⁇ faA [1 - (1 - ⁇ faA) 2 x (1 - ⁇ faB) 2 ] x [1 - (1 - ⁇ faDRB3) 2 ], whereby 1 - (1 - ⁇ faA) 2 x (1 - ⁇ faB) 2 indicates the probability that an individual carries at least one SV-BR-l-GM HLA-A or -B allele and 1 - (1 -
  • APC Antigen-Presenting Cell DC: Dendritic Cell
  • HGNC Human Genome Organisation (HUGO) Gene Nomenclature Committee
  • HLA Human Leukocyte Antigen
  • HMEC Human Mammary Epithelial Cell
  • MoA Major Histocompatibility Complex
  • RT-PCR Reverse Transcription-Polymerase Chain Reaction
  • TAA Tumor-Associated Antigen
  • Table 13 95% confidence intervals of in silico validated TAA candidates in normal and breast cancer tissues (Her2 3+, 2+, and 0-1+)
  • GEO DataSet GSE2943 was used to establish the breast cancer expression values. 151 samples from GSE7307 were selected for the normal tissues. These 151 samples represented 44 different categories of tissues ⁇ i.
  • adipose adrenal gland
  • artery e.g., adipose
  • bone marrow e.g., adipose
  • brain e.g., adipose
  • cervix e.g., endometrium, esophagus, fallopian tube
  • gut heart
  • immune cells joint, kidney, liver, lung, lymph node, mucosa, nerve, ovary, pancreas, penis, peritoneum, pituitary gland, placenta, prostate, retrocervical infiltrate, salivary gland, skeletal muscle, skin, spleen, stomach, testis, thymus, thyroid gland, tongue, tonsil, trachea, urethra, uterus, vagina, vein, vulva).
  • each category was represented by its highest expression value.
  • the 95% CIs of ERBB2, MIEN J, and PGAP3 were highest for the Her2 3+ and lowest for the Her2 0-1+ cancer groups.
  • Table 14 95% confidence intervals of in silico validated TAA candidates in normal and breast cancer tissues (FISH positive and negative Her2 2+)
  • adipose adrenal gland, artery, bone marrow, brain, breast, cervix, endometrium, esophagus, fallopian tube, gut, heart, immune cells, joint, kidney, liver, lung, lymph node, mucosa, nerve, ovary, pancreas, penis, peritoneum, pituitary gland, placenta, prostate, retrocervical infiltrate, salivary gland, skeletal muscle, skin, spleen, stomach, testis, thymus, thyroid gland, tongue, tonsil, trachea, urethra, uterus, vagina, vein, vulva).
  • the 95% CIs of ERBB2, MIEN1, and PGAP3 were higher for the Her2 FISH+ than for the Her2 FISH- cancer group.
  • Example 2 Overexpression of HLA-A*02:01 and HLA-DRB3*02:02 via stable transfection.
  • HLA-A*02:01 is a particularly prevalent HLA-A allele among 16 ethnic groups living in the U.S. (3.5-27.5%, median: 13.6%), with highest prevalence in the North American Indian group (27.8%) followed by the European Caucasian group (27.6%).
  • HLA-DRB3*02:02 is the most prevalent HLA-DRB3 allele among the same 16 groups (10.4-34.5%), median: 20.0%>), with highest prevalence in the Middle Eastern or N. Coast of Africa group (34.5%>) followed by the South Asian Indian group (27.2%).
  • HLA-DRB3*02:02 prevalence in the North American Indian and European Caucasian groups were reported to be 14.5% and 18.2%, respectively (Table 16).
  • AAFA African American
  • AFB African
  • AINDI denotes South Asian Indian
  • AMINE North American Indian
  • CARB denotes Caribbean black
  • CARHIS Caribbean Hispanic
  • EURCAU denotes European Caucasian
  • FILII European Caucasian
  • JAPI JAPI denotes Vietnamese
  • MENAFC Middle Eastern or N. Coast of Africa
  • MSWHIS denotes Mexican or Chicano
  • NCHI denotes Chinese
  • SCAHIS denotes Hispanic - South or Central American
  • SCSEAI denotes Southeast Asian
  • VIET denotes Vietnamese.
  • the "g” in some of the allele designations refers to the inclusion of alleles with different designations but with amino acids identical in the antigen recognition site to the alleles listed.
  • Phenotype frequencies defined by the presence of at least one copy of the respective allele(s) per individual (2n), of HLA-A / HLA-DRB3 allele combinations are indicated in Table 17.
  • Table 17 Phenotype frequencies, defined by the presence of at least one copy of the respective allele(s) per individual (2n), of HLA-A / HLA-DRB3 allele combinations are indicated in Table 17.
  • HLA-A*02:01/HLA- DRB3*02:02 has the highest prevalence among the 16 ethnic groups addressed above.
  • trogocytosis i.e., "cross-dressing”
  • vaccines expressing the HLA-A*02:01/HLA-DRB3*02:02 combination have particularly broad applicability.
  • phenotype frequencies were calculated indicating probabilities that an individual carries at least one of the indicated HLA-A and at least one of the indicated HLA-DRB3 alleles. Shown in Table 17 above are "phenotype frequencies" as percentage values.
  • AAFA denotes African American
  • AFB denotes African
  • AINDI denotes South Asian Indian
  • AMINE denotes North American Indian
  • CARB denotes Caribbean black
  • CARHIS denotes Caribbean Hispanic
  • EURCAU denotes European Caucasian
  • FILII European Caucasian
  • FILII European Caucasian
  • JAPI denotes Japanese
  • KORI denotes Korean
  • MENAFC denotes Middle Eastern or N.
  • HLA-A*02:01 cDNA nucleic acid sequence as represented by GenBank (NCBI) accession number AY365426.1 is used (SEQ ID NO: l). Optimization is conducted using software such as the Gene Optimizer software (available from Thermo Fisher Scientific, Waltham, MA).
  • User specified parameters include 1) ensuring the presence of a Kozak sequence by the addition of a "GCCACC" sequence immediately upstream of the translational start codon , 2) a 5' BamHl restriction site sequence (GGATCC) and a 3' CM (ATCGAT) restriction site sequence for straightforward transfer of the insert to another vector, and 3) optimization for Homo sapiens.
  • Methods of gene synthesis, transfer into a suitable vector such as the pcDNATM 3.4-TOPO ® vector (available from Thermo Fisher Scientific), plasmid amplification ⁇ e.g., using bacterial cells such as E. coli) and purification will be known to one of skill in the art.
  • the DNA sequence of the optimized HLA-A*02:01 ORF is set forth in SEQ ID NO:2 and the entire pcDNA3.4- A0201 construct sequence is set forth in SEQ ID NO:3.
  • ULA-A gene e.g., in mammalian cells
  • Methods of achieving expression of the ULA-A gene will be known to one of skill in the art.
  • Particularly relevant for the current invention is that SV- BR-l-GM cells (see, e.g., U.S. Patent No., 7674456 and U.S. Patent Application No. US 10/868,094, both of which are incorporated fully herein for all purposes), despite numerous months of culturing, have not lost expression of the CMV promoter-driven CSF2 gene, encoding GM-CSF.
  • an alternative promoter can be used, such as the EF-la promoter, which is less prone to silencing than a CMV promoter (101).
  • a preferred aspect of the current invention comprises cancer cells engineered to express two ectopic ULA genes.
  • the pVITR02-neo-mcs available from Invivogen, San Diego, CA
  • the pVITR02-neo-mcs plasmid comprises two multiple cloning sites (i.e., MCSl and MCS2).
  • MCSl permits ectopic expression via a promoter containing human ferritin heavy chain and mouse EF-la regulatory elements
  • MCS2 inserts are expressed by means of a composite promoter comprising human ferritin light chain and chimpanzee EF-la regulatory elements.
  • MCSl transcription unit results in a bicistronic messenger RNA comprising mRNA encoding the MCSl insert, an internal ribosome entry site (IRES), and an mRNA encoding a neomycin/G418 resistance marker.
  • IRS internal ribosome entry site
  • mRNA encoding a neomycin/G418 resistance marker a marker that is particularly important for the selection of mammalian cells with stably integrated DNA derived from pVITR02- neo-mcs, as neomycin/G418 resistant cells also express the transgene cloned into the MCS1.
  • both plasmids are double-digested with BamHl and Seal. Thereafter, the BamHl-[HLA-A*02:0 ⁇ ]-Scal fragment from pcDNA3.4-A0201 is ligated into the BamHl and Seal sites of the pVITR02-neo-mcs vector. Thereafter, the resulting plasmid, referred to as pVITRO2-A0201, is amplified in E.coli under kanamycin selective pressure, then purified.
  • the purified pVITRO2-A0201 plasmid can be utilized to transiently or stably (via G418 selection) transfect mammalian cells, and/or can be further engineered for expression of a second ectopic gene, inserted into the MCS2.
  • pVITRO2-A0201 contains a single ApaLl restriction (GTGCAC) site in the ori region (for plasmid replication in E.coli), i.e., outside of mammalian regulatory regions or in the ORFs of the neomycin-resistance marker or of HLA-A* 02:01.
  • GTGCAC ApaLl restriction
  • pVITR02- A0201 can be digested with ApaLl to promote chromosomal integration without functional inactivation of any of these critical elements.
  • the HLA-DRB3*02:02 ORF is inserted into the MCB2 of pVITRO2-A0201.
  • the ApaLl site (GTGCAC) in the HLA-DRB3*02:02 ORF sequence is first removed by altering the last "C” through an "A". Through this alteration, a CGG codon is replaced with an AGG codon, both encoding arginine.
  • the frequencies of both codons are similar (i.e., 11.4/1000 for CGG and 12.0/1000 for AGG).
  • the HLA-DRB3*02:02 ORF (SEQ ID NO: 4), after inclusion of the synonymous mutation, is shown as SEQ ID NO:5.
  • the latter sequence is thereafter optimized using the Gene Optimizer software (Thermo Fisher Scientific). User specified parameters include those described above. After optimization, this temporary ApaLl site is removed from the sequence. Subsequent steps for synthesis, transfer into a vector, amplification, and purification are as described above.
  • the DNA sequence of the optimized HLA-DRB3*02:02 ORF is set forth in SEQ ID NO:6 and the sequence of the entire pcDNA3.4-DRB30202 construct is set forth in SEQ ID NO:7.
  • both plasmids are double-digested with Xhol and Nhel. Thereafter, the 3 ⁇ 4oI-[HLA-DRB3*02:02]-N3 ⁇ 4eI fragment from pcDNA3.4-DRB30202 is ligated into the Xhol and Nhel sites of the pVITRO2-A0201 vector. Thereafter, the resulting plasmid, referred to as pVITRO2-A0201-DRB30202, is amplified in E.coli under kanamycin selective pressure, then purified.
  • the purified pVITRO2-A0201-DRB30202 plasmid can be utilized to transiently or stably transfect mammalian cells.
  • the sequence of pVITR02- A0202-DRB30202 is set forth in SEQ ID NO:8.
  • the plasmids are purified using methods known to one of skill in the art. Subsequent steps, including the culturing of SV-BR-l-GM cells, preparation of the transfection reagent (TR)-DNA complexes, enzymatic detachment of the cells and resuspension in culture medium, seeding of cells and incubation with TR-DNA complexes, replacement of medium with fresh culture medium, short-term culturing antibiotic-selection of stably transfected cells, and cloning of stably transfected cells, will also be known to one of skill in the art. It will also be known to one of skill in the art that methods similar to those employed for the transfection of suspended cells can be applied to the transfection of adherent cells.
  • TR transfection reagent
  • Example 3 Assessing Immunogenicity of SV-BR-l-GM Cells Engineered to Overexpress HLA-A*02:01 and HLA-DRB3*02:02.
  • T cells specific for MHCs comprising HLA-A*02:01 proteins are co-incubated with HLA-A*02:01 + SV-BR- l-GM cells, then assayed for activation.
  • T cells from SV-BR-l-GM vaccinated or unvaccinated donors carrying the HLA-A*02:01 allele are in vitro expanded via antibody-mediated stimulation of CD28 and CD3, and optionally CD2.
  • the T Cell Activation/Expansion Kit available from Miltenyi Biotec GmbH, Bergisch Gladbach, Germany
  • T cells specific for MHCs comprising HLA-A*02:01 proteins are isolated from the total population of donor-derived cells.
  • This enrichment step is conducted by FACS using fluorescently labelled MHC tetramers or pentamers comprising HLA-A*02:01 and antigenic peptides representing tumor- associated antigens that are expressed in SV-BR-l-GM cells such as PRAME or ERBB2 (HER2).
  • MHC tetramers or pentamers comprising HLA-A*02:01 and antigenic peptides representing tumor- associated antigens that are expressed in SV-BR-l-GM cells such as PRAME or ERBB2 (HER2).
  • peptide-specific effector T cells and target cells are co- incubated. Thereafter, the effector T cells are retrieved and analyzed for activation.
  • staining for the activation marker CD137 (4-1BB) can be performed, followed by flow cytometry-based quantification and assessment of the cells' proliferative behavior.
  • Such assessment can be performed, as a non-limiting example, in a CFSE dye dilution assay by employing, for instance, the CellTraceTM CFSE Cell Proliferation Kit (available from Thermo Fisher Scientific).
  • CFSE carboxyfluorescein succinimidyl ester
  • target cells are seeded in 96-well plates and then incubated with effector cells. Following removal of the effector T cells, cell viability of the target cells is measured.
  • peripheral blood mononuclear cells from donors carrying the HLA-DRB3*02:02 allele are stimulated with tetanus toxin (TT) peptides ⁇ e.g., MSLLTEVETYVLSIIPSGPL, T YVL SUP SGPLK AEIAQRL, and/or
  • TT tetanus toxin
  • CD4+ T cells ⁇ i.e., enriched with TT-HLA-DRB3*02:02- specific T cells) are isolated and then co-incubated with SV-BR-l-GM cells overexpressing HLA-DRB3*02:02, which have, or have not, been pre-incubated with TT peptides.
  • T cells are retrieved and analyzed for production of cytokines such as interferon-gamma or IL-2 by ELISpot and/or flow cytometry, and for their proliferative behavior, for instance, by a CSFE dye dilution assay.
  • cytokines such as interferon-gamma or IL-2 by ELISpot and/or flow cytometry, and for their proliferative behavior, for instance, by a CSFE dye dilution assay.
  • F639 cells are mouse breast tumor cells with FVB/N background expressing Erbb2/neu and thus resemble SV-BR-l-GM cells.
  • GMCSF granulocyte-macrophage colony-stimulating factor
  • FVB/N mice carry the "q" alleles at the MHC I loci H-2K, H-2D, and H-2L, and the MHC II loci I-A and I-E.
  • Balb/c mice carry the "d” alleles at these MHC I and II loci.
  • NF639-GM cells are further engineered, using techniques that will be known to one of skill in the art, to express the (Balb/c) "d" MHC I and II alleles outlined in Table 18.
  • Example 4 Overexpression of HLA-A*02:01 and HLA-DRB3*02:02 via Zinc Finger Nuclease-Based Engineering.
  • chromosomal integration of the ectopic expression cassette is directed to a defined locus.
  • AAVSl adeno-associated virus integration site 1
  • a commercially available kit referred to as CompoZr Targeted Integration Kit - AAVSl (available from Sigma-Aldrich, St. Louis, MO), permits customized integration into this site.
  • the method employed by the kit utilizes a plasmid, pZDonor, into which the ORF to be expressed is cloned.
  • the multiple cloning site (MCS) into which the ORF is inserted is flanked by DNA elements also found in the AAVSl integration site.
  • Cotransfection (as a non-limiting example, by nucleofection (i.e., an electroporation approach)) of the pZDonor plasmid carrying the ORF with mRNA encoding the AAVSl -specific ZFN permits integration of the ORF into the AAVSl locus.
  • ORFs into the AAVSl loci of both copies of chromosome 19 that are present in diploid cells.
  • both HLA-A*0201 and HLA-DRB3*02:02 can be overexpressed in the same cell.
  • Example 5 Assessing Correlative Relationship between Patient and Vaccine HLA Types, and Vaccine Effectivity.
  • HLA types of clinical trial subjects enrolled in a Phase I/IIa study are determined.
  • the clinical study comprises a series of vaccine cycles, whereby each vaccine administration comprises four intradermal injections of the vaccine (i.e., at four different locations with about five million irradiated SV-BR-l-GM cells per location).
  • Each vaccine cycle includes four study events: 1) pre-vaccine cyclophosphamide, 2) vaccine inoculation, 3) interferon-alpha-2b (available from Merck) administration at about 48 hours post-vaccine, and 4) interferon-alpha-2b administration at about about 96 hours post-vaccine (e.g., performed at a physician's office).
  • the evaluation of safety and clinical developments is assessed at every study visit after starting the vaccine therapy cycles.
  • Low-dose Interferon-alpha-2b serves as an adjuvant and is given by intradermal injection to the inoculation site about 48 hours and about 96 hours after vaccine inoculation.
  • Biological samples are collected at regular intervals per protocol, and stored in a repository.
  • any of the following may be applied as success measures: 1) objective clinical response as defined by irRC RECIST 1.1 criteria in 25% of patients, 2) improvement in quality of life in 50% or more patients as evidenced by significant change in one or more scales in the SF-36 questionnaire (quality of life), 3) prolongation of disease-free and overall survival as compared with historical controls from reports of other salvage therapies in the published literature, 4) evidence of development or amplification of immune responses, especially if correlating with prolongation of survival.
  • Objective clinical response is primarily assessed by radiographic assessment of tumor burden. This may be conducted, as non-limiting examples, by computed tomography (CT), magnetic resonance imaging (MRI), and/or positron emission tomography (PET). See, (16).
  • CT computed tomography
  • MRI magnetic resonance imaging
  • PET positron emission tomography
  • HLA types from, as non-lmiting examples, buccal cells or blood cells of clinical trial subjects are determined.
  • HLA types from, as non-lmiting examples, buccal cells or blood cells of clinical trial subjects are determined.
  • Several methods known to one of skill in the art are suitable to determine HLA alleles. For non- limiting examples, see (104).
  • Keenan BP Jaffee EM. Whole cell vaccines—past progress and future strategies. Semin Oncol. 2012;39(3):276-86. 21. De Remigis A, de Gruijl TD, Uram JN, Tzou SC, Iwama S, Talor MV, et al. Development of thyroglobulin antibodies after GVAX immunotherapy is associated with prolonged survival. Int J Cancer. 2015; 136(1): 127-37.
  • TGF-beta blockade depletes T regulatory cells from metastatic pancreatic tumors in a vaccine dependent manner. Oncotarget. 2015;6(40):43005-15.
  • TRANCE tumor necrosis factor [TNF]-related activation-induced cytokine
  • T cell- directed CC chemokine TARC is a highly specific biological ligand for CC chemokine receptor 4. J Biol Chem. 1997;272(23): 15036-42.
  • CTdatabase a knowledge-base of high-throughput and curated data on cancer-testis antigens. Nucleic Acids Res. 2009;37(Database issue):D816-9.
  • the HER2 amplicon includes several genes required for the growth and survival of HER2 positive breast cancer cells - A data description. Genom Data. 2014;2:249-53.
  • the HER2 amplicon includes several genes required for the growth and survival of HER2 positive breast cancer cells. Mol Oncol. 2013;7(3):392-401.
  • a modified human cancer cell comprising a recombinant polynucleotide encoding an allele of a human leukocyte antigen (FILA) class I gene.
  • FILA human leukocyte antigen
  • modified human cancer cell of embodiment 1 further comprising a recombinant polynucleotide encoding an allele of an FILA class II gene.
  • a modified human cancer cell comprising a recombinant polynucleotide encoding an allele of an HLA class II gene.
  • modified human cancer cell of embodiment 3 further comprising a recombinant polynucleotide encoding an allele of an HLA class I gene.
  • modified human cancer cell of any one of embodiments 1 to 4, wherein the recombinant polynucleotide is present on a vector in the cell.
  • HLA class I gene is selected from the group consisting of an HLA-A gene, an HLA-B gene, an HLA-C gene, an HLA-E gene, an HLA-F gene, an HLA-G gene, a beta-2-microglobulin (B2M) gene, and a combination thereof.
  • the allele of the HLA-C gene is an allele selected from the group consisting of HLA-C*04:01, HLA-C*07:02, HLA- C*07:01, HLA-C*06:02, HLA-C*03 :04, HLA-C*01 :02, HLA-C*02:02, HLA-C*08:02, HLA-C* 15:02, HLA-C*03 :03, HLA-C*05:01, HLA-C*08:01, HLA-C* 16:01, HLA- C* 12:03, HLA-C* 14:02, and a combination thereof.
  • HLA class II gene is selected from the group consisting of an HLA class II alpha subunit gene, an HLA class II beta subunit gene, and a combination thereof.
  • HLA class II gene is selected from the group consisting of an HLA-DP gene, an HLA-DM gene, an HLA-DOA gene, an HLA-DOB gene, an HLA-DQ gene, an HLA-DR gene, and a combination thereof.
  • the modified human cancer cell of embodiment 12, wherein the HLA-DM gene is selected from the group consisting of an HLA-DMA gene, an HLA-DMB gene, and a combination thereof.
  • HLA-DR gene is selected from the group consisting of an HLA-DRA gene, an HLA-DRB l gene, an HLA- DRB3 gene, an HLA-DRB4 gene, an HLA-DRB5 gene, and a combination thereof.
  • GM-CSF granulocyte-macrophage colony- stimulating factor
  • IFNa interferon alpha
  • a method for selecting a whole-cell cancer vaccine for a subject having cancer comprising:
  • HLA human leukocyte antigen
  • HLA class I gene is selected from the group consisting of an HLA-A gene, an HLA-B gene, an HLA-C gene, an HLA-E gene, an HLA-F gene, an HLA-G gene, a beta-2-microglobulin (B2M) gene, and a combination thereof.
  • the allele of the HLA-A gene is an allele selected from the group consisting of HLA-A* 11 :01, HLA-A*01 :01, HLA-A*02:01, HLA- A*03 :01, HLA-A*26:01, HLA-A*29:02, HLA-A*32:01, HLA-A*24:02, HLA-A*33 :03, HLA-A*68:01, HLA-A*31 :01, HLA-A*02:06, and a combination thereof.
  • HLA class II gene is selected from the group consisting of an HLA class II alpha subunit gene, an HLA class II beta subunit gene, and a combination thereof.
  • HLA class II gene is selected from the group consisting of an HLA-DP gene, an HLA-DM gene, an HLA-DOA gene, an HLA-DOB gene, an HLA-DQ gene, an HLA-DR gene, and a combination thereof.
  • HLA-DM gene is selected from the group consisting of an HLA-DMA gene, an HLA-DMB gene, and a combination thereof.
  • HLA-DR gene is selected from the group consisting of an HLA-DRA gene, an HLA-DRB l gene, an HLA-DRB3 gene, an HLA- DRB4 gene, an HLA-DRB5 gene, and a combination thereof.
  • a method for selecting a whole-cell cancer vaccine for a subject having cancer comprising:
  • step (b) comparing the presence or level of the one or more biomarkers detected in step (a)(i) and/or the level of activity and/or number of the one or more immune cells measured in step (a)(ii) to the presence or level of the one or more biomarkers and/or the level of activity and/or number of one or more immune cells in a control sample; and (c) selecting the whole-cell cancer vaccine for the subject based on the comparison in step (b), wherein the whole-cell cancer vaccine is derived from a breast cancer cell line or a breast cancer cell.
  • the one or more biomarkers is selected from the group consisting of preferentially expressed antigen in melanoma (PRAME), PDZ binding kinase (PBK), centrosomal protein 55 (CEP55), kinesin family member 2C (KIF2C), placenta-specific protein 1 (PLAC1), Opa interacting protein 5 (OIP5), calcium binding tyrosine phosphorylation regulated (CABYR), sperm-associated antigen 1 (SPAG1), alpha- 1, 3 -glucosyltransf erase (ALG8), actin-related protein 2/3 complex, subunit 5-like (ARPC5L), chromobox homolog 2 (CBX2), collagen type VIII alpha 1 chain (COL8A1), DDB1 and CUL4 associated factor 10, (DCAF10), eukaryotic translation initiation factor 3 subunit H (EIF3H), erb-b2 receptor tyrosine kinase 2 (ER)
  • PRAME preferentially expressed antigen
  • PBMC peripheral blood mononuclear cell
  • NK natural killer
  • MDSC myeloid-derived suppressor cell
  • the one or more immune cells in which the level of activity and/or number is measured is selected from the group consisting of a PBMC, a lymphocyte, a dendritic cell, and a combination thereof.
  • any one of embodiments 36 to 48 wherein the level of activity and/or number of the one or more immune cells is measured using a method selected from the group consisting of an ELISA, an ELISPOT assay, a Western blot, a cytotoxic T lymphocyte (CTL) activity assay, a cytotoxicity assay, a proliferation assay, a cytokine production assay, an MHC multimer assay, a flow cytometry assay, and a combination thereof. 50. The method of any one of embodiments 36 to 49, wherein the level of activity and/or number of the one or more immune cells is measured following stimulation with an antigen.
  • biomarkers comprise one or more alleles of one or more human leukocyte antigen (HLA) genes.
  • HLA human leukocyte antigen
  • HLA class I gene is selected from the group consisting of an HLA-A gene, an HLA-B gene, an HLA-C gene, an HLA-E gene, an HLA-F gene, an HLA-G gene, a beta-2-microglobulin (B2M) gene, and a combination thereof.
  • the allele of the HLA-A gene is an allele selected from the group consisting of HLA-A* 11 :01, HLA-A*01 :01, HLA-A*02:01, HLA- A*03 :01, HLA-A*26:01, HLA-A*29:02, HLA-A*32:01, HLA-A*24:02, HLA-A*33 :03, HLA-A*68:01, HLA-A*31 :01, HLA-A*02:06, and a combination thereof.
  • the allele of the HLA-C gene is an allele selected from the group consisting of HLA-C*04:01, HLA-C*07:02, HLA-C*07:01, HLA- C*06:02, HLA-C*03 :04, HLA-C*01 :02, HLA-C*02:02, HLA-C*08:02, HLA-C* 15:02, HLA-C*03 :03, HLA-C*05:01, HLA-C*08:01, HLA-C* 16:01, HLA-C* 12:03, HLA- C* 14:02, and a combination thereof.
  • the HLA class II gene is selected from the group consisting of an HLA class II alpha subunit gene, an HLA class II beta subunit gene, and a combination thereof.
  • the HLA class II gene is selected from the group consisting of an HLA-DP gene, an HLA-DM gene, an HLA-DOA gene, an HLA-DOB gene, an HLA-DQ gene, an HLA-DR gene, and a combination thereof.
  • HLA-DM gene is selected from the group consisting of an HLA-DMA gene, an HLA-DMB gene, and a combination thereof.
  • HLA-DR gene is selected from the group consisting of an HLA-DRA gene, an HLA-DRB l gene, an HLA-DRB3 gene, an HLA- DRB4 gene, an HLA-DRB5 gene, and a combination thereof.
  • sample obtained from the subject is a whole blood sample, a plasma sample, a serum sample, a buccal swab sample, a tumor tissue sample, a biofluid sample, a pleural effusion sample, a urine sample, a hair sample, a skin sample, or a combination thereof.
  • a composition comprising a modified human cancer cell comprising a recombinant polynucleotide encoding an allele of a human leukocyte antigen (HLA) class I gene.
  • HLA human leukocyte antigen
  • composition comprising a modified human cancer cell comprising a recombinant polynucleotide encoding an allele of an HLA class II gene.
  • composition of embodiment 69, wherein the modified human cancer cell further comprises a recombinant polynucleotide encoding an allele of an HLA class I gene.
  • composition of any one of embodiments 67 to 72, wherein the HLA class I gene is selected from the group consisting of an HLA- A gene, an HLA-B gene, an HLA-C gene, an HLA-E gene, an HLA-F gene, an HLA-G gene, a beta-2-microglobulin (B2M) gene, and a combination thereof.
  • composition of embodiment 73 wherein the allele of the HLA-A* 11 :01, HLA- A*01 :01, HLA-A*02:01, HLA-A*03 :01, HLA-A*26:01, HLA-A*29:02, HLA-A*32:01, HLA-A*24:02, HLA-A*33 :03, HLA-A*68:01, HLA-A*31 :01, HLA-A*02:06, and a combination thereof.
  • composition of embodiment 73, wherein the allele of the HLA-B gene is an allele selected from the group consisting of HLA-B* 13 :02, HLA-B*41 :01, HLA-B* 18:03, HLA-B*44:02, HLA-B*07:02, HLA-B*35:01, HLA-B*40:01, HLA-B*35:08, HLA- B*55:01, HLA-B*51 :01, HLA-B*44:03, HLA-B*58:01, HLA-B*08:01, HLA-B* 18:01, HLA-B* 15:01, HLA-B*52:01, and a combination thereof.
  • composition of embodiment 73 wherein the allele of the HLA-C gene is an allele selected from the group consisting of HLA-C*04:01, HLA-C*07:02, HLA-C*07:01, HLA-C*06:02, HLA-C*03 :04, HLA-C*01 :02, HLA-C*02:02, HLA-C*08:02, HLA- C* 15:02, HLA-C*03 :03, HLA-C*05:01, HLA-C*08:01, HLA-C* 16:01, HLA-C* 12:03, HLA-C* 14:02, and a combination thereof.
  • HLA class II gene is selected from the group consisting of an HLA class II alpha subunit gene, an HLA class II beta subunit gene, and a combination thereof.
  • composition of any one of embodiments 68 to 76, wherein the HLA class II gene is selected from the group consisting of an HLA-DP gene, an HLA-DM gene, an HLA- DOA gene, an HLA-DOB gene, an HLA-DQ gene, an HLA-DR gene, and a combination thereof.
  • composition of embodiment 78, wherein the HLA-DM gene is selected from the group consisting of an HLA-DMA gene, an HLA-DMB gene, and a combination thereof.
  • composition of embodiment 78, wherein the HLA-DR gene is selected from the group consisting of an HLA-DRA gene, an HLA-DRB l gene, an HLA-DRB3 gene, an HLA- DRB4 gene, an HLA-DRB5 gene, and a combination thereof.
  • composition of embodiment 80, wherein the allele of the HLA-DRB3 gene is an allele selected from the group consisting of HLA-DRB3*02:02, HLA-DRB3*01 :01, HLA- DRB3*03 :01, and a combination thereof.
  • ADA adenosine deaminase
  • ADGRE5 adhesion G protein-coupled receptor E
  • GM-CSF granulocyte-macrophage colony-stimulating factor
  • composition of embodiment 84 wherein the GM-CSF is encoded by a recombinant polynucleotide and expressed by a modified cell.
  • composition of embodiment 85 wherein the GM-CSF is expressed by the same modified cell that comprises the recombinant polynucleotide encoding an allele of a human leukocyte antigen (HLA) class I and/or class II gene.
  • HLA human leukocyte antigen
  • HLA human leukocyte antigen
  • composition of embodiment 84, wherein the GM-CSF is present in a soluble form is present in a soluble form.
  • IFNa interferon alpha
  • HLA human leukocyte antigen
  • composition of embodiment 89, wherein the IFNa is present in a soluble form is present in a soluble form.
  • composition of any one of embodiments 67 to 91, wherein the human cancer cell is a human cancer cell line.
  • composition of embodiment 92, wherein the human cancer cell line is an SV- BR-1 breast cancer cell line.
  • a pharmaceutical composition comprising the composition of any one of embodiments 67 to 93 and a pharmaceutically acceptable carrier.
  • a method for treating cancer in a subject comprising administering to the subject a therapeutically effective amount of the pharmaceutical composition of embodiment 94.
  • invention 95 further comprising treating the subject with a therapy selected from the group consisting of chemotherapy, immunotherapy, radiotherapy, hormone therapy, a differentiating agent, a small-molecule drug, and a combination thereof.
  • a therapy selected from the group consisting of chemotherapy, immunotherapy, radiotherapy, hormone therapy, a differentiating agent, a small-molecule drug, and a combination thereof.
  • the immunotherapy comprises an agent selected from the group consisting of an immune checkpoint inhibitor, a monoclonal antibody, a small-molecule drug, and a combination thereof.
  • the chemotherapy comprises an agent selected from the group consisting of an alkylating agent, an antimetabolite, an anti-tumor antibiotic, a topoisomerase inhibitor, a mitotic inhibitor, a corticosteroid, and a combination thereof.
  • the cancer is selected from the group consisting of breast cancer, ovarian cancer, cervical cancer, prostate cancer, pancreatic cancer, colorectal cancer, gastric cancer, lung cancer, skin cancer, liver cancer, brain cancer, eye cancer, soft tissue cancer, renal cancer, bladder cancer, head and neck cancer, mesothelioma, acute leukemia, chronic leukemia, medulloblastoma, multiple myeloma, sarcoma, and a combination thereof.
  • PBMC peripheral blood mononuclear cell
  • NK natural killer
  • MDSC myeloid-derived suppressor cell
  • the one or more immune cells in which the level of activity and/or number is increased is selected from the group consisting of a PBMC, a lymphocyte, a dendritic cell, and a combination thereof.
  • CTL cytotoxic T lymphocyte
  • kits for treating a subject with cancer comprising the pharmaceutical composition of embodiment 94.
  • kit of embodiment 113 further comprising instructions for use.
  • kit of embodiment 113 or 114 further comprising one or more reagents.
  • kits of embodiment 115 wherein the one or more reagents are for isolating a sample from the subject having cancer, detecting the presence or absence of one or more alleles of one or more human leukocyte antigen (HLA) genes, detecting the presence or level of one or more biomarkers, and/or measuring the activity and/or number of one or more immune cells.
  • HLA human leukocyte antigen
  • a method for determining the HER2 status of a sample cell comprising:
  • step (b) comparing the presence or level of the one or more biomarkers detected in step (a) to the presence or level of the one or more biomarkers in a reference cell;
  • step (c) determining the HER2 status of the sample cell based upon the comparison performed in step (b).
  • sample cell is a cancer cell or is a cell obtained from a subject who has cancer.
  • the reference cell is a non-cancer cell obtained from the same subject as the sample cell or is a non-cancer cell obtained from a different subject or population of subjects.
  • detecting the presence or level of the one or more biomarkers comprises measuring mRNA expression, protein abundance, or a combination thereof.
  • GGATCC start codon
  • ATCGAT start codon
  • TGA stop codon
  • 3 '-CM restriction site ATCGAT
  • CGATCG single Pvul restriction site
  • HLA-DRB3*02:02 ORF before optimization, with removed ApaLI site (801 bp) (SEQ ID NO: 5)
  • GTGCAC ApaLI restriction site
  • HLA-DRB3*02:02 ORF after optimization (801 bp) (SEQ ID NO: 6) ATGGTTTGCCTTAAACTGCCTGGCGGCAGCTCTCTGGCTGCCCTGACAGTTACACTGATGGT GCTGAGCAGCAGACTGGCCTTTGCCGGCGATACCCGGCCTAGATTTCTGGAACTGCTGAAGT CCGAGTGCCACTTCTTCAACGGAACCGAGAGTGCGGTTCCTGGAAAGGCACTTCCACAAT CAAGAGGAATACGCCAGATTCGACAGCGACGTGGGCGAGTACAGAGCCGTCAGAGAACTGGG CAGACCCGATGCCGAGTACTGGAACAGCCAGAAGGACCTGCTGGAACAGAAGAGAGGCCAGG TCGACAACTACTGCCGGCACAATTATGGCGTGGGCGAAAGCTTCACCGTGCAGAAGAGTG CATCCCCAAGTGACAGTGTACCCCGCCAAGACACAGCCTCTGCAGCACCACAATCTGCTCGT GTGTAGCGTGTCCGGCTTCTACCCTGGCTCTATCGT
  • Optimized HLA-DRB3*02:02 sequence in pcDNA3.4-TOPO 5'-Xhol restriction site (CTCGAG), start codon (ATG), stop codon (TGA), and V-Nhel restriction site (GCTAGC) are underlined. Also underlined is the single Pvul restriction site (CGATCG), useful for linearization of the plasmid prior to stable transfection.
  • CTCGAG 5'-Xhol restriction site
  • ATG start codon
  • TGA stop codon
  • GCTAGC V-Nhel restriction site
  • CGATCG single Pvul restriction site
  • HLA-A*02:01 insert 5'- ⁇ restriction site (GGATCC), start codon (ATG), stop codon (TGA), and 3 '-CM restriction site (ATCGAT) are underlined.
  • ULA- DRB3*02:02 insert ⁇ -Xhol restriction site (CTCGAG), start codon (ATG), stop codon (TGA), and V-Nhel restriction site (GCTAGC) are underlined.
  • GTGCAC single ApaLl restriction site

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Mycology (AREA)
  • Cell Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Urology & Nephrology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Food Science & Technology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Dermatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2017/019757 2016-02-25 2017-02-27 Whole-cell cancer vaccines and methods for selection thereof Ceased WO2017147600A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
CA3015080A CA3015080A1 (en) 2016-02-25 2017-02-27 Whole-cell cancer vaccines and methods for selection thereof
JP2018563769A JP6901505B2 (ja) 2016-02-25 2017-02-27 全細胞がんワクチンおよびその選択のための方法
NZ745327A NZ745327A (en) 2016-02-25 2017-02-27 Whole-cell cancer vaccines and methods for selection thereof
EP17757429.0A EP3419657A4 (en) 2016-02-25 2017-02-27 CELLULAR CANCER VACCINES AND METHOD FOR SELECTION THEREOF
CN201780023982.8A CN109069603A (zh) 2016-02-25 2017-02-27 全细胞癌症疫苗及其选择方法
AU2017224232A AU2017224232B2 (en) 2016-02-25 2017-02-27 Whole-cell cancer vaccines and methods for selection thereof
IL261354A IL261354A (en) 2016-02-25 2018-08-23 Human cancer cells comprising recombinant polynucleotides encoding human leukocyte antigen (hla) genes compositions comprising same and uses thereof
US16/110,317 US11559574B2 (en) 2016-02-25 2018-08-23 Whole-cell cancer vaccines and methods for selection thereof
AU2022259857A AU2022259857B2 (en) 2016-02-25 2022-10-28 Whole-cell cancer vaccines and methods for selection thereof
US18/078,351 US20230277640A1 (en) 2016-02-25 2022-12-09 Whole-cell cancer vaccines and methods for selection thereof
AU2025205094A AU2025205094A1 (en) 2016-02-25 2025-07-03 Whole-cell cancer vaccines and methods for selection thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201662299674P 2016-02-25 2016-02-25
US62/299,674 2016-02-25
US201662425027P 2016-11-21 2016-11-21
US62/425,027 2016-11-21

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/110,317 Continuation US11559574B2 (en) 2016-02-25 2018-08-23 Whole-cell cancer vaccines and methods for selection thereof

Publications (1)

Publication Number Publication Date
WO2017147600A1 true WO2017147600A1 (en) 2017-08-31

Family

ID=59685619

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/019757 Ceased WO2017147600A1 (en) 2016-02-25 2017-02-27 Whole-cell cancer vaccines and methods for selection thereof

Country Status (9)

Country Link
US (2) US11559574B2 (https=)
EP (1) EP3419657A4 (https=)
JP (1) JP6901505B2 (https=)
CN (1) CN109069603A (https=)
AU (3) AU2017224232B2 (https=)
CA (2) CA3015080A1 (https=)
IL (1) IL261354A (https=)
NZ (1) NZ745327A (https=)
WO (1) WO2017147600A1 (https=)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108175853A (zh) * 2018-01-24 2018-06-19 上海赛群生物科技有限公司 一种肿瘤细胞疫苗及其制备方法
CN108486038A (zh) * 2018-03-21 2018-09-04 中国人民解放军第四军医大学 一种构建脂肪干细胞膜片的方法及应用
CN110938630A (zh) * 2019-12-20 2020-03-31 中国人民解放军第四军医大学 人b3gnt5基因的用途及相关产品
WO2020132595A1 (en) * 2018-12-21 2020-06-25 The Regents Of The University Of California Il-10-containing vaccines and uses thereof
JP2021505138A (ja) * 2017-12-04 2021-02-18 ヒート バイオロジクス,インコーポレイテッド 細胞に基づくワクチンの製造
EP3727467A4 (en) * 2017-12-22 2021-12-01 Centivax, Inc. MAJOR HISTOCOMPATIBILITY COMPLEX (CMH) COMPOSITIONS AND CORRESPONDING PROCEDURES FOR USE
US11559574B2 (en) 2016-02-25 2023-01-24 Briacell Therapeutics Corp. Whole-cell cancer vaccines and methods for selection thereof
WO2023092053A1 (en) * 2021-11-18 2023-05-25 Partner Therapeutics, Inc. Granulocyte-macrophage colony-stimulating factor-based cancer treatments
WO2023167973A1 (en) 2022-03-03 2023-09-07 Briacell Therapeutics Corp. Cancer vaccines and methods of use thereof
WO2025171109A1 (en) 2024-02-07 2025-08-14 Briacell Therapeutics Corp. Cancer vaccines expressing post-translational modified antigens and methods of use thereof
WO2026068517A1 (en) * 2024-09-24 2026-04-02 Universiteit Gent Cancer immunotherapy

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TW202134430A (zh) 2019-12-03 2021-09-16 美商紐沃進公司 腫瘤細胞疫苗
CN115433734B (zh) * 2022-06-01 2025-03-04 北京奇糖科技有限公司 核酸片段及其在制备肿瘤疫苗中的应用
CN117990593A (zh) * 2024-01-31 2024-05-07 南昌铭硕生科生物工程有限公司 一种流式多因子分析系统及其分析方法
CN118207320A (zh) * 2024-04-28 2024-06-18 复旦大学附属中山医院 Hla-c*04:01基因的新用途及检测试剂盒
CN118207319A (zh) * 2024-04-28 2024-06-18 复旦大学附属中山医院 Hla-a*03:04基因的新用途及检测试剂盒

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5750102A (en) * 1992-03-13 1998-05-12 Yeda Research And Development Co., Ltd. Double transfectants of the MHC genes as cellular vaccines for immuno prevention of tumor metastasis
US20050276822A1 (en) 2004-06-14 2005-12-15 Charles Wiseman Novel breast cancer cell lines and uses thereof
WO2006135454A1 (en) 2005-06-08 2006-12-21 Saint Vincent Medical Center, A California Corporation Novel cancer cell lines and uses thereof

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5858776A (en) * 1993-11-03 1999-01-12 Repligen Corporation Tumor cells with increased immunogenicity and uses therefor
WO2000050589A1 (en) * 1999-02-22 2000-08-31 Ludwig Institute For Cancer Research TYROSINE KINASE RECEPTOR EphA3 ANTIGENIC PEPTIDES
US20130052215A9 (en) * 2003-09-26 2013-02-28 Eckhard Podack Tumor vaccine
WO2006081629A1 (en) 2005-02-04 2006-08-10 Stem Cell Australia Pty Ltd Adenoviral vectors comprising a nucleic acid encoding a mhc class i molecule and the use of such vectors in cancer therapy.
US20080020386A1 (en) 2006-03-29 2008-01-24 Medigen Biotechnology Corporation Methods and apparatus for genotyping
US7807186B2 (en) * 2007-01-17 2010-10-05 University Of Maryland, Baltimore County Tumor cells from immune privileged sites as base cells for cell-based cancer vaccines
US8969254B2 (en) * 2010-12-16 2015-03-03 Dana-Farber Cancer Institute, Inc. Oligonucleotide array for tissue typing
AU2012257377B2 (en) 2011-05-17 2017-09-07 Hadasit Medical Research Services And Development Ltd. Allogeneic tumor cell vaccination
WO2017147600A1 (en) 2016-02-25 2017-08-31 Briacell Therapeutics Corp. Whole-cell cancer vaccines and methods for selection thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5750102A (en) * 1992-03-13 1998-05-12 Yeda Research And Development Co., Ltd. Double transfectants of the MHC genes as cellular vaccines for immuno prevention of tumor metastasis
US20050276822A1 (en) 2004-06-14 2005-12-15 Charles Wiseman Novel breast cancer cell lines and uses thereof
US7674456B2 (en) 2004-06-14 2010-03-09 Charles Wiseman Breast cancer cell lines and uses thereof
WO2006135454A1 (en) 2005-06-08 2006-12-21 Saint Vincent Medical Center, A California Corporation Novel cancer cell lines and uses thereof

Non-Patent Citations (116)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. NP_001276867
"Gene Bank", Database accession no. NM_002175
"NCBI", Database accession no. NP_000749.2
ALMEIDA LGSAKABE NJDEOLIVEIRA ARSILVA MCMUNDSTEIN ASCOHEN T ET AL.: "CTdatabase: a knowledge-base of high-throughput and curated data on cancer-testis antigens", NUCLEIC ACIDS RES., vol. 37, 2009, pages D816 - 9
ARANGO DUQUE GDESCOTEAUX A: "Macrophage cytokines: involvement in immunity and infectious diseases", FRONT IMMUNOL, vol. 5, 2014, pages 491
ARRUDA LBSIM DCHIKHLIKAR PRMACIEL M, JR.AKASAKI KAUGUST JT ET AL.: "Dendritic cell-lysosomal-associated membrane protein (LAMP) and LAMP-1-HIV-1 gag chimeras have distinct cellular trafficking pathways and prime T and B cell responses to a diverse repertoire of epitopes", J IMMUNOL., vol. 177, no. 4, 2006, pages 2265 - 75, XP055266226, DOI: 10.4049/jimmunol.177.4.2265
BATES JMFLANAGAN KMO LOTA NDING JHO S ET AL.: "Dendritic cell CD83 homotypic interactions regulate inflammation and promote mucosal homeostasis", MUCOSAL IMMUNOL, vol. 8, no. 2, 2015, pages 414 - 28
BATZER ET AL., NUCLEIC ACID RES., vol. 19, 1991, pages 5081
BLEIJS DADE WAAL-MALEFYT RFIGDOR CGVAN KOOYK Y: "Co-stimulation of T cells results in distinct IL-10 and TNF-alpha cytokine profiles dependent on binding to ICAM-1, ICAM-2 or ICAM-3", EUR J IMMUNOL, vol. 29, no. 7, 1999, pages 2248 - 58
BOEGEL ET AL.: "A catalog of HLA type, HLA expression, and neo-epitope candidates in human cancer cell lines", ONCOIMMUNOLOGY, vol. 3, no. 8, 3 August 2014 (2014-08-03), pages e954893-1 - e954893- 12, XP002759685 *
BONACCORSI IPEZZINO GMORANDI BFERLAZZO G: "Drag cells in immunity (Plasmacytoid DCs dress up as cancer cells", ONCOLMMUNOLOGY, vol. 3, 2014, pages e27897
BORRELLO IMLEVITSKY HISTOCK WSHER DQIN LDEANGELO DJ ET AL.: "Granulocyte-macrophage colony-stimulating factor (GM-CSF)-secreting cellular immunotherapy in combination with autologous stem cell transplantation (ASCT) as postremission therapy for acute myeloid leukemia (AML", BLOOD, vol. 114, no. 9, 2009, pages 1736 - 45
BROUGHTON SEHERCUS TRNERO TLDOTTORE MMCCLURE BJDHAGAT U ET AL.: "Conformational Changes in the GM-CSF Receptor Suggest a Molecular Mechanism for Affinity Conversion and Receptor Signaling", STRUCTURE, vol. 24, no. 8, 2016, pages 1271 - 81, XP029671224, DOI: 10.1016/j.str.2016.05.017
BROWN CBPIHL CEKAUSHANSKY K: "Mapping of human granulocyte-macrophage-colony-stimulating-factor domains interacting with the human granulocyte-macrophage-colony-stimulating-factor-receptor alpha-subunit", EUR J BIOCHEM., vol. 225, no. 3, 1994, pages 873 - 80
CAUX CMASSACRIER CVANBERVLIET BDUBOIS BVAN KOOTEN CDURAND I ET AL.: "Activation of human dendritic cells through CD40 cross-linking", J EXP MED., vol. 180, no. 4, 1994, pages 1263 - 72, XP001119225, DOI: 10.1084/jem.180.4.1263
CHAPMAN KBPRENDES MJKIDD JLSTERNBERG HWEST MDWAGNER J: "Elevated expression of cancer/testis antigen FSIP1 in ER-positive breast tumors", BIOMARK MED, vol. 7, no. 4, 2013, pages 601 - 11, XP008176241, DOI: 10.2217/bmm.13.58
CHEN GGUPTA RPETRIK SLAIKO MLEATHERMAN JMASQUITH JM ET AL.: "A feasibility study of cyclophosphamide, trastuzumab, and an allogeneic GM-CSF-secreting breast tumor vaccine for HER2+ metastatic breast cancer", CANCER IMMUNOL RES, vol. 2, no. 10, 2014, pages 949 - 61
CREELAN BCANTONIA SNOYES DHUNTER TBSIMON GRBEPLER G ET AL.: "Phase II trial of a GM-CSF-producing and CD40L-expressing bystander cell line combined with an allogeneic tumor cell-based vaccine for refractory lung adenocarcinoma", J IMMUNOTHER, vol. 36, no. 8, 2013, pages 442 - 50
DAMLE NKARUFFO A: "Vascular cell adhesion molecule 1 induces T-cell antigen receptor-dependent activation of CD4+T lymphocytes", PROC NATL ACAD SCI USA, vol. 88, no. 15, 1991, pages 6403 - 7, XP002037913, DOI: 10.1073/pnas.88.15.6403
DE REMIGIS ADE GRUIJL TDURAM JNTZOU SCIWAMA STALOR MV ET AL.: "Development of thyroglobulin antibodies after GVAX immunotherapy is associated with prolonged survival", INT J CANCER, vol. 136, no. 1, 2015, pages 127 - 37, XP071288052, DOI: 10.1002/ijc.28973
DIEU MCVANBERVLIET BVICARI ABRIDON JMOLDHAM EAIT-YAHIA S ET AL.: "Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites", J EXP MED, vol. 188, no. 2, 1998, pages 373 - 86, XP002155396, DOI: 10.1084/jem.188.2.373
DOBRYNIN PMATYUNINA EMALOV SVKOZLOV AP: "The novelty of human cancer/testis antigen encoding genes in evolution", INT J GENOMICS, 2013, pages 105108
DORAK MTLAWSON TMACHULLA HKMILLS KIBURNETT AK: "Increased heterozygosity for MHC class II lineages in newborn males", GENES IMMUN, vol. 3, no. 5, 2002, pages 263 - 9
DYKXHOORN DMWU YXIE HYU FLAL APETROCCA F ET AL.: "miR-200 enhances mouse breast cancer cell colonization to form distant metastases", PLOS ONE, vol. 4, no. 9, 2009, pages e7181, XP055017967, DOI: 10.1371/journal.pone.0007181
EMENS LAASQUITH JMLEATHERMAN JMKOBRIN BJPETRIK SLAIKO M ET AL.: "Timed sequential treatment with cyclophosphamide, doxorubicin, and an allogeneic granulocyte-macrophage colony-stimulating factor-secreting breast tumor vaccine: a chemotherapy dose-ranging factorial study of safety and immune activation", J CLIN ONCOL, vol. 27, no. 35, 2009, pages 5911 - 8, XP055279599, DOI: 10.1200/JCO.2009.23.3494
EVANS EEHENN ADJONASON APARIS MJSCHIFFHAUER LMBORRELLO MA ET AL.: "C35 (C17orf37) is a novel tumor biomarker abundantly expressed in breast cancer", MOL CANCER THER, vol. 5, no. 11, 2006, pages 2919 - 30
EZINNE CCYOSHIMITSU MWHITE YARIMA N: "HTLV-1 specific CD8+ T cell function augmented by blockade of 2B4/CD48 interaction in HTLV-1 infection", PLOS ONE, vol. 9, no. 2, 2014, pages e87631
FANER RJAMES EHUSTON LPUJOL-BORREL RKWOK WWJUAN M: "Reassessing the role of HLA-DRB3 T-cell responses: evidence for significant expression and complementary antigen presentation", EUR J IMMUNOL., vol. 40, no. 1, 2010, pages 91 - 102
FINKELSTEIN SESALENIUS SMANTZ CASHORE NDFERNANDEZ EBSHULMAN J ET AL.: "Combining immunotherapy and radiation for prostate cancer", CLIN GENITOURIN CANCER, vol. 13, no. 1, 2015, pages 1 - 9
FORONI ICOUTO ARBETTENCOURT BFSANTOS MLIMA MBRUGES-ARMAS J: "HLA and Associated Important Diseases", 19 March 2014, HLA AND ASSOCIATED IMPORTANT DISEASES, article "HLA-E, HLA-F and HLA-G — The Non-Classical Side of the MHC Cluster"
FORTIN JSCLOUTIER MTHIBODEAU J: "Exposing the Specific Roles of the Invariant Chain Isoforms in Shaping the MHC Class II Peptidome", FRONT IMMUNOL, vol. 4, 2013, pages 443
FRATTA ECORAL SCOVRE APARISI GCOLIZZI FDANIELLI R ET AL.: "The biology of cancer testis antigens: putative function, regulation and therapeutic potential", MOL ONCOL, vol. 5, no. 2, 2011, pages 164 - 82, XP028383542, DOI: 10.1016/j.molonc.2011.02.001
GEIJTENBEEK TBTORENSMA RVAN VLIET SJVAN DUIJNHOVEN GCADEMA GJVAN KOOYK Y ET AL.: "Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses", CELL, vol. 100, no. 5, 2000, pages 575 - 85, XP000929197, DOI: 10.1016/S0092-8674(00)80693-5
GESSANI SCONTI LDEL CORNO MBELARDELLI F: "Type I interferons as regulators of human antigen presenting cell functions", TOXINS (BASEL, vol. 6, no. 6, 2014, pages 1696 - 723
GHINDILISPAVLOVATANASSOV: "Immunoassay Methods and Protocols", 2003, HUMANA PRESS
GIBBERT KSCHLAAK JFYANG DDITTMER U: "IFN-alpha subtypes: distinct biological activities in anti-viral therapy", BR J PHARMACOL, vol. 168, no. 5, 2013, pages 1048 - 58, XP055768789, DOI: 10.1111/bph.12010
GJERSTORFF MFANDERSEN MHDITZEL HJ: "Oncogenic cancer/testis antigens: prime candidates for immunotherapy", ONCOTARGET, vol. 6, no. 18, 2015, pages 15772 - 87, XP055435840, DOI: 10.18632/oncotarget.4694
GOKHALE AKANTHALA SLATENDRESSE JTANEJA VSATYANARAYANAJOIS S: "Immunosuppression by co-stimulatory molecules: inhibition of CD2-CD48/CD58 interaction by peptides from CD2 to suppress progression of collagen-induced arthritis in mice", CHEM BIOL DRUG DES, vol. 82, no. 1, 2013, pages 106 - 18
GOSWAMI RKAPLAN MH: "A brief history of IL-9", J IMMUNOL, vol. 186, no. 6, 2011, pages 3283 - 8, XP055563685, DOI: 10.4049/jimmunol.1003049
GRAGERT LMADBOULY AFREEMAN JMAIERS M: "Six-locus high resolution HLA haplotype frequencies derived from mixed-resolution DNA typing for the entire US donor registry", HUM IMMUNOL, vol. 74, no. 10, 2013, pages 1313 - 20
GROEPER CGAMBAZZI FZAJAC PBUBENDORF LADAMINA MROSENTHAL R ET AL.: "Cancer/testis antigen expression and specific cytotoxic T lymphocyte responses in non small cell lung cancer", INT J CANCER, vol. 120, no. 2, 2007, pages 337 - 43, XP002475670, DOI: 10.1002/ijc.22309
GUCE AIMORTIMER SEYOON TPAINTER CAJIANG WMELLINS ED ET AL.: "HLA-DO acts as a substrate mimic to inhibit HLA-DM by a competitive mechanism", NAT STRUCT MOL BIOL, vol. 20, no. 1, 2013, pages 90 - 8
GUPTA REMENS LA: "GM-CSF-secreting vaccines for solid tumors: moving forward", DISCOV MED, vol. 10, no. 50, 2010, pages 52 - 60
HE SWANG LWU YLI DZHANG Y: "CCL3 and CCL20-recruited dendritic cells modified by melanoma antigen gene-1 induce anti-tumor immunity against gastric cancer ex vivo and in vivo", J EXP CLIN CANCER RES, vol. 29, 2010, pages 37, XP021083444, DOI: 10.1186/1756-9966-29-37
HILLYER PRAVIV NGOLD DMDOUGHERTY DLIU JJOHNSON TR ET AL.: "Subtypes of type I IFN differentially enhance cytokine expression by suboptimally stimulated CD4(+) T cells", EUR J IMMUNOL, vol. 43, no. 12, 2013, pages 3197 - 208, XP071226164, DOI: 10.1002/eji.201243288
HIRANO NBUTLER MOXIA ZANSEN SVON BERGWELT-BAILDON MSNEUBERG D ET AL.: "Engagement of CD83 ligand induces prolonged expansion of CD8+ T cells and preferential enrichment for antigen specificity", BLOOD, vol. 107, no. 4, 2006, pages 1528 - 36, XP055386990, DOI: 10.1182/blood-2005-05-2073
HONGISTO VAURE MRMAKELA RSAHLBERG KK: "The HER2 amplicon includes several genes required for the growth and survival of HER2 positive breast cancer cells - A data description", GENOM DATA, vol. 2, 2014, pages 249 - 53
HU ZBMA WZABORSKI MMACLEOD RQUENTMEIER HDREXLER HG: "Establishment and characterization of two novel cytokine-responsive acute myeloid and monocytic leukemia cell lines, MUTZ-2 and MUTZ-3", LEUKEMIA, vol. 10, no. 6, 1996, pages 1025 - 40
IMAI TBABA MNISHIMURA MKAKIZAKI MTAKAGI SYOSHIE O: "The T cell-directed CC chemokine TARC is a highly specific biological ligand for CC chemokine receptor 4", J BIOL CHEM, vol. 272, no. 23, 1997, pages 15036 - 42, XP000669636, DOI: 10.1074/jbc.272.23.15036
JONGENEEL CVDELORENZI MISELI CZHOU DHAUDENSCHILD CDKHREBTUKOVA I ET AL.: "An atlas of human gene expression from massively parallel signature sequencing (MPSS", GENOME RES, vol. 15, no. 7, 2005, pages 1007 - 14, XP002566986, DOI: 10.1101/gr.4041005
KATZ EDUBOIS-MARSHALL SSIMS AHFARATIAN DLI JSMITH ES ET AL.: "A gene on the HER2 amplicon, C35, is an oncogene in breast cancer whose actions are prevented by inhibition of Syk", BR J CANCER, vol. 103, no. 3, 2010, pages 401 - 10
KEENAN BPJAFFEE EM: "Whole cell vaccines--past progress and future strategies", SEMIN ONCOL, vol. 39, no. 3, 2012, pages 276 - 86
KNAUS AAWAYA THELBIG IAFAWI ZPENDZIWIAT MABU-RACHMA J ET AL.: "Rare Noncoding Mutations Extend the Mutational Spectrum in the PGAP3 Subtype of Hyperphosphatasia with Mental Retardation Syndrome", HUM MUTAT, vol. 37, no. 8, 2016, pages 737 - 44
KONTERMANN REBRINKMANN U: "Bispecific antibodies", DRUG DISCOV TODAY, vol. 20, no. 7, 2015, pages 838 - 47, XP055251363, DOI: 10.1016/j.drudis.2015.02.008
KPETEMEY MCHAUDHARY PVAN TREUREN TVISHWANATHA JK: "MIEN1 drives breast tumor cell migration by regulating cytoskeletal-focal adhesion dynamics", ONCOTARGET, vol. 7, no. 34, 2016, pages 54913 - 24
LAVOY ECBOLLARD CMHANLEY PJBLANEY JWO'CONNOR DPBOSCH JA ET AL.: "A single bout of dynamic exercise enhances the expansion of MAGE-A4 and PRAME-specific cytotoxic T-cells from healthy adults", EXERC IMMUNOL REV, vol. 21, 2015, pages 144 - 53
LE DTWANG-GILLAM APICOZZI VGRETEN TFCROCENZI TSPRINGETT G ET AL.: "Safety and survival with GVAX pancreas prime and Listeria Monocytogenes-expressing mesothelin (CRS-207) boost vaccines for metastatic pancreatic cancer", J CLIN ONCOL, vol. 33, no. 12, 2015, pages 1325 - 33, XP055501578, DOI: 10.1200/JCO.2014.57.4244
LE YZHOU YIRIBARREN PWANG J: "Chemokines and chemokine receptors: their manifold roles in homeostasis and disease", CELL MOL IMMUNOL, vol. 1, no. 2, 2004, pages 95 - 104, XP055331932
LEBRE MCBURWELL TVIEIRA PLLORA JCOYLE AJKAPSENBERG ML ET AL.: "Differential expression of inflammatory chemokines by Thl- and Th2-cell promoting dendritic cells: a role for different mature dendritic cell populations in attracting appropriate effector cells to peripheral sites of inflammation", IMMUNOL CELL BIOL, vol. 83, no. 5, 2005, pages 525 - 35
LEE SMARGOLIN K: "Cytokines in cancer immunotherapy", CANCERS (BASEL, vol. 3, no. 4, 2011, pages 3856 - 93, XP055215785, DOI: 10.3390/cancers3043856
LEITNER J: "Dissertation (Ph.D. Thesis", UNIVERSITY OF VIENNA, article "The role of costimulatory pathways during the activation of human T cells"
LEITNER JGRABMEIER-PFISTERSHAMMER KSTEINBERGER P: "Receptors and ligands implicated in human T cell costimulatory processes", IMMUNOL LETT, vol. 128, no. 2, 2010, pages 89 - 97, XP026896008, DOI: 10.1016/j.imlet.2009.11.009
LIPSON EJSHARFMAN WHCHEN SMCMILLER TLPRITCHARD TSSALAS JT ET AL.: "Safety and immunologic correlates of Melanoma GVAX, a GM-CSF secreting allogeneic melanoma cell vaccine administered in the adjuvant setting", J TRANSL MED, vol. 13, 2015, pages 214, XP021227882, DOI: 10.1186/s12967-015-0572-3
LOLLINI PLCAVALLO FNANNI PQUAGLINO E: "The Promise of Preventive Cancer Vaccines", VACCINES (BASEL, vol. 3, no. 2, 2015, pages 467 - 89
LOWE ET AL., GENOME BIOL, vol. 16, 17 September 2015 (2015-09-17), pages 194
LOWE ROVERHOFF MGRAMAGOPALAN SVGARBE JCKOH JSTAMPFER MR ET AL.: "The senescent methylome and its relationship with cancer, ageing and germline genetic variation in humans", GENOME BIOL, vol. 16, 2015, pages 194
LUO HYU GWU YWU J: "EphB6 crosslinking results in costimulation of T cells", J CLIN INVEST, vol. 110, no. 8, 2002, pages 1141 - 50
MA DYCLARK EA: "The role of CD40 and CD154/CD40L in dendritic cells", SEMIN IMMUNOL, vol. 21, no. 5, 2009, pages 265 - 72
MAKKOUK A, WEINER GJ: "new approaches to an old challenge", CANCER RES, vol. 75, no. 1, 2015, pages 5 - 10
MANDAPATHIL MSZCZEPANSKI MHARASYMCZUK MREN JCHENG DJACKSON EK ET AL.: "CD26 expression and adenosine deaminase activity in regulatory T cells (Treg) and CD4(+) T effector cells in patients with head and neck squamous cell carcinoma", ONCOIMMUNOLOGY, vol. 1, no. 5, 2012, pages 659 - 69
MANTEGAZZA ARMAGALHAES JGAMIGORENA SMARKS MS: "Presentation of phagocytosed antigens by MHC class I and II", TRAFFIC, vol. 14, no. 2, 2013, pages 135 - 52
MARCHINI CKALOGRIS CGARULLI CPIETRELLA LGABRIELLI FCURCIO C ET AL.: "Tailoring DNA Vaccines: Designing Strategies Against HER2-Positive Cancers", FRONT ONCOL, vol. 3, 2013, pages 122
MAUDE SLFREY NSHAW PAAPLENC RBARRETT DMBUNIN NJ ET AL.: "Chimeric antigen receptor T cells for sustained remissions in leukemia", N ENGL J MED, vol. 371, no. 16, 2014, pages 1507 - 17, XP055188099, DOI: 10.1056/NEJMoa1407222
MAUS MVGRUPP SAPORTER DLJUNE CH: "Antibody-modified T cells: CARs take the front seat for hematologic malignancies.", BLOOD, vol. 123, no. 17, 2014, pages 2625 - 35
MITTENDORF EACLIFTON GTHOLMES JPSCHNEBLE EVAN ECHO DPONNIAH S ET AL.: "Final report of the phase 1/11 clinical trial of the E75 (nelipepimut-S) vaccine with booster inoculations to prevent disease recurrence in high-risk breast cancer patients", ANN ONCOL, vol. 25, no. 9, 2014, pages 1735 - 42
NAKAYAMA M: "Antigen Presentation by MHC-Dressed Cells", FRONT IMMUNOL, vol. 5, 2014, pages 672
NORRMAN KFISCHER YBONNAMY BWOLFHAGEN SAND FRAVASSARD PSEMB H: "Quantitative comparison of constitutive promoters in human ES cells", PLOS ONE, vol. 5, no. 8, 2010, pages el2413, XP055880435, DOI: 10.1371/journal.pone.0012413
OFT M: "IL-10: master switch from tumor-promoting inflammation to antitumor immunity", CANCER IMMUNOL RES, vol. 2, no. 3, 2014, pages 194 - 9, XP055550593, DOI: 10.1158/2326-6066.CIR-13-0214
OGAWA TKUSUMOTO MMIZUMOTO KSATO NTANAKA M: "Adenoviral GM-CSF Gene Transduction into Breast Cancer Cells Induced Long-Lasting Antitumor Immunity in Mice", BREAST CANCER, vol. 6, no. 4, 1999, pages 301 - 4
OHNUMA KUCHIYAMA MYAMOCHI TNISHIBASHI KHOSONO OTAKAHASHI N ET AL.: "Caveolin-1 triggers T-cell activation via CD26 in association with CARMA1", J BIOL CHEM., vol. 282, no. 12, 2007, pages 10117 - 31
OHSHIMA YTANAKA YTOZAWA HTAKAHASHI YMALISZEWSKI CDELESPESSE G: "Expression and function of OX40 ligand on human dendritic cells", J IMMUNOL., vol. 159, no. 8, 1997, pages 3838 - 48
OHTSUKA ET AL., J. BIOL. CHEM., vol. 260, 1985, pages 2605 - 2608
OZAKI ET AL.: "HLA-DRB1, -DRB3, -DRB4 and -DRB5 genotyping at a super-high resolution level by long range PCR and high-throughput sequencing", TISSUE ANTIGENS, vol. 83, no. 1, January 2014 (2014-01-01), pages 10 - 16, XP055452136, DOI: 10.1111/tan.12258 *
PRAZMA CMTEDDER TF: "Dendritic cell CD83: a therapeutic target or innocent bystander?", IMMUNOL LETT, vol. 115, no. 1, 2008, pages 1 - 8, XP022400678, DOI: 10.1016/j.imlet.2007.10.001
PRICKETT TDCRYSTAL JSCOHEN CJPASETTO APARKHURST MRGARTNER JJ ET AL.: "Durable Complete Response from Metastatic Melanoma after Transfer of Autologous T Cells Recognizing 10 Mutated Tumor Antigens", CANCER IMMUNOL RES, vol. 4, no. 8, 2016, pages 669 - 78, XP055531679, DOI: 10.1158/2326-6066.CIR-15-0215
RAY PKRISHNAMOORTHY NRAY A: "Emerging functions of c-kit and its ligand stem cell factor in dendritic cells: regulators of T cell differentiation", CELL CYCLE, vol. 7, no. 18, 2008, pages 2826 - 32
REICH MLIEFELD TGOULD JLERNER JTAMAYO PMESIROV JP: "GenePattern 2.0", NAT GENET, vol. 38, no. 5, 2006, pages 500 - 1
RESCIGNO MPIGUET VVALZASINA BLENS SZUBLER RFRENCH L ET AL.: "Fas engagement induces the maturation of dendritic cells (DCs), the release of interleukin (IL)-lbeta, and the production of interferon gamma in the absence of IL-12 during DC-T cell cognate interaction: a new role for Fas ligand in inflammatory responses", J EXP MED., vol. 192, no. 11, 2000, pages 1661 - 8
REYNDERS KILLIDGE TSIVA SCHANG JYDE RUYSSCHER D: "The abscopal effect of local radiotherapy: using immunotherapy to make a rare event clinically relevant", CANCER TREAT REV, vol. 41, no. 6, 2015, pages 503 - 10, XP029169665, DOI: 10.1016/j.ctrv.2015.03.011
ROBBINS PFKASSIM SHTRAN TLCRYSTAL JSMORGAN RAFELDMAN SA ET AL.: "A pilot trial using lymphocytes genetically engineered with an NY-ESO-1-reactive T-cell receptor: long-term follow-up and correlates with response", CLIN CANCER RES, vol. 21, no. 5, 2015, pages 1019 - 27, XP055212606, DOI: 10.1158/1078-0432.CCR-14-2708
RODRIGUEZ RMPITZALIS CKINGSLEY GHHENDERSON EHUMPHRIES MJPANAYI GS: "T lymphocyte adhesion to fibronectin (FN): a possible mechanism for T cell accumulation in the rheumatoid joint", CLIN EXP IMMUNOL, vol. 89, no. 3, 1992, pages 439 - 45
ROSSOLINI ET AL., MOL. CELL. PROBES, vol. 8, 1994, pages 91 - 98
SAFI SBECKHOVE PWARTH ABENNER AROEDER FRIEKEN S ET AL.: "A randomized phase II study of radiation induced immune boost in operable non-small cell lung cancer (RadImmune trial", BMC CANCER, vol. 15, 2015, pages 988
SAHLBERG KKHONGISTO VEDGREN HMAKELA RHELLSTROM KDUE EU ET AL.: "The HER2 amplicon includes several genes required for the growth and survival of HER2 positive breast cancer cells", MOL ONCOL, vol. 7, no. 3, 2013, pages 392 - 401, XP028543795, DOI: 10.1016/j.molonc.2012.10.012
SAMBROOK ET AL.: "Molecular Cloning - A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY
SANTEGOETS SJSTAM AGLOUGHEED SMGALL HJOOSS KSACKS N ET AL.: "Myeloid derived suppressor and dendritic cell subsets are related to clinical outcome in prostate cancer patients treated with prostate GVAX and ipilimumab", J IMMUNOTHER CANCER, vol. 2, 2014, pages 31, XP021198865, DOI: 10.1186/s40425-014-0031-3
SHARMA ABODE BWENGER RHLEHMANN KSARTORI AAMOCH H ET AL.: "gamma-Radiation promotes immunological recognition of cancer cells through increased expression of cancer-testis antigens in vitro and in vivo", PLOS ONE, vol. 6, 2011, pages e28217
SHEHATA ET AL., BREAST CANCER RES., vol. 14, no. 5, 2012, pages R134
SHEHATA MTESCHENDORFF ASHARP GNOVCIC NRUSSELL IAAVRIL S ET AL.: "Phenotypic and functional characterisation of the luminal cell hierarchy of the mammary gland", BREAST CANCER RES, vol. 14, no. 5, 2012, pages R134, XP021130355, DOI: 10.1186/bcr3334
SHIINA ET AL.: "The HLA genomic loci map: expression, interaction, diversity and disease", J HUM GENET, vol. 54, no. 1, January 2009 (2009-01-01), pages 15 - 39, XP055412700 *
SHIINA T, HOSOMICHI K, INOKO H, KULSKI JK: "expression, interaction, diversity and disease", J HUM GENET, vol. 54, no. 1, 2009, pages 15 - 39, XP055412700, DOI: 10.1038/jhg.2008.5
SHIMIZU YVAN SEVENTER GAHORGAN KJSHAW S: "Costimulation of proliferative responses of resting CD4+ T cells by the interaction of VLA-4 and VLA-5 with fibronectin or VLA-6 with laminin", J IMMUNOL, vol. 145, no. 1, 1990, pages 59 - 67, XP002362286
SILVESTRI ICATTARINO SAGLIANO AMCOLLALTI GSCIARRA A: "Beyond the Immune Suppression: The Immunotherapy in Prostate Cancer", BIOMED RES INT, 2015, pages 794968
SMYTH LAHARKER NTURNBULL WEL-DOUEIK HKLAVINSKIS LKIOUSSIS D ET AL.: "The relative efficiency of acquisition of MHC:peptide complexes and cross-presentation depends on dendritic cell type", J IMMUNOL, vol. 181, no. 5, 2008, pages 3212 - 20
SOARES KCRUCKI AAKIM VFOLEY KSOLT SWOLFGANG CL ET AL.: "TGF-beta blockade depletes T regulatory cells from metastatic pancreatic tumors in a vaccine dependent manner", ONCOTARGET, vol. 6, no. 40, 2015, pages 43005 - 15
SRIVATSAN SPATEL JMBOZEMAN ENIMASUEN IEHE SDANIELS D ET AL.: "Allogeneic tumor cell vaccines: the promise and limitations in clinical trials", HUM VACCIN IMMUNOTHER, vol. 10, no. 1, 2014, pages 52 - 63, XP055507694, DOI: 10.4161/hv.26568
SURI AJAGADISH NSAINI SGUPTA N: "Targeting cancer testis antigens for biomarkers and immunotherapy in colorectal cancer: Current status and challenges", WORLD J GASTROINTEST ONCOL, vol. 7, no. 12, 2015, pages 492 - 502
SUTAVANI RVBRADLEY RGRAMAGE JMJACKSON AMDURRANT LGSPENDLOVE I: "CD55 costimulation induces differentiation of a discrete T regulatory type 1 cell population with a stable phenotype", J IMMUNOL, vol. 191, no. 12, 2013, pages 5895 - 903
TURNER MDNEDJAI BHURST TPENNINGTON DJ: "Cytokines and chemokines: At the crossroads of cell signalling and inflammatory disease", BIOCHIM BIOPHYS ACTA, vol. 1843, no. 11, 2014, pages 2563 - 82
VILLADOLID JAMIN A: "Immune checkpoint inhibitors in clinical practice: update on management of immune-related toxicities", TRANSL LUNG CANCER RES., vol. 4, no. 5, 2015, pages 560 - 75, XP055383844, DOI: 10.3978/j.issn.2218-6751.2015.06.06
WISEMAN CLKHARAZI A: "Objective clinical regression of metastatic breast cancer in disparate sites after use of whole-cell vaccine genetically modified to release sargramostim", BREAST J, vol. 12, no. 5, 2006, pages 475 - 80, XP055825522, DOI: 10.1111/j.1075-122X.2006.00319.x
WISEMAN CLKHARAZI A: "Phase I Study with SV-BR-1 Breast Cancer Cell Line Vaccine and GM-CSF: Clinical Experience in 14 Patients", THE OPEN BREAST CANCER JOURNAL (DISCONTINUED, vol. 2, 2010, pages 4 - 11, XP055825524
WITTIG MANMARKRUD JAKASSENS JCKOCH SFORSTER MELLINGHAUS E ET AL.: "Development of a high-resolution NGS-based HLA-typing and analysis pipeline", NUCLEIC ACIDS RES., vol. 43, no. 11, 2015, pages e70
WONG BRJOSIEN RLEE SYSAUTER BLI HLSTEINMAN RM ET AL.: "TRANCE (tumor necrosis factor [TNF]-related activation-induced cytokine), a new TNF family member predominantly expressed in T cells, is a dendritic cell-specific survival factor", J EXP MED, vol. 186, no. 12, 1997, pages 2075 - 80, XP002432392, DOI: 10.1084/jem.186.12.2075
YANG JYI Q: "Killing tumor cells through their surface beta(2)-microglobulin or major histocompatibility complex class I molecules", CANCER, vol. 116, no. 7, 2010, pages 1638 - 45, XP055618562, DOI: 10.1002/cncr.24953
ZOU GM, TAM YK: "recent advances", EUR CYTOKINE NETW, vol. 13, no. 2, 2002, pages 186 - 99, XP009014615

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11559574B2 (en) 2016-02-25 2023-01-24 Briacell Therapeutics Corp. Whole-cell cancer vaccines and methods for selection thereof
JP2021505138A (ja) * 2017-12-04 2021-02-18 ヒート バイオロジクス,インコーポレイテッド 細胞に基づくワクチンの製造
EP3727467A4 (en) * 2017-12-22 2021-12-01 Centivax, Inc. MAJOR HISTOCOMPATIBILITY COMPLEX (CMH) COMPOSITIONS AND CORRESPONDING PROCEDURES FOR USE
CN108175853A (zh) * 2018-01-24 2018-06-19 上海赛群生物科技有限公司 一种肿瘤细胞疫苗及其制备方法
CN108486038A (zh) * 2018-03-21 2018-09-04 中国人民解放军第四军医大学 一种构建脂肪干细胞膜片的方法及应用
CN108486038B (zh) * 2018-03-21 2021-08-27 中国人民解放军第四军医大学 一种构建脂肪干细胞膜片的方法及应用
WO2020132595A1 (en) * 2018-12-21 2020-06-25 The Regents Of The University Of California Il-10-containing vaccines and uses thereof
EP3897691A4 (en) * 2018-12-21 2022-08-31 The Regents of the University of California IL-10 CONTAINING VACCINES AND THEIR USES
EP4582440A3 (en) * 2018-12-21 2025-10-08 The Regents of the University of California Il-10-containing vaccines and uses thereof
CN110938630A (zh) * 2019-12-20 2020-03-31 中国人民解放军第四军医大学 人b3gnt5基因的用途及相关产品
CN110938630B (zh) * 2019-12-20 2023-07-28 中国人民解放军第四军医大学 人b3gnt5基因的用途及相关产品
WO2023092053A1 (en) * 2021-11-18 2023-05-25 Partner Therapeutics, Inc. Granulocyte-macrophage colony-stimulating factor-based cancer treatments
WO2023167973A1 (en) 2022-03-03 2023-09-07 Briacell Therapeutics Corp. Cancer vaccines and methods of use thereof
WO2025171109A1 (en) 2024-02-07 2025-08-14 Briacell Therapeutics Corp. Cancer vaccines expressing post-translational modified antigens and methods of use thereof
WO2026068517A1 (en) * 2024-09-24 2026-04-02 Universiteit Gent Cancer immunotherapy

Also Published As

Publication number Publication date
AU2017224232B2 (en) 2022-07-28
AU2017224232A1 (en) 2018-09-06
NZ745327A (en) 2023-06-30
US20190046624A1 (en) 2019-02-14
JP6901505B2 (ja) 2021-07-14
IL261354A (en) 2018-10-31
EP3419657A1 (en) 2019-01-02
AU2022259857A1 (en) 2022-12-08
US11559574B2 (en) 2023-01-24
AU2025205094A1 (en) 2025-07-24
JP2019507608A (ja) 2019-03-22
CN109069603A (zh) 2018-12-21
AU2022259857B2 (en) 2025-05-29
US20230277640A1 (en) 2023-09-07
NZ785587A (en) 2025-02-28
EP3419657A4 (en) 2019-11-06
CA3015080A1 (en) 2017-08-31
CA3300406A1 (en) 2026-03-02

Similar Documents

Publication Publication Date Title
US20230277640A1 (en) Whole-cell cancer vaccines and methods for selection thereof
ES3042082T3 (en) Methods of making chimeric antigen receptor-expressing cells
CN113260633A (zh) 用于癌症免疫疗法的诊断方法和组合物
CN115551537A (zh) 肿瘤细胞疫苗
US11740242B2 (en) Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy
US20200323905A1 (en) Methods and compositions for modulating the immune system
CN111148518A (zh) 使用cdk4/6抑制剂调控调节性t细胞和免疫应答的方法
US20210254097A1 (en) Engineering of immune cells for ex vivo cell therapy applications
US20220298222A1 (en) Combination therapy of a t cell therapy and an enhancer of zeste homolog 2 (ezh2) inhibitor and related methods
Lacher et al. SV-BR-1-gm, a clinically effective GM-CSF-Secreting breast cancer cell line, expresses an immune signature and directly activates CD4+ T lymphocytes
US20210369825A1 (en) Cd40 and cd40l combo in an adv vaccine vehicle
WO2021062313A1 (en) Immunogenic egfr peptide compositions and their use in the treatment of cancer
EP3417289B1 (en) Methods of immunogenic modulation
WO2024026308A2 (en) COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF THE SIGNAL REGULATORY PROTEIN ALPHA (SIRPα) GENE
JP2025003730A (ja) 癌患者への免疫チェックポイント阻害薬の投与の有効性を予測するためのデータを収集する方法
JP2023515190A (ja) Apc欠損がんの治療のための方法および組成物
EP4431153A1 (en) Mutants of a ligand-dependent corepressor (lcor) and uses thereof
US20240226161A9 (en) Mir200c-epcam axis reprogramed immune cells for enhanced anti-tumor function
CN118401562A (zh) 抗tnmuc1 gold car t细胞的组合物和方法
WO2015142713A1 (en) Compositions and methods for reducing c/ebp homologous protein activity in myeloid-derived suppressor cells
Davis Strategies to overcome Immunomodulatory drug resistance in multiple myeloma
HK40058894A (en) Diagnostic methods and compositions for cancer immunotherapy
WO2025171109A1 (en) Cancer vaccines expressing post-translational modified antigens and methods of use thereof
HK40028190A (en) Methods for modulating regulatory t cells and immune responses using cdk4/6 inhibitors
Khandelwal et al. Alemtuzumab for Steroid Refractory Acute Graft Versus Host Disease in Pediatric Patients: A Retrospective Review of 12 Patients Reveals a Response Rate of 83%

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 3015080

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 261354

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2018563769

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017224232

Country of ref document: AU

Date of ref document: 20170227

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2017757429

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017757429

Country of ref document: EP

Effective date: 20180925

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17757429

Country of ref document: EP

Kind code of ref document: A1