WO2017143156A1 - Nucleic acid carriers and therapeutic methods of use - Google Patents
Nucleic acid carriers and therapeutic methods of use Download PDFInfo
- Publication number
- WO2017143156A1 WO2017143156A1 PCT/US2017/018323 US2017018323W WO2017143156A1 WO 2017143156 A1 WO2017143156 A1 WO 2017143156A1 US 2017018323 W US2017018323 W US 2017018323W WO 2017143156 A1 WO2017143156 A1 WO 2017143156A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody
- fragment
- targeting agent
- directed
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/14—Peptides containing saccharide radicals; Derivatives thereof, e.g. bleomycin, phleomycin, muramylpeptides or vancomycin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
- A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
- A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
- A61K47/68031—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being an auristatin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
- A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
- A61K47/6881—Cluster-antibody conjugates, i.e. the modifying agent consists of a plurality of antibodies covalently linked to each other or of different antigen-binding fragments covalently linked to each other
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
- A61K47/6883—Polymer-drug antibody conjugates, e.g. mitomycin-dextran-Ab; DNA-polylysine-antibody complex or conjugate used for therapy
- A61K47/6885—Polymer-drug antibody conjugates, e.g. mitomycin-dextran-Ab; DNA-polylysine-antibody complex or conjugate used for therapy the conjugate or the polymer being a starburst, a dendrimer, a cascade
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/08—Drugs for disorders of the urinary system of the prostate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3513—Protein; Peptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/32—Special delivery means, e.g. tissue-specific
Definitions
- nucleic acid carriers comprising targeting agents, pharmaceutical compositions comprising the same, and methods of making and using the same.
- Multi-molecular scaffold devices including DNA dendrimers, may be useful as cellular transfection, imaging, and drug delivery agents.
- DNA dendrimers may be bound with targeting devices (e.g., an antibody specific for a cell surface feature capable of eliciting an cellular endocytotic internalization event) and can bind to surface features on targeted cells to provide delivery of a cargo (e.g., a drug) intracellularly or extracellularly, respectively.
- Cargos may be passively associated with the targeted DNA dendrimer and enter the cell simply by spatial association with the dendrimer, or cargos may be directly bound to the dendrimer via a number of attachment strategies for release at the target destination.
- DNA dendrimers could only be successfully made from DNA produced by "natural" means, such as DNA produced via the use of biological systems (e.g., bacterial cloning) or via the use of enzymatic polymerization of DNA sequences (as from the polymerase chain reaction (PCR) and other enzymatically dependent DNA synthesis methods).
- biological systems e.g., bacterial cloning
- enzymatic polymerization of DNA sequences as from the polymerase chain reaction (PCR) and other enzymatically dependent DNA synthesis methods.
- PCR polymerase chain reaction
- DNA dendrimers it is not economically feasible to produce DNA dendrimers in the quantities necessary for commercial applications such as therapeutic drug delivery applications when they are assembled from naturally produced DNA.
- biological replication of the sequences required for construction of a DNA dendrimer produces double-stranded molecules from which the single-strands required for construction of the dendrimer must be separated and isolated.
- the present disclosure provides monomeric nucleic acid carriers comprising: a first and a second oligonucleotide; wherein a central portion of each of the first and second
- oligonucleotides is complementary to each other, forming a double-stranded region, wherein the two terminal portions of the first oligonucleotide are not complementary to the two terminal portions of the second oligonucleotide, forming four single-stranded arms; and at least one targeting agent conjugated to at least one single-stranded arm.
- the present disclosure also provides double monomer nucleic acid carriers comprising a first monomeric nucleic acid carrier and a second monomeric nucleic acid carrier, wherein one single-stranded arm of the first monomeric nucleic acid carrier is conjugated to one single- stranded arm of the second monomeric nucleic acid carrier, forming a double monomer nucleic acid carrier comprising six peripheral single-stranded arms.
- trimer nucleic acid carriers comprising: a first oligonucleotide having a central portion, a first terminal arm, and a second terminal arm; a second oligonucleotide having a central portion, a first terminal arm, and a second terminal arm, wherein the first terminal arm of the second oligonucleotide is complementary to the first terminal arm of the first oligonucleotide and hybridized thereto; and a third oligonucleotide having a central portion, a first terminal arm, and a second terminal arm, wherein the first terminal arm of the third oligonucleotide is complementary to the second terminal arm of the first oligonucleotide and hybridized thereto; wherein the second terminal arm of the second oligonucleotide is conjugated to a first targeting agent, and the second terminal arm of the third oligonucleotide is conjugated to a second targeting agent.
- nucleic acid carriers comprising: a central portion, a first terminal arm, and a second terminal arm; wherein the first terminal arm is conjugated to a first targeting agent, and the second terminal is conjugated to a second targeting agent.
- compositions comprising any of the nucleic acid carriers described herein, and a pharmaceutically acceptable vehicle.
- the present disclosure also provides methods of making the monomeric nucleic acid carrier comprising: hybridizing the first oligonucleotide to the second oligonucleotide; and conjugating the at least one targeting agent to the at least one single-stranded arm.
- the present disclosure also provides methods of making the double monomer nucleic acid carriers comprising: hybridizing the first oligonucleotide to the second oligonucleotide to form a first nucleic acid carrier; hybridizing the third oligonucleotide to the fourth
- oligonucleotide to form a second nucleic acid carrier; hybridizing one single-stranded arm of the first nucleic acid carrier to one single-stranded arm of the second nucleic acid carrier, forming a double monomer nucleic acid carrier comprising six single-stranded arms; and conjugating the at least one targeting agent to the at least one single-stranded arm.
- the present disclosure also provides methods of making the trimer nucleic acid carriers comprising: hybridizing the first terminal arm of the second oligonucleotide to the first terminal arm of the first oligonucleotide; hybridizing the first terminal arm of the third oligonucleotide to the second terminal arm of the first oligonucleotide; conjugating the first targeting agent to the second terminal arm of the second oligonucleotide; and conjugating the second targeting agent to the second terminal arm of the third oligonucleotide.
- the present disclosure also provides methods of making nucleic acid carriers comprising: conjugating the first targeting agent to the first terminal arm; and conjugating the second targeting agent to the second terminal arm.
- the present disclosure also provides methods of inducing an immune response in an animal comprising administering to the animal any of the nucleic acid carriers described herein, or a pharmaceutical composition comprising the same, wherein the nucleic acid carrier comprises at least two targeting agents chosen from an antigen, a peptide, an antibody or fragment thereof, and an adjuvant.
- the present disclosure also provides methods of treating an animal having cancer comprising administering to the animal any of the nucleic acid carriers described herein, or a pharmaceutical composition comprising the same, wherein the nucleic acid carrier comprises at least two targeting agents chosen from an antibody, or fragment thereof, and a label.
- the present disclosure also provides methods of treating an animal having a disease associated with a disease-associated antigen comprising administering to the animal any of the nucleic acid carriers described herein, or a pharmaceutical composition comprising the same, wherein the nucleic acid carrier comprises at least two targeting agents chosen from an antibody, or fragment thereof, and a label.
- Figure 1 shows representative first and second oligonucleotides (e.g., #1, #2, #3, #4, #5, #6, and #7) that form a nucleic acid carrier monomer (e.g., A, B', B", C, and C") when hybridized;
- the oligonucleotides comprise a central core portion (e.g., "bl”, “bl(-)", “b2", “b2(- 1)", and “bl") that hybridize to form a double-stranded region;
- the oligonucleotides also comprise two terminal portions (e.g., "a", “c”, "a(-)' ⁇ "e”, “d” "e(-)' ⁇ and "d(-)”) that form four single-stranded arms when the two oligonucleotides are hybridized to form the monomer.
- Figures 2A, 2B, 2C, 2D, and 2E show representative nucleic acid carrier monomers with 1, 2, 3 or 4 targeting agents (e.g., antibodies AglAb, Ag2Ab, Ag3Ab, and Ag4Ab) per monomer; also shown are optional oligonucleotides (which are not conjugated to any antibodies) bound to single-stranded arms and forming double-stranded DNA structures.
- 1, 2, 3 or 4 targeting agents e.g., antibodies AglAb, Ag2Ab, Ag3Ab, and Ag4Ab
- optional oligonucleotides which are not conjugated to any antibodies bound to single-stranded arms and forming double-stranded DNA structures.
- Figures 3A, 3B, and 3C show representative double monomer nucleic acid carriers comprising two monomers bound to one another via a conjugation oligonucleotide; these double monomer nucleic acid carriers have six single-stranded arms capable of conjugating to any of the targeting agents described herein.
- Figure 4 shows representative trimer nucleic acid carriers comprising three
- oligonucleotides configured to provide two single-stranded arms capable of conjugating to any of the targeting agents described herein.
- Figure 5 shows representative ssDNA or dsDNA oligonucleotides configured to provide two single-stranded arms capable of conjugating to any of the targeting agents described herein.
- Figure 6 shows representative serum degradation gel analysis of naked nucleic acid carrier versus phosphorothioate naked nucleic acid carrier in mouse serum.
- the present disclosure provides monomeric nucleic acid carriers comprising a core unit that comprises a first oligonucleotide and a second oligonucleotide.
- a central portion of each of the first and second oligonucleotides is complementary to each other, thus forming a double- stranded region.
- the two terminal portions of the first oligonucleotide are not complementary to the two terminal portions of the second oligonucleotide, thus forming four single-stranded arms.
- Figure 1 shows representative first and second oligonucleotides (see, #1, #2, #3, #4, #5, #6, and #1 oligonucleotides) that form a nucleic acid carrier monomer (see, A, B', B", C, and C" monomers) when hybridized.
- Each oligonucleotide comprises a central core portion (see, "bl”, “bl(-)”, “b2”, “b2(-l)", and "bl”) that hybridizes with another oligonucleotide having a central core portion to form a double-stranded region.
- Each oligonucleotide also comprise two terminal portions (see, “a”, “c”, “a(-)' ⁇ “e”, “d” "e(-)”, and “d(-)”) that form four single-stranded arms when the two oligonucleotides are hybridized to form the monomer.
- each terminal portion i.e., the four terminal portions of a hybridized pair of oligonucleotides
- the oligonucleotide is 97 nucleotides in length.
- the 97-mer has some advantages because it is short enough for efficient synthesis and does not need to be gel- purified, but is still sufficiently large that hybridization is efficient.
- Suitable nucleotide sequences comprise little or no secondary structure such as hairpins, have a T m greater than 50°C-55°C (suitably 65°C-75°C), at least one cross-linking site, and a central hybridization region and 3-prime and 5-prime arm regions of no less than 25 bases in length unless modified nucleotides, comprising locked nucleic acids or similar nucleotides, are used to further increase the T m .
- the nucleic acid comprising the oligonucleotides may be any type of nucleic acid or nucleic acid derivative that is amenable to chemical synthesis methods known in the art, or to chemical synthesis methods with subsequent derivatization.
- Suitable nucleic acids include, but are not limited to, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), modified DNA or RNA, peptide nucleic acid (PNA), morpholino and locked nucleic acid (LNA), glycol nucleic acid (GNA), threose nucleic acid (TNA), DNA containing phosphorothioate residues (S-oligos) and derivatives thereof, or any combination thereof.
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- PNA peptide nucleic acid
- LNA morpholino and locked nucleic acid
- GAA glycol nucleic acid
- TAA threose nucleic acid
- the nucleic acid carrier may contain oligonucleotides that comprise different nucleotide backbones.
- the oligonucleotides making up the first inner layer may comprise a particular nucleotide backbone
- the oligonucleotides making up the second more outer layer may comprise a different particular nucleotide backbone.
- the same can be present in multiple layer nucleic acid carriers, with one or more of the layers having oligonucleotides with a different nucleotide backbone compared to an adjacent layer. For example, in some
- a nucleic acid carrier can contain both phosphodiester (PO) synthetic oligonucleotide strands and phosphorothioate (PS) oligonucleotide strands.
- the first inner layer is all PO-DNA and the oligonucleotide strands added to make the second more outer layer are PS-DNA.
- using modified nucleotide bases can alter the serum degradation profile and the resulting clearance profile, indicating that the PK/PD profile of the carrier may be subsequently altered as well.
- the nucleic acid comprising the oligonucleotides is a nucleoside analog which increases the T m of the molecule as compared to conventional nucleosides
- LNATM Locked Nucleic Acids
- nucleoside analogs may be used in which the ribose ring is modified with a methylene bridge between the 2'-0 atom and the 4'-C atom.
- LNATM Locked Nucleic Acids
- the oligonucleotides comprise one or more T m -increasing nucleotides, the overall length may be reduced compared to those consisting of all naturally occurring nucleotides without
- the length and composition of naturally- occurring and T m -increasing nucleotides in the oligonucleotides can be selected such that the T m of the segment is greater, or at least 5°C greater or at least 10°C greater, than the temperature at which the nucleic acid will be used.
- a nucleic acid strand comprising 31 conventional DNA residues has the same T m as a 19 nucleotide strand comprising 50% LNA residues (66°C T m for both).
- oligonucleotides as described herein that comprise T m -increasing nucleotides in segments that will be used for hybridization may be from 40 to 50 nucleotides in total length, with the double-stranded region and the single- stranded arms each independently from 12 to 18 nucleotides in length.
- the nucleic acid may have alternate backbones, such as a phosphoramidite backbone.
- the oligonucleotides comprise one or more adjacent thymidine- adenine (TpA - 5' to 3' orientation) residues.
- TpA site improves crosslinking of the oligonucleotide molecules when they are assembled in the branched nucleic acid carriers and psoralen or psoralen-like molecules are used as inducible cross-linking agents.
- TpA residues may be present in any or all of the single-stranded arms or the double-stranded region.
- the oligonucleotides comprise from about 3 to about 7 TpA sites.
- both of the single-stranded arms and the double-stranded region comprise at least 3 TpA residues.
- one or more of the single-stranded arms and the double- stranded region may comprise from about 3 to about 7 TpA sites, such as 3, 4, 5, 6, or 7 TpA sites.
- the single-stranded arms comprise from about 3 to about 7 TpA sites, or from about 3 to about 4 TpA sites.
- the double-stranded region comprises from about 5 to about 6 TpA sites.
- TpA sites may also be replaced with other cross- linking sites and combined with that corresponding and most suitable cross-linking agent. For example, mitomycin C forms intrastrand cross-links at GpG, and CpG sites and may also be used as an effective alternative or additional site for cross-linking of the DNA scaffold.
- T m hybridization melting temperature
- the double-stranded region formed by the complementarity between the first and second oligonucleotides is from about 4 to about 2000 bases in length, from about 5 to about 200 bases in length, from about 25 to about 50 bases in length, or from about 25 to about 35 bases in length. In some embodiments, the double-stranded region is 31 bases in length.
- Each single-stranded arm is from about 4 to about 200 bases in length, from about 5 to about 50 bases in length, from about 25 to about 50 bases in length, from about 25 to about 35 bases in length, from about 16 to about 50 bases in length, or from about 12 to about 18 bases in length. In some embodiments, the single-stranded arm is 31 bases in length.
- the oligonucleotides may comprise one or two hinge segments joining one or both of the single-stranded arms to the double-stranded region.
- Each hinge segment may be from 1 to 4 nucleotides in length, from 2 to 4 nucleotides in length, 1 nucleotide in length, 2 nucleotides in length, 3 nucleotides in length, or 4 nucleotides in length.
- the nucleotide sequence of the hinge segment 5' to the double-stranded region is CA
- the nucleotide sequence of the hinge segment 3 ' to the double-stranded region is AC.
- Each of the single-stranded arms has a nucleic acid sequence that can be the same as or different from any other single-stranded arm.
- the nucleotide sequence of each of the four single-stranded arms is identical.
- the nucleotide sequences of three of the four single-stranded arms are identical to each other and different than the nucleotide sequence of the fourth single-stranded arm.
- the nucleotide sequences of two of the four single-stranded arms are identical to each other and different than the nucleotide sequences of the other two single-stranded arms.
- nucleotide sequences of two of the four single-stranded arms are identical to each other and the nucleotide sequences of the other two of the four single-stranded arms are identical to each other, wherein the nucleotide sequence of the first two single-stranded arms is different than the nucleotide sequences of the second two single-stranded arms. In some embodiments, the nucleotide sequence of each of the four single-stranded arms is different.
- nucleotide sequence of any particular single-stranded arm provides flexibility in design choice and can be used to specifically bind to or be conjugated to a particular linking oligonucleotide (which may or may not be further conjugated to a targeting agent) or to another single-stranded arm of another monomelic nucleic acid carrier.
- At least one targeting agent is conjugated to at least one single- stranded arm.
- a single targeting agent is conjugated to one single-stranded arm.
- two targeting agents are conjugated to two different single-stranded arms.
- three targeting agents are conjugated to three different single- stranded arms.
- four targeting agents are conjugated to four different single-stranded arms.
- a single targeting agent is conjugated to a single-stranded arm.
- a first targeting agent is conjugated to one single-stranded arm and a second targeting agent is conjugated to a different single-stranded arm.
- the first targeting agent is identical to the second targeting agent.
- the first targeting agent is different than the second targeting agent.
- a first targeting agent is conjugated to one single-stranded arm
- a second targeting agent is conjugated to a different single-stranded arm
- a third targeting agent is conjugated to a different single-stranded arm.
- the first targeting agent, the second targeting agent, and the third targeting agent are identical.
- the first and second targeting agents are identical and the third targeting agent is different than the first and second targeting agents. In some embodiments, the first targeting agent, the second targeting agent, and the third targeting agent are different.
- a first targeting agent is conjugated to one single-stranded arm
- a second targeting agent is conjugated to a different single-stranded arm
- a third targeting agent is conjugated to a different single-stranded arm
- a fourth targeting agent is conjugated to a different single-stranded arm.
- the first targeting agent, the second targeting agent, the third targeting agent, and the fourth targeting agent are identical.
- the first targeting agent, the second targeting agent, and the third targeting agent are identical and the fourth targeting agent is different.
- the first targeting agent and the second targeting agent are identical, and the third targeting agent and the fourth targeting agent are identical, wherein the first and second targeting agents are different than the third and fourth targeting agents.
- the first targeting agent and the second targeting agent are identical, and the third targeting agent and the fourth targeting agent are each different.
- the first targeting agent, the second targeting agent, the third targeting agent, and the fourth targeting agent are each different.
- Figures 2A, 2B, 2C, 2D, and 2E show representative nucleic acid carrier monomers with 1, 2, 3 or 4 targeting agents (see, antibodies AglAb, Ag2Ab, Ag3Ab, and Ag4Ab) per monomer. Also shown are optional oligonucleotides (which are not conjugated to any antibodies) bound to single-stranded arms and forming double-stranded DNA structures.
- the double-stranded region formed by the hybridization of the optional oligonucleotide to a single- stranded arm can be blunt-ended, or either the optional oligonucleotide or the single-stranded arm can have a 1 to 5 nucleotide base overhang.
- the present disclosure also provides double monomer nucleic acid carriers comprising a first monomeric nucleic acid carrier as described herein and a second monomeric nucleic acid carrier as described herein.
- an unhybridized, single-stranded arm of the first monomer may be available for hybridization to an unhybridized, single-stranded arm of the second monomer to produce the double monomer nucleic acid carrier described herein.
- the arms of the monomers are selected such that they are complementary to unhybridized single-stranded arms of further monomers.
- the unhybridized, single-stranded arms of the monomers are therefore available for hybridization to the unhybridized, single-stranded arms of further monomers to produce a branched nucleic acid carrier or nucleic acid-based matrix.
- the nucleotide sequence of the single-stranded arms which flank the double-stranded region may be varied as desired to construct different branched nucleic acid carriers via hybridization of the single-stranded arms of one monomer to another monomer.
- relatively few double-stranded regions are necessary for constructing the branched nucleic acid carriers, because many different single-stranded arms may be linked to them to define and direct construction of the branched nucleic acid carriers.
- the nucleotide sequence of a single-stranded arm may be designed such that it is complementary to the nucleotide sequence of a single-stranded arm on another monomer, thus providing the ability to link to monomers by their single-stranded arm.
- a conjugation oligonucleotide may be used to link to monomers by their single-stranded arms, wherein a portion of the conjugation oligonucleotide is complementary to a portion of the single-stranded arm on one monomer and is also
- conjugation oligonucleotide joins one monomer to another monomer.
- Conjugation of one single- stranded arm of the first monomeric nucleic acid carrier to one single-stranded arm of the second monomeric nucleic acid carrier forms a double monomer nucleic acid carrier comprising six peripheral single-stranded arms.
- the double monomer nucleic acid carrier can comprise the types of nucleic acid described above for the monomeric nucleic acid carriers.
- the double monomer nucleic acid carrier can comprise the lengths and content of the double-stranded regions and the lengths and content of the single-stranded arms described above for the monomeric nucleic acid carriers.
- the nucleotide sequence of each of the six peripheral single- stranded arms is identical. In some embodiments, the nucleotide sequence of at least one, at least two, at least three, at least four, or at least five of the peripheral single-stranded arms are different than the nucleotide sequence of the other peripheral single-stranded arms.
- the nucleotide sequence of any particular peripheral single-stranded arm can also be identical to any one or more of the nucleotide sequences of the other peripheral single-stranded arms. Any combination of nucleotide sequences of the peripheral single-stranded arms is possible.
- At least one targeting agent, at least two targeting agents, at least three targeting agents, at least four targeting agents, at least five targeting agents, or six targeting agents are conjugated to the peripheral single-stranded arms. In some embodiments, all targeting agents are identical, or at least one targeting agent, at least two targeting agents, at least three targeting agents, at least four targeting agents, or at least five targeting agents, are different from one another. In some embodiments, one or more peripheral single-stranded arms not conjugated to a targeting agent is complementary base paired to an oligonucleotide linker.
- the double- stranded region formed by the hybridization of the oligonucleotide linker to a single-stranded arm can be blunt-ended, or either the oligonucleotide linker or the single-stranded arm can have a 1 to 5 nucleotide base overhang.
- Figures 3A, 3B, and 3C show representative double monomer nucleic acid carriers comprising two monomers bound to one another via a conjugation oligonucleotide. These double monomer nucleic acid carriers have six single-stranded arms capable of conjugating to any of the targeting agents described herein.
- trimer nucleic acid carriers comprising a first oligonucleotide having a central portion, a first terminal arm, and a second terminal arm; a second oligonucleotide having a central portion, a first terminal arm, and a second terminal arm, wherein the first terminal arm of the second oligonucleotide is complementary to the first terminal arm of the first oligonucleotide and hybridized thereto; and a third oligonucleotide having a central portion, a first terminal arm, and a second terminal arm, wherein the first terminal arm of the third oligonucleotide is complementary to the second terminal arm of the first oligonucleotide and hybridized thereto; and wherein the second terminal arm of the second oligonucleotide is conjugated to a first targeting agent, and the second terminal arm of the third oligonucleotide is conjugated to a second targeting agent.
- the trimer nucleic acid carrier can comprise the types of nucleic acid described above for the monomelic nucleic acid carriers.
- the trimer nucleic acid carrier can comprise the lengths and content of the double-stranded regions and the lengths and content of the single-stranded arms described above for the monomelic nucleic acid carriers.
- nucleotide sequences of the two terminal arms available for conjugation to a targeting agent are identical. In some embodiments, the nucleotide sequence of one of the terminal arms available for conjugation to a targeting agent is different than the nucleotide sequence of the second terminal arm available for conjugation to a targeting agent.
- the first targeting agent is identical to the second targeting agent. In some embodiments, the first targeting agent is different than the second targeting agent.
- Figure 4 shows representative trimer nucleic acid carriers comprising three
- oligonucleotides configured to provide two single-stranded arms capable of conjugating to any of the targeting agents described herein.
- the present disclosure also provides another nucleic acid carrier comprising a central portion, a first terminal arm, and a second terminal arm, wherein the first terminal arm is conjugated to a first targeting agent, and the second terminal is conjugated to a second targeting agent.
- the central portion, the first terminal arm, and the second terminal arm are single-stranded DNA.
- the central portion, the first terminal arm, and the second terminal arm are double-stranded DNA.
- the nucleic acid carrier can comprise the types of nucleic acid described above for the monomelic nucleic acid carriers.
- the nucleic acid carrier can comprise the lengths and content of the double-stranded regions and the lengths and content of the single-stranded arms described above for the monomeric nucleic acid carriers.
- the nucleotide sequences of the two terminal arms are identical. In some embodiments, the nucleotide sequences of the two terminal arms are different.
- the first targeting agent is identical to the second targeting agent. In some embodiments, the first targeting agent is different than the second targeting agent.
- the first and/or second targeting agents are conjugated to its peripheral single-stranded arm by an oligonucleotide linker as described herein for the monomelic nucleic acid carriers.
- Figure 5 shows representative ssDNA or dsDNA oligonucleotides configured to provide two single-stranded arms capable of conjugating to any of the targeting agents described herein.
- a targeting agent is conjugated to a single-stranded arm or terminal arm
- conjugation may be carried out via an oligonucleotide linker that is linked to the targeting agent, and wherein a portion of the oligonucleotide linker is complementary to a portion of the nucleotide sequence of the single-stranded arm or terminal arm.
- the targeting agent is conjugated to the single-stranded arm or terminal arm by an oligonucleotide linker.
- one or more single-stranded arms or terminal arms that are not conjugated to a targeting agent are complementary base paired to an oligonucleotide linker that is not conjugated to a targeting agent.
- a single-stranded arm or terminal arm is complementary to a portion of the oligonucleotide linker
- the oligonucleotide linker (with or without a conjugated targeting agent) need not be complementary to all 31 nucleotides. Rather, the oligonucleotide linker must be sufficiently complementary to the particular single-stranded arm or terminal arm to result in hybridization.
- that targeting agent may be conjugated to the nucleic acid carrier via the single-stranded arm or terminal arm by chemical modifications of the same which are incorporated into the single-stranded nucleic acid molecules during or after their synthesis.
- modification may include, for example, nucleoside amidites chemically modified with amine on a carbon chain linker.
- conjugation of a targeting agent to the nucleic acid carrier may be via the unhybridized, single-stranded arms or terminal arms, such as by linkage to a capture oligonucleotide hybridized to the single-stranded monomer arms or terminal arms.
- the capture oligonucleotide may be reversibly or irreversibly cross-linked to the monomer arm.
- the targeting agent can be chemically attached via hydrophilic or hydrophobic binding characteristics (including via electrostatic attraction and hydrogen binding) to the single-stranded arm or terminal arm, or attached by binding between a hapten and its binding partner (e.g., biotin and streptavidin).
- one or more of the targeting agents is, for example, an antigen, a peptide, an antibody or fragment thereof, an antibody-drug conjugate, a non-antibody scaffold, a label, an adjuvant, an RNA molecule, a DNA molecule, a vitamin, a protein, a fusion protein, a fusion peptide, a carbohydrate, a lipid, a polysaccharide, a lipopolysaccharide, a polymer, a virus particle, or a virus-like particle, or any combination thereof.
- Any nucleic acid carrier can comprise any combination of any of these targeting agents.
- a monomeric nucleic acid carrier can comprise up to any four of these targeting agents.
- a monomeric nucleic acid carrier can comprise one, two, three, or four of these targeting agents.
- a double monomer nucleic acid carrier can comprise up to any six of these targeting agents.
- a double monomer nucleic acid carrier can comprise one, two, three, four, five, or six of these targeting agents.
- the vitamin is folic acid.
- the carbohydrate is mannose.
- the polymer is hyaluronic acid, polyargenine, polylysine, polyethylenimine (PEI), polyethyleneglycol (PEG), polyglycolic acid (PGA), polylactic acid (PLA), or poly(lactic-co-glycolic acid) (PLGA).
- PEI polyethylenimine
- PEG polyethyleneglycol
- PGA polyglycolic acid
- PLA polylactic acid
- PLGA poly(lactic-co-glycolic acid)
- the RNA molecule is siRNA, miRNA, mRNA, snRNA, dsRNA, ncRNA, snoRNA, or an aptamer.
- the non-antibody scaffold is an affibody, an affilin, an anticalin, an atrimer, an avimer, a bicyclic peptide, a cys-knot, a DARPin, an FN3, a fynomer, a kunitz domain, or an O-body.
- the antigen is a bacterial antigen, a viral antigen, a fungal antigen, a yeast antigen, a protozoan antigen, or prion.
- the antigen is from Acetobacter aurantius, Acinetobacter baumannii, Acinetobacter calcoaceticus, Acinetobacter haemolyticus, Acinetobacter junii, Acinetobacter Iwqffii, Actinomyces israelii, Actinomyces viscosus, Aggregatibacter actinomycetemcomitans, Agrobacterium radiobacter, Agrobacterium tumefaciens, Azorhizobium caulinodans, Azotobacter vinelandii, Anaplasma phagocytophilum, Bacillus anthracis, Bacillus brevis, Bacillus cereus, Bacillus fusiformis, Bacillus licheniformis, Bacillus megaterium, Bacill
- Bordetella pertussis Borrelia burgdorferi, Brucella abortus, Brucella melitensis, Brucella suis, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia, Calymmatobacterium granulomatis, Campylobacter coli, Campylobacter fetus, Campylobacter jejuni, Campylobacter pylori, Chlamydia trachomatis, Chlamydophila pneumoniae ⁇ Chlamydia pneumoniae),
- Citrobacter koseri Clostridium botulinum, Clostridium difficile, Clostridium perfringens ⁇ Clostridium welchii), Clostridium tetani, Corynebacterium diphtheria, Corynebacterium fusiforme, Coxiella burnetii, Ehrlichia chaffeensis, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter faecalis, Enterococcus avium, Enterococcus durans, Enterococcus faecalis, Enterococcus faecium, Enterococcus galllinarum, Enterococcus maloratus, Eschericia coli, Francisella tularensis, Fusobacterium nucleatum, Gardnerella vaginalis, Haemophilus ducreyi, Haemophilus parainfluenzae , Haemophilus pertussis, Haemophil
- Haemophilus influenza Haemophilus aegyptius, Helicobacter pylori, Klebsiella pneumonia, Klebsiella oxytoca, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus casei, Lactococcus lactis, Legionella pneumophila, Listeria monocytogenes, Methanobacterium extroquens, Microbacterium multiforme, Micrococcus luteus, Moraxella lacunata, Moraxella catarrhalis, Morganella morganii, Mycobacterium avium, Mycobacterium africanum,
- Mycobacterium bovis Mycobacterium canetti, Mycobacterium diphtheria, Mycobacterium intracellular e, Mycobacterium leprae, Mycobacterium lepraemurium, Mycobacterium microti, Mycobacterium phlei, Mycobacterium smegmatis, Mycobacterium tuberculosis, Mycoplasma fermentans, Mycoplasma genitalium, Mycoplasma hominis, Mycoplasma penetrans,
- Mycoplasma pneumonia Neisseria gonorrhoeae, Neisseria meningitides, Pasteurella multocida, Pasteurella tularensis, Porphyromonas gingivalis, Prevotella melaninogenica (Bacteroides melaninogenicus), Propionibacterium acnes, Proteus mirabillis, Proteus vulgaris, Providencia stuartii, Pseudomonas aeruginosa, Pseudomonas otitidis, Rhizobium radiobacter, Rickettsia prowazekii, Rickettsia psittaci, Rickettsia quintana, Rickettsia rickettsia, Rickettsia trachomae, Rochalimaea henselae, Rochalimaea Quintana, Rothia dentocariosa, Salmonella enter itidis,
- Staphylococcus aureus methicillin-resistant Staphylococcus aureus, Staphylococcus
- Streptococcus rattus Streptococcus salivarius, Streptococcus sanguis, Streptococcus sobrinus, Streptococcus viridans, Treponema pallidum, Treponema denticola, Vibrio cholera, Vibrio comma, Vibrio parahaemolyticus, Vibrio vulnificus, Wolbachia, Yersinia enter ocolitica, Yersinia pestis, Yersinia pseudotuberculosis, Aspergillus fumigatus, Aspergillus flavus, Aspergillus clavatus, Aspergillus niger, Aspergillus terreus, Candida albicans, Candida glabrata, Candida tropicalis, Candida krusei, Candida dubliniensis, Candida parapsilosis, Fusarium solani, Fusarium moniliforme, Fusarium proliferartum
- Corynebacterium diphtheria Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Haemophilis influenza, Human Papillomavirus, Influenza virus, Japanese Encephalitis virus, Measles virus, Neisseria meningitidis, Mumps virus, Bordetella pertussis, Streptococcus pneumonia, Poliovirus, Rabies virus, Rotavirus, Rubella virus, Herpes Zoster virus, Clostridium tetani, Salmonella typhi, Yellow Fever virus, Ebola virus, avian flu virus, Bacillus anthracis, Smallpox virus, or Zika virus.
- the antibody fragment is Fab, F(ab') 2 , scFv, tandem scFv, a
- BiTE single domain (sdAb) antibody, diabody, single chain diabody, minibody, fusion protein, or scFv-Fc.
- the antibody, or fragment thereof is directed to a disease- associated antigen.
- the disease-associated antigen is a tumor-associated antigen. Table 1 lists exemplary antibodies (or fragments thereof) to tumor-associated antigens.
- Atezolizumab CD274 PD-L1 urothelial bladder cancer, non-small cell lung carcinoma, melanoma, breast, renal cell carcinoma
- EMD640744 survivin melanoma, glioma, solid tumors Emibetuzumab HHGFR cancer
- Indusatumab vedotin GUCY2C cancer Intetumumab CD51 solid tumors, prostate, melanoma
- Iratumumab CD30 (TNFRSF8) Hodgkin's lymphoma
- Lucatumumab CD40 multiple myeloma, non-Hodgkin's lymphoma, Hodgkin's lymphoma
- Lumiliximab CD23 (IgE receptor) chronic lymphocytic leukemia
- Milatuzumab CD74 multiple myeloma and hematological malignancies
- Naptumomab estafenatox 5T4 non-small cell lung carcinoma, renal cell carcinoma, colorectal, prostate
- CD20 non-Hodgkin's lymphoma chronic lymphocytic leukemia
- B cell non- Hodgkin's lymphoma pre-B acute lymphoblastic leukemia
- Onartuzumab MET human scatter non-small cell lung carcinoma
- Racotumomab N-glycolylneuraminic non-small cell lung carcinoma, breast, acid melanoma
- Ramucirumab VEGF-R2 gastric, non-small cell lung carcinoma RecMAGE-A3 MAGE-A3 melanoma
- Tacatuzumab tetraxetan alpha-fetoprotein cancer
- lymphoma chronic lymphocytic leukemia
- WT1 peptide vaccine WT1 ovarian, uterine, acute myelogenous
- the tumor-associated antigen is 4- IBB, 5 AC, 5T4, A2aR, activin receptor-like kinase 1, AGS-22M6, AKAP4, alpha-fetoprotein, angiopoietin 2, B7-H3, BAFF, BAGE, BCR-ABL, BORIS, CA-125, CA19-9, C242 antigen, carbonic anhydrase 9 (CA-IX), CCR4, CD19, CD20, CD22, CD23 (IgE receptor), CD24, CD28, CD30 (TNFRSF8), CD33, CD37, CD38 (cyclic ADP ribose hydrolase), CD40, CD44 v6, CD51, CD56, CD70, CD71, CD73, CD74, CD79B, CD80, CD137, CD140a, CD152, CD200, CD221, CD274, CEA, ch4D5, CLDN18.2, CSl, CSFIR, CTLA-4, C-X-C chemokine receptor type
- the tumor- associated antigen is HER-2, EGFR, CD30, CD20, EpCAM, NG2, CD19, CEA, MUC-1, CA19- 9, OCAA, MAPG, TAM, TLR, CD71, ERBB2, VEGF, or glioma.
- Table 2 lists exemplary antibodies (or fragments thereof) to disease-associated antigens.
- Abciximab CD41 integ platelet aggregation inhibitor
- Atorolimumab Rhesus factor hemolytic disease of the newborn
- Basiliximab CD25 (a chain of IL-2 prevention of organ transplant rejections receptor)
- Daclizumab CD25 (a chain of IL-2 prevention of organ transplant rejection receptor)
- Efalizumab LFA-1 (CD 11 a) psoriasis (blocks T-cell migration)
- Inolimomab CD25 (a chain of IL-2 graft versus host disease
- Rafivirumab rabies virus rabies (prophylaxis)
- Refanezumab myelin-associated recovery of motor function after stroke glycoprotein
- glycoprotein B glycoprotein B
- Sonepcizumab sphingosine-1- choroidal and retinal neovascularization phosphate
- Toralizumab CD 154 (CD40L) rheumatoid arthritis, lupus nephritis
- the disease-associated antigen is l-40-P-amyloid, AOC3 (VAP-
- the antibody, or fragment thereof is directed to a cell surface marker.
- the cell surface marker is on an immune cell.
- the immune cell is a T cell, B cell, K cell, macrophage, TIL, dendritic cell, neutrophil, eosinophil, basophil, or mast cell.
- the T cell is a CD4 + T cell, CD8 + T cell, helper T cell, regulatory T cell, cytotoxic T cell, or natural killer T cell; and wherein the B cell is a memory B cell or a plasma cell.
- the cell surface marker is CD36, CD68, CD83, CD180, CD206 (MRC1- mannose receptor), F4/80 (EGF-TM7 family), CD205, CD56, CD161, CD94: KG2 heterodimer, KIR/CD158 family, CD335, CD64, CD16, CD3, CD28, CD4, CD25, CD39, Toll-like receptors (TLRs), CD281, CD283, CD284, CD286, CD289, CD282, C-type lectin receptors (CLRs), Fc Receptor, or HSG.
- CD36 CD68, CD83, CD180, CD206 (MRC1- mannose receptor), F4/80 (EGF-TM7 family)
- CD205 CD56, CD161, CD94: KG2 heterodimer
- the nucleic acid carrier comprises one or two of the following: a first targeting agent which is an antibody, or fragment thereof, directed to HER2 and a second targeting agent which is an antibody, or fragment thereof, directed to CD64; a first targeting agent which is an antibody, or fragment thereof, directed to EGFR and a second targeting agent which is an antibody, or fragment thereof, directed to PD-1; a first targeting agent which is an antibody, or fragment thereof, directed to PD-L1 and a second targeting agent which is an antibody, or fragment thereof, directed to OX-40; a first targeting agent which is an antibody, or fragment thereof, directed to EGFR and a second targeting agent which is an antibody, or fragment thereof, directed to CD64; a first targeting agent which is an antibody, or fragment thereof, directed to CD30 and a second targeting agent which is an antibody, or fragment thereof, directed to CD 16; a first targeting agent which is an antibody, or fragment thereof, directed to HER2 and a second targeting agent which is an antibody, or fragment thereof, directed to CD3
- the antibody, or fragment thereof is an antibody-drug conjugate (ADC).
- ADC antibody-drug conjugate
- the nucleic acid carrier comprises one, two, three, for, five, or six, or more of the ADCs listed in Table 3.
- the nucleic acid carrier may comprise multiple copies of the same ADC, as set forth above for targeting agents.
- DM1 Kadcyla (DM1) (SMCC) HER2 breast cancer
- CDX-011 (MMAE) (Val-Cit) GPNMB breast cancer/melanoma
- PSMA ADC (MMAE) (Val-Cit) PSMA prostate cancer
- ASG-5ME (MMAE) (Val-Cit) SLC44A4 pancreatic cancer
- ASG-15ME (MMAE) (Val-Cit) SLITRK6 lung cancer
- ASG-22ME (MMAE) (Val-Cit) Nectin-4 solid tumors
- RG-7596 (MMAE) (Val-Cit) CD79b NHL RG-7600 (NA) (NA) NA ovarian tumor
- IMMU-110 Doxorubicin
- Ac-But linker CD74 multiple myeloma
- IMMU-115 Doxorubicin
- Ac-But linker CD74 NHL/CLL
- IMMU-132 (SN38) (Phenylalaninelysine) TACSTD2 solid tumors
- IMMU-130 (SN38) (Phenylalaninelysine) CEACAM5 colorectal tumor
- AGS67E (MMAE) (Val-Cit-PABC) CD37 CLL/AML
- FMGN853 (DM4) (sulfo-SPDB) FRa ovarian cancer
- AML acute myeloid leukaemia
- HL Hodgkin's lymphoma
- NHL non- Hodgkin's lymphoma
- ALCL anaplasia large cell lymphoma
- DLBCL diffuse large B cell lymphoma
- RCC renal cell carcinoma
- SCLC small cell lung cancer
- NSCLC non-small cell lung cancer
- CLL chronic lymphocytic leukaemia
- EGFR epidermal growth factor receptor
- GPNMB glycoprotein NMB
- PSMA prostate-specific membrane antigen
- NA not available.
- Highly potent drugs such as, for example, calicheamicins, doxorubicin, maytansinoids, auristatins, and camptothecin can be used as drug payloads for ADCs.
- Additional drug classes that may serve as drug payloads for ADCs include, but are not limited to, pyrrolobenzodiaze- pine (PDB) dimer, a-Amanitin, duocarmycin analogs, tubulysin B, and cryptophycin analogs.
- Additional ADCs include brentuximab vedotin and ado-trastuzumab emtansine.
- the label is a chemiluminescent agent, a fluorescent agent, an infrared dye, a radiolabel agent, a metal, a chelating agent, a hapten, or a gene or mRNA encoding a detectable protein.
- the detectable protein is GFP or CFP.
- the adjuvant is one or more of a CpG containing oligonucleotide, a ssRNA, a dsRNA, a monophosphate lipid, aluminum, squalene, 3-deacyl-monophosphoryl lipid A, vitamin E, surfactant polysorbate 80, mannide-mono-oleate, SLAG-3, or a galactosyl ceramide.
- the CpG containing oligonucleotide is ODN 1585 (ggggtcaacgttgagggggg; SEQ ID NO: l), ODN 1668 (tccatgacgttcctgatgct; SEQ ID NO:2), ODN 1826 (tccatgacgttcctgacgtt; SEQ ID NO:3), ODN 2006 (tcgtcgtttttgtcgttttgtcgtcgtcgtcgttt; SEQ ID NO:4), ODN 2007 (tcgtcgttgcgttttgtcgtcgttt; SEQ ID NO: 5), ODN 2216 (gggggacgatcgtcgggggggg; SEQ ID NO:6), ODN 2336 (ggggacgacgtcgtggggggggg; SEQ ID NO:7), ODN 2395
- oligonucleotide is ODN 1668 (tccatgacgttcctgatgct; SEQ ID NO:2), ODN 1826
- the nucleic acid carrier comprises a targeting agent that is an antigen, an antibody, or a fragment of an antibody, and the oligonucleotide linker conjugating the targeting moiety to the single-stranded arm or terminal arm is or comprises a CpG containing oligonucleotide.
- the nucleic acid carrier comprises at least one antigen, at least one antibody or fragment thereof directed to an immune cell, and at least one adjuvant.
- compositions comprising any of the nucleic acid carriers described herein, or any combination thereof, and a pharmaceutically acceptable vehicle.
- the pharmaceutically acceptable vehicle may be a diluent, filler, disintegrant, binder, lubricant, surfactant, hydrophobic vehicle, water soluble vehicle, emulsifier, buffer, humectant, moisturizer, solubilizer, preservative, and the like.
- vehicles include, but are not limited to, calcium carbonate, calcium phosphate, sodium phosphate, potassium phosphate, sodium chloride, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols, Cremophor EL (CrEL; polyoxy ethyl eneglycerol triricinoleate 35) and polysorbate 80 (Tween) 80; polyoxy ethyl ene- sorbitan-20-monool eate) .
- Cremophor EL Cremophor EL
- TrEL polyoxy ethyl eneglycerol triricinoleate 35
- Teween 80 polyoxy ethyl ene- sorbitan-20-monool eate
- the present disclosure also provides methods of making the monomelic nucleic acid carrier comprising: hybridizing the first oligonucleotide to the second oligonucleotide; and conjugating the at least one targeting agent to the at least one single-stranded arm.
- the at least one targeting agent is further conjugated to an oligonucleotide linker prior to conjugating the at least one targeting agent to the at least one single-stranded arm.
- the at least one targeting agent/oligonucleotide linker is conjugated to the at least one single-stranded arm by hybridizing the oligonucleotide linker portion of the at least one targeting agent/oligonucleotide linker to a complementary nucleotide sequence of the at least one single-stranded arm.
- one, two, or three additional targeting agents are further conjugated to other single-stranded arms.
- the oligonucleotides can be synthesized using chemical techniques that do not employ synthetic enzymes (e.g., as in PCR) or in vivo replication (e.g., as in cloning and replicating the sequence in a microorganism).
- the nucleic acids may be synthesized by solid-phase synthesis using the phosphoramidite method, with subsequent isolation of the products by HPLC or gel electrophoresis if necessary.
- the nucleic acids may be derived from 2'-deoxynucleosides, ribonucleosides, or chemically modified nucleosides (e.g., LNA or BNA).
- the single-stranded nucleic acid molecules may by synthesized using naturally-occurring or non-naturally occurring nucleosides.
- the chemically synthesized single-stranded nucleic acid molecules may be chemically synthesized using any of the known synthetic methods, including methods for solid-phase synthesis such as nucleoside
- the present disclosure also provides methods of making the double monomer nucleic acid carriers described herein comprising: hybridizing the first oligonucleotide to the second oligonucleotide to form a first nucleic acid carrier; hybridizing the third oligonucleotide to the fourth oligonucleotide to form a second nucleic acid carrier; hybridizing one single-stranded arm of the first nucleic acid carrier to one single-stranded arm of the second nucleic acid carrier, forming a double monomer nucleic acid carrier comprising six single-stranded arms; and conjugating the at least one targeting agent to the at least one single-stranded arm.
- the at least one targeting agent is further conjugated to an oligonucleotide linker prior to conjugating the at least one targeting agent to the at least one single-stranded arm.
- the at least one targeting agent/oligonucleotide linker is conjugated to the at least one single-stranded arm by hybridizing the oligonucleotide linker portion of the at least one targeting agent/oligonucleotide linker to a complementary nucleotide sequence of the at least one single-stranded arm.
- one, two, three, four, or five additional targeting agents are further conjugated to other single-stranded arms.
- the present disclosure also provides methods of making the trimer nucleic acid carriers described herein comprising: hybridizing the first terminal arm of the second oligonucleotide to the first terminal arm of the first oligonucleotide; hybridizing the first terminal arm of the third oligonucleotide to the second terminal arm of the first oligonucleotide; conjugating the first targeting agent to the second terminal arm of the second oligonucleotide; and conjugating the second targeting agent to the second terminal arm of the third oligonucleotide.
- each targeting agent is further conjugated to an oligonucleotide linker prior to conjugating the targeting agents to the terminal arms.
- each targeting agent/oligonucleotide linker is conjugated to the terminal arm by hybridizing the oligonucleotide linker portion of the targeting agent/oligonucleotide linker to a complementary nucleotide sequence of the terminal arm.
- each targeting agent is further conjugated to an oligonucleotide linker prior to conjugating the targeting agents to the terminal arms.
- each targeting agent is further conjugated to an oligonucleotide linker prior to conjugating the targeting agents to the terminal arms.
- agent/oligonucleotide linker is conjugated to the terminal arm by hybridizing the oligonucleotide linker portion of the targeting agent/oligonucleotide linker to a complementary nucleotide sequence of the terminal arm.
- All of the nucleic acid carriers described herein may be covalently cross-linked as described herein.
- the cross-linked monomers provide an advantage because it maintains the structural integrity of the assembled nucleic acids and improves the stability of the nucleic acid carriers. Such cross-linking was not previously possible for branched polynucleotide molecules constructed from chemically synthesized nucleic acids.
- Cross-links may be reversible or irreversible.
- a plurality of monomers are cross-linked.
- all of the monomer linkages can be cross-linked.
- the double-stranded region within a single monomer is cross-linked.
- the single-stranded arm of one monomer is cross-linked to the oligonucleotide conjugated to the targeting agent.
- the double-stranded region of one monomer is cross-linked to the double-stranded region of another monomer.
- the single-stranded arm of one monomer is cross-linked to a single-stranded arm of another monomer.
- the double-stranded region of one monomer is cross-linked to a single-stranded arm of another monomer.
- cross-linking agents include, but are not limited to, mitomycin C and daunamycin, and other anticancer drugs that cross-link DNA, ethidium diazide, cisplatin, EDC- type compounds, and psoralens.
- a suitable cross-linking agent can be selected by persons skilled in the art based on the particular requirements of the cross-linker and the sequence of the nucleic acids involved.
- psoralen is used as the cross-linking agent. Psoralen intercalates into the double helix of double-stranded DNA and readily forms covalent bonds with pyrimidine nucleotides upon irradiation with UV light.
- the psoralen derivatives are useful for cross-linking the nucleic acids of the nucleic acid carriers.
- Psoralen derivatives include, but are not limited to, 8-methoxy psoralen, 4,5',8-trimethylpsoralen, and 4'- adducts of trioxsalen (e.g., 4'-hydroxymethyl-4,5',trimethyl psoralen, 4'-methoxymethyl-4,5',8- trimethyl psoralen, 4'N-phthalimidomethyl-4,5',8-trimethyl psoralen, and 4'-aminomethyl-4,5'- ,8trimethyl psoralen hydrochloride). Procedures for cross-linking with psoralens are standard and known in the art.
- nucleic acid carriers described herein are useful for drug delivery, diagnostics, and medical imaging, among other biotechnological applications.
- the present disclosure also provides methods of inducing an immune response in an animal (suitably a mammal such as a human) comprising administering to the animal (suitably a mammal such as a human) any one or more of the nucleic acid carriers described herein, or a pharmaceutical composition comprising the nucleic acid carrier, wherein the nucleic acid carrier comprises at least two targeting agents chosen from an antigen, a peptide, an antibody or fragment thereof, and an adjuvant.
- the antigen is chosen from the bacterial or viral antigens described herein.
- the antibody fragment is any of the antibody fragments described herein.
- the antibody, or fragment thereof is directed to a cell surface marker described herein.
- the adjuvant is one or more of the adjuvants described herein.
- the oligonucleotide linker conjugating the targeting moiety to the terminal arm is a CpG containing oligonucleotide comprising one or more CpG sequences.
- the present disclosure also provides methods of treating an animal (suitably a mammal such as a human) having cancer comprising administering to the animal (suitably a mammal such as a human) a nucleic acid carrier of any one or more of the nucleic acid carriers described herein, or a pharmaceutical composition comprising the nucleic acid carrier, wherein the nucleic acid carrier comprises at least two targeting agents chosen from an antibody, or fragment thereof, and a label.
- the antibody fragment is any of the antibody fragments described herein.
- a first antibody, or fragment thereof is directed to a tumor- associated antigen.
- the tumor-associated antigen is any of the tumor- associated antigens described herein.
- a second antibody, or fragment thereof is directed to a cell surface marker.
- the cell surface marker is any of the cell surface markers described herein.
- the nucleic acid carrier comprises any one or more of: a first targeting agent which is an antibody, or fragment thereof, directed to HER2 and a second targeting agent which is an antibody, or fragment thereof, directed to CD64, and wherein the cancer is breast, ovarian, or prostrate; a first targeting agent which is an antibody, or fragment thereof, directed to EGFR and a second targeting agent which is an antibody, or fragment thereof, directed to CD64, and wherein the cancer is a solid tumor, lung, or colorectal; a first targeting agent which is an antibody, or fragment thereof, directed to EGFR and a second targeting agent which is an antibody, or fragment thereof, directed to PD-1, and wherein the cancer is triple negative breast cancer; a first targeting agent which is an antibody, or fragment thereof, directed to PD-L1 and a second targeting agent which is an antibody, or fragment thereof, directed to OX-40, and wherein the cancer is breast cancer; a first targeting agent which is an antibody, or fragment thereof, directed to CD30 and a second targeting agent which is
- the nucleic acid carrier comprises any one or more of: a first targeting agent which is an antibody, or fragment thereof, directed to a disease-associated marker, a second targeting agent which is an antibody directed to a cell surface marker, and a third targeting agent which is an antibody, or fragment thereof, directed to a second cell surface marker, and wherein the disease is a cancer.
- the nucleic acid carrier comprises any one or more of: a first targeting agent which is an antigen associated with a disease, a second targeting agent which is an antibody directed to a cell surface marker, and a third targeting agent which is an adjuvant, and wherein the indication is a vaccine.
- the label is a chemiluminescent agent, a fluorescent agent, an infrared dye, a radiolabel agent, a metal, a chelating agent, a hapten, or a gene or mRNA encoding a detectable protein.
- the presence of the label is used to track the location of the nucleic acid carrier.
- the present disclosure also provides methods of treating an animal (suitably a mammal such as a human) having a disease associated with a disease-associated antigen comprising administering to the animal (suitably a mammal such as a human) a nucleic acid carrier of any one or more of the nucleic acid carriers described herein, or a pharmaceutical composition comprising the nucleic acid carrier, wherein the nucleic acid carrier comprises at least two targeting agents chosen from an antibody, or fragment thereof, and a label.
- the antibody fragment is any of the antibody fragments described herein.
- a first antibody, or fragment thereof is directed to a disease- associated antigen.
- the disease-associated antigen is any of the disease- associated antigens described herein.
- a second antibody, or fragment thereof is directed to a cell surface marker.
- the cell surface marker is any of the cell surface markers described herein.
- the label is a
- chemiluminescent agent a fluorescent agent, an infrared dye, a radiolabel agent, a metal, a chelating agent, a hapten, or a gene or mRNA encoding a detectable protein.
- the presence of the label is used to track the location of the nucleic acid carrier.
- nucleotide sequence is "complementary" to another nucleotide sequence when it is capable of base-pairing with the oligonucleotide according to the standard Watson-Crick, Hoogsteen or reverse Hoogsteen binding
- complementarity rules refer to an oligonucleotide or sequence thereof comprising a sequence of consecutive nucleotides or semi-consecutive nucleotides (e.g., one or more nucleotide moieties are not present in the molecule) capable of hybridizing to another nucleic acid molecule that may be consecutive, semi-consecutive or non-consecutive nucleotides even if less than all the nucleotides base pair with a counterpart nucleotide.
- a "complementary" nucleic acid comprises a sequence in which about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%), or about 100%, and any range derivable therein, of the nucleotide sequence is capable of base-pairing with another nucleotide sequence during hybridization.
- the term “complementary” refers to a nucleotide sequence that may hybridize to another nucleotide sequence under stringent conditions, as would be understood by one of ordinary skill in the art.
- the nucleotide sequence may be "partly complementary” to another nucleotide sequence, and may hybridize in low stringency
- nucleotide sequence is capable of base-pairing with another nucleotide sequence.
- the animal is a bird, reptile, amphibian, or mammal, which can be a mouse, rat, other rodent, rabbit, dog, cat, swine, cattle, sheep, horse, or primate, such as a human. In some embodiments, the animal is a human.
- the animal or mammal being treated is "in need thereof," which means that the animal or mammal (suitably a human) has been identified as having a need for the particular method of treatment. In some embodiments, the identification can be by any means of diagnosis. In any of the methods and treatments described herein, the animal or mammal (suitably a human) can be in need thereof.
- a "therapeutically effective amount" of the nucleic acid carrier is administered to the animal or mammal (suitably a human).
- a “therapeutically effective amount” means the amount that elicits the biological or medicinal response that is being sought in a tissue, system, animal, mammal, individual or human by a researcher, veterinarian, medical doctor or other clinician.
- the therapeutic effect is dependent upon the disorder being treated or the biological effect desired. As such, the therapeutic effect can be a decrease in the severity of symptoms associated with the disorder and/or inhibition (partial or complete) of progression of the disorder, or improved treatment, healing, prevention or elimination of a disorder, or side- effects.
- the amount needed to elicit the therapeutic response can be determined based on the age, health, size and sex of the animal or mammal. Optimal amounts can also be determined based on monitoring of the animal's or mammal's response to treatment.
- Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of extent of condition, disorder or disease; stabilized (i.e., not worsening) state of condition, disorder or disease; delay in onset or slowing of condition, disorder or disease progression; amelioration of the condition, disorder or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder or disease.
- Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.
- a suitable dosage range for oral administration is, generally, from about 0.001 milligram to about 200 milligrams per kilogram body weight, from about 0.01 milligram to about 100 milligrams per kilogram body weight, from about 0.01 milligram to about 70 milligrams per kilogram body weight, from about 0.1 milligram to about 50 milligrams per kilogram body weight, from 0.5 milligram to about 20 milligrams per kilogram body weight, or from about 1 milligram to about 10 milligrams per kilogram body weight.
- the oral dose is about 5 milligrams per kilogram body weight.
- a suitable dosage range for oral administration is, generally, from about 0.1 mg to about 500 mg, from about 1 mg to about 100 mg, from about 10 mg to about 50 mg, or from about 10 mg to about 25 mg.
- suitable dosage ranges for intravenous (i.v.) administration are from about 0.01 mg to about 500 mg per kg body weight, from about 0.1 mg to about 100 mg per kg body weight, from about 1 mg to about 50 mg per kg body weight, or from about 10 mg to about 35 mg per kg body weight. In some embodiments, a suitable dosage range for i.v.
- administration is, generally, from about 0.1 mg to about 500 mg, from about 1 mg to about 100 mg, from about 10 mg to about 50 mg, or from about 10 mg to about 25 mg.
- Suitable dosage ranges for other modes of administration can be calculated based on the forgoing dosages as known by those skilled in the art.
- recommended dosages for intradermal, intramuscular, intraperitoneal, subcutaneous, epidural, sublingual, intracerebral, intravaginal, transdermal administration or administration by inhalation are in the range of from about 0.001 mg to about 200 mg per kg of body weight, from about 0.01 mg to about 100 mg per kg of body weight, from about 0.1 mg to about 50 mg per kg of body weight, or from about 1 mg to about 20 mg per kg of body weight.
- Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems. Such animal models and systems are well known in the art.
- the nucleic acid carriers described herein can be formulated for parenteral administration by injection, such as by bolus injection or continuous infusion.
- the nucleic acid carriers can be administered by continuous infusion subcutaneously over a period of about 15 minutes to about 24 hours.
- Formulations for injection can be presented in unit dosage form, such as in ampoules or in multi-dose containers, with an added preservative.
- the compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- the injectable is in the form of short-acting, depot, or implant and pellet forms injected subcutaneously or intramuscularly.
- the parenteral dosage form is the form of a solution, suspension, emulsion, or dry powder.
- the nucleic acid carriers described herein can be formulated by combining the nucleic acid carriers with pharmaceutically acceptable carriers well known in the art.
- Such carriers enable the compounds to be formulated as tablets, pills, dragees, capsules, emulsions, liquids, gels, syrups, caches, pellets, powders, granules, slurries, lozenges, aqueous or oily suspensions, and the like, for oral ingestion by an animal or mammal to be treated.
- compositions for oral use can be obtained by, for example, adding a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
- suitable excipients include, but are not limited to, fillers such as sugars, including, but not limited to, lactose, sucrose, mannitol, and sorbitol; cellulose preparations such as, but not limited to, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose,
- disintegrating agents can be added, such as, but not limited to, the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
- compositions can contain one or more optional agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavoring agents such as peppermint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a
- compositions may be coated to delay disintegration and absorption in the gastrointestinal tract thereby providing a sustained action over an extended period of time.
- Oral compositions can include standard vehicles such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Such vehicles are suitably of pharmaceutical grade.
- Dragee cores can be provided with suitable coatings.
- suitable coatings can be used, which can optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments can be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
- compositions which can be used orally include, but are not limited to, push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
- the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
- the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid
- polyethylene glycols polyethylene glycols.
- stabilizers can be added.
- compositions can take the form of, such as, tablets or lozenges formulated in a conventional manner.
- the nucleic acid carriers described herein can be delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- Capsules and cartridges of, such as gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the nucleic acid carriers and a suitable powder base such as lactose or starch.
- nucleic acid carriers described herein can also be formulated in rectal compositions such as suppositories or retention enemas, such as containing conventional suppository bases such as cocoa butter or other glycerides.
- rectal compositions such as suppositories or retention enemas, such as containing conventional suppository bases such as cocoa butter or other glycerides.
- nucleic acid carriers described herein can also be formulated in vaginal compositions such as vaginal creams, suppositories, pessaries, vaginal rings, and intrauterine devices.
- the nucleic acid carriers can be applied to a plaster, or can be applied by transdermal, therapeutic systems that are consequently supplied to the organism.
- the nucleic acid carriers are present in creams, solutions, powders, fluid emulsions, fluid suspensions, semi-solids, ointments, pastes, gels, jellies, and foams, or in patches containing any of the same.
- nucleic acid carriers described herein can also be formulated as a depot preparation.
- nucleic acid carriers can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
- the nucleic acid carriers can be delivered in a controlled release system.
- a pump may be used.
- polymeric materials can be used.
- a controlled-release system can be placed in proximity of the target of the nucleic acid carriers described herein, such as the liver, thus requiring only a fraction of the systemic dose.
- the nucleic acid carriers can be contained in such formulations with pharmaceutically acceptable diluents, fillers, disintegrants, binders, lubricants, surfactants, hydrophobic vehicles, water soluble vehicles, emulsifiers, buffers, humectants, moisturizers, solubilizers, preservatives and the like.
- the pharmaceutical compositions can also comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
- the compounds described herein can be used with agents including, but not limited to, topical analgesics (e.g., lidocaine), barrier devices (e.g., GelClair), or rinses (e.g., Caphosol).
- topical analgesics e.g., lidocaine
- barrier devices e.g., GelClair
- rinses e.g., Caphosol
- the nucleic acid carriers described herein can be delivered in a vesicle, in particular a liposome.
- the formulation can be lyophilized to a solid and reconstituted with, for example, water prior to use.
- the nucleic acid carriers When administered to a human, can be in a sterile vehicle. Water is a suitable carrier when the compound is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical carriers also include excipients such as starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The present compositions, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
- compositions described herein can take the form of a solution, suspension, emulsion, tablet, pill, pellet, capsule, capsule containing a liquid, powder, sustained-release formulation, suppository, aerosol, spray, or any other form suitable for use.
- the pharmaceutical compositions can be in unit dosage form.
- the composition can be divided into unit doses containing appropriate quantities of the nucleic acid carriers.
- the unit dosage form can be a packaged preparation, the package containing discrete quantities of the preparations, for example, packeted tablets, capsules, and powders in vials or ampules.
- the unit dosage form can also be a capsule, cachet, or tablet itself, or it can be the appropriate number of any of these packaged forms.
- Suitable preservatives include, but are not limited to, mercury-containing substances such as phenylmercuric salts (e.g., phenylmercuric acetate, borate and nitrate) and thimerosal; stabilized chlorine dioxide; quaternary ammonium compounds such as benzalkonium chloride, cetyltrimethylammonium bromide and cetylpyridinium chloride; imidazolidinyl urea; parabens such as methylparaben, ethylparaben, propylparaben and butylparaben, and salts thereof;
- mercury-containing substances such as phenylmercuric salts (e.g., phenylmercuric acetate, borate and nitrate) and thimerosal; stabilized chlorine dioxide; quaternary ammonium compounds such as benzalkonium chloride, cetyltrimethylammonium bromide and cetylpyridinium chloride; imidazo
- phenyl ethyl alcohol phenyl ethyl alcohol
- disodium EDTA sorbic acid and salts thereof.
- one or more stabilizers can be included in the compositions to enhance chemical stability where required.
- Suitable stabilizers include, but are not limited to, chelating agents or complexing agents, such as, for example, the calcium complexing agent ethylene diamine tetraacetic acid (EDTA).
- EDTA calcium complexing agent
- an appropriate amount of EDTA or a salt thereof, e.g., the disodium salt can be included in the composition to complex excess calcium ions and prevent gel formation during storage.
- EDTA or a salt thereof can suitably be included in an amount of about 0.01% to about 0.5%.
- the EDTA or a salt thereof, more particularly disodium EDTA can be present in an amount of about 0.025% to about 0.1% by weight.
- One or more antioxidants can also be included in the compositions. Suitable
- antioxidants include, but are not limited to, ascorbic acid, sodium metabi sulfite, sodium bisulfite, acetylcysteine, polyquaternium-1, benzalkonium chloride, thimerosal, chlorobutanol, methyl paraben, propyl paraben, phenylethyl alcohol, edetate disodium, sorbic acid, a tocopherol, a tocotrienol, or other agents know to those of skill in the art.
- Such preservatives are typically employed at a level of from about 0.001% to about 1.0% by weight.
- the nucleic acid carriers are solubilized at least in part by an acceptable solubilizing agent.
- an acceptable solubilizing agent for example polysorbate 80, can be useful as solubilizing agents, as can acceptable glycols, polyglycols, e.g.,
- Suitable solubilizing agents for solution and solution/suspension compositions are cyclodextrins.
- Suitable cyclodextrins can be chosen from a-cyclodextrin, ⁇ -cyclodextrin, ⁇ -cyclodextrin, alkylcyclodextrins (e.g., methyl- ⁇ - cyclodextrin, dimethyl-P-cyclodextrin, diethyl-P-cyclodextrin), hydroxyalkylcyclodextrins (e.g., hy droxy ethyl - ⁇ -cyclodextrin, hydroxypropyl-P-cyclodextrin), carboxy-alkylcyclodextrins (e.g., carboxymethyl-P-cyclodextrin), sulfoalkylether cyclodextrins (e.g.
- the composition optionally contains a suspending agent.
- the composition can contain one or more polymers as suspending agents.
- Useful polymers include, but are not limited to, water-soluble polymers such as cellulosic polymers, for example, hydroxypropyl methylcellulose, and water-insoluble polymers such as cross-linked carboxyl-containing polymers.
- compositions do not contain substantial amounts of solid particulate matter, whether of the anti-microbial polymer or oligomer active agent, an excipient, or both, as solid particulate matter, if present, can cause discomfort and/or irritation of a treated eye.
- One or more acceptable pH adjusting agents and/or buffering agents can be included in the compositions, including acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris-hydroxymethylaminomethane; and buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride. Such acids, bases and buffers are included in an amount required to maintain pH of the composition in an acceptable range.
- one or more acceptable surfactants preferably nonionic surfactants, or co- solvents can be included in the compositions to enhance solubility of the components of the compositions or to impart physical stability, or for other purposes.
- Suitable nonionic surfactants include, but are not limited to, polyoxyethylene fatty acid glycerides and vegetable oils, e.g., polyoxyethylene (60) hydrogenated castor oil; and polyoxyethylene alkylethers and alkylphenyl ethers, e.g., octoxynol 10, octoxynol 40; polysorbate 20, 60 and 80; polyoxyethylene / polyoxypropylene surfactants (e.g., Pluronic ® F-68, F84 and P-103); cyclodextrin; or other agents known to those of skill in the art.
- co-solvents or surfactants are employed in the compositions at a level of from about 0.01% to about 2% by weight.
- kits comprising one or more containers filled with one or more of the nucleic acid carriers are provided herein.
- Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration for treating a condition, disease, or disorder described herein.
- the kit contains more than one nucleic acid carrier described herein.
- the kit comprises a nucleic acid carrier described herein and optionally another therapeutic agent.
- the kit contains an injectable device such as a syringe with a needle.
- nucleic acid carriers described herein may have numerous benefits including, but not limited to, improved flexibility, improved efficacy, enhanced immunity, less toxicity, improved solubility of hydrophobic targeting agents and drugs, and improved half-life, circulation time, clearance, and PK profile.
- the nucleic acid carriers described herein are highly modular in both design and construction as well as in final formulation when combining various targeting agents to achieve a desired outcome.
- Individual components, nucleic acid carriers scaffold of varying design, and individual targeting agents conjugated to linker sequences that bind to the arms of the nucleic acid carriers, can be separately prepared and characterized.
- the individually characterized components and targets can be mixed and matched at varying desired ratios prior to testing in vitro or in vivo using the linker oligonucleotides to couple particular components to the scaffold. Combining more than one of the same targeting agent alters both the specificity and avidity of the nucleic acid carrier formulation to the disease or cellular target.
- bi- or tri-specific antibodies or fusion proteins This ability to fine tune a nucleic acid carrier is an advantage over bi- or tri-specific antibodies or fusion proteins because bi- or tri-specific antibodies or fusion proteins are limited to only one or sometimes two valences for a particular target. Also, many of the bi- and tri-specific constructs, especially those used in immune oncology programs, have proven to be challenging to manufacture in clinically relevant quantities and a wide variety of formats have been used, including diabodies, tandem scFv, cross-linked antigen binding fragments (Fab) and quadroma-derived constructs. It would be more advantageous to use the original whole antibody clone to produce bi-, tri-, or multi-specific combinations rather than having to generate new genetic or fusion constructs and repeat the extensive characterization process. Coupling the original antibody clone to a linker
- oligonucleotide to introduce the antibody clone into a nucleic acid carrier and proceeding into formulation is a quicker and less costly process.
- the nucleic acid carriers described herein may possess improved efficacy for several reasons.
- the nucleic acid carriers have a higher target capacity for targeting and payload (drug delivery). Control of positioning of immune cells relative to disease cells in immune oncology applications to facilitate more efficient immune cell based responses is also an advantage.
- the nucleic acid carrier scaffold also has a diameter that can be modulated and adjusted to maximize both the cell to cell positioning, distance between cells, and also provide for more stable binding between partner cells.
- the nucleic acid carriers may possess more efficient binding and recruitment of immune cells and targeting to the tumor because of the multivalence to both tumor and immune cells as compare to other bi- and tri-specific constructs that only have one or two binding sites for immune and disease cells.
- Nanoparticle-mediated targeting of adjuvants to lymph nodes in vaccination increases both efficacy and safety, both by blocking systemic distribution of the adjuvant and by permitting significant dose-sparing (up to 250-fold).
- targeted delivery of TLR ligands in nanoparticles to dendritic cells has also been shown to strongly enhance the potency of the delivery adjuvant.
- nucleic acid carriers described herein may also possess enhanced adaptive characteristics
- the multivalent structure of the nucleic acid carriers lends adaptability to include immune cell targeting molecules, one or more antigens (the same or different), and one or more adjuvants (the same or different).
- immune cell targeting molecules one or more antigens (the same or different)
- one or more adjuvants the same or different.
- combining mannose and TLR agonists as part of one multivalent nucleic acid carriers allows for synergistic enhancement of long term humoral immune responses. This trend should continue for the foreseeable future as many classes of new materials have yet to be studied in depth and may have great potential in this field. Examples include DNA nanostructures that can present complex, three-dimensional multivalent motifs to engage and organize immune cell receptors.
- the nucleic acid carriers can simultaneously target specific antigen presenting cells (such as dendritic cells) while delivering one or more of the same or different adjuvants, and antigens.
- the nucleic acid carriers possess active targeting through conjugation of ligands for cell-surface receptors, which can often increase the uptake of nanoparticles by phagocytic cells relative to non-targeted particles, making macrophages and monocytes suitable targets for the nucleic acid carriers to deliver immunoregulatory drugs.
- Numerous receptors allow macrophage-specific targeting, including the Fc receptor, scavenger receptors, and mannose receptors (MMR or CD206).
- Targeting the macrophage Fc receptor is achieved by coating nanoparticles with IgG, which accelerates uptake of particles and enhances their retention within macrophages.
- the macrophage mannose receptor (MMR) is expressed on mature macrophages and dendritic cells but not on monocytes in the blood circulation.
- MMR mannose receptor
- the nucleic acid carriers may also possess improved delivery and presentation of MHC I antigens into the cytosol.
- the flexibly of the nucleic acid carrier to be easily adapted into different sizes as well as flexibly of the scaffold materials to bend, compress and change positioning allows for a more efficient uptake by the lymphatic system. This feature has been consistently linked to improved performance for immune response and reduction of system cytokine associated toxicity.
- the nucleic acid carriers described herein may also possess less toxicity compared to the same targeting agents in the absence of the nucleic acid carriers. By sequestering potentially toxic materials (drugs, antibodies and other molecules) as part of the formulation until it reaches the destination, the nucleic acid carriers may prevent off target accumulation and side effects.
- These materials can include the targeting antibodies or portions thereof, antigens of cytotoxic drugs, or molecules to be delivered at the same time as the nanoparticle with all targeting molecules.
- the change in biodistribution of loaded cargo (i.e., drugs) and targeting antibodies, drugs as a function of the unique properties of the nucleic acid carriers may limit the off target exposure as well as result in a different, less toxic clearance of the cargo not reaching the disease target.
- the nucleic acid carriers described herein may also possess improved solubility of hydrophobic targeting agents and drugs. Many classes of drugs, small molecules, and biologies have been linked to poor solubility when delivered as singular compounds, often reducing their circulation time or ability to reach a desired target. However, the nucleic acid carrier scaffold is highly negatively charged and once a drug is linked, it improves the ability to deliver the drug to target destination in an aqueous environment. The chemistry, composition, and negative charge of the nucleic acid carrier scaffold may reconfigure the biologically presented properties of targeting agents and drugs once attached.
- the nucleic acid carriers described herein may also possess improved half-life, circulation time, clearance, and PK profile.
- small drugs can be redirected away from the normally observed kidney clearance, resulting in an increases in the overall circulation half-life and an increase in the PK of the drug.
- Doxorubicin a small drug less than 1 kDa molecular weight, is cleared through glomerular filtration in the kidney and has a half-life measured in minutes. When attached to a nucleic acid carrier, however, the new half-life is measured in hours.
- the nucleic acid carriers described herein may also possess the improved ability to transport drug cargo across the blood-brain barrier.
- the nucleic acid carriers described herein may be used as a delivery vehicle for active ingredients that are normally not transported across the blood-brain barrier.
- various types of diseases and disorders associated with the brain may be treated by delivery of drugs across the blood-brain barrier inlcuding, for example, neurological disorders and cancers of the brain (i.e., glioblastoma, and
- a nucleic acid carrier comprising: a first and a second oligonucleotide
- each of the first and second oligonucleotides is complementary to each other, forming a double-stranded region, wherein the two terminal portions of the first oligonucleotide are not complementary to the two terminal portions of the second oligonucleotide, forming four single-stranded arms;
- At least one targeting agent conjugated to at least one single-stranded arm at least one targeting agent conjugated to at least one single-stranded arm.
- Embodiment 2 The nucleic acid carrier of embodiment 1, wherein the nucleic acid is deoxyribonucleic acid (DNA), ribonucleic acid (RNA), modified DNA or RNA, or a
- Embodiment 3 The nucleic acid carrier of embodiment 1 or 2, wherein the double- stranded region is 4 to 2000 bases in length.
- Embodiment 4 The nucleic acid carrier of embodiment 3, wherein the double-stranded region is 5 to 200 bases in length.
- Embodiment 5 The nucleic acid carrier of embodiment 4, wherein the double-stranded region is 25 to 50 bases in length.
- Embodiment 6 The nucleic acid carrier of any one of embodiments 1 to 5, wherein each single-stranded arm is 4 to 200 bases in length.
- Embodiment 7 The nucleic acid carrier of embodiment 6, wherein each single-stranded arm is 5 to 50 bases in length.
- Embodiment 8 The nucleic acid carrier of embodiment 7, wherein each single-stranded arm is 25 to 50 bases in length.
- Embodiment 9 The nucleic acid carrier of embodiment 8, wherein each single-stranded arm is 16 to 50 bases in length.
- Embodiment 10 The nucleic acid carrier of any one of embodiments 1 to 9, wherein the nucleotide sequence of each of the four single-stranded arms is identical.
- Embodiment 11 The nucleic acid carrier of any one of embodiments 1 to 9, wherein the nucleotide sequences of three of the single-stranded arms are identical to each other and different than the nucleotide sequence of the fourth single-stranded arm.
- Embodiment 12 The nucleic acid carrier of any one of embodiments 1 to 9, wherein the nucleotide sequences of two of the single-stranded arms are identical to each other and different than the nucleotide sequences of the other two single-stranded arms.
- Embodiment 13 The nucleic acid carrier of any one of embodiments 1 to 9, wherein the nucleotide sequences of two of the single-stranded arms are identical to each other and the nucleotide sequences of the other two single-stranded arms are identical to each other, wherein the nucleotide sequence of the first two single-stranded arms is different than the nucleotide sequences of the second two single-stranded arms.
- Embodiment 14 The nucleic acid carrier of any one of embodiments 1 to 9, wherein the nucleotide sequence of each of the four single-stranded arms is different.
- Embodiment 15 The nucleic acid carrier of any one of embodiments 1 to 4, wherein the at least one targeting agent is conjugated to the at least one single-stranded arm by an oligonucleotide linker.
- Embodiment 16 The nucleic acid carrier of embodiment 15, wherein a single targeting agent is conjugated to a single-stranded arm.
- Embodiment 17 The nucleic acid carrier of embodiment 15, wherein a first targeting agent is conjugated to one single-stranded arm and a second targeting agent is conjugated to a different single-stranded arm.
- Embodiment 18 The nucleic acid carrier of embodiment 17, wherein the first targeting agent is identical to the second targeting agent.
- Embodiment 19 The nucleic acid carrier of embodiment 17, wherein the first targeting agent is different than the second targeting agent.
- Embodiment 20 The nucleic acid carrier of embodiment 15, wherein a first targeting agent is conjugated to one single-stranded arm, a second targeting agent is conjugated to a different single-stranded arm, and a third targeting agent is conjugated to a different single- stranded arm.
- Embodiment 21 The nucleic acid carrier of embodiment 20, wherein the first targeting agent, the second targeting agent, and the third targeting agent are identical.
- Embodiment 22 The nucleic acid carrier of embodiment 20, wherein the first and second targeting agents are identical and the third targeting agent is different than the first and second targeting agents.
- Embodiment 23 The nucleic acid carrier of embodiment 20, wherein the first targeting agent, the second targeting agent, and the third targeting agent are different.
- Embodiment 24 The nucleic acid carrier of any one of embodiments 1 to 23, wherein one or more single-stranded arms not conjugated to a targeting agent is complementary base paired to an oligonucleotide linker.
- Embodiment 25 The nucleic acid carrier of embodiment 15, wherein a first targeting agent is conjugated to one single-stranded arm, a second targeting agent is conjugated to a different single-stranded arm, a third targeting agent is conjugated to a different single-stranded arm, and a fourth targeting agent is conjugated to a different single-stranded arm.
- Embodiment 26 The nucleic acid carrier of embodiment 25, wherein the first targeting agent, the second targeting agent, the third targeting agent, and the fourth targeting agent are identical.
- Embodiment 27 The nucleic acid carrier of embodiment 25, wherein the first targeting agent, the second targeting agent, and the third targeting agent are identical and the fourth targeting agent is different.
- Embodiment 28 The nucleic acid carrier of embodiment 25, wherein the first targeting agent and the second targeting agent are identical, and the third targeting agent and the fourth targeting agent are identical, wherein the first and second targeting agents are different than the third and fourth targeting agents.
- Embodiment 29 The nucleic acid carrier of embodiment 25, wherein the first targeting agent and the second targeting agent are identical, and the third targeting agent and the fourth targeting agent are each different.
- Embodiment 30 The nucleic acid carrier of embodiment 25, wherein the first targeting agent, the second targeting agent, the third targeting agent, and the fourth targeting agent are each different.
- Embodiment 31 The nucleic acid carrier of any one of embodiments 1 to 30, wherein the at least one targeting agent is an antigen, a peptide, an antibody or fragment thereof, an antibody-drug conjugate, a non-antibody scaffold, a label, an adjuvant, an RNA molecule, a DNA molecule, a vitamin, a protein, a fusion protein, a fusion peptide, a carbohydrate, a lipid, a polysaccharide, a lipopolysaccharide, a polymer, a virus particle, or a virus-like particle, or any combination thereof.
- the at least one targeting agent is an antigen, a peptide, an antibody or fragment thereof, an antibody-drug conjugate, a non-antibody scaffold, a label, an adjuvant, an RNA molecule, a DNA molecule, a vitamin, a protein, a fusion protein, a fusion peptide, a carbohydrate, a lipid, a
- Embodiment 32 The nucleic acid carrier of embodiment 31, wherein the polymer is hyaluronic acid, polyargenine, polylysine, polyethylenimine (PEI), polyethyleglycol (PEG), polyglycolic acid (PGA), polylactic acid (PLA), or poly(lactic-co-glycolic acid) (PLGA).
- the polymer is hyaluronic acid, polyargenine, polylysine, polyethylenimine (PEI), polyethyleglycol (PEG), polyglycolic acid (PGA), polylactic acid (PLA), or poly(lactic-co-glycolic acid) (PLGA).
- Embodiment 33 The nucleic acid carrier of embodiment 31, wherein the non-antibody scaffold is an affibody, an affilin, an anticalin, an atrimer, an avimer, a bicyclic peptide, a cys- knot, a DARPin, an FN3, a fynomer, a kunitz domain, or an O-body.
- the non-antibody scaffold is an affibody, an affilin, an anticalin, an atrimer, an avimer, a bicyclic peptide, a cys- knot, a DARPin, an FN3, a fynomer, a kunitz domain, or an O-body.
- Embodiment 34 The nucleic acid carrier of embodiment 31, wherein the antigen is a bacterial antigen, a viral antigen, a fungal antigen, a yeast antigen, a protozoan antigen, or prion.
- the antigen is a bacterial antigen, a viral antigen, a fungal antigen, a yeast antigen, a protozoan antigen, or prion.
- Embodiment 35 The nucleic acid carrier of embodiment 34, wherein the antigen is from Acetobacter aurantius, Acinetobacter baumannii, Acinetobacter calcoaceticus, Acinetobacter haemolyticus, Acinetobacter junii, Acinetobacter Iwoffii, Actinomyces israelii, Actinomyces viscosus, Aggregatibacter actinomycetemcomitans, Agrobacterium radiobacter, Agrobacterium tumefaciens, Azorhizobium caulinodans, Azotobacter vinelandii, Anaplasma phagocytophilum, Bacillus anthracis, Bacillus brevis, Bacillus cereus, Bacillus fusiformis, Bacillus licheniformis, Bacillus megaterium, Bacillus mycoides, Bacillus stearothermophilus, Bacillus subtilis, Bacteroides gingivalis, Bacteroides fragilis,
- bronchiseptica Bordetella pertussis, Borrelia burgdorferi, Brucella abortus, Brucella melitensis, Brucella suis, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia,
- Clostridium welchii Clostridium tetani
- Coryne bacterium diphtheria Clostridium welchii
- Haemophilus vaginalis Haemophilus influenza, Haemophilus aegyptius, Helicobacter pylori, Klebsiella pneumonia, Klebsiella oxytoca, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus casei, Lactococcus lactis, Legionella pneumophila, Listeria monocytogenes, Methanobacterium extroquens, Microbacterium multiforme, Micrococcus luteus, Moraxella lacunata, Moraxella catarrhalis, Morganella morganii, Mycobacterium avium, Mycobacterium africanum, Mycobacterium bovis, Mycobacterium canetti, Mycobacterium diphtheria,
- Mycobacterium intracellulare Mycobacterium leprae, Mycobacterium lepraemurium,
- Mycobacterium microti Mycobacterium phlei, Mycobacterium smegmatis, Mycobacterium tuberculosis, Mycoplasma fermentans, Mycoplasma genitalium, Mycoplasma hominis,
- Mycoplasma penetrans Mycoplasma pneumonia, Neisseria gonorrhoeae, Neisseria
- Pasteur ella multocida meningitides, Pasteur ella multocida, Pasteur ella tularensis, Porphyromonas gingivalis,
- Prevotella melaninogenica (Bacteroides melaninogenicus), Propionibacterium acnes, Proteus mirabillis, Proteus vulgaris, Providencia stuartii, Pseudomonas aeruginosa, Pseudomonas otitidis, Rhizobium radiobacter, Rickettsia prowazekii, Rickettsia psittaci, Rickettsia quintana, Rickettsia rickettsia, Rickettsia trachomae, Rochalimaea henselae, Rochalimaea Quintana, Rothia dentocariosa, Salmonella enteritidis, Salmonella typhi, Salmonella typhimurium, Serratia marcescens, Shigella dysenteriae, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus, St
- Streptococcus pneumoniae Streptococcus pyogenes, Streptococcus rattus, Streptococcus salivarius, Streptococcus sanguis, Streptococcus sobrinus, Streptococcus viridans, Treponema pallidum, Treponema denticola, Vibrio cholera, Vibrio comma, Vibrio parahaemolyticus, Vibrio vulnificus, Wolbachia, Yersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis, Aspergillus fumigatus, Aspergillus flavus, Aspergillus clavatus, Aspergillus niger, Aspergillus terreus, Candida albicans, Candida glabrata, Candida tropicalis, Candida krusei, Candida dubliniensis, Candida parapsilosis, Fusarium sol
- Embodiment 36 The nucleic acid carrier of embodiment 32, wherein the antigen is from Mycobacterium tuberculosis, Varicella zoster virus, Corynebacterium diphtheria, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Haemophilis influenza, Human Papillomavirus, Influenza virus, Japanese Encephalitis virus, Measles virus, Neisseria meningitidis, Mumps virus, Bordetella pertussis, Streptococcus pneumonia, Poliovirus, Rabies virus, Rotavirus, Rubella virus, Herpes Zoster virus, Clostridium tetani, Salmonella typhi, Yellow Fever virus, Ebola virus, avian flu virus, Bacillus anthracis, Smallpox virus, or Zika virus.
- the antigen is from Mycobacterium tuberculosis, Varicella zoster virus, Corynebacterium diphtheria, Hepati
- Embodiment 37 The nucleic acid carrier of embodiment 31, wherein the antibody fragment is Fab, F(ab') 2 , scFv, tandem scFv, a BiTE, single domain (sdAb) antibody, diabody, single chain diabody, minibody, fusion protein, or scFv-Fc.
- the antibody fragment is Fab, F(ab') 2 , scFv, tandem scFv, a BiTE, single domain (sdAb) antibody, diabody, single chain diabody, minibody, fusion protein, or scFv-Fc.
- Embodiment 38 The nucleic acid carrier of embodiment 31, wherein the antibody, or fragment thereof, is directed to a disease-associated antigen.
- Embodiment 39 The nucleic acid carrier of embodiment 38, wherein the disease- associated antigen is a tumor-associated antigen.
- Embodiment 40 The nucleic acid carrier of embodiment 39, wherein the tumor- associated antigen is 4-1BB, 5AC, 5T4, A2aR, activin receptor-like kinase 1, AGS-22M6, AKAP4, alpha-fetoprotein, angiopoietin 2, B7-H3, BAFF, BAGE, BCR-ABL, BORIS, CA-125, CA19-9, C242 antigen, carbonic anhydrase 9 (CA-IX), CCR4, CD 19, CD20, CD22, CD23 (IgE receptor), CD24, CD28, CD30 (TNFRSF8), CD33, CD37, CD38 (cyclic ADP ribose hydrolase), CD40, CD44 v6, CD51, CD56, CD70, CD71, CD73, CD74, CD79B, CD80, CD137, CD140a, CD152, CD200, CD221, CD274, CEA, ch4D5, CLDN18.2, CS1, CSF1R, CTLA-4
- Embodiment 41 The nucleic acid carrier of embodiment 39, wherein the tumor- associated antigen is HER-2, EGFR, CD30, CD20, EpCAM, NG2, CD19, CEA, MUC-1, CA19- 9, OCAA, MAPG, TAM, TLR, CD71, ERBB2, VEGF, or glioma.
- the tumor- associated antigen is HER-2, EGFR, CD30, CD20, EpCAM, NG2, CD19, CEA, MUC-1, CA19- 9, OCAA, MAPG, TAM, TLR, CD71, ERBB2, VEGF, or glioma.
- Embodiment 42 The nucleic acid carrier of embodiment 38, wherein the disease- associated antigen is l-40-P-amyloid , AOC3 (VAP-1), ACVR2B, angiopoietin 3, beta-amyloid, C5, CCL11 (eotaxin-1), CCR5, CD2, CD3, CD4, CD5, CD11, CD18, CD20, CD23 (IgE receptor), CD25 (a chain of IL-2 receptor), CD28, CD41 (integrin alpha-lib), CD52, CD125, CD147 (basigin), CD154 (CD40L), CEA-related antigen, clumping factor A, endotoxin, GMCSF receptor a-chain, growth differentiation factor 8, hemagglutinin, HNGF, Hsp90, IGHE, IgE Fc region, IL- ⁇ , IL-4, IL-5, IL-6, IL-9, IL-12, IL-13, IL-17, IL-17A, IL-20, IL-22,
- Embodiment 43 The nucleic acid carrier of embodiment 31, wherein the antibody, or fragment thereof, is directed to a cell surface marker.
- Embodiment 44 The nucleic acid carrier of embodiment 43, wherein the cell surface marker is on an immune cell.
- Embodiment 45 The nucleic acid carrier of embodiment 44, wherein the immune cell is a T cell, B cell, K cell, macrophage, TIL, dendritic cell, neutrophil, eosinophil, basophil, or mast cell.
- the immune cell is a T cell, B cell, K cell, macrophage, TIL, dendritic cell, neutrophil, eosinophil, basophil, or mast cell.
- Embodiment 46 The nucleic acid carrier of embodiment 45, wherein the T cell is a
- Embodiment 47 The nucleic acid carrier of embodiment 43, wherein the cell surface marker is CD36, CD68, CD83, CD180, CD206 (MRC1- mannose receptor), F4/80 (EGF-TM7 family), CD205, CD56, CD161, CD94: KG2 heterodimer, KIR/CD158 family, CD335, CD64, CD16, CD3, CD28, CD4, CD25, CD39, Toll-like receptors (TLRs), CD281, CD283, CD284, CD286, CD289, CD282, C-type lectin receptors (CLRs), Fc Receptor, or HSG.
- the cell surface marker is CD36, CD68, CD83, CD180, CD206 (MRC1- mannose receptor), F4/80 (EGF-TM7 family), CD205, CD56, CD161, CD94: KG2 heterodimer, KIR/CD158 family, CD335, CD64, CD16, CD3, CD28, CD4, CD25, CD39, Toll-like receptors
- Embodiment 48 The nucleic acid carrier of embodiment 31, comprising one or two of the following:
- first targeting agent which is an antibody, or fragment thereof, directed to FIER2
- second targeting agent which is an antibody, or fragment thereof, directed to CD64
- first targeting agent which is an antibody, or fragment thereof, directed to EGFR and a second targeting agent which is an antibody, or fragment thereof, directed to CD64;
- first targeting agent which is an antibody, or fragment thereof, directed to EGFR and a second targeting agent which is an antibody, or fragment thereof, directed to PD-1;
- first targeting agent which is an antibody, or fragment thereof, directed to PD-L1
- second targeting agent which is an antibody, or fragment thereof, directed to OX40
- first targeting agent which is an antibody, or fragment thereof, directed to CD30 and a second targeting agent which is an antibody, or fragment thereof, directed to CD 16;
- first targeting agent which is an antibody, or fragment thereof, directed to FIER2
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to CD20 and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to EpCAM and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to NG2
- second targeting agent which is an antibody, or fragment thereof, directed to CD28
- first targeting agent which is an antibody, or fragment thereof, directed to CD 19 and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to CD 19 and a second targeting agent which is an antibody, or fragment thereof, directed to CD 16;
- first targeting agent which is an antibody, or fragment thereof, directed to CEA
- second targeting agent which is an antibody, or fragment thereof, directed to HSG
- first targeting agent which is an antibody, or fragment thereof, directed to MUC-1
- second targeting agent which is an antibody, or fragment thereof, directed to HSG
- first targeting agent which is an antibody, or fragment thereof, directed to CA19-9 and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to CEA
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to OCAA
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to MAPG and a second targeting agent which is an antibody, or fragment thereof, directed to CD28;
- first targeting agent which is an antibody, or fragment thereof, directed to HER2
- second targeting agent which is an antibody, or fragment thereof, directed to CD 16
- first targeting agent which is an antibody, or fragment thereof, directed to glioma
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is folic acid or folic acid receptor and a second targeting agent which is an antibody, or fragment thereof, directed to CD3 or CD 16;
- first targeting agent which is an antibody, or fragment thereof, directed to PD-1
- second targeting agent which is an antibody, or fragment thereof, directed to PDL-1 or PDL-2.
- Embodiment 49 The nucleic acid carrier of embodiment 31, wherein the label is a chemiluminescent agent, a fluorescent agent, an infrared dye, a radiolabel agent, a metal, a chelating agent, a hapten, or a gene or mRNA encoding a detectable protein.
- the label is a chemiluminescent agent, a fluorescent agent, an infrared dye, a radiolabel agent, a metal, a chelating agent, a hapten, or a gene or mRNA encoding a detectable protein.
- Embodiment 50 The nucleic acid carrier of embodiment 31, wherein the adjuvant is one or more of a CpG containing oligonucleotide, a ssRNA, a dsRNA, a monophosphate lipid, aluminum, squalene, 3-deacyl-monophosphoryl lipid A, vitamin E, surfactant polysorbate 80, mannide-mono-oleate, SLAG-3, or a galactosylceramide.
- the adjuvant is one or more of a CpG containing oligonucleotide, a ssRNA, a dsRNA, a monophosphate lipid, aluminum, squalene, 3-deacyl-monophosphoryl lipid A, vitamin E, surfactant polysorbate 80, mannide-mono-oleate, SLAG-3, or a galactosylceramide.
- Embodiment 51 The nucleic acid carrier of embodiment 50, wherein the CpG containing oligonucleotide is ODN 1585, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2216, ODN 2336, ODN 2395, ODN M362, AT-ODN-1, AT-ODN-2, ODNBW006, ODN 2088, ODN 4084, ODN INH-1, ODN INH-47, ODN TTAGGG, or G-ODN.
- the CpG containing oligonucleotide is ODN 1585, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2216, ODN 2336, ODN 2395, ODN M362, AT-ODN-1, AT-ODN-2, ODNBW006, ODN 2088, ODN 4084, ODN INH-1, ODN INH-47, ODN TTAGGG, or G-ODN.
- Embodiment 52 The nucleic acid carrier of embodiment 31, wherein the RNA molecule is siRNA, miRNA, mRNA, snRNA, dsRNA, ncRNA, snoRNA, or an aptamer.
- Embodiment 53 The nucleic acid carrier of any one of embodiments 1 to 30, wherein the targeting agent is an antigen, an antibody, or a fragment of an antibody, and the
- oligonucleotide linker conjugating the targeting moiety to the at least one single-stranded arm is a CpG containing oligonucleotide.
- Embodiment 54 The nucleic acid carrier of any one of embodiments 1 to 30, wherein the nucleic acid carrier comprises at least one antigen, at least one antibody or fragment thereof directed to an immune cell, and at least one adjuvant.
- Embodiment 55 A double monomer nucleic acid carrier comprising a first nucleic acid carrier of any one of embodiments 1 to 30 and a second nucleic acid carrier of any one of embodiments 1 to 30, wherein one single-stranded arm of the first nucleic acid carrier is conjugated to one single-stranded arm of the second nucleic acid carrier, forming a double monomer nucleic acid carrier comprising six peripheral single-stranded arms.
- Embodiment 56 The double monomer nucleic acid carrier of embodiment 55, wherein the nucleic acid is deoxyribonucleic acid (DNA), ribonucleic acid (RNA), modified DNA or RNA, or a combination thereof.
- the nucleic acid is deoxyribonucleic acid (DNA), ribonucleic acid (RNA), modified DNA or RNA, or a combination thereof.
- Embodiment 57 The double monomer nucleic acid carrier of embodiment 55 or embodiment 56, wherein the double-stranded region is 4 to 2000 bases in length.
- Embodiment 58 The double monomer nucleic acid carrier of embodiment 57, wherein the double-stranded region is 5 to 200 bases in length.
- Embodiment 59 The double monomer nucleic acid carrier of embodiment 57, wherein the double-stranded region is 25 to 50 bases in length.
- Embodiment 60 The double monomer nucleic acid carrier of any one of embodiments
- each single-stranded arm is 4 to 200 bases in length.
- Embodiment 61 The double monomer nucleic acid carrier of embodiment 60, wherein each single-stranded arm is 5 to 50 bases in length.
- Embodiment 62 The double monomer nucleic acid carrier of embodiment 61, wherein each single-stranded arm is 25 to 50 bases in length.
- Embodiment 63 The double monomer nucleic acid carrier of embodiment 62, wherein each single-stranded arm is 16 to 50 bases in length.
- Embodiment 64 The double monomer nucleic acid carrier of any one of embodiments
- nucleotide sequence of each of the six peripheral single-stranded arms is identical.
- Embodiment 65 The double monomer nucleic acid carrier of any one of embodiments 55 to 63, wherein the nucleotide sequence of at least one, at least two, at least three, at least four, or at least five of the peripheral single-stranded arms are different than the nucleotide sequence of the other peripheral single-stranded arms.
- Embodiment 66 The double monomer nucleic acid carrier of any one of embodiments 55 to 65, wherein the at least one targeting agent is conjugated to the at least one peripheral single-stranded arm by an oligonucleotide linker.
- Embodiment 67 The double monomer nucleic acid carrier of embodiment 66, wherein at least one targeting agent, at least two targeting agents, at least three targeting agents, at least four targeting agents, at least five targeting agents, or six targeting agents are conjugated to the peripheral single-stranded arms.
- Embodiment 68 The double monomer nucleic acid carrier of embodiment 67, wherein all targeting agents are identical, or at least one targeting agent, at least two targeting agents, at least three targeting agents, at least four targeting agents, or at least five targeting agents, are different from one another.
- Embodiment 69 The double monomer nucleic acid carrier of any one of embodiments 55 to 68, wherein one or more peripheral single-stranded arms not conjugated to a targeting agent is complementary base paired to an oligonucleotide linker.
- Embodiment 70 The double monomer nucleic acid carrier of any one of embodiments 55 to 69, wherein the at least one targeting agent is an antigen, a peptide, an antibody or fragment thereof, an antibody-drug conjugate, a non-antibody scaffold, a label, an adjuvant, an RNA molecule, a DNA molecule, a vitamin, a protein, a fusion protein, a fusion peptide, a carbohydrate, a lipid, a polysaccharide, a lipopoly saccharide, a polymer, a virus particle, or a virus-like particle, or any combination thereof.
- the at least one targeting agent is an antigen, a peptide, an antibody or fragment thereof, an antibody-drug conjugate, a non-antibody scaffold, a label, an adjuvant, an RNA molecule, a DNA molecule, a vitamin, a protein, a fusion protein, a fusion peptide, a carbohydrate, a
- Embodiment 71 The double monomer nucleic acid carrier of embodiment 70, wherein the polymer is hyaluronic acid, polyargenine, polylysine, polyethylenimine (PEI), polyethyleglycol (PEG), polyglycolic acid (PGA), polylactic acid (PLA), or poly(lactic-co- glycolic acid) (PLGA).
- the polymer is hyaluronic acid, polyargenine, polylysine, polyethylenimine (PEI), polyethyleglycol (PEG), polyglycolic acid (PGA), polylactic acid (PLA), or poly(lactic-co- glycolic acid) (PLGA).
- Embodiment 72 The double monomer nucleic acid carrier of embodiment 70, wherein the non-antibody scaffold is an affibody, an affilin, an anticalin, an atrimer, an avimer, a bicyclic peptide, a cys-knot, a DARPin, an FN3, a fynomer, a kunitz domain, or an O-body.
- the non-antibody scaffold is an affibody, an affilin, an anticalin, an atrimer, an avimer, a bicyclic peptide, a cys-knot, a DARPin, an FN3, a fynomer, a kunitz domain, or an O-body.
- Embodiment 73 The double monomer nucleic acid carrier of embodiment 70, wherein the antigen is a bacterial antigen, a viral antigen, a fungal antigen, a yeast antigen, a protozoan antigen, or prion.
- the antigen is a bacterial antigen, a viral antigen, a fungal antigen, a yeast antigen, a protozoan antigen, or prion.
- Embodiment 74 The double monomer nucleic acid carrier of embodiment 73, wherein the antigen is from Acetobacter aurantius, Acinetobacter baumannii, Acinetobacter
- Agrobacterium radiobacter Agrobacterium tumefaciens, Azorhizobium caulinodans,
- Azotobacter vinelandii Anaplasma phagocytophilum, Bacillus anthracis, Bacillus brevis, Bacillus cereus, Bacillus fusiformis, Bacillus licheniformis, Bacillus megaterium, Bacillus mycoides, Bacillus stearothermophilus, Bacillus subtilis, Bacteroides gingivalis, Bacteroides fragilis, Bacteroides melaninogenicus ⁇ Prevotella melaninogenicd), Bartonella henselae, Bartonella quintana, Bordetella bronchiseptica, Bordetella pertussis, Borrelia burgdorferi, Brucella abortus, Brucella melitensis, Brucella suis, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia, Calymmatobacterium granulomatis, Campylobacter coli, Campylobacter fe
- Haemophilus pertussis Haemophilus vaginalis, Haemophilus influenza, Haemophilus aegyptius, Helicobacter pylori, Klebsiella pneumonia, Klebsiella oxytoca, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus casei, Lactococcus lactis, Legionella pneumophila, Listeria monocytogenes, Methanobacterium extroquens, Microbacterium multiforme,
- Micrococcus luteus Moraxella lacunata, Moraxella catarrhalis, Morganella morganii, Mycobacterium avium, Mycobacterium ajricanum, Mycobacterium bovis, Mycobacterium canetti, Mycobacterium diphtheria, Mycobacterium intracellular, Mycobacterium leprae, Mycobacterium lepraemurium, Mycobacterium microti, Mycobacterium phlei, Mycobacterium smegmatis, Mycobacterium tuberculosis, Mycoplasma fermentans, Mycoplasma genitalium, Mycoplasma hominis, Mycoplasma penetrans, Mycoplasma pneumonia, Neisseria gonorrhoeae, Neisseria meningitides, Pasteurella multocida, Pasteurella tularensis, Porphyromonas gingivalis, Prevotella melaninogenica (Bacteroides melaninogenicus), Propionibacterium acne
- Streptococcus anginosus Streptococcus avium, Streptococcus bovis, Streptococcus cricetus, Streptococcus faceium, Streptococcus faecalis, Streptococcus ferus, Streptococcus gallinarum, Streptococcus lactis. Streptococcus mitior, Streptococcus mitis, Streptococcus mutans,
- Streptococcus oralis Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus rattus, Streptococcus salivarius, Streptococcus sanguis, Streptococcus sobrinus, Streptococcus viridans, Treponema pallidum, Treponema denticola, Vibrio cholera, Vibrio comma, Vibrio parahaemolyticus, Vibrio vulnificus, Wolbachia, Yersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis, Aspergillus fumigatus, Aspergillus flavus, Aspergillus clavatus, Aspergillus niger, Aspergillus terreus, Candida albicans, Candida glabrata, Candida tropicalis, Candida krusei, Candida dubliniensis, Candida paraps
- Embodiment 75 The double monomer nucleic acid carrier of embodiment 73, wherein the antigen is from Mycobacterium tuberculosis, Varicella zoster virus, Coryne bacterium diphtheria, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Haemophilis influenza,
- Human Papillomavirus Influenza virus, Japanese Encephalitis virus, Measles virus, Neisseria meningitidis, Mumps virus, Bordetella pertussis, Streptococcus pneumonia, Poliovirus, Rabies virus, Rotavirus, Rubella virus, Herpes Zoster virus, Clostridium tetani, Salmonella typhi, Yellow Fever virus, Ebola virus, avian flu virus, Bacillus anthracis, Smallpox virus, and Zika virus.
- Embodiment 76 The double monomer nucleic acid carrier of embodiment 70, wherein the antibody fragment is Fab, F(ab') 2 , scFv, tandem scFv, a BiTE, single domain (sdAb) antibody, diabody, single chain diabody, minibody, fusion protein, or scFv-Fc.
- the antibody fragment is Fab, F(ab') 2 , scFv, tandem scFv, a BiTE, single domain (sdAb) antibody, diabody, single chain diabody, minibody, fusion protein, or scFv-Fc.
- Embodiment 77 The double monomer nucleic acid carrier of embodiment 70, wherein the antibody, or fragment thereof, is directed to a disease-associated antigen.
- Embodiment 78 The double monomer nucleic acid carrier of embodiment 77, wherein the disease-associated antigen is a tumor-associated antigen.
- Embodiment 79 The double monomer nucleic acid carrier of embodiment 78, wherein the tumor-associated antigen is 4- IBB, 5 AC, 5T4, A2aR, activin receptor-like kinase 1, AGS- 22M6, AKAP4, alpha-fetoprotein, angiopoietin 2, B7-H3, BAFF, BAGE, BCR-ABL, BORIS, CA-125, CA19-9, C242 antigen, carbonic anhydrase 9 (CA-IX), CCR4, CD19, CD20, CD22, CD23 (IgE receptor), CD24, CD28, CD30 (TNFRSF8), CD33, CD37, CD38 (cyclic ADP ribose hydrolase), CD40, CD44 v6, CD51, CD56, CD70, CD71, CD73, CD74, CD79B, CD80, CD137, CD140a, CD152, CD200, CD221, CD274, CEA, ch4D5, CLDN18.2, CS1, C
- Embodiment 80 The double monomer nucleic acid carrier of embodiment 78, wherein the tumor-associated antigen is chosen from HER-2, EGFR, CD30, CD20, EpCAM, NG2, CD 19, CEA, MUC-1, CA19-9, OCAA, MAPG, TAM, TLR, CD71, ERBB2, VEGF, and glioma.
- Embodiment 81 The double monomer nucleic acid carrier of embodiment 78, wherein the tumor-associated antigen is chosen from HER-2, EGFR, CD30, CD20, EpCAM, NG2, CD 19, CEA, MUC-1, CA19-9, OCAA, MAPG, TAM, TLR, CD71, ERBB2, VEGF, and glioma.
- the double monomer nucleic acid carrier of embodiment 77 wherein the disease-associated antigen is l-40-P-amyloid , AOC3 (VAP-1), ACVR2B, angiopoietin 3, beta-amyloid, C5, CCL1 1 (eotaxin-1), CCR5, CD2, CD3, CD4, CD5, CD11, CD18, CD20, CD23 (IgE receptor), CD25 (a chain of IL-2 receptor), CD28, CD41 (integrin alpha-Ob), CD52, CD125, CD147 (basigin), CD154 (CD40L), CEA-related antigen, clumping factor A, endotoxin, GMCSF receptor a-chain, growth differentiation factor 8, hemagglutinin, HNGF, Hsp90, IGUE, IgE Fc region, IL- ⁇ , IL-4, IL-5, IL-6, IL-9, IL-12, IL-13, IL-17, IL-17A, IL-20, IL-22,
- Embodiment 82 The double monomer nucleic acid carrier of embodiment 70, wherein the antibody, or fragment thereof, is directed to a cell surface marker.
- Embodiment 83 The double monomer nucleic acid carrier of embodiment 82, wherein the cell surface marker is on an immune cell.
- Embodiment 84 The double monomer nucleic acid carrier of embodiment 83, wherein the immune cell is a T cell, B cell, NK cell, macrophage, TIL, dendritic cell, neutrophil, eosinophil, basophil, or mast cell.
- the immune cell is a T cell, B cell, NK cell, macrophage, TIL, dendritic cell, neutrophil, eosinophil, basophil, or mast cell.
- Embodiment 85 The double monomer nucleic acid carrier of embodiment 84, wherein the T cell is a CD4 + T cell, CD8 + T cell, helper T cell, cytotoxic T cell, or natural killer T cell; and wherein the B cell is a memory B cell or a plasma cell.
- Embodiment 86 The double monomer nucleic acid carrier of embodiment 82, wherein the cell surface marker is CD36, CD68, CD83, CD180, CD206 (MRC1- mannose receptor), F4/80 (EGF-TM7 family), CD205, CD56, CD161, CD94:NKG2 heterodimer, KIR/CD158 family, CD335, CD64, CD16, CD3, CD28, CD4, CD25, CD39, Toll-like receptors (TLRs), CD281, CD283, CD284, CD286, CD289, CD282, C-type lectin receptors (CLRs), Fc Receptor, or HSG.
- the cell surface marker is CD36, CD68, CD83, CD180, CD206 (MRC1- mannose receptor), F4/80 (EGF-TM7 family), CD205, CD56, CD161, CD94:NKG2 heterodimer, KIR/CD158 family, CD335, CD64, CD16, CD3, CD28, CD4, CD25, CD39, To
- Embodiment 87 The double monomer nucleic acid carrier of embodiment 70, comprising one or two of the following:
- first targeting agent which is an antibody, or fragment thereof, directed to HER2 and a second targeting agent which is an antibody, or fragment thereof, directed to CD64
- first targeting agent which is an antibody, or fragment thereof, directed to EGFR and a second targeting agent which is an antibody, or fragment thereof, directed to CD64;
- first targeting agent which is an antibody, or fragment thereof, directed to EGFR and a second targeting agent which is an antibody, or fragment thereof, directed to PD-1;
- first targeting agent which is an antibody, or fragment thereof, directed to PD-L1
- second targeting agent which is an antibody, or fragment thereof, directed to OX40
- first targeting agent which is an antibody, or fragment thereof, directed to CD30 and a second targeting agent which is an antibody, or fragment thereof, directed to CD 16;
- first targeting agent which is an antibody, or fragment thereof, directed to HER2
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to CD20 and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to EpCAM
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to NG2
- second targeting agent which is an antibody, or fragment thereof, directed to CD28
- first targeting agent which is an antibody, or fragment thereof, directed to CD 19 and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to CD 19 and a second targeting agent which is an antibody, or fragment thereof, directed to CD 16;
- first targeting agent which is an antibody, or fragment thereof, directed to CEA
- second targeting agent which is an antibody, or fragment thereof, directed to HSG
- first targeting agent which is an antibody, or fragment thereof, directed to MUC-1
- second targeting agent which is an antibody, or fragment thereof, directed to HSG
- first targeting agent which is an antibody, or fragment thereof, directed to CA19-9 and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to CEA
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to OCAA
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to MAPG and a second targeting agent which is an antibody, or fragment thereof, directed to CD28;
- first targeting agent which is an antibody, or fragment thereof, directed to HER2 and a second targeting agent which is an antibody, or fragment thereof, directed to CD 16; a first targeting agent which is an antibody, or fragment thereof, directed to glioma and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is folic acid or folic acid receptor and a second targeting agent which is an antibody, or fragment thereof, directed to CD3 or CD 16;
- first targeting agent which is an antibody, or fragment thereof, directed to PD-1
- second targeting agent which is an antibody, or fragment thereof, directed to PDL-1 or PDL-2.
- Embodiment 88 The double monomer nucleic acid carrier of embodiment 70, wherein the label is a chemiluminescent agent, a fluorescent agent, an infrared dye, a radiolabel agent, a metal, a chelating agent, a hapten, or a gene or mRNA encoding a detectable protein.
- the label is a chemiluminescent agent, a fluorescent agent, an infrared dye, a radiolabel agent, a metal, a chelating agent, a hapten, or a gene or mRNA encoding a detectable protein.
- Embodiment 89 The double monomer nucleic acid carrier of embodiment 70, wherein the adjuvant is one or more of a CpG containing oligonucleotide, a ssRNA, a dsRNA, a monophosphate lipid, aluminum, squalene, 3-deacyl-monophosphoryl lipid A, vitamin E, surfactant polysorbate 80, mannide-mono-oleate, SLAG-3, or a galactosylceramide.
- the adjuvant is one or more of a CpG containing oligonucleotide, a ssRNA, a dsRNA, a monophosphate lipid, aluminum, squalene, 3-deacyl-monophosphoryl lipid A, vitamin E, surfactant polysorbate 80, mannide-mono-oleate, SLAG-3, or a galactosylceramide.
- Embodiment 90 The double monomer nucleic acid carrier of embodiment 89, wherein the CpG containing oligonucleotide is ODN 1585, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2216, ODN 2336, ODN 2395, ODN M362, AT-ODN-1, AT-ODN-2, ODNBW006, ODN 2088, ODN 4084, ODN INH-1, ODN INH-47, ODN TTAGGG, or G-ODN.
- the CpG containing oligonucleotide is ODN 1585, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2216, ODN 2336, ODN 2395, ODN M362, AT-ODN-1, AT-ODN-2, ODNBW006, ODN 2088, ODN 4084, ODN INH-1, ODN INH-47, ODN TTAGGG, or G-ODN.
- Embodiment 91 The double monomer nucleic acid carrier of embodiment 70, wherein the RNA molecule is siRNA, miRNA, mRNA, snRNA, dsRNA, ncRNA, snoRNA, or an aptamer.
- Embodiment 92 The double monomer nucleic acid carrier of any one of embodiments 55 to 69, wherein the targeting agent is an antigen, an antibody, or a fragment of an antibody, and the oligonucleotide linker conjugating the targeting moiety to the at least one single-stranded arm is a CpG containing oligonucleotide.
- Embodiment 93 The double monomer nucleic acid carrier of any one of embodiments
- nucleic acid carrier comprises at least one antigen, at least one antibody or fragment thereof directed to an immune cell, and at least one adjuvant.
- a trimer nucleic acid carrier comprising:
- a first oligonucleotide having a central portion, a first terminal arm, and a second terminal arm;
- a second oligonucleotide having a central portion, a first terminal arm, and a second terminal arm, wherein the first terminal arm of the second oligonucleotide is complementary to the first terminal arm of the first oligonucleotide and hybridized thereto; and a third oligonucleotide having a central portion, a first terminal arm, and a second terminal arm, wherein the first terminal arm of the third oligonucleotide is complementary to the second terminal arm of the first oligonucleotide and hybridized thereto;
- the second terminal arm of the second oligonucleotide is conjugated to a first targeting agent
- the second terminal arm of the third oligonucleotide is conjugated to a second targeting agent
- Embodiment 95 The trimer nucleic acid carrier of embodiment 94, wherein the nucleic acid is deoxyribonucleic acid (DNA), ribonucleic acid (RNA), modified DNA or RNA, or a combination thereof.
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- modified DNA or RNA or a combination thereof.
- Embodiment 96 The trimer nucleic acid carrier of embodiment 94 or embodiment 95, wherein the central portion of each of the first and second oligonucleotides is 4 to 2000 bases in length.
- Embodiment 97 The trimer nucleic acid carrier of embodiment 96, wherein the central portion of each of the first and second oligonucleotides is 5 to 200 bases in length.
- Embodiment 98 The trimer nucleic acid carrier of embodiment 96, wherein the central portion of each of the first and second oligonucleotides is 25 to 50 bases in length.
- Embodiment 99 The trimer nucleic acid carrier of any one of embodiments 94 to 98, wherein each of the first and second terminal arms of each of the first and second
- oligonucleotides is 4 to 200 bases in length.
- Embodiment 100 The trimer nucleic acid carrier of embodiment 99, wherein each of the first and second terminal arms of each of the first and second oligonucleotides is 5 to 50 bases in length.
- Embodiment 101 The trimer nucleic acid carrier of embodiment 99, wherein each of the first and second terminal arms of each of the first and second oligonucleotides is 25 to 50 bases in length.
- Embodiment 102 The trimer nucleic acid carrier of embodiment 99, wherein each of the first and second terminal arms of each of the first and second oligonucleotides is 16 to 50 bases in length.
- Embodiment 103 The trimer nucleic acid carrier of any one of embodiments 94 to 102, wherein the nucleotide sequences of the four terminal arms are identical.
- Embodiment 104 The trimer nucleic acid carrier of any one of embodiments 94 to 102, wherein the nucleotide sequences of three of the terminal arms are identical and different than the nucleotide sequence of the fourth terminal arm.
- Embodiment 105 The trimer nucleic acid carrier of any one of embodiments 94 to 102, wherein the nucleotide sequences of two of the terminal arms are identical to each other and different than the nucleotide sequences of the other two terminal arms.
- Embodiment 106 The trimer nucleic acid carrier of any one of embodiments 94 to 102, wherein the nucleotide sequences of two of the terminal arms are identical to each other and the nucleotide sequences of the other two terminal arms are identical to each other, wherein the nucleotide sequence of the first two terminal arms is different than the nucleotide sequences of the second two terminal arms.
- Embodiment 107 The trimer nucleic acid carrier of any one of embodiments 94 to 102, wherein the nucleotide sequence of each of the four terminal arms is different.
- Embodiment 108 The trimer nucleic acid carrier of any one of embodiments 94 to 107, wherein the first and second targeting agents are conjugated to the terminal arms by an oligonucleotide linker.
- Embodiment 109 The trimer nucleic acid carrier of any one of embodiments 94 to 108, wherein the first targeting agent is identical to the second targeting agent.
- Embodiment 110 The trimer nucleic acid carrier of any one of embodiments 94 to 108, wherein the first targeting agent is different than the second targeting agent.
- Embodiment 111 The trimer nucleic acid carrier of any one of embodiments 94 to 110, wherein the targeting agent is an antigen, a peptide, an antibody or fragment thereof, an antibody-drug conjugate, a non-antibody scaffold, a label, an adjuvant, an RNA molecule, a DNA molecule, a vitamin, a protein, a fusion protein, a fusion peptide, a carbohydrate, a lipid, a polysaccharide, a lipopolysaccharide, a polymer, a virus particle, a virus-like particle, or any combination thereof.
- the targeting agent is an antigen, a peptide, an antibody or fragment thereof, an antibody-drug conjugate, a non-antibody scaffold, a label, an adjuvant, an RNA molecule, a DNA molecule, a vitamin, a protein, a fusion protein, a fusion peptide, a carbohydrate, a lipid, a polys
- Embodiment 112 The trimer nucleic acid carrier of embodiment 111, wherein the polymer is hyaluronic acid, polyargenine, polylysine, polyethylenimine (PEI), polyethyleglycol (PEG), polyglycolic acid (PGA), polylactic acid (PLA), or poly(lactic-co-glycolic acid) (PLGA).
- the polymer is hyaluronic acid, polyargenine, polylysine, polyethylenimine (PEI), polyethyleglycol (PEG), polyglycolic acid (PGA), polylactic acid (PLA), or poly(lactic-co-glycolic acid) (PLGA).
- Embodiment 113 The trimer nucleic acid carrier of embodiment 111, wherein the non- antibody scaffold is an affibody, an affilin, an anticalin, an atrimer, an avimer, a bicyclic peptide, a cys-knot, a DARPin, an FN3, a fynomer, a kunitz domain, or an O-body.
- the non- antibody scaffold is an affibody, an affilin, an anticalin, an atrimer, an avimer, a bicyclic peptide, a cys-knot, a DARPin, an FN3, a fynomer, a kunitz domain, or an O-body.
- Embodiment 114 The trimer nucleic acid carrier of embodiment 111, wherein the antigen is a bacterial antigen, a viral antigen, a fungal antigen, a yeast antigen, a protozoan antigen, or prion.
- the antigen is a bacterial antigen, a viral antigen, a fungal antigen, a yeast antigen, a protozoan antigen, or prion.
- Embodiment 115 The trimer nucleic acid carrier of embodiment 114, wherein the antigen is from Acetobacter aurantius, Acinetobacter baumannii, Acinetobacter calcoaceticus, Acinetobacter haemolyticus, Acinetobacter junii, Acinetobacter Iwoffii, Actinomyces israelii, Actinomyces viscosus, Aggregatibacter actinomycetemcomitans, Agrobacterium radiobacter, Agrobacterium tumefaciens, Azorhizobium caulinodans, Azotobacter vinelandii, Anaplasma phagocytophilum, Bacillus anthracis, Bacillus brevis, Bacillus cereus, Bacillus fusiformis, Bacillus licheniformis, Bacillus megaterium, Bacillus mycoides, Bacillus stearothermophilus, Bacillus subtilis, Bacteroides gingivalis, Bactero
- bronchiseptica Bordetella pertussis, Borrelia burgdorferi, Brucella abortus, Brucella melitensis, Brucella suis, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia,
- Clostridium welchii Clostridium tetani
- Coryne bacterium diphtheria Clostridium welchii
- Haemophilus vaginalis Haemophilus influenza, Haemophilus aegyptius, Helicobacter pylori, Klebsiella pneumonia, Klebsiella oxytoca, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus casei, Lactococcus lactis, Legionella pneumophila, Listeria monocytogenes, Methanobacterium extroquens, Microbacterium multiforme, Micrococcus luteus, Moraxella lacunata, Moraxella catarrhalis, Morganella morganii, Mycobacterium avium, Mycobacterium africanum, Mycobacterium bovis, Mycobacterium canetti, Mycobacterium diphtheria,
- Mycobacterium intracellulare Mycobacterium leprae, Mycobacterium lepraemurium,
- Mycobacterium microti Mycobacterium phlei, Mycobacterium smegmatis, Mycobacterium tuberculosis, Mycoplasma fermentans, Mycoplasma genitalium, Mycoplasma hominis,
- Mycoplasma penetrans Mycoplasma pneumonia, Neisseria gonorrhoeae, Neisseria
- Pasteur ella multocida meningitides, Pasteur ella multocida, Pasteur ella tularensis, Porphyromonas gingivalis,
- Prevotella melaninogenica (Bacteroides melaninogenicus), Propionibacterium acnes, Proteus mirabillis, Proteus vulgaris, Providencia stuartii, Pseudomonas aeruginosa, Pseudomonas otitidis, Rhizobium radiobacter, Rickettsia prowazekii, Rickettsia psittaci, Rickettsia quintana, Rickettsia rickettsia, Rickettsia trachomae, Rochalimaea henselae, Rochalimaea Quintana, Rothia dentocariosa, Salmonella enteritidis, Salmonella typhi, Salmonella typhimurium, Serratia marcescens, Shigella dysenteriae, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus, St
- Streptococcus pneumoniae Streptococcus pyogenes, Streptococcus rattus, Streptococcus salivarius, Streptococcus sanguis, Streptococcus sobrinus, Streptococcus viridans, Treponema pallidum, Treponema denticola, Vibrio cholera, Vibrio comma, Vibrio parahaemolyticus, Vibrio vulnificus, Wolbachia, Yersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis, Aspergillus fumigatus, Aspergillus flavus, Aspergillus clavatus, Aspergillus niger, Aspergillus terreus, Candida albicans, Candida glabrata, Candida tropicalis, Candida krusei, Candida dubliniensis, Candida parapsilosis, Fusarium sol
- Embodiment 116 The trimer nucleic acid carrier of embodiment 114, wherein the antigen is from Mycobacterium tuberculosis, Varicella zoster virus, Coryne bacterium diphtheria, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Haemophilis influenza, Human
- Papillomavirus Influenza virus, Japanese Encephalitis virus, Measles virus, Neisseria
- Mumps virus Bordetella pertussis, Streptococcus pneumonia, Poliovirus, Rabies virus, Rotavirus, Rubella virus, Herpes Zoster virus, Clostridium tetani, Salmonella typhi, Yellow Fever virus, Ebola virus, avian flu virus, Bacillus anthracis, Smallpox virus, or Zika virus.
- Embodiment 117 The trimer nucleic acid carrier of embodiment 111, wherein the antibody fragment is Fab, F(ab') 2 , scFv, tandem scFv, a BiTE, single domain (sdAb) antibody, diabody, single chain diabody, minibody, fusion protein, or scFv-Fc.
- the antibody fragment is Fab, F(ab') 2 , scFv, tandem scFv, a BiTE, single domain (sdAb) antibody, diabody, single chain diabody, minibody, fusion protein, or scFv-Fc.
- Embodiment 118 The trimer nucleic acid carrier of embodiment 111, wherein the antibody, or fragment thereof, is directed to a disease-associated antigen.
- Embodiment 119 The trimer nucleic acid carrier of embodiment 118, wherein the disease-associated antigen is a tumor-associated antigen.
- Embodiment 120 The trimer nucleic acid carrier of embodiment 119, wherein the tumor-associated antigen is 4-1BB, 5AC, 5T4, A2aR, activin receptor-like kinase 1, AGS-22M6, AKAP4, alpha-fetoprotein, angiopoietin 2, B7-H3, BAFF, BAGE, BCR-ABL, BORIS, CA-125, CA19-9, C242 antigen, carbonic anhydrase 9 (CA-IX), CCR4, CD 19, CD20, CD22, CD23 (IgE receptor), CD24, CD28, CD30 (T FRSF8), CD33, CD37, CD38 (cyclic ADP ribose hydrolase), CD40, CD44 v6, CD51, CD56, CD70, CD71, CD73, CD74, CD79B, CD80, CD137, CD140a, CD152, CD200, CD221, CD274, CEA, ch4D5, CLDN18.2, CS1, CSF1R
- Embodiment 121 The trimer nucleic acid carrier of embodiment 119, wherein the tumor-associated antigen is HER-2, EGFR, CD30, CD20, EpCAM, NG2, CD19, CEA, MUC-1, CA19-9, OCAA, MAPG, TAM, TLR, CD71, ERBB2, VEGF, or glioma.
- the tumor-associated antigen is HER-2, EGFR, CD30, CD20, EpCAM, NG2, CD19, CEA, MUC-1, CA19-9, OCAA, MAPG, TAM, TLR, CD71, ERBB2, VEGF, or glioma.
- Embodiment 122 The trimer nucleic acid carrier of embodiment 118, wherein the disease-associated antigen is l-40-P-amyloid , AOC3 (VAP-1), ACVR2B, angiopoietin 3, beta- amyloid, C5, CCL11 (eotaxin-1), CCR5, CD2, CD3, CD4, CD5, CD11, CD18, CD20, CD23 (IgE receptor), CD25 (a chain of IL-2 receptor), CD28, CD41 (integrin alpha-lib), CD52, CD125, CD147 (basigin), CD154 (CD40L), CEA-related antigen, clumping factor A, endotoxin, GMCSF receptor a-chain, growth differentiation factor 8, hemagglutinin, HNGF, Hsp90, IGHE, IgE Fc region, IL- ⁇ , IL-4, IL-5, IL-6, IL-9, IL-12, IL-13, IL-17, IL-17A, IL-20
- Embodiment 123 The trimer nucleic acid carrier of embodiment 111, wherein the antibody, or fragment thereof, is directed to a cell surface marker.
- Embodiment 124 The trimer nucleic acid carrier of embodiment 123, wherein the cell surface marker is on an immune cell.
- Embodiment 125 The trimer nucleic acid carrier of embodiment 124, wherein the immune cell is a T cell, B cell, NK cell, macrophage, TIL, dendritic cell, neutrophil, eosinophil, basophil, or mast cell.
- the immune cell is a T cell, B cell, NK cell, macrophage, TIL, dendritic cell, neutrophil, eosinophil, basophil, or mast cell.
- Embodiment 126 The trimer nucleic acid carrier of embodiment 125, wherein the T cell is a CD4 + T cell, CD8 + T cell, helper T cell, cytotoxic T cell, or natural killer T cell; and wherein the B cell is a memory B cell or a plasma cell.
- Embodiment 127 The trimer nucleic acid carrier of embodiment 123, wherein the cell surface marker is CD36, CD68, CD83, CD180, CD206 (MRC1- mannose receptor), F4/80 (EGF-TM7 family), CD205, CD56, CD161, CD94:NKG2 heterodimer, KIR/CD158 family, CD335, CD64, CD16, CD3, CD28, CD4, CD25, CD39, Toll-like receptors (TLRs), CD281, CD283, CD284, CD286, CD289, CD282, C-type lectin receptors (CLRs), Fc Receptor, or HSG.
- the cell surface marker is CD36, CD68, CD83, CD180, CD206 (MRC1- mannose receptor), F4/80 (EGF-TM7 family), CD205, CD56, CD161, CD94:NKG2 heterodimer, KIR/CD158 family, CD335, CD64, CD16, CD3, CD28, CD4, CD25, CD39, Toll
- Embodiment 128 The trimer nucleic acid carrier of embodiment 111, comprising one or two of the following:
- first targeting agent which is an antibody, or fragment thereof, directed to HER2
- second targeting agent which is an antibody, or fragment thereof, directed to CD64
- first targeting agent which is an antibody, or fragment thereof, directed to EGFR and a second targeting agent which is an antibody, or fragment thereof, directed to CD64;
- first targeting agent which is an antibody, or fragment thereof, directed to EGFR and a second targeting agent which is an antibody, or fragment thereof, directed to PD-1;
- first targeting agent which is an antibody, or fragment thereof, directed to PD-L1
- second targeting agent which is an antibody, or fragment thereof, directed to OX40
- first targeting agent which is an antibody, or fragment thereof, directed to CD30 and a second targeting agent which is an antibody, or fragment thereof, directed to CD 16;
- first targeting agent which is an antibody, or fragment thereof, directed to HER2
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to CD20 and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to EpCAM and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to NG2
- second targeting agent which is an antibody, or fragment thereof, directed to CD28
- first targeting agent which is an antibody, or fragment thereof, directed to CD 19 and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to CD 19 and a second targeting agent which is an antibody, or fragment thereof, directed to CD 16;
- first targeting agent which is an antibody, or fragment thereof, directed to CEA
- second targeting agent which is an antibody, or fragment thereof, directed to HSG
- first targeting agent which is an antibody, or fragment thereof, directed to MUC-1
- second targeting agent which is an antibody, or fragment thereof, directed to HSG
- first targeting agent which is an antibody, or fragment thereof, directed to CA19-9 and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to CEA
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to OCAA
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to MAPG and a second targeting agent which is an antibody, or fragment thereof, directed to CD28;
- first targeting agent which is an antibody, or fragment thereof, directed to HER2
- second targeting agent which is an antibody, or fragment thereof, directed to CD 16
- first targeting agent which is an antibody, or fragment thereof, directed to glioma
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is folic acid or folic acid receptor and a second targeting agent which is an antibody, or fragment thereof, directed to CD3 or CD 16;
- first targeting agent which is an antibody, or fragment thereof, directed to PD-1
- second targeting agent which is an antibody, or fragment thereof, directed to PDL-1 or PDL-2.
- Embodiment 129 The trimer nucleic acid carrier of embodiment 111, wherein the label is a chemiluminescent agent, a fluorescent agent, an infrared dye, a radiolabel agent, a metal, a chelating agent, a hapten, or a gene or mRNA encoding a detectable protein.
- the label is a chemiluminescent agent, a fluorescent agent, an infrared dye, a radiolabel agent, a metal, a chelating agent, a hapten, or a gene or mRNA encoding a detectable protein.
- Embodiment 130 The trimer nucleic acid carrier of embodiment 111, wherein the adjuvant is one or more of a CpG containing oligonucleotide, a ssRNA, a dsRNA, a monophosphate lipid, aluminum, squalene, 3-deacyl-monophosphoryl lipid A, vitamin E, surfactant polysorbate 80, mannide-mono-oleate, SLAG-3, or a galactosylceramide.
- the adjuvant is one or more of a CpG containing oligonucleotide, a ssRNA, a dsRNA, a monophosphate lipid, aluminum, squalene, 3-deacyl-monophosphoryl lipid A, vitamin E, surfactant polysorbate 80, mannide-mono-oleate, SLAG-3, or a galactosylceramide.
- Embodiment 131 The trimer nucleic acid carrier of embodiment 130, wherein the CpG containing oligonucleotide is ODN 1585, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2216, ODN 2336, ODN 2395, ODN M362, AT-ODN-1, AT-ODN-2, ODNBW006, ODN 2088, ODN 4084, ODN INH-1, ODN INH-47, ODN TTAGGG, or G-ODN.
- the CpG containing oligonucleotide is ODN 1585, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2216, ODN 2336, ODN 2395, ODN M362, AT-ODN-1, AT-ODN-2, ODNBW006, ODN 2088, ODN 4084, ODN INH-1, ODN INH-47, ODN TTAGGG, or G-ODN.
- Embodiment 132 The trimer nucleic acid carrier of embodiment 111, wherein the RNA molecule is siRNA, miRNA, mRNA, snRNA, dsRNA, ncRNA, snoRNA, or an aptamer.
- Embodiment 133 The trimer nucleic acid carrier of any one of embodiments 94 to 110, wherein the targeting agent is an antigen, an antibody, or a fragment of an antibody, and the oligonucleotide linker conjugating the targeting moiety to the at least one single-stranded arm is a CpG containing oligonucleotide.
- a nucleic acid carrier comprising:
- first terminal arm is conjugated to a first targeting agent
- second terminal is conjugated to a second targeting agent
- Embodiment 135. The nucleic acid carrier of embodiment 134, wherein the central portion, the first terminal arm, and the second terminal arm are single-stranded DNA.
- Embodiment 136 The nucleic acid carrier of embodiment 134, wherein the central portion, the first terminal arm, and the second terminal arm are double-stranded DNA.
- Embodiment 137 The nucleic acid carrier of any one of embodiments 134 to 136, wherein the nucleic acid is deoxyribonucleic acid (DNA), ribonucleic acid (RNA), modified DNA or RNA, or a combination thereof.
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- modified DNA or RNA or a combination thereof.
- Embodiment 138 The nucleic acid carrier of any one of embodiments 134 to 137, wherein the central portion is 4 to 2000 bases in length.
- Embodiment 139 The nucleic acid carrier of embodiment 138, wherein the central portion is 5 to 200 bases in length.
- Embodiment 140 The nucleic acid carrier of embodiment 138, wherein the central portion is 25 to 50 bases in length.
- Embodiment 141 The nucleic acid carrier of any one of embodiments 134 to 140, wherein each of the first and second terminal arms is 4 to 200 bases in length.
- Embodiment 142 The nucleic acid carrier of embodiment 141, wherein each of the first and second terminal arms is 5 to 50 bases in length.
- Embodiment 143 The nucleic acid carrier of embodiment 141, wherein each of the first and second terminal arms is 25 to 50 bases in length.
- Embodiment 144 The nucleic acid carrier of embodiment 141, wherein each of the first and second terminal arms is 16 to 50 bases in length.
- Embodiment 145 The nucleic acid carrier of any one of embodiments 134 to 144, wherein the nucleotide sequences of the two terminal arms are identical.
- Embodiment 146 The nucleic acid carrier of any one of embodiments 134 to 144, wherein the nucleotide sequences of the two terminal arms are different.
- Embodiment 147 The nucleic acid carrier of any one of embodiments 134 to 146, wherein the first and second targeting agents are conjugated to the terminal arms by an oligonucleotide linker.
- Embodiment 148 The nucleic acid carrier of any one of embodiments 134 to 147, wherein the first targeting agent is identical to the second targeting agent.
- Embodiment 149 The nucleic acid carrier of any one of embodiments 134 to 147, wherein the first targeting agent is different than the second targeting agent.
- Embodiment 150 The nucleic acid carrier of any one of embodiments 134 to 149, wherein the targeting agent is an antigen, a peptide, an antibody or fragment thereof, an antibody-drug conjugate, a non-antibody scaffold, a label, an adjuvant, an RNA molecule, a DNA molecule, a vitamin, a protein, a fusion protein, a fusion peptide, a carbohydrate, a lipid, a polysaccharide, a lipopolysaccharide, a polymer, a virus particle, of a virus-like particle, or any combination thereof.
- the targeting agent is an antigen, a peptide, an antibody or fragment thereof, an antibody-drug conjugate, a non-antibody scaffold, a label, an adjuvant, an RNA molecule, a DNA molecule, a vitamin, a protein, a fusion protein, a fusion peptide, a carbohydrate, a lipid, a polysacc
- Embodiment 151 The nucleic acid carrier of embodiment 150, wherein the polymer is hyaluronic acid, polyargenine, polylysine, polyethylenimine (PEI), polyethyleglycol (PEG), polyglycolic acid (PGA), polylactic acid (PLA), or poly(lactic-co-glycolic acid) (PLGA).
- the polymer is hyaluronic acid, polyargenine, polylysine, polyethylenimine (PEI), polyethyleglycol (PEG), polyglycolic acid (PGA), polylactic acid (PLA), or poly(lactic-co-glycolic acid) (PLGA).
- Embodiment 152 The nucleic acid carrier of embodiment 150, wherein the non- antibody scaffold is an affibody, an affilin, an anticalin, an atrimer, an avimer, a bicyclic peptide, a cys-knot, a DARPin, an FN3, a fynomer, a kunitz domain, or an O-body.
- the non- antibody scaffold is an affibody, an affilin, an anticalin, an atrimer, an avimer, a bicyclic peptide, a cys-knot, a DARPin, an FN3, a fynomer, a kunitz domain, or an O-body.
- Embodiment 153 The nucleic acid carrier of embodiment 150, wherein the antigen is a bacterial antigen, a viral antigen, a fungal antigen, a yeast antigen, a protozoan antigen, or prion.
- Embodiment 154 The nucleic acid carrier of embodiment 153, wherein the antigen is from Acetobacter aurantius, Acinetobacter baumannii, Acinetobacter calcoaceticus,
- bronchiseptica Bordetella pertussis, Borrelia burgdorferi, Brucella abortus, Brucella melitensis, Brucella suis, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia,
- Haemophilus vaginalis Haemophilus influenza, Haemophilus aegyptius, Helicobacter pylori, Klebsiella pneumonia, Klebsiella oxytoca, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus casei, Lactococcus lactis, Legionella pneumophila, Listeria monocytogenes, Methanobacterium extroquens, Microbacterium multiforme, Micrococcus luteus, Moraxella lacunata, Moraxella catarrhalis, Morganella morganii, Mycobacterium avium, Mycobacterium africanum, Mycobacterium bovis, Mycobacterium canetti, Mycobacterium diphtheria,
- Mycobacterium intracellulare Mycobacterium leprae, Mycobacterium lepraemurium,
- Mycobacterium microti Mycobacterium phlei, Mycobacterium smegmatis, Mycobacterium tuberculosis, Mycoplasma fermentans, Mycoplasma genitalium, Mycoplasma hominis,
- Mycoplasma penetrans Mycoplasma pneumonia, Neisseria gonorrhoeae, Neisseria
- Pasteurella multocida Pasteurella multocida
- Pasteurella tularensis Porphyromonas gingivalis
- Prevotella melaninogenica (Bacteroides melaninogenicus), Propionibacterium acnes, Proteus mirabillis, Proteus vulgaris, Providencia stuartii, Pseudomonas aeruginosa, Pseudomonas otitidis, Rhizobium radiobacter, Rickettsia prowazekii, Rickettsia psittaci, Rickettsia quintana, Rickettsia rickettsia, Rickettsia trachomae, Rochalimaea henselae, Rochalimaea Quintana, Rothia dentocariosa, Salmonella enteritidis, Salmonella typhi, Salmonella typhimurium, Serratia marcescens, Shigella dysenteriae, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus, St
- Streptococcus pneumoniae Streptococcus pyogenes, Streptococcus rattus, Streptococcus salivarius, Streptococcus sanguis, Streptococcus sobrinus, Streptococcus viridans, Treponema pallidum, Treponema denticola, Vibrio cholera, Vibrio comma, Vibrio parahaemolyticus, Vibrio vulnificus, Wolbachia, Yersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis, Aspergillus fumigatus, Aspergillus flavus, Aspergillus clavatus, Aspergillus niger, Aspergillus terreus, Candida albicans, Candida glabrata, Candida tropicalis, Candida krusei, Candida dubliniensis, Candida parapsilosis, Fusarium sol
- Embodiment 155 The nucleic acid carrier of embodiment 153, wherein the antigen is from Mycobacterium tuberculosis, Varicella zoster virus, Corynebacterium diphtheria, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Haemophilis influenza, Human Papillomavirus, Influenza virus, Japanese Encephalitis virus, Measles virus, Neisseria meningitidis, Mumps virus, Bordetella pertussis, Streptococcus pneumonia, Poliovirus, Rabies virus, Rotavirus, Rubella virus, Herpes Zoster virus, Clostridium tetani, Salmonella typhi, Yellow Fever virus, Ebola virus, avian flu virus, Bacillus anthracis, Smallpox virus, or Zika virus.
- the antigen is from Mycobacterium tuberculosis, Varicella zoster virus, Corynebacterium diphtheria,
- Embodiment 156 The nucleic acid carrier of embodiment 150, wherein the antibody fragment is Fab, F(ab') 2 , scFv, tandem scFv, a BiTE, single domain (sdAb) antibody, diabody, single chain diabody, minibody, fusion protein, or scFv-Fc.
- the antibody fragment is Fab, F(ab') 2 , scFv, tandem scFv, a BiTE, single domain (sdAb) antibody, diabody, single chain diabody, minibody, fusion protein, or scFv-Fc.
- Embodiment 157 The nucleic acid carrier of embodiment 150, wherein the antibody, or fragment thereof, is directed to a disease-associated antigen.
- Embodiment 158 The nucleic acid carrier of embodiment 157, wherein the disease- associated antigen is a tumor-associated antigen.
- Embodiment 159 The nucleic acid carrier of embodiment 158, wherein the tumor- associated antigen is 4-1BB, 5AC, 5T4, A2aR, activin receptor-like kinase 1, AGS-22M6,
- AKAP4 alpha-fetoprotein, angiopoietin 2, B7-H3, BAFF, BAGE, BCR-ABL, BORIS, CA-125, CA19-9, C242 antigen, carbonic anhydrase 9 (CA-IX), CCR4, CD 19, CD20, CD22, CD23 (IgE receptor), CD24, CD28, CD30 (T FRSF8), CD33, CD37, CD38 (cyclic ADP ribose hydrolase), CD40, CD44 v6, CD51, CD56, CD70, CD71, CD73, CD74, CD79B, CD80, CD137, CD140a, CD152, CD200, CD221, CD274, CEA, ch4D5, CLDN18.2, CS1, CSF1R, CTLA-4, C-X-C chemokine receptor type 4, DLL4, DR5, EBAG9, EGF, EGFR, EGFL7, EpCAM, ERBB2, ERBB3, FAP, fibronectin
- Embodiment 160 The nucleic acid carrier of embodiment 158, wherein the tumor- associated antigen is HER-2, EGFR, CD30, CD20, EpCAM, NG2, CD19, CEA, MUC-1, CA19- 9, OCAA, MAPG, TAM, TLR, CD71, ERBB2, VEGF, or glioma.
- the tumor- associated antigen is HER-2, EGFR, CD30, CD20, EpCAM, NG2, CD19, CEA, MUC-1, CA19- 9, OCAA, MAPG, TAM, TLR, CD71, ERBB2, VEGF, or glioma.
- Embodiment 161 The nucleic acid carrier of embodiment 157, wherein the disease- associated antigen is l-40-P-amyloid , AOC3 (VAP-1), ACVR2B, angiopoietin 3, beta-amyloid, C5, CCL11 (eotaxin-1), CCR5, CD2, CD3, CD4, CD5, CD11, CD18, CD20, CD23 (IgE receptor), CD25 (a chain of IL-2 receptor), CD28, CD41 (integrin alpha-lib), CD52, CD125, CD147 (basigin), CD154 (CD40L), CEA-related antigen, clumping factor A, endotoxin, GMCSF receptor a-chain, growth differentiation factor 8, hemagglutinin, HNGF, Hsp90, IGHE, IgE Fc region, IL- ⁇ , IL-4, IL-5, IL-6, IL-9, IL-12, IL-13, IL-17, IL-17A, IL-20, IL
- Embodiment 162 The nucleic acid carrier of embodiment 150, wherein the antibody, or fragment thereof, is directed to a cell surface marker.
- Embodiment 163. The nucleic acid carrier of embodiment 162, wherein the cell surface marker is on an immune cell.
- Embodiment 164 The nucleic acid carrier of embodiment 163, wherein the immune cell is a T cell, B cell, K cell, macrophage, TIL, dendritic cell, neutrophil, eosinophil, basophil, or mast cell.
- the immune cell is a T cell, B cell, K cell, macrophage, TIL, dendritic cell, neutrophil, eosinophil, basophil, or mast cell.
- Embodiment 165 The nucleic acid carrier of embodiment 164, wherein the T cell is a CD4 + T cell, CD8 + T cell, helper T cell, cytotoxic T cell, or natural killer T cell; and wherein the B cell is a memory B cell or a plasma cell.
- Embodiment 166 The nucleic acid carrier of embodiment 162, wherein the cell surface marker is CD36, CD68, CD83, CD180, CD206 (MRC1- mannose receptor), F4/80 (EGF-TM7 family), CD205, CD56, CD161, CD94: KG2 heterodimer, KIR/CD158 family, CD335, CD64, CD16, CD3, CD28, CD4, CD25, CD39, Toll-like receptors (TLRs), CD281, CD283, CD284, CD286, CD289, CD282, C-type lectin receptors (CLRs), Fc Receptor, or HSG.
- the cell surface marker is CD36, CD68, CD83, CD180, CD206 (MRC1- mannose receptor), F4/80 (EGF-TM7 family), CD205, CD56, CD161, CD94: KG2 heterodimer, KIR/CD158 family, CD335, CD64, CD16, CD3, CD28, CD4, CD25, CD39, Toll-like receptor
- Embodiment 167 The nucleic acid carrier of embodiment 150, comprising one or two of the following:
- first targeting agent which is an antibody, or fragment thereof, directed to FIER2
- second targeting agent which is an antibody, or fragment thereof, directed to CD64
- first targeting agent which is an antibody, or fragment thereof, directed to EGFR and a second targeting agent which is an antibody, or fragment thereof, directed to CD64;
- first targeting agent which is an antibody, or fragment thereof, directed to EGFR and a second targeting agent which is an antibody, or fragment thereof, directed to PD-1;
- first targeting agent which is an antibody, or fragment thereof, directed to PD-L1
- second targeting agent which is an antibody, or fragment thereof, directed to OX40
- first targeting agent which is an antibody, or fragment thereof, directed to CD30 and a second targeting agent which is an antibody, or fragment thereof, directed to CD 16;
- first targeting agent which is an antibody, or fragment thereof, directed to FIER2
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to CD20 and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to EpCAM
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to NG2 and a second targeting agent which is an antibody, or fragment thereof, directed to CD28; a first targeting agent which is an antibody, or fragment thereof, directed to CD 19 and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to CD 19 and a second targeting agent which is an antibody, or fragment thereof, directed to CD 16;
- first targeting agent which is an antibody, or fragment thereof, directed to CEA
- second targeting agent which is an antibody, or fragment thereof, directed to HSG
- first targeting agent which is an antibody, or fragment thereof, directed to MUC-1
- second targeting agent which is an antibody, or fragment thereof, directed to HSG
- first targeting agent which is an antibody, or fragment thereof, directed to CA19-9 and a second targeting agent which is an antibody, or fragment thereof, directed to CD3;
- first targeting agent which is an antibody, or fragment thereof, directed to CEA
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to OCAA
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is an antibody, or fragment thereof, directed to MAPG and a second targeting agent which is an antibody, or fragment thereof, directed to CD28;
- first targeting agent which is an antibody, or fragment thereof, directed to HER2
- second targeting agent which is an antibody, or fragment thereof, directed to CD 16
- first targeting agent which is an antibody, or fragment thereof, directed to glioma
- second targeting agent which is an antibody, or fragment thereof, directed to CD3
- first targeting agent which is folic acid or folic acid receptor and a second targeting agent which is an antibody, or fragment thereof, directed to CD3 or CD 16;
- first targeting agent which is an antibody, or fragment thereof, directed to PD-1
- second targeting agent which is an antibody, or fragment thereof, directed to PDL-1 or PDL-2.
- Embodiment 168 The nucleic acid carrier of embodiment 150, wherein the label is a chemiluminescent agent, a fluorescent agent, an infrared dye, a radiolabel agent, a metal, a chelating agent, a hapten, or a gene or mRNA encoding a detectable protein.
- the label is a chemiluminescent agent, a fluorescent agent, an infrared dye, a radiolabel agent, a metal, a chelating agent, a hapten, or a gene or mRNA encoding a detectable protein.
- Embodiment 169 The nucleic acid carrier of embodiment 150, wherein the adjuvant is one or more of a CpG containing oligonucleotide, a ssRNA, a dsRNA, a monophosphate lipid, aluminum, squalene, 3-deacyl-monophosphoryl lipid A, vitamin E, surfactant polysorbate 80, mannide-mono-oleate, SLAG-3, or a galactosylceramide.
- the adjuvant is one or more of a CpG containing oligonucleotide, a ssRNA, a dsRNA, a monophosphate lipid, aluminum, squalene, 3-deacyl-monophosphoryl lipid A, vitamin E, surfactant polysorbate 80, mannide-mono-oleate, SLAG-3, or a galactosylceramide.
- Embodiment 170 The nucleic acid carrier of embodiment 169, wherein the CpG containing oligonucleotide is ODN 1585, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2216, ODN 2336, ODN 2395, ODN M362, AT-ODN-1, AT-ODN-2, ODNBW006, ODN 2088, ODN 4084, ODN INH-1, ODN INH-47, ODN TTAGGG, or G-ODN.
- the CpG containing oligonucleotide is ODN 1585, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2216, ODN 2336, ODN 2395, ODN M362, AT-ODN-1, AT-ODN-2, ODNBW006, ODN 2088, ODN 4084, ODN INH-1, ODN INH-47, ODN TTAGGG, or G-ODN.
- Embodiment 171 The nucleic acid carrier of embodiment 150, wherein the RNA molecule is siRNA, miRNA, mRNA, snRNA, dsRNA, ncRNA, snoRNA, or an aptamer.
- Embodiment 172 The nucleic acid carrier of any one of embodiments 134 to 149, wherein the targeting agent is an antigen, an antibody, or a fragment of an antibody, and the oligonucleotide linker conjugating the targeting moiety to the at least one terminal arm is a CpG containing oligonucleotide.
- Embodiment 173 The nucleic acid carrier of any one of embodiments 1 to 172, wherein the nucleic acid carrier is cross-linked by a cross-linking agent.
- Embodiment 174 The nucleic acid carrier of embodiment 173, wherein the cross- linking agent is mitomycin C, daunamycin, ethidium diazide, cisplatin, an EDC-type compound, or a psoralen.
- the cross- linking agent is mitomycin C, daunamycin, ethidium diazide, cisplatin, an EDC-type compound, or a psoralen.
- Embodiment 175. The nucleic acid carrier of embodiment 174, wherein the psoralen is 8-methoxy psoralen, 4,5',8-trimethylpsoralen, 4'-hydroxymethyl-4,5',trimethyl psoralen, 4'- methoxymethyl-4,5',8-trimethyl psoralen, 4'N-phthalimidomethyl-4,5',8-trimethyl psoralen, or 4'-aminomethyl-4,5'-8-trimethyl psoralen hydrochloride.
- the psoralen is 8-methoxy psoralen, 4,5',8-trimethylpsoralen, 4'-hydroxymethyl-4,5',trimethyl psoralen, 4'- methoxymethyl-4,5',8-trimethyl psoralen, 4'N-phthalimidomethyl-4,5',8-trimethyl psoralen, or 4'-aminomethyl-4,5'-8-trimethyl psoralen hydrochloride
- Embodiment 176 A pharmaceutical composition comprising a nucleic acid carrier of any one of embodiments 1 to 175, and a pharmaceutically acceptable vehicle.
- Embodiment 177 A method of making the nucleic acid carrier of embodiment 1 comprising:
- conjugating the at least one targeting agent to the at least one single-stranded arm conjugating the at least one targeting agent to the at least one single-stranded arm.
- Embodiment 178 The method of embodiment 177, further comprising conjugating the at least one targeting agent to an oligonucleotide linker prior to conjugating the at least one targeting agent to the at least one single-stranded arm.
- Embodiment 179 The method of embodiment 178, wherein the at least one targeting agent/oligonucleotide linker is conjugated to the at least one single-stranded arm by hybridizing the oligonucleotide linker portion of the at least one targeting agent/oligonucleotide linker to a complementary nucleotide sequence of the at least one single-stranded arm.
- Embodiment 180 The method of embodiment 177, further comprising conjugating one, two, or three additional targeting agents to other single-stranded arms.
- Embodiment 181 A method of making the double monomer nucleic acid carrier of embodiment 55 comprising: hybridizing the first oligonucleotide to the second oligonucleotide to form a first nucleic acid carrier;
- conjugating the at least one targeting agent to the at least one single-stranded arm conjugating the at least one targeting agent to the at least one single-stranded arm.
- Embodiment 182 The method of embodiment 181, further comprising conjugating the at least one targeting agent to an oligonucleotide linker prior to conjugating the at least one targeting agent to the at least one single-stranded arm.
- Embodiment 183 The method of embodiment 182, wherein the at least one targeting agent/oligonucleotide linker is conjugated to the at least one single-stranded arm by hybridizing the oligonucleotide linker portion of the at least one targeting agent/oligonucleotide linker to a complementary nucleotide sequence of the at least one single-stranded arm.
- Embodiment 184 The method of embodiment 181, further comprising conjugating one, two, three, four, or five additional targeting agents to other single-stranded arms.
- Embodiment 185 A method of making the trimer nucleic acid carrier of embodiment 94 comprising:
- Embodiment 186 The method of embodiment 185, further comprising conjugating each targeting agent to an oligonucleotide linker prior to conjugating the targeting agents to the terminal arms.
- Embodiment 187 The method of embodiment 186, wherein each targeting
- a method of making the nucleic acid carrier of embodiment 134 comprising:
- Embodiment 189 The method of embodiment 188, further comprising conjugating each targeting agent to an oligonucleotide linker prior to conjugating the targeting agents to the terminal arms.
- Embodiment 190 The method of embodiment 189, wherein each targeting
- agent/oligonucleotide linker is conjugated to the terminal arm by hybridizing the oligonucleotide linker portion of the targeting agent/oligonucleotide linker to a complementary nucleotide sequence of the terminal arm.
- Embodiment 191 A method of inducing an immune response in a mammal comprising administering to the mammal a nucleic acid carrier of any one of embodiments 1 to 175, or a pharmaceutical composition comprising a nucleic acid carrier of any one of embodiments 1 to 175, wherein the nucleic acid carrier comprises at least two targeting agents chosen from an antigen, a peptide, an antibody or fragment thereof, and an adjuvant.
- Embodiment 192 The method of embodiment 191, wherein the antigen is from
- Acetobacter aurantius Acinetobacter baumannii, Acinetobacter calcoaceticus, Acinetobacter haemolyticus, Acinetobacter junii, Acinetobacter Iwoffii, Actinomyces israelii, Actinomyces viscosus, Aggregatibacter actinomycetemcomitans, Agrobacterium radiobacter, Agrobacterium tumefaciens, Azorhizobium caulinodans, Azotobacter vinelandii, Anaplasma phagocytophilum, Bacillus anthracis, Bacillus brevis, Bacillus cereus, Bacillus fusiformis, Bacillus licheniformis, Bacillus megaterium, Bacillus mycoides, Bacillus stearothermophilus, Bacillus subtilis, Bacteroides gingivalis, Bacteroides fragilis, Bacteroides melaninogenicus (Prevotella melaninogenicd), Bartonell
- Bordetella pertussis Borrelia burgdorferi, Brucella abortus, Brucella melitensis, Brucella suis, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia, Calymmatobacterium granulomatis, Campylobacter coli, Campylobacter fetus, Campylobacter jejuni, Campylobacter pylori, Chlamydia trachomatis, Chlamydophila pneumoniae ⁇ Chlamydia pneumoniae),
- Haemophilus influenza Haemophilus aegyptius, Helicobacter pylori, Klebsiella pneumonia, Klebsiella oxytoca, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus casei, Lactococcus lactis, Legionella pneumophila, Listeria monocytogenes, Methanobacterium extroquens, Microbacterium multiforme, Micrococcus luteus, Moraxella lacunata, Moraxella catarrhalis, Morganella morganii, Mycobacterium avium, Mycobacterium africanum,
- Mycobacterium bovis Mycobacterium canetti, Mycobacterium diphtheria, Mycobacterium intracellulare, Mycobacterium leprae, Mycobacterium lepraemurium, Mycobacterium microti, Mycobacterium phlei, Mycobacterium smegmatis, Mycobacterium tuberculosis, Mycoplasma fermentans, Mycoplasma genitalium, Mycoplasma hominis, Mycoplasma penetrans,
- Mycoplasma pneumonia Neisseria gonorrhoeae, Neisseria meningitides, Pasteurella multocida, Pasteurella tularensis, Porphyromonas gingivalis, Prevotella melaninogenica (Bacteroides melaninogenicus), Propionibacterium acnes, Proteus mirabillis, Proteus vulgaris, Providencia stuartii, Pseudomonas aeruginosa, Pseudomonas otitidis, Rhizobium radiobacter, Rickettsia prowazekii, Rickettsia psittaci, Rickettsia quintana, Rickettsia rickettsia, Rickettsia trachomae, Rochalimaea henselae, Rochalimaea Quintana, Rothia dentocariosa, Salmonella enteritidis,
- Staphylococcus aureus methicillin-resistant Staphylococcus aureus, Staphylococcus
- Streptococcus rattus Streptococcus salivarius, Streptococcus sanguis, Streptococcus sobrinus, Streptococcus viridans, Treponema pallidum, Treponema denticola, Vibrio cholera, Vibrio comma, Vibrio parahaemolyticus, Vibrio vulnificus, Wolbachia, Yersinia enter ocolitica, Yersinia pestis, Yersinia pseudotuberculosis, Aspergillus fumigatus, Aspergillus flavus, Aspergillus clavatus, Aspergillus niger, Aspergillus terreus, Candida albicans, Candida glabrata, Candida tropicalis, Candida krusei, Candida dubliniensis, Candida parapsilosis, Fusarium solani, Fusarium moniliforme, Fusarium proliferartum
- Embodiment 193 The method of embodiment 191, wherein the antigen is an antigen from Mycobacterium tuberculosis, Varicella zoster virus, Corynebacterium diphtheria, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Haemophilis influenza, Human Papillomavirus, Influenza virus, Japanese Encephalitis virus, Measles virus, Neisseria meningitidis, Mumps virus, Bordetella pertussis, Streptococcus pneumonia, Poliovirus, Rabies virus, Rotavirus, Rubella virus, Herpes Zoster virus, Clostridium tetani, Salmonella typhi, Yellow Fever virus, Ebola virus, avian flu virus, Bacillus anthracis, Smallpox virus, or Zika virus.
- the antigen is an antigen from Mycobacterium tuberculosis, Varicella zoster virus, Corynebacterium diphtheria
- Embodiment 194 The method of any one of embodiments 191 to 193, wherein the antibody fragment is Fab, F(ab') 2 , scFv, tandem scFv, a BiTE, single domain (sdAb) antibody, diabody, single chain diabody, minibody, fusion protein, or scFv-Fc.
- the antibody fragment is Fab, F(ab') 2 , scFv, tandem scFv, a BiTE, single domain (sdAb) antibody, diabody, single chain diabody, minibody, fusion protein, or scFv-Fc.
- Embodiment 195 The method of any one of embodiments 191 to 194, wherein the antibody, or fragment thereof, is directed to a cell surface marker.
- Embodiment 196 The method of embodiment 195, wherein the cell surface marker is on an immune cell.
- Embodiment 197 The method of embodiment 196, wherein the immune cell is a T cell,
- B cell B cell, NK cell, macrophage, TIL, dendritic cell, neutrophil, eosinophil, basophil, or mast cell.
- Embodiment 198 The method of embodiment 197, wherein the T cell is a CD4 + T cell, CD8 + T cell, helper T cell, cytotoxic T cell, or natural killer T cell; and wherein the B cell is a memory B cell or a plasma cell.
- Embodiment 199 The method of embodiment 195, wherein the cell surface marker is
- TLRs Toll-like receptors
- CLRs C-type lectin receptors
- Embodiment 200 The method of any one of embodiments 191 to 199, wherein the adjuvant is one or more of a CpG containing oligonucleotide, a ssRNA, a dsRNA, a
- Embodiment 201 The method of embodiment 200, wherein the CpG containing oligonucleotide is ODN 1585, ODN 1668, ODN 1826, ODN 2006, ODN 2007, ODN 2216,
- Embodiment 202 The method of any one of embodiments 191 to 201, wherein the oligonucleotide linker conjugating the targeting moiety to the terminal arm is a CpG containing oligonucleotide.
- Embodiment 203 A method of treating a mammal having cancer comprising administering to the mammal a nucleic acid carrier of any one of embodiments 1 to 175, or a pharmaceutical composition comprising a nucleic acid carrier of any one of embodiments 1 to 175, wherein the nucleic acid carrier comprises at least two targeting agents chosen from an antibody, or fragment thereof, and a label.
- Embodiment 204 The method of embodiment 203, wherein the antibody fragment is Fab, F(ab') 2 , scFv, tandem scFv, a BiTE, single domain (sdAb) antibody, diabody, single chain diabody, minibody, fusion protein, or scFv-Fc.
- the antibody fragment is Fab, F(ab') 2 , scFv, tandem scFv, a BiTE, single domain (sdAb) antibody, diabody, single chain diabody, minibody, fusion protein, or scFv-Fc.
- Embodiment 205 The method of embodiment 203 or embodiment 204, wherein a first antibody, or fragment thereof, is directed to a tumor-associated antigen.
- Embodiment 206 The method of embodiment 205, wherein the tumor-associated antigen is 4- IBB, 5 AC, 5T4, A2aR, activin receptor-like kinase 1, AGS-22M6, AKAP4, alpha- fetoprotein, angiopoietin 2, B7-H3, BAFF, BAGE, BCR-ABL, BORIS, CA-125, CA19-9, C242 antigen, carbonic anhydrase 9 (CA-IX), CCR4, CD 19, CD20, CD22, CD23 (IgE receptor), CD24, CD28, CD30 (T FRSF8), CD33, CD37, CD38 (cyclic ADP ribose hydrolase), CD40, CD44 v6, CD51, CD56, CD70, CD71, CD73, CD74, CD79B, CD80, CD137, CD140a, CD152, CD200, CD221, CD274, CEA, ch4D5, CLDN18.2, CS1, CSF1R, CTLA-4
- Embodiment 207 The method of embodiment 205, wherein the tumor-associated antigen is HER-2, EGFR, CD30, CD20, EpCAM, NG2, CD19, CEA, MUC-1, CA19-9, OCAA, MAPG, or glioma.
- Embodiment 208 The method of any one of embodiments 203 to 207, wherein a second antibody, or fragment thereof, is directed to a cell surface marker.
- Embodiment 209 The method of embodiment 208, wherein the cell surface marker is on an immune cell.
- Embodiment 210 The method of embodiment 209, wherein the immune cell is a T cell,
- B cell K cell, macrophage, TIL, dendritic cell, neutrophil, eosinophil, basophil, or mast cell.
- Embodiment 211 The method of embodiment 210, wherein the T cell is a CD4 + T cell,
- CD8 + T cell helper T cell, cytotoxic T cell, or natural killer T cell; and wherein the B cell is a memory B cell or a plasma cell.
- Embodiment 212 The method of embodiment 208, wherein the cell surface marker is
- CD289 CD282, C-type lectin receptors (CLRs), Fc Receptor, or HSG.
- CLRs C-type lectin receptors
- Fc Receptor Fc Receptor
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Epidemiology (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Inorganic Chemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Urology & Nephrology (AREA)
- Endocrinology (AREA)
- Reproductive Health (AREA)
- Dermatology (AREA)
- Cell Biology (AREA)
- Pulmonology (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2017220012A AU2017220012B2 (en) | 2016-02-19 | 2017-02-17 | Nucleic acid carriers and therapeutic methods of use |
| US15/999,774 US12338435B2 (en) | 2016-02-19 | 2017-02-17 | Nucleic acid carriers and therapeutic methods of use |
| JP2018543674A JP7366541B2 (ja) | 2016-02-19 | 2017-02-17 | 核酸キャリア及び治療上の使用方法 |
| IL260983A IL260983B (en) | 2016-02-19 | 2017-02-17 | Nucleic acid carriers and methods of medical use |
| EP17753899.8A EP3416671A4 (en) | 2016-02-19 | 2017-02-17 | NUCLEIC ACID CARRIER AND THERAPEUTIC METHODS OF USE |
| JP2022001374A JP2022050550A (ja) | 2016-02-19 | 2022-01-07 | 核酸キャリア及び治療上の使用方法 |
| US17/836,304 US20230136794A1 (en) | 2016-02-19 | 2022-06-09 | Nucleic Acid Carriers And Therapeutic Methods Of Use |
| AU2024202345A AU2024202345B2 (en) | 2016-02-19 | 2024-04-11 | Nucleic acid carriers and therapeutic methods of use |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662297194P | 2016-02-19 | 2016-02-19 | |
| US62/297,194 | 2016-02-19 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/999,774 A-371-Of-International US12338435B2 (en) | 2016-02-19 | 2017-02-17 | Nucleic acid carriers and therapeutic methods of use |
| US17/836,304 Division US20230136794A1 (en) | 2016-02-19 | 2022-06-09 | Nucleic Acid Carriers And Therapeutic Methods Of Use |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017143156A1 true WO2017143156A1 (en) | 2017-08-24 |
Family
ID=59625528
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/018323 Ceased WO2017143156A1 (en) | 2016-02-19 | 2017-02-17 | Nucleic acid carriers and therapeutic methods of use |
Country Status (6)
| Country | Link |
|---|---|
| US (2) | US12338435B2 (https=) |
| EP (1) | EP3416671A4 (https=) |
| JP (2) | JP7366541B2 (https=) |
| AU (2) | AU2017220012B2 (https=) |
| IL (1) | IL260983B (https=) |
| WO (1) | WO2017143156A1 (https=) |
Cited By (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019166877A1 (en) | 2018-03-02 | 2019-09-06 | Sixfold Bioscience Ltd. | Compositions for delivery of cargo to cells |
| WO2020056341A2 (en) | 2018-09-14 | 2020-03-19 | Northwestern University | Programming protein polymerization with dna |
| CN111196855A (zh) * | 2018-11-19 | 2020-05-26 | 三生国健药业(上海)股份有限公司 | 抗egfr/pd-1双特异性抗体 |
| JP2020519696A (ja) * | 2017-05-09 | 2020-07-02 | アッセンブリー メディシン, エルエルシー.Assembly Medicine, Llc. | 多重特異性タンパク質薬物およびそのライブラリー、ならびに製造方法と使用 |
| WO2021027850A1 (en) * | 2019-08-12 | 2021-02-18 | I-Mab Biopharma Co., Ltd. | Anti-claudin 18.2 and anti-4-1bb bispecific antibodies and uses thereof |
| WO2021053405A2 (en) | 2019-08-30 | 2021-03-25 | Sixfold Bioscience Ltd. | Compositions for transfer of cargo to cells |
| WO2021091899A1 (en) | 2019-11-04 | 2021-05-14 | Genisphere, Llc | Brain-specific angiogenesis inhibitor 1 (bai1) antibodies and uses thereof |
| US11111309B2 (en) | 2018-08-02 | 2021-09-07 | Dyne Therapeutics, Inc. | Method of reducing expression of DUX4 in a muscle cell by administering an anti-transferrin receptor antibody linked to an oligonucleotide targeting DUX4 |
| US11168141B2 (en) | 2018-08-02 | 2021-11-09 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11357865B2 (en) | 2020-04-27 | 2022-06-14 | Sixfold Bioscience Ltd. | Compositions containing nucleic acid nanoparticles with modular functionality |
| US11369689B2 (en) | 2018-08-02 | 2022-06-28 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11633498B2 (en) | 2021-07-09 | 2023-04-25 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating myotonic dystrophy |
| US11638761B2 (en) | 2021-07-09 | 2023-05-02 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating Facioscapulohumeral muscular dystrophy |
| US11648318B2 (en) | 2021-07-09 | 2023-05-16 | Dyne Therapeutics, Inc. | Anti-transferrin receptor (TFR) antibody and uses thereof |
| US11771776B2 (en) | 2021-07-09 | 2023-10-03 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11911484B2 (en) | 2018-08-02 | 2024-02-27 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating myotonic dystrophy |
| US11931421B2 (en) | 2022-04-15 | 2024-03-19 | Dyne Therapeutics, Inc. | Muscle targeting complexes and formulations for treating myotonic dystrophy |
| US11969475B2 (en) | 2021-07-09 | 2024-04-30 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy |
| US12018087B2 (en) | 2018-08-02 | 2024-06-25 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of delivering oligonucleotide to a subject |
| US12097263B2 (en) | 2018-08-02 | 2024-09-24 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating myotonic dystrophy |
| US12128109B2 (en) | 2021-07-09 | 2024-10-29 | Dyne Therapeutics, Inc. | Muscle targeting complexes and formulations for treating dystrophinopathies |
| US12338435B2 (en) | 2016-02-19 | 2025-06-24 | Code Biotherapeutics, Inc. | Nucleic acid carriers and therapeutic methods of use |
| US12370264B1 (en) | 2018-08-02 | 2025-07-29 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of delivering oligonucleotide to a subject |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2017221437A1 (en) * | 2016-02-19 | 2018-08-23 | Genisphere Llc | Nucleic acid carriers and therapeutic methods of use |
| JP6871948B2 (ja) | 2016-04-27 | 2021-05-19 | アッヴィ・インコーポレイテッド | 抗il−13抗体を使用する、il−13活性が有害である疾患の治療方法 |
| CN115177740A (zh) * | 2021-04-01 | 2022-10-14 | 安升(上海)医药科技有限公司 | 核酸自组装介导的adc药物的构建方法及应用 |
| WO2025240771A1 (en) * | 2024-05-16 | 2025-11-20 | Curadel Surgical Innovations, Inc. | Small zwitterionic multimeric targeted drugs and methods of use and manufacture thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008147526A1 (en) * | 2007-05-23 | 2008-12-04 | The Trustees Of The University Of Pennsylvania | Targeted carriers for intracellular drug delivery |
| US20090011956A1 (en) * | 2007-05-16 | 2009-01-08 | Peng Yin | Versatile nucleic acid hairpin motif for programming biomolecular self-assembly pathways |
| US20120122800A1 (en) * | 2008-08-08 | 2012-05-17 | Genisphere, LLC Hatfield, Pennsylvania | Long-Acting DNA Dendrimers and Methods Thereof |
| US20140212503A1 (en) * | 2011-03-17 | 2014-07-31 | Hyukjin Lee | Delivery system |
| WO2014121050A1 (en) * | 2013-02-01 | 2014-08-07 | Genisphere, Llc | Functionalized dna dendrimers for gene delivery to cells |
| WO2015077891A1 (en) * | 2013-11-27 | 2015-06-04 | Zymeworks Inc. | Bispecific antigen-binding constructs targeting her2 |
Family Cites Families (170)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| NL154600B (nl) | 1971-02-10 | 1977-09-15 | Organon Nv | Werkwijze voor het aantonen en bepalen van specifiek bindende eiwitten en hun corresponderende bindbare stoffen. |
| US3641235A (en) | 1968-11-01 | 1972-02-08 | Miles Lab | Immunological reagent and process for making same |
| NL154598B (nl) | 1970-11-10 | 1977-09-15 | Organon Nv | Werkwijze voor het aantonen en bepalen van laagmoleculire verbindingen en van eiwitten die deze verbindingen specifiek kunnen binden, alsmede testverpakking. |
| NL154599B (nl) | 1970-12-28 | 1977-09-15 | Organon Nv | Werkwijze voor het aantonen en bepalen van specifiek bindende eiwitten en hun corresponderende bindbare stoffen, alsmede testverpakking. |
| US3901654A (en) | 1971-06-21 | 1975-08-26 | Biological Developments | Receptor assays of biologically active compounds employing biologically specific receptors |
| US3853987A (en) | 1971-09-01 | 1974-12-10 | W Dreyer | Immunological reagent and radioimmuno assay |
| US3867517A (en) | 1971-12-21 | 1975-02-18 | Abbott Lab | Direct radioimmunoassay for antigens and their antibodies |
| NL171930C (nl) | 1972-05-11 | 1983-06-01 | Akzo Nv | Werkwijze voor het aantonen en bepalen van haptenen, alsmede testverpakkingen. |
| US3850578A (en) | 1973-03-12 | 1974-11-26 | H Mcconnell | Process for assaying for biologically active molecules |
| US3966897A (en) | 1973-04-02 | 1976-06-29 | Marine Colloids, Inc. | Medium for use in bioassay and method of using same |
| US3959078A (en) | 1973-05-18 | 1976-05-25 | Midwest Research Institute | Enzyme immobilization with a thermochemical-photochemical bifunctional agent |
| US3935074A (en) | 1973-12-17 | 1976-01-27 | Syva Company | Antibody steric hindrance immunoassay with two antibodies |
| US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
| US4034074A (en) | 1974-09-19 | 1977-07-05 | The Board Of Trustees Of Leland Stanford Junior University | Universal reagent 2-site immunoradiometric assay using labelled anti (IgG) |
| SE388694B (sv) | 1975-01-27 | 1976-10-11 | Kabi Ab | Sett att pavisa ett antigen exv i prov av kroppvetskor, med utnyttjande av till porost berarmaterial bundna eller adsorberande antikroppar |
| US3984533A (en) | 1975-11-13 | 1976-10-05 | General Electric Company | Electrophoretic method of detecting antigen-antibody reaction |
| IL52322A (en) | 1976-06-18 | 1980-10-26 | Alfa Laval Ab | Method of making reagent test device and device made accorording to this method |
| US4094647A (en) | 1976-07-02 | 1978-06-13 | Thyroid Diagnostics, Inc. | Test device |
| US4196281A (en) | 1976-10-20 | 1980-04-01 | Regents Of The University Of California | Psoralens |
| US4098876A (en) | 1976-10-26 | 1978-07-04 | Corning Glass Works | Reverse sandwich immunoassay |
| US4299916A (en) | 1979-12-26 | 1981-11-10 | Syva Company | Preferential signal production on a surface in immunoassays |
| US4391904A (en) | 1979-12-26 | 1983-07-05 | Syva Company | Test strip kits in immunoassays and compositions therein |
| US4347312A (en) | 1980-03-20 | 1982-08-31 | Research Triangle Institute | Detection of antibiotics in milk |
| US4366241A (en) | 1980-08-07 | 1982-12-28 | Syva Company | Concentrating zone method in heterogeneous immunoassays |
| US4879219A (en) | 1980-09-19 | 1989-11-07 | General Hospital Corporation | Immunoassay utilizing monoclonal high affinity IgM antibodies |
| US4517288A (en) | 1981-01-23 | 1985-05-14 | American Hospital Supply Corp. | Solid phase system for ligand assay |
| US4425438A (en) | 1981-03-13 | 1984-01-10 | Bauman David S | Assay method and device |
| US5141875A (en) | 1982-01-08 | 1992-08-25 | Environmental Diagnostics, Inc. | Rotary fluid manipulator |
| US5073484A (en) | 1982-03-09 | 1991-12-17 | Bio-Metric Systems, Inc. | Quantitative analysis apparatus and method |
| DE3327642A1 (de) | 1983-07-30 | 1985-02-14 | Boehringer Mannheim Gmbh, 6800 Mannheim | Verfahren zur bestimmung eines partners einer immunreaktion sowie reagens zur durchfuehrung dieses verfahrens |
| DE3484505D1 (de) | 1983-12-19 | 1991-05-29 | Daiichi Pure Chemicals Co Ltd | Immuntest. |
| US4703017C1 (en) | 1984-02-14 | 2001-12-04 | Becton Dickinson Co | Solid phase assay with visual readout |
| US4695554A (en) | 1984-02-14 | 1987-09-22 | Becton Dickinson And Company | Sac or liposome containing dye (sulforhodamine) for immunoassay |
| US4743560A (en) | 1984-03-26 | 1988-05-10 | Becton Dickinson And Company | Solid phase assay |
| US5011771A (en) | 1984-04-12 | 1991-04-30 | The General Hospital Corporation | Multiepitopic immunometric assay |
| US4666828A (en) | 1984-08-15 | 1987-05-19 | The General Hospital Corporation | Test for Huntington's disease |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4801531A (en) | 1985-04-17 | 1989-01-31 | Biotechnology Research Partners, Ltd. | Apo AI/CIII genomic polymorphisms predictive of atherosclerosis |
| DE3689123T2 (de) | 1985-11-01 | 1994-03-03 | Xoma Corp | Modulare einheit von antikörpergenen, daraus hergestellte antikörper und verwendung. |
| US5514602A (en) | 1986-06-09 | 1996-05-07 | Ortho Diagnostic Systems, Inc. | Method of producing a metal sol reagent containing colloidal metal particles |
| AU602694B2 (en) | 1986-06-09 | 1990-10-25 | Ortho Diagnostic Systems Inc. | Improved colloidal gold membrane assay |
| US5175270A (en) | 1986-09-10 | 1992-12-29 | Polyprobe, Inc. | Reagents for detecting and assaying nucleic acid sequences |
| US4960691A (en) | 1986-09-29 | 1990-10-02 | Abbott Laboratories | Chromatographic test strip for determining ligands or receptors |
| USRE38430E1 (en) | 1987-03-27 | 2004-02-17 | Becton, Dickinson And Company | Solid phase chromatographic immunoassay |
| CA1303983C (en) | 1987-03-27 | 1992-06-23 | Robert W. Rosenstein | Solid phase assay |
| US4857453A (en) | 1987-04-07 | 1989-08-15 | Syntex (U.S.A.) Inc. | Immunoassay device |
| DE3856421T2 (de) | 1987-04-27 | 2000-12-14 | Unilever Nv | Spezifische Bindungstestverfahren |
| US5120643A (en) | 1987-07-13 | 1992-06-09 | Abbott Laboratories | Process for immunochromatography with colloidal particles |
| US4956302A (en) | 1987-09-11 | 1990-09-11 | Abbott Laboratories | Lateral flow chromatographic binding assay device |
| US5275785A (en) | 1987-10-30 | 1994-01-04 | Unilever Patent Holdings B.V. | Test device for detecting an analyte in a liquid sample |
| CA1312544C (en) | 1987-12-21 | 1993-01-12 | James L. Wilcox | Chromatographic binding assay devices and methods |
| AU2684488A (en) | 1988-06-27 | 1990-01-04 | Carter-Wallace, Inc. | Test device and method for colored particle immunoassay |
| US5272057A (en) | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
| US6352862B1 (en) | 1989-02-17 | 2002-03-05 | Unilever Patent Holdings B.V. | Analytical test device for imuno assays and methods of using same |
| ATE118824T1 (de) | 1989-03-10 | 1995-03-15 | Amoco Corp | Immobilisierte oligonukleotidsonden und ihre verwendungen. |
| US5703055A (en) | 1989-03-21 | 1997-12-30 | Wisconsin Alumni Research Foundation | Generation of antibodies through lipid mediated DNA delivery |
| US5168053A (en) | 1989-03-24 | 1992-12-01 | Yale University | Cleavage of targeted RNA by RNAase P |
| US5108921A (en) | 1989-04-03 | 1992-04-28 | Purdue Research Foundation | Method for enhanced transmembrane transport of exogenous molecules |
| DE3920358A1 (de) | 1989-06-22 | 1991-01-17 | Behringwerke Ag | Bispezifische und oligospezifische, mono- und oligovalente antikoerperkonstrukte, ihre herstellung und verwendung |
| US5192659A (en) | 1989-08-25 | 1993-03-09 | Genetype Ag | Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes |
| US5075078A (en) | 1989-10-05 | 1991-12-24 | Abbott Laboratories | Self-performing immunochromatographic device |
| US5252496A (en) | 1989-12-18 | 1993-10-12 | Princeton Biomeditech Corporation | Carbon black immunochemical label |
| KR910014706A (ko) | 1990-01-10 | 1991-08-31 | 원본미기재 | 세척이 필요없는 개량된 이뮤노어세이(immunoassay)장치 |
| US6395492B1 (en) | 1990-01-11 | 2002-05-28 | Isis Pharmaceuticals, Inc. | Derivatized oligonucleotides having improved uptake and other properties |
| ES2061416T3 (es) | 1990-10-12 | 1997-03-01 | Max Planck Gesellschaft | Ribozimas modificadas. |
| US5998220A (en) | 1991-05-29 | 1999-12-07 | Beckman Coulter, Inc. | Opposable-element assay devices, kits, and methods employing them |
| WO1992021769A1 (en) | 1991-05-30 | 1992-12-10 | Abbott Laboratories | Reagents containing a nonspecific binding blocker in ion-capture binding assays |
| US6335434B1 (en) | 1998-06-16 | 2002-01-01 | Isis Pharmaceuticals, Inc., | Nucleosidic and non-nucleosidic folate conjugates |
| ATE207080T1 (de) | 1991-11-25 | 2001-11-15 | Enzon Inc | Multivalente antigen-bindende proteine |
| US5281521A (en) | 1992-07-20 | 1994-01-25 | The Trustees Of The University Of Pennsylvania | Modified avidin-biotin technique |
| FI92882C (fi) | 1992-12-29 | 1995-01-10 | Medix Biochemica Ab Oy | Kertakäyttöinen testiliuska ja menetelmä sen valmistamiseksi |
| ATE247128T1 (de) | 1993-09-03 | 2003-08-15 | Isis Pharmaceuticals Inc | Aminoderivatisierte nukleoside und oligonukleoside |
| ES2145034T3 (es) | 1993-11-12 | 2000-07-01 | Unilever Nv | Dispositivos analiticos y procedimientos para el uso de los mismos. |
| IL112920A (en) | 1994-03-07 | 2003-04-10 | Dow Chemical Co | Composition comprising a dendritic polymer complexed with at least one unit of biological response modifier and a process for the preparation thereof |
| GB9419267D0 (en) | 1994-09-23 | 1994-11-09 | Unilever Plc | Assay devices |
| GB9505425D0 (en) | 1995-03-17 | 1995-05-03 | Unilever Plc | Assay devices |
| US5653979A (en) | 1995-03-30 | 1997-08-05 | Trustees Of The University Of Pennsylvania | Immunotargeting of plasminogen activators to the pulmonary endothelium |
| US6319676B1 (en) | 1995-05-02 | 2001-11-20 | Carter Wallace, Inc. | Diagnostic detection device and method |
| SE9501671D0 (sv) | 1995-05-05 | 1995-05-05 | Pharmacia Ab | Method and composition for prevention of posterior capsule opacification |
| WO1997006439A1 (en) | 1995-08-09 | 1997-02-20 | Quidel Corporation | Test strip and method for one step lateral flow assay |
| US6072043A (en) | 1996-06-04 | 2000-06-06 | Polyprobe, Inc. | Optimally fluorescent oligonucleotides |
| US5846737A (en) | 1996-07-26 | 1998-12-08 | Molecular Probes, Inc. | Conjugates of sulforhodamine fluorophores with enhanced fluorescence |
| US6117631A (en) | 1996-10-29 | 2000-09-12 | Polyprobe, Inc. | Detection of antigens via oligonucleotide antibody conjugates |
| GB2322192B (en) | 1997-02-14 | 2001-01-31 | Unilever Plc | Assay devices |
| US6924153B1 (en) | 1997-03-06 | 2005-08-02 | Quidel Corporation | Quantitative lateral flow assays and devices |
| DE69836482T2 (de) | 1997-07-25 | 2007-09-27 | Agene Research Institute, Co., Ltd., Kamakura | Menschliches recq4 gen, das für eine helikase kodiert |
| WO1999006595A1 (en) * | 1997-07-29 | 1999-02-11 | Polyprobe, Inc. | Dendritic nucleic acids exhibiting maximal self-assembly |
| WO1999040438A1 (en) | 1998-02-03 | 1999-08-12 | Synbiotics Corporation | Device and method to detect immunoprotective antibody titers |
| EP1064026A4 (en) | 1998-03-10 | 2003-04-09 | Univ Pennsylvania | STRENGTHENING INTRA-CELLULAR ADMINISTRATION AND TARGETING SPECIFIC TISSUE OF MEDICINES AND GENES |
| US6287765B1 (en) | 1998-05-20 | 2001-09-11 | Molecular Machines, Inc. | Methods for detecting and identifying single molecules |
| US7041287B2 (en) | 1998-05-21 | 2006-05-09 | Trustees Of The University Of Pennsylvania | Compositions and methods for selective dissolution of nascent intravascular blood clots |
| WO1999059611A1 (en) | 1998-05-21 | 1999-11-25 | The Trustees Of The University Of Pennsylvania | Compositions and methods for prevention and treatment of uncontrolled formation of intravascular fibrin clots |
| AU754117B2 (en) | 1998-08-04 | 2002-11-07 | Louisiana State University And Agricultural And Mechanical College | Targeting and prolonging association of drugs to the luminal surface of the pulmonary vascular endothelial cells |
| US6656730B1 (en) | 1999-06-15 | 2003-12-02 | Isis Pharmaceuticals, Inc. | Oligonucleotides conjugated to protein-binding drugs |
| US7674466B2 (en) | 1999-08-05 | 2010-03-09 | The Trustees Of The University Of Pennsylvania | Targeting and prolonging association of drugs to the luminal surface of the pulmonary vascular endothelial cells using antibodies that bind to ICAM-1 |
| US6822086B1 (en) | 1999-08-09 | 2004-11-23 | The General Hospital Corporation | Drug-carrier complexes and methods of use thereof |
| US6773928B1 (en) | 1999-09-22 | 2004-08-10 | The United States Of America As Represented By The Secretary Of The Army | Compositions and methods for enhancing bioassay performance |
| US6180357B1 (en) | 1999-10-08 | 2001-01-30 | Arius Research, Inc. | Individualized patient-specific anti-cancer antibodies |
| US7491805B2 (en) | 2001-05-18 | 2009-02-17 | Sirna Therapeutics, Inc. | Conjugates and compositions for cellular delivery |
| WO2001071018A2 (en) | 2000-03-22 | 2001-09-27 | Board Of Trustees Of The University Of Arkansas | Secreting products from skin by adeno-associated virus (aav) gene transfer |
| WO2001076641A1 (en) | 2000-04-06 | 2001-10-18 | Lankenau Medical Research Center | Targeted death of cancer cells |
| CA2408830A1 (en) | 2000-05-12 | 2001-11-22 | The Regents Of The University Of California | Treatment of human papillomavirus (hpv)-infected cells |
| DE60130852T2 (de) | 2000-06-12 | 2008-07-17 | Fujirebio Inc. | Immuntest zur Messung des humanen C-Peptides sowie Reagenzienkit hierfür |
| AU2001282920A1 (en) | 2000-07-19 | 2002-01-30 | Genisphere Inc | Methods for detecting and assaying nucleic acid sequences |
| US6770487B2 (en) | 2001-05-01 | 2004-08-03 | Ischemia Technologies, Inc. | Bar code readable diagnostic strip test |
| US20070173473A1 (en) | 2001-05-18 | 2007-07-26 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of proprotein convertase subtilisin Kexin 9 (PCSK9) gene expression using short interfering nucleic acid (siNA) |
| EP2423335B1 (en) * | 2001-06-21 | 2014-05-14 | Dynavax Technologies Corporation | Chimeric immunomodulatory compounds and methods of using the same |
| GR1003966B (el) | 2001-10-16 | 2002-08-06 | Εμβαπτιζομενος χαρτης αποξηραμενων αντιδραστηριων και μεθοδος για την ανιχνευση η και προσδιορισμο ειδικων αλληλουχιων νουκλεικων οξεων | |
| WO2003048736A2 (en) | 2001-12-05 | 2003-06-12 | University Of Washington | Microfluidic device and surface decoration process for solid phase affinity binding assays |
| US20040023248A1 (en) | 2001-12-07 | 2004-02-05 | Whitehead Institiute For Biomedical Research | Methods and reagents for improving nucleic acid detection |
| AU2002357932A1 (en) | 2001-12-18 | 2003-06-30 | Whitehead Institute For Biomedical Research | Fusion partner cells and uses thereof |
| US7175992B2 (en) | 2002-04-10 | 2007-02-13 | Response Biomedical Corporation | Sensitive immunochromatographic assay |
| EP1530581A4 (en) * | 2002-06-12 | 2006-08-30 | Datascope Investment Corp | POLYMERIC MARKING MOLECULES |
| CA2487849A1 (en) | 2002-07-18 | 2004-01-29 | Cytos Biotechnology Ag | Hapten-carrier conjugates comprising virus like particles and uses thereof |
| WO2004035789A1 (en) | 2002-10-18 | 2004-04-29 | Lg Life Sciences Ltd. | Gene families associated with cancers |
| CN1753687A (zh) | 2002-10-29 | 2006-03-29 | 科勒制药集团股份有限公司 | Cpg寡核苷酸在治疗丙型肝炎病毒感染中的应用 |
| AU2003295600A1 (en) | 2002-11-14 | 2004-06-15 | Dharmacon, Inc. | Functional and hyperfunctional sirna |
| CA2502015A1 (en) | 2002-12-11 | 2004-06-24 | Coley Pharmaceutical Group, Inc. | 5' cpg nucleic acids and methods of use |
| CA2512717A1 (en) | 2003-01-09 | 2004-07-29 | Arizeke Pharmaceuticals Inc. | Compositions and methods for targeted biological delivery of molecular carriers |
| BRPI0407446A (pt) | 2003-02-13 | 2006-01-31 | Pharmacia Corp | Anticorpos para c-met para o tratamento de cânceres |
| US20040220084A1 (en) | 2003-05-02 | 2004-11-04 | Jasbir Sandhu | Methods for nucleic acid delivery |
| AU2004238289A1 (en) | 2003-05-09 | 2004-11-25 | The Trustees Of The University Of Pennsylvania | Compositions and methods for treating cancer |
| US7317532B2 (en) | 2003-06-04 | 2008-01-08 | Inverness Medical Switzerland Gmbh | Flow sensing for determination of assay results |
| US7223544B2 (en) | 2003-06-27 | 2007-05-29 | Cornell Research Foundation, Inc. | Nucleic acid-engineered materials |
| US7445906B2 (en) | 2003-06-30 | 2008-11-04 | East Carolina University | Method of detecting cancer using delta-catenin |
| US7238538B2 (en) | 2003-09-19 | 2007-07-03 | Freitag Helmut E | Chromatographic assay device and methods |
| US20060228404A1 (en) | 2004-03-04 | 2006-10-12 | Anderson Daniel G | Compositions and methods for treatment of hypertrophic tissues |
| EP1730286A4 (en) | 2004-03-04 | 2007-09-05 | Massachusetts Inst Technology | THERAPEUTIC ANTICIPLE DNA |
| KR101147147B1 (ko) | 2004-04-01 | 2012-05-25 | 머크 샤프 앤드 돔 코포레이션 | Rna 간섭의 오프 타겟 효과 감소를 위한 변형된폴리뉴클레오타이드 |
| US20080199960A1 (en) | 2004-05-13 | 2008-08-21 | Juliano Rudolph L | Methods for the Delivery of Oligomeric Compounds |
| US20060040879A1 (en) | 2004-08-21 | 2006-02-23 | Kosak Kenneth M | Chloroquine coupled nucleic acids and methods for their synthesis |
| US8445293B2 (en) | 2005-02-09 | 2013-05-21 | Rapid Pathogen Screening, Inc. | Method to increase specificity and/or accuracy of lateral flow immunoassays |
| US7189522B2 (en) | 2005-03-11 | 2007-03-13 | Chembio Diagnostic Systems, Inc. | Dual path immunoassay device |
| WO2006098804A2 (en) | 2005-03-11 | 2006-09-21 | Chembio Diagnostic Systems, Inc. | Dual path immunoassay device |
| EP1891216B1 (en) | 2005-05-25 | 2012-02-22 | The University Of York | Hybrid interfering rna |
| US8999370B2 (en) | 2005-05-26 | 2015-04-07 | Thomas Jefferson University | Method to treat and prevent posterior capsule opacification |
| US20070015166A1 (en) | 2005-07-14 | 2007-01-18 | Nilsen Thor W | Lateral flow methods and devices for detection of nucleic acid binding proteins |
| US20100136614A1 (en) | 2005-10-18 | 2010-06-03 | Dan Luo | Dendrimer-like modular delivery vector |
| US20090130104A1 (en) | 2005-10-05 | 2009-05-21 | The Trustees Of The University Of Pennsylvania | Fusion proteins for inhibition and dissolution of coagulation |
| US20120003727A1 (en) | 2006-03-10 | 2012-01-05 | Javanbakhsh Esfandiari | Immunoassay Device for Detecting Antibodies and Antigens |
| US20070225213A1 (en) | 2006-03-23 | 2007-09-27 | Kosak Matthew K | Nucleic acid carriers for delivery of therapeutic agents |
| JP2008195613A (ja) | 2006-12-19 | 2008-08-28 | Nissei Bio Kk | マイクロ微粒子製剤および医薬組成物 |
| PL2308514T3 (pl) | 2007-03-23 | 2013-11-29 | To Bbb Holding B V | Koniugaty do ukierunkowanego dostarczania leku poprzez barierę krew-mózg |
| RU2010107199A (ru) * | 2007-07-31 | 2011-09-10 | Дзе Джонс Хопкинс Юниверсити (Us) | Конъюгат полипептид-нуклеиновая кислота для иммунопрофилактики или иммунотерапии для неопластических или инфекционных нарушений |
| US9029524B2 (en) | 2007-12-10 | 2015-05-12 | California Institute Of Technology | Signal activated RNA interference |
| WO2009080832A1 (en) | 2007-12-26 | 2009-07-02 | Biotest Ag | Methods and agents for improving targeting of cd138 expressing tumor cells |
| WO2009086552A1 (en) | 2008-01-02 | 2009-07-09 | The Trustees Of The University Of Pennsylvania | Targeting recombinant therapeutics to circulating red blood cells |
| US20090297479A1 (en) | 2008-03-28 | 2009-12-03 | Kiyoshi Ariizumi | Dc-hil conjugates for treatment of t-cell disorders |
| WO2009137055A1 (en) | 2008-05-05 | 2009-11-12 | Los Alamos National Security, Llc | Nanocrystal-based lateral flow microarrays and low-voltage signal detection systems |
| WO2010045518A1 (en) | 2008-10-16 | 2010-04-22 | The Trustees Of The University Of Pennsylvania | Compositions containing thrombomodulin domains and uses thereof |
| US9273133B2 (en) | 2008-12-04 | 2016-03-01 | Lankenau Institute For Medical Research | Compositions and methods for the treatment and prevention of lens fibrotic diseases |
| WO2010107960A1 (en) | 2009-03-17 | 2010-09-23 | Brody Jonathan R | Methods for assessing the efficacy of gemcitabine or ara-c treatment of cancer using human antigen r levels |
| CA2761120A1 (en) | 2009-05-06 | 2010-11-11 | Biotest Ag | Uses of immunoconjugates targeting cd138 |
| US20100323018A1 (en) | 2009-06-17 | 2010-12-23 | Massachusetts Institute Of Technology | Branched DNA/RNA monomers and uses thereof |
| US20110206611A1 (en) | 2010-02-24 | 2011-08-25 | Genisphere, Llc | DNA Dendrimers as Thermal Ablation Devices |
| WO2011115810A2 (en) | 2010-03-16 | 2011-09-22 | Massachusetts Institute Of Technology | Isoform-specific rnai based on codon redundancy/degeneracy |
| JP4638555B1 (ja) | 2010-09-08 | 2011-02-23 | 田中貴金属工業株式会社 | 核酸又は免疫クロマトグラフィー用試薬組成物、核酸又は免疫クロマトグラフィー測定方法及び核酸又は免疫クロマトグラフィー測定用キット |
| US8632789B2 (en) | 2010-11-01 | 2014-01-21 | Syracuse University | System and method for delivery of DNA-binding chemotherapy drugs using nanoparticles |
| EP2699603B1 (en) | 2011-04-19 | 2016-03-02 | The United States of America As Represented by the Secretary Department of Health and Human Services | Human monoclonal antibodies specific for glypican-3 and use thereof |
| EP2822593A4 (en) | 2012-03-09 | 2015-10-14 | Lankenau Inst Medical Res | COMPOSITIONS AND METHOD FOR THE TREATMENT OF CANCER |
| WO2014001326A1 (en) | 2012-06-27 | 2014-01-03 | F. Hoffmann-La Roche Ag | Method for the selection and production of tailor-made, selective and multi-specific therapeutic molecules comprising at least two different targeting entities and uses thereof |
| US9651549B2 (en) | 2012-07-13 | 2017-05-16 | Genisphere, Llc | Lateral flow assays using DNA dendrimers |
| CA2870170C (en) | 2012-09-12 | 2018-06-12 | Boston Scientific Scimed, Inc. | Adhesive stent coating for anti-migration |
| JP2015536952A (ja) | 2012-11-05 | 2015-12-24 | プロナイ セラピューティクス インコーポレイテッド | オリゴヌクレオチド癌療法の投薬および実施 |
| US20160051693A1 (en) | 2013-03-21 | 2016-02-25 | Genisphere, Llc | Cellular Delivery of DNA Intercalating Agents |
| GB201502645D0 (en) | 2015-02-17 | 2015-04-01 | Touchlight Genetics Ltd | Method |
| EP3289084B1 (en) | 2015-04-17 | 2020-09-16 | Genisphere, LLC | siRNA INHIBITION OF HUMAN ANTIGEN R EXPRESSION FOR TREATMENT OF CANCER |
| AU2017221437A1 (en) | 2016-02-19 | 2018-08-23 | Genisphere Llc | Nucleic acid carriers and therapeutic methods of use |
| EP3416671A4 (en) | 2016-02-19 | 2019-10-30 | Genisphere, LLC | NUCLEIC ACID CARRIER AND THERAPEUTIC METHODS OF USE |
| US11802151B2 (en) * | 2019-11-04 | 2023-10-31 | Code Biotherapeutics, Inc. | Brain-specific angiogenesis inhibitor 1 (BAI1) antibodies and uses thereof |
-
2017
- 2017-02-17 EP EP17753899.8A patent/EP3416671A4/en active Pending
- 2017-02-17 IL IL260983A patent/IL260983B/en unknown
- 2017-02-17 WO PCT/US2017/018323 patent/WO2017143156A1/en not_active Ceased
- 2017-02-17 AU AU2017220012A patent/AU2017220012B2/en active Active
- 2017-02-17 JP JP2018543674A patent/JP7366541B2/ja active Active
- 2017-02-17 US US15/999,774 patent/US12338435B2/en active Active
-
2022
- 2022-01-07 JP JP2022001374A patent/JP2022050550A/ja active Pending
- 2022-06-09 US US17/836,304 patent/US20230136794A1/en active Pending
-
2024
- 2024-04-11 AU AU2024202345A patent/AU2024202345B2/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090011956A1 (en) * | 2007-05-16 | 2009-01-08 | Peng Yin | Versatile nucleic acid hairpin motif for programming biomolecular self-assembly pathways |
| WO2008147526A1 (en) * | 2007-05-23 | 2008-12-04 | The Trustees Of The University Of Pennsylvania | Targeted carriers for intracellular drug delivery |
| US20120122800A1 (en) * | 2008-08-08 | 2012-05-17 | Genisphere, LLC Hatfield, Pennsylvania | Long-Acting DNA Dendrimers and Methods Thereof |
| US20140212503A1 (en) * | 2011-03-17 | 2014-07-31 | Hyukjin Lee | Delivery system |
| WO2014121050A1 (en) * | 2013-02-01 | 2014-08-07 | Genisphere, Llc | Functionalized dna dendrimers for gene delivery to cells |
| WO2015077891A1 (en) * | 2013-11-27 | 2015-06-04 | Zymeworks Inc. | Bispecific antigen-binding constructs targeting her2 |
Cited By (72)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12338435B2 (en) | 2016-02-19 | 2025-06-24 | Code Biotherapeutics, Inc. | Nucleic acid carriers and therapeutic methods of use |
| JP2020519696A (ja) * | 2017-05-09 | 2020-07-02 | アッセンブリー メディシン, エルエルシー.Assembly Medicine, Llc. | 多重特異性タンパク質薬物およびそのライブラリー、ならびに製造方法と使用 |
| WO2019166877A1 (en) | 2018-03-02 | 2019-09-06 | Sixfold Bioscience Ltd. | Compositions for delivery of cargo to cells |
| US10982210B2 (en) | 2018-03-02 | 2021-04-20 | Sixfold Bioscience Ltd. | Compositions for delivery of cargo to cells |
| US12280122B2 (en) | 2018-08-02 | 2025-04-22 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating myotonic dystrophy |
| US12370264B1 (en) | 2018-08-02 | 2025-07-29 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of delivering oligonucleotide to a subject |
| US12496352B2 (en) | 2018-08-02 | 2025-12-16 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating myotonic dystrophy |
| US12478687B2 (en) | 2018-08-02 | 2025-11-25 | Dyne Therapeutics, Inc. | United states |
| US11911484B2 (en) | 2018-08-02 | 2024-02-27 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating myotonic dystrophy |
| US12460011B2 (en) | 2018-08-02 | 2025-11-04 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of delivering an oligonucleotide to a subject |
| US12428487B2 (en) | 2018-08-02 | 2025-09-30 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonicleotide and method of delivering oligonucleotide to a subject |
| US11111309B2 (en) | 2018-08-02 | 2021-09-07 | Dyne Therapeutics, Inc. | Method of reducing expression of DUX4 in a muscle cell by administering an anti-transferrin receptor antibody linked to an oligonucleotide targeting DUX4 |
| US11168141B2 (en) | 2018-08-02 | 2021-11-09 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11248056B1 (en) | 2018-08-02 | 2022-02-15 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12357703B2 (en) | 2018-08-02 | 2025-07-15 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping |
| US11286305B2 (en) | 2018-08-02 | 2022-03-29 | Dyne Therapeutics, Inc. | Complex comprising anti-transferrin receptor antibody covalently linked to an oligonucleotide that targets DUX4 RNA |
| US12329825B1 (en) | 2018-08-02 | 2025-06-17 | Dyne Therapeutics, Inc. | Muscle targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping of exon 44 of dystrophin in a subject |
| US11369689B2 (en) | 2018-08-02 | 2022-06-28 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11390682B2 (en) | 2018-08-02 | 2022-07-19 | Dyne Therapeutics, Inc. | Methods of intravenouisly delivering anti-transferrin antibody/oligonucleotide complexes to subjects having muscular dystrophy |
| US12325753B2 (en) | 2018-08-02 | 2025-06-10 | Dyne Therapeutics, Inc. | Method of using an anti-transferrin receptor antibody to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy |
| US11497815B2 (en) | 2018-08-02 | 2022-11-15 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11518816B2 (en) | 2018-08-02 | 2022-12-06 | Dyne Therapeutics, Inc. | Methods of delivering an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy |
| US12319743B2 (en) | 2018-08-02 | 2025-06-03 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of delivering oligonucleotide to a subject |
| US11633496B2 (en) | 2018-08-02 | 2023-04-25 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12263225B2 (en) | 2018-08-02 | 2025-04-01 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of use thereof to target dystrophin and to treat Duchenne muscular dystrophy |
| US12173078B2 (en) | 2018-08-02 | 2024-12-24 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US12173079B2 (en) | 2018-08-02 | 2024-12-24 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US12097263B2 (en) | 2018-08-02 | 2024-09-24 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating myotonic dystrophy |
| US12018087B2 (en) | 2018-08-02 | 2024-06-25 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of delivering oligonucleotide to a subject |
| US12012460B2 (en) | 2018-08-02 | 2024-06-18 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US11787869B2 (en) | 2018-08-02 | 2023-10-17 | Dyne Therapeutics, Inc. | Methods of using muscle targeting complexes to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy or a disease associated with muscle weakness |
| US11795234B2 (en) | 2018-08-02 | 2023-10-24 | Dyne Therapeutics, Inc. | Methods of producing muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US11795233B2 (en) | 2018-08-02 | 2023-10-24 | Dyne Therapeutics, Inc. | Muscle-targeting complex comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US11833217B2 (en) | 2018-08-02 | 2023-12-05 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12005124B2 (en) | 2018-08-02 | 2024-06-11 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| WO2020056341A3 (en) * | 2018-09-14 | 2020-04-16 | Northwestern University | Programming protein polymerization with dna |
| CN112912422A (zh) * | 2018-09-14 | 2021-06-04 | 西北大学 | 用dna编程蛋白质聚合 |
| WO2020056341A2 (en) | 2018-09-14 | 2020-03-19 | Northwestern University | Programming protein polymerization with dna |
| CN111196855A (zh) * | 2018-11-19 | 2020-05-26 | 三生国健药业(上海)股份有限公司 | 抗egfr/pd-1双特异性抗体 |
| CN111196855B (zh) * | 2018-11-19 | 2022-11-15 | 三生国健药业(上海)股份有限公司 | 抗egfr/pd-1双特异性抗体 |
| WO2021027850A1 (en) * | 2019-08-12 | 2021-02-18 | I-Mab Biopharma Co., Ltd. | Anti-claudin 18.2 and anti-4-1bb bispecific antibodies and uses thereof |
| CN113166265B (zh) * | 2019-08-12 | 2024-06-04 | 天境生物科技(上海)有限公司 | 抗紧密连接蛋白18.2和抗4-1bb双特异性抗体及其用途 |
| CN113166265A (zh) * | 2019-08-12 | 2021-07-23 | 天境生物科技(上海)有限公司 | 抗紧密连接蛋白18.2和抗4-1bb双特异性抗体及其用途 |
| US11261259B2 (en) | 2019-08-12 | 2022-03-01 | I-Mab Biopharma Us Limited | Anti-claudin 18.2 and anti-4-1BB bispecific antibodies and uses thereof |
| US12577313B2 (en) | 2019-08-12 | 2026-03-17 | I-Mab Biopharma Us Limited | Anti-claudin 18.2 and anti-4-1BB bispecific antibodies and uses thereof |
| WO2021053405A2 (en) | 2019-08-30 | 2021-03-25 | Sixfold Bioscience Ltd. | Compositions for transfer of cargo to cells |
| WO2021091899A1 (en) | 2019-11-04 | 2021-05-14 | Genisphere, Llc | Brain-specific angiogenesis inhibitor 1 (bai1) antibodies and uses thereof |
| US12472267B2 (en) | 2020-04-27 | 2025-11-18 | Sixfold Bioscience Ltd. | Compositions containing nucleic acid nanoparticles with modular functionality |
| US11357865B2 (en) | 2020-04-27 | 2022-06-14 | Sixfold Bioscience Ltd. | Compositions containing nucleic acid nanoparticles with modular functionality |
| US12102687B2 (en) | 2021-07-09 | 2024-10-01 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating myotonic dystrophy |
| US11679161B2 (en) | 2021-07-09 | 2023-06-20 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy |
| US12239717B2 (en) | 2021-07-09 | 2025-03-04 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12239716B2 (en) | 2021-07-09 | 2025-03-04 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11638761B2 (en) | 2021-07-09 | 2023-05-02 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating Facioscapulohumeral muscular dystrophy |
| US11672872B2 (en) | 2021-07-09 | 2023-06-13 | Dyne Therapeutics, Inc. | Anti-transferrin receptor antibody and uses thereof |
| US11633498B2 (en) | 2021-07-09 | 2023-04-25 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating myotonic dystrophy |
| US12144867B2 (en) | 2021-07-09 | 2024-11-19 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12329824B1 (en) | 2021-07-09 | 2025-06-17 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12144868B2 (en) | 2021-07-09 | 2024-11-19 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12128109B2 (en) | 2021-07-09 | 2024-10-29 | Dyne Therapeutics, Inc. | Muscle targeting complexes and formulations for treating dystrophinopathies |
| US11648318B2 (en) | 2021-07-09 | 2023-05-16 | Dyne Therapeutics, Inc. | Anti-transferrin receptor (TFR) antibody and uses thereof |
| US11969475B2 (en) | 2021-07-09 | 2024-04-30 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy |
| US12397062B2 (en) | 2021-07-09 | 2025-08-26 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12403203B2 (en) | 2021-07-09 | 2025-09-02 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11759525B1 (en) | 2021-07-09 | 2023-09-19 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy |
| US11986537B2 (en) | 2021-07-09 | 2024-05-21 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12440575B2 (en) | 2021-07-09 | 2025-10-14 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11771776B2 (en) | 2021-07-09 | 2023-10-03 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US11839660B2 (en) | 2021-07-09 | 2023-12-12 | Dyne Therapeutics, Inc. | Anti-transferrin receptor antibody and uses thereof |
| US11844843B2 (en) | 2021-07-09 | 2023-12-19 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy |
| US11931421B2 (en) | 2022-04-15 | 2024-03-19 | Dyne Therapeutics, Inc. | Muscle targeting complexes and formulations for treating myotonic dystrophy |
| US12440574B2 (en) | 2022-04-15 | 2025-10-14 | Dyne Therapeutics, Inc. | Muscle targeting complexes and formulations for treating myotonic dystrophy |
Also Published As
| Publication number | Publication date |
|---|---|
| US12338435B2 (en) | 2025-06-24 |
| US20210213138A1 (en) | 2021-07-15 |
| AU2017220012B2 (en) | 2024-05-02 |
| JP2022050550A (ja) | 2022-03-30 |
| JP2019511474A (ja) | 2019-04-25 |
| AU2017220012A1 (en) | 2018-08-16 |
| EP3416671A4 (en) | 2019-10-30 |
| IL260983A (https=) | 2018-09-20 |
| AU2024202345A1 (en) | 2024-05-02 |
| JP7366541B2 (ja) | 2023-10-23 |
| IL260983B (en) | 2022-07-01 |
| US20230136794A1 (en) | 2023-05-04 |
| EP3416671A1 (en) | 2018-12-26 |
| AU2024202345B2 (en) | 2026-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2024202345B2 (en) | Nucleic acid carriers and therapeutic methods of use | |
| US20250049942A1 (en) | Nucleic acid carriers and therapeutic methods of use | |
| US11613609B2 (en) | PLGA-modified polyethylenimine self-assembly nanotechnology for nucleic acid and drug delivery | |
| US20240033376A1 (en) | Systems and methods for nucleic acid expression in vivo | |
| KR20210039376A (ko) | 개인 맞춤형 암 백신 | |
| US20260091125A1 (en) | Multifunctional delivery system and uses thereof | |
| JP2025538981A (ja) | TGF-β1ワクチン | |
| WO2025235413A1 (en) | Compositions targeting cancer antigens and methods of use thereof | |
| EP4727978A2 (en) | Compositions comprising anti-mutant kras antibodies and methods of use thereof | |
| WO2025051915A1 (en) | Product | |
| AU2023353838A1 (en) | Design and utilization of gene targeting antibody fusion proteins to perform in vivo therapeutic gene editing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17753899 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 260983 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2017220012 Country of ref document: AU Date of ref document: 20170217 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018543674 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2017753899 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2017753899 Country of ref document: EP Effective date: 20180919 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 15999774 Country of ref document: US |