WO2017131493A1 - 표적 돌연변이 유전자 검출용 미세 유동 장치, 및 표적 유전자 검출용 미세 유동 장치의 검출 효율을 개선하는 방법 - Google Patents

표적 돌연변이 유전자 검출용 미세 유동 장치, 및 표적 유전자 검출용 미세 유동 장치의 검출 효율을 개선하는 방법 Download PDF

Info

Publication number
WO2017131493A1
WO2017131493A1 PCT/KR2017/000998 KR2017000998W WO2017131493A1 WO 2017131493 A1 WO2017131493 A1 WO 2017131493A1 KR 2017000998 W KR2017000998 W KR 2017000998W WO 2017131493 A1 WO2017131493 A1 WO 2017131493A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
target
microfluidic device
detecting
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2017/000998
Other languages
English (en)
French (fr)
Inventor
이혁진
정일영
김지수
최보람
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ewha Womans University
Original Assignee
Ewha Womans University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ewha Womans University filed Critical Ewha Womans University
Publication of WO2017131493A1 publication Critical patent/WO2017131493A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/502Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
    • B01L3/5027Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00Additional constructional details
    • B01L2300/08Geometry, shape and general structure
    • B01L2300/0809Geometry, shape and general structure rectangular shaped
    • B01L2300/0819Microarrays; Biochips
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00Additional constructional details
    • B01L2300/08Geometry, shape and general structure
    • B01L2300/0861Configuration of multiple channels and/or chambers in a single devices
    • B01L2300/0864Configuration of multiple channels and/or chambers in a single devices comprising only one inlet and multiple receiving wells, e.g. for separation, splitting
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00Reactions of nucleic acids characterised by
    • C12Q2531/10Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/125Rolling circle
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the present invention relates to a microfluidic device for detecting a target mutant gene, and a method for improving the detection efficiency of the microfluidic device for detecting a target gene.
  • a microfluidic device is a device in which each component is connected through a microfluidic channel on a substrate, and when a sample solution is injected, the entire process necessary for obtaining a detection signal is automated. It can be detected in a small amount of sample, uses less reagent, and the entire process is automated, which is convenient.
  • Publication No. 10-2014-0032094 discloses a microfluidic device that can be combined with a DNA template.
  • the microfluidic device disclosed in the above document has a two-layer structure, and the manufacturing process and the use method are complicated because the sample flows by controlling the angle of the flow path.
  • the pump is used to inject the sample, it must be externally powered and only one substance can be detected at a time.
  • Korean Patent Publication No. 10-2012-0125164 Name of the invention: EFFFR exon 19 polymorphism detection test oligonucleotide and use thereof)
  • the present invention is to provide a microfluidic device for detecting a target mutant gene and a detection method using the same.
  • the present invention also provides a microfluidic device kit for detecting a target gene with improved detection efficiency and a method for detecting a target gene using the same.
  • the present invention is a.
  • a first flow passage connected with the inlet to accommodate the sample solution introduced
  • a second flow path connected to the first flow path
  • a microfluidic device for detecting a target mutant gene comprising an outlet connected to the second flow path
  • the second flow path surface is coated
  • a primer is immobilized on the coating
  • the fixed primer is coupled to a template for detecting a target mutant gene
  • the target mutant gene detection template includes a primer binding portion that complementarily binds to the primer, a binding site complementary to the first template bound to one end of the primer binding portion-a first target mutation gene binding site, and the primer binding Provided is a microfluidic device for detecting a target mutant gene, comprising a complementary binding site-second target mutant gene binding site in a second template bound to the other end of the moiety.
  • the second flow path may be 1 to 20.
  • the second flow path is 2 to 20, each of the second flow path is branched at the end of the first flow path, the target mutant gene bound to the primer immobilized on each second flow path
  • the detection template may bind to the same or different mutant genes.
  • the coating is 5-hydroxydopamine hydrochloric acid, norepinephrine, epinephrine, pyrogallolamine, DOPA (3,4-Dihydroxyphenylalanine), catechin, tannins, pyrogallol, pyrocatechol , Heparin-catechol, chitosan-catechol, polyethyleneglycol-catechol, polyethyleneimine-catechol, polymethylmethacrylate-catechol, hyaluronic acid-catechol, polylysine-catechol, and It may be selected from the group containing polylysine (polylysine).
  • the primer is thiol, amine, hydroxyl, carboxyl, isothiocyanate, NHS ester, aldehyde, epoxide, carbonate, HOBt ester, glutaraldehyde, carbamate, imidazole carbamate, Terminals may be modified at least one selected from the group comprising maleimide, aziridine, sulfone, vinylsulfone, hydrazine, phenyl azide, benzophenone, anthraquinone, and diene groups.
  • the coating is 5-hydroxydopamine hydrochloric acid
  • the primer may be a terminal modified with a thiol or amine group.
  • the primer binding portion of the target mutant gene detection template may comprise a nucleotide sequence described in SEQ ID NO: 2.
  • mutant gene that can be detected by the microfluidic device for detecting a target mutant gene of the present invention.
  • the present invention can be applied to various mutant genes known in the art.
  • the mutant gene may be a cancer specific mutant gene appearing in cancer.
  • the cancer specific mutant gene may be a website such as http://www.mycancergenome.org, and any cancer specific mutant gene known in the art.
  • the mutant gene may be a carcinogenic mutant gene, which is a gene causing cancer, specifically a lung cancer specific mutant gene, more specifically, a gene in which EGFR exon 19 deletion has occurred, It is not limited.
  • Mutant genes that can be detected by the present invention are not limited to mutant genes associated with cancer, and other mutant genes associated with other congenital or acquired diseases or malformations may be used.
  • a mutant gene that can be detected by the present invention can be any mutant gene in which the normal gene and one or more bases are substituted, deleted or added.
  • the mutant gene may be a mutant gene in which two or more bases are substituted, deleted or added continuously or discontinuously.
  • the first target mutant gene binding site and the second target mutant gene binding site of the target mutant gene detection template of the present invention may be designed to bind complementarily to the mutant gene but not to the normal gene.
  • the mutant gene of the present invention can be, for example, a mutation of an epidermal growth factor receptor (EGFR) gene.
  • the mutant gene may be a gene in which EGFR exon 19 deletion (hereinafter, 'EGFR 19del') occurs.
  • EGFR 19del is a deletion of several to several ten bases consecutively in exon 19 of the EGFR gene, and a plurality of variants are known. Exemplary variants of EGFR 19del are shown in Table 1 below. In the table below, '-' means a deletion, lowercase means a mutation, and 'wild type' means a gene of the normal EGFR exon 19 part without deletion. Korean Patent Publication No. 10-2012-0125164 describes variously about the EGFR exon 19 polymorph, and many other documents have been reported about the EGFR exon 19 polymorph. However, EGFR 19del is not limited to that described in Table 1 below.
  • the EGFR 19del is a mutation commonly occurring in lung cancers such as Non-Small Cell Lung Cancer (NSCLC), and among them, abundantly observed in adenocarcinoma. Whether EGFR 19del has occurred can be used to confirm lung cancer.
  • NSCLC Non-Small Cell Lung Cancer
  • iresa compound name: gefitinib
  • tarseva compound name: erlotinib
  • geotripps compound name: afatinib
  • Numerous target anticancer agents for 19del's lung cancer are currently under development or clinical trials.
  • a mutant gene in which various variants of EGFR 19del can be detected quickly and accurately can be used to confirm lung cancer, and an appropriate anti-cancer agent can be selected to plan treatment of lung cancer patients. It can be a decisive help in establishing.
  • the present invention provides a method for producing a microfluidic device for detecting a target mutant gene, comprising the following steps.
  • a microfluidic device including a substrate, an inlet formed on the substrate, a first flow path connected to the inlet to receive the sample solution introduced therein, a second flow path connected to the first flow path, and an outlet connected to the second flow path Providing a;
  • the present invention provides a method for detecting a target mutant gene using the microfluidic device for detecting the target mutant gene comprising the following steps.
  • the steps c) and d) may be performed simultaneously (i.e., let the ligation and the rotation amplification reaction occur simultaneously), or c) after step d) is performed ( That is, after the ligation to cause a rotation ring amplification reaction). Simultaneously or separately, steps c) and d) may be determined according to the number and type of target substances to be detected.
  • the method is
  • the microfluidic device for detecting a target mutant gene of the present invention can be used for detection of various mutant genes occurring in humans and animals.
  • the animal includes all mammals, birds, reptiles, amphibians, fish and the like.
  • the present invention provides a microfluidic device for detecting a target gene
  • microfluidic device kit for detecting a target gene, comprising additional primers.
  • the microfluidic device is a microfluidic device.
  • a first flow passage connected with the inlet to accommodate the sample solution introduced
  • a second flow path connected to the first flow path
  • a microfluidic device for detecting a target gene comprising an outlet connected to the second flow path
  • the second flow path surface is coated
  • a primer is immobilized on the coating
  • the fixed primer is coupled to a template for detecting a target gene
  • the target gene detection template includes a primer binding portion that complementarily binds to the primer, a binding site complementary to the first template bound to one end of the primer binding portion-a first target gene binding portion, and the other of the primer binding portion.
  • a microfluidic device for detecting target genes comprising a complementary binding site-second target gene binding site in a second template bound to a terminal, and the specific configuration and features of the microfluidic device for detecting target genes are described in Application No. 10. -2015-0151941 (name of the invention: a microfluidic device for detecting a target gene, a preparation method thereof and a detection method using the same).
  • the additional primer may be the entire sequence, or a partial sequence of the primer binding portion of the target gene detection template, for example 5 to 50, preferably 10 to 25 Some, more preferably 15 to 22 bases in length.
  • the additional primer sequence is the same sequence as the sequence, or a part of the sequence. It may be a corresponding sequence, and in the case of a sequence corresponding to a part of the sequence, it may be preferably a sequence consisting of 10 to 25 bases, such as SEQ ID NO: 3 (5 ′ TGC TAG TAT C 3 ′).
  • the ligase may be a DNA ligase, such as T7 ligase, or CircLigase TM.
  • the isothermal nucleic acid polymerase may be phi 29 polymerase.
  • the kit may further include dithiothreitol (DTT) or pyrophosphatase.
  • DTT dithiothreitol
  • pyrophosphatase pyrophosphatase
  • the kit may further include a dyeing reagent, a high salt solution, or a fluorescent reagent.
  • the present invention provides a method for producing a microfluidic device comprising: a) providing a microfluidic device for detecting a target gene;
  • additional primers are coupled in the middle of the sequence to be rotated and amplified by the addition of additional primers, thereby causing amplification of the template in a larger amount more rapidly. That is, the addition of additional primers significantly shortens the time for amplification of the nucleic acid mass and can be detected much faster, and also if the target contains a small amount of the target gene or if the amount of the sample itself is small.
  • By increasing the amplification site through the second amplification by a large amount of template amplification can form a large nucleic acid clumps, thereby increasing the accuracy of detection.
  • the target gene detection method of the present invention is a daughter strand generated through the second amplification (additional amplification) by adding additional primers (mother strand generated by the first amplification (mother) Complementary binding to the strand) forms a DNA hydrogel faster and more robustly, thus improving the detection efficiency compared to the conventional detection method.
  • the method of detecting a target gene using a microfluidic device kit for detecting a target gene including the additional primer is used for detecting genes that can be derived from all origins such as animals, plants, bacteria, viruses, fungi, and the environment. Applicable
  • the target gene to be detected may be a pathogen gene.
  • the target gene can be targeted to any pathogen that knows the nucleic acid sequence.
  • the pathogen is avian influenza, SARS, Escherichia coli O157: H7, Mycobacterium tuberculosis, Bacillus anthracis, Streptococcus pneumonia, Malaria (Plasmodium), Salmonella (Salmonella), Hepatitis A, B, C, D and E viruses, Françasella tularensis, Yersinia pestis, Ersinia enterocolitica and Ebola virus, It is useful for the detection of MERS-Cov virus.
  • the pathogen is also useful for the detection of pneumococci, enterococci, staphylococcus, tropic fever and pathogens with antibiotic resistance such as tuberculosis or malaria bacteria in the third world.
  • the target gene to be detected may be a mutant gene.
  • the mutant gene may be a cancer specific mutant gene that appears in cancer.
  • the cancer specific mutant gene may be any cancer specific mutant gene known in the art, and specific cancer specific mutant genes are as described above. More specifically, it may be a lung cancer specific mutant gene, such as but not limited to a gene in which EGFR exon 19 deletion has occurred.
  • the present invention does not need to change the temperature for nucleic acid amplification, and can detect a target mutant gene without external power supply. Therefore, there is no need for complicated equipment, it is simple and inexpensive to manufacture, easy to operate, and easy to carry. It can also be used to detect a variety of mutant genes, and can be used to detect two or more mutant genes simultaneously.
  • the microfluidic device kit for detecting a target gene comprising the additional primer of the present invention; And by using the detection method using the same it can significantly shorten the detection time of the conventional microfluidic device for detecting the target material and increase the accuracy of the detection.
  • FIG. 1 is a diagram showing a result of detecting a gene having a EGFR exon 19 deletion mutation of SEQ ID NO: 5 using a microfluidic device for detecting a target mutant gene of the present invention with fluorescence.
  • Figure 2 is a schematic diagram showing that the secondary amplification of the ring by the addition of the additional primer can be amplified more quickly and a lot of templates.
  • FIG. 3 is a result of detecting a target gene by a method developed by the present inventor (named DNA Hydrogel Formation by Isothermal Amplification of Complementary Target in Fluidic Channels) using the same microfluidic device for detecting a target gene.
  • Figures (a) and (c)) and the results of detecting target genes (DbITACT-TR) by adding additional primers (DhITACT-TR) developed this time are shown respectively (b) and (d).
  • FIG. 4 is a diagram showing an Atomic Force Microscope (AFM) image of a target mers coronavirus gene hydrogel formed through DhITACT.
  • AFM Atomic Force Microscope
  • FIG. 5 shows an Atomic Force Microscope (AFM) image of a target mers coronavirus gene hydrogel formed through DhITACT-TR.
  • AFM Atomic Force Microscope
  • FIG. 6 is a diagram showing the results of rheology measurement of target mers coronavirus gene hydrogel formed through DhITACT and DhITACT-TR.
  • Figure 7 is a diagram confirming the result of detecting the gene for which the EGFR exon 19 deletion mutation of SEQ ID NO: 5 by the target gene detection method of the present invention with the addition of additional primers.
  • target mutant gene that can be detected by the microfluidic device for detecting a target mutant gene of the present invention is not limited, and may be any mutant gene having one or more base differences from a normal gene.
  • Mutant genes that can be detected with the present invention can be any mutant genes associated with a congenital or acquired disease or malformation.
  • the mutant gene may be a mutant gene in which two or more genes are substituted or deleted continuously or discontinuously.
  • the mutant gene may be a gene described by SEQ ID NO: 5, which is a kind of EGFR 19del. Comparing the mutant gene with a normal gene is shown in Table 2 below.
  • the template for detecting the target mutant gene of the present invention can be designed as follows (SEQ ID NO: 6).
  • the first target mutant gene binding site and the second target mutant gene binding site shown in bold, bind complementarily to 'AAATTCCCGGGA' and 'ATTAAGAGAAGCCAACAAGG' in the mutant gene of SEQ ID NO: 5, respectively. That is, the template can be designed such that the target mutant gene binding site complementarily binds only to the mutant gene.
  • the dark gray portion is a 'primer binding portion', and is prepared to bind complementarily with the primer represented by SEQ ID NO: 1 (5′-Thiol-AAA AAA AAA GGG ACG TCG ATA CTA GCA TGC TA-3 ′). (SEQ ID NO: 2).
  • the light gray portions are portions that complementarily bind to each other in the template (complementary binding sites in the first template and complementary binding sites in the second template).
  • the method for detecting a target gene using the microfluidic device for detecting a target substance that is, the microfluidic device for detecting a target gene, invented by the inventors of the present invention is disclosed in Korean Patent Application No. 10-2015-0151941 (name of the invention: for detecting a target gene).
  • the additional primer may be the entire sequence or a partial sequence of the primer binding portion of the target gene detection template used in the microfluidic device, for example, a partial sequence of 10 to 25 bases in length.
  • the upper two diagrams show a process in which rotation amplification occurs in the method of the existing application
  • the lower diagram shows additional primers coupled in the middle of the sequence to be amplified by the rotation when additional primers are added.
  • the process of amplifying the template in larger amounts is shown. That is, the addition of additional primers significantly shortens the time for amplification of the nucleic acid mass and can be detected much faster, and also template amplification when small amounts of target material are included in the sample or when the amount of the sample itself is small. This can occur a lot and form a large nucleic acid lump, which increases the accuracy of detection.
  • Example 1 Detection of EGFR 19del using microfluidic device for detecting target gene (cancer mutant gene)
  • 5-hydroxydopamine hydrochloric acid (5-hydroxydopamine HCl) was used as the coating material of the second flow path. Specifically, 5-hydroxydopamine hydrochloric acid (Sigma Aldrich) was dissolved in 10 mM Tris buffer (1M UltraPure 1M Tris-HCl pH 8.0 / Invitrogen) at a concentration of 1 mg / ml. Then, the pH was adjusted to 8 to prepare a coating composition. Wherein in the coating composition for a 1 ⁇ -Slide III 3in1 uncoated Microscopy Chamber filled the each second flow path of the product. After 2 hours it was washed with DDW (Water Purification System / LABOGENE).
  • DDW Water Purification System / LABOGENE
  • Primer was used to purchase Primer-5SS-polyA9 (BIONEER) having the following sequence.
  • the 5 'end of the primer sequence is attached to a thiol group.
  • the primer composition was prepared by the addition. Allow 4 hours to break any disulfide bonds that may have been generated in the primer by DTT, and then at 132,000 rpm, 4 ° C., 25 minutes using a 3K amicon tube (Amicon Ultra Centrifugal Filters 3K / MILLIPORE). First centrifugation, 40 ⁇ l DDW was added and second centrifugation to completely remove DTT remaining after reaction.
  • SEQ ID NO: 6 the template for detecting EGFR 19del described in SEQ ID NO: 5 (SEQ ID NO: 6) was prepared as follows.
  • the EGFR 19del was detected by DDW (Water Purification System / LABOGENE) and then left for 2 hours to allow complementary binding to occur between the primer binding portion of the template for detection and the second immobilized primer.
  • the right channel contains a template for detection of EGFR 19del in which nicking has already occurred (positive control).
  • a solution containing the EGFR 19del gene of SEQ ID NO: 5 was prepared as a sample solution.
  • a solution containing the EGFR normal gene of SEQ ID NO: 4 was prepared.
  • 3.5 ⁇ l of the sample solution was introduced into the second channel in the middle, and the negative control solution was introduced into the second channel on the left.
  • 30 ⁇ l of T7 ligase, 0.2 ⁇ l of 100 mM DTT, and 24.8 ⁇ l of Water Purification System / LABOGENE (DDW) were used to fill the second flow path of the microfluidic device for target gene detection. It was placed in a plastic container sealed with a para film to prevent the moisture in the second flow passage.
  • the plastics were filled with a tissue dampened with water and water at 30 ° C. Thereafter, it was left to stand at a non-shaking, 30 ° C., and 3 hours to allow the ligation of nicks of the EGFR 19del detection template.
  • the EGFR 19del detection template was amplified in the central flow path of FIG. 1 and entangled with hydroxydopamine hydrochloric acid coated with the second flow path to form a large hydrogel mass to block the outlet of the second flow path. there was. Similarly, it was confirmed that the outlet of the second flow path was blocked in the right flow path as the positive control. In contrast, no fluorescence was observed in the left channel, which was a negative control.
  • the inventors have invented a microfluidic device for detecting a target gene.
  • the present inventors invented a method of shortening the detection time of the microfluidic device and increasing the accuracy as follows.
  • a microfluidic device for detecting a target MERS gene was prepared as described in Experiment 5 of Application No. 10-2015-0151941.
  • the basic structure of the device is as described in 1-1 above, and the template sequence is as follows.
  • portions complementary to the target mers coronavirus gene are shown in bold letters, and portions complementary to the primers are light gray on a light gray background, and the portions complementary to the primer are displayed in dark gray. It was.
  • target mers coronavirus gene sequence to which the first target gene binding site and the second target gene binding site of the template sequence bind complementarily is as follows.
  • the sample solution was placed in the second channel in the middle and the negative control solution was placed in the leftmost second channel in the same manner as in the method of 1-2. Inflow.
  • 30 ⁇ l of T7 ligase, 0.2 ⁇ l of 100 mM DTT, and 24.8 ⁇ l of Water Purification System / LABOGENE (DDW) were used to fill the second flow path of the microfluidic device for target gene detection. It was placed in a plastic container sealed with a para film to prevent the moisture in the second flow passage. The plastics were filled with a tissue dampened with water and water at 30 ° C. Thereafter, it was left to stand at a non-shaking, 30 DEG C, and 3 hours to allow the ligation of the nick of the template to occur.
  • a microfluidic device for detecting a target MERS gene was prepared, a sample solution containing the MERS virus gene was injected, and a ligation reaction and a rotation ring amplification reaction occurred in sequence.
  • 'additional primer' (consisting of a short DNA sequence) was further added during the rotation amplification reaction. Additional primer sequences added are as follows.
  • the present inventors also added the pore size of the hydrogel using an Atomic Force Microscope (AFM) and to confirm the improved detection efficiency of the microfluidic device for target gene detection by adding additional primers. Rheology was measured.
  • AFM Atomic Force Microscope
  • the target MERS gene hydrogel of Example 2-1 which was amplified by adding the target MERS gene hydrogel of Example 1 and an additional primer, which was formed by using an atomic force microscope (NX10, Park Systems, South Korea) as an existing device
  • NX10 Park Systems, South Korea
  • the pore size of the mass was measured and the results are shown in FIGS. 4 and 5.
  • the average pore size of the hydrogel amplified using the existing microfluidic device for detecting target genes was 56 nm (FIG. 4), but when additional primers were added (DhITACT -TR) average pore size was 16 nm (Fig. 5), the density was confirmed to increase about 3.5 times. That is, by adding additional primers to form a more robust DNA hydrogel mass it was confirmed that the detection efficiency was improved.
  • the MERS gene hydrogel (TR) formed through DhITACT-TR formed a more viscoelastic gel than the hydrogel (D) formed through DhITACT, and storage modulus (G ′) was also increased. High. That is, it was confirmed that by adding additional primers to form a hydrogel having a stronger elasticity, the detection efficiency of the microfluidic device was increased.
  • microfluidic device for detecting target mutant genes As described in 1-1 above, a microfluidic device for detecting EGFR 19del was prepared.
  • the specific template sequence (SEQ ID NO: 6) is as follows, and the meaning indicated in the sequence is the same as the MERS template.
  • target EGFR 19del gene sequence to which the first target gene binding site and the second target gene binding site of the template sequence bind complementarily is as follows.
  • amplification of the EGFR 19del gene was performed in the same manner as the method using the microfluidic device for detecting MERS, and an additional primer of SEQ ID NO: 3 was added.
  • the template was amplified to visually observe that the hydrogel mass was formed only 30 minutes after the reaction, and the time required for amplification was greatly shortened by the addition of additional primers. That is, the detection of the target EGFR 19del gene of Example 1-2 without adding the additional primer was able to visually confirm the hydrogel 2 hours after the rotation amplification reaction (Fig. 1), but the addition of the additional primer In this case, the time required for amplification of the EGFR 19del mutant gene was significantly shortened. Therefore, when the additional primer is added, even when a small amount of the target EGFR 19del mutant gene is present in the sample solution, it is possible to detect with high sensitivity, thereby increasing the accuracy.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Clinical Laboratory Science (AREA)
  • Dispersion Chemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Hematology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)

Abstract

본 발명은 표적 돌연변이 유전자 검출용 미세 유동 장치에 관한 것이다. 본 발명의 장치는 핵산 증폭을 위하여 온도를 변화시킬 필요가 없고, 외부의 동력 공급이 없어도 표적 돌연변이 유전자를 검출할 수 있다. 따라서 복잡한 장비를 수반할 필요가 없으며, 간단하고 저렴하게 제조가 가능하고, 조작이 간편하며, 휴대가 용이하다. 또한 다양한 돌연변이 유전자의 검출에 이용할 수 있고, 2 이상의 돌연변이 유전자를 동시에 검출하는데 이용할 수 있다. 또한 본 발명은 표적 유전자 검출용 미세 유동 장치의 검출 효율을 개선하는 방법에 관한 것이다. 본 발명의 방법을 이용하면 기존의 표적 유전자 검출용 미세 유동 장치의 검출 소요 시간을 크게 단축시키고 검출의 정확성을 높일 수 있다.

Description

표적 돌연변이 유전자 검출용 미세 유동 장치, 및 표적 유전자 검출용 미세 유동 장치의 검출 효율을 개선하는 방법
본 발명은 표적 돌연변이 유전자 검출용 미세 유동 장치, 및 표적 유전자 검출용 미세 유동 장치의 검출 효율을 개선하는 방법에 관한 것이다.
미세 유동 장치(microfluidic device)란 기판 상에서 미세유체 유로(microfluidic channel)를 통해 각 구성이 연결되어, 시료 용액을 주입하면 검출 신호를 얻을 때까지 필요한 전 공정이 자동화되어 있는 장치를 말한다. 적은 양의 시료에서도 검출이 가능하며, 시약을 적게 사용하고, 전 공정이 자동화되어 있어 편리하다는 장점이 있다.
공개번호 제10-2014-0032094호는 DNA 템플레이트와 결합될 수 있는 미세 유동 장치를 개시하고 있다. 그러나 상기 문헌에 공개된 미세 유동 장치는 2층 구조이고 유로의 각도를 조절하여 시료를 흐르게 하므로 제조 공정과 사용 방법이 복잡하다. 또한 시료를 주입하기 위해 펌프를 이용하므로 외부에서 동력을 공급해야 하고, 한 번에 한 가지 물질만을 검출할 수 있다.
[선행기술문헌]
[특허문헌]
국내등록특허 제10-1263450호(발명의 명칭: 카나마이신에 특이적으로 결합하는 DNA 앱타머)
국내공개특허 제10-2014-0032094호(발명의 명칭: 표적 물질 포획이 용이한 미세유동 장치 및 상기 미세유동 장치를 이용한 표적 물질 분리 방법)
국내공개특허 제10-2012-0125164호(발명의 명칭: EGFR 엑손 19 다형 검출 시험용 올리고뉴클레오티드 및 그 용도)
본 발명은 표적 돌연변이 유전자 검출용 미세 유동 장치 및 이를 이용한 검출 방법을 제공하고자 한다.
본 발명은 또한 검출 효율이 개선된 표적 유전자 검출용 미세 유동 장치 키트 및 이를 이용한 표적 유전자 검출 방법을 제공하고자 한다.
본 발명은
기판;
상기 기판 상에 형성된 시료용액이 외부로부터 유입되는 유입구;
상기 유입구와 연결되어 유입된 시료용액을 수용하는 제 1 유로;
상기 제 1 유로와 연결된 제 2 유로;
상기 제 2 유로와 연결된 배출구를 포함하는 표적 돌연변이 유전자 검출용 미세 유동 장치로서,
상기 제 2 유로 표면은 코팅되어 있고;
상기 코팅 상에 프라이머가 고정되고;
상기 고정된 프라이머에는 표적 돌연변이 유전자 검출용 템플레이트가 결합되어 있으며,
상기 표적 돌연변이 유전자 검출용 템플레이트는 상기 프라이머에 상보적으로 결합하는 프라이머 결합부, 상기 프라이머 결합부의 일 말단에 결합된 제 1 템플레이트 내 상보적인 결합 부위-제 1 표적 돌연변이 유전자 결합 부위, 및 상기 프라이머 결합부의 다른 말단에 결합된 제 2 템플레이트 내 상보적인 결합 부위-제 2 표적 돌연변이 유전자 결합 부위를 포함하는, 표적 돌연변이 유전자 검출용 미세 유동 장치를 제공한다.
본 발명의 일 구체예로서, 상기 제 2 유로는 1 내지 20개일 수 있다.
본 발명의 다른 구체예로서, 상기 제 2 유로는 2 내지 20개이며, 제 1 유로의 말단에서 각각의 제 2 유로가 분지되고, 각각의 제 2 유로 상에 고정된 프라이머에 결합된 표적 돌연변이 유전자 검출용 템플레이트는 서로 같거나 다른 돌연변이 유전자에 결합하는 것일 수 있다.
본 발명의 일 구체예로서, 상기 코팅은 5-하이드록시도파민 염산, 노르에피네프린, 에피네프린, 파이로갈롤아민, DOPA(3,4-Dihydroxyphenylalanine), 카테킨, 탄닌류, 파이로갈롤, 파이로카테콜, 헤파린-카테콜, 키토산-카테콜, 폴리에틸렌글리콜-카테콜, 폴리에틸렌이민-카테콜, 폴리메틸메타크릴레이트-카테콜, 히알루론산-카테콜, 폴리라이신-카테콜 (polylysine-catechol), 및 폴리라이신 (polylysine)을 포함하는 군으로부터 선택된 것일 수 있다.
본 발명의 일 구체예로서, 상기 프라이머는 티올, 아민, 하이드록실, 카복실, 이소티오시아네이트, NHS 에스테르, 알데히드, 에폭시드, 카보네이트, HOBt 에스테르, 글루타르알데히드, 카바메이트, 이미다졸 카바메이트, 말레이미드, 아지리딘, 설폰, 비닐설폰, 하이드라진, 페닐 아자이드, 벤조페논, 안트라퀴논, 및 디엔 기를 포함하는 군으로부터 선택된 1 이상으로 말단이 변형된 것일 수 있다.
본 발명의 일 구체예로서, 상기 코팅은 5-하이드록시도파민 염산이고, 상기 프라이머는 티올 또는 아민 기로 말단이 변형된 것일 수 있다.
본 발명의 일 구체예로서, 상기 표적 돌연변이 유전자 검출용 템플레이트의 프라이머 결합부는 서열번호 2로 기재되는 염기서열을 포함할 수 있다.
본 발명의 표적 돌연변이 유전자 검출용 미세 유동 장치로 검출할 수 있는 돌연변이 유전자의 종류에는 제한이 없다. 당 업계에 알려진 다양한 돌연변이 유전자에 대하여 본 발명을 적용할 수 있다.
본 발명의 일 구현예로서, 상기 돌연변이 유전자는 암에서 나타나는 암 특이적인 돌연변이 유전자가 될 수 있다. 암 특이적인 돌연변이 유전자는 http://www.mycancergenome.org와 같은 웹사이트, 그 외 당업계에 알려진 임의의 암 특이적인 돌연변이 유전자가 될 수 있다. 예를 들어, 상기 돌연변이 유전자는 암을 유발하는 유전자인 발암성 돌연변이 유전자가 될 수 있고, 구체적으로 폐암 특이적 돌연변이 유전자 일 수 있으며, 보다 구체적으로 EGFR 엑손 19번 결실이 일어난 유전자일 수 있으며, 이에 제한되지 않는다.
각각의 암에서 나타나는 유전자의 돌연변이에 대해서는 하기와 같은 것들이 보고되어 있다(http://www.mycancergenome.org 발췌);
급성 림프아세포성 백혈병(Acute Lymphoblastic Leukemia)의 CRLF2 또는 JAK2 유전자의 돌연변이, 급성 골수성 백혈병(Acute Myeloid Leukemia)의 CBFB-MYH11, DEK-NUP214, DNMT3A, FLT3, IDH1, IDH2, KIT, MLL-MLLT3, PML-RARA, RBM15-MKL1, RPN1-EVI1, 또는 RUNX1-RUNX1T1 유전자의 돌연변이, 역형성대세포림프종(Anaplastic Large Cell Lymphoma)의 ALK 유전자 돌연변이, 기저세포암(Basal Cell Carcinoma)의 SMO 유전자 돌연변이, 방광암(Bladder Cancer)의 TSC1 유전자 돌연변이, 유방암(Breast Cancer)의 AKT1, AR, ERBB2, ESR1, FGFR1, FGFR2, PGR, PIK3CA, 또는 PTEN 유전자 돌연변이, 만성 골수성 백혈병(Molecular Profiling of Chronic Myeloid Leukemia)의 BCR-ABL1 유전자의 돌연변이, 대장암(Colorectal Cancer)의 AKT1, BRAF, KRAS, NRAS, PIK3CA, PTEN, 또는 SMAD4 유전자의 돌연변이, 위장관 기질 종양(Gastrointestinal Stromal Tumor (GIST))의 BRAF, KIT, 또는 PDGFRA 유전자의 돌연변이, 위암(Gastric Cancer)의 ERBB2 유전자의 돌연변이, 교종(Glioma)의 BRAF, IDH1, 또는 IDH2 유전자의 돌연변이, 염증성 근섬유아세포종(Inflammatory Myofibroblastic Tumor)의 ALK 유전자의 돌연변이, 폐암(Lung Cancer)의 AKT1, ALK, BRAF, DDR2, EGFR, ERBB2, FGFR1, FGFR3, KRAS, MAP2K1, MET, NRAS, NTRK1, PIK3CA, PTEN, RET, RICTOR, 또는 ROS1 유전자의 돌연변이, 수모세포종(Medulloblastoma)의 SMO 유전자의 돌연변이, 흑색종(Melanoma)의 BRAF, CTNNB1, GNA11, GNAQ, KIT, MAP2K1, NF1, 또는 NRAS 유전자의 돌연변이, 골수이형성 증후군(Myelodysplastic Syndromes)의 ASXL1, BCOR, DNMT3A, ETV6, EZH2, NF1, RUNX1, SF3B1, SRSF2, STAG2, TET2, TP53, U2AF1 또는 ZRSR2 유전자의 돌연변이, 신경아세포종(Neuroblastoma)의 ALK 유전자의 돌연변이, 난소암(Ovarian Cancer)의 BRAF, KRAS, PIK3CA, 또는 PTEN 유전자의 돌연변이, 횡문근육종(Rhabdomyosarcoma)의 ALK 유전자 돌연변이, 흉선암(Thymic Malignancies)의 KIT 유전자 돌연변이, 및 갑상선암(Thyroid Cancer)의 BRAF, HRAS, KRAS, NRAS, 또는 RET 유전자의 돌연변이.
본 발명으로 검출될 수 있는 돌연변이 유전자는 암과 관련된 돌연변이 유전자에 한정되지 않으며, 그 외에 다른 선천적 또는 후천적 질환 또는 기형과 관련된 것도 임의의 돌연변이 유전자가 될 수 있다.
본 발명으로 검출될 수 있는 돌연변이 유전자는 정상 유전자와 1개 이상의 염기가 치환, 결실 또는 부가된 것인 임의의 돌연변이 유전자가 될 수 있다.
본 발명의 다른 구현예로서, 상기 돌연변이 유전자는 2 이상의 염기가 연속적 또는 불연속적으로 치환, 결실 또는 부가된 돌연변이 유전자일 수 있다.
본 발명의 표적 돌연변이 유전자 검출용 템플레이트의 제 1 표적 돌연변이 유전자 결합 부위 및 제 2 표적 돌연변이 유전자 결합 부위는 돌연변이 유전자에만 상보적으로 결합하고 정상 유전자에는 결합하지 않도록 디자인할 수 있다.
본 발명의 돌연변이 유전자는, 예를 들어 EGFR(epidermal growth factor receptor) 유전자의 돌연변이가 될 수 있다. 예컨대 상기 돌연변이 유전자는 EGFR 엑손 19번 결실(이하 'EGFR 19del')이 일어난 유전자가 될 수 있다.
EGFR 19del은 EGFR 유전자의 엑손 19에 있어서 수 개 내지 십 수개의 염기가 연속해서 결실된 것으로서, 복수의 변이형이 알려져 있다. EGFR 19del의 변이형에 대하여 하기 표 1에 예시적으로 나타내었다. 하기 표에서, '-'는 결실부를 의미하고, 소문자는 변이부를 의미하며, '야생형'은 결실이 일어나지 않은 정상 EGFR 엑손 19 부분의 유전자를 의미한다. 국내공개특허 제10-2012-0125164호에는 EGFR 엑손 19 다형에 대해 다양하게 기재되어 있으며, 그 외 다수의 문헌에 EGFR 엑손 19 다형에 대해 보고되어 있다. 그러나 EGFR 19del은 하기 표 1에 기술한 것에 제한되지 않는다.
[표 1]
Figure PCTKR2017000998-appb-I000001
상기 EGFR 19del은 비소세포 폐암(Non-Small Cell Lung Cancer, NSCLC) 등의 폐암에서 흔하게 일어나는 돌연변이이며, 그 중에서 조직학적으로 선암의 경우에 많이 관찰된다. EGFR 19del이 발생했는지 여부는 폐암을 확진하는데 사용될 수 있다. 또한 EGFR 19del이 발생한 폐암 환자를 치료하는데 사용될 수 있는 표적 항암제로서 이레사(성분명: 게피티닙), 타쎄바(성분명: 엘로티닙), 지오트립(성분명: 아파티닙) 등이 시판되고 있고, EGFR 19del이 발생한 폐암에 대한 다수의 표적항암제가 현재 개발 또는 임상실험 중에 있다. EGFR 19del이 없는 폐암 환자에게 이러한 표적 항암제를 처방하는 경우, 초기에는 반응이 있지만 점차 항암 효과가 기대만큼 나타나지 않는 경우가 빈번하다. 그렇게 되면 환자의 경제적 부담이 커질 뿐 아니라 다른 적절한 항암제로 치료될 기회를 놓치게 되어 치료 예후가 나빠질 수 있다.
본 발명의 미세 유동 장치를 이용하면, 다양한 변이형의 EGFR 19del이 발생한 돌연변이 유전자를 신속하고 정확하게 검출할 수 있으므로, 폐암 확진에 이용할 수 있고, 또한 적절한 항암제를 선택할 수 있게 하여 폐암 환자의 치료 계획을 수립하는 데 결정적인 도움이 될 수 있다.
본 발명은 다음 단계를 포함하는 표적 돌연변이 유전자 검출용 미세 유동 장치를 제조하는 방법을 제공한다.
1) 기판, 상기 기판 상에 형성된 유입구, 상기 유입구와 연결되어 유입된 시료용액을 수용하는 제 1 유로, 상기 제 1 유로와 연결된 제 2 유로, 상기 제 2 유로와 연결된 배출구를 포함하는 미세 유동 장치를 제공하는 단계;
2) 상기 미세 유동 장치의 제 2 유로 표면을 코팅하는 단계;
3) 상기 코팅 상에 프라이머를 고정시키는 단계; 및
4) 상기 고정된 프라이머에 표적 돌연변이 유전자 검출용 템플레이트를 결합시키는 단계.
또한 본 발명은 다음 단계를 포함하는 상기 표적 돌연변이 유전자 검출용 미세 유동 장치를 이용하여 표적 돌연변이 유전자를 검출하는 방법을 제공한다.
a) 상기 표적 돌연변이 유전자 검출용 미세 유동 장치를 제공하는 단계;
b) 시료 용액을 상기 표적 돌연변이 유전자 검출용 미세 유동 장치의 유입구로 주입하는 단계; 및
c) 상기 미세 유동 장치의 제 2 유로에 리가아제를 첨가하는 단계;
d) 상기 미세 유동 장치의 제 1 유로에 dNTP 및 등온 핵산 중합효소를 첨가하는 단계.
본 발명의 일 구현예로서, 상기 c) 단계와 d) 단계는 동시에 수행될 수도 있고(즉, 라이게이션과 회전환 증폭 반응이 동시에 일어나도록 함) 또는 c) 단계 후 d) 단계가 수행되도록(즉, 라이게이션 후 회전환 증폭 반응이 일어나도록 함) 할 수도 있다. c) 단계와 d) 단계를 동시 또는 각각 일어나도록 하는 것은 검출하고자 하는 표적 물질의 수 및 종류 등에 따라 결정될 수 있다.
본 발명의 일 구체예로서, 상기 방법은
e) 상기 미세 유동 장치의 유입구에 염색 시약, 고염 용액 또는 형광 시약을 주입하는 단계를 더 포함할 수 있다.
본 발명의 표적 돌연변이 유전자 검출용 미세 유동 장치는 사람 및 동물에서 발생하는 다양한 돌연변이 유전자의 검출에 이용할 수 있다. 상기 동물은 포유류, 조류, 파충류, 양서류, 어류 등을 모두 포함한다.
본 발명은 표적 유전자 검출용 미세 유동 장치;
dNTP;
리가아제;
등온 핵산 중합효소; 및
추가 프라이머를 포함하는, 표적 유전자 검출용 미세 유동 장치 키트를 제공한다.
상기 미세 유동 장치는
기판;
상기 기판 상에 형성된 시료용액이 외부로부터 유입되는 유입구;
상기 유입구와 연결되어 유입된 시료용액을 수용하는 제 1 유로;
상기 제 1 유로와 연결된 제 2 유로;
상기 제 2 유로와 연결된 배출구를 포함하는 표적 유전자 검출용 미세 유동 장치로서,
상기 제 2 유로 표면은 코팅되어 있고;
상기 코팅 상에 프라이머가 고정되고;
상기 고정된 프라이머에는 표적 유전자 검출용 템플레이트가 결합되어 있으며,
상기 표적 유전자 검출용 템플레이트는 상기 프라이머에 상보적으로 결합하는 프라이머 결합부, 상기 프라이머 결합부의 일 말단에 결합된 제 1 템플레이트 내 상보적인 결합 부위-제 1 표적 유전자 결합 부위, 및 상기 프라이머 결합부의 다른 말단에 결합된 제 2 템플레이트 내 상보적인 결합 부위-제 2 표적 유전자 결합 부위를 포함하는, 표적 유전자 검출용 미세 유동 장치이며, 상기 표적 유전자 검출용 미세 유동 장치의 구체적인 구성 및 특징은 출원번호 제10-2015-0151941호(발명의 명칭: 표적 유전자 검출용 미세 유동 장치, 이의 제조방법 및 이를 이용한 검출 방법)에 기재된 바와 같다.
본 발명의 일 구현예로서, 상기 추가 프라이머(additional primer)는 상기 표적 유전자 검출용 템플레이트의 프라이머 결합부의 전체 서열, 또는 일부 서열일 수 있고, 예를 들어 5 내지 50개, 바람직하게는 10 내지 25개, 보다 바람직하게는 15 내지 22개 염기 길이의 일부 서열일 수 있다.
예컨대 본 발명의 표적 유전자 검출용 템플레이트의 프라이머 결합부가 서열번호 2(5'-TA GCA TGC TAG TAT CGA CGT-3')인 경우, 추가 프라이머 서열은 상기 서열과 동일한 서열, 또는 상기 서열의 일부에 해당하는 서열이 될 수 있으며, 상기 서열의 일부에 해당하는 서열인 경우 바람직하게는 10 내지 25개 염기로 이루어진 서열, 예컨대 서열번호 3(5' TGC TAG TAT C 3')이 될 수 있다.
본 발명의 일 구체예로서, 상기 리가아제는 DNA 리가아제, 예컨대 T7 리가아제, 또는 써클리가아제™(CircLigase™)일 수 있다. 또한 상기 등온 핵산 중합효소는 phi 29 폴리머라제일 수 있다.
본 발명의 다른 구체예로서, 상기 키트는 디티오트레이톨(DTT) 또는 파이로포스파타제(phyrophosphatase)를 더 포함할 수 있다.
또한 상기 키트는 염색 시약, 고염 용액(high salt solution), 또는 형광 시약을 더 포함할 수 있다.
또한 본 발명은 a) 표적 유전자 검출용 미세 유동 장치를 제공하는 단계;
b) 시료 용액을 상기 미세 유동 장치의 유입구로 주입하는 단계; 및
c) 상기 미세 유동 장치의 제 2 유로에 dNTP, 리가아제, 등온 핵산 중합효소, 및 추가 프라이머를 첨가하는 단계를 포함하는, 미세 유동 장치를 이용하여 표적 유전자를 검출하는 방법을 제공한다.
상기 표적 유전자 검출방법은 추가 프라이머를 첨가하여 회전환 증폭되는 서열 중간 중간에 추가 프라이머가 결합되어 2차 증폭이 일어남으로써 더욱 빠르게 많은 양으로 템플레이트의 증폭이 일어난다. 즉, 추가 프라이머를 첨가함으로써 핵산 덩어리가 증폭되는 시간이 크게 단축되어 훨씬 더 빨리 검출될 수 있고, 또한 적은 양의 표적 유전자가 시료에 포함되어 있는 경우, 또는 시료의 양 자체가 적은 경우에도 추가 프라이머에 의한 2차 증폭을 통해 증폭 사이트를 증가시킴으로써 템플레이트 증폭이 많이 일어나 큰 핵산 덩어리를 형성할 수 있으므로 검출의 정확도가 높아진다.
본 발명의 일 구체예에 따르면, 본 발명의 표적 유전자 검출 방법은 추가 프라이머를 첨가함으로써 2차 증폭(추가 증폭)을 통해 생성된 딸가닥(daughter strand)이 1차 증폭을 통해 생성된 모가닥(mother strand)과 상보적인 결합을 하여 더욱 빠르고 견고하게 DNA 하이드로겔을 형성하여 기존의 검출 방법에 비해 검출 효율이 개선되었다.
상기 추가 프라이머를 포함하는 표적 유전자 검출용 미세 유동 장치 키트를 이용하여 표적 유전자를 검출하는 방법은 동물, 식물, 세균, 바이러스, 진균, 환경 등 모든 기원(origin)에서 유래될 수 있는 유전자의 검출에 적용할 수 있다.
본 발명의 일 구체예에 따르면, 상기 검출하고자 하는 표적 유전자는 병원균 유전자 일 수 있다. 상기 표적 유전자로는 핵산 서열을 아는 모든 병원균을 대상으로 할 수 있다. 구체적으로, 상기 병원균은 조류독감, 사스(SARS), 대장균 O157:H7 (Escherichia coli O157:H7), 결핵(Mycobacterium tuberculosis), 탄저병(Bacillus anthracis), 폐렴(Streptococcus pneumonia), 말라리아(Plasmodium), 살모넬라(Salmonella), 간염(Hepatitis A,B,C,D 및 E virus), 야토병균(Francisella tularensis), 페스트균(Yersinia pestis), 에르시니아 엔테로콜리티카(Yersinia enterocolitica) 및 출혈열(Ebola virus), 메르스 코로나 바이러스(MERS-Cov virus)의 검출에 유용하다. 또한, 본 발명의 일 구체예에 따르면, 상기 병원균은 폐렴상구균, 장내구균, 포도상구균, 열대열원충 및 제 3세계에서의 결핵 또는 말라리아 박테리아와 같은 항생제 저항을 갖는 병원균의 검출에도 유용하다.
본 발명의 다른 구현예에 따르면, 상기 검출하고자 하는 표적 유전자는 돌연변이 유전자 일 수 있다. 구체적으로, 상기 돌연변이 유전자는 암에서 나타나는 암 특이적인 돌연변이 유전자가 될 수 있다. 암 특이적인 돌연변이 유전자는 당업계에 알려진 임의의 암 특이적인 돌연변이 유전자 일 수 있으며, 구체적인 암 특이적 돌연변이 유전자는 상기 기재한 바와 같다. 보다 구체적으로, 폐암 특이적 돌연변이 유전자 일 수 있고, 예컨대 EGFR 엑손 19번 결실이 일어난 유전자일 수 있으며, 이에 제한되지 않는다.
본 발명은 핵산 증폭을 위하여 온도를 변화시킬 필요가 없고, 외부의 동력 공급이 없어도 표적 돌연변이 유전자를 검출할 수 있다. 따라서 복잡한 장비를 수반할 필요가 없으며, 간단하고 저렴하게 제조가 가능하고, 조작이 간편하며, 휴대가 용이하다. 또한 다양한 돌연변이 유전자의 검출에 이용할 수 있고, 2 이상의 돌연변이 유전자를 동시에 검출하는데 이용할 수 있다.
또한 본 발명의 추가 프라이머를 포함하는 표적 유전자 검출용 미세 유동 장치 키트; 및 이를 이용한 검출 방법을 이용하면 기존의 표적 물질 검출용 미세 유동 장치의 검출 소요 시간을 크게 단축시키고 검출의 정확성을 높일 수 있다.
도 1은 본 발명의 표적 돌연변이 유전자 검출용 미세 유동 장치를 이용하여 서열번호 5의 EGFR 엑손 19 결실 돌연변이가 발생한 유전자를 검출한 결과를 형광으로 확인한 도이다.
도 2는 추가 프라이머가 첨가됨으로써 2차 회전환 증폭이 일어나 템플레이트의 증폭이 더욱 빠르고 많이 될 수 있음을 보여주는 모식도이다.
도 3은 동일한 표적 유전자 검출용 미세 유동 장치를 사용하여, 본 발명자들이 기존에 개발한 방법(DhITACT(DNA Hydrogel Formation by Isothermal Amplification of Complementary Target in Fluidic Channels)로 명명)에 의해 표적 유전자를 검출한 결과((a) 및 (c))와 이번에 개발한 추가 프라이머를 첨가한 방법(DhITACT-TR)에 의해 표적 유전자를 검출한 결과((b) 및 (d))를 각각 보여주는 도이다.
도 4는 DhITACT를 통해 형성된 표적 메르스 코로나바이러스 유전자 하이드로겔의 원자간력현미경(Atomic Force Microscope; AFM) 이미지를 나타낸 도이다.
도 5는 DhITACT-TR를 통해 형성된 표적 메르스 코로나바이러스 유전자 하이드로겔의 원자간력현미경(Atomic Force Microscope; AFM) 이미지를 나타낸 도이다.
도 6은 DhITACT 및 DhITACT-TR를 통해 형성된 표적 메르스 코로나바이러스 유전자 하이드로겔의 리올로지 측정 결과를 나타낸 도이다.
도 7은 추가 프라이머를 첨가한 본 발명의 표적 유전자 검출 방법에 의해 서열번호 5의 EGFR 엑손 19 결실 돌연변이가 발생한 유전자를 검출한 결과를 형광으로 확인한 도이다.
이하, 본 발명의 이해를 돕기 위하여 도면을 참조하여 상세하게 설명하기로 한다. 다만 하기의 설명은 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 설명에 한정되는 것은 아니며 다른 형태로 구체화될 수도 있다. 또한, 도면들에 있어서, 구성요소의 폭, 길이, 두께 등은 편의를 위하여 과장되어 표현될 수도 있다. 명세서 전체에 걸쳐서 동일한 참조번호들은 동일한 구성요소들을 나타낸다. 또한, 일 구성요소가 다른 구성요소 위에 있다고 할 때, 이는 다른 구성요소 바로 위에 있는 경우 뿐 아니라, 그 중간에 또 다른 구성요소가 있는 경우도 포함한다.
표적 돌연변이 유전자 검출용 미세 유동 장치
본 발명의 표적 돌연변이 유전자 검출용 미세 유동 장치의 기본 구조, 제조 방법, 및 이를 이용한 표적 돌연변이 유전자 검출 방법은 출원번호 제10-2015-0151941호(발명의 명칭: 표적 유전자 검출용 미세 유동 장치, 이의 제조방법 및 이를 이용한 검출 방법)에 기재된 바와 같다.
본 발명의 표적 돌연변이 유전자 검출용 미세 유동 장치에 의해 검출될 수 있는 표적 돌연변이 유전자의 종류에는 제한이 없으며, 정상 유전자와 1개 이상의 염기 차이가 있는 임의의 돌연변이 유전자가 될 수 있다. 본 발명으로 검출될 수 있는 돌연변이 유전자는 선천적 또는 후천적 질환 또는 기형과 관련된 임의의 돌연변이 유전자가 될 수 있다.
본 발명의 일 구현예로서, 상기 돌연변이 유전자는 2 이상의 유전자가 연속적 또는 불연속적으로 치환 또는 결실된 돌연변이 유전자일 수 있다.
예를 들어, 상기 돌연변이 유전자는 EGFR 19del의 일종인 서열번호 5로 기재되는 유전자가 될 수 있다. 상기 돌연변이 유전자를 정상 유전자와 비교하면 하기 표 2와 같다.
[표 2]
Figure PCTKR2017000998-appb-I000002
이 경우 본 발명의 표적 돌연변이 유전자 검출용 템플레이트를 하기와 같이 디자인할 수 있다(서열번호 6).
Figure PCTKR2017000998-appb-I000003
상기 서열에서, 진한 글씨로 표시한 제 1 표적 돌연변이 유전자 결합 부위 및 제 2 표적 돌연변이 유전자 결합 부위는 각각 서열번호 5의 돌연변이 유전자에서 'AAATTCCCGGGA' 및 'ATTAAGAGAAGCCAACAAGG'에 상보적으로 결합한다. 즉, 표적 돌연변이 유전자 결합 부위가 돌연변이 유전자에만 상보적으로 결합하도록 템플레이트를 디자인할 수 있다.
상기 진한 회색으로 표시한 부분은 '프라이머 결합부'로서, 서열번호 1(5′-Thiol-AAA AAA AAA GGG ACG TCG ATA CTA GCA TGC TA-3′)로 표시되는 프라이머와 상보적으로 결합하도록 제조되었다(서열번호 2). 또한 상기 연한 회색으로 표시한 부분은 템플레이트 내 서로 상보적으로 결합하는 부분(제 1 템플레이트 내 상보적인 결합 부위 및 제 2 템플레이트 내 상보적인 결합 부위)이다.
표적 물질 검출용 미세 유동 장치의 검출 효율을 개선하는 방법
본 발명자들이 발명한 표적 물질 검출용 미세 유동 장치, 즉 표적 유전자 검출용 미세 유동 장치를 이용하여 표적 유전자를 검출하는 방법은, 출원번호 제10-2015-0151941호(발명의 명칭: 표적 유전자 검출용 미세 유동 장치, 이의 제조방법 및 이를 이용한 검출 방법)에 기재된 바와 기본적으로 동일하나, 회전환 증폭을 위해 dNTP, 리가아제, 등온 핵산 중합효소 등을 첨가할 때 추가 프라이머(additional primer)도 첨가한다는 차이점이 있다.
상기 추가 프라이머(additional primer)는 미세 유동 장치에 사용되는 표적 유전자 검출용 템플레이트의 프라이머 결합부의 전체 서열 또는 일부 서열이 될 수 있으며, 예컨대 10 내지 25개 염기 길이의 일부 서열일 수 있다.
도 2의 모식도에서 상단의 2개 도는 기존 출원의 방법에서 회전환 증폭이 일어나는 과정을 나타낸 것이며, 하단의 도는 추가 프라이머를 첨가한 경우에 회전환 증폭되는 서열 중간 중간에 추가 프라이머가 결합되어 2차 증폭이 일어남으로써 더욱 빠르게 많은 양으로 템플레이트의 증폭이 일어나는 과정을 나타낸 것이다. 즉, 추가 프라이머를 첨가함으로써 핵산 덩어리가 증폭되는 시간이 크게 단축되어 훨씬 더 빨리 검출될 수 있고, 또한 적은 양의 표적 물질이 시료에 포함되어 있는 경우, 또는 시료의 양 자체가 적은 경우에도 템플레이트 증폭이 많이 일어나 큰 핵산 덩어리를 형성할 수 있으므로 검출의 정확도가 높아진다.
실시예
이하, 본 발명의 이해를 돕기 위하여 실시예를 제시한다. 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
실시예 1. 표적 유전자(암 돌연변이 유전자) 검출용 미세 유동장치를 이용한 EGFR 19del 검출
1-1. EGFR 19del 검출용 미세 유동 장치의 제조
ibidi 사에서 제조한 1 μ-Slide Ⅲ 3in1uncoated Microscopy Chamber 제품을 구입하여 준비하였다.
제 2 유로의 코팅물질로서 5-하이드록시도파민 염산(5-hydroxydopamine HCl)을 사용하였다. 구체적으로, 5-하이드록시도파민 염산(Sigma Aldrich)을 1 mg/ml 농도로 10 mM Tris 완충액(1M UltraPure 1M Tris-HCl pH 8.0 / Invitrogen)에 녹였다. 그 후 pH를 8로 맞추어 코팅용 조성물을 제조하였다. 상기 코팅용 조성물로 상기 1 μ-Slide Ⅲ 3in1uncoated Microscopy Chamber 제품의 각 제 2 유로를 채웠다. 2시간 후 DDW(Water Purification System / LABOGENE)로 세척(washing) 하였다.
또한 상기 제 2 유로의 코팅 상에 부착시킬 프라이머를 준비하였다. 프라이머는 하기 서열을 갖는 Primer-5SS-polyA9 (BIONEER)를 구입하여 사용하였다. 하기 프라이머 서열의 5′ 말단은 티올기가 결합되어 있다.
5′-Thiol-AAA AAA AAA GGG ACG TCG ATA CTA GCA TGC TA-3′ (서열번호 1)
상기 프라이머 100 pmol과 5 M DTT(DL-Dithiothreitol/Sigma Aldrich)를 준비한 후, 100 pmol의 프라이머에 5 M DTT 5 ㎕를 첨가하고, 여기에 총 50 ㎕가 되게 DDW(Water Purification System/LABOGENE)를 첨가하여 프라이머 조성물을 제조하였다. DTT에 의해 프라이머 내에 생성되었을 수 있는 이황화 결합이 끊어지도록 4시간 동안 방치한 후, 3K 아미콘 튜브(amicon tube)(Amicon Ultra Centrifugal Filters 3K / MILLIPORE)를 이용하여 132,000 rpm, 4 ℃, 25분에서 1차 원심분리하고, 40 ㎕ DDW를 첨가하고 2차 원심분리하여 반응 후 남아있는 DTT를 완전히 제거하였다. 상기 DTT가 제거된 프라이머 조성물을 제 2 유로마다 5 ㎕씩 넣고 2시간 동안 방치하여 프라이머가 제 2 유로의 코팅 상에 부착되도록 한 후, DDW(Water Purification System / LABOGENE)로 세척(washing) 하였다.
또한 서열번호 5로 기재되는 EGFR 19del 검출용 템플레이트(서열번호 6)을 하기와 같이 제조하였다.
100 μM의 상기 EGFR 19del 검출용 템플레이트 0.2 ㎕(=20 pmole)에 1X PBS(life technoligies사의 gibcoㄾ)를 첨가하여 5 ㎕의 EGFR 19del 검출용 템플레이트 조성물을 제조하여 미세 유동 장치의 2개의 제 2 유로(중앙 및 위에서 보았을 때 좌측)에 각각 넣었다. 상기 EGFR 19del 검출용 템플레이트의 프라이머 결합부와 제 2 유로에 고정된 프라이머 간에 상보적 결합이 일어나도록 2시간 동안 방치한 후 DDW(Water Purification System / LABOGENE) 세척하였다. 한편 우측 유로에는 닉(nick) 부분에 라이게이션이 이미 일어난 EGFR 19del 검출용 템플레이트를 넣었다(양성 대조군).
1-2. EGFR 19del 검출
서열번호 5의 EGFR 19del 유전자를 포함하는 용액을 시료 용액으로서 준비하였다. 음성 대조군 용액으로는 서열번호 4의 EGFR 정상 유전자를 포함하는 용액을 준비하였다. 상기 시료용액을 중앙의 제2유로에, 음성 대조군 용액을 가장 왼쪽의 제2유로에 3.5 ㎕씩 각각 유입시켰다. T7 리가아제 30 ㎕, 100 mM DTT 0.2㎕, DDW(Water Purification System/LABOGENE) 24.8 ㎕로 표적 유전자 검출용 미세 유동 장치의 제 2 유로를 채웠다. 제 2 유로 내 안의 수분이 날아가는 것을 방지하기 위해 파라 필름으로 밀봉한 플라스틱 용기 안에 넣었다. 플라스틱 안은 물에 적신 휴지와 30 ℃ 물로 채웠다. 그 후 무교반(non-shaking), 30 ℃, 3시간 조건에 방치하여 EGFR 19del 검출용 템플레이트의 닉(nick)의 라이게이션이 일어나도록 하였다.
그 다음 25 mM dNTP 2 ㎕, phi 29 폴리머라제(10 unit/㎕) 50 ㎕, 파이로포스파타제(pyrophosphatase) 1 ㎕, 각 효소의 반응 완충액, 및 DDW의 혼합물 약 60 ㎕를 주입하였다(유입구를 통하여 주입하여 제 1 유로를 따라 제 2 유로로 흘러들어가도록 하거나, 각각의 제 2 유로에 주입할 수도 있음). 제 2 유로 내 안의 수분이 날아가는 것을 방지하기 위해 파라 필름으로 밀봉한 플라스틱 용기 안에 넣었다. 플라스틱 안은 물에 적신 휴지와 30 ℃ 물로 채웠다. 그 후 무교반(non-shaking), 30 ℃, 2시간 조건에 방치하여 EGFR 19del 검출용 템플레이트의 회전환 증폭 반응이 일어나도록 하였다.
형광으로 확인한 결과, 도 1의 중앙 유로에서, EGFR 19del 검출용 템플레이트가 증폭되어 제 2 유로를 코팅한 하이드록시도파민 염산과 함께 엉겨 큰 하이드로겔 덩어리를 형성하여 제 2 유로의 배출구를 막음을 알 수 있었다. 양성 대조군인 우측 유로에서도 마찬가지로 제 2 유로의 배출구를 막음을 확인하였다. 반면 음성 대조군인 좌측 유로에서는 형광이 확인되지 않았다.
실시예 2. 미세 유동 장치의 검출 효율을 더욱 증가시키는 방법
본 발명자들은 표적 유전자 검출용 미세 유동 장치를 발명한 바 있다. 본 발명자들은 상기 미세유동장치의 검출 시간을 단축하고 정확도를 높이는 방법을 하기와 같이 발명하였다.
2-1. 표적 메르스(MERS) 유전자 검출
출원번호 제10-2015-0151941호의 실험예 5에 기재된 바와 같이 표적 메르스(MERS) 유전자 검출용 미세 유동 장치를 제조하였다. 상기 장치의 기본 구조는 상기 1-1에서 기재한 바와 같으며, 템플레이트 서열은 하기와 같다.
Figure PCTKR2017000998-appb-I000004
상기 템플레이트 메르스(MERS) 서열에서, 표적 메르스 코로나바이러스 유전자에 상보적인 부분을 굵은 글씨로, 템플레이트 내 서로 상보적인 부분을 연한 회색 바탕으로, 프라이머에 상보적으로 결합하는 부분을 진한 회색으로 표시하였다.
또한 상기 템플레이트 서열의 제 1 표적 유전자 결합 부위 및 제 2 표적 유전자 결합 부위가 상보적으로 결합하는 표적 메르스 코로나바이러스 유전자 서열은 하기와 같다.
5'-/CG GAG AUG UGC CCU GGG UAU/3Phos/-3' (서열번호 7)
제조된 표적 메르스(MERS) 유전자 검출용 미세 유동 장치에, 1-2의 방법과 동일하게 상기 시료용액을 중앙의 제2유로에, 음성 대조군 용액을 가장 왼쪽의 제2유로에 3.5 ㎕씩 각각 유입시켰다. T7 리가아제 30 ㎕, 100 mM DTT 0.2 ㎕, DDW(Water Purification System/LABOGENE) 24.8 ㎕로 표적 유전자 검출용 미세 유동 장치의 제 2 유로를 채웠다. 제 2 유로 내 안의 수분이 날아가는 것을 방지하기 위해 파라 필름으로 밀봉한 플라스틱 용기 안에 넣었다. 플라스틱 안은 물에 적신 휴지와 30 ℃ 물로 채웠다. 그 후 무교반(non-shaking), 30 ℃, 3시간 조건에 방치하여 템플레이트의 닉(nick)의 라이게이션이 일어나도록 하였다.
그 다음 25 mM dNTP 2 ㎕, phi 29 폴리머라제(10 unit/㎕) 50 ㎕, 파이로포스파타제(pyrophosphatase) 1 ㎕, 각 효소의 반응 완충액, 및 DDW의 혼합물 약 60 ㎕를 주입하였다(유입구를 통하여 주입하여 제 1 유로를 따라 제 2 유로로 흘러들어가도록 하거나, 각각의 제 2 유로에 주입할 수도 있음). 제 2 유로 내 안의 수분이 날아가는 것을 방지하기 위해 파라 필름으로 밀봉한 플라스틱 용기 안에 넣었다. 플라스틱 안은 물에 적신 휴지와 30 ℃ 물로 채웠다. 그 후 무교반(non-shaking), 30 ℃, 2시간 조건에 방치하여 템플레이트의 회전환 증폭 반응이 일어나도록 하였다. 30분 경과 후에 형광으로 관찰하였을 때 템플레이트가 증폭된 것을 관찰할 수 없었다(도 3의 (a)). 약 2시간 후에 템플레이트가 증폭되어 하이드로겔 덩어리를 형성되었다.
그런데 이와 동일하게 표적 메르스(MERS) 유전자 검출용 미세 유동 장치를 준비하고 MERS 바이러스 유전자가 포함된 시료 용액을 주입하고 라이게이션 반응 및 회전환 증폭 반응이 차례로 일어나도록 하였다. 이 때 회전환 증폭 반응 시 '추가 프라이머'(additional primer, 짧은 DNA 서열로 이루어짐)를 더 첨가하였다. 첨가된 추가 프라이머 서열은 하기와 같다.
5' TGC TAG TAT C 3'(서열번호 3)
30분 후 형광으로 관찰하였을 때, 템플레이트가 증폭되어 하이드로겔 덩어리를 형성하는 것을 관찰할 수 있었다(도 3의 (b)). 즉, 추가 프라이머가 첨가된 경우 증폭에 소요되는 시간이 크게 단축되었다.
또한 추가 프라이머를 첨가하지 않은 경우와 첨가한 경우 각각 4시간 후에 염색약을 주입하여 육안으로 확인한 결과, 추가 프라이머를 첨가하지 않은 경우에는 템플레이트 증폭이 일어난 경우(중앙 유로)를 음성 대조군(좌측 유로)과 구별할 수 없었으나, 추가 프라이머를 첨가한 경우에는 음성 대조군에서만 제 2 유로가 막히지 않고 나머지 2개 유로에서는 유로가 막힌 것을 명확히 확인할 수 있어, 템플레이트 증폭이 일어난 경우와 음성 대조군을 구별할 수 있었다(도 3의 (c) 및 (d). 즉, 추가 프라이머가 첨가된 경우 적은 양의 표적 메르스 바이러스 유전자가 시료 용액 내에 존재하는 경우에도 높은 감도로 검출이 가능하여 정확도가 증가하였다.
2-2. 추가 프라이머 첨가에 의한 검출 효율 증가 확인
본 발명자들은 또한 추가 프라이머를 첨가함으로써 표적 유전자 검출용 미세 유동 장치의 개선된 검출효율을 확인하기 위하여, 추가적으로 원자간력현미경(Atomic Force Microscope; AFM)을 이용한 하이드로겔의 공극 크기(pore size) 및 리올로지(Rheology)를 측정하였다.
원자간현미경(NX10, Park Systems, 대한민국)를 이용하여 기존 장치로 형성된 상기 실시예 1의 표적 메르스 유전자 하이드로겔 및 추가 프라이머를 첨가하여 증폭시킨 상기 실시예 2-1의 표적 메르스 유전자 하이드로겔 덩어리의 공극 크기를 측정하였으며, 그 결과를 도 4 및 도 5에 나타내었다.
도 4 및 도 5에서 확인되는 바와 같이, 기존 표적 유전자 검출용 미세 유동 장치(DhITACT)를 이용하여 증폭된 하이드로겔의 평균 공극 크기는 56 nm이었으나(도 4), 추가 프라이머를 첨가한 경우(DhITACT-TR) 평균 공극 크기는 16 nm 로(도 5), 그 밀도가 약 3.5배 증가한 것을 확인하였다. 즉, 추가 프라이머를 첨가함으로써 보다 견고한 DNA 하이드로겔 덩어리를 형성하여 검출 효율이 개선되었음을 확인하였다.
또한, DhITACT 및 DhITACT-TR을 통해 형성된 표적 메르스 유전자 하이드로겔의 점탄성을 점탄성 측정기(parallel rheometer, Kinexus, Malvern, 영국)를 이용하여 측정하였으며, 그 결과를 도 6에 나타내었다.
도 6에서 확인되는 바와 같이, DhITACT-TR을 통해 형성된 메르스 유전자 하이드로겔(TR)이 DhITACT을 통해 형성된 하이드로겔(D)에 비해 더욱 점탄성이 높은 겔을 형성하였으며, 저장 탄성율(G') 또한 높았다. 즉, 추가 프라이머를 첨가함으로써 더욱 강한 탄성을 갖는 하이드로겔을 형성하여 미세 유동 장치의 검출 효율이 증가되었음을 확인하였다.
2-3. 표적 EGFR 19del 돌연변이 유전자 검출
본 발명자들은 또한 표적 돌연변이 유전자 검출용 미세 유동 장치를 이용하여 추가 프라이머를 첨가함으로써 증가된 검출 효율을 확인하였다. 상기 1-1에 기재한 바와 같이, EGFR 19del 검출용 미세 유동 장치를 제조하였다. 구체적인 템플레이트 서열(서열번호 6)은 하기와 같으며, 서열에 표시한 의미는 상기 메르스 템플레이트와 같다.
Figure PCTKR2017000998-appb-I000005
또한 상기 템플레이트 서열의 제 1 표적 유전자 결합 부위 및 제 2 표적 유전자 결합 부위가 상보적으로 결합하는 표적 EGFR 19del 유전자 서열은 하기와 같다.
5'-/AAA TTC CCG GGA ATT AAG AGA AGC CAA CAA GG /3Phos/-3' (서열번호 4)
제조된 표적 EGFR 19del 유전자 검출용 미세 유동 장치를 이용하여, 상기 메르스 검출용 미세 유동 장치를 이용한 방법과 동일하게 EGFR 19del 유전자의 증폭을 수행하였으며, 상기 서열번호 3의 추가 프라이머를 첨가하였다.
그 결과, 도 7에 나타난 바와 같이, 템플레이트가 증폭되어 반응 후 30분만에 하이드로겔 덩어리가 형성되는 것을 육안으로 관찰할 수 있었으며, 추가 프라이머가 첨가됨으로써 증폭에 소요되는 시간이 크게 단축되었다. 즉, 추가 프라이머를 첨가하지 않은 상기 실시예 1-2의 표적 EGFR 19del 유전자의 검출은 회전환 증폭 반응 후 2시간이 경과하여 하이드로겔을 육안으로 확인할 수 있었으나(도 1), 추가 프라이머를 첨가한 경우, EGFR 19del 돌연변이 유전자의 증폭에 소요되는 시간이 크게 단축되었다. 따라서, 추가 프라이머가 첨가된 경우 적은 양의 표적 EGFR 19del 돌연변이 유전자가 시료 용액 내에 존재하는 경우에도 높은 감도로 검출이 가능하여 정확도가 증가함을 확인하였다.

Claims (23)

  1. 기판;
    상기 기판 상에 형성된 시료용액이 외부로부터 유입되는 유입구;
    상기 유입구와 연결되어 유입된 시료용액을 수용하는 제 1 유로;
    상기 제 1 유로와 연결된 제 2 유로;
    상기 제 2 유로와 연결된 배출구를 포함하는 표적 돌연변이 유전자 검출용 미세 유동 장치로서,
    상기 제 2 유로 표면은 코팅되어 있고;
    상기 코팅 상에 프라이머가 고정되고;
    상기 고정된 프라이머에는 표적 돌연변이 유전자 검출용 템플레이트가 결합되어 있으며,
    상기 표적 돌연변이 유전자 검출용 템플레이트는 상기 프라이머에 상보적으로 결합하는 프라이머 결합부, 상기 프라이머 결합부의 일 말단에 결합된 제 1 템플레이트 내 상보적인 결합 부위-제 1 표적 돌연변이 유전자 결합 부위, 및 상기 프라이머 결합부의 다른 말단에 결합된 제 2 템플레이트 내 상보적인 결합 부위-제 2 표적 돌연변이 유전자 결합 부위를 포함하는,
    표적 돌연변이 유전자 검출용 미세 유동 장치.
  2. 제1항에 있어서, 상기 제 2 유로는 1 내지 20개인 표적 돌연변이 유전자 검출용 미세 유동 장치.
  3. 제1항에 있어서, 상기 제 2 유로는 2 내지 20개이며, 제 1 유로의 말단에서 각각의 제 2 유로가 분지되고,
    각각의 제 2 유로 상에 고정된 프라이머에 결합된 표적 돌연변이 유전자 검출용 템플레이트는 서로 같거나 다른 돌연변이 유전자에 결합하는, 표적 돌연변이 유전자 검출용 미세 유동 장치.
  4. 제1항에 있어서, 상기 돌연변이 유전자는 암 특이적인 돌연변이 유전자인, 표적 돌연변이 유전자 검출용 미세 유동 장치.
  5. 제4항에 있어서, 상기 암 특이적인 돌연변이 유전자는 EGFR(epidermal growth factor receptor) 19번 엑손 결실이 일어난 유전자인, 돌연변이 유전자 검출용 미세 유동 장치.
  6. 제5항에 있어서, 상기 EGFR 19번 엑손 결실이 일어난 유전자는 서열번호 5로 기재되는 유전자인, 표적 돌연변이 유전자 검출용 미세 유동 장치.
  7. 제1항에 있어서, 상기 표적 돌연변이 유전자 검출용 템플레이트의 제 1 표적 돌연변이 유전자 결합 부위 및 제 2 표적 돌연변이 유전자 결합 부위는 돌연변이 유전자에만 상보적으로 결합하고 정상 유전자에는 결합하지 않는, 표적 돌연변이 유전자 검출용 미세 유동 장치.
  8. 제1항에 있어서, 상기 돌연변이 유전자는 정상 유전자와 비교하여 1 이상의 염기가 치환, 결실 또는 부가된 것인, 표적 돌연변이 유전자 검출용 미세 유동 장치.
  9. 제1항에 있어서, 상기 표적 돌연변이 유전자는 점 돌연변이를 포함하는 유전자이고, 상기 표적 돌연변이 유전자 검출용 템플레이트의 제 1 표적 돌연변이 유전자 결합 부위 또는 제 2 표적 돌연변이 유전자 결합 부위의 말단 염기가 상기 점 돌연변이가 일어난 염기에 상보적으로 결합하는 것인, 표적 돌연변이 유전자 검출용 미세 유동 장치.
  10. 제1항에 있어서, 상기 표적 돌연변이 유전자 검출용 템플레이트는 서열번호 6으로 기재되는 것인, 표적 돌연변이 유전자 검출용 미세 유동 장치.
  11. 표적 유전자 검출용 미세 유동 장치;
    dNTP;
    리가아제;
    등온 핵산 중합효소; 및
    추가 프라이머를 포함하는, 표적 유전자 검출용 미세 유동 장치 키트.
  12. 제11항에 있어서, 상기 표적 유전자 검출용 미세 유동 장치는
    기판;
    상기 기판 상에 형성된 시료용액이 외부로부터 유입되는 유입구;
    상기 유입구와 연결되어 유입된 시료용액을 수용하는 제 1 유로;
    상기 제 1 유로와 연결된 제 2 유로;
    상기 제 2 유로와 연결된 배출구를 포함하고;
    상기 제 2 유로 표면은 코팅되어 있고;
    상기 코팅 상에 프라이머가 고정되고;
    상기 고정된 프라이머에는 표적 유전자 검출용 템플레이트가 결합되어 있으며,
    상기 표적 유전자 검출용 템플레이트는 상기 프라이머에 상보적으로 결합하는 프라이머 결합부, 상기 프라이머 결합부의 일 말단에 결합된 제 1 템플레이트 내 상보적인 결합 부위-제 1 표적 유전자 결합 부위, 및 상기 프라이머 결합부의 다른 말단에 결합된 제 2 템플레이트 내 상보적인 결합 부위-제 2 표적 유전자 결합 부위를 포함하는 것인, 표적 유전자 검출용 미세 유동 장치 키트.
  13. 제12항에 있어서,
    상기 추가 프라이머는 상기 표적 물질 검출용 템플레이트의 프라이머 결합부의 전체 서열, 또는 10~25개 염기 길이의 일부 서열인, 표적 유전자 검출용 미세 유동 장치 키트.
  14. 제11항에 있어서,
    상기 리가아제는 T7 리가아제 또는 써클리가아제™(CircLigase™)인, 표적 유전자 검출용 미세 유동 장치 키트.
  15. 제11항에 있어서,
    상기 등온 핵산 중합효소는 phi 29 폴리머라제인, 표적 유전자 검출용 미세 유동 장치 키트.
  16. 제11항에 있어서,
    상기 키트는 디티오트레이톨(DTT) 또는 파이로포스파타제(phyrophosphatase)를 더 포함하는 것인, 표적 유전자 검출용 미세 유동 장치 키트.
  17. 제11항에 있어서,
    상기 키트는 염색 시약, 고염 용액(high salt solution), 또는 형광 시약을 더 포함하는 것인, 표적 유전자 검출용 미세 유동 장치 키트.
  18. a) 표적 유전자 검출용 미세 유동 장치를 제공하는 단계;
    b) 시료 용액을 상기 미세 유동 장치의 유입구로 주입하는 단계; 및
    c) 상기 미세 유동 장치의 제 2 유로에 dNTP, 리가아제, 등온 핵산 중합효소, 및 추가 프라이머를 첨가하는 단계를 포함하는, 표적 유전자 검출용 미세 유동 장치를 이용하여 표적 유전자를 검출하는 방법.
  19. 제18항에 있어서,
    상기 표적 유전자 검출방법은 추가 프라이머를 첨가함으로써 2차 증폭이 일어나는 것인, 표적 유전자를 검출하는 방법.
  20. 제18항에 있어서,
    상기 표적 유전자는 동물, 동물, 식물, 세균, 바이러스, 진균, 환경에서 유래된 것인, 표적 유전자를 검출하는 방법.
  21. 제18항에 있어서,
    상기 표적 유전자는 조류독감, 사스(SARS), 대장균 O157:H7(Escherichia coli O157:H7), 결핵(Mycobacterium tuberculosis), 탄저병(Bacillus anthracis), 폐렴(Streptococcus pneumonia), 말라리아(Plasmodium), 살모넬라(Salmonella), 간염(Hepatitis A, B, C, D 또는 E virus), 야토병균(Francisella tularensis), 페스트균(Yersinia pestis), 에르시니아 엔테로콜리티카(Yersinia enterocolitica) 및 출혈열(Ebola virus), 및 메르스 코로나 바이러스(MERS-Cov virus)로 이루어진 군으로부터 선택된 1 이상으로부터 유래된 표적 유전자인, 표적 유전자를 검출하는 방법.
  22. 제18항에 있어서,
    상기 표적 유전자는 돌연변이 유전자인, 표적 유전자를 검출하는 방법.
  23. 제22항에 있어서,
    상기 돌연변이 유전자는 EGFR 엑손 19번 결실이 일어난 유전자인, 표적 유전자를 검출하는 방법.
PCT/KR2017/000998 2016-01-29 2017-01-26 표적 돌연변이 유전자 검출용 미세 유동 장치, 및 표적 유전자 검출용 미세 유동 장치의 검출 효율을 개선하는 방법 Ceased WO2017131493A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20160011953 2016-01-29
KR10-2016-0011953 2016-01-29

Publications (1)

Publication Number Publication Date
WO2017131493A1 true WO2017131493A1 (ko) 2017-08-03

Family

ID=59398633

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/000998 Ceased WO2017131493A1 (ko) 2016-01-29 2017-01-26 표적 돌연변이 유전자 검출용 미세 유동 장치, 및 표적 유전자 검출용 미세 유동 장치의 검출 효율을 개선하는 방법

Country Status (2)

Country Link
KR (1) KR101976117B1 (ko)
WO (1) WO2017131493A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113817807A (zh) * 2021-10-13 2021-12-21 中国人民解放军陆军军医大学第二附属医院 基于CRISPR-Cas触发无非特异滚环扩增的可视化检测系统及其应用和方法

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114464246B (zh) * 2022-01-19 2023-05-30 华中科技大学同济医学院附属协和医院 基于CovMutt框架检测与遗传性增加相关的突变的方法

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010041340A1 (en) * 2000-05-12 2001-11-15 Stephen Kingsmore Poly-primed amplification of nucleic acid sequences
KR20110098440A (ko) * 2010-02-26 2011-09-01 주식회사 파나진 Pna 기반의 실시간 pcr 클램핑을 이용한 egfr 돌연변이 검출 방법 및 키트
KR20130135111A (ko) * 2012-05-30 2013-12-10 나노바이오시스 주식회사 다-채널 액체 분배 장치, 이를 포함하는 핵산 추출 장치, 및 이를 이용한 핵산 추출 방법
KR20160052400A (ko) * 2014-10-30 2016-05-12 이화여자대학교 산학협력단 표적 유전자 검출용 미세 유동 장치, 이의 제조방법 및 이를 이용한 검출 방법

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101263450B1 (ko) 2010-12-30 2013-07-04 주식회사 아이센스 카나마이신에 특이적으로 결합하는 dna 앱타머
JP5930825B2 (ja) 2011-05-06 2016-06-08 アークレイ株式会社 Egfrエクソン19多型検出試験用試薬キット及びその用途
KR20140032094A (ko) 2012-09-05 2014-03-14 삼성전자주식회사 표적 물질 포획이 용이한 미세유동 장치 및 상기 미세유동 장치를 이용한 표적 물질 분리 방법
KR101667149B1 (ko) 2015-04-28 2016-10-17 이화여자대학교 산학협력단 표적 단백질 또는 표적 펩타이드 검출용 미세 유동 장치, 이의 제조방법 및 이를 이용한 표적 단백질 또는 표적 펩타이드 검출 방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010041340A1 (en) * 2000-05-12 2001-11-15 Stephen Kingsmore Poly-primed amplification of nucleic acid sequences
KR20110098440A (ko) * 2010-02-26 2011-09-01 주식회사 파나진 Pna 기반의 실시간 pcr 클램핑을 이용한 egfr 돌연변이 검출 방법 및 키트
KR20130135111A (ko) * 2012-05-30 2013-12-10 나노바이오시스 주식회사 다-채널 액체 분배 장치, 이를 포함하는 핵산 추출 장치, 및 이를 이용한 핵산 추출 방법
KR20160052400A (ko) * 2014-10-30 2016-05-12 이화여자대학교 산학협력단 표적 유전자 검출용 미세 유동 장치, 이의 제조방법 및 이를 이용한 검출 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KUHNEMUND, MALTE ET AL.: "Circle-to-circle Amplification on a Digital Microfluidic Chip for Amplified Single Molecule Detection", LAB ON A CHIP, vol. 14, 2014, pages 2983 - 2992, XP055403238 *
ZHOU, YUNTAO ET AL.: "A Dumbbell Probe-mediated Rolling Circle Amplification Strategy for Highly Sensitive McroRNA Detection", NUCLEIC ACIDS RESEARCH, vol. 38, no. 15, 2010, pages 1 - 5, XP055213312 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113817807A (zh) * 2021-10-13 2021-12-21 中国人民解放军陆军军医大学第二附属医院 基于CRISPR-Cas触发无非特异滚环扩增的可视化检测系统及其应用和方法

Also Published As

Publication number Publication date
KR101976117B1 (ko) 2019-05-07
KR20170091050A (ko) 2017-08-08

Similar Documents

Publication Publication Date Title
AU2021240134B2 (en) Methods for analysis of somatic mobile elements, and uses thereof
US6383749B2 (en) Methods of labeling nucleic acids for use in array based hybridization assays
US9315860B2 (en) Conjugates of nucleotides and method for the application thereof
CN114250283B (zh) 基于环境敏感染料的单色荧光mrt基因测序试剂及方法
PT1040202E (pt) Determinação da identidade de polimorfismos de adn utilizando citometria de fluxo
BR112017008931B1 (pt) Dispositivo microfluídico para detecção de gene-alvo, método para fabricação do mesmo e método para detecção com o uso do mesmo
WO2017131493A1 (ko) 표적 돌연변이 유전자 검출용 미세 유동 장치, 및 표적 유전자 검출용 미세 유동 장치의 검출 효율을 개선하는 방법
WO2018194437A2 (ko) 표적 점 돌연변이 유전자 검출을 위한 핵산 분자 템플레이트 및 이를 이용한 유전자 검사방법
HK1222881A1 (zh) 改进的ngs工作流程
JP2024507210A (ja) Dnaフラグメント連結検出方法及びそのキット
US20090176724A1 (en) Methods and Compositions for the Diagnosis, Prognosis and Treatment of Cancer
WO2013122319A1 (ko) 리가제 반응과 절단효소 증폭반응을 이용한 표적 유전자 또는 이의 돌연변이 검출방법
WO2016080750A1 (ko) 암 유전체 돌연변이 검출용 유전자 패널
WO2012020965A2 (ko) Pna의 실시간 pcr 클램핑을 이용한 pik3ca 돌연변이 검출 방법 및 키트
WO2018048205A1 (ko) 회전환 증폭 기반 분자 진단 방법
CN108642169A (zh) 检测十种甲氧苄胺嘧啶类药物耐药基因方法及所用试剂盒
WO2011142646A9 (ko) 인유두종바이러스 검출 및 유전형 확인 방법
WO2022225114A1 (ko) 금 나노 입자-DNA 복합체 및 CRISPR/Cas12a 복합체를 포함하는 바이오센서, 및 이를 이용한 표적 DNA 검출 방법
WO2022131803A1 (ko) 유방암 유전자 돌연변이 초고감도 선택적 증폭 방법 및 이를 위한 조성물
Song et al. Three-dimensional polyacrylamide gel-based DNA microarray method effectively identifies UDP-glucuronosyltransferase 1A1 gene polymorphisms for the correct diagnosis of Gilbert's syndrome
WO2013105679A1 (ko) 프라이머를 포함하는 핵산 증폭 장치와 이것의 제조방법 및 이를 이용한 핵산 증폭 방법
WO2021041764A2 (en) Kit and methods to detect met gene fusion
CN112080562A (zh) 检测高血压药物治疗相关基因的基因芯片和试剂盒
CN102191329A (zh) 检测重度抑郁关联基因的试剂盒及其制备方法
WO2019151757A1 (ko) 삼중접합구조 기반 등온 핵산 증폭 기술을 이용한 표적핵산 검출 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17744614

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17744614

Country of ref document: EP

Kind code of ref document: A1